A set of primers, composition of the reaction mixture, and method for detecting selected orthomyxoviruses.

A set of primers for RT-LAMP amplifies influenza A and B viruses with high sensitivity and specificity, enabling rapid, cost-effective point-of-care testing with real-time quantification and room-temperature storage, addressing the limitations of existing methods.

JP2026516338APending Publication Date: 2026-05-21GENOMTEC SA
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
GENOMTEC SA
Filing Date
2024-05-10
Publication Date
2026-05-21

AI Technical Summary

Technical Problem

Existing diagnostic methods for influenza virus infection, particularly those using real-time PCR, are costly, require specialized equipment, and are time-consuming, making them unsuitable for rapid point-of-care testing, and existing LAMP methods often lack sensitivity and specificity for both influenza A and B viruses, especially without considering the reverse transcription step and requiring separate amplification reactions.

Method used

A set of primers specifically designed for amplifying the seventh segment of influenza A virus and the eighth segment of influenza B virus using RT-LAMP, combined with fluorescent markers, allows for rapid and sensitive detection with a detection limit of 10 copies per reaction, enabling real-time quantification and storage at room temperature through lyophilization.

Benefits of technology

The method achieves rapid, sensitive, and specific detection of influenza A and B viruses within 21 minutes, suitable for point-of-care testing, with high sensitivity and the ability to quantify viral load, while maintaining diagnostic accuracy without the need for specialized equipment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026516338000007
    Figure 2026516338000007
  • Figure 2026516338000008
    Figure 2026516338000008
  • Figure 2026516338000009
    Figure 2026516338000009
Patent Text Reader

Abstract

The first subject of the present invention is a set of primers for amplifying the nucleotide sequence of the seventh segment of influenza A virus. The second subject of the present invention is a set of primers for amplifying the nucleotide sequence of the eighth segment of influenza B virus. The third subject of the present invention is a method for detecting influenza A virus and / or influenza B virus. Another subject of the present invention is a method for detecting infection caused by influenza A virus and / or influenza B virus. The fifth subject of the present invention is a kit for detecting infection caused by influenza A virus and / or influenza B virus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a set of primers for detecting a selected orthomyxovirus using a set of primers, and a set of primers for detecting a selected orthomyxovirus. The present invention is applicable to medical diagnosis.

Background Art

[0002] Influenza virus is the most well-known virus among the Orthomyxoviridae family. Orthomyxovirus belongs to group V viruses according to the Baltimore classification, and its genetic material is negative-polarity segmented single-stranded RNA (-ssRNA). This is a family of viruses that mainly infect vertebrates. The Orthomyxoviridae family includes seven types of viruses: influenza A virus, influenza B virus, influenza C virus, influenza D virus, isavirus, thogotovirus, and quarantavirus. Influenza A, B, and C viruses, which cause acute respiratory infections in vertebrates including humans, are the most pathogenic. Influenza A virus (mainly subtypes H1N1, H2N2, H3N2) infects not only human cells but also cells of other mammals and birds, and is the main cause of influenza pandemics that occur once every ten to fifteen years worldwide. These viruses are characterized by extremely high genetic variability. Influenza B virus mainly infects human cells and causes seasonal diseases and large-scale epidemics that recur every three to five years on average.

[0003] Influenza virus infection is primarily transmitted through droplets. The main symptoms of infection are fever, chills, headache, and muscle aches. The onset is rapid, and symptoms worsen quickly. Influenza is also accompanied by fatigue, disorientation, and general malaise. The main respiratory symptoms are sore throat, rhinitis, and dry cough. In children, nausea, vomiting, and diarrhea may occur. The course of influenza virus infection can range from mild to severe, and even fatal. According to the WHO (World Health Organization), approximately 5-10% of adults and 20-30% of children contract influenza each year. Hospitalization and death rates are increased in individuals with chronic illnesses, the elderly, and infants. Treatment and prevention of influenza virus infection using vaccination (especially with influenza A virus) is hampered by the high genetic variability of these viruses.

[0004] Given the life-threatening nature of influenza virus infection, rapid diagnosis and diagnostic methods characterized by high sensitivity and specificity are crucial.

[0005] One diagnostic method for detecting influenza virus is pathogen isolation, but this method is rarely used due to the long waiting time for results. Routine diagnosis of infection is based on serological confirmation of viral infection by confirming the presence of viral antigens or genetic material in a biological specimen taken from the patient, or by detecting elevated antibody levels in the patient's serum. The presence of influenza virus antigens or genetic material in clinical samples can be confirmed by specimen collection using nasopharyngeal swabs, nasopharyngeal lavage fluid, middle ear effusion, nasopharyngeal aspirates, or bronchial lavage fluid. The most commonly used methods for detecting viral antigens are based on immunofluorescence (IF) or enzyme-linked immunosorbent assay (ELISA). The method characterized by the highest specificity and sensitivity is the so-called NAAT method (nucleic acid amplification test), which detects RSV nucleic acid in biological material. The most commonly used test using NAAT technology is an assay based on real-time RT-PCR. Although a variety of tests using real-time PCR technology are available on the market, these methods remain relatively expensive despite intense competition. Furthermore, they require highly specialized personnel, expensive equipment, and isolation of genetic material from patient samples. Furthermore, this method is time-consuming because it requires heating and cooling cycles of the reaction mixture, and the equipment used consumes a relatively large amount of energy to perform the diagnostic process.

[0006] Isothermal methods, including LAMP (Loop-mediated isothermal amplification), are techniques that enable accelerated diagnostic processes and reduce the energy and reagent costs required for analysis. According to literature data, these methods exhibit higher sensitivity and specificity than the aforementioned real-time PCR techniques, and are significantly faster. The isothermal process does not require specialized equipment.

[0007] Due to its low equipment requirements, isothermal testing is an ideal diagnostic solution in primary care settings (point-of-care testing - POCT), and this test can be performed by a general practitioner or specialist when a patient visits a clinic. This solution enables rapid diagnostic testing (less than 15 minutes), allowing for targeted therapy selection at the initial consultation. This is especially important in the case of influenza virus infection, where the infection can progress rapidly and become life-threatening in a short time. Delays in diagnosing influenza virus infection not only increase the patient's risk of death but also increase the risk of developing serious complications. On the other hand, using lyophilized reagents eliminates the need to freeze the diagnostic reagents, allowing them to be stored at room temperature.

