Methods for detecting interactions

The use of complementary binding polypeptides like Spycatcher and Spytag allows precise control of ligand combinations and concentrations on cell surfaces, addressing the limitations of current methods to study receptor-ligand interactions and immune cell function.

JP2026516109APending Publication Date: 2026-05-19OXFORD UNIVERSITY INNOVATION LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
OXFORD UNIVERSITY INNOVATION LTD
Filing Date
2024-05-09
Publication Date
2026-05-19

AI Technical Summary

Technical Problem

Current methods for studying receptor-ligand interactions on cell surfaces are limited by the inability to control ligand combinations and concentrations, making it difficult to assess the function of immune cells like T cells and CAR-T cells, especially when targeting cells with varying antigen levels.

Method used

A method using complementary binding polypeptides, such as Spycatcher and Spytag, to covalently present defined ligands on cell surfaces, allowing precise control over ligand combinations and concentrations for quantitative evaluation of receptor-ligand interactions.

Benefits of technology

Enables quantitative assessment of ligand combinations and interactions, facilitating the study of T cell activation and CAR-T cell function across different antigen levels, and applicable to various immune cells and synthetic interactions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026516109000038
    Figure 2026516109000038
  • Figure 2026516109000039
    Figure 2026516109000039
  • Figure 2026516109000040
    Figure 2026516109000040
Patent Text Reader

Abstract

Methods for detecting interactions between a target protein and an analyte are provided herein. Polypeptides, nucleic acids, cells, and kits suitable for binding the target protein to cells are also provided herein. Cells and populations of cells containing the target protein, as well as methods for preparing such cells and populations, are also provided herein.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a method for determining interactions between molecules, such as molecules present on a cell surface. The present invention also relates to a polypeptide for presenting a protein on a cell surface, a nucleic acid encoding the polypeptide, and a cell comprising the polypeptide. [Background technology]

[0002] Understanding receptor / ligand interactions occurring at intercellular interfaces has been hampered because the combinations and concentrations of ligands on the cell surface cannot be directly controlled. In contrast, the study of surface receptors that recognize ligands in solution (e.g., GPCRs, RTKs, cytokine receptors) is relatively straightforward because the combinations and concentrations of soluble ligands can be easily controlled.

[0003] Current methods for studying receptor / ligand interactions involve individually removing ligands from target cells (e.g., via CRISPR). However, removing, for example, 10 ligands for all possible combinations would require the generation of over 1000 cell lines, making the study of ligand combinations quickly unmanageable. Furthermore, this system cannot quantitatively assess ligand levels on the cell surface.

[0004] For example, T cells that recognize peptide antigens in almost all cells in the body, such as healthy cells, infected cells, and / or cancer cells, have diverse combinations and surface-level ligands that are crucial in T cell activation (Chen et al. (2013) Nature reviews immunology, 13(4), 227-242). Studying the contribution of individual ligands to T cell activation by target cells or antigen-presenting cells is difficult using currently available methods.

[0005] T cells and other immune cells, such as macrophages and NK cells, are currently used in therapies that redirect them to target infected or cancer cells using chimeric antigen receptors (CARs). While these CARs target surface antigens on target cells, there is no simple way to quantitatively assess antigen levels, making it difficult to investigate how CARs function at different antigen levels. For example, patients receiving CD19-targeted CAR-T cell therapy for B-cell leukemia (e.g., Kymriah, Yescarta) relapse with cancer cells expressing low levels of CD19 (Majzner et al. (2018). Cancer discovery, 8(10), 1219-1226).

[0006] Therefore, there is a need in this technology for further improved methods to evaluate interactions between molecules, particularly those present on the cell surface, such as receptor-ligand interactions. Such methods would be useful for evaluating how immune cells, such as T cells and CAR-T cells, function with various surface-level ligands and surface-expressed ligand combinations. [Overview of the project]

[0007] The inventors have developed a method for presenting a target molecule on the cell surface using a pair of complementary binding polypeptides, thereby enabling the evaluation of the interactions between those molecules. In particular, the inventors have found that the protein Spycatcher, which forms a covalent bond with a short peptide tag known as Spytag, can be manipulated to be expressed on the cell surface, and that this protein can then be linked to a molecule manipulated to contain Spytag. Therefore, this method has broad utility for studying protein-protein interactions, such as receptor-ligand interactions related to intercellular interactions. In particular, the inventors have found that this method can be used to efficiently quantitatively evaluate ligands and ligand combinations and to study T cell activation by innate T cell receptors (TCRs) or manipulated CARs.

[0008] Advantageously, the method of the present invention makes it possible to covalently present a defined combination and concentration of protein ligands on the cell surface. This system has been demonstrated using human T cells that recognize pMHC by TCR or protein antigen (CD19) by CAR. In both examples, the relevant endogenous ligands can be removed by CRISPR to avoid cross-reactivity with exogenously loaded spytag ligands.

[0009] Beyond studying the contribution of T cell surface receptors to T cell responses, this system can be used to study any intercellular interactions, including but not limited to NK cells and macrophages that interact with their target cells. Furthermore, this platform can be used to study synthetic intercellular interactions, such as interactions between T cells expressing synthetic antigen receptors (CARs) and target cells expressing antigens. This platform can also be used to study the ability of soluble bispecific reagents, such as BiTE and / or ImmTAX molecules, to redirect T cells to target cells loaded with various concentrations of antigens.

[0010] Therefore, the present invention relates to a method for detecting the interaction between a cell-binding protein of interest (POI) and an analyte, (i) A step of contacting a cell containing a membrane-bound conjugate polypeptide with a fusion polypeptide containing a complementary conjugate polypeptide and the POI, wherein the complementary conjugate polypeptide can form a covalent bond with the membrane-bound conjugate polypeptide, and the POI contains the extracellular domain of a naturally occurring membrane protein. (ii) the step of bringing cells into contact with the analyte, and (iii) Step to detect the interaction between the POI and the analyte. This provides a method that includes [something].

[0011] The method may further include a step of repeating steps (i) to (iii) once or more times, in each repeat the concentration of the fusion polypeptide being a predetermined different concentration. The method may include a step in step (i) of contacting cells with two or more fusion polypeptides, where the POIs of each fusion polypeptide are different from each other. The analyte may be cells, such as T cells or chimeric antigen receptor T cells (CAR-T cells). The analyte may be a soluble molecule such as an antibody. The membrane-bound conjugate polypeptide may be directly bound to the membrane portion via a hinge. The hinge may contain 30 or fewer amino acids, preferably 20 or fewer amino acids. The hinge may contain a sequence having at least 60% sequence identity with any one of SEQ ID NOs. 36 to 38. The membrane-bound conjugate polypeptide may contain a sequence having at least 80% sequence identity with any one of SEQ ID NOs. 20 to 22, 24, and 26 to 35. The membrane-bound polypeptide may contain a sequence having at least 80% sequence identity with one of SEQ ID NOs. 20-22, 24, 26, and 27. The complementary polypeptide may contain a sequence having at least 80% sequence identity with one of SEQ ID NOs. 20-22, 24, and 26-35. The complementary polypeptide may contain a sequence having at least 80% sequence identity with one of SEQ ID NOs. 28-35. The fusion polypeptide may contain, in order from the N-terminus to the C-terminus, a POI, optionally a linker sequence, and a complementary polypeptide, with the N-terminus of the complementary polypeptide optionally being at a height of 5 nm or less from the cell membrane. The analyte may be a cell containing a target that binds to a POI, and the intermembrane distance of the complex formed between the POI and its target may be 19 nm or less, and optionally, the intermembrane distance of the complex formed between the POI on a first cell and its target on a second cell may be 9 nm to 19 nm. The analyte may be a cell containing a target that binds to a POI, and the intermembrane distance of the complex formed between the POI and its target may differ by 5 nm or less from the intermembrane distance of a naturally occurring membrane protein containing the POI and its target.The membrane-bound polypeptide may be a SpyCatcher protein, and the complementary binding polypeptide may be a SpyTag protein. The membrane-bound polypeptide may be a SpyCatcher002 protein, and the complementary binding polypeptide may be a SpyTag002 protein. The membrane-bound polypeptide may be a SpyCatcher003 protein, and the complementary binding polypeptide may be a SpyTag003 protein. The membrane-bound polypeptide may be a SpyTag protein, and the complementary binding polypeptide may be a KTag protein. The membrane-bound polypeptide may be a KTag protein, and the complementary binding polypeptide may be a SpyTag protein. The membrane-bound polypeptide may be a SnoopCatcher protein, and the complementary binding polypeptide may be a SnoopTag protein. The membrane-bound polypeptide may be a DogTag protein, and the complementary binding polypeptide may be a SnoopTagJr protein. The membrane-bound polypeptide may be the SnoopTagJr protein, and the complementary binding polypeptide may be the DogTag protein. The membrane-bound polypeptide may be the DogCatcher protein, and the complementary binding polypeptide may be the DogTag protein. The membrane-bound polypeptide may be Pilin-C, and the complementary binding polypeptide may be the IsopepTag protein. Naturally occurring membrane proteins may be MHC-peptide complexes and / or accessory proteins involved in the interaction between antigen-presenting cells and T cells.

[0012] The present invention also provides a polypeptide comprising a membrane-bound conjugate polypeptide directly bound to a membrane portion via a hinge, wherein the membrane-bound conjugate polypeptide can form a covalent bond with a complementary conjugate polypeptide, the hinge comprises 25 or fewer amino acids, and the membrane-bound conjugate polypeptide has at least 80% identity with any one of SEQ ID NOs. 20-22, 24, 26, and 27.

[0013] The present invention also provides nucleic acids encoding polypeptides. The present invention also provides cells comprising polypeptides and / or nucleic acids. The cells may be immune effector cells such as T cells, or may be non-human cells. The cells may further comprise a fusion polypeptide comprising a complementary binding polypeptide and a protein of interest (POI), wherein the complementary binding polypeptide is covalently bound to a membrane-bound binding polypeptide. The POI may comprise the extracellular domain of a naturally occurring membrane protein. The POI may comprise an antigen-recognition domain. The present invention also provides multiple populations of cells, each of which cells comprise two or more different POIs, each of which cells comprise the same combination of POIs, and each of which populations comprises different combinations of POIs.

[0014] The present invention further provides a kit comprising cells expressing a membrane-bound conjugate polypeptide and a plurality of fusion polypeptides, each comprising a complementary conjugate polypeptide and a protein of interest (POI), wherein the complementary conjugate polypeptide can form a covalent bond with the membrane-bound conjugate polypeptide, and each of the different fusion polypeptides comprises a different extracellular domain of one or more naturally occurring membrane proteins.

[0015] The present invention further provides a method for preparing cells containing a target protein (POI), the method comprising the step of contacting cells containing a membrane-bound conjugate polypeptide with a fusion polypeptide containing a complementary conjugate polypeptide and a POI, wherein the complementary conjugate polypeptide can form a covalent bond with the membrane-bound conjugate polypeptide, and the POI contains the extracellular domain of a naturally occurring membrane protein. The method may also comprise the step of contacting cells with two or more different fusion polypeptides, wherein the POIs of each of the different fusion polypeptides are different from each other.

[0016] The present invention also provides a method for preparing a plurality of populations of cells, each population containing a protein of interest (POI) at a predetermined different concentration, the method comprising: (i) contacting a first population of cells each containing a membrane-bound binding polypeptide with a fusion polypeptide containing a complementary binding polypeptide and a POI, wherein the complementary binding polypeptide is capable of forming a covalent bond with the membrane-bound binding polypeptide, and the POI contains an extracellular domain of a naturally occurring membrane protein; and (ii) repeating step (i) using one or more additional populations of cells each containing a membrane-bound binding polypeptide, wherein in each repetition the concentration of the fusion polypeptide is a predetermined different concentration.

Brief Description of the Drawings

[0017] [Figure 1-1] Expression of surface Spycatcher with different hinges on CHO-K1 cells. (A) Schematic diagrams of three different surface Spycatcher molecules tested by linking Spycatcher to a hinge derived from human CD52 (GPI anchor) or mouse CD80 (transmembrane) containing the full hinge (mCD80) or short hinge (mCD80-short). (B) Purified Spytag-mClover3 is added at 8 μM to CHO-K1 cells transduced with the indicated surface Spycatcher molecules. (C) Purified Spytag-mClover3 is added at the indicated concentrations (x-axis) to CHO-K1 cells transduced with the indicated surface Spycatcher molecules. [Figure 1-2] Same as above. [Figure 2-1]Generation of target cells for studying various T cell accessory receptors. (A) Protocol for generating target cells expressing surface Spycatcher. (B) Surface expression of hamster ICAM-1 on the indicated CHO-K1 cells. (C) Primary human CD8+ T cells expressing 1G4 TCR are co-cultured with the indicated CHO-K1 strains transduced with surface Spycatcher loaded with various concentrations of Spytag-pMHC (x-axis), alone or in combination with human Spytag-ICAM-1 (0.03 μM). [Figure 2-2] Same as above. [Figure 2-3] Same as above. [Figure 3-1] The extracellular domain of a naturally occurring membrane protein (ligand) fused with Spytag can be easily ligated to cells expressing surface Spycatcher and quantitatively evaluated thereon. (A–B) The extracellular domain of either ICAM-1, CD58, CD86, CD80, or pMHC fused with Spytag was purified and incubated with CHO-K1 ICAM-1 KO cells expressing Spycatcher with an hCD52 hinge at various concentrations for 40 min at 37°C. (A) Representative flow cytometry histograms (lower concentrations) and (B) mean gMFI versus ligand concentration over multiple independent experiments. [Figure 3-2] Same as above. [Figure 4-1]The amount of ligands that can be bound to surface Spycatchers is comparable to or greater than the naturally occurring amounts in various cells. (A) CHO-K1 ICAM-1 KO cells expressing a Spycatcher with an hCD52 hinge were incubated at 37°C for 40 minutes with purified extracellular domains of ICAM-1, CD58, CD86, and CD80 (ligands) fused with Spytags at various concentrations. Surface expression was detected using antibodies specific to each ligand. Surface expression of ligands endogenously expressed on human T2 cell lines was used as a reference. Data are presented as mean multiplicative changes between CHO and T2 cells. (B) Expression of directed ligands across three cell lines (T2, U87, and THP1) and two primary cell types (T cells and macrophages). Data are presented as mean multiplicative changes between T2 cells and directed cells. The horizontal dashed line indicates the loading limit on CHO-K1 cells when using 0.5 μM Spytag ligand. [Figure 4-2] Same as above. [Figure 5-1] Ligand combinations can be ligated onto surface Spycatchers and detected. (A~D) Purified Spytag-pMHCs are mixed with purified extracellular domains of (A) CD58, (B) ICAM-1, (C) CD86, or (D) CD80 fused to Spytag at the indicated concentrations, and then added to CHO-K1 ICAM-1 KO cells expressing human CD52 hinged surface Spycatchers at 37°C for 40 minutes. The expression of each ligand (top row) or pMHC (bottom row) is detected using specific antibodies in flow cytometry, and the gMFI values ​​are shown on the y axis. [Figure 5-2] Same as above. [Figure 6-1]T cell activation is determined by the combination of ligands linked to surface spycatchers. Primary human CD8+ T cells transduced with a 1G4 TCR were co-cultured with CHO-K1 ICAM-1 KO cells expressing surface spycatchers with human CD52 hinges linked to indicated concentrations of Spytag-pMHC (x axis) and indicated concentrations of Spytag-ligands (Spytag-CD58, Spytag-ICAM-1, Spytag-CD86, or Spytag-CD80) linked to T cell accessory receptors. After 6 hours of co-culture, T cell activation was evaluated by flow cytometry for (A) 4-1BB expression or (B) CD69 expression, and by ELISA detecting supernatant levels of cytokines (C) IL-2, (D) IFN-γ, or (E) TNF-α. EC50 provides (A) 4-1BB expression and (B) CD69 expression. The multiplicative changes in P15 and Emax are provided for the cytokines (C) IL-2, (D) IFN-γ, and (E) TNF-α. Emax is the maximum level of cytokine produced across all concentrations (presented as a multiplicative change relative to pMHC alone). P15 is the concentration of pMHC required to induce 15% of Emax for that donor. [Figure 6-2] Same as above. [Figure 6-3] Same as above. [Figure 7-1] T cell activation by a chimeric antigen receptor (CAR) that recognizes Spytag-CD19 on the surface of Nalm6 target cells. (A) Schematic diagram of the process for producing Nalm6 target cells that can be quantitatively evaluated for CD19. (B) Surface CD19 under indicated conditions. (C-D) Primary human CD8+ T cells transduced with Kymriah or Yescarata CAR were co-cultured with Nalm6 CD19 KO cells expressing a surface Spycatcher with a human CD52 hinge linked to an indicated concentration of Spytag-CD19 (x axis), and (C) surface 4-1BB was measured by flow cytometry, and (D) supernatant cytokine IL-2 was measured by ELISA. [Figure 7-2] Same as above. [Figure 8-1] T cell activation by a chimeric antigen receptor (CAR) recognizing Spytag-CD19 on the surface of CHO-K1 ICAM-1 KO cells. (A) Schematic diagram of an experiment showing that the extracellular domains of purified Spytag-CD19 and purified Spytag-ligand are linked to surface Spycatcher expressed on CHO-K1 ICAM-1 KO cells. (B-C) Primary human CD8+ T cells transduced with Kymriah, a CD19-targeting CAR, were co-cultured with CHO-K1 ICAM-1 KO cells expressing a surface Spycatcher with a human CD52 hinge linked to a specified concentration of Spytag-CD19 (x axis) and a 0.1 μM specified ligand (CD58, ICAM-1, CD86, or CD80) fused to Spytag for a T cell accessory receptor. After 6 hours of co-culture, T cell activation was evaluated at the 4-1BB surface level. (B) Typical dose-response and (C) CD19 concentrations required to induce 15% activation beyond the background are shown across four independent experiments. [Figure 8-2] Same as above. [Figure 9] Reducing the length of the extracellular hinge of surface spycatchers enhances the ability of T cells to recognize the ligated Spytag-pMHC antigen. Jurkat T cells expressing the 1G4 TCR were co-cultured with U87 B2M KO glioblastoma cell lines transduced with surface spycatchers ligated to either full-length human CD52 hinges (FL) or two variants with 8 (delta 8) or 15 (delta 15) fewer amino acids in the hinge. (A) Representative dose response, and (B) N=3 independently adapted EC50 values.

