Genome editing methods and constructs

Abstract

The present invention relates to a gene editing system comprising: a) a donor nucleic acid comprising a degradation signal sequence, an enzyme cleavage site, a ribosome skip sequence, and an exogenous DNA sequence, wherein the donor nucleic acid is adjacent to the inverse targeting sequence at 5' and 3'; b) an oligonucleotide complementary to the targeting sequence; and c) a nuclease that recognizes the targeting sequence.

Description

[Technical Field]

[0001] The present invention relates to genome editing methods, and in particular, the present invention relates to - Degradation signal sequence, -enzyme cleavage site, - Ribosome skipping sequence, - Exogenous DNA sequence Regarding gene editing systems that include donor nucleic acids, The donor nucleic acid is adjacent to the inverse targeting sequence at 5' and 3'. The invention optionally includes an oligonucleotide complementary to the targeting sequence and / or a nuclease that recognizes the targeting sequence. The invention also refers to a method for incorporating an exogenous DNA sequence into the genome of a cell, comprising contacting the cell with a donor nucleic acid, an oligonucleotide complementary to the targeting sequence and a nuclease that recognizes the targeting sequence. The invention also relates to a vector comprising the donor nucleic acid and / or oligonucleotide complementary to the targeting sequence and / or nuclease, and its medical use. [Background technology]

[0002] Gene therapy using adeno-associated virus (AAV) vectors is highly promising for providing long-term expression of therapeutic inducers after a single dose. However, some of the significant challenges include counteracting gain-of-function mutations or dominant-negative effects that do not benefit from conventional gene replacement therapies. To overcome these limitations, genome editing has recently emerged as a viable option for treating dominantly inherited diseases, including retinal diseases (IRDs) (1). This approach relies on the use of nucleases found in bacterial systems, typically CRISPR / Cas9. Cas9 is a ribonucleoprotein that recognizes target DNA by Watson-Crick base complementarity using a short guide RNA sequence (gRNA). This target DNA sequence must be flanked by a protospacer flanking motif (PAM) sequence for Cas9 to bind to and cleave the DNA targeting sequence (2). This allows for the blocking of toxic protein production without affecting the correct copy of the gene. This approach is particularly useful for treating dominant types of IRDs, such as autosomal dominant retinitis pigmentosa (adRP) (3). Retinitis pigmentosa (RP) affects 1 in 3,000 people worldwide, with 30–40% of cases inheriting in an autosomal dominant (AD) pattern (4). The rhodopsin gene (RHO) is most commonly mutated in AD RP patients (RP4), with the P23H mutation being most common in the US (5). RHO P23H exerts toxic gain-of-function effects, ultimately leading to progressive retinal degeneration and vision loss. To overcome the toxic effects of misfolded RHO, it is necessary to disrupt the mutant P23H allele. Therefore, based on recently described homology-independent targeted integration (HITI) strategies (6,7) and microhomology-mediated end joining (MMEJ) strategies (15), we have developed a genome editing strategy targeting autosomal dominant retinitis pigmentosa caused by high-frequency P23H RHO (rhodopsin) mutations.In the HITI approach, the CRISPR / Cas9 system generates double-strand breaks (DBs) at specific sites of gene loci driven by specific gRNA sequences; the resulting DBs are primarily degraded by the cell's non-homologous end joining (NHEJ) repair pathway, which is a major repair mechanism in terminally differentiated cells such as photoreceptors and is generally active throughout the cell cycle. HITI utilizes the NHEJ pathway to integrate an exogenous sequence (HITI donor DNA adjacent to the inverted gRNA target site) into the specific gene locus in the DB. Upon integration of the donor DNA in the desired orientation, correct expression of the therapeutic gene will arise from the endogenous promoter.

[0003] Furthermore, HITI-mediated insertion of a wild-type copy of a therapeutic gene may be therapeutic regardless of the specific disease-causing mutation and can be used to treat dominantly inherited diseases by replacing at least the mutated allele with the correct copy of the gene provided by the donor DNA. This avoids the limitations on targeting sequences imposed by the allele specificity of the knockout and broadens the applicability of the treatment to all mutations within the same gene. We recently used HITI to obtain a targeted knockout of RHO regardless of mutation and then replaced it with a healthy copy of RHO at the mouse RHO locus (7).

[0004] Microhomology (MH)-mediated end joining (MMEJ) is an alternative NHEJ (A-NHEJ) that repairs DNA double-strand breaks (DBS) by annealing a 2-20 bp extension of a duplicated base adjacent to the DSB (15).

[0005] Previous approaches for incorporating exogenous DNA sequences into the cellular genome based on HITI are disclosed in International Publication No. 2020 / 079033, which is incorporated herein by reference.

[0006] However, there is still a need to improve HITI and MMEJ technologies. [Prior art documents] [Patent Documents]

[0007] [Patent Document 1] International Publication No. 2020 / 079033 [Overview of the project] [Problems that the invention aims to solve]

[0008] Here, the inventors have discovered a remarkably efficient HITI and MMEJ approach that enables the degradation of toxic proteins and the expression of wild-type proteins. These results demonstrate the efficacy of HITI and MMEJ as therapeutic strategies for AD RP caused by RHO mutations in a humanized mouse model (8), and therefore, they can be readily adapted to the human environment.

[0009] Therefore, we propose the HITI and MMEJ approaches as strategies for evaluating therapeutic potential, particularly at the human RHO locus.

[0010] We evaluated a novel HITI construct carrying a splice acceptor sequence for efficient splicing at a target site of the RHO locus (instead of a 3xSTOP codon), followed by a CL1 degradation signal (9,10) fused to an active frin cleavage site to enhance the degradation of the cleaved RHO protein (11). By including the CL1 degradation signal, selective degradation of the 5' cleaved protein is promoted without affecting the production of the full-length protein. CL1 is further fused to P2A, a ribosome skipping sequence that would aid in the translation of the RHO coding sequence. We then evaluated the HITI efficiency of this novel construct in cells and hRHO-P23H-TagRFP mice (8) and, surprisingly, found that levels of hRHO transcript were approximately twice as high in cells transfected with the optimized HITI donor compared to cells transfected with previous HITI donors, as known from the prior art. The gene editing system used in hRHO-P23H-TagRFP mice resulted in an improvement in HITI efficiency of up to 12±8% in the transduction region. The MMEJ construct contains the same elements of the optimized HITI donor DNA. Furthermore, it contains two different homologous arms: one adjacent to the 5' end of the splicing acceptor signal and the other adjacent to the 3' end of the polyA sequence of the donor DNA homologous to the target gene. In eyes, the inventors who injected AAV-HITI gRNA and AAV-MMEJ gRNA expression cassettes found significant improvements compared to eyes injected with AAV-scRNA, as determined by both ER and OCT analyses. [Means for solving the problem]

[0011] (Modes for carrying out the invention) Therefore, the object of the present invention is a) - Degradation signal sequence, -enzyme cleavage site, - Ribosome skipping sequence, - Exogenous DNA sequence A donor nucleic acid containing, When the donor nucleic acid is adjacent to the inverted targeting sequence at both the 5' and 3' ends, it is a donor nucleic acid. In some cases, b) an oligonucleotide complementary to the targeting sequence (also defined herein as a complementary oligonucleotide) and / or c) a nuclease that recognizes the targeting sequence, is a gene editing system.

[0012] The object of the present invention is also a) - a degradation signal sequence, - an enzyme cleavage site, - a ribosome skip sequence, - an exogenous DNA sequence is a donor nucleic acid comprising the donor nucleic acid is adjacent to the inverted targeting sequence at both the 5' and 3' ends, and b) an oligonucleotide complementary to the targeting sequence, and c) a nuclease that recognizes the targeting sequence, is a gene editing system.

[0013] In the context of the present invention, the donor nucleic acid preferably further comprises a splice acceptor sequence 5' to the degradation signal sequence.

[0014] Therefore, the present invention also a) - a splice acceptor sequence - a degradation signal sequence, - an enzyme cleavage site, - a ribosome skip sequence, - an exogenous DNA sequence is a donor nucleic acid comprising the donor nucleic acid is adjacent to the inverted targeting sequence at both the 5' and 3' ends, In some cases, b) an oligonucleotide complementary to the targeting sequence, and / or c) a nuclease that recognizes the targeting sequence, We provide gene editing systems that include [specific features / features].

[0015] The gene editing system of the present invention is preferably, a) - Splice acceptor array - Degradation signal sequence, -enzyme cleavage site, - Ribosome skipping sequence, - Exogenous DNA sequence A donor nucleic acid containing, The donor nucleic acid, at 5' and 3', is adjacent to the inverse targeting sequence, and b) Oligonucleotides complementary to the targeting sequence, c) A nuclease that recognizes the target sequence, Includes.

[0016] Preferably, the degradation signal sequence is CL1, CL2, CL6, CL9, CL10, CL11, CL12, CL15, CL16, SL17, SMN, CIITA, ODc7, ecDHFR, PEST, or Mini ecDHFR sequence.

[0017] Preferably, the degradation signal sequence is located at the C-terminus and / or destabilizes the endogenous sequence, making it the target of degradation. Preferably, the enzyme cleavage site is selected from the group consisting of furin cleavage sites, serine protease cleavage sites, cysteine ​​protease cleavage sites, aspartate protease cleavage sites, metalloprotease cleavage sites, and threonine protease cleavage sites, and / or is active and / or optimized.