[0008] The LAMP method is disclosed, for example, in patent specifications WO0028082 and WO0224902. The majority of previously published patent applications describing the use of primers in the RT-LAMP method for influenza virus diagnosis relate to the identification of a single type or subtype of the virus, and few include the diagnosis of both type A and type B viruses. Examples of applications including the diagnosis of both types include KR20220040073A, US10907222B2, CN113136454A, or CN112195275A. The detection methods in the above patent applications (US10907222B2, CN113136454A) are not quantitative and rely on endpoint detection using an agarose gel or marker based on the color change of the reaction mixture during a positive amplification reaction. Furthermore, the above patent specifications (KR20220040073A, CN113136454A) do not include information regarding the sensitivity of the presented methods. In patent specification CN112195275A, the sensitivity of the method is determined without considering the reverse transcription step that underlies the detection of viral RNA, and furthermore, the detection of type A and type B viruses is performed by two separate amplification reactions. None of the described patent specifications include a freeze-drying process. [Overview of the project]

[0009] Therefore, there remains a need to provide a diagnostic method using a properly purified primer set for the diagnosis of influenza virus infection using the LAMP method, with extremely high sensitivity, intended for use in point-of-care testing. The use of fluorescent markers has enabled a remarkably low detection limit of 10 copies per reaction. Furthermore, the fluorescent dyes enable real-time detection of the reaction product, which significantly shortens the reaction time (≤21 minutes) and allows for quantitative measurement of the pathogen. [Modes for carrying out the invention]

[0010] The first subject of the present invention is a set of primers for amplifying the nucleotide sequence of the seventh segment of influenza A virus, A set of internal primers having the following nucleotide sequences a) and b) specific to a selected fragment of the seventh segment of influenza A virus, and a set of external primers having the following nucleotide sequences c) and d): a) At the 3' end, preferably by TTTT crosslinking, F1c 5'CTCAAGATCTGTGTTTTTCCCAGCA3' (nucleotide sequence of SEQ ID NO: 3) is linked to sequence F2 5'CCCCCTCAAAGCCGAGA3' (nucleotide sequence of SEQ ID NO: 4), b) At the 3' end, preferably by TTTT crosslinking, B1c 5'TCATGGAATGGCTAAAGACAAGAC3' (nucleotide sequence of SEQ ID NO: 5) is linked to sequence B2 5'GTGAGCGTGAACACAAACC3' (nucleotide sequence of SEQ ID NO: 6), c) F3 5'CTCTCTATCGTTCCATCAGG3' (nucleotide sequence of SEQ ID NO: 1) and d) B3 5'TACGCTGCAGTCCTCG3' (nucleotide sequence of SEQ ID NO: 2) This is a set of primers characterized by containing [a specific ingredient / feature].

[0011] In a preferred embodiment of the present invention, the primer set comprises a set of loop primer sequences comprising a nucleotide sequence contained in the seventh segment of influenza A virus or a nucleotide sequence complementary to the seventh segment of influenza A virus: LF 5'GACATCTTCAAGTCTCTGCGC3' (SEQ ID NO: 7) and LB 5'ATTCTGTCACCTCTGACTAAGGGGA3' (SEQ ID NO: 8).

[0012] A second subject of the present invention is a set of primers for amplifying the nucleotide sequence of the eighth segment of influenza B virus, comprising a set of internal primers having the following nucleotide sequences a) and b) specific to a selected fragment of the eighth segment of influenza B virus, and a set of external primers having the following nucleotide sequences c) and d): a) At the 3' end, preferably by TTTT crosslinking, F1c 5'CGAAGAGTGAGTTGAGGATCCG3' (nucleotide sequence of SEQ ID NO: 11) is linked to sequence F2 5'GCTACTGATGATCKKACAG3' (nucleotide sequence of SEQ ID NO: 12), b) At the 3' end, preferably by TTTT crosslinking, B1c 5'AAGCCAATTCGAGCAGCTGA3' (nucleotide sequence of SEQ ID NO: 13) is linked to sequence B2 5'ATCGGTGCTCTTGACCAA3' (nucleotide sequence of SEQ ID NO: 14), c) F3 5'GRCTTGTTGCTAAACTTGTT3' (nucleotide sequence of SEQ ID NO: 9) and d) B3 5'TTGTCTCCCTCTTCTGGT3' (nucleotide sequence of sequence number 10) This is a set of primers characterized by containing [a specific ingredient / feature].

[0013] In a preferred embodiment of the present invention, the primer set comprises a set of loop primer sequences comprising a nucleotide sequence contained in the eighth segment of influenza B virus or a nucleotide sequence complementary to the eighth segment of influenza B virus: LF 5'GGCCATCTTYTTCATCCTCCA3' (SEQ ID NO: 15) and LB 5'GCGGTGGGAGTCTTATCCC3' (SEQ ID NO: 16).

[0014] A third subject of the present invention is a method for detecting influenza A virus and influenza B virus, characterized in that a selected region of the nucleotide sequence of the influenza A virus genome (seventh segment fragment) and a selected region of the nucleotide sequence of the influenza B virus genome (eighth segment) are amplified using a mixture of primers defined in the first and second subjects of the present invention, and the amplification method is the RT-LAMP method.

[0015] In a preferred embodiment, amplification is performed with a temperature profile of 64°C for 40 minutes.

[0016] In a more preferred embodiment of the present invention, the endpoint reaction is carried out with an additional temperature profile: 80°C for 5 minutes, which is performed after the amplification step.

[0017] A fourth subject of the present invention is a method for detecting an infection caused by influenza A virus and / or influenza B virus, characterized in that it comprises a detection method as defined in the third subject of the present invention.

[0018] The fifth subject of the present invention is a kit for detecting infection caused by influenza A virus and / or influenza B virus, characterized in that it comprises a set of primers defined in the first and second subjects of the present invention.