[0018] A brief explanation of sequence listings Sequence IDs 1–3, 79, and 80 are exemplary full-length membrane-bound polypeptide sequences (including signal peptides).

[0019] Sequence IDs 4-6 are exemplary mature, full-length membrane-bound polypeptides (excluding signal peptides).

[0020] Sequence IDs 7-19 are exemplary fusion polypeptides.

[0021] Sequence IDs 20-27 are exemplary "catcher" sequences for membrane-bound polypeptides.

[0022] Sequence IDs 28-35 are exemplary complementary binding polypeptides for sequence IDs 20-27, respectively.

[0023] Sequence IDs 36-54 are exemplary hinge sequences of membrane-bound polypeptides.

[0024] Sequence ID 55 is the mucin-like sequence in the extracellular portion of CD43.

[0025] Sequence ID 56 is an exemplary linker sequence for a membrane-bound polypeptide.

[0026] Sequence IDs 57, 58, and 81 are exemplary membrane-binding moieties of membrane-binding polypeptides.

[0027] Sequence IDs 59-75 are exemplary linker sequences.

[0028] Sequence ID 76 is an sgRNA sequence.

[0029] Sequence numbers 77-78 are primer sequences.

[0030] Sequence ID 82 is a GPI anchor sequence derived from human CD52.

[0031] Sequence IDs 83–85 are exemplary mature, full-length membrane-bound polypeptides corresponding to Sequence IDs 3, 79, and 80, respectively (excluding signal peptides and GPI-anchored signal sequences). [Modes for carrying out the invention]

[0032] The present invention relates to the use of a novel cell platform for presenting one or more target proteins (POIs) on cells. The invention can be used, for example, to screen and / or quantitatively evaluate interactions between one or more POIs and analytes such as cells or soluble molecules. POIs are typically the extracellular domains of membrane-bound proteins. The method typically provides physiologically relevant characterization of interactions between POIs and analytes, because the target protein can be presented on cells in a nearly natural orientation and position relative to the cell membrane. Furthermore, the invention can be used as a platform for presenting pharmaceutically relevant molecules and targeting them to specific cell types, such as cancer cells.

[0033] Various target proteins or various combinations of target proteins can be presented by cells. The relative concentrations of target proteins as part of monovalent and / or polyvalent interactions can be studied by precise control over their relative concentrations. This makes it possible to perform screening methods for many different combinations of target proteins without requiring a single cell line to present various combinations at various relative concentrations. The present invention also has the advantage that cells presenting the desired POI or combination of target proteins can be generated within minutes.

[0034] Method for detecting interactions with target proteins A method is provided for detecting the interaction between a target protein (POI) and an analyte. The POI may be any molecule, for example, the extracellular domain of a naturally occurring membrane protein. The POI can bind to cells. The method comprises the step of (i) contacting a cell containing a membrane-bound conjugate polypeptide with a fusion polypeptide containing a complementary conjugate polypeptide and a POI. The complementary conjugate polypeptide can form a covalent bond with the membrane-bound conjugate polypeptide. Thereafter, the cell contains a membrane-bound complex containing the POI, for example, the POI covalently binding to the membrane-bound conjugate polypeptide via the complementary conjugate polypeptide.

[0035] The method further includes (ii) a step of contacting cells with the analyte. Preferably, the analyte is a cell or a soluble protein. If the analyte is a cell, the cell surface contains proteins that can interact with POIs, for example, proteins that can specifically bind to POIs. In some cases, it may be unclear whether the cell analyte contains proteins that interact with POIs. If the analyte is a soluble protein, it may be unclear whether the soluble protein interacts with POIs. Preferably, the cell is known to contain proteins that interact with POIs. Preferably, the soluble protein is known to interact with POIs. This means that quantitative evaluation can be performed without the wasteful consumption of reagents that may occur if no interaction / binding is observed.

[0036] The method further includes (iii) a step of detecting the interaction between the POI and the analyte.

[0037] The method may further include step (iv), which involves repeating steps (i) to (iii) once or more times, in each repeat, with a different concentration of fusion polypeptide in contact with the cell. By varying the concentration of fusion polypeptide in each repeat, the total amount of fusion polypeptide covalently bound to the membrane-bound polypeptide on the cell will differ in each repeat (up to the maximum saturation point, which has been shown to exceed the naturally occurring saturation level of the POI tested; see Examples). This makes it possible to quantitatively evaluate the concentration of POI on the cell with respect to the analyte and to evaluate the effect of this concentration change on the observed interaction. For example, the EC of POI binding to the analyte. 50 Quantitative evaluation can be performed to determine this. Steps (i) to (iii) may be repeated two or more times, for example three or more times, four or more times, five or more times, or ten or more times. Steps (i) to (iii) may be repeated two to twenty times, for example three to twenty times, four to sixteen times, or five to twelve times. The concentration of the fusion polypeptide may be in the range of 0 μM to 1 mM, for example 0 μM to 100 μM, 0 μM to 10 μM, or 0 μM to 1 μM. The range of the fusion polypeptide concentration is preferably designed so that the total amount of POI bound to the cell encompasses the surface expression level of POI naturally present on the cell. For example, the total amount of POI bound to the cell may be up to 100 times more than the naturally occurring expression level of POI on the cell, for example up to 10 times more, up to 5 times more, up to 4 times more, up to 3 times more, up to 2 times more, up to 1.5 times more, or approximately the same as the naturally occurring expression level of POI on the cell. The total amount of POI bound to the cell may be at least 0.001 times the naturally occurring expression level of the POI on the cell, for example, at least 0.01 times or at least 0.1 times the naturally occurring expression level of the POI on the cell. The total amount of POI bound to the cell may be in the range of 0.001 to 100 times the naturally occurring expression level of the POI on the cell, for example, in the range of 0.001 to 10 times, 0.01 to 100 times, 0.01 to 10 times, or 0.01 to 5 times the naturally occurring expression level of the POI on the cell.

[0038] In step (i), the method may include contacting a first cell with two or more fusion polypeptides, for example, three or more, four or more, or five or more fusion polypeptides, where the POIs of each fusion polypeptide are different from each other. This allows for the study of the effects of different combinations of POIs when interacting with the analyte. For example, if one of the fusion polypeptides contains the extracellular domain of a peptide-MHC molecule as its POI, the second fusion polypeptide may contain the extracellular domain of an accessory receptor. Thus, the effect of the accessory receptor on the interaction between the peptide-MHC molecule and the analyte can be studied. Step (i) may include contacting a cell with three or more, four or more, or five or more fusion polypeptides, where the POIs of each fusion polypeptide are different from each other. The complementary binding polypeptides of the different fusion polypeptides may be the same. The complementary binding polypeptides of the different fusion polypeptides may be different. Using different complementary binding polypeptides is useful to reduce competition between fusion polypeptides when they come into contact with cells. Preferably, the complementary binding polypeptides of different fusion polypeptides do not compete with the complementary binding polypeptides of other different fusion polypeptides when in contact with cells. This is achieved by selecting non-competitive pairs of membrane-bound binding polypeptides and complementary binding polypeptides, which will be discussed in more detail below. In this case, step (i) may include contacting cells containing two or more different membrane-bound binding polypeptides with two or more different fusion polypeptides, each containing a complementary binding polypeptide and a POI, where the membrane-bound binding polypeptides and complementary binding polypeptides form pairs of binding polypeptides that can form covalent bonds but do not cross-react with other pairs of binding polypeptides, and the POIs of each fusion polypeptide are different. This also allows different fusion polypeptides to come into contact with cells at different time points, while reducing the chance of cells being saturated with fusion polypeptides.

[0039] In some cases, the method may include a step (i) in which cells are brought into contact with two or more fusion polypeptides, wherein the POIs of each fusion polypeptide are different from each other as described above, and a step of repeating steps (i) to (iii) once or more times, in which the concentration of the fusion polypeptide in contact with the cells is different as described above in each repeat. This makes it possible to quantitatively evaluate the concentrations of two or more POIs simultaneously, and / or to quantitatively evaluate the concentration of one POI in the presence of one or more other POIs at a constant concentration.

[0040] This method may include, in step (i), a step of contacting cells with two or more fusion polypeptides, wherein the POIs of each fusion polypeptide are different from each other as described above, and a step of repeating steps (i) to (iii) once or more times, in which at least one of the fusion polypeptides is replaced with a different fusion polypeptide containing a different POI. This makes it possible to study the effects of different combinations of POIs and their interactions with analytes.

[0041] When using two or more fusion polypeptides in this method, the method may include a step of detecting two or more different types of analytes, such as one or more proteins and one or more cells.

[0042] The method may further include, in step (i), the addition of an agent that enables the formation of a covalent bond between a complementary binding polypeptide and a membrane-bound binding polypeptide. The agent may be a ligase, as described herein.

[0043] Fusion polypeptides are typically soluble proteins. The step of contacting cells containing membrane-bound polypeptides with the fusion polypeptide may be carried out by any means known to those skilled in the art, for example, the means described in the examples. Similarly, the step of contacting cells with the analyte may be carried out by any means known to those skilled in the art, for example, the means described in the examples.

[0044] This method may be used to detect interactions between POIs and analytes. This method may be used to detect interactions between cell-binding POIs and analytes. This method may be used to bind POIs to the cell surface in order to detect interactions with analytes. This method may be used to change the composition of the cell surface and detect the effects thereof. This method may be used to screen POIs for interactions with analytes. This method may be used to screen combinations of POIs and detect interactions with analytes. This method may be used to quantitatively evaluate POIs on the cell surface and detect interactions between POIs and analytes.

[0045] The method may be for the purpose of modifying (e.g., increasing or decreasing) the affinity and / or affinity of the interaction between the POI and the analyte. The method may further include the step of modifying the POI and repeating the method to detect whether the affinity and / or affinity of the present invention between the modified POI and the analyte has been modified (e.g., increased or decreased). The method may further include the step of modifying the analyte and repeating the method to detect whether the affinity and / or affinity of the present invention between the POI and the modified analyte has been modified (e.g., increased or decreased). The method may further include the step of modifying the POI and the analyte and repeating the method to detect whether the affinity and / or affinity of the present invention between the modified POI and the modified analyte has been modified (e.g., increased or decreased). In one embodiment, the method is for increasing the affinity and / or affinity of the interaction between the POI and the analyte. In one embodiment, the method is for decreasing the affinity and / or affinity of the interaction between the POI and the analyte.

[0046] Pair of binding polypeptides The cell contains a membrane-bound binding polypeptide, and the fusion polypeptide contains a complementary binding polypeptide, thereby allowing the complementary binding polypeptide to form a covalent bond with the membrane-bound binding polypeptide. Any suitable pair of binding polypeptides may be used in this invention. The formation of a covalent bond between the binding polypeptide pair ensures that the target protein is permanently bound to the cell surface until the entire complex is recycled, thus enabling improved surface expression compared to transient interactions.

[0047] In some embodiments, the cells described herein include two or more POIs and therefore two or more pairs of binding polypeptides as described herein. Preferably, the first membrane-bound binding polypeptide can form a covalent bond with the first complementary binding polypeptide, and the second membrane-bound binding polypeptide can form a covalent bond with the second complementary binding polypeptide. The first and second pairs of binding polypeptides may be the same or different. The first and second pairs of binding polypeptides may be different but may be cross-reactive, for example, the first complementary binding polypeptide can form a covalent bond with the first or second complementary binding polypeptide, and the second complementary binding polypeptide can form a covalent bond with the first or second complementary binding polypeptide. The first and second pairs of binding polypeptides may be different and not cross-reactive. For example, a first complementary binding polypeptide can form a covalent bond with another first complementary binding polypeptide, but not with a second complementary binding polypeptide, and a second complementary binding polypeptide can form a covalent bond with another second complementary binding polypeptide, but not with a first complementary binding polypeptide. The same principle applies when three, four, or more pairs of binding polypeptides are involved.

[0048] The binding polypeptide pair may contain a naturally occurring reactive functional group in the polypeptide, or it may be introduced by, for example, genetic engineering or chemical modification of the polypeptide. The reactive group may originate from a non-natural amino acid, such as δ-mercaptolysine, incorporated into the monomer, for example, via in vitro transcription / translation, during its synthesis or expression, for example, cell-free expression. Any suitable reactive group may be used. For example, the reactive group may be an amine reactive group, a carboxyl reactive group, a sulfhydryl reactive group, or a carbonyl reactive group. The reactive group may include a cysteine ​​reactive group, a lysine reactive group, or an asparagine reactive group. The reactive group may include, for example, click chemical functionalization of the polypeptide with a non-natural amino acid. The binding polypeptide pair may form a disulfide bond.

[0049] Preferably, the binding polypeptide forms an isopeptide bond. An isopeptide bond is an amide bond that can be formed, for example, between the carboxyl group of one amino acid and the amino group of another amino acid. At least one of these binding groups is typically part of one of the side chains of these amino acids.

[0050] Preferably, each pair of binding polypeptides contains a divided, distinct protein domain, such as a divided ligand-binding protein domain. As used herein, the ligand-binding protein domain is the domain of a protein-binding ligand. Any suitable protein can be used, but proteins naturally stabilized by intrachain covalent bonds, such as isopeptide bonds, are preferred. In such cases, a portion of the protein containing an isopeptide bond donor residue is divided from a portion of the peptide containing an isopeptide bond receiver residue. The two protein fragments can then be bound to further polypeptides, such as monomers and / or polypeptide targets of the oligomeric core described herein, for example, by gene fusion. An isopeptide bond is created by contacting the two separated fragments, which typically irreversibly binds the two fragments together. Therefore, the divided protein approach is preferred for producing binding polypeptides. Since one protein fragment preferentially or exclusively binds to its native partner (i.e., the complementary portion of the protein from which it originates) rather than any other possible partner, such pairs of binding polypeptides are typically exclusive. These principles are discussed, for example, in Reddington & Howarth, Curr. Op. Chem. Biol. 29, 94-99 (2015) and Keeble et al, PNAS 2019 116(52) 26523. However, such binding polypeptide pairs may not exclude other pairs, especially if they originate from the same protein.

[0051] The binding polypeptide pair may originate from a divided Streptococcus pyogenes fibronectin-binding protein domain. The binding polypeptide pair may originate from a divided Streptococcus pneumoniae adhesin domain.

[0052] Preferably, the binding polypeptide pair may include peptide linker pairs such as those disclosed in International Publication No. 2016 / 193746, International Publication No. 2018 / 197854, International Publication No. 2018 / 189517, Keeble et al. (PNAS 116(52), 2019: 26523-26533), and Fiere et al. (PNAS 111(13), 2014: E1176-E1181).

[0053] Membrane-bound polypeptides may contain amino acid sequences having at least 50% amino acid identity with any one of SEQ ID NOs. 20-22, 24, and 26-35, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% amino acid identity with any one of SEQ ID NOs. Complementary binding polypeptides may contain amino acid sequences having at least 50% amino acid identity with any one of SEQ ID NOs. 20-22, 24, and 26-35, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% amino acid identity with any one of SEQ ID NOs. 20-22, 24, and 26-35.

[0054] Assuming that membrane-bound conjugate polypeptides can still form covalent bonds with complementary conjugate polypeptides, variations in conjugate polypeptides, as shown in SEQ ID NOs. 20-35, are acceptable. These variations may result from amino acid substitutions, insertions, or deletions in one or both polypeptides of the pair.

[0055] Preferably, the membrane-bound conjugate polypeptide is selected from an amino acid sequence having at least 50% amino acid identity with any one of SEQ ID NOs. 20-22, 24, and 26, and the complementary conjugate polypeptide is selected from an amino acid sequence having at least 50% amino acid identity with any one of SEQ ID NOs. 28-30 and 32-34, provided that the membrane-bound conjugate polypeptide can form a covalent bond with the complementary conjugate polypeptide.