[0018] Preferably, the enzyme cleavage site is an active and / or optimized fulin cleavage site.

[0019] Preferably, the ribosome skip sequence is a ribosome skip sequence derived from porcine tescovirus-1 2A (P2A), or a ribosome skip sequence derived from tosea adinavirus 2A (T2A), or an E2A or F2A sequence, preferably a P2A sequence.

[0020] Preferably, the splice acceptor sequence may include the nucleotide sequence (Y)nNYAG.

[0021] Preferably, the targeting sequence is a sequence contained in the rhodopsin (Rho) gene, and more preferably, the Rho gene represents one or more mutations, such as mutations that cause retinitis pigmentosa 4 (RP4 (RHO; OMIM:180380)) or retinitis pigmentosa 63 (RP63 (OMIM:614494)).

[0022] Alternatively, the target sequence is a sequence contained in CORD1 (cone-rod dystrophy 1 (OMIM:600624), CORD17 (cone-rod dystrophy 17 (see OMIM:615163)), BEST1 (Bestrophage-1; Best Disease; vitiligo macular dystrophy protein 2 (see OMIM:607854)), OPA1 (OPA1 mitochondrial dynamin-like GTPase; see OMIM:605290)), or any other gene that is mutated in an autosomal dominant state.

[0023] Preferably, the targeting sequence is contained within an intron or exon of the gene, preferably within the first intron or exon of the gene.

[0024] Preferably, the targeting sequence is - Preferably the first intron of the RHO gene derived from human, mouse, or pig, or - Preferably the first exon of the RHO gene derived from a human, mouse, or pig. Composed of within, If the targeting sequence is located within a gene exon, a splice acceptor sequence is not present.

[0025] Preferably, the exogenous DNA sequence includes the coding sequence of a therapeutic protein, such as rhodopsin (preferably one or more exons or fragments thereof), and more preferably one or more rhodopsin exons or fragments thereof.

[0026] Preferably, the targeting sequence is a guide RNA (gRNA) target site.

[0027] Preferably, the oligonucleotide complementary to the targeting sequence is a guide RNA that hybridizes to the targeting sequence of the gene or its complementary strand.

[0028] Therefore, the oligonucleotide induces the nuclease to cleave within the target sequence of the gene. Preferably, the guide RNA is adjacent to a protospacer fringe motif (PAM) sequence.

[0029] Preferably, the oligonucleotide complementary to the targeting sequence is under the control of a promoter, preferably a U6 promoter. Preferably, the inverted targeting sequence is an inverted sequence with respect to the targeting sequence and / or preferably contains a PAM sequence at its 3'.

[0030] Preferably, the donor nucleic acid is - Preferably a linker between the enzyme cleavage site and the ribosome skipping sequence; - Preferably a further ribosome skipping sequence localized to the 3' position of the exogenous DNA sequence; - Preferably a post-transcriptional regulatory element localized to the 3' end of an exogenous DNA sequence or a further ribosome skipping sequence; - A transcription termination sequence preferably localized to the 3' end of a post-transcriptional regulatory element or the 3' end of an exogenous DNA sequence or a further ribosome skipping sequence. It further includes one or more of the following: Preferably, the post-transcriptional regulator is a woodchuck hepatitis virus post-transcriptional regulator (WPRE), and / or the transcription termination sequence is a polyadenylation signal sequence, preferably bovine growth hormone polyA (BGH polyA), and / or the further ribosome skip sequence is T2A, P2A, E2A, F2A, preferably a T2A sequence.

[0031] In one embodiment, the donor nucleic acid further comprises at least one homologous arm, preferably two homologous arms. More preferably, - Preferably a first homologous arm localized at 5' of the splice acceptor array, - Preferably a second homologous arm localized at 3' of the transcription termination sequence, Includes.

[0032] Therefore, in one embodiment, the donor nucleic acid is in the 5'-3' order, - Inverse targeting sequence having a protospacer adjacent motif (PAM) sequence; - First homologous arm - Splice acceptor array - Degradation signal sequence, preferably CL1 sequence, - Enzyme cleavage site, preferably fulin cleavage site, - Ribosome skipping sequence, preferably P2A sequence, - Exogenous DNA sequence, preferably one or more rhodopsin exons, - Further ribosome skipping sequences, preferably T2A, - Further exogenous DNA sequences localized at the 3' end of ribosome skipping sequences; -Transcription termination sequence, - Second homologous arm and - Further inverted targeting sequences having the protospacer adjacent motif (PAM) sequence Includes.

[0033] As mentioned above, the donor DNA sequence has the same gRNA target sites recognized by the gRNA adjacent at 5' and 3', but they are inverted (e.g., inverted target sites or inverted targeting sequences).

[0034] In the present invention, the donor nucleic acid (or construct) is preferably: - Inverse targeting sequence having a protospacer adjacent motif (PAM) sequence; - Splice acceptor array - Degradation signal sequence, preferably CL1 sequence, - Enzyme cleavage site, preferably fulin cleavage site, - Ribosome skipping sequence, preferably P2A sequence, - Exogenous DNA sequence, preferably one or more rhodopsin exons, - Further ribosome skipping sequences, preferably T2A, -Transcription termination sequence, and - Further inverted targeting sequences having the protospacer adjacent motif (PAM) sequence Includes.

[0035] A linker may exist between the enzyme cleavage site and the ribosome skipping sequence.

[0036] Post-transcriptional regulatory elements may be located at 5' of the transcription termination sequence.

[0037] Preferably, the elements are in the order 5'-3' as listed, but other orders may be equally appropriate.

[0038] In a preferred embodiment, the donor nucleic acid is arranged in a 5'-3' order: - Degradation signal sequence, -enzyme cleavage site, - Ribosome skipping sequence, - Exogenous DNA sequence Includes, The donor nucleic acid is adjacent to the inverse targeting sequence at the 5' and 3' ends.

[0039] More preferably, it is in the order of 5'-3', - Inverse targeting sequence having a protospacer adjacent motif (PAM) sequence; - Splice acceptor array - Degradation signal sequence, preferably CL1 sequence, - Enzyme cleavage site, preferably fulin cleavage site, - Ribosome skipping sequence, preferably P2A sequence, - Exogenous DNA sequence, preferably one or more rhodopsin exons, - Further ribosome skipping sequences, preferably T2A, -Transcription termination sequence, and - Further inverted targeting sequences having the protospacer adjacent motif (PAM) sequence Includes.

[0040] Preferably, the ribosome skip sequence includes, or essentially contains, a sequence having at least 80% identity with SEQ ID NO: 1 (GCCACCAACTTCTCCCTGCTGAAGCAGGCCGGCGACGTGGAGGAGAACCCCGGCCCC) or SEQ ID NO: 2 (GGAAGCGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGACCT), or a sequence encoding SEQ ID NO: 3 (GSG)EGRGSLLTCGDVEENPGP, or a sequence encoding SEQ ID NO: 4 (GSG)ATNFSLLKQAGDVEENPGP, or a functional fragment thereof, and / or The inverse targeting sequence contains, or essentially contains, a sequence or functional fragment thereof that has at least 95% identity with sequence number 5 (ACACCAGGAGACTTGGAACG), and / or may contain the SpCas9 PAM sequence (CGG), and / or The guide RNA contains, or essentially contains, a sequence or functional fragment thereof that has at least 95% identity with SEQ ID NO: 5 (ACACCAGGAGACTTGGAACG), and / or Oligonucleotides complementary to the targeting sequence contain, or essentially possess, a sequence or functional fragment thereof that has at least 95% identity with SEQ ID NO: 5 (ACACCAGGAGACTTGGAACG), and / or The degradation signal sequence contains, or essentially contains, a sequence that is at least 95% identical to sequence number 6 (gcctgcaagaactggttcagcagcctgagccacttcgtgatccacctg), and / or The enzyme cleavage site contains, or essentially contains, a sequence that is at least 95% identical to sequence number 7 (CGAAAAAGAAGA), and / or The linker contains, or essentially contains, a sequence that is at least 95% identical to ggaagcgga, and / or The splice acceptor sequence contains, or essentially contains, a sequence that is at least 80% identical to sequence number 9 (GATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGGTGT), and / or The exogenous DNA sequence is the following sequence: Sequence ID No. 10 (ATGAATGGCACAGAAGGCCCTAACTTCTACGTGCCCTTCTCCAATGCGACGGGTGTGGTACGCAGCCCCTTCGAGTACCCACAGTACTACCTGGCTGAGCCATGGCAGTTCTCCATGCTGGCCGCCTACATGTTTCTGCTGATCGTGCTGGGCTTCCCCATCAACTTCCTCACGCTCTACG TCACCGTCCAGCACAAGAAGCTGCGCACGCCTCTCAACTACATCCTGCTCAACCTAGCCGTGGCTGACCTCTTCATGGTCCTAGGTGGCTTCACCAGCACCCTCTACACCTCTCTGCATGGATACTTCGTCTTCGGGCCCACAGGATGCAATTTGGAGGGCTTCTTTGCCACCCTGGGCG), Sequence ID 11 (GTGAAATTGCCCTGTGGTCCTTGGTGGTCCTGGCCATCGAGCGGTACGTGGTGGTGTGTAAGCCCATGAGCAACTTCCGCTTCGGGGAGAACCATGCCATCATGGGCGTTGCCTTCACCTGGGTCATGGCGCTGGCCTGCGCCGCACCCCCACTCGCCGGCTGGTCCAG); Sequence ID 12 (GTACATCCCCGAGGGCCTGCAGTGCTCGTGTGGAATCGACTACTACACGCTCAAGCCGGAGGTCAACAACGAGTCTTTTGTCATCTACATGTTCGTGGTCCACTTCACCATCCCCATGATTATCATCTTTTTCTGCTATGGGCAGCTCGTCTTCACCGTCAAGGAG); Sequence ID 13 (GCCGCTGCCCAGCAGCAGGAGTCAGCCACCACACAGAAGGCAGAGAAGGAGGTCACCCGCATGGTCATCATCATGGTCATCGCTTTCCTGATCTGCTGGGTGCCCTACGCCAGCGTGGCATTCTACATCTTCACCCACCAGGGCTCCAACTTCGGTCCCATCTTCATGACCATCCCAGCGTTCTTTGCCAAGAGCGCCGCCATCTACAACCCTGTCATCTATATCATGATGAACAAGCAG); Sequence ID 14 A sequence that has at least 80% identity with at least one of (TTCCGGAACTGCATGCTCACCACCATCTGCTGCGGCAAGAACCCACTGGGTGACGATGAGGCCTCTGCTACCGTGTCCAAGACGGAGACGAGCCAGGTGGCACCAGCA), and / or Woodchuck hepatitis virus post-transcriptional regulatory element (WPre) is identified in SEQ ID NO: 15 () contains, or essentially contains, a sequence having at least 80% identity with respect to (), and / or Bovine growth hormone polyadenylation signaling (BGH pA) is indicated by sequence number 16. (GCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGA) contains, or essentially contains, a sequence having at least 80% identity with (GCCTCGACTGTGCCTTCTAGTTGCCAGCCATCT The first and / or second homologous arm is sequence number 66 (ctccctgccgg) or sequence number 68