[0019] In a preferred embodiment of the present invention, the infection detection kit comprises 5.0 μL of Universal WarmStart® LAMP 2X Master Mix (New England Biolabs).

[0020] In a more preferred embodiment of the present invention, the infection detection kit comprises individual amplification primers defined in the first and second subjects of the present invention, where, in the case of influenza A virus, the primers have the following concentrations: 0.15 μM F3, 0.15 μM B3, 1.20 μM FIP A, 1.20 μM BIP, 0.30 μM LF, 0.30 μM LB; in the case of influenza B virus, the following concentrations: 0.15 μM F3, 0.15 μM B3, 1.20 μM FIP, 1.20 μM BIP, 0.30 μM LF, 0.30 μM LB; 6% D-(+)-trehalose dihydrate; 1.25% mannitol; a fluorescent marker that interacts with double-stranded DNA - EvaGreen ≤ 1X (Biotium) or Fluorescent Dye (New England The solution comprises Biolabs) ≤ 1 μL or Syto-13 ≤ 16 μM (ThermoFisher Scientific) or SYTO-82 ≤ 16 μM (ThermoFisher Scientific) or another fluorescent dye that interacts with double-stranded DNA at a concentration that does not inhibit the amplification reaction.

[0021] The primer set of the present invention for detecting influenza A virus and influenza B virus, as well as the methods for detecting an infection caused by influenza A virus and / or influenza B virus and for detecting an amplification product, have the advantage that they can be used for point-of-care (POCT) medical diagnosis in the intended applications using a portable gene analysis device. By lyophilizing the reaction mixture of the present invention, it becomes possible to store the diagnostic kit at room temperature without degrading the diagnostic parameters of the test. And the use of a fluorescent dye for detecting the amplification product enhances the sensitivity of the method, enables the detection of 10 copies of influenza A virus per reaction and 10 copies of influenza B virus per reaction, and enables the measurement of the amount of virus in the test sample.

[0022] Exemplary embodiments of the present invention are shown in the drawings.