[0056] Preferably, the binding polypeptide pair is selected from (i) any one of SEQ ID NOs. 20, 21, or 22 and any one of SEQ ID NOs. 28, 29, or 30, (ii) SEQ ID NOs. 24 and SEQ ID NOs. 32 or 33, (iii) SEQ ID NOs. 28 and SEQ ID NOs. 31, (iv) SEQ ID NOs. 26 and SEQ ID NOs. 34, (v) SEQ ID NOs. 33 and SEQ ID NOs. 34, or (vi) SEQ ID NOs. 27 and SEQ ID NOs. 35. More preferably, the binding polypeptide pair is selected from (i) any one of SEQ ID NOs. 20, 21, or 22 and any one of SEQ ID NOs. 28, 29, or 30, (ii) SEQ ID NOs. 24 and SEQ ID NOs. 32 or 33, or (iii) SEQ ID NOs. 26 and SEQ ID NOs. 34.

[0057] If the pair of binding polypeptides is SEQ ID NO: 28 and SEQ ID NO: 31, the binding is mediated by SpyLigase (SEQ ID NO: 23) or a protein having at least 50% identity with SEQ ID NO: 23, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% amino acid identity with SEQ ID NO: 23. To form the isopeptide bond, SpyLigase may be exogenously added to the mixture containing the binding polypeptide, or endogenously expressed by cells containing the membrane-bound binding polypeptide. If the pair of binding polypeptides is SEQ ID NO: 33 and SEQ ID NO: 34, the binding is mediated by SnoopLigase (SEQ ID NO: 25) or a protein having at least 50% identity with SEQ ID NO: 25, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% amino acid identity with SEQ ID NO: 25. To form the isopeptide bond, SnoopLigase may be exogenously added to the mixture containing the binding polypeptide, or endogenously expressed by cells containing the membrane-bound binding polypeptide.

[0058] The binding polypeptide pair may be selected from the following pairs.

[0059] [Table 1-1]

[0060] [Table 1-2]

[0061] [Table 1-3]

[0062] The protein domain and target domain may have at least 50% amino acid identity with the sequence shown above, for example, at least 60%, 70%, 80%, 90%, 95%, 97%, 98%, 99%, or 100% amino acid identity, while retaining the ability of the protein domain to specifically bind to the target domain.

[0063] To more accurately reflect the orientation of the naturally occurring membrane protein from which the POI originates in relation to the cell, the membrane-bound and complementary binding polypeptides may be selected from the following pairs.

[0064] [Table 2]

[0065] The protein domain and target domain may have at least 50% amino acid identity with the sequence shown above, for example, at least 60%, 70%, 80%, 90%, 95%, 97%, 98%, 99%, or 100% amino acid identity, while retaining the ability of the protein domain to specifically bind to the target domain.

[0066] When a cell contains two or more POIs and different POIs need to covalently bind to the cell via non-cross-reactive pairs of binding polypeptides, the above-mentioned binding groups and targets can be divided into the following subgroups. Subgroup A: - SpyCatcher / SpyTag; - SpyCatcher / SpyTag002; - SpyCatcher / SpyTag003; - SpyCatcher002 / SpyTag; - SpyCatcher002 / SpyTag002; - SpyCatcher002 / SpyTag003; - SpyCatcher003 / SpyTag003; - SpyCatcher003 / SpyTag003; - SpyCatcher003 / SpyTag003; - SpyTag / K-tag (mediated by SpyLigase) Subgroup B: - SnoopCatcher / SnoopTag; - SnoopCatcher / SnoopTagJr; - DogCatcher / DogTag; - SnoopTagJr / DogTag (mediated by SnoopLigase); Subgroup C: - Pilin-C / IsopepTag

[0067] Preferably, the first pair of binding polypeptides is selected from subgroup A, and the second pair of binding polypeptides is selected from subgroups B and C. Alternatively, the first pair of binding polypeptides is selected from subgroup B, and the second pair of binding polypeptides is selected from subgroups A and C. Alternatively, the first pair of binding polypeptides is selected from subgroup C, and the second pair of binding polypeptides is selected from subgroups A and B.

[0068] Other binding site / tag pairs include SdyTag / SdyCatcher (Tan et al, PLOS One 11(1) e0165074) and Cpe0147 derived from the Clostridium perfringens cell surface adhesive protein Cpe0147. 439-563 / Cpe0147 565-587 This includes the pair (Young et al, Chem Comm. 53(9) 1502).

[0069] As used herein in relation to binding between a binding site and its target, “specifically binding” refers to the ability of a binding site to bind to a complementary binding site with greater affinity than it would to an unrelated control. The unrelated control may be an unrelated control protein. For example, SnoopCatcher specifically binds to SnoopTag with greater affinity than it would to an unrelated control protein. Binding is preferably covalent, such as the formation of an isopeptide bond. Preferably, the control protein is bovine serum albumin, and the binding site binds to the complementary binding site with at least 10-fold, at least 50-fold, at least 100-fold, at least 500-fold, or at least 1000-fold greater affinity than the control protein. Affinity may be determined by methods known in the art. For example, affinity may be determined by ELISA assay, biolayer interferometry, surface plasmon resonance, kinetic methods, or equilibrium / solution methods. Those skilled in the art will recognize which pair of binding sites specifically binds to produce a protein complex usable in the methods of the present invention.

[0070] Membrane-bound binding polypeptides Membrane-bound polypeptides are polypeptides that can form covalent bonds with complementary polypeptides and bind to the cell membrane. Membrane-bound polypeptides may be bound to the cell membrane by any means known to those skilled in the art. Membrane-bound polypeptides may be bound to the cell membrane by a "membrane moiety." Membrane-bound polypeptides may be bound directly to the membrane moiety. Membrane-bound polypeptides may be bound to the membrane moiety via linkers and / or hinges.

[0071] The membrane portion is typically a portion of any naturally occurring protein that interacts with the membrane and anchors a naturally occurring protein to the membrane, such as a transmembrane protein, intermembrane protein, membrane protein, GPI-immobilized peptide / protein, prenylated protein, N-myristoylated protein, and / or S-palmitoylated protein, or variants thereof, which retain the ability to interact with the membrane and act as a membrane anchor. Preferably, the membrane portion is monomeric. As used herein, the term “anchor” is intended to refer to the mechanism by which the membrane portion is linked to the cell membrane. The membrane portion may be a portion of a human protein that interacts with the cell membrane. The membrane portion may be a portion of CD52 (GPI-immobilized), CD58 (GPI-immobilized), ICAM-1, or CD80 that interacts with the membrane. The membrane portion may be a portion of CD52 or CD80 that interacts with the cell membrane. The membrane portion may be modified to suit the POI used in the method described herein. The membrane portion may be a portion of a naturally occurring membrane protein (from which the POI is derived) that interacts with the membrane. For example, when using a fusion polypeptide containing the extracellular domain of CD19 according to the method described herein, the membrane portion may be part of the CD19 that interacts with the membrane. In this way, the diffusion of the membrane-bound polypeptide on the cell surface is similar to the diffusion of naturally occurring membrane proteins (from which POIs originate).

[0072] The membrane portion may have at least 50% amino acid identity with a subset of naturally occurring membrane proteins that interact with membranes, provided that it retains the ability to interact with membranes. For example, the membrane portion may have at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% amino acid identity with a subset of naturally occurring membrane proteins that interact with membranes, provided that it retains the ability to interact with membranes. Exemplary membrane portions are provided in Examples and are shown in SEQ ID NOs: 1-6, 38, 57, and 58. Further exemplary membrane portions are provided in Example 8 and are shown in SEQ ID NOs: 80, 81, and 83-85. In some cases, the membrane portion has at least 50% amino acid identity with the sequence of SEQ ID NO: 57, provided that it retains the ability to interact with the membrane, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% amino acid identity with the sequence of SEQ ID NO: 57. In some cases, the membrane portion has at least 50% amino acid identity with the sequence of SEQ ID NO: 38 or 58, provided that it retains the ability to interact with the membrane, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% amino acid identity with the sequence of SEQ ID NO: 38 or 58. In some cases, the membrane portion has at least 50% amino acid identity with the sequence of SEQ ID NO: 81, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% amino acid identity with the sequence of SEQ ID NO: 81, provided that it retains the ability to interact with the membrane by holding GPI-immobilized amidated serine.In some cases, such as in mature proteins, the membrane portion consists of a single GPI-fixed amino acid residue. This single GPI-fixed amino acid residue may be serine.

[0073] The GPI anchor signal sequence may include "SASSNISGGIFLFFVANAIIHLFCFS" (SEQ ID NO: 81). When the GPI anchor is added post-translation, the sequence ASSNISGGIFLFFVANAIIHLFCFS (SEQ ID NO: 82) is also cleaved, and a new carboxy-terminal amino acid (serine in this case) becomes the GPI binding site. SEQ ID NOs. 83-85 provide mature forms of SEQ ID NOs. 3, 79, and 80, respectively, in which the signal peptide and GPI anchor signal sequence have been removed.

[0074] The membrane portion may be directly bound to a membrane-bound polypeptide, for example, as part of a single continuous amino acid sequence.

[0075] Membrane-bound polypeptides may be bound to a membrane portion via a linker. The linker is a short amino acid sequence for connecting the membrane-bound polypeptide to the membrane portion. Preferred linkers are typically 1-50, 1-30, 1-25, 1-20, 1-15, or 1-10 amino acids long. Preferably, the linker contains or consists of 30 or fewer amino acids, more preferably 25 or fewer amino acids, for example, 20 or fewer, 15 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, or 6 or fewer amino acids. The linker may consist of one or more of the following amino acids, for example, lysine, serine, arginine, proline, glycine, and alanine. An example of a preferred flexible peptide linker is a stretch of 2-20, for example, 4, 6, 8, 10, or 16 serine and / or glycine amino acids. An example of a rigid linker is a stretch of 2-30, for example, 4, 6, 8, 16, or 24 proline amino acids. Suitable linker examples, though not limited to these, include GGGS (SEQ ID NO: 59), PGGS (SEQ ID NO: 60), PGGG (SEQ ID NO: 61), RPPPPP (SEQ ID NO: 62), RPPPP (SEQ ID NO: 63), VGG, RPPG (SEQ ID NO: 64), PPPP (SEQ ID NO: 65), RPPG (SEQ ID NO: 66), PPPPPPPPP (SEQ ID NO: 67), PPPPPPPPPPPP (SEQ ID NO: 68), RPPG (SEQ ID NO: 69), GG, GGG, SG, SGSG (SEQ ID NO: 70), SGSGSG (SEQ ID NO: 71), GSSGSGGS (SEQ ID NO: 72), SGSGSGSG (SEQ ID NO: 73), SGSGSGSGSG (SEQ ID NO: 74), and SGSGSGSGSGSGSGSG (SEQ ID NO: 75), where G is glycine, P is proline, R is arginine, S is serine, and V is valine. Appropriate linking groups may be designed using conventional modeling methods. The linker is typically flexible enough to allow the membrane-bound polypeptide and its membrane portion to assume their respective secondary and tertiary structures. The membrane portion may be directly linked to the membrane-bound polypeptide via the linker, for example, as part of a single, continuous amino acid sequence.For example, the amino acid sequence may be arranged from the N-terminus to the C-terminus in the order of (i) membrane-bound polypeptide - linker - membrane moiety, or (ii) membrane moiety - linker - membrane-bound polypeptide.

[0076] Membrane-bound polypeptides may be bound to a membrane portion via a hinge. A hinge is an amino acid sequence for connecting two polypeptide domains. Hinges are naturally occurring sequences or variants thereof typically found in proteins that connect two protein domains. A hinge may be a portion of a naturally occurring hinge domain, for example, a 2-40 amino acid stretch of a hinge domain, or a 2-30, 2-25, 2-20, 2-15, 2-10, 8, 6, or 4 amino acid stretch of a hinge domain. Preferably, the hinge contains or consists of 30 or fewer amino acids, more preferably 25 or fewer amino acids, for example, 20 or fewer, 15 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, or 6 or fewer amino acids. The hinge may have at least 50% amino acid identity with the hinge domain or a portion thereof, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% amino acid identity with the hinge domain or a portion thereof. For example, the hinge may have at least 50% amino acid identity with a 30-amino acid stretch of the amino acids of the hinge domain. The hinge may contain or consist of sequences having at least 50% amino acid identity with any one of the sequences of SEQ ID NOs. 36 to 54, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% amino acid identity with any one of the sequences of SEQ ID NOs. 36 to 54. The hinge may be the hinge domain of CD80 or CD52, for example, mouse CD80 or human CD52, or a part thereof. The hinge may contain or consist of a sequence having at least 50% amino acid identity with one of sequence numbers 36-38 (if sequence number 38 is used, the C-terminal S is a GPI-immobilized amidated serine). In some cases, the hinge may consist of a single GPI-immobilized serine residue. In this case, the GPI anchor may be considered a membrane portion, and the serine residue may be considered a hinge linking the membrane portion to a membrane-bound polypeptide.The sequence resulting in the generation of a single GPI-fixed serine residue is shown in SEQ ID NO: 81, and post-translational addition of the GPI anchor to the N-terminal serine of SEQ ID NO: 81 results in the removal of the sequence immediately adjacent to the C-terminal serine, i.e., ASSNISGGIFLFFVANAIIHLFCFS, from the construct. The hinge may include or consist of sequences that physically increase the height of the membrane-bound polypeptide from the cell membrane. For example, the hinge may include or consist of mucin-like sequences or fragments or derivatives thereof, such as sequences of proteins having a mucin-like stalk or sequences of mucin-like stalks. The mucin-like sequence may be a mucin-like sequence of CD43 (i.e., indicated by SEQ ID NO: 55), CD8α, CD28, MUC1, MUC3A, MUC3B, MUC4, MUC12, MUC13, MUC15, MUC16, MUC17, MUC18, MUC20, MUC21, or the extracellular portion of PSGL-1. The mucin-like sequence may be a fragment of the extracellular domain of CD43 indicated by SEQ ID NO: 55. For example, the fragment may be 4 to 40 amino acids long. The fragment may consist of 5 or more, 10 or more, 20 or more, 30 or more, or 40 or more consecutive amino acids from the N-terminus or C-terminus of SEQ ID NO: 55. The fragment may be 4 to 40 amino acids, 8 to 30 amino acids, or 20 to 40 amino acids long. The fragment may be any of SEQ ID NOs: 50 to 54. The mucin-like sequence may be a fragment of the mucin-like stalk of CD28 indicated by SEQ ID NO: 39. The fragment may be any one of sequence numbers 40, 44, and 45. The mucin-like sequence may be a fragment of the mucin-like stalk of CD8α shown in sequence number 46. The fragment may be any one of sequence numbers 47 to 49. The hinge may include a combination of mucin-like sequences shown in sequence numbers 41 to 43.

[0077] The hinge or portion is typically flexible enough to allow the membrane-bound polypeptide and the membrane portion to assume their respective secondary and tertiary structures. The membrane portion may be directly bound to the membrane-bound polypeptide via the hinge, for example, as part of a single, continuous amino acid sequence. For example, the amino acid sequence may be arranged from N-terminus to C-terminus in the order (i) membrane-bound polypeptide-hinge-membrane portion, or (ii) membrane portion-hinge-membrane-bound polypeptide.

[0078] The membrane-bound polypeptide may be bound to the membrane moiety via the linkers and hinges described above. The membrane moiety may be directly bound to the membrane-bound polypeptide via the linkers and hinges, for example, as part of a single continuous amino acid sequence. For example, the amino acid sequence may be arranged from the N-terminus to the C-terminus in the order of (i) membrane-bound polypeptide-linker-hinge-membrane moiety, (ii) membrane-bound polypeptide-hinge-linker-membrane moiety, (iii) membrane moiety-linker-hinge-membrane-bound polypeptide, or (iv) membrane moiety-hinge-linker-membrane-bound polypeptide. The overall size of the hinges and linkers is typically 1-50, 1-30, 1-25, 1-20, 1-15, or 1-10 amino acids in length. Preferably, the overall size of the hinge and linker includes or comprises 30 or fewer amino acids, more preferably 25 or fewer amino acids, for example, 20 or fewer, 15 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, or 6 or fewer amino acids. Exemplary combinations of linkers and / or hinges are provided in SEQ ID NOs: 3, 6, 79, and 80.

[0079] As shown in Example 8, in the case of interactions between, for example, the Spytag-peptide-MHC complex and T cells, the interaction between the target protein and the analyte can be optimized by reducing the height of the membrane-bound polypeptide from the cell membrane. In some cases, the full length of the linker and / or hinge is 20 or fewer amino acids, e.g., 16 or fewer amino acids, 12 or fewer amino acids, 8 or fewer amino acids, 5 or fewer amino acids, 4 or fewer amino acids, 3 or fewer amino acids, 2 or fewer amino acids, or a single amino acid (e.g., GPI-fixed amidated serine). The membrane portion may be, for example, a GPI-fixed serine residue, as recognized.