[0041] [Table 1] It contains, or essentially contains, a sequence that has at least 80%, at least 90%, or at least 95% identity with respect to.

[0042] Another object of the present invention is a gene editing system as defined above or herein, or a vector comprising a donor nucleic acid and / or oligonucleotide complementary to a targeting sequence, and / or a nuclease that recognizes a targeting sequence as defined above or herein.

[0043] Preferably, the vector is a viral vector, preferably selected from the group consisting of adeno-associated vectors (AAVs), adenovirus vectors, lentiviral vectors, integrase-deficient lentiviral vectors, retroviral vectors, or nonviral vectors, and preferably selected from polymer-based, particle-based, lipid-based, peptide-based delivery vehicles or combinations thereof, such as nanoparticles containing cationic polymers, micelles, liposomes, exosomes, microparticles, and lipid nanoparticles (LNPs).

[0044] Preferably, the vector further comprises a 5'-terminal repeat (5'-TR) nucleotide sequence and a 3'-terminal repeat (3'-TR) nucleotide sequence, wherein the 5'-TR is a 5'-inverted terminal repeat (5'-ITR) nucleotide sequence and the 3'-TR is a 3'-inverted terminal repeat (3'-ITR) nucleotide sequence.

[0045] Preferably, the ITRs are derived from the same or different viral serotypes. Preferably, the virus is AAV, preferably serotype 2 AAV.

[0046] A further object of the present invention is a host cell comprising a gene editing system or vector as defined herein or above.

[0047] Another object of the present invention is a viral particle comprising a gene editing system or vector as defined above or herein.

[0048] Preferably, the viral particles contain the capsid protein of AAV. Preferably, the viral particles contain the capsid protein of AAV of a serotype selected from one or more of the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and AAV10, preferably AAV2 or AAV8 serotype.

[0049] A further object of the present invention is a pharmaceutical composition comprising one of a gene editing system, a vector, a host cell, a viral particle as defined above or herein, and a pharmaceutically acceptable carrier.

[0050] Appropriately, a viral vector as defined herein includes a viral vector particle.

[0051] The term "viral particle" is intended to refer to the extracellular form of a non-pathogenic virus, particularly a viral vector, which consists of genetic material made from either DNA or RNA surrounded by an envelope containing viral glycoproteins, and which may originate from a protein coat called a capsid, sometimes from a part of the host cell membrane.

[0052] As used herein, viral vector also refers to viral vector particles.

[0053] The viral vectors included in this invention are suitable for gene therapy.

[0054] Preferably, the viral particles contain the AAV capsid protein.

[0055] Preferably, the viral particles contain the capsid protein of an AAV serotype selected from one or more of the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVSH19, AAVPHP.B, or derivatives thereof. Preferably, it is from the AAV2 or AAV8 serotype.

[0056] Another object of the present invention is a kit comprising one or more containers containing a gene editing system, vector, or host cell, or viral particle, or a pharmaceutical composition as defined herein, and optionally further comprising instructions or packaging material describing a method for administering the nucleic acid construct, vector, host cell, viral particle, or pharmaceutical composition to a patient.

[0057] A further object of the present invention is a gene editing system, or a vector, host cell, viral particle, or pharmaceutical composition, as defined above or herein, for use as a pharmaceutical, preferably for use in the treatment of hereditary diseases.

[0058] A further object of the present invention is a gene editing system, vector, host cell, viral particle, or pharmaceutical composition as defined above or herein, for use in the treatment of autosomal dominant inherited disorders in which at least one mutated allele is replaced with a correct copy of the gene provided by donor DNA, or for use in the treatment of hereditary and common diseases resulting from toxic acquisition, preferably including retinal dystrophy, where retinal dystrophy is preferably retinitis pigmentosa, cone dystrophy or cone-rod dystrophy, macular degeneration, e.g., Stargardt disease (ELOVL4), von Hippel-Lindau, retinoblastoma, RP4 (RHO;OM). The following are selected from the group consisting of neurological disorders, liver diseases, metabolic disorders, lipofuscinosis (such as Batten's disease), preferably autosomal dominant ocular disorders, e.g., retinal degeneration, preferably retinitis pigmentosa, neurological disorders, and liver diseases. In some embodiments, both the mutant allele and the wild-type allele are replaced with the correct copies of the gene provided by the donor DNA.

[0059] A further object of the present invention is a gene editing system, or vector, host cell, viral particle, or pharmaceutical composition as defined above or herein, for use in the treatment of a genetic disorder, or for use in the treatment of a recessive genetic disorder in which at least one allele is replaced with a correct copy of the gene provided by donor DNA, or for use in the treatment of genetic disorders and common diseases resulting from loss of function, preferably such disorder includes hemophilia, diabetes mellitus, lysosomal storage disorders including mucopolysaccharidosis (MPSI, MPSII, MPSIIIA, MPSIIIB, MPSIIIC, MPSIVA, MPSIVB, MPSVII), sphingolipidosis (Fabry disease, Gaucher disease, Niemann-Pick disease, GM1 gangliosides), lipofuscinosis (Batten disease, etc.), mucolipidosis, adenilosuccinate deficiency, hemophilia A and B, ALA dehydration deficiency, and adrenoleukodystrophy.

[0060] Another object of the present invention is a gene editing system, vector, or construct as defined above or herein for producing viral particles.

[0061] Preferably, the ribosome skip T2A sequence includes, or essentially contains, a sequence that has at least 80% identity with SEQ ID NO: 2 (GGAAGCGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGACCT) or a sequence that has at least 80% identity with the sequence encoding SEQ ID NO: 3 (GSG)EGRGSLLTCGDVEENPGP or a functional fragment thereof.

[0062] Preferably, the ribosome skip P2A sequence includes, or essentially contains, a sequence that has at least 80% identity to the sequence encoding SEQ ID NO: 1 (gccaccaacttctccctgctgaagcaggccggcgacgtggaggagaaccccggcccc) or SEQ ID NO: 4 (GSG)ATNFSLLKQAGDVEENPGP or a functional fragment thereof.

[0063] In a preferred embodiment, the oligonucleotide complementary to the targeting sequence may include, essentially have, or be encoded by having at least 95% identity with SEQ ID NO: 5 (ACACCAGGAGACTTGGAACG) or its functional fragment.

[0064] Preferably, the donor nucleic acid further comprises a polyadenylation signal, preferably bovine growth hormone polyA.

[0065] Preferably, the targeting sequence is a sequence contained in the rhodopsin (Rho) gene. Preferably, the targeting sequence is a sequence contained in the rhodopsin gene, and the exogenous DNA sequence (or donor DNA sequence) is the coding sequence for the rhodopsin protein.

[0066] Preferably, the targeting sequence is - Preferably the first exon of the RHO gene derived from a human, mouse, or pig. Composed of within, - Preferably the first intron of the RHO gene derived from a human, mouse, or pig, Or it is composed within its functional fragment.

[0067] Preferably, the targeting sequence is a guide RNA (gRNA) target site, and the oligonucleotide complementary to the targeting sequence is a guide RNA that hybridizes to the targeting sequence of the gene.

[0068] The guide RNA may contain, or may essentially contain, or may encode, a sequence having at least 95% identity with sequence number 5 (ACACCAGGAGACTTGGAACG) or its functional fragment.

[0069] The exogenous DNA sequence preferably includes a reporter gene, which is preferably selected from at least one of discosoma red (ds-RED), green fluorescent protein (GFP), red fluorescent protein (RFP), luciferase, β-galactosidase, and β-glucuronidase.