Brief Description of the Drawings

[0023] [Figure 1] FIG. 1 shows the sensitivity characteristics of the method. Specific signals were obtained when quantitative genomic RNA derived from influenza virus (H1N1) A / PR / 8 / 34 strain ATCC number: VR-95DQ™ was used at 10, 20, 50 copies / μL as a template, but no product was seen in the NTC. FIG. 1: Lane 1: Mass marker (Quick-Load® Purple 100bp DNA Ladder, New England Biolabs); Lane 2: 10 copies of template; Lane 3: 20 copies of template; Lane 4: 50 copies of template; Lane 5: NTC. [Figure 2]Figure 2 shows the sensitivity characteristics of the present method. When quantitative genomic RNA derived from Influenza A virus (H3N2) A / Wisconsin / 15 / 2009 strain ATCC number: VR-1882 DQ (trademark) was used as a template at 10, 20, and 50 copies / μL, specific signals were obtained, but no product was seen in the NTC. Figure 2: Lane 1: Mass marker (Quick-Load (registered trademark) Purple 100bp DNA Ladder, New England Biolabs); Lane 2: 10 copies of the template; Lane 3: 20 copies of the template; Lane 4: 50 copies of the template; Lane 5: NTC. [Figure 3] Figure 3 shows the sensitivity characteristics of the present method. When quantitative genomic RNA derived from Influenza B virus B / Wisconsin / 1 / 2010 BX-41A strain ATCC number: VR-1885 DQ (trademark) was used as a template at 10, 20, and 50 copies / μL, specific signals were obtained, but no product was seen in the NTC. Figure 3: Lane 1: Mass marker (Quick-Load (registered trademark) Purple 100bp DNA Ladder, New England Biolabs); Lane 2: 10 copies of the template; Lane 3: 20 copies of the template; Lane 4: 50 copies of the template; Lane 5: NTC. [Figure 4] Figure 4 shows the sensitivity of the method of the present invention measured by assaying serial dilution solutions of quantitative genomic RNA derived from Influenza A virus subtype H1N1 standard: Influenza virus (H1N1) A / PR / 8 / 34 strain ATCC number: VR-95 DQ (trademark) in the range of 10 - 50 copies per reaction, and the amplification of the product was measured in real time. The results of real-time detection are shown in Table 1, indicating the minimum time required to detect the fluorescence signal. [Figure 5]Figure 5 shows the sensitivity of the present invention, measured by assaying serial dilutions of quantitative genomic RNA derived from influenza A virus subtype H3N2 standard: influenza A virus (H3N2) A / Wisconsin / 15 / 2009 strain ATCC number: VR-1882DQ (trademark) in the range of 10 to 50 copies per reaction, with product amplification measured in real time. The real-time detection results are shown in Table 2, indicating the minimum time required to detect the fluorescence signal. [Figure 6] Figure 6 shows the sensitivity of the present invention, measured by assaying serial dilutions of quantitative genomic RNA from influenza B virus standard: influenza B virus B / Wisconsin / 1 / 2010 BX-41A strain ATCC number: VR-1885DQ™ in the range of 10–50 copies per reaction, with product amplification measured in real time. The real-time detection results are shown in Table 3, indicating the minimum time required to detect the fluorescence signal. [Figure 7] Figure 7 shows the specificity of the product obtained after detection of influenza A virus subtype H1N1. Specificity was measured using quantitative genomic RNA derived from the influenza virus (H1N1) A / PR / 8 / 34 strain ATCC number: VR-95DQ (trademark) standard, with a range of 10-50 copies per reaction, and the dissociation curve of the amplified product was determined by real-time fluorescence measurement. The target dissociation temperature (Tm) for the specific reaction product of influenza A virus subtype H1N1 was set in the range of 83.5-84.5°C. [Figure 8] Figure 8 shows the specificity of the product obtained after detection of influenza A virus subtype H3N2. Specificity was measured using quantitative genomic RNA derived from the influenza A virus (H3N2) A / Wisconsin / 15 / 2009 strain ATCC number: VR-1882DQ (trademark) standard, with a range of 10-50 copies per reaction, and the dissociation curve of the amplified product was determined by real-time fluorescence measurement. The target dissociation temperature (Tm) for the specific reaction product of influenza A virus subtype H3N2 was set at 85-86°C. [Figure 9]Figure 9 shows the specificity of the product obtained after detection of influenza B virus. Specificity was measured using quantitative genomic RNA derived from the influenza B virus B / Wisconsin / 1 / 2010 BX-41A strain ATCC number: VR-1885DQ (trademark) standard, with a range of 10 to 50 copies per reaction, and the dissociation curve of the amplified product was determined by real-time fluorescence measurement. The target dissociation temperature (Tm) for the specific reaction product of influenza B virus was set at 84 to 85°C. [Figure 10]Figure 10 illustrates the specificity of the present invention's method using a standard template for multiple pathogens potentially present as a natural physiological bacterial flora in the biological material under test, pathogens that may arise from co-infections, or pathogens that share similar genome sequences. Figure 10: Lane 1: Mass marker (Quick-Load® Purple 100bp DNA Ladder, NewEngland Biolabs); Lane 2 and 3: Mycoplasma genitalium; Lane 4 and 5: Klebsiella pneumoniae; Lane 6 and 7: Bordetella pertussis; Lane 8 and 9: Streptococcus pyogenes; Lane 10 and 11: Staphylococcus aureus (MRSA); Lane 12 and 13: Enterococcus faecalis; Lane 14 and 15: Enterococcus faecium; Lane 16 and 17: Pseudomonas aeruginosa; Lane 18 and 19: Moraxella catarrhalis catarrhalis); lanes 20 and 21: Acinetobacter baumannii; lanes 22 and 23: Listeria monocytogenes; lanes 24 and 25: Legionella pneumophila; lanes 26 and 27: Mycoplasma hominis; lanes 28 and 30: Haemophilus ducreyi; lane 29: Mass marker (Quick-Load® Purple 100bp DNA Ladder, New England Biolabs); lanes 31 and 32: Escherichia coli; lanes 33 and 34: Ureaplasma urealyticum; lanes 35 and 36: Campylobacter jejuni;Lanes 37 and 38: HPV 18; Lanes 39 and 40: Candida albicans; Lanes 41 and 42: Mycoplasma pneumoniae; Lanes 43 and 44: Influenza A virus (H3N2) A / Wisconsin / 15 / 2009 strain; Lanes 45 and 46: Influenza B virus B / Wisconsin / 1 / 2010 BX-41A strain; Lanes 47 and 48: NTC. [Figure 11]Figure 11 illustrates the specificity of the present invention's method using a standard template for multiple pathogens potentially present as a natural physiological bacterial flora in the biological material under test, pathogens that may arise from co-infections, or pathogens that share similar genome sequences. Figure 11: Lane 1: Mass marker (Quick-Load® Purple 100bp DNA Ladder, NewEngland Biolabs); Lanes 2 and 3: Chlamydophila pneumoniae; Lanes 4 and 5: Haemophilus influenzae; Lanes 6 and 7: Streptococcus pneumoniae; Lanes 8 and 9: Human (Homo sapiens); Lanes 10 and 11: SARS-CoV-2 Frankfurt 1; Lanes 12 and 13: SARS-CoV-2 Isolate Italy-INMI1; Lanes 14 and 15: Human coronavirus OC43; Lanes 16 and 17: SARS-CoV-2 Isolate Germany / BavPat1 / 2020; Lanes 18 and 19: SARS-CoV-2 derived from NR 52726 Human Coronavirus 229E; Lanes 20 and 21: SARS-CoV-2 Isolate USA-CA1 / 2020; lanes 22 and 23: SARS-CoV-2 Isolate New York-PV08410 / 2020; lanes 24 and 25: SARS-CoV-2 Isolate USA-IL1 / 2020; lanes 26 and 27: SARS-CoV-2 Isolate Chile / Santiago_op4d1 / 2020; lanes 28 and 29: Amplirun Respiratory Syncytial Virus (A subtype); lanes 30 and 32: Amplirun Respiratory Syncytial Virus (B subtype); lane 31: Mass marker (Quick-Load® Purple 100bp DNA Ladder, New England Biolabs); lanes 33 and 34: MERS coronavirus England-1 strain; lanes 35 and 36: SARS-CoV-2 B.1.1.7; Lanes 37 and 38: Staphylococcus aureus (MSSA); Lanes 39 and 40: HPV 16; Lanes 41 and 42: Influenza virus (H1N1) A / PR / 8 / 34 strain; Lanes 43 and 44: Influenza A virus (H3N2) A / Wisconsin / 15 / 2009 strain; Lanes 45 and 46: Influenza B virus B / Wisconsin / 1 / 2010 BX-41A strain; Lanes 47 and 48: NTC. [Figure 12]Part of Figure 12 illustrates the specificity of the present invention's method using standard templates for multiple pathogens potentially present as part of the natural physiological bacterial flora in the biological material under test, pathogens that may arise from co-infections, or pathogens that share similar genome sequences. Figure 12 shows the specificity of the primers for different strains of influenza A and B viruses. Figure 12: Lane 1: Mass marker (Quick-Load® Purple 100bp DNA Ladder, NewEngland Biolabs); Lane 2 and 3: Influenza B virus B / Texas / 06 / 2011 (BY); Lane 4 and 5: Influenza B virus B / Nevada / 03 / 2011 (BV); Lane 6 and 7: Influenza A virus A / California / 07 / 2009 (H1N1) egg culture strain; Lane 8 and 9: Influenza A virus A / Brisbane / 59 / 2007 (HA,NA) × A / PR / 8 / 34 (H1N1); Lane 10 and 11: Influenza B virus B / Nevada / 03 / 2011; Lane 12 and 13: Influenza A virus A / Uruguay / 716 / 2007 (H3N2); Lane 14 and 15: Influenza B virus B / Ohio / 01 / 2005(BV); Lanes 16 and 17: Influenza A virus A / Mississippi / 1 / 85(HA,NA)×A / PR / 8 / 34; Lanes 18 and 19: Influenza A virus A / Wisconsin / 67 / 2005×A / PR / 8 / 34; Lanes 20 and 21: Influenza A virus A / Guizhou / 54 / 89(HA,NA)×A / PR8 / 34(H3N2); Lanes 22 and 23: Influenza A virus A / Victoria / 3 / 75(HA,NA)×A / PR / 8 / 34; Lanes 24 and 25: Influenza A virus A / California / 07 / 2009(H1N1); Lanes 26 and 27: Influenza B virus B / Texas / 06 / 2011; Lanes 28 and 29: Influenza B virus B / Malaysia / 2506 / 2004; Lanes 30 and 32: Influenza B virus B / Hong Kong / 330 / 2001(BV);Lane 31: Mass marker (Quick-Load® Purple 100bp DNA Ladder, New England Biolabs); Lanes 33 and 34: SARS-CoV-2 Isolate USA-WI / 202; Lanes 35 and 36: 1st SARS-CoV-2 WHO international standard; Lanes 37 and 38: Zika virus; Lanes 39 and 40: Influenza virus (H1N1) A / PR / 8 / 34 strain; Lanes 41 and 42: Influenza A virus (H3N2) A / Wisconsin / 15 / 2009 strain; Lanes 43 and 44: Influenza B virus B / Wisconsin / 1 / 2010 BX-41A strain; Lanes 45 and 46: NTC. [Figure 13] Figure 13 shows the effectiveness of the method of the present invention, which was measured by assaying reactions using oligonucleotides defined in the first and second subjects of the present invention, in which LF oligonucleotides of influenza A virus and influenza B virus were selectively removed; reactions using quantitative genomic RNA derived from influenza A virus H1N1 subtype standard - influenza virus (H1N1) A / PR / 8 / 34 strain ATCC number: VR-95DQ™ per reaction; and reactions using quantitative genomic RNA derived from influenza B virus standard - influenza B virus B / Wisconsin / 1 / 2010 BX-41A strain ATCC number: VR-1885DQ™ per reaction, with product amplification measured in real time. [Figure 14]Figure 14 shows the effectiveness of the method of the present invention, which was measured by assaying reactions using oligonucleotides defined in the first and second subjects of the present invention, in which LB oligonucleotides of influenza A virus and influenza B virus were selectively removed; reactions using quantitative genomic RNA derived from influenza A virus H1N1 subtype standard - influenza virus (H1N1) A / PR / 8 / 34 strain ATCC number: VR-95DQ™ per reaction; and reactions using quantitative genomic RNA derived from influenza B virus standard - influenza B virus B / Wisconsin / 1 / 2010 BX-41A strain ATCC number: VR-1885DQ™ per reaction, with product amplification measured in real time. [Examples]