[0080] The membrane-bound polypeptide may further bind to the cytoplasmic domain, for example, via a membrane portion such as a transmembrane domain, and optionally via a hinge and / or linker. Any suitable cytoplasmic domain may be used. If the effect of the interaction between the POI and the analyte should be observed on the cell surface, the cytoplasmic domain may include a signaling domain such as a dimerization domain. Suitable cytoplasmic domains that can lead to downstream signaling are known to those skilled in the art. The cytoplasmic domain may be modified depending on the POI used in the method described herein. The cytoplasmic domain may be the cytoplasmic domain of a naturally occurring membrane protein (the source of the POI). For example, when using a fusion polypeptide containing the extracellular domain of PD-1 according to the method described herein, the cytoplasmic domain may be the cytoplasmic domain of PD-1 containing an immunoreceptor tyrosine system inhibitory motif and a switch motif (ITIM and ITSM). In this way, upon binding of the target protein to the analyte, a signal transduction similar to that which occurs upon binding of a naturally occurring protein (the source of the POI) to the analyte occurs. Furthermore, both the membrane portion and the cytoplasmic domain are regulated in response to the POI, and for example, the membrane portion and the cytoplasmic domain may be derived from naturally occurring membrane proteins (from which the POI originates). This makes the diffusion of the membrane-bound polypeptide on the cell very similar to the diffusion of naturally occurring membrane proteins (from which the POI originates), and also enables similar signal transduction as described above. The cytoplasmic domain may be inactive, i.e., it has no downstream effect on the cell. The cytoplasmic domain may contain, or consist of, an amino acid sequence having at least 50% amino acid identity with the naturally occurring cytoplasmic domain of the membrane protein.The cytoplasmic domain may be, for example, the mouse CD80 cytoplasmic domain shown in SEQ ID NO: 1 and 2, or a sequence having at least 50% amino acid identity with the mouse CD80 cytoplasmic domain, such as at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% amino acid identity with the mouse CD80 cytoplasmic domain.

[0081] The membrane-bound binding polypeptide bound to the membrane portion typically has a membrane diffusion coefficient similar to that of the naturally occurring protein from which the membrane portion is derived. For example, when using the human CD52 membrane portion, the membrane-bound binding polypeptide has a diffusion coefficient of ±50% of the diffusion coefficient of human CD52, such as ±40%, ±30%, ±20%, ±10%, or ±5% of the diffusion coefficient of human CD52. When using the mouse CD80 transmembrane domain, the membrane-bound binding polypeptide has a diffusion coefficient of ±50% of the diffusion coefficient of mouse CD80, such as ±40%, ±30%, ±20%, ±10%, or ±5% of the diffusion coefficient of mouse CD80. This enables the study of interactions in a form of mobility closer to the physiological state, and more relevant data for predicting in vivo characteristics can be provided compared to studying interactions with a POI bound to a solid phase or in solution. The membrane-bound binding polypeptide typically has a diffusion coefficient of 0.01 - 10 μm 2 / s, which is a typical range of the diffusion coefficient of naturally occurring membrane proteins. Therefore, the membrane-bound binding polypeptide can have a diffusion coefficient of 0.005 - 15 μm 2 / s (±50% of the typical natural range). The membrane-bound binding polypeptide can have a diffusion coefficient of 0.05 - 5 μm 2 / s, such as 0.1 - 1 μm 2 / s. The membrane-bound binding polypeptide can have a diffusion coefficient of 0.01 μm 2 / s or more, such as 0.05 μm 2 / s or more, 0.1 μm 2 / s or more, or 0.2 μm 2It may have a diffusion coefficient of 10 μm or more. Membrane-bound binding polypeptides are 10 μm 2 / s or less, for example, 5 μm 2 / s or less, 4μm 2 / s or less, 3μm 2 / s or less, 2μm 2 / s or less, or 1 μm 2 It may have a diffusion coefficient of / s. Preferably, the diffusion coefficient is measured by scanning fluorescence correlation spectroscopy (sFCS) in CHO cells, for example, CHO-K1 cells. Those skilled in the art are familiar with suitable conditions and methods for measuring the diffusion coefficient of membrane proteins. A membrane-bound polypeptide bound to the membrane portion may have at least 50% amino acid identity with any one of the sequences of SEQ ID NOs: 1 to 6, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% amino acid identity with any one of the sequences of SEQ ID NOs: 1 to 6.

[0082] Membrane-bound fused polypeptides may further be bound to or contain other features related to protein expression and / or purification, in addition to those described herein. For example, a membrane-bound fused polypeptide may contain an N-terminal signal sequence, which is preferably removed from the mature protein. For example, a fusion protein may contain a purification tag, such as a hexahistidine tag, at the N and / or C terminus. The purification tag can preferably be removed from the mature protein, or has been removed. This can be achieved by using a site-specific endonuclease (e.g., restriction enzyme).

[0083] Fusion polypeptide A fusion polypeptide comprises or consists of a complementary binding polypeptide and a protein of interest (POI). A POI is typically the extracellular domain of a naturally occurring membrane protein.

[0084] As used herein, the term “naturally occurring” refers to proteins that can be found naturally, for example, in eukaryotic or prokaryotic cells, or in viruses. Eukaryotic cells may be, for example, animal, plant, or fungal cells. Prokaryotic cells may be bacterial cells. Preferably, naturally occurring proteins are derived from mammalian cells, more preferably from human, rodent, pig, horse, cattle, dog, cattle, or primate cells, most preferably from human cells. The term “naturally occurring” may refer to wild-type proteins, as well as naturally occurring variants, for example, variants found in disease states. For example, the term “naturally occurring” includes human proteins that have mutated and are found in disease states such as cancer. The term “naturally occurring” also includes proteins that are exogenous to the host cell but produced by pathogens within the host cell, for example, viral proteins or malaria proteins produced in human cells, as well as fragments of such exogenous proteins and endogenous proteins presented on MHC molecules.

[0085] Membrane proteins are proteins that are attached to the cell membrane of a cell. Membrane proteins are preferably permanently fixed to the cell. For example, a membrane protein may be a transmembrane protein, i.e., a protein that spans the thickness of the cell membrane. A transmembrane protein may span the membrane thickness using one or more alpha helices or using beta sheets, for example, in a beta barrel. A membrane protein may be a unified, single-type protein, i.e., a protein that is bound to one side of the membrane but does not span the entire width of the membrane. For example, a membrane protein may be bound to the membrane via amphipathic alpha helices, hydrophobic loops, covalently bonded membrane lipids, and electrostatic or ionic interactions with membrane lipids. A membrane protein may be a lipid-fixed membrane protein. A lipid-fixed membrane protein may be fixed to the membrane via prenylation, N-myristoylation, S-palmitoylation, or GPI anchoring.

[0086] The naturally occurring membrane proteins described herein include an extracellular domain. According to the present invention, the extracellular domain of a naturally occurring protein is fused to a complementary binding polypeptide. The extracellular domain of a naturally occurring protein is preferably fused to the complementary binding polypeptide genetically, i.e., as part of a single continuous amino acid sequence. Preferably, the extracellular domain of a naturally occurring membrane protein is bound to the complementary binding polypeptide directly, i.e., without any intervening amino acids. However, the extracellular domain of a naturally occurring membrane protein may be bound to the complementary binding polypeptide via a peptide linker.

[0087] As used herein, the “extracellular domain” of a naturally occurring membrane protein is a portion of a naturally occurring protein located on the extracellular side of the cell membrane. As used herein, the term “domain” is used to refer to any portion of a naturally occurring protein that, when bound to a complementary binding protein, can assume its naturally occurring structure and / or function. For example, a “domain” may be an amino acid sequence that can independently fold into structural units (e.g., having a secondary or tertiary structure) and / or functional units (retaining signaling properties).

[0088] The peptide linker may contain one or more amino acids and links the extracellular domain of a naturally occurring membrane protein to a complementary binding polypeptide. The peptide linker is preferably a short amino acid sequence. For example, the peptide linker may be one amino acid length, e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids. The peptide linker may be 1 to 25 amino acids length, more preferably 1 to 20, 1 to 15, or 1 to 10 amino acids length. Preferably, the linker contains or consists of 30 or fewer amino acids, more preferably 20 or fewer amino acids, e.g., 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, or 6 or fewer amino acids. The linker may consist of, for example, one or more of the following amino acids, namely lysine, serine, arginine, proline, glycine, and alanine. A suitable example of a flexible peptide linker is a stretch of 2 to 20, e.g., 4, 6, 8, 10, or 16 serine and / or glycine amino acids. Examples of rigid linkers include stretches of 2 to 30 proline amino acids, such as 4, 6, 8, 16, or 24. Examples of suitable linkers, though not limited to these, include GGGS (SEQ ID NO: 59), PGGS (SEQ ID NO: 60), PGGG (SEQ ID NO: 61), RPPPPP (SEQ ID NO: 62), RPPPP (SEQ ID NO: 63), VGG, RPPG (SEQ ID NO: 64), PPPP (SEQ ID NO: 65), RPPG (SEQ ID NO: 66), PPPPPPPPP (SEQ ID NO: 67), PPPPPPPPPPPP (SEQ ID NO: 68), RPPG (SEQ ID NO: 69), GG, GGG, SG, SGSG (SEQ ID NO: 70), SGSGSG (SEQ ID NO: 71), GSSGSGGS (SEQ ID NO: 72), SGSGSGSG (SEQ ID NO: 73), SGSGSGSGSG (SEQ ID NO: 74), and SGSGSGSGSGSGSGSG (SEQ ID NO: 75), where G is glycine, P is proline, R is arginine, S is serine, and V is valine. Appropriate linking groups may be designed using conventional modeling methods. Linkers are typically flexible enough to allow naturally occurring extracellular domains of membrane proteins and complementary binding polypeptides to fold into their native secondary and tertiary structures.In practice, linkers have not been observed to be necessary to enable the correct folding of the extracellular domains and complementary binding polypeptides of naturally occurring membrane proteins.

[0089] The fusion polypeptide preferably comprises, or consists of, a POI and a complementary binding polypeptide from the N-terminus to the C-terminus. The fusion polypeptide may comprise, or consist of, (i) a POI and a complementary binding polypeptide, (ii) a POI, a linker, and a complementary binding polypeptide, (iii) a complementary binding polypeptide and the target protein, or (iv) a complementary binding polypeptide, a linker, and a POI, from the N-terminus to the C-terminus.

[0090] Naturally occurring membrane proteins are preferably human proteins. Naturally occurring membrane proteins are preferably proteins involved in the interaction between immune cells such as lymphocytes and antigen-presenting cells such as cancer cells. Naturally occurring membrane proteins may be proteins involved in immunological synapses. Naturally occurring membrane proteins may be proteins of antigen-presenting cells involved in immunological synapses, such as peptide-MHC class I, peptide-MHC class II, CD80, CD86, CD58, CD48, CD59, ICAM-1, ICAM-2, ICAM-3, CD155, PD-L1, PD-L2, and LICOS. Naturally occurring membrane proteins may be proteins targeted by chimeric antigen receptors (CARs), such as disease-associated proteins. Naturally occurring membrane proteins may be proteins targeted by therapeutic CARs.

[0091] Naturally occurring membrane proteins may include proteins of immune effector cells involved in immunological synapses, such as T cell receptors (TCRs), CD3, CD4, CD8, CD44, CD45, CD28, CTLA-4, CD2, LFA1, CD43, CD226, CD96, inhibitory killer cell immunoglobulin-like receptors (inhibitory KIRs), activated KIRs, IgM, PD-1, ICOS, CD27, CD357, CD137, and OX40. Immune effector cells may be lymphocytes such as T cells, B cells, or natural killer (NK) cells.

[0092] The MHC molecules described herein may include peptides produced within cells, such as endogenous peptides, peptides produced by cancer cells, and exogenous peptides derived from pathogenic organisms and / or viruses.

[0093] When using two or more POIs, one POI may be a peptide-MHC class I or II molecule, and one or more of the additional target proteins may be accessory receptors, co-receptors, and / or co-stimulatory molecules.

[0094] Naturally occurring membrane proteins may be targets of soluble molecules such as antibodies. The antibodies may be therapeutic antibodies. The antibodies may be antibodies that target immune checkpoints. The antibodies may be selected from PD-1 antibodies, PD-L1 antibodies, and / or LAG3 antibodies. The antibodies may be selected from pembrolizumab (Keytruda), nivolumab (Opdivo), semiprimab (Libtayo), atezolizumab (Tecentriq), avelumab (Bavencio), durvalumab (Imfinzi), and reratrimab.

[0095] When the complementary binding polypeptide is located at or in the direction of the fusion polypeptide, the N-terminus of the complementary binding polypeptide and / or the C-terminus of the POI are preferably at a height of about 5 nm or less from the cell membrane, for example, about 0.1 nm to about 5 nm from the cell membrane. We have found that the compact fusion of the POI to the membrane via a pair of binding polypeptides allows the method to closely replicate the physiological size and / or diffusion of naturally occurring membrane proteins. Similarly, when the complementary binding polypeptide is located at or in the direction of the fusion polypeptide, the C-terminus of the complementary binding polypeptide and / or the N-terminus of the POI are preferably at a height of about 5 nm or less from the cell membrane, for example, about 0.1 nm to about 5 nm from the cell membrane. The height from the membrane may be determined by any means known to those skilled in the art, such as molecular modeling. The height is typically estimated after the covalent bond is formed while preserving the secondary and tertiary structures for the complex of the membrane-bound binding polypeptide, the complementary binding polypeptide and the POI.

[0096] The fusion polypeptide may have at least 50% amino acid identity with any one of the sequences of SEQ ID NOs. 7 to 19, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% amino acid identity with any one of the sequences of SEQ ID NOs. 7 to 19.

[0097] The fusion polypeptide may further include other features related to protein expression and / or purification, in addition to those described herein. For example, the fusion polypeptide may include an N-terminal signal sequence, which is preferably removed from the mature protein. For example, the fusion protein may include a purification tag, such as a hexahistidine tag, at the N and / or C terminus. The purification tag can preferably be removed from the mature protein, or has been removed. This can be achieved by the use of a site-directed protease. The fusion polypeptide is typically isolated or purified before use in the methods disclosed herein. For example, if the fusion polypeptide is produced by expression in cells, the fusion polypeptide is typically isolated, purified, or separated from the cells. The fusion polypeptide may be isolated, purified, or separated from the culture medium in which it was expressed. The fusion polypeptide may be separated by other elements used in the production of the fusion polypeptide, for example, by affinity chromatography, ion exchange chromatography, size exclusion chromatography, hydrophobic interaction chromatography, or liquid chromatography (e.g., HPLC).

[0098] Analyte The method of the present invention may include the step of bringing cells into contact with an analyte. The analyte may be any molecule to which the POI can specifically bind and whose interaction and / or effect can be observed.

[0099] For example, the analyte may be a polymer, amino acid, polypeptide, nucleotide, polynucleotide, liposome, micelle, lipid bilayer, organelle, cell, tissue, pharmaceutical, or diagnostic agent. The analyte may be a cell. The analyte may be a soluble molecule such as an antibody.

[0100] This method may include a step of detecting interactions with two or more analytes, for example, two or more proteins on a cell surface. The method may also include a step of detecting two or more different types of analytes, for example, one or more proteins (e.g., antibodies) and one or more cells (e.g., neutrophils, eosinophils, macrophages, or NK cells). In this way, antibody-dependent cell-mediated cytotoxicity or antibody-dependent cell-mediated phagocytosis can be studied.

[0101] The analyte can be secreted from cells. In one embodiment, the analyte is present on the cell surface, such as a membrane-bound polypeptide.

[0102] The analyte may be a human protein, for example, a human protein expressed on the cell surface. The analyte may be a protein involved in the interaction between immune cells such as lymphocytes and antigen-presenting cells such as cancer cells. The analyte may be a cell that expresses any of such proteins on its cell surface. For example, the method of the present invention is useful for characterizing the antigen sensitivity of immune cells, and the analyte may be a protein involved in immunological synapses, or a cell containing such a protein.

[0103] The analyte may be a protein of an immune effector cell involved in immunological synapses, or an immune effector cell containing such a protein. Such proteins may be T cell receptors (TCRs), CD3, CD4, CD8, CD44, CD45, CD28, CTLA-4, CD2, LFA1, CD43, CD226, CD96, inhibitory killer cell immunoglobulin-like receptors (inhibitory KIRs), activated KIRs, IgM, PD-1, ICOS, CD27, CD357, CD137, or OX40. The immune effector cells may be lymphocytes such as T cells, B cells, or natural killer (NK) cells. The proteins of the immune effector cells may be modified to express a chimeric antigen receptor (CAR) as described above. The CAR may be a therapeutic CAR such as a CAR known in this technology. The CAR may be a CD19-targeting CAR, such as Yescarta or Kymriah. The CAR may be a CAR that targets pMHC antigens. The CAR may be a CAR that targets CD22 and BCMA. Immune effector cells, e.g., T cells (e.g., CD4 + T cells, CD8 + T cells, T reg Cells, B cells, NK cells, macrophages, CAR-T cells, CAR-NK cells, or CAR-macrophage cells. The analyte may be immune effector cells.