[0070] The nuclease is preferably selected from CRISPR nuclease, TALEN, DNA guide nuclease, meganuclease, and zinc finger nuclease, and preferably selected from the group consisting of Cas9, Cpf1, Cas12b(C2cl), Cas13a(C2c2), Cas3, Csf1, Cas13b(C2c6), and C2c3 or their variants, such as SaCas9 or VQR-Cas9-HF1.

[0071] The complementary oligonucleotide, the donor nucleic acid, and the polynucleotide encoding the nuclease are preferably contained in a viral vector or a non-viral vector, and the viral vector is preferably selected from adeno-associated viruses, lentiviruses, retroviruses, and adenoviruses.

[0072] Preferably, the cells are selected from the group consisting of one or more of the following: retinal cells, preferably retinal ganglion cells, bipolar cells, amacrine cells, retinal pigment epithelium, horizontal cells, rod cells and cone cells, preferably cells of the anterior region of the eye such as iris pigment epithelium, corneal epithelium and corneal fibroblasts, lymphocytes, monocytes, neutrophils, eosinophils, basophils, endothelial cells, epithelial cells, hepatocytes, liver cells, osteocytes, platelets, adipocytes, cardiomyocytes, neurons, smooth muscle cells, skeletal muscle cells, spermatids, oocytes and pancreatic cells, induced pluripotent stem cells (iPS cells), stem cells, hematopoietic stem cells, and hematopoietic primordial stem cells, and preferably the cells are retinal or hepatic cells of the target eye.

[0073] In a preferred embodiment, the donor nucleic acid and / or splice acceptor sequence and / or degradation signal sequence and / or enzymatic cleavage site and / or ribosome skip sequence and / or exogenous DNA sequence and / or targeting sequence and / or complementary oligonucleotide and / or nuclease are as defined above.

[0074] Preferably, the polynucleotide encoding complementary oligonucleotides and / or donor nucleic acids and / or nucleases is contained in one or more viral or nonviral vectors, and preferably the viral vector is selected from adeno-associated viruses, retroviruses, adenoviruses, and lentiviruses.

[0075] Preferably, the object of the present invention is the sequence referred to herein.

[0076] Regarding donor nucleic acids, they are generally intended to be nucleic acids containing exogenous sequences that must be integrated into the target genome.

[0077] However, it may also be intended to include oligonucleotides complementary to the targeting sequence.

[0078] In connection with the present invention, the donor DNA cassette element and / or gRNA expression cassette element and / or promoter sequence and / or U6 promoter for gRNA expression and / or gRNA and / or gRNA target site and / or Cas9 / Cas9-2a-GFP and / or therapeutic transgene and / or polyA and / or T2A and / or P2A and / or splice acceptor sequence and / or CL1 is the sequence shown in the following sequences 27, 30, 31, 32, 34, 62, 72 or 73 or the sequences disclosed herein.

[0079] Preferably, the first vector comprises a donor nucleic acid and an oligonucleotide complementary to the targeting sequence, and the second vector comprises a nucleic acid encoding a nuclease that recognizes the targeting sequence. Alternatively, the first vector comprises a donor nucleic acid, and the second vector comprises an oligonucleotide complementary to the targeting sequence and a nucleic acid encoding a nuclease that recognizes the targeting sequence. Further alternatives are provided: three vectors: a first vector comprising a donor nucleic acid, a second vector comprising an oligonucleotide complementary to the targeting sequence, and a third vector comprising a nucleic acid encoding a nuclease that recognizes the targeting sequence.

[0080] A further object of the present invention is a method for incorporating an exogenous DNA sequence into the genome of a cell (or a target nucleic acid sequence within the genome), preferably into the genome of a non-dividing cell, wherein the cell a) - Degradation signal sequence, -enzyme cleavage site, - Ribosome skipping sequence, - Exogenous DNA sequence This includes making contact with The donor nucleic acid is adjacent to the inverse targeting sequence at 5' and 3', and in some cases, b) Oligonucleotides complementary to the targeting sequence, and / or c) Nucleases that recognize the target sequence, That is the case.

[0081] Preferably, the donor nucleic acid further comprises a splice acceptor sequence at 5' of the degradation signal sequence.

[0082] Preferably, a method for incorporating an exogenous DNA sequence into a cell's genome (or a target nucleic acid sequence within the genome) involves the cell, a) - Splice acceptor array - Degradation signal sequence, -enzyme cleavage site, - Ribosome skipping sequence, - Exogenous DNA sequence A donor nucleic acid containing, The donor nucleic acid, at 5' and 3', is adjacent to the inverse targeting sequence, and b) Oligonucleotides complementary to the targeting sequence, c) A nuclease that recognizes the target sequence, This includes making contact.

[0083] Preferably, the donor nucleic acid and / or degradation signal sequence and / or enzymatic cleavage site and / or ribosome skipping signal and / or exogenous DNA sequence and / or targeting sequence and / or complementary oligonucleotide and / or nuclease are as defined above or herein.

[0084] A method for preparing viral vector particles, including introducing such DNA constructs into host cells to obtain viral vector particles, is also an object of the present invention.

[0085] In preferred embodiments, the donor nucleic acid and / or degradation signal sequence and / or enzymatic cleavage site and / or ribosome skipping signal and / or exogenous DNA sequence and / or targeting sequence and / or complementary oligonucleotide and / or nuclease are as defined above.

[0086] Preferably, a polynucleotide encoding a complementary oligonucleotide and / or donor nucleic acid and / or nuclease is contained in one or more viral or nonviral vectors, preferably the viral vector is selected from adeno-associated viruses, retroviruses, adenoviruses, and lentiviruses. Preferably the nonviral vector is selected from nonviral vectors, which include polymer-based, particle-based, lipid-based, peptide-based delivery vehicles or combinations thereof, such as cationic polymers, micelles, liposomes, exosomes, microparticles, and nanoparticles containing lipid nanoparticles (LNPs).

[0087] Preferably, the first vector comprises a donor nucleic acid and an oligonucleotide complementary to the targeting sequence, and the second vector comprises a nucleic acid encoding a nuclease that recognizes the targeting sequence. Alternatively, the first vector comprises a donor nucleic acid, and the second vector comprises an oligonucleotide complementary to the targeting sequence and a nucleic acid encoding a nuclease that recognizes the targeting sequence. Further alternatives are provided: three vectors: a first vector comprising a donor nucleic acid, a second vector comprising an oligonucleotide complementary to the targeting sequence, and a third vector comprising a nucleic acid encoding a nuclease that recognizes the targeting sequence.

[0088] Preferably, both the target sequence in the genome (also defined as the target sequence) and the target nucleic acid sequence are recognized by the nuclease.

[0089] In a preferred embodiment of the present invention, once the exogenous DNA sequence is incorporated into the genome of a cell (preferably a non-dividing cell) in the correct orientation, the target nucleic acid sequence in the genome is no longer present.

[0090] In preferred embodiments of the present invention, the method does not involve altering the genetic identity of the human germline.

[0091] Preferably, the exogenous DNA sequence includes a reporter gene, which is preferably selected from at least one of discosoma red, green fluorescent protein (GFP), red fluorescent protein (RFP), luciferase, β-galactosidase, and β-glucuronidase.

[0092] In the context of the present invention, a nuclease can be provided as a protein or as a nucleic acid encoding the nuclease. The nucleic acid may be DNA or RNA, and may be, for example, the mRNA of the nuclease, or the cDNA or DNA coding sequence of the nuclease, or a DNA construct encoding the nuclease. Preferably, the nucleic acid encoding the nuclease is a DNA construct comprising a nucleic acid encoding Cas9 or spCas9 under the control of a tissue-specific promoter. The construct may further contain poly(A), and conveniently short synthetic poly(A) (sh poly(A). All such elements are well known in the art and may have conventional nucleotide sequences.

[0093] Preferably, the nuclease is selected from CRISPR nucleases, TALENs, DNA guide nucleases, meganucleases, and zinc finger nucleases, and preferably, the nuclease is a CRISPR nuclease selected from the group consisting of: Cas9, Cpf1, Cas12b(C2cl), Cas13a(C2c2), Cas3, Csf1, Cas13b(C2c6), and C2c3 or their variants, for example, SaCas9 or VQR-Cas9-HF1.

[0094] Appropriately, the donor nucleic acid, the oligonucleotide complementary to the targeting sequence, and the nucleic acid encoding the nuclease are included in the DNA construct. Preferably, the first DNA construct includes the donor nucleic acid and the oligonucleotide complementary to the targeting sequence, and the second DNA construct includes the nucleic acid encoding the nuclease that recognizes the targeting sequence. Alternatively, the first DNA construct includes the donor nucleic acid, and the second DNA construct includes the oligonucleotide complementary to the targeting sequence and the nucleic acid encoding the nuclease that recognizes the targeting sequence. Further alternatives are provided: three constructs are provided: a first construct including the donor nucleic acid, a second construct including the oligonucleotide complementary to the targeting sequence, and a third construct including the nucleic acid encoding the nuclease that recognizes the targeting sequence.

[0095] The structure in question is also an object of this invention.