[0024] Example 1. Primer sequence The sequences and characteristics of the specific oligonucleotides used to detect the genetic material of influenza A and B viruses using RT-LAMP technology are shown below.

[0025] 1. The F3 oligonucleotide sequence of influenza A virus: 5'CTCTCTATCGTTCCATCAGG3' is identical to the sequence of the seventh segment (5'-3' chain) of influenza A virus.

[0026] 2. Influenza A virus B3 oligonucleotide sequence: 5'TACGCTGCAGTCCTCG3' is a complementary fragment (5'-3' chain) of the seventh segment of the influenza A virus, located 160 nucleotides from the 3' end of oligonucleotide 1.

[0027] 3. The oligonucleotide sequence of influenza A virus F2: 5'CCCCCTCAAAGCCGAGA3' is identical to the seventh segment fragment (5'-3' chain) of influenza A virus, which is immediately adjacent to the 3' end of oligonucleotide 1.

[0028] 4. Influenza A virus B2 oligonucleotide sequence: 5'GTGAGCGTGAACACAAACC3' is a complementary fragment (5'-3' chain) of the seventh segment of influenza A virus, located 128 nucleotides from the 3' end of oligonucleotide 1.

[0029] 5. The influenza A virus F1c oligonucleotide sequence: 5'CTCAAGATCTGTGTTTTTCCCAGCA3' is a complementary fragment (5'-3' chain) of the seventh segment of the influenza A virus, located 42 nucleotides from the 3' end of oligonucleotide 1.

[0030] 6. The oligonucleotide sequence of influenza A virus B1c: 5'TCATGGAATGGCTAAAGACAAGAC3' is identical to the fragment of the 7th segment (5'-3' chain) of influenza A virus, located 71 nucleotides from the 3' end of oligonucleotide 1.

[0031] The sequences of F1c and F2 oligonucleotides are preferably linked by TTTT crosslinks and used as FIP. The sequences of B1c and B2 oligonucleotides are preferably linked by TTTT crosslinks and used as BIP.

[0032] 7. Influenza A virus LF oligonucleotide sequence: 5'GACATCTTCAAGTCTCTGCGC3'.

[0033] 8. Influenza A virus LB oligonucleotide sequence: 5'ATTCTGTCACCTCTGACTAAGGGGA3'.

[0034] 9. The influenza B virus F3 oligonucleotide sequence: 5'GRCTTGTTGCTAAACTTGTT3' is a sequence similar to the fragment (5'-3' chain) of the eighth segment of the influenza B virus.

[0035] 10. Influenza B virus B3 oligonucleotide sequence: 5'TTGTCTCCCTCTTCTGGT3' is a complementary fragment (5'-3' chain) of the eighth segment of the influenza B virus, located 155 nucleotides from the 3' end of oligonucleotide 9.

[0036] 11. The oligonucleotide sequence of influenza B virus F2: 5'GCTACTGATGATCKKACAG3' is similar in sequence to the fragment of the 8th segment (5'-3' chain) of influenza B virus, which is immediately adjacent to the 3' end of oligonucleotide 9.

[0037] 12. Influenza B virus B2 oligonucleotide sequence: 5'ATCGGTGCTCTTGACCAA3' is a complementary fragment (5'-3' chain) of segment 8 of the influenza B virus, located 133 nucleotides from the 3' end of oligonucleotide 9.