[0104] The analyte may be a protein from an antigen-presenting cell involved in immunological synapses, or an antigen-presenting cell containing such a protein. Such proteins may be peptide-MHC class I, peptide-MHC class II, CD80, CD86, CD58, CD48, CD59, ICAM-1, ICAM-2, ICAM-3, CD155, PD-L1, PD-L2, or LICOS. Proteins, such as disease-associated proteins, may be targeted by chimeric antigen receptors (CARs). Proteins such as CD19, pMHC molecules, CD22, and / or BCMA may be targeted by therapeutic CARs. The analyte may be an antigen-presenting cell.

[0105] When studying two or more analytes, for example, two or more proteins or antibodies on a cell and a combination of cells, the analytes may be TCRs and accessory receptors, coreceptors, costimulatory molecules, and / or coinhibitory molecules. The analytes may be CARs and accessory receptors, coreceptors, costimulatory molecules, and / or coinhibitory molecules.

[0106] In the methods described herein, the POI and the analyte preferably bind specifically to each other. The POI and the analyte may be a pair of molecules that bind specifically as part of an immunological synapse. For example, the POI may be a peptide-MHC molecule and the analyte may be a TCR or CAR. Similarly, the POI may be ICAM-1 and the analyte may be LFA-1. The POI may be PDL-1 or PDL-2 and the analyte may be PD-1. Other pairs of molecules that bind in an immunological synapse are well known to those skilled in the art.

[0107] Preferably, the analyte is a cell containing a target that binds to a POI, such as an immune cell (e.g., a human immune cell). The target is preferably a protein, such as a protein found in immunological synapses, as described above. The strength with which immune effector cells bind to their target antigen-presenting cells depends in part on the interaction between the CAR / TCR and its target (e.g., a peptide-MHC molecule), as well as the interaction between the co-receptor and accessory receptor (e.g., LFA-1 and ICAM-1). Therefore, the membrane alignment of immune effector cells and antigen-presenting cells plays a role in the strength of binding between the CAR / TCR and its target. Membrane alignment is influenced by the size of receptor-ligand complexes, such as the CAR and accessory receptor co-localized on immune effector cells, and the respective antigen and ligand on antigen-presenting cells. Membrane alignment for antigen recognition by TCR / CAR can be optimized when the intermembrane distance across the CAR-target antigen complex is comparable to the intermembrane distance across the complex of a particular accessory receptor and its ligand.

[0108] The intermembrane distance of the complex formed between the POI and its target on the cell (the analyte) may be adjusted to match the intermembrane distance of a naturally occurring membrane protein (from which the POI originates) and its target. When the POI is an antigen receptor such as a TCR or CAR and the target is a pMHC molecule, or vice versa, the intermembrane distance of the complex formed between the POI and its target on the cell (the analyte) may be approximately 19 nm or less. In the immunological synaptic region where TCR / pMHC interactions occur, the typical intermembrane distance is approximately 14 nm. When the POI is ICAM-1 and the target is LFA-1, or vice versa, the intermembrane distance of the complex formed between the POI and its target on the cell (the analyte) may be 41 nm or less. The typical intermembrane distance in the immunological synaptic region where LFA-1 and ICAM-1 interact is approximately 36 nm. The binding polypeptide pair used in this invention typically binds the POI to the cell membrane at a height of 5 nm or less. The inventors have found that this compact binding of the POI to the cell membrane allows for a configuration of the target protein that closely resembles its physiological placement on the cell membrane, thereby enabling better replication of in vivo interactions.

[0109] In some cases, for example, when the POI is a pMHC molecule, TCR, or CAR, the intermembrane distance of the complex formed between the POI on the cell and its target on the cell, which is the analyte, may be approximately 9 nm to 19 nm, for example, approximately 10 nm to 18 nm, approximately 11 nm to 17 nm, approximately 12 nm to 16 nm, approximately 13 nm to 15 nm, or approximately 14 nm.

[0110] In some cases, for example, when the POI is ICAM-1 or LFA-1, the intermembrane distance of the complex formed between the POI on the cell and its target on the cell, which is the analyte, may be approximately 31 nm to 41 nm, for example, approximately 32 nm to 40 nm, approximately 33 nm to 39 nm, approximately 34 nm to 38 nm, approximately 35 nm to 37 nm, or approximately 36 nm.

[0111] The intermembrane distance of the complex formed between the POI and its target on the cell (the analyte) may differ from the intermembrane distance of the naturally occurring membrane protein containing the POI and its target by approximately 5 nm or less, for example, approximately 4 nm or less, approximately 3 nm or less, approximately 2 nm or less, or approximately 1 nm or less.

[0112] Preferably, the POI is a human protein, and the analyte is a human cell (e.g., a T cell or CAR-T cell).

[0113] Cells containing membrane-bound polypeptides The method of the present invention comprises the step of contacting a cell containing a membrane-bound conjugate polypeptide with a fusion polypeptide. The cell may be any cell capable of expressing the membrane-bound conjugate polypeptide and presenting it on the cell surface in a correctly folded state. Preferably, the cell has a cell membrane that allows the membrane-bound conjugate polypeptide (and consequently the POI bound via the complementary conjugate polypeptide) to diffuse through the cell membrane at a rate similar to the diffusion coefficient of the naturally occurring membrane protein from which the POI originates. For example, the diffusion coefficient may be ±50% of the diffusion coefficient of the naturally occurring membrane protein from which the POI originates, for example, ±40%, ±30%, ±20%, ±10%, or ±5% of the diffusion coefficient of the naturally occurring membrane protein from which the POI originates.

[0114] The cells may be eukaryotic cells. The cells may be mammalian cells, e.g., human, rodent (e.g., mouse, hamster, rat), pig, horse, cattle, dog, cat, or primate cells. The cells are preferably non-human mammalian cells. In particular, if the POI is a human protein and the analyte is a human cell, then the cells containing the POI (bound via a pair of binding polypeptides) are non-human mammalian cells. The cells may be rodent cells, e.g., mouse cells, hamster cells, or rat cells. The cells may be Chinese hamster ovary (CHO) cells or modified variants thereof. The cells may be antigen-presenting cells. The cells may be associated with a disease, for example, the cells may have the genotype or phenotypic features of the disease. For example, the cells may be cancer cells (e.g., glioblastoma cells). In some cases, the cells are not T cells. In some cases, the cells are not lymphocytes. In some cases, the cells are not myeloid cells.

[0115] Cells may be modified to remove cell surface proteins that may interfere with the methods described herein and cross-react with analytes, such as human analytes. Cells are preferably modified to remove endogenous, naturally occurring membrane proteins from which the POI originates; for example, if the POI is derived from human PD-1, the cells are modified to remove endogenous PD-1. For example, endogenous hamster ICAM-1 protein can cross-react with human LFA-1 present on analyte cells such as T cells, and such interactions are known to interfere with the results of this method. To avoid these interactions, cells are preferably modified to remove one or more cross-reactive proteins on their cell surface (i.e., endogenous proteins to the cell that can interact with the target on the cell analyte). Cells useful in the present invention may be modified to remove cell surface expression of ICAM-1. This can be achieved by any means known to those skilled in the art, such as genomic modification (e.g., via CRISPR). Therefore, the cells may be non-human mammalian cells lacking cell surface expression of endogenous ICAM-1.

[0116] Cells containing membrane-bound polypeptides are typically distinguished from cells that express fusion polypeptides.

[0117] Detection of interactions This method includes the step of detecting the interaction between the target protein (POI) and the analyte. Detection may be carried out by any means known to those skilled in the art. Detection is performed by measuring binding affinity, for example, equilibrium dissociation constant or IC50. 50 Or e-commerce 50 The detection may be the determination of a value. Detection may be the readout of a function resulting from downstream signaling of a cell or analyte (if the analyte is a cell). For example, if detection is the detection of a change within a cell (e.g., a cell containing a POI and / or analyte), detection may be cell activation, cell inhibition, changes in protein expression, changes in gene transcription, changes in cell morphology, or any other change in genotype or phenotype.

[0118] Detection may be an assay of cell viability, cell proliferation, cytotoxicity, cell senescence, cell death, cell motility, or cell affinity. Detection may be a fluorescence assay, for example, using a fluorescently labeled antibody, such as flow cytometry and / or immunofluorescence staining. Detection may include a microscope, such as a fluorescence microscope. The microscope may be used to detect viable or fixed cells.

[0119] For example, a method for detecting a ligand, such as a POI or analyte, may be performed using a fluorescently conjugated antibody followed by flow cytometry, as demonstrated in the examples. If the analyte is, for example, a T cell or a CAR-T cell, T cell activation may be measured by flow cytometry using a fluorescently labeled antibody against a T cell activation marker, as demonstrated in the examples. Flow cytometry may be used to detect cell-cell conjugations. Cytokine levels, which are also markers of immune cell activation, may be measured, for example, by ELISA, as demonstrated in the examples. Cell affinity assays measure the strength of interactions between two cells, either directly or mediated by soluble bispecific engagers, such as bispecific T cell engagers (BiTEs) and ImmTACs (immune-mobilizing monoclonal T cell receptors against cancer). Cell affinity assays may be performed using acoustic force spectroscopy-based methods, such as the Lumicks z-Movi Cell Avidity Analyser. Cytotoxicity / death assays may be performed, for example, by imaging viable cells, such as using the IncuCyte platform.

[0120] Detection may be performed by PCR assay, RT-PCT assay, or qRT PCR assay. Detection may also be performed by Northern blot, Western blot, or Southern blot assay.

[0121] Interactions between two cells may include, for example, activating interactions of the second cell to the first cell, inhibitory interactions of the second cell to the first cell, inductive interactions of the second cell to the first cell, or combinations thereof, if the analyte is a cell in the method described herein. Activating interactions may include increased gene expression levels and / or protein expression levels, increased cell proliferation, increased cell viability, increased cell motility, increased cell differentiation, increased expression of a particular protein or its expression level, increased secretion of a particular cytokine or its secretion level, or combinations thereof. Inductive interactions may include the production of proteins or small molecules such as cytokines or chemokines from the first cell and / or the second cell that can confer growth, survival, proliferation, or drug resistance to the first cell and / or the second cell. Inhibitory interactions may include inhibition of cell motility, reduction of cell proliferation, decrease in cell viability, inhibition of cell differentiation, decreased protein expression, decreased cytokine secretion, or combinations thereof. For example, the cell may be an antigen-presenting cell, the second cell may be a T cell, and the interaction between the antigen-presenting cell and the T cell may result in activation, inhibition, or induction of the T cell, and / or death of the antigen-presenting cell.

[0122] Polypeptide The present invention also provides polypeptides comprising membrane-bound conjugating polypeptides bound to a membrane portion. These membrane-bound conjugating polypeptides can form covalent bonds with complementary conjugating polypeptides.

[0123] Membrane-bound polypeptides may contain, or consist of, amino acid sequences having at least 50% amino acid identity with any one of SEQ ID NOs. 20-22, 24, and 26-35, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% amino acid identity with any one of SEQ ID NOs. Variants of membrane-bound polypeptides retain their ability to form covalent bonds with complementary polypeptides. Exemplary pairs of membrane-bound polypeptides and complementary polypeptides are shown in Table 1 above.

[0124] Preferably, the membrane-bound conjugate polypeptide is selected from an amino acid sequence having at least 50% amino acid identity with any one of SEQ ID NOs. 20-22, 24, and 26, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% amino acid identity with any one of SEQ ID NOs. Variants of the membrane-bound conjugate polypeptide retain their ability to form covalent bonds with complementary conjugate polypeptides. Preferred exemplary pairs of membrane-bound conjugate polypeptides and complementary conjugate polypeptides are shown in Table 2 above.

[0125] Membrane-bound polypeptides may bind directly to the membrane portion. Membrane-bound polypeptides may bind directly to the membrane portion via hinges and / or linkers. Suitable hinges and linkers are described above. The total length of the hinges and / or linkers is preferably 25 amino acids or less. For example, the total length of the hinges and / or linkers may be 20 amino acids or less, for example, 15 amino acids or less, 14 amino acids or less, 13 amino acids or less, 12 amino acids or less, 11 amino acids or less, 10 amino acids or less, 9 amino acids or less, 8 amino acids or less, 7 amino acids or less, 6 amino acids or less, 5 amino acids or less, 4 amino acids or less, 3 amino acids or less, or 2 amino acids or less. A shorter total length of the hinges and / or linkers allows the POI to bind to the membrane portion in a compact form via membrane-bound polypeptides and complementary polypeptides, and thus allows the protein to bind in a configuration close to its physiological configuration, as described herein.

[0126] A fusion polypeptide comprising or comprising a complementary binding polypeptide and a POI is also provided. The complementary binding polypeptide may be any complementary binding polypeptide described herein. The POI may be any target protein described herein.

[0127] Complementary polypeptides may contain, or consist of, amino acid sequences having at least 50% amino acid identity with any one of SEQ ID NOs. 20-22, 24, and 26-35, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% amino acid identity with any one of SEQ ID NOs. Variants of complementary binding polypeptides retain their ability to form covalent bonds with membrane-bound binding polypeptides. Exemplary pairs of membrane-bound and complementary binding polypeptides are shown in Table 1 above.

[0128] Preferably, the complementary binding polypeptide is selected from an amino acid sequence having at least 50% amino acid identity with any one of SEQ ID NOs. 28-30 and 32-34, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% amino acid identity with any one of SEQ ID NOs. Variants of the complementary binding polypeptide retain their ability to form covalent bonds with the complementary binding polypeptide. Preferred exemplary pairs of membrane-bound binding polypeptides and complementary binding polypeptides are shown in Table 2 above.

[0129] The complementary binding polypeptide is preferably directly bound to the POI, for example, as part of a single continuous amino acid sequence. The complementary binding polypeptide may also be directly bound to the POI via a hinge and / or linker. Suitable hinges and linkers are described above. The total length of the hinge and / or linker is preferably 25 amino acids or less. For example, the total length of the hinge and / or linker may be 20 amino acids or less, for example, 15 amino acids or less, 14 amino acids or less, 13 amino acids or less, 12 amino acids or less, 11 amino acids or less, 10 amino acids or less, 9 amino acids or less, 8 amino acids or less, 7 amino acids or less, 6 amino acids or less, 5 amino acids or less, 4 amino acids or less, 3 amino acids or less, or 2 amino acids or less.

[0130] Multiple polypeptides are also provided, each containing a membrane-bound conjugate polypeptide bound to a membrane portion. The membrane-bound conjugate polypeptide may be any membrane-bound conjugate polypeptide described herein. The membrane portion may be any membrane portion described herein. In some cases, the multiple polypeptides may include the same polypeptide. In some cases, the multiple polypeptides may include two or more different polypeptides, for example, three or more different polypeptides. The different polypeptides may have different membrane-bound conjugate polypeptides as described herein, and / or different membrane portions as described herein.

[0131] Multiple fusion polypeptides comprising or consisting of complementary binding polypeptides and POIs are also provided. The complementary binding polypeptide may be any complementary binding polypeptide described herein. The POI may be any target protein described herein. In some cases, multiple fusion polypeptides may comprise the same fusion polypeptide. In some cases, multiple fusion polypeptides may comprise two or more different fusion polypeptides, e.g., three or more, four or more, or five or more different fusion polypeptides. Different fusion polypeptides may have different complementary binding polypeptides and / or different target proteins, as described herein. For example, different fusion polypeptides may have the same complementary binding polypeptide and different target proteins. Different fusion polypeptides may have different complementary binding polypeptides and different target proteins.

[0132] nucleic acids, vectors, and cells The present invention also provides nucleic acids encoding polypeptides of the present invention. For example, the polypeptide may be a membrane-bound conjugate polypeptide as described herein. The polypeptide may be a membrane-bound conjugate polypeptide bound to a membrane portion as described herein. The polypeptide may be a fusion polypeptide as described herein.

[0133] Multiple nucleic acids encoding multiple polypeptides of the present invention are also provided. For example, the multiple nucleic acids may encode multiple polypeptides, including membrane-bound polypeptides bound to a membrane portion, as described herein. The multiple nucleic acids may encode multiple fusion polypeptides, as described herein. The multiple nucleic acids may encode one or more polypeptides (e.g., multiple polypeptides) and one or more fusion polypeptides, including membrane-bound polypeptides bound to a membrane portion.

[0134] The present invention also provides cells comprising membrane-bound polypeptides, or polypeptides comprising membrane-bound polypeptides, attached to a membrane portion, as described herein. The cells may comprise a plurality of polypeptides comprising membrane-bound polypeptides, attached to a membrane portion, as described herein. The present invention further provides cells comprising membrane-bound polypeptides, for example, nucleic acids encoding membrane-bound polypeptides attached to a membrane portion, as described herein. The cells may comprise a plurality of nucleic acids encoding membrane-bound polypeptides, for example, membrane-bound polypeptides, attached to a membrane portion, as described herein.