[0096] Preferably, one or more of the DNA constructs are contained in a vector, preferably a viral vector, more preferably a lentiviral vector, or an adeno-associated vector. Alternatively, all or part of the DNA constructs can be inserted into a non-viral vector, which is selected from polymer-based, particle-based, lipid-based, peptide-based delivery vehicles or combinations thereof, such as cationic polymers, micelles, liposomes, exosomes, microparticles, and nanoparticles containing lipid nanoparticles (LNPs).

[0097] The vector in question is also an objective of the present invention.

[0098] The complementary oligonucleotide, the donor nucleic acid, and the nucleic acid encoding the nuclease can be contained in one or more viral or nonviral vectors, preferably the viral vector being selected from adeno-associated viruses, lentiviruses, retroviruses, and adenoviruses. This means they may be in the same or different vectors.

[0099] The construct comprising the donor nucleic acid and complementary oligonucleotide may contain, or essentially contain, sequences having at least 80, at least 85, at least 90, or at least 95% identity with SEQ ID NO: 32, SEQ ID NO: 30, SEQ ID NO: 62, or SEQ ID NO: 72.

[0100] Preferably, the polynucleotide encoding the complementary oligonucleotide, donor nucleic acid, and nuclease is contained in a viral vector or a non-viral vector, and preferably the viral vector is selected from adeno-associated viruses, lentiviruses, retroviruses, and adenoviruses.

[0101] Another object of the present invention is cells that can be obtained by the methods defined above, preferably for medical use and / or for use in the treatment of genetic disorders, preferably for use in the treatment of autosomal dominant inherited disorders in which at least the mutant allele is replaced with the correct copy of the gene provided by the donor DNA, and preferably both the mutant allele and the wild-type allele are replaced with the correct copy of the gene provided by the donor DNA, or for use in the treatment of genetic and general diseases resulting from the acquisition of toxic function, preferably including retinal dystrophy, preferably retinal dystrophy is retinitis pigmentosa, cone dystrophy or cone-rod dystrophy, macular degeneration, e.g., Stargardt disease (ELOVL4) The following are selected from the group consisting of von Hippel-Lindau, retinoblastoma, RP4 (RHO; see OMIM:180380), RP63 (see OMIM:614494), CORD1 (cone-rod dystrophy 1; see OMIM:600624), CORD17 (cone-rod dystrophy 17; see OMIM:615163), BEST1 (Bestrophage-1; Best Disease; vitiligo macular dystrophy protein 2; see OMIM:607854), OPA1 (OPA1 mitochondrial dynamin-like GTPase; see OMIM:605290), neurological diseases, liver diseases, metabolic disorders, lipofuscinosis (such as Batten's disease), preferably autosomal dominant inherited eye conditions, such as retinal degeneration, preferably retinitis pigmentosa, neurological diseases and liver diseases, and metabolic diseases.

[0102] Another object of the present invention is cells that can be obtained by the methods defined above, for use in the treatment of hereditary diseases, or for use in the treatment of hereditary diseases and common diseases resulting from loss of function, wherein at least one allele is replaced with the correct copy of the gene provided by donor DNA, preferably the disease being hemophilia, diabetes mellitus, lysosomal storage disorders including mucopolysaccharidosis (MPSI, MPSII, MPSIIIA, MPSIIIB, MPSIIIC, MPSIVA, MPSIVB, MPSVII), sphingolipidosis (Fabry disease, Gaucher disease, Niemann-Pick disease, GM1 gangliosides), lipofuscinosis (Batten disease, etc.), mucolipidosis, adenilosuccinate deficiency, hemophilia A and B, ALA dehydration deficiency, and adrenoleukodystrophy.

[0103] Preferably, the cells are selected from the group consisting of one or more cells from the anterior region of the eye, such as retinal cells, preferably retinal ganglion cells, bipolar cells, amacrine cells, retinal pigment epithelium, horizontal cells, rod cells and cone cells, iris pigment epithelium, corneal epithelium, and corneal fibroblasts; lymphocytes, monocytes, neutrophils, eosinophils, basophils, endothelial cells, epithelial cells, hepatocytes, liver cells, osteocytes, platelets, adipocytes, cardiomyocytes, neurons, smooth muscle cells, skeletal muscle cells, spermatids, oocytes and pancreatic cells; induced pluripotent stem cells (iPS cells); stem cells; hematopoietic stem cells; and preferably, the cells are retinal or hepatic cells of the target eye.

[0104] A further object of the present invention is a (DNA) construct comprising an oligonucleotide complementary to a donor nucleic acid and / or a targeting sequence and / or a nucleic acid encoding a nuclease that recognizes the targeting sequence, as defined herein.

[0105] In the context of the present invention, the terms “oligonucleotide complementary to the targeting sequence” or “gRNA” may include an encoding DNA molecule. Therefore, sequences referred herein with respect to oligonucleotides or gRNAs complementary to the targeting sequence may be encoding sequences.

[0106] In one embodiment, the method of the present invention is in vitro and ex vivo. In one embodiment, in the method of the present invention, the cells are cells isolated from a subject or patient.

[0107] In an alternative embodiment, the method of the present invention is in vivo.

[0108] In one embodiment, the cells in the method of the present invention are cells isolated from a subject or patient.

[0109] Another object of the present invention is a composition preferably for medical use, preferably for treating diseases / conditions referred to herein, a) - Degradation signal sequence, -enzyme cleavage site, - Ribosome skipping sequence, - Exogenous DNA sequence A donor nucleic acid containing, The donor nucleic acid, in the 5' and 3' positions, is adjacent to the inverse targeting sequence, and may also be the donor nucleic acid, b) Oligonucleotides complementary to the targeting sequence, and / or c) Nucleases that recognize the target sequence, It is a crude product containing [unspecified material].

[0110] Preferably, the composition is a) - Degradation signal sequence, -enzyme cleavage site, - Ribosome skipping sequence, - Exogenous DNA sequence A donor nucleic acid containing, The donor nucleic acid, at 5' and 3', is adjacent to the inverse targeting sequence, and b) Oligonucleotides complementary to the targeting sequence, c) Nucleases that recognize the target sequence, Includes.

[0111] Preferably, the donor nucleic acid further comprises a splice acceptor sequence at 5' of the degradation signal sequence.

[0112] Therefore, preferably, the composition is a) - Splice acceptor array - Degradation signal sequence, -enzyme cleavage site, - Ribosome skipping sequence, - Exogenous DNA sequence A donor nucleic acid containing, The donor nucleic acid, at 5' and 3', is adjacent to the inverse targeting sequence, and b) Oligonucleotides complementary to the targeting sequence, c) Nucleases that recognize the target sequence, Includes.

[0113] Preferably, both the target sequence in the genome (also defined as the target sequence) and the target nucleic acid sequence are recognized by the nuclease.

[0114] In a preferred embodiment of the present invention, once the exogenous DNA sequence is incorporated into the genome of a cell (preferably a non-dividing cell) in the correct orientation, the target nucleic acid sequence in the genome is no longer present.

[0115] Preferably, the elements specified in the donor nucleic acid or vector or system are in the order of 5'-3' listed, but other orders may be equally appropriate.

[0116] In a preferred embodiment of the present invention, the cells are not human germline cells.

[0117] Preferably, the exogenous DNA sequence corrects mutations in the genome of a cell, preferably a non-dividing cell.

[0118] In the context of this invention, the inverted targeting sequence (or inverted gRNA site) is positioned upstream and downstream of the donor DNA, which is a DNA construct that is cleaved and then integrated into the target genome. The inverted targeting sequence is the exact same sequence recognized by the guide RNA at the target genome locus, i.e., the targeting sequence (e.g., rhodopsin), but inverted or reversed with respect to the genome sequence. This allows for obtaining a unidirectional integral.

[0119] Inversion or reversed orientation may mean that, if the targeting sequence has a specific 5'-3' sequence, the inverted targeting sequence has the same sequence but is oriented 3'-5'. Therefore, the inverted targeting sequence can be complementary to the guide RNA but inverted. This makes it possible to obtain a unidirectional integral, as known from the HITI method. In short, if the donor DNA is incorporated in the opposite direction, nucleases such as Cas9 can again recognize and cleave their target site. If incorporated in the correct orientation, the nuclease can no longer cleave the target site. Preferably, each of the inverted targeting sequences is ligated to a protospacer adjacent motif (PAM) sequence at its 3'.

[0120] The genes and / or exogenous DNA sequences and / or introns and / or exons disclosed herein may be of any origin, preferably human or mouse.

[0121] In this invention, the rhodopsin (Rho) sequence is preferably disclosed by the following accession numbers: human: AB065668.1, mouse: AC142099.3, pig: AEMK02000087.1.

[0122] In the present invention, the exogenous DNA sequence may contain at least one nucleotide difference compared to the genome. The exogenous DNA may not present mutations present in the gene targeted by the oligonucleotide or gRNA complementary to the targeting sequence.

[0123] In the present invention, guide RNA or gRNA can be used as a synonym for complementary oligonucleotide homologous to the target sequence or complementary oligonucleotide, and may also refer to the encoding DNA sequence or the corresponding DNA molecule.

[0124] In a preferred embodiment of the present invention, one vector comprising IRBP and Cas9 is used together with a second vector comprising donor DNA as defined above.

[0125] The donor DNA sequence preferably has the same gRNA target sites recognized by the gRNA adjacent at 3' and 5' but inverted (e.g., inverted target sites).

[0126] The cells obtained by this invention express exogenous sequences.