[0038] 13. The influenza B virus F1c oligonucleotide sequence: 5'CGAAGAGTGAGTTGAGGATCCG3' is a complementary fragment (5'-3' chain) of the eighth segment of the influenza B virus, located 42 nucleotides from the 3' end of oligonucleotide 9.

[0039] 14. The B1c oligonucleotide sequence of influenza B virus: 5'AAGCCAATTCGAGCAGCTGA3' is identical to the fragment of the 8th segment (5'-3' chain) of influenza B virus, located 87 nucleotides from the 3' end of oligonucleotide 9.

[0040] The sequences of F1c and F2 oligonucleotides are preferably linked by TTTT crosslinks and used as FIP. The sequences of B1c and B2 oligonucleotides are preferably linked by TTTT crosslinks and used as BIP.

[0041] 15. Influenza B virus LF oligonucleotide sequence: 5'GGCCATCTTYTTCATCCTCCA3'.

[0042] 16. Influenza B virus LB oligonucleotide sequence: 5'GCGGTGGGAGTCTTATCCC3'.

[0043] Example 2. Composition of the reaction mixture A method for amplifying the seventh segment of influenza A virus and the eighth segment of influenza B virus using the oligonucleotides characterized in Example 1, together with RT-LAMP technology and the following reaction mixture composition: 5.0 μL Universal WarmStart® LAMP 2X Master Mix (New England Biolabs) 0.15μM F3 Influenza A virus / 0.15μM F3 Influenza B virus 0.15μM B3 Influenza A virus / 0.15μM B3 Influenza B virus 1.20 μM FIP influenza A virus / 1.20 μM FIP influenza B virus 1.20 μM BIP Influenza A virus / 1.20 μM BIP Influenza B virus 0.30 μM LF Influenza A virus / 0.30 μM LF Influenza B virus 0.30 μM LB Influenza A virus / 0.30 μM LB Influenza B virus D-(+)-Trehalose Dihydrate - 6% Mannitol -1.25% Fluorescent markers - EvaGreen (Biotium) ≤ 1X or Fluorescent dye 50X (New England Biolabs) ≤ 1 μL or Green Fluorescent Dye (Lucigen) ≤ 1 μL or Syto-13 ≤ 16 μM or SYTO-82 ≤ 16 μM or another fluorescent dye that interacts with double-stranded DNA at concentrations that inhibit amplification reactions. For influenza A virus, the RNA matrix per reaction is ≥ 10 copies; for influenza B virus, the RNA matrix per reaction is ≥ 10 copies. The total reaction volume was adjusted to 10 μL with water that did not contain DNase or RNase.

[0044] Example 3. Temperature Profile The oligonucleotides characterized in Example 1 were used with RT-LAMP technology, and the composition of the reaction mixture characterized in Example 2 and the following temperature profile: 1) 64℃, 40 minutes 2) Preferably, after the above steps, a further endpoint reaction at 80°C for 5 minutes. A method for amplifying fragments of the seventh segment of influenza A virus and fragments of the eighth segment of influenza B virus using together

[0045] Example 4. Detection Method A method for amplifying and detecting fragments of the seventh segment of influenza A virus and fragments of the eighth segment of influenza B virus using oligonucleotides characterized in Example 1 in conjunction with RT-LAMP technology, the reaction mixture composition characterized in Example 2, the temperature profile characterized in Example 3, and the detection method described below. The fluorescent dyes used were 0.5 μL of EvaGreen 20X at a concentration of 0.5 μL or ≤1X; GreenFluorescent Dye (Lucigen) at ≤16 μM; SYTO-13 and SYTO-82, respectively, added to the reaction mixture, and measurements were performed before the start of the reaction, in real time, and / or at the endpoint. The excitation wavelength was set to the same range as that of FAM dyes, namely 490-500 nm (optimal 494 nm) for EvaGreen, Fluorescent dye 50X (New England Biolabs), GreenFluorescent Dye (Lucigen), and SYTO-13 dyes; and 535 nm (optimal 541 nm) for SYTO-82 dye. The emission wavelength was set to 509-530 nm (optimal 518 nm) for EvaGreen, GreenFluorescent Dye (Lucigen), and SYTO-13 dyes; and 556 nm (optimal 560 nm) for SYTO-82 dye. For detection and change recording time, the process began 15 minutes after the start of the reaction for influenza A virus, influenza B virus, and negative control.

[0046] Example 5 Preparation and freeze-drying method of reagents for detecting fragments of the 7th segment of influenza A virus and fragments of the 8th segment of influenza B virus, using oligonucleotides characterized in Example 1 together with RT-LAMP technology, the reaction mixture composition characterized in Example 2, the temperature profile characterized in Example 3, and the detection method described in Example 4.

[0047] Example 6. Description of the freeze-drying process The reaction components were mixed according to the composition described in Example 2, which used EvaGreen dye (Biotium) ≤ 1X, excluding the template RNA, to a total volume of 10 μL. This mixture was transferred to a 0.2 mL tube and freeze-dried according to the following parameters.

[0048] The mixture in the test tube was pre-cooled to -80°C for 2 hours. Then, 5 -2 The freeze-drying process was carried out under mBar pressure at -25°C for 18 hours, followed by 3 hours and 30 minutes under the same pressure at 25°C.

[0049] Example 7. Sensitivity and specificity of the method The sensitivity and specificity of this method were determined by using the oligonucleotides characterized in Example 1 together with RT-LAMP technology, the reaction mixture composition characterized in Example 2, the temperature profile characterized in Example 3, and the detection method described in Example 4. The standards used were: influenza A virus (H1N1) A / PR / 8 / 34 strain, quantitative genomic RNA derived from ATCC number: VR-95DQ™; influenza A virus (H3N2) A / Wisconsin / 15 / 2009 strain, quantitative genomic RNA derived from ATCC number: VR-1882DQ™; and influenza B virus (B / Wisconsin / 1 / 2010) strain BX-41A. The quantitative genomic RNA derived from ATCC number: VR-1885DQ (trademark) was determined by assaying serial dilutions using 10 to 50 copies per reaction mixture. Product amplification was measured in real time (Figures 4, 5, and 6 (Real-time LAMP of serial dilutions)), and the dissociation temperature was recorded in the range of 83.5–84.5°C for influenza A virus H1N1 subtype (Figure 7), 85–86°C for influenza A virus H3N2 subtype (Figure 8), and 84–85°C for influenza B virus (Figure 9). The time required to detect the emitted fluorescence for each sample is shown in Table 1 for influenza A virus H1N1 subtype, Table 2 for influenza A virus H3N2 subtype, and Table 3 for influenza B virus.