[0135] The cells may be eukaryotic cells. The cells may be mammalian cells, e.g., human, rodent (e.g., mouse, hamster, rat), pig, horse, cattle, dog, cat, or primate cells. The cells may be non-human mammalian cells. In particular, if a membrane polypeptide is covalently bonded to or will be covalently bonded to a fusion protein containing a POI, and the POI is a human protein, the cells are preferably non-human mammalian cells. The cells may be rodent cells, e.g., mouse cells, hamster cells, or rat cells. The cells may be Chinese hamster ovary (CHO) cells or modified variants thereof.

[0136] Cells may be modified to remove cell surface proteins that may interfere with the methods described herein and cross-react with analytes such as human analytes. For example, if the cells are rodent cells, e.g., CHO cells, it is known that the endogenous hamster ICAM-1 protein can cross-react with human LFA-1 present on analyte cells such as T cells. Such interactions may interfere with the results of the methods. To avoid these interactions, cells are preferably modified to remove one or more cross-reactive proteins on the cell surface (i.e., endogenous proteins to the cell that can interact with targets on the cell analyte). Cells are preferably modified to remove cell surface expression of ICAM-1. This can be achieved by any means known to those skilled in the art, e.g., genomic modification (e.g., via CRISPR). Thus, the cells may be non-human mammalian cells lacking cell surface expression of endogenous ICAM-1.

[0137] The cells may be immune effector cells. This is particularly relevant when the membrane polypeptide is covalently bonded to, or will covalently bonded to, a fusion protein containing a POI, and the POI is a therapeutically effective molecule such as an antibody, CAR, or TCR, which can enable cells to target antigens (e.g., disease-associated antigens, e.g., cancer-associated antigens). For example, immune effector cells may be lymphocytes such as T cells, B cells, natural killer (NK) cells, or macrophages, such as CAR-T cells, CAR-NK cells, or CAR-macrophages.

[0138] The cell may further contain a complementary binding polypeptide and a POI, or a fusion polypeptide comprising these, wherein the complementary binding polypeptide is covalently bound to a membrane-bound binding polypeptide. The fusion polypeptide may be any fusion polypeptide described herein. The complementary binding polypeptide may be any complementary binding polypeptide described herein, provided that it retains the ability to bind to a membrane-bound binding polypeptide on the cell. The POI may be any target protein described herein.

[0139] POI may be, for example, the extracellular domain of a naturally occurring membrane protein. The naturally occurring membrane protein is preferably a protein involved in the interaction between immune cells such as lymphocytes and antigen-presenting cells such as cancer cells. The naturally occurring membrane protein may be a protein involved in immunological synapses. The naturally occurring membrane protein may be a protein of antigen-presenting cells involved in immunological synapses, such as peptide-MHC class I, peptide-MHC class II, CD80, CD86, CD58, CD48, CD59, ICAM-1, ICAM-2, ICAM-3, CD155, PD-L1, PD-L2, or LICOS. The naturally occurring membrane protein may be a protein targeted by a chimeric antigen receptor (CAR), such as a disease-associated protein. The naturally occurring membrane protein may be a protein targeted by a therapeutic CAR. Naturally occurring membrane proteins may include proteins of immune effector cells involved in immunological synapses, such as T cell receptors (TCRs), CD3, CD4, CD8, CD44, CD45, CD28, CTLA-4, CD2, LFA1, CD43, CD226, CD96, inhibitory killer cell immunoglobulin-like receptors (inhibitory KIRs), activated KIRs, IgM, PD-1, ICOS, CD27, CD357, CD137, and OX40.

[0140] The MHC molecules described herein may include peptides produced within cells, such as endogenous peptides, peptides produced by cancer cells, and exogenous peptides derived from pathogenic organisms and / or viruses.

[0141] When using two or more POIs, one POI may be a peptide-MHC class I or II molecule, and one or more of the additional target proteins may be accessory receptors, co-receptors, and / or co-stimulatory molecules.

[0142] Naturally occurring membrane proteins may be targets of soluble molecules such as antibodies. The antibodies may be therapeutic antibodies. The antibodies may be antibodies that target immune checkpoints. The antibodies may be selected from PD-1 antibodies, PD-L1 antibodies, and / or LAG3 antibodies. The antibodies may be selected from pembrolizumab (Keytruda), nivolumab (Opdivo), cemiprimab (Libtayo), atezolizumab (Tecentriq), avelumab (Bavencio), durvalumab (Imfinzi), and reratrimab.

[0143] The POI may be an antigen-recognition domain. The POI may be an antibody, CAR, TCR, etc., or an antigen-binding fragment thereof. The antibody or its binding fragment may be a therapeutic antibody or a fragment thereof. The CAR, TCR, or their antigen-binding fragment may be a therapeutic CAR cell or therapeutic T cell, for example, a CAR, TCR, or their antigen-binding fragment of a CAR cell or T cell used for adoptive cell therapy (ACT).

[0144] The population of cells described herein is also provided.

[0145] The present invention also provides multiple populations of cells, as described herein. The cells preferably contain a membrane-bound binding polypeptide bound to a membrane portion. The cells preferably further contain a fusion polypeptide containing a complementary binding polypeptide and POI, as described herein, where the complementary binding polypeptide is covalently bound to the membrane-bound binding polypeptide. In some cases, each cell in a population contains POI at the same concentration, and each population contains cells having POI at different concentrations than each other population of cells. For example, the concentration of POI on the cells of one population of multiple populations is different from the concentration of POI on the cells of each other population of multiple populations. The concentration of POI can be varied by changing the concentration of the fusion polypeptide before contacting the cells containing the membrane-bound binding polypeptide. In some cases, each cell contains two or more different target proteins, each cell in a population contains the same combination of target proteins, and each population contains different combinations of target proteins. In some cases, multiple populations may contain a combination of the two variables described above. For example, the multiple populations may include multiple populations each containing different combinations of the target protein, and multiple populations each containing the said combination at different concentrations.

[0146] Cells containing fusion polypeptides are also provided, as described herein. The cells may contain multiple fusion polypeptides, as described herein. Further provided are cells containing nucleic acids encoding fusion polypeptides, as described herein. The cells may contain multiple nucleic acids encoding fusion polypeptides, as described herein.

[0147] kit The present invention also provides a kit comprising cells containing or expressing membrane-bound conjugating polypeptides, and a plurality of fusion polypeptides, each comprising a complementary conjugating polypeptide and a protein of interest (POI), the complementary conjugating polypeptide being able to form a covalent bond with the membrane-bound conjugating polypeptide. Each of the different fusion polypeptides preferably contains a different POI. More preferably, the protein of interest is the extracellular domain of one or more naturally occurring membrane proteins. The cells may be any of the cells described herein. The membrane-bound conjugating polypeptide may be any of the membrane-bound conjugating polypeptides described herein. The membrane-bound conjugating polypeptide may be bound to a membrane portion as described herein. The fusion polypeptide may be any of the fusion polypeptides described herein. The plurality of fusion polypeptides may be any plurality of fusion polypeptides described herein. The membrane-bound conjugating polypeptide and the complementary conjugating polypeptide may be any pair of conjugating polypeptides described herein, for example, as shown in Table 1 or Table 2. The kit may be suitable for use in the methods described herein, for example, to detect interactions between POIs and analytes, or for example, to prepare cells containing POIs.

[0148] Methods for preparing cells The present invention also provides a method for preparing cells containing a protein of interest (POI), the method comprising the step of contacting cells containing a membrane-bound conjugate polypeptide with a fusion polypeptide containing a complementary conjugate polypeptide and a POI, the complementary conjugate polypeptide being able to form a covalent bond with the membrane-bound conjugate polypeptide. The POI may be any of the proteins of interest described herein. Preferably, the POI comprises or consists of the extracellular domain of a naturally occurring membrane protein, as described herein. In some cases, the method comprises the step of contacting cells with two or more different fusion polypeptides, each of which has a different POI. Thereafter, the method may provide cells containing two or more different proteins of interest.

[0149] The present invention also provides a method for preparing multiple populations of cells.

[0150] Each population may contain POI at predetermined different concentrations. The method comprises the step of contacting a first population of cells, each containing a membrane-bound conjugate polypeptide, with a fusion polypeptide containing a complementary conjugate polypeptide and POI, wherein the complementary conjugate polypeptide can form a covalent bond with the membrane-bound conjugate polypeptide. The POI preferably contains or consists of the extracellular domain of a naturally occurring membrane protein. The method further comprises the step of repeating the step of contacting one or more further populations of cells, each containing a membrane-bound conjugate polypeptide, in each iteration at predetermined different concentrations of the fusion polypeptide.

[0151] Each population may contain different combinations of the target protein. The method comprises the step of contacting cells containing a membrane-bound conjugate polypeptide with two or more different fusion polypeptides, each containing a complementary conjugate polypeptide and a POI, the complementary conjugate polypeptide being able to form a covalent bond with the membrane-bound conjugate polypeptide. The target protein preferably contains or consists of the extracellular domain of a naturally occurring membrane protein, as described herein. Each of the different fusion polypeptides has a different POI. The method further comprises the step of repeating the contact step once or more times with different combinations of different fusion polypeptides. In some cases, as described herein, the cells may contain two or more different membrane-bound conjugate polypeptides, and the different fusion polypeptides may contain different complementary conjugate polypeptides in a pair of non-cross-reactive conjugate polypeptides. This improves the loading of the different fusion polypeptide combinations so that the cells are not saturated by a single type of fusion polypeptide that may interfere with the binding of the second type of fusion polypeptide containing a different POI to the cell.

[0152] Cells, populations of cells, and multiple populations of cells produced by the methods disclosed herein are also provided.

[0153] others It should be understood that the disclosed antibody combinations or various applications of the pharmaceutical compositions of the present invention may be modified to suit specific needs in this technology. It should also be understood that the terms used herein are for the purpose of describing specific embodiments of the present invention and are not intended to limit them.

[0154] Furthermore, as used herein and in the appended claims, the singular forms "a," "an," and "the" include multiple references unless the context clearly indicates otherwise. Thus, for example, a reference to "fusion polypeptide" includes two or more "fusion polypeptides."

[0155] For the purposes of this invention, in order to determine the identity percentage of two sequences (e.g., two polynucleotides or two polypeptide sequences), the sequences are aligned for optimal comparison purposes (for example, a gap can be introduced in the first sequence for optimal alignment with the second sequence). Next, nucleotide or amino acid residues at each position are compared. If a position in the first sequence is occupied by the same nucleotide or amino acid as the corresponding position in the second sequence, then that nucleotide or amino acid is identical at that position. The identity percentage between the two sequences is a function of the number of identical positions shared by these sequences (i.e., identity % = number of identical positions / total number of positions in the reference sequence × 100).

[0156] Typically, sequence comparison is performed over the length of a reference sequence. For example, if it is desired to determine whether a given ("test") sequence is 95% identical to sequence number 3, then sequence number 3 would be the reference sequence. To evaluate whether a sequence is at least 95% identical to sequence number 3 (an example of a reference sequence), a person skilled in the art would perform alignment over the length of sequence number 3 and identify how many positions in the test sequence are identical to positions in sequence number 3. If at least 95% of the positions are identical, then the test sequence is at least 95% identical to sequence number 3. If the sequence is shorter than sequence number 3, any gaps or deletions should be considered non-identical positions.

[0157] Those skilled in the art are familiar with the various computer programs available for determining homology or identity between two sequences. For example, the comparison of sequences and the determination of the identity percentage between two sequences can be achieved using mathematical algorithms. In one embodiment, the identity percentage between two amino acid or nucleic acid sequences is determined using the Needleman and Wunsch (1970) algorithm incorporated into the GAP program in the Accelrys GCG software package (available at http: / / www.accelrys.com / products / gcg / ), using a Blosum 62 matrix or PAM250 matrix, as well as gap weights of 16, 14, 12, 10, 8, 6, or 4 and length weights of 1, 2, 3, 4, 5, or 6.

[0158] All publications, patents, and patent applications cited herein, both above and below, are incorporated herein by reference in their entirety.

[0159] The present invention will be explained by the following examples. [Examples]

[0160] [Example 1] Spycatcher can be presented on the cell surface and can be linked to purified spytag proteins. To enable ligand ligation and presentation on the cell surface, the protein Spycatcher, which spontaneously forms a covalent bond with the peptide tag (Spytag) (Keeble et al. (2020). Chemical Science, 11(28), 7281-7291), was engineered to be expressed on the cell surface (surface Spycatcher).

[0161] Surface Spycatchers were prepared by ligating the C-terminus of Spycatcher to either the human CD52 hinge (hCD52) or the mouse CD80 hinge (mCD80) (Figure 1A). A variant of the mouse CD80 hinge containing fewer residues (mCD80-short) was also prepared. The rationale for ligating the C-terminus of Spycatcher to these shorter hinges is to maintain a compact conformation and to bring either ligated Spytag fusion protein closer to the membrane.

[0162] These three surface Spycatcher constructs were transduced into CHO-K1 cells, and the surface Spycatchers were detected by flow cytometry after adding purified fluorescent protein mClover3 fused to Spytag (Figure 1B). Quantitative evaluation of Spytag-mClover3 levels revealed that all three surface Spycatchers were well expressed, and the Spycatcher fused to hCD52 was expressed at approximately twice the level compared to the mouse CD80-based hinge (Figure 1C). Therefore, the hCD52 hinge was used in subsequent experiments.

[0163] All three structures were found to have similar diffusion coefficients within the cell membrane.

[0164] [Example 2] Production of target cells to study the effects of T cell accessory receptors T cell activation is known to be partially regulated by accessory receptors CD2, LFA-1, and CD28, whose ligands are CD58, ICAM-1, and CD86 (or CD80), respectively. To study these individual contributions using surface Spycatcher technology, target cells that do not express these ligands are needed. Given that CHO-K1 cells are hamster ovary cells, with the exception of ICAM-1, which has been shown to be functional, they are not expected to express ligands that cross-react with human accessory receptors. ICAM-1 was knocked out using CRISPR (Figures 2A and 2B).

[0165] We designed constructs containing the extracellular domains of CD58, ICAM-1, CD80, and CD86 fused to a C-terminal Spytag (for ligation to Spycatcher) and a His-tag (for purification). After producing and purifying these ligands, they were added at various concentrations to CHO-K1 ICAM-1 KO cells expressing a surface Spycatcher (Figure 3). We observed an increase in the level of ligated ligands as the solution concentrations increased. The Spytag was ligated to the C-terminus of HLA-A2, refolded with β2m and the peptide to produce purified Spytag-pMHC, which could also be readily ligated and detected (Figure 3).

[0166] [Example 3] The loading capacity of surface spycatchers on CHO-K1 ICAM-1 KO cells is high enough to allow ligand binding at a level similar to that found on target cells. The surface levels of ligands linked to surface spycatchers on CHO-K1 cells were compared when they were in contact with various target cells. First, each ligand was quantitatively evaluated and compared to its surface level on commonly used T2 cell lines, which are B cell hybridomas expressing CD58, ICAM-1, and CD86 / CD80 (Figure 4A). For all ligands, the maximum levels were found to be higher than those of ligands presented on T2 cells.

[0167] We compared the expression of these four ligands in various cell lines and primary cells, and found expression variations of up to 100-fold across different cell types (Figure 4B). Importantly, the loading capacity of surface spycatchers in CHO-K1 ICAM-1 KO cells exceeded the levels observed in these cells. Therefore, quantitative evaluation of these ligands can reproduce the native surface levels found in various cell types.

[0168] [Example 4] Ligand combinations can be loaded into the surface Spycatcher. Considering that cells typically express multiple ligands, we investigated whether it is possible to simultaneously quantify multiple ligands on a surface Spycatcher. Various concentrations of pMHC were mixed with various concentrations of CD58 (Figure 5A), ICAM-1 (Figure 5B), CD86 (Figure 5C), or CD80 (Figure 5D), and then pMHC and each ligand were quantified using specific antibodies in flow cytometry. It was found that when the total ligand concentration was less than 0.5 μM, it was possible to quantify each ligand independently.

[0169] [Example 5] Determination of T cell activation by ligand combinations Next, we investigated whether the ligand linked to the surface Spycatcher was functional. This involved transfecting primary human CD8 with a 1G4 TCR. +T cells were co-cultured with CHO-K1 ICAM-1 KO cells expressing surface spycatchers loaded with various ligand combinations, including pMHC ligands recognized by the 1G4 TCR (Figure 6). The 1G4 TCR is a human anti-NY-ESO-1 T cell receptor that utilizes an endogenous CD3 component, comprising a variable alpha domain and a constant alpha domain, a P2A self-cleaving peptide, followed by a variable beta domain and a constant beta domain.

[0170] T cell activation, as measured by the expression of 4-1BB (Figure 6A) or CD69 (Figure 6B), or the production of IL-2 (Figure 6C), IFN-g (Figure 6D), or TNFα (Figure 6E), was found to be dependent on the surface level (x-axis) of pMHC. This is consistent with previous observations using normal target cells pulsed with various concentrations of peptide antigens (Pettmann et al. (2021). Elife, 10, e67092). As previously reported (Bachmann et al. (1999). The Journal of experimental medicine, 190(10), 1383-1392), involvement of CD2 or LFA-1 (by addition of CD58 or ICAM-1) was found to reduce the pMHC concentration required for T cell activation (Figure 6A, Figure 6B). Involvement of CD2 (by addition of CD58) resulted in increased cytokine production (Figure 6C, Figure 6D, Figure 6E). The involvement of CD28 (by the addition of CD80 or CD86) leads to an increase in the level of cytokine IL-2 produced, and when CD80-Spytag is used, P 15 This resulted in an improvement in the value.