[0127] In the context of the present invention, the nuclease is preferably located in a different vector, particularly when an AAV vector is used.

[0128] Preferably, an AAV2 / 8 vector is used.

[0129] In the present invention, the first vector comprising Cas9 or spCas9 is preferably under the control of a tissue-specific promoter, such as a retina-specific or photoreceptor-specific promoter, such as an interphotoreceptor retinoid-binding protein (IRBP). The vector may further comprise a short synthetic poly(A) (sh poly(A)). Preferably, the second vector comprises a gRNA expression cassette and donor DNA as defined herein. Preferably, the rhodopsin-specific gRNA is under the U6 promoter. Preferably, the donor DNA is 3' and 5' adjacent to an inverted rhodopsin gRNA target site, preferably comprising PAM.

[0130] Preferably, the second vector described above may alternatively include an expression cassette for rhodopsin-specific gRNA and donor DNA containing the coding sequence for rhodopsin, as defined above.

[0131] In a preferred embodiment, the gene of interest and the enzymes required for NHEJ site-specific insertion are supported by two AAV vectors, and because the size of the elements required for the process is limited, a larger gene of interest can be used. The inventors have actually minimized the structural portion (for example, using the insertion site instead of homologous arms) that enables the insertion of longer cDNA into the vector.

[0132] In relation to the present invention, donor nucleic acids are inserted into the gene via non-homologous end joining.

[0133] The present invention also provides a pharmaceutical composition comprising a nucleic acid or nucleotide sequence or vector as defined above, and a pharmaceutically acceptable diluent and / or excipient and / or carrier.

[0134] Preferably, the composition further comprises a therapeutic agent, which is preferably selected from the group consisting of enzyme replacement therapy and small molecule therapy.

[0135] Preferably, the pharmaceutical composition is administered via a route selected from the group consisting of intracerebrospinal fluid (CSF), intrathecal cavity, parenteral, intravenous, intrafocal, intraperitoneal, intramuscular, intratumoral, subcutaneous, intraventricular, intracisional, lumbar, intracranial, intraspinal, intravenous, topical, nasal, oral, ocular, subretinal, or any combination thereof.

[0136] The present invention also provides vectors comprising the above-mentioned nucleic acids or nucleotide sequences for medical use, which are administered via routes selected from the group consisting of intracerebrospinal fluid (CSF), intrathecal, parenteral, intravenous, intrafocal, intraperitoneal, intramuscular, intratumoral, subcutaneous, intraventricular, intracisional, lumbar, intracranial, intraspinal, intravenous, topical, nasal, oral, ocular, subretinal, or any combination thereof. Preferably, the vectors of the present invention are administered via intravenous, parenteral, ocular, and preferably subretinal routes.

[0137] Preferably, the vector is a viral vector, and preferably the viral vector is a lentiviral vector, integrase-deficient lentiviral vector, adeno-associated virus vector, adenovirus vector, retrovirus vector, poliovirus vector, mouse Maloney-based viral vector, alphavirus vector, poxvirus vector, herpesvirus vector, vaccinia virus vector, baculovirus vector, or parvovirus vector, and preferably the adeno-associated virus is AAV2, AAV9, AAV1, AAVSH19, AAVPHP.B, AAV8, or AAV6. In the context of the present invention, the AAV2 / 8 vector is preferably used.

[0138] Preferably, the viral vector further comprises a 5'-terminal repeat (5'-TR) nucleotide sequence and a 3'-terminal repeat (3'-TR) nucleotide sequence, preferably the 5'-TR being a 5'-inverted terminal repeat (5'-ITR) nucleotide sequence and the 3'-TR being a 3'-inverted terminal repeat (3'-ITR) nucleotide sequence, preferably the ITRs being derived from the same or different viral serotypes, and preferably the virus is AAV, preferably serotype 2 AAV.

[0139] In one embodiment, the viral vector comprising a gRNA expression cassette and donor DNA further comprises, preferably, a 5' inverted end repeat (ITR) sequence of AAV, which is localized to the 5' end of the construct comprising the gRNA expression cassette and donor DNA, and preferably, a 3' inverted end repeat (ITR) sequence of AAV, which is localized to the 3' end of the construct comprising the gRNA expression cassette and donor DNA.

[0140] Preferably, the ITR contains or has a sequence that is at least 95% identical to sequence number 17 or 26.

[0141] Preferably, the nucleotide sequence is inserted into a vector, preferably a viral vector, and more preferably an adeno-associated vector.

[0142] Preferably, the viral vector comprising a gRNA expression cassette and donor DNA, or the viral vector of the present invention, -AAV 5' inverted terminal repeat (5'-ITR) sequence; - An inverse targeting sequence linked to the protospacer adjacent motif (PAM) sequence; - Splice acceptor array - Degradation signal sequence, -enzyme cleavage site, - Ribosome skipping sequence, preferably P2A, - Exogenous DNA sequence, preferably the coding sequence of the rhodopsin gene - Ribosome skipping sequence, preferably T2A, -Transcription termination sequence, - Further inverted targeting sequences linked to the protospacer adjacent motif (PAM) sequence; - Oligonucleotides complementary to the target sequence, under the control of a promoter, preferably a U6 promoter; - Chimeric gRNA skeleton, and -AAV 3' inverted terminal repeat (3'-ITR) sequence Includes.

[0143] In one embodiment, the U6 promoter is sequence number 70

[0144] [Table 2] It may contain or essentially possess at least 80% identity with it.

[0145] If the vector does not contain a gRNA expression cassette, the cassette is included in the vector containing the nucleic acid that expresses the nuclease.

[0146] The elements described above may be in the order defined above, from 5' to 3', but other orders are equally suitable, as those skilled in the art will understand. The vector may further include additional viral sequences, such as additional AAV sequences.

[0147] In this invention, “at least 80% identity” means that the sequence may have at least 80%, 85%, 90%, 95%, or 100% sequence identity with the sequence for which identity is mentioned. This applies to all identity percentages described. In this invention, “at least 95% identity” means that the sequence may have at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the sequence for which identity is mentioned. This applies to all identity percentages described. In this invention, “at least 98% identity” means that the sequence may have at least 98%, 99%, or 100% sequence identity with the sequence for which identity is mentioned. This applies to all identity percentages described. Preferably, the identity percentage is relative to the total length of the sequence for which it is mentioned.

[0148] Nucleic acid sequences derived from the nucleotide sequences referred to herein, such as functional fragments, variants, derivatives, analogs, and sequences having at least 80% identity with the sequences referred to herein, are also included in the present invention.

[0149] The coding sequences of the present invention can encode gene variants and may include additions, deletions, or substitutions with respect to the coding sequence of a wild-type gene, for example, as long as these protein variants retain substantially the same relevant functional activity as the original protein. The coding sequences can also encode protein fragments, as long as these fragments retain substantially the same relevant functional activity as the original protein. Preferably, the coding sequences can be codon-optimized for expression in humans.

[0150] The present invention also includes embodiments in which the sequences referred to herein, such as guide RNA (or gRNA sequences), gRNA sites, targeting sequences, inverse targeting sequences, or complementary oligonucleotides, are oriented in reverse, i.e., have a 3' to 5' position, or are complementary sequences (which may also be oriented in reverse or inverse complementary sequences), compared to the sequences referred to herein. Such gRNAs, gRNA sites, targeting sequences, inverse targeting sequences, or oligonucleotides are also subject to the present invention.

[0151] The present invention also includes isolated guide ribonucleic acid (gRNA) comprising or consisting of a sequence that is substantially complementary to or completely anneals to the sequence disclosed herein (in its 5'-3' or 3'-5' direction) and at least 15 nucleotides in length thereof.

[0152] In the present invention, the donor nucleic acid may preferably include a protein detection tag such as a 3XFLAG at the 5' of the degradation signal sequence.

[0153] In the context of the present invention, the fragment is preferably at least 15 nucleotides long.

[0154] Another object of the present invention is a method for treating a subject suffering from the above-mentioned disease, comprising administering an effective amount of the above-defined gene editing system or vector or host cells or viral particles or pharmaceutical composition to the subject. Preferably, the object of the present invention is a sequence as referred to herein. [Brief explanation of the drawing]