[0050] The characteristic primers enable the detection of influenza A virus H1N1 and H3N2 subtypes by detecting fragments of the 7th segment with a minimum of 10 genome copies / reaction mixture, and enable the detection of influenza B virus by detecting fragments of the 8th segment with a minimum of 10 genome copies / reaction mixture.

[0051] The comprehensiveness of this method for various influenza A and B virus strains was determined by assaying standard templates of specific influenza A and B virus strains shown in Table 4 (Figure 12).

[0052] [Table 1]

[0053] [Table 2]

[0054] [Table 3]

[0055] [Table 4]

[0056] Example 8. Selectivity of the method against other pathogens The selectivity of the method for other pathogens was determined by assaying the reaction using standard templates for multiple pathogens potentially present as part of the natural physiological bacterial flora in the test biological material, pathogens that may result from co-infections, or pathogens that share similar genome sequences, along with the oligonucleotides characterized in Example 1, the reaction mixture composition characterized in Example 2, the temperature profile characterized in Example 3, and the detection method described in Example 4 (Figures 10, 11, 12). A list of pathogens for which specificity was determined is shown in Table 5.

[0057] [Table 5]

[0058] Example 9. Comprehensiveness of the Method Bioinformatics analysis has shown that a method for amplifying and detecting fragments of the seventh segment of influenza A virus, using the oligonucleotide characterized in Example 1 in conjunction with RT-LAMP technology, the reaction mixture composition characterized in Example 2, the temperature profile characterized in Example 3, and the detection method described in Example 4, enables the detection of influenza A virus subtypes shown in Table 6. This application is accompanied by a report generated using the publicly available influenza virus BLAST tool (Influenza Virus Resources of the National Center for Biotechnology Information (NCBI)).

[0059] [Table 6]

[0060] Example 10. Effectiveness of the method without loop primers. The effectiveness of the method excluding loop primers from the reaction mixture was determined by selectively removing LF oligonucleotides of influenza A and influenza B viruses or LB oligonucleotides of influenza A and influenza B viruses from the oligonucleotides characterized in Example 1, and using all loop oligonucleotides of both influenza A and influenza B viruses, i.e., LF and LB excluded, together with the RT-LAMP technology, the reaction mixture composition characterized in Example 2, the temperature profile characterized in Example 3, and the detection method described in Example 4. The reaction was assayed using quantitative genomic RNA from influenza A virus standard: influenza virus (H1N1) A / PR / 8 / 34 strain ATCC number: VR-95DQ™ and quantitative genomic RNA from influenza B virus standard: influenza B virus B / Wisconsin / 1 / 2010 BX-41A strain ATCC number: VR-1885DQ™ at a rate of 1000 copies per reaction mixture, and product acquisition was measured in real time.

[0061] Selective removal of LF oligonucleotides or LB oligonucleotides of influenza A and B viruses does not impair the effectiveness of this method (Figures 13 and 14).

[0062] The amplification method and oligonucleotides described in this patent specification are superior to real-time LAMP technology-based testing methods due to their significantly higher sensitivity and reduced analysis time.

[0063] Sequence List <110> Genomtec SA <120> A set of primers for detecting influenza A virus and influenza B virus, a method for detecting influenza A virus and influenza B virus using the primer set, and a kit for detecting influenza A virus and influenza B virus. <170> PatentIn version 3.5 <210> 1. Influenza A F3 <211> 20 <212> DNA <213> artificial <223> Primer <400> 1 F3 CTCTCTATCGTTCCATCAGG 20 <210> 2. Influenza A, B, and 3 <211> 16 <212> DNA <213> artificial <223> Primer <400> 2 B3 TACGCTGCAGTCCTCG 16 <210> 3. Influenza A F1c <211> twenty five <212> DNA <213> artificial <223> Primer <400> 3 F1c CTCAAGATCTGTGTTTTTCCCAGCA 25 <210> 4. Influenza A F2 <211> 17 <212> DNA <213> artificial <223> Primer <400> 4 F2 CCCCCTCAAAGCCGAGA 17 <210> 5. Influenza A, B, and C <211> twenty four <212> DNA <213> artificial <223> Primer <400> 5 B1c TCATGGAATGGCTAAAGACAAGAC 24 <210> Influenza A and B2 <211> 19 <212> DNA <213> artificial <223> Primer <400> 6 B2 GTGAGCGTGAACACAAACC 19 <210> 7. Influenza A LF <211> twenty one <212> DNA <213> artificial <223> Primer <400> 7 LF GACATCTTCAAGTCTCTGCGC 21 <210> 8. Influenza A LB <211> twenty five <212> DNA <213> artificial <223> Primer <400> 8 LB ATTCTGTCACCTCTGACTAAGGGGA 25 <170> PatentIn version 3.5 <210> 9. Influenza B F3 <211> 20 <212> DNA <213> artificial <223> Primer <400> 9 F3 GRCTTGTTGCTAAACTTGTT 20 <210> 10. Influenza B B3 <211> 18 <212> DNA <213> artificial <223> Primer <400> 10 B3 TTGTCTCCCTCTTCTGGT 18 <210> 11. Influenza B F1c: <211> twenty two <212> DNA <213> artificial <223> Primer <400> 11 F1c CGAAGAGTGAGTTGAGGATCCG 22 <210> 12. Influenza B F2 <211> 19 <212> DNA <213> artificial <223> Primer <400> 12 F2 GCTACTGATGATCKKACAG 19 <210> 13. Influenza B B1c <211> 20 <212> DNA <213> artificial <223> Primer <400> 13 B1c AAGCCAATTCGAGCAGCTGA 20 <210> 14. Influenza B (B2) <211> 18 <212> DNA <213> artificial <223> Primer <400> 14 B2 AticGGTGCTCTTGACCAA 18 <210> 15. Influenza B LF <211> twenty one <212> DNA <213> artificial <223> Primer <400> 15 LF GGCCATCTTYTTCATCCTCCA 21 <210> 16. Influenza B LB <211> 19 <212> DNA <213> artificial <223> Primer <400> 16 LB GCGGTGGGAGTCTTATCCC 19 <210> Influenza A Seg. 7 <211> 1027 <212> DNA <213> <223> segment <400> 17 <210> Influenza B Seg. 8 <211> 1063 <212> DNA <213> <223> segment <400> 18

Claims

1. A set of primers for amplifying the nucleotide sequence of the seventh segment of the influenza A virus, A set of internal primers having the following nucleotide sequences a) and b), and a set of external primers containing the following nucleotide sequences c) and d): a) At the 3' end, preferably by TTTT crosslinking, F1c 5'CTCAAGATCTGTGTTTTTCCCAGCCA3' (nucleotide sequence of SEQ ID NO: 3) is linked to sequence F2 5'CCCCCTCAAAAGCCAGA3' (nucleotide sequence of SEQ ID NO: 4), b) At the 3' end, preferably by TTTT crosslinking, B1c 5'TCATGGAAATGGGCTAAAAGAACAAAC3' (nucleotide sequence of SEQ ID NO: 5) is linked to sequence B2 5'GTGAGCGTGAACACAAACC3' (nucleotide sequence of SEQ ID NO: 6), c) F3 5'CTCTCTATCGTTCCATCAGG3' (nucleotide sequence of SEQ ID NO: 1) and d) B3 5'TAGCCTGCAGTCCTCG3' (nucleotide sequence of SEQ ID NO: 2) A set of primers characterized by containing the following:

2. A set of loop primer sequences comprising a nucleotide sequence contained in the seventh segment of influenza A virus or a nucleotide sequence complementary to the seventh segment of influenza A virus: LF 5'GACATCTTCCAAGTCCTGCGC3' (SEQ ID NO: 7) and LB 5'ATTCGTCAACCTCTGACTAAGGGGA3' (SEQ ID NO: 8), characterized by comprising the set of primers according to claim 1.

3. A set of primers for amplifying the nucleotide sequence of the eighth segment of influenza B virus, comprising a set of internal primers having the following nucleotide sequences a) and b), and a set of external primers having the following nucleotide sequences c) and d): a) At the 3' end, preferably by TTTT crosslinking, F1c 5'CGAAGAGTGAGTTGAGGATCCCG3' (nucleotide sequence of SEQ ID NO: 11) is linked to sequence F2 5'GCTACTGATATCKKACAG3' (nucleotide sequence of SEQ ID NO: 12), b) At the 3' end, preferably by TTTT crosslinking, B1c 5'AAGCCAATTCGAGCAGCTGA3' (nucleotide sequence of SEQ ID NO: 13) is linked to sequence B2 5'ATCGGTGCTCTTGAACCAA3' (nucleotide sequence of SEQ ID NO: 14), c) F3 5'GRCTTTGTGCTAAAACTTTGTT3' (nucleotide sequence of SEQ ID NO: 9) and d) B3 5'TTGTTCCCCCTCTCTTGT3' (nucleotide sequence of SEQ ID NO: 10) A set of primers characterized by containing the following:

4. The set of primers according to claim 3, characterized by comprising a set of loop primer sequences comprising a nucleotide sequence contained in the eighth segment of influenza B virus or a nucleotide sequence complementary to the eighth segment of influenza B virus: LF 5'GGCCATCTTYTTCATCCTCCA3' (SEQ ID NO: 15) and LB 5'GCGGTGGGAGTCTTATCCC3' (SEQ ID NO: 16).

5. A method for detecting influenza A virus and / or influenza B virus in a single reaction, characterized in that a selected region of the nucleotide sequence of a viral genome is amplified using a set of primers described in any one of claims 1, 2, 3, and 4, and the amplification method is the RT-LAMP method.

6. Amplification of temperature profile: -64°C, 40 minutes The method for detecting a virus according to claim 5, characterized in that it is carried out by [a specific method].

7. The method according to claim 5 or 6, characterized in that the endpoint reaction is carried out with an additional temperature profile: 80°C for 5 minutes.

8. A method for detecting influenza A virus infection and / or influenza B virus infection, characterized by comprising the detection method described in any one of claims 5 to 7.

9. A kit for detecting infection caused by influenza A virus and / or influenza B virus, comprising a set of primers according to any one of claims 1 to 4.

10. An infection detection kit according to any one of claims 5 to 9, characterized by comprising 5.0 μL of Universal WarmStart® LAMP 2X Master Mix (New England Biolabs).

11. An amplification primer according to any one of claims 1 to 4, wherein, in the case of influenza A virus, the primer has the following concentrations: 0.15 μM F3, 0.15 μM B3, 1.20 μM FIP A, 1.20 μM BIP, 0.30 μM LF, and 0.30 μM LB; and in the case of influenza B virus, it has the following concentrations: 0.15 μM F3, 0.15 μM B3, 1.20 μM FIP, 1.20 μM BIP, and 0.30 μM LF; 0.30 μM LB; 6% D-(+)-trehalose dihydrate; 1.25% mannitol; and a fluorescent marker that interacts with double-stranded DNA, EvaGreen ≤ 1X (Biotium) or Fluorescent Dye (New England). An infection detection kit according to any one of claims 5 to 9, characterized by comprising Biolabs) ≤ 1 μL or Syto-13 ≤ 16 μM (ThermoFisher Scientific) or SYTO-82 ≤ 16 μM (ThermoFisher Scientific) or another fluorescent dye that interacts with double-stranded DNA at a concentration that does not inhibit the amplification reaction.