[0171] Finally, the improved results achieved by removing the endogenous ligand from CHO-K1 cells were illustrated by comparing pMHC-mediated T cell activation in parental CHO-K1 cells and ICAM-1 KO CHO-K1 Spycatcher cells (Figure 2C). Spytag-ICAM-1 increased the T cell response only in the ICAM-1 KO cell line, but not in the parental CHO-K1 cell line. This is because endogenous hamster ICAM-1 is an effective ligand for human LFA-1, and it blocked the effect that the SpyTag-ICAM-1 construct has on T cell activation.

[0172] These results demonstrate that ligands fused to Spytag can regulate T cell activation when linked to cells expressing Spycatcher, highlighting the importance of removing endogenous ligands from these cells.

[0173] [Example 6] Application to the activation of chimeric antigen receptor (CAR) T cells While CAR-T cell sensitivity to antigen density is functionally important, manipulating the levels of these antigens on the surface of target cells to measure sensitivity is challenging. To investigate the usefulness of surface Spycatcher for measuring CAR-T cell sensitivity, surface Spycatcher was transduced into Nalm6 cells from which CD19 had been removed by CRISPR (Figure 7A). Purified Spytag-CD19 was readily ligated and detected by flow cytometry on the surface of these cells (Figure 7B). Nalm6 CD19 KO cells were loaded with various concentrations of Spytag-CD19, and their ability to activate primary human CD8+ T cells transduced with the anti-CD19 CARs Kymriah or Yescarata was measured (Figures 7C, 7D). T cell activation was observed by increasing the concentration of Spytag-CD19, confirming that this system can be used to measure CAR-T cell antigen sensitivity.

[0174] To evaluate the influence of CD2, LFA-1, or CD28 on the antigen sensitivity of CAR-T cells, CHO-K1 ICAM-1 KO target cells were exposed to various concentrations of CD19 in combination with CD58, ICAM-1, CD80, or CD86, either alone or at fixed concentrations (Figure 8). These cells were co-cultured with primary human CD8+ T cells transduced with the anti-CD19 CAR, Kymriah. Interestingly, only ICAM-1 increased antigen recognition sensitivity (Figure 8). This is consistent with recent observations that CARs may be less effective than TCRs in the utilization of accessory receptors (Burton et al (2023). PNAS, 120(2), e2216352120).

[0175] In summary, these results confirm that CAR-T cells can recognize Spytag antigens linked to surface Spycatchers on Nalm6 and CHO-K1 target cells, and that this system can be used to more easily quantify the effects of accessory receptor ligands on CAR-T cell antigen sensitivity and CAR-T cell activation.

[0176] [Example 7] material and method Protein production Cells were grown in Expi293® expression medium (ThermoFisher Scientific, A1435101) on a 130 rpm shaking platform in a 37°C, 8% CO2 incubator. Cells were passaged every 2-3 days, maintaining the suspension volume at all times below 33.3% of the total flask volume. Cell density was maintained at 0.5-3 million cells per ml. Cells were counted before transfection to ensure cell viability was above 95%, and the density was adjusted to 3.0 million cells per ml. For 100 ml of transfection, 320 μl of ExpiFectamine® 293 transfection reagent (ThermoFisher Scientific, A14524) was mixed with 6 ml of Opti-MEM (ThermoFisher Scientific, 31985062) for 5 minutes. During this incubation period, 100 μg of expression plasmid was mixed with 6 ml of Opti-MEM. The DNA was then mixed with ExpiFectamine® and incubated for 15 minutes before being added to the cell culture medium. One day after transfection, 600 μl of enhancer 1 and 6 ml of enhancer 2 were added to the culture flask. The culture medium was returned to a shaking incubator for 4–5 days to allow protein expression to occur.

[0177] Protein purification Cells were harvested by centrifugation, and the supernatant was collected and filtered through a 0.22 μm filter. Imidazole was added to a final concentration of 1 mM, and PMSF was added to a final concentration of 1 mM. 2 ml of Ni-NTA agarose (Qiagen, 30310) was added per 50 ml of supernatant, and the mixture was left overnight at 4°C on a rotating platform. The mixture was poured into a gravity flow column, and the Ni-NTA agarose was collected. The Ni-NTA agarose was washed three times with 10 ml of washing buffer (50 mM NaH2PO4, 300 mM NaCl, and 5 mM imidazole, pH 8). The proteins were eluted with 15 ml of elution buffer (50 mM NaH2PO4, 300 mM NaCl, and 250 mM imidazole, pH 8). Proteins were concentrated using a protein concentrator with a 10,000 molecular weight cutoff, and the buffer was replaced with size exclusion buffer (25 mM NaH2PO4 and 150 mM NaCl, pH 7.5). The proteins were concentrated to 500 μl and loaded onto a Superdex 200 10 / 300 GL (Cytiva, 17-5175-01) size exclusion column. Fractions corresponding to the desired peaks were pooled and frozen at -80°C. Samples from all observed peaks were analyzed by reduced SDS-PAGE gel.

[0178] For purified Spytag-CD19, the protein was stabilized using SUMO during production, and therefore SUMO was removed using an HRV 3C protease solution kit (Pierce®, 88946). To completely cleave the HRV site, HRV protease was added to the purified protein in a predetermined optimal ratio. The mixture was left to stand overnight to allow complete cleavage, and then 1 ml of glutathione agarose (Pierce®, 16100) was added and left for 4 hours to remove the protease. The solution was passed through a gravity flow column to collect the mixture of SUMO and the target protein. This was then added to 1 ml of Ni-NTA agarose (Qiagen, 30310) and left overnight on a rotating platform at 4°C. The mixture was poured through a gravity flow column to collect the Ni-NTA agarose. Ni-NTA agarose was washed once with 10 ml of washing buffer (50 mM NaH2PO4, 300 mM NaCl, and 5 mM imidazole, pH 8). The protein was eluted with 15 ml of elution buffer (50 mM NaH2PO4, 300 mM NaCl, and 250 mM imidazole, pH 8). The protein was concentrated using a protein concentrator with a 10,000 molecular weight cutoff, and the buffer was replaced with a size exclusion buffer (25 mM NaH2PO4 and 150 mM NaCl, pH 7.5). The resulting aliquots were then frozen at -80°C.

[0179] Generation of ICAM-1 knockout CHO-K1 cells The expression of the hamster surface molecule ICAM1 was eliminated in CHO-K1 cells (ATCC CCL-61) using CRISPR / Cas9 lipofection, followed by the introduction of a human CD52 hinged surface spycatcher via lentivirus. The cells were maintained in DMEM (Sigma Aldrich) supplemented with 10% FCS (Sigma Aldrich). Initially, 200,000 cells were seeded overnight into 6-well plates, followed by transfection with Lipofectamine CRISPRMAX Cas (Invitrogen), TrueCut Cas9 Protein v2 (Invitrogen), and ICAM1 exon 2 (Ig domain 1)-targeted TrueGuide sgRNA (Invitrogen, sequence: CCACAGTTCTCAAAGCACAG (SEQ ID NO: 76)) according to the manufacturer's U2OS protocol. Specifically, 125 μl of OptiMEM (Thermo Fisher), 6.25 μg (37.5 pmol) of Cas9, 3.75 μl of 10 μM sgRNA (37.5 pmol) in TE, and 2.5 μl of Lipofectamine Cas9 Plus were mixed in one tube. Separately, 125 μl of OptiMEM and 7.5 μl of Lipofectamine CRISPRMAX were mixed and incubated for 1 minute. Both tubes were combined and incubated at room temperature for 15 minutes. Finally, 50 μl of the solution was added per well of CHO cells. After one week, single clones were grown by limiting dilution.

[0180] Clones were screened using Sanger sequencing after genomic PCR. Specifically, gDNA from overgrown single-cell clones was isolated using the PureLink Genomic DNA Mini Kit (Invitrogen), amplified by PCR using forward primer AGGCATCAGATGGTGGCATTCT (SEQ ID NO: 77) and reverse primer GGTGTTTGGGGAGGGCAATACT (SEQ ID NO: 78), and subjected to Sanger sequencing. Clones showing genome editing were selected for further processing. Next, surface Spycatcher was introduced using high-MOI lentiviral transduction, followed by single-cell cloning using the limiting dilution method. The final selected clones showed high expression of surface Spycatcher and absence of ICAM1 on the cell surface, as determined by flow cytometry. Surface Spycatcher expression was evaluated by coupling purified Spytag-mClover and flow cytometry. Specifically, 100k cells were incubated in PBS with 10 μM Spytag-mClover in the dark at room temperature for 1 hour, washed with PBS, and captured on a flow cytometer. ICAM1 expression was tested using unpurified Y5-3F9 hybridoma supernatant. 100k cells were incubated in undiluted Y5 supernatant on ice in the dark for 30 minutes. The cells were washed with PBS and stained with 1:200 anti-mouse Alexa Fluor-488 secondary antibody on ice in the dark for 30 minutes. Finally, the cells were washed and captured on a flow cytometer.

[0181] Original human CD8 transduced with TCR or CAR + T cell production HEK 293 T cells were seeded in 6-well plates in DMEM supplemented with 10% FBS and 1% penicillin / streptomycin, and allowed to reach 60-80% confluence the following day. 5.8 Using X-tremeGENE HP (Roche), cells were transfected with 0.25 μg of pRSV-Rev (Addgene, #12253), 0.53 μg of pMDLg / pRRE (Addgene, #12251), 0.35 μg of pMD2.G (Addgene, #12259), and 0.8 μg of transfer plasmid. After 16 hours, the medium was replaced, and after another 24 hours, the supernatant was harvested by filtration through a 0.45 μg cellulose acetate filter. One million T cells were transduced using the supernatant from one well of the 6-well plate.

[0182] Human CD8 + T cells were isolated from leukocyte clones purchased from the National Health Service (UK) Blood and Transplantation Service. Isolation was performed using negative selection. In short, blood samples were isolated from Rosette-Sep Human CD8 cells. + The cells were incubated with an enrichment cocktail (Stemcell) at 150°C for 20 minutes. Subsequently, a 3.1-fold dilution was performed with PBS, and then the cells were overlaid on Ficoll Paque Plus (GE) in a ficoll-to-sample ratio of 0.8:1.0. The Ficoll-sample preparation was centrifuged at 1200°C for 20 minutes at room temperature. The buffy coat was collected, washed, and the isolated cells were counted. The cells were resuspended in complete RMPI (RPMI supplemented with 10% v / v FBS, 100 oz penicillin, and 100 oz streptomycin) with 50 U of IL-2 (PeproTech) and CD3 / CD28 human T-activator Dynabeads (Thermo Fisher) in a bead-to-cell ratio of 1:1. Isolated human CD8 + T cells were always cultured in 37% and 5% CO2.

[0183] Using lentiviruses encoding 1G4 TCR, Kymriah CAR, or Yescarta CAR, one culture medium was transduced the following day, following the procedure outlined in the section on lentiviral transduction. Two and four days after transduction, one culture medium was replaced, and IL-2 was added to a final concentration of 50 U. Dynabeads were magnetically removed five days after transduction. When using TCR, T cells were further cultured at a density of 1, with 50 U of IL-2 added every other day. When using CAR, T cells were further cultured at a density of 0.5, with 100 U of IL-2 added every other day. T cells were used 10–16 days after transduction.

[0184] Ligand binding to CHO-K1 cells 50,000 CHO cells were seeded into TC-coated 96-well flat-bottom plates and incubated overnight at 37°C in 10% CO2. Spytag ligand was diluted to the required concentration in complete DMEM (10% FCS, 1% penicillin / streptomycin). The existing medium was removed from the CHO cells, and 200 μl of the diluted ligand was added. The cells were incubated at 37°C in 10% CO2 for 40 minutes. The CHO cells were then washed twice with complete DMEM.

[0185] Ligand ligation to Nalm6 cells 30,000 Nalm6 cells were seeded into TC-coated 96-well round-bottom plates and incubated overnight at 37°C in 5% CO2. On the day of the experiment, the Nalm6 cells were transferred to TC-coated 96-well V-bottom plates and centrifuged at 520 g for 5 minutes. Spytag ligand was diluted to the required concentration in complete RPMI (10% FCS, 1% penicillin / streptomycin). The existing medium was removed from the Nalm6 cells, and 200 μl of the diluted ligand was added. The cells were incubated at 37°C in 5% CO2 for 40 minutes. The Nalm6 cells were then washed twice with complete RPMI.

[0186] Co-culture assay using T cells transduced with TCR or CAR For the stimulation experiment, T cells transduced with TCR or CAR were counted and washed once with complete RPMI. 50,000 T cells in 200 μl of complete RPMI were added to ligand-linked CHO cells or ligand-linked Nalm6 cells in a 96-well flat-bottom plate, and then transferred to a 96-well round-bottom plate. The cells were centrifuged at 50 g for 1 minute to confirm that the T cells settled at the bottom of the plate and came into contact with the adherent CHO cells. The cells were then incubated at 37°C in 5% CO2 for 6 hours.

[0187] Flow cytometry - Ligand detection Immediately after ligand ligation and subsequent washing, 10 mM EDTA was added to the CHO cells to detach them. The cells were transferred to a V-bottom plate and centrifuged at 500 g, 4°C for 5 minutes. The cells were washed once with PBS-BSA 1% for 5 minutes at 500 g, 4°C.

[0188] To detect the ligand, a fluorescently conjugated antibody against the target protein was diluted 200-fold with PBS-BSA (1%) and added to CHO cells in a volume of 50 μl. The cells were resuspended and incubated in the dark at 4°C for 20 minutes. The cells were washed twice with PBS, resuspended in 75 μl of PBS, and then subjected to flow cytometry.

[0189] Flow cytometry - Detection of T cell activation At the end of the stimulation assay, the supernatant was carefully removed and saved for ELISA analysis. T cells and CHO cells were then detached by adding 10 mM EDTA in PBS. The cells were then aspirated and transferred to a V-bottom plate, and washed once with 200 μl of 1% BSA PBS (500 g, 4°C, 5 min). Antibodies against T cell activation markers were diluted 200-fold with 1% BSA PBS. T cells were selectively stained with anti-CD45 antibody to distinguish them from CHO cells during flow cytometry analysis. To detect TCR / CAR expression, a fluorescently conjugated peptide-MHC tetramer was added to the staining antibody at a 1000-fold dilution. A viability dye was also added at a 2500-fold dilution to distinguish viable cells from dead cells. 50 μl of this staining solution was added to the cells, and the cells were incubated in the dark at 4°C for 20 minutes. The cells were washed twice with PBS, resuspended in 75 μl of PBS, and then subjected to flow cytometry. Flow cytometry data was analyzed using FlowJo (BD Biosciences).

[0190] Cytokine levels ELISA: An IL-2 human uncoated ELISA kit, a TNF-α human uncoated ELISA kit, or an IFN-γ human uncoated ELISA kit, along with a Nunc MaxiSorp 96-well plate, was used according to the manufacturer's instructions. The supernatant from the stimulation assay was diluted 15-fold for ELISA. Absorbance at 450 nm and 570 nm was measured using a SpectraMax M5 plate reader (Molecular Devices).

[0191] Antibodies for flow cytometry (all from BioLegend): CD58-Clone: ​​TS2 / 9, Fluorophor: APC, Catalog: 330918 ICAM-1 clone: ​​HCD54, Fluorophore: AF647, Catalog: 353114 CD86-Fluorophore: FITC, Catalog: 374203 CD80-Clone: ​​2D10, Fluorophor: BV421, Catalog: 305221 HLA-A2 clone: ​​BB7.2, Fluorophor: PE, Catalog: 343306 CD69-Clone: ​​FN50, Fluorophor: AF488, Catalog: 310916 4-1BB-Clone: ​​4B4-1, Fluorophor: AF647, Catalog: 309824 CD45-Clone: ​​HI30, Fluorophor: BV510, Catalog: 304036 Zombie NIR Fixable Viability Kit - Catalog: 423105

[0192] [Example 8] The effect of reducing the length of the extracellular hinge of surface spycatchers on the ability of T cells to recognize linked spytag-pMHC antigens. cell U87 glioblastoma cells with B2M knockout were transduced with the specified surface spycatchers (FL, Delta 8, Delta 15, hCD58-spycatcher). E6.1 Jurkat T cells were transduced with CD8a and 1G4 TCRs.

[0193] Co-culture of Jurkat T cells and U87 target cells 50,000 U87 cells per well were seeded into a TC-coated 96-well flat-bottom plate and incubated overnight at 37°C in 5% CO2. On the day of the experiment, Spytag-pMHC(9V) ligand was diluted to the required concentration in complete DMEM (10% FCS, 1% penicillin-streptomycin). The existing medium was removed from the U87 cells, and the diluted ligand was added at a volume of 60 μl per well. The cells were incubated at 37°C in 5% CO2 for 40 minutes. The U87 cells were then washed once with 200 μL of DMEM.