[0155] Herein, the present invention will be explained by non-limiting examples with reference to the following figures. [Figure 1] Homology-independent targeted integration platform. Schematic diagram of homology-independent targeted integration strategies at specific genomic loci of interest. Key components of HITI donor DNA are reported: SA = splice acceptor sequence; 3XFLAG = protein detection tag; CL1 = degradation signal for endogenous mutant proteins; Fu = optimized cleavage site of furin; GSG = linker peptide; P2A = ribosome skip sequence derived from porcine tescovirus-1 2A; T2A = ribosome skip sequence derived from Thosea Asigna virus 2A; eGFP = enhanced green fluorescent protein coding sequence; WPRE = post-translational regulatory element of woodchuck hepatitis virus; BGH polya = polyadenylation signal from bovine growth hormone; U6 = U6 expression cassette. [Figure 2-1] (ab) Inclusion of the CL1 peptide increases HITI efficiency in HEK 293 cells. Key components of Optm. HITI donors have been reported. SA = splice acceptor sequence; 3XFLAG = protein detection tag; CL1 = degradation signal for endogenous mutant rhodopsin; Fu = optimized cleavage site of furin; GSG = linker peptide; P2A = ribosome skip sequence derived from porcine tescovirus-1 2A; Rho = rhodopsin coding sequence; T2A = ribosome skip sequence derived from Thosea Asigna virus 2A; eGFP = enhanced green fluorescent protein coding sequence; WPRE = woodchuck hepatitis virus posttranslational regulator; BGH polya = polyadenylation signal from bovine growth hormone; U6 = human U6 promoter. (c) Relative levels of RHO transcript in cells transfected with Optm. HITI donors (IRES / Kozak) compared to three tandem stop codons (3xSTOP). Error bars indicate the standard error of the mean. Significance was assessed using Student's t-test (p<0, 05). [Figure 2-2](ab) Inclusion of the CL1 peptide increases HITI efficiency in HEK 293 cells. Key components of Optm. HITI donors have been reported. SA = splice acceptor sequence; 3XFLAG = protein detection tag; CL1 = degradation signal for endogenous mutant rhodopsin; Fu = optimized cleavage site of furin; GSG = linker peptide; P2A = ribosome skip sequence derived from porcine tescovirus-1 2A; Rho = rhodopsin coding sequence; T2A = ribosome skip sequence derived from Thosea Asigna virus 2A; eGFP = enhanced green fluorescent protein coding sequence; WPRE = woodchuck hepatitis virus posttranslational regulator; BGH polya = polyadenylation signal from bovine growth hormone; U6 = human U6 promoter. (c) Relative levels of RHO transcript in cells transfected with Optm. HITI donors (IRES / Kozak) compared to three tandem stop codons (3xSTOP). Error bars indicate the standard error of the mean. Significance was assessed using Student's t-test (p<0, 05). [Figure 2-3](ab) Inclusion of the CL1 peptide increases HITI efficiency in HEK 293 cells. Key components of Optm. HITI donors have been reported. SA = splice acceptor sequence; 3XFLAG = protein detection tag; CL1 = degradation signal for endogenous mutant rhodopsin; Fu = optimized cleavage site of furin; GSG = linker peptide; P2A = ribosome skip sequence derived from porcine tescovirus-1 2A; Rho = rhodopsin coding sequence; T2A = ribosome skip sequence derived from Thosea Asigna virus 2A; eGFP = enhanced green fluorescent protein coding sequence; WPRE = woodchuck hepatitis virus posttranslational regulator; BGH polya = polyadenylation signal from bovine growth hormone; U6 = human U6 promoter. (c) Relative levels of RHO transcript in cells transfected with Optm. HITI donors (IRES / Kozak) compared to three tandem stop codons (3xSTOP). Error bars indicate the standard error of the mean. Significance was assessed using Student's t-test (p<0, 05). [Figure 3] Evaluation of HITI efficacy in mouse photoreceptors. A) Heterozygous mice were subretinally injected at 4 weeks of age. Representative fluorescence microscopy images of retinal OCT sections from eyes treated with AAV-HITI gRNA (N=4) were shown; the contralateral eye was treated with AAV-HITI scRNA and used as a negative control. The percentage of HITI efficiency (%) is reported below. B) Electroretinography (ERG) analysis was performed 1 month post-treatment in eyes treated with AAV-HITI gRNA and AAV-HITI scRNA injected at p7. Significance was evaluated using Student's t-test (p<0.01). [Figure 4]Therapeutic efficacy in hRHO-P23H-tagRFP heterozygous mice. A-B) Electroretinography (ERG) and OCT analysis C) were performed at different time points after AAV administration in eyes injected with AAV-HITI gRNA, MMEJ gRNA, or scRNA. D) Visual acuity evaluated at 1 year of age in treated mice. All data are reported as mean ± SD. WT = wild-type mouse; heterozygous mice were injected with AAV-HITI or MMEJ donor DNA, and gRNA expression cassettes (HITI gRNA and MMEJ gRNA) and scRNA expression cassettes were used as negative controls. Statistical analysis was performed using a one-way ANOVA test. [Modes for carrying out the invention]

[0156] Array description

[0157] [Table 3-1]

[0158] [Table 3-2]

[0159] [Table 3-3]

[0160] [Table 3-4]

[0161] [Table 3-5]

[0162] [Table 3-6]

[0163] Table 3-7

[0164] Table 3-8

[0165] Table 3-9

[0166] Table 3-10

[0167] Table 3-11

[0168] Table 3-12

[0169] Table 3-13

[0170] Table 3-14

[0171] Table 3-15

[0172] Table 3-16

[0173] Table 3-17

[0174] Table 3-18

[0175] Table 3-19

[0176] Table 3-20

[0177] Table 3-21

[0178] Table 3-22

[0179] Table 3-23

[0180] Table 3-24

[0181] Table 3-25

[0182] Table 3-26

[0183] Table 3-27

[0184] [Table 3-28]

[0185] [Table 3-29]

[0186] definition As used herein, the terms “comprising,” “comprises,” and “comprised of” are synonymous with “including” or “includes,” or “containing” or “contains,” and are comprehensive or open-ended, not excluding additional unlisted components, elements, or processes. The terms “comprising,” “comprises,” and “comprised of” also include the term “consisting of.”

[0187] In this invention, “at least 80% identity” means that the sequence may have at least 80%, 85%, 90%, 95%, or 100% sequence identity with the sequence for which identity is mentioned. This applies to all identity percentages described. In this invention, “at least 95% identity” means that the sequence may have at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the sequence for which identity is mentioned. This applies to all identity percentages described. In this invention, “at least 98% identity” means that the sequence may have at least 98%, 99%, or 100% sequence identity with the sequence for which identity is mentioned. This applies to all identity percentages described. Preferably, the identity percentage is relative to the total length of the sequence for which it is mentioned.

[0188] Nucleic acid sequences derived from nucleotide sequences referred to herein, such as functional fragments, variants, derivatives, analogs, and sequences having at least 80% identity with the sequences referred to herein, are also included in the present invention, and such fragments, variants, derivatives, and analogs maintain the function of the sequences from which they are derived.

[0189] The term "functional" refers to the intention to maintain the function of the sequence from which they originate.

[0190] The terms "gene editing system" and "genome editing system" are equivalent.

[0191] Exogenous DNA sequence The exogenous DNA sequences described above include fragments of DNA that are incorporated into the genomic DNA of the target genome. In some embodiments, the exogenous DNA includes at least a portion of a gene. The exogenous DNA may include a coding sequence, e.g., a cDNA associated with a wild-type gene or "codon-optimized" sequence of a factor that must be expressed. In some embodiments, the exogenous DNA includes at least one exon of a gene and / or at least one intron of a gene. In some embodiments, the exogenous DNA includes an enhancer or promoter element of a gene. In some embodiments, the exogenous DNA includes a discontinuous sequence of a gene that includes the 5' portion of a gene fused to the 3' portion of the gene. In some embodiments, the exogenous DNA includes a wild-type gene sequence. In some embodiments, the exogenous DNA includes a mutant gene sequence. In some embodiments, the exogenous DNA includes a wild-type gene sequence. In some embodiments, the exogenous DNA sequence includes a reporter gene. In some embodiments, the reporter gene is selected from at least one of green fluorescent protein (GFP), red fluorescent protein (RFP), luciferase, β-galactosidase, and β-glucuronidase. In some embodiments, the exogenous DNA sequence includes gene transcription regulatory elements, which may include, for example, a promoter sequence or an enhancer sequence. In some embodiments, the exogenous DNA sequence includes one or more exons or fragments thereof. In some embodiments, the exogenous DNA sequence includes one or more introns or fragments thereof. In some embodiments, the exogenous DNA sequence includes at least a portion of a 3' untranslated region or a 5' untranslated region. In some embodiments, the exogenous DNA sequence includes an artificial DNA sequence. In some embodiments, the exogenous DNA sequence includes a nuclear localization sequence and / or a nuclear export sequence. In some embodiments, the exogenous DNA sequence includes a segment of nucleic acid to be integrated into a target genomic locus. In some embodiments, the exogenous DNA sequence includes one or more polynucleotides of interest. In some embodiments, the exogenous DNA sequence includes one or more expression cassettes.Such an expression cassette, in some embodiments, includes an exogenous DNA sequence of interest, a polynucleotide encoding a selection marker and / or reporter gene, and regulatory components that affect expression. The exogenous DNA sequence, in some embodiments, includes a genomic nucleic acid. The genomic nucleic acid is derived from animals, mice, humans, non-humans, rodents, rats, hamsters, rabbits, pigs, cattle, deer, sheep, goats, chickens, cattle, dogs, ferrets, primates (e.g., marmosets, rhesus monkeys), domesticated mammals or agricultural mammals, birds, bacteria, archaea, viruses, or any other organism of interest or a combination thereof. An exogenous DNA sequence of any appropriate size is incorporated into the target genome. In some embodiments, the exogenous DNA sequence incorporated into the genome is approximately 3, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, or more than 500 kilobases (kb). In some embodiments, the exogenous DNA sequence integrated into the genome is at least about 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500 or 500 (kb) in length.

[0192] Targeted sequence In some embodiments, the targeting construct (containing a donor nucleic acid adjacent at 5' and 3' to the inverse targeting sequence) comprises at least two targeting sequences. The targeting sequences herein are nucleic acid sequences that are recognized and cleaved by a nuclease. In some embodiments, the targeting sequences are of about 9–about 12 nucleotides, about 12–about 18 nucleotides, about 18–about 21 nucleotides, about 21–about 40 nucleotides, about 40–about 80 nucleotides, or any combination of subranges (e.g., 9–18, 9–21, 9–40, and 9–80 nucleotides). In some embodiments, the targeting sequence includes a nuclease binding site. In some embodiments, the targeting sequence includes a nick / cleavage site. In some embodiments, the targeting sequence includes a protospacer adjacent motif (PAM) sequence. In some embodiments, the target nucleic acid sequence (e.g., protospacer) is 20 nucleotides. In some embodiments, the target nucleic acid is less than 20 nucleotides. In some embodiments, the target nucleic acid is at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. In some embodiments, the target nucleic acid is at most 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. In some embodiments, the target nucleic acid sequence is 16, 17, 18, 19, 20, 21, 22, or 23 bases immediately 5' of the first nucleotide of the PAM. In some embodiments, the target nucleic acid sequence is 16, 17, 18, 19, 20, 21, 22, or 23 bases immediately 3' of the last nucleotide of the PAM. In some embodiments, the target nucleic acid sequence is 20 bases immediately 5' of the first nucleotide of the PAM. In some embodiments, the target nucleic acid sequence is 20 bases immediately 3' of the last nucleotide of the PAM. In some embodiments, the target nucleic acid sequence is the 5' or 3' of the PAM. In some embodiments, the targeting sequence includes a nucleic acid sequence present in the target nucleic acid to which the nucleic acid targeting segment of the complementary nucleic acid binds. For example, in some embodiments, the targeting sequence includes a sequence designed such that the complementary nucleic acid has base pairings.In some embodiments, the targeting sequence includes any polynucleotide located, for example, in the nucleus or cytoplasm of a cell, or within a cellular organelle such as a mitochondria or chloroplast. The targeting sequence includes a cleavage site for a nuclease. In some embodiments, the targeting sequence is adjacent to the cleavage site for a nuclease. In some embodiments, the nuclease cleaves the nucleic acid at a site inside or outside the nucleic acid sequence present in the target nucleic acid to which the complementary nucleic acid targeting sequence binds. In some embodiments, the cleavage site includes the nucleic acid location where the nuclease produces a single-strand or double-strand break. For example, the formation of a nuclease complex including a complementary nucleic acid that hybridizes to a protease recognition sequence and complexes with a protease results in a cleavage of one or both strands within or near the nucleic acid sequence present in the target nucleic acid to which the spacer region of the complementary nucleic acid binds (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 19, 20, 23, 50 base pairs, or more). In some embodiments, the cleavage sites are on only one or both strands of the nucleic acid. In some embodiments, the cleavage sites are at the same location on both strands of the nucleic acid (producing blunt ends) or at different locations on each strand (producing staggered ends). Staggered ends are, in some embodiments, 5' or 3' overhanging sticky ends. In some embodiments, staggered ends are produced by a sticky end-producing nuclease (e.g., Cpfl). In some embodiments, staggered ends are produced, for example, by using two nucleases, each producing a single-strand break at a different cleavage site on each strand, thereby producing a double-strand break. For example, a first nickase produces a single-strand break on the first strand of double-stranded DNA (dsDNA), and a second nickase produces a single-strand break on the second strand of dsDNA, thereby producing an overhang sequence. In some cases, the nuclease recognition sequence of nickase on the first strand is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100, 250, 500, or 1000 base pairs away from the nuclease recognition sequence of nickase on the second strand.Site-specific cleavage of a target nucleic acid by a nuclease occurs, in some embodiments, at a location determined by the base pair complementarity between the complementary nucleic acid and the target nucleic acid. Site-specific cleavage of a target nucleic acid by a nuclease protein occurs, in some embodiments, at a location determined by a short motif called a protospacer adjacency motif (PAM) in the target nucleic acid. For example, a PAM is adjacent to the nuclease recognition sequence at the 3' end of the recognition sequence. For example, the cleavage site of the nuclease is, in some embodiments, about 1 to about 25, or about 2 to about 5, or about 19 to about 23 base pairs (e.g., 3 base pairs) upstream or downstream of the PAM sequence. In some embodiments, the cleavage site of the nuclease is 3 base pairs upstream of the PAM sequence. In some embodiments, the cleavage site of the nuclease is 19 bases on the (+) strand and 23 bases on the (-) strand, producing a 5' overhang of 5 nucleotides (nt). In some cases, the cleavage produces a blunt end. In some cases, the cleavage produces alternating or sticky ends with a 5' overhang. In other cases, the cleavage produces alternating or sticky ends with a 3' overhang. Orthologues of various nuclease proteins utilize different PAM sequences. For example, different Cas proteins recognize different PAM sequences in some embodiments. For example, in Streptococcus pyogenes, the PAM is a sequence in the target nucleic acid containing the sequence 5'-XRR-3', where R is either A or G, X is any nucleotide, and X is immediately 3' of the target nucleic acid sequence targeted by the spacer sequence. The PAM sequence of Streptococcus pyogenes Cas9 (SpyCas9) is 5'-XGG-3', where X is any DNA nucleotide and is immediately 3' of the nuclease recognition sequence on the non-complementary strand of the target DNA. The PAM of Cpfl is 5'-TTX-3', where X is any DNA nucleotide and is immediately 5' of the nuclease recognition sequence. Preferably, the Cas9 / sgRNA complex introduces a double-sided split (DSB) three base pairs upstream of the PAM sequence in the genome targeting sequence, resulting in two blunt ends. The exact same Cas9 / sgRNA targeting sequence is then loaded into the donor DNA in reverse.The targeted genomic locus and donor DNA are cleaved by Cas9 / gRNA, and the linearized donor DNA is integrated into the target site via the NHEJ DSB repair pathway. If the donor DNA is integrated in the correct orientation, the junction sequence is protected from further cleavage by Cas9 / gRNA. If the donor DNA is integrated in the reverse orientation, Cas9 / gRNA will excise the integrated donor DNA due to the presence of intact Cas9 / gRNA target sites.

[0193] Complementary nucleic acid chain (also defined as complementary oligonucleotide) A complementary nucleic acid, such as a complementary oligonucleotide or complementary RNA, refers to a nucleic acid that hybridizes to another nucleic acid, such as a target nucleic acid in the genome of a cell. The complementary nucleic acid may be, for example, RNA or DNA. In some embodiments, the complementary nucleic acid includes nucleotide analogs and / or modified nucleotides. In some embodiments, the complementary nucleic acid is programmed or designed to site-specifically bind to a sequence of nucleic acid. In some embodiments, the complementary nucleic acid includes one or more modifications to provide novel or enhanced features to the nucleic acid. In some embodiments, the complementary nucleic acid includes nucleic acid affinity tags and / or synthetic nucleotides, synthetic nucleotide analogs, nucleotide derivatives and / or modified nucleotides. In some embodiments, the complementary nucleic acid includes a nucleotide sequence (e.g., a spacer) that hybridizes to a sequence in the target nucleic acid, such as the 5' end or 3' end or nearby thereto. In some embodiments, the spacer of the complementary nucleic acid interacts with the target nucleic acid sequence-specifically via hybridization (i.e., base pairing). In some embodiments, the spacer sequence hybridizes to a target nucleic acid (e.g., the protospacer sequence) located at the 5' or 3' of the protospacer adjacent motif (PAM). In some embodiments, the complementary nucleic acid comprises two distinct nucleic acid molecules called double-stranded complementary nucleic acids. In some embodiments, the complementary nucleic acid comprises a single-stranded nucleic acid molecule called single-stranded complementary nucleic acid. In some embodiments, the complementary nucleic acid is a single-stranded complementary nucleic acid containing crRNA. In some embodiments, the complementary nucleic acid is a single-stranded complementary nucleic acid containing a fusion construct. In some embodiments, the nucleic acid targeting region of the complementary nucleic acid comprises a nucleotide sequence complementary to the sequence in the target nucleic acid. In some embodiments, the nucleic acid targeting region comprises a spacer region. The nucleotide sequence of the spacer region is varied to determine the position in the target nucleic acid with which the complementary nucleic acid interacts. In some embodiments, the spacer region of the complementary nucleic acid is modified to hybridize to any desired sequence in the target nucleic acid. Complementarity can be alternatively complete or substantial / sufficient. Perfect complementarity between two nucleic acids means that the two nucleic acids form a double helix in which all the bases in the double helix are bonded to complementary bases by Watson-Crick pairing.Substantial or sufficient complementarity means that the sequence of one strand is not completely and / or entirely complementary to the sequence of the opposing strand, but sufficient binding occurs between the bases of the two strands to form a stable hybrid complex under a set of hybridization conditions (e.g., salt concentration and temperature). Such conditions can be predicted by using sequences and standard mathematical calculations to predict the Tm of the hybridized strands, or by empirical determination of Tm using routine methods. In some embodiments, the nucleic acid targeting region of the complementary strand nucleic acid (e.g., spacer region) is 18 to 72 nucleotides long. The nucleic acid targeting region of the complementary strand nucleic acid (e.g., spacer region) is about 12 to about 100 nucleotides long. For example, the nucleic acid targeting region of the complementary nucleic acid chain (e.g., the spacer region) has a length of approximately 12 nucleotides (nt) to approximately 80 nt, approximately 12 nt to approximately 50 nt, approximately 12 nt to approximately