[0194] Next, Jurkat T cells were counted and resuspended in complete RPMI (10% FCS, 1% penicillin-streptomycin). 50,000 T cells in 200 μL of RPMI were added to each well of a 96-well flat-bottom plate of U87 cells. The co-culture was centrifuged at 50 g for 5 minutes to settle the T cells to the bottom of the plate and into contact with the adherent U87 cells. The co-culture was incubated at 37°C and 5% CO2 for 4 hours.

[0195] Detection of T cell activation by flow cytometry After 4 hours, the supernatant was removed and 10 mM EDTA in PBS was added to detach the T cells and U87 cells. The cells were then transferred to a 96-well V-bottom plate and centrifuged at 500 g for 5 minutes. The supernatant was discarded, and the cells were resuspended in PBS 1% BSA staining solution containing 200-fold dilutions of anti-CD45 and anti-CD69 antibodies. The anti-CD45 antibody was used to distinguish T cells from U87 cells, and the anti-CD69 antibody functioned as a marker of T cell activation. The cells were incubated in the dark at 4°C for 40 minutes. The cells were then washed with 125 μL of PBS, resuspended in 70 μL of PBS, and subjected to flow cytometry. Data analysis was performed using FlowJo (BD Biosciences).

[0196] result The results of this experiment demonstrate the effect of reducing the stretch of amino acids connecting membrane-bound polypeptides to the membrane portion in a system designed to measure the interaction between peptide-MHC complexes and T cell receptors. Removing the 8-amino acid linker sequence found in the FL construct (full length, SEQ ID NO: 3) yields the Delta-8 construct (SEQ ID NO: 79). The Delta-8 construct, as measured by CD69 surface expression, results in increased T cell activation compared to the FL construct (Figure 9). Further removal of everything except the GPI-fixed serine of the CD52 hinge found in the FL and Delta-8 constructs yields the Delta-15 construct (SEQ ID NO: 80). The Delta-15 construct, as measured by CD69 surface expression, results in increased T cell activation compared to the FL and Delta-8 constructs (Figure 9). While we do not wish to be bound by theory, it is thought that by removing the hinge and linker sequences, the pMHC molecule will be presented by glioblastoma cells at a distance from the cell membrane that is more comparable to the distance from the membrane of endogenous MHC molecules. Subsequently, other endogenous protein-protein interactions between glioblastoma cells and T cells may occur with greater strength than those in the hinge and / or linker constructs. This is because the pMHC-TCR interaction positions glioblastoma cells and T cells at an optimal distance for these other interactions to occur.

[0197] Sequence List Sequence ID 1 - Mouse CD80 hinge-containing membrane-bound polypeptide (IgK signal peptide (bold); SpyCatcher003 (underlined); linker (italic); mCD80 hinge (bold and underlined); mCD80™ domain (bold and italic); mCD80 cytoplasmic domain (underlined and italic)).

[0198] [ka] Sequence ID No. 2 - Membrane-bound conjugating polypeptide with short mouse CD80 hinge (IgK signal peptide (bold); SpyCatcher003 (underlined); linker (italic); mCD80 hinge (bold and underlined); mCD80™ domain (bold and italic); mCD80 cytoplasmic domain (underlined and italic)).

[0199] [ka] Sequence ID 3 - Membrane-bound polypeptide with human CD52 hinge (IgK signal peptide (bold); SpyCatcher003 (underlined); linker (italic); human CD52 hinge (bold and underlined)).

[0200] [ka] Sequence ID No. 4 - Mouse CD80 hinge-containing membrane-bound polypeptide (SpyCatcher003 (underlined); linker (italic); mCD80 hinge (bold and underlined); mCD80™ domain (bold and italic); mCD80 cytoplasmic domain (underlined and italic)).

[0201] [ka] Sequence ID 5 - Membrane-bound conjugating polypeptide with short mouse CD80 hinge (SpyCatcher003 (underlined); linker (italic); mCD80 hinge (bold and underlined); mCD80™ domain (bold and italic); mCD80 cytoplasmic domain (underlined and italic)).

[0202] [ka] Sequence ID 6 - Membrane-bound conjugate polypeptide with human CD52 hinge (SpyCatcher003 (underlined); linker (italic); human CD52 hinge (bold and underlined)).

[0203] [ka] Fusion polypeptide of sequence number 7-SpyTag003 (bold) and human ICAM-1 (underlined); His-tag (italic)

[0204] [ka] Fusion polypeptide of sequence number 8-CD58-SpyTag(bold)-HisTag(italic)

[0205] [ka] Fusion polypeptide of sequence number 9-CD80-SpyTag(bold)-HisTag(italic)

[0206] [ka] Fusion polypeptide of SEQ ID NO: 10-CD86-SpyTag(bold)-HisTag(italic)

[0207] [ka] Sequence ID 11-PD-L1-SpyTag(bold)-HisTag(italic) fusion polypeptide

[0208] [ka] Sequence ID 12-BCMA-SpyTag(bold)-HisTag(italic) fusion polypeptide

[0209] [ka] Sequence ID 13 - SUMO tag (underlined) - BCMA - SpyTag (bold) - HisTag (italicized) fusion polypeptide

[0210] [ka] * In this sequence and some of the other sequences described herein, SUMO is used as a chaperone for protein production. Before using the fusion polypeptide in experiments, the SUMO tag is biochemically cleaved. Fusion polypeptide of sequence number 14-CD19-SpyTag(bold)-HisTag(italic)

[0211] [ka] A fused polypeptide of sequence number 15 - SUMO tag (underlined) - CD19 - SpyTag (bold) - HisTag (italicized)

[0212] [ka] Fusion polypeptide of sequence number 16-CD22-SpyTag(bold)-HisTag(italic)

[0213] [ka] A fused polypeptide of sequence number 17 - SUMO tag (underlined) - CD22 - SpyTag (bold) - HisTag (italicized)

[0214] [ka] Sequence ID 18-HVEM-SpyTag(bold)-HisTag(italic) fusion polypeptide

[0215] [ka] Sequence ID 19-HLA-A2(heavy chain)-SpyTag(bold) fusion polypeptide

[0216] [ka] Sequence number 20 - SpyCatcher (also referred to as SpyCatcher001)

[0217]

Chem.

[0218]

Chem.

[0219]

Chem.

[0220]

Chem.

[0221]

Chem.

[0222]

Chem.

[0223]

Chem.

[0224]

Chem.

[0225] [ka] Sequence ID 56 - Exemplary Linker GSSGSGGS Sequence ID 57 - Mouse CD80™ Domain TLVLFGAGFGAVITVVVIVVII Sequence ID 58 - Human CD52 membrane binding moiety TSQTSSPSASSNISGGIFLFFVANAIIHLFCFS SEQ ID NO: 59 - Peptide Linker GGGS SEQ ID NO: 60 - Peptide Linker PGGS Sequence ID 61 - Peptide Linker PGGG SEQ ID NO: 62 - Peptide Linker RPPPPP Sequence ID 63 - Peptide Linker RPPPP Sequence ID 64 - Peptide Linker RPPG SEQ ID NO: 65 - Peptide Linker PPPP Sequence ID 66 - Peptide Linker RPPG Sequence ID 67 - Peptide Linker PPPPPPPPP SEQ ID NO: 68 - Peptide Linker PPPPPPPPPPPP SEQ ID NO: 69 - Peptide Linker RPPG SEQ ID NO: 70 - Peptide Linker SGSG Sequence ID 71 - Peptide Linker SGSGSG SEQ ID NO: 72 - Peptide Linker GSSGSGGS Sequence ID 73 - Peptide Linker SGSGSGSG SEQ ID NO: 74 - Peptide Linker SGSGSGSGSG SEQ ID NO: 75 - Peptide Linker SGSGSGSGSGSGSGSG Sequence ID 76-ICAM1 exon 2 (Ig domain 1) targeted TrueGuide sgRNA CCACAGTTCTCAAAGCACAG Sequence ID 77 - Forward Primer AGGCATCAGATGGTGGCATTCT Sequence ID 78 - Reverse Primer GGTGTTTGGGGAGGGCAATACT Sequence ID 79 - Human "Delta-8" CD52 hinged membrane-bound polypeptide (IgK signal peptide (bold); SpyCatcher003 (underlined); human CD52 hinge (bold and underlined)). The sequence "ASSNISGGIFLFFVANAIIHLFCFS" is a GPI anchor sequence and is removed in the mature protein. The sequence "TSQTSSPS" remains in the mature protein, and the C-terminal S is a GPI fixation site.

[0226] [ka] Sequence ID 80 - Human "Delta-15" CD52 hinged membrane-bound polypeptide (IgK signal peptide (bold); SpyCatcher003 (underlined); Human "Delta-15" CD52 hinge (bold and underlined)). The sequence "ASSNISGGIFLFFVANAIIHLFCFS" is a GPI anchor sequence and is removed in the mature protein. The sequence "S" remains in the mature protein and is a GPI fixation site.

[0227] [ka] Sequence ID 81 - Human "Delta 15" CD52 membrane binding region. The sequence "ASSNISGGIFLFFVANAIIHLFCFS" is a GPI anchor sequence and is removed in mature proteins. The sequence "S" remains in mature proteins and is a GPI fixation site. SASSNISGGIFLFFVANAIIHLFCFS Sequence ID 82 - GPI anchor sequence derived from human CD52. ASSNISGGIFLFFVANAIIHLFCFS Sequence ID 83 - Mature membrane-bound polypeptide with human CD52 hinge (SpyCatcher003 (underlined); linker (italic); human CD52 hinge (bold and underlined)).

[0228] [ka] Sequence ID 84 - Human "Delta-8" CD52 hinge-containing mature membrane-bound polypeptide (SpyCatcher003 (underlined); human CD52 hinge (bold and underlined)).

[0229] [ka] Sequence ID 85 - Human "Delta-15" CD52 hinge mature membrane-bound polypeptide (SpyCatcher003 (underlined); Human "Delta-15" CD52 hinge (bold and underlined)).

[0230] [ka]

Claims

1. A method for detecting the interaction between a target protein (POI) that can bind to cells and an analyte, (i) A step of contacting a cell containing a membrane-bound conjugate polypeptide with a fusion polypeptide containing a complementary conjugate polypeptide and the POI, wherein the complementary conjugate polypeptide can form a covalent bond with the membrane-bound conjugate polypeptide and the POI contains the extracellular domain of a naturally occurring membrane protein. (ii) The step of bringing the cells into contact with the analyte, and (iii) Step of detecting the interaction between the POI and the analyte. A method that includes this.

2. The method according to claim 1, further comprising the step of repeating steps (i) to (iii) once or more times, wherein the concentration of the fusion polypeptide is a predetermined different concentration in each iteration.

3. The method according to claim 1 or 2, wherein in step (i), the cells are in contact with two or more fusion polypeptides, and the POIs of each of the fusion polypeptides are different from each other.

4. The aforementioned analyte is, (a) Cells, for example, T cells or chimeric antigen receptor T cells (CAR-T cells), (b) Soluble molecules such as antibodies The method according to any one of the prior claims.

5. The method according to any one of the prior claims, wherein the membrane-bound binding polypeptide is directly bound to the membrane portion via a hinge.

6. The method according to claim 5, wherein the hinge comprises 30 or fewer amino acids, preferably 20 or fewer amino acids.

7. The method according to claim 5 or 6, wherein the hinge includes an array having at least 60% identity with any one of sequence numbers 36 to 38.

8. The method according to any one of the prior claims, wherein the membrane-bound conjugating polypeptide comprises a sequence having at least 80% sequence identity with any one of SEQ ID NOs: 20-22, 24, and 26-35, and optionally comprises a sequence having at least 80% sequence identity with any one of SEQ ID NOs: 20-22, 24, 26, and 27.

9. The method according to any one of the prior claims, wherein the complementary binding polypeptide comprises a sequence having at least 80% sequence identity with any one of SEQ ID NOs: 20-22, 24, and 26-35, and optionally the membrane-bound binding polypeptide comprises a sequence having at least 80% sequence identity with any one of SEQ ID NOs: 28-35.

10. The aforementioned fusion polypeptide is arranged in the order from the N-terminus to the C-terminus. (a) The POI, (b) Linker array (optional) (c) The complementary binding polypeptide A method according to any one of the prior claims, including

11. The method according to claim 10, wherein the N-terminus of the complementary binding polypeptide is at a height of 5 nm or less from the cell membrane.

12. The analyte is a cell containing a target that binds to the POI, (a) The intermembrane distance of the complex formed between the POI and its target is 19 nm or less, and optionally, the intermembrane distance of the complex formed between the POI on the first cell and its target on the second cell is 9 nm to 19 nm, and / or (b) The intermembrane distance of the complex formed between the POI and its target differs from the intermembrane distance of a naturally occurring membrane protein containing the POI and its target by 5 nm or less. The method according to any one of the prior claims.

13. (a) The membrane-bound polypeptide is SpyCatcher003 protein, and the complementary binding polypeptide is SpyTag003 protein, (b) The membrane-bound polypeptide is a SpyCatcher protein, and the complementary binding polypeptide is a SpyTag protein, (c) The membrane-bound polypeptide is SpyCatcher002 protein, and the complementary binding polypeptide is SpyTag002 protein, (d) The membrane-bound polypeptide is a SpyTag protein, and the complementary binding polypeptide is a KTag protein, (e) The membrane-bound polypeptide is a KTag protein, and the complementary binding polypeptide is a SpyTag protein, (f) The membrane-bound polypeptide is a SnoopCatcher protein, and the complementary binding polypeptide is a SnoopTag protein, (g) The membrane-bound polypeptide is DogTag protein, and the complementary binding polypeptide is SnoopTagJr protein, (h) The membrane-bound polypeptide is SnoopTagJr protein, and the complementary binding polypeptide is DogTag protein, (i) The membrane-bound polypeptide is a DogCatcher protein and the complementary binding polypeptide is a DogTag protein, or (j) The membrane-bound polypeptide is Pilin-C, and the complementary binding polypeptide is IsopepTag protein. The method according to any one of the prior claims.

14. The method according to any one of the prior claims, wherein the naturally occurring membrane protein is an MHC-peptide complex and / or accessory protein involved in the interaction between antigen-presenting cells and T cells.

15. A polypeptide comprising a membrane-bound polypeptide directly bound to a membrane portion via a hinge, The aforementioned membrane-bound binding polypeptide can form a covalent bond with a complementary binding polypeptide. A polypeptide wherein the hinge comprises 25 or fewer amino acids, and the membrane-bound conjugable polypeptide has at least 80% identity with any one of SEQ ID NOs. 20-22, 24, 26, and 27.

16. A nucleic acid encoding the polypeptide according to claim 15.

17. A cell comprising the polypeptide according to claim 15 and / or the nucleic acid according to claim 16.

18. (i) Immune effector cells such as T cells, (ii) Non-human cells The cell according to claim 17.

19. The cell according to claim 17 or 18, further comprising a fusion polypeptide containing a complementary binding polypeptide and a protein of interest (POI), wherein the complementary binding polypeptide is covalently bound to the membrane-bound binding polypeptide.

20. The aforementioned POI is (i) the extracellular domain of a naturally occurring membrane protein, or (ii) Antigen recognition domain The cell according to claim 19, comprising:

21. (i) Each cell in a population contains POI at the same concentration, and the concentration of POI differs from the concentration of POI in other cell populations, and / or (ii) Each cell contains two or more different POIs, each cell in a population contains the same combination of POIs, and each population contains different combinations of POIs, A plurality of populations of cells according to claim 19 or 20.

22. Cells expressing membrane-bound polypeptides, Each of the multiple fusion polypeptides contains a complementary binding polypeptide and a target protein (POI). A kit that includes, A kit wherein the complementary binding polypeptide can form a covalent bond with the membrane-bound binding polypeptide, and each of the different fusion polypeptides comprises different extracellular domains of one or more naturally occurring membrane proteins.

23. A method for preparing cells containing a target protein (POI), comprising the step of contacting cells containing a membrane-bound conjugate polypeptide with a fusion polypeptide containing a complementary conjugate polypeptide and the POI, wherein the complementary conjugate polypeptide can form a covalent bond with the membrane-bound conjugate polypeptide, and the POI contains the extracellular domain of a naturally occurring membrane protein.

24. The method of claim 23, comprising the step of contacting the cells with two or more different fusion polypeptides, wherein the POIs of each of the different fusion polypeptides are different from each other.

25. A method for preparing multiple populations of cells, wherein each population contains a target protein (POI) at predetermined different concentrations, and the method is (i) A step of contacting a first population of cells, each containing a membrane-bound conjugate polypeptide, with a fusion polypeptide containing a complementary conjugate polypeptide and the POI, wherein the complementary conjugate polypeptide can form a covalent bond with the membrane-bound conjugate polypeptide, and the POI contains the extracellular domain of a naturally occurring membrane protein, and (ii) A step of repeating step (i) using one or more further populations of cells, each containing the membrane-bound binding polypeptide, wherein the concentration of the fusion polypeptide is a predetermined different concentration in each iteration. A method that includes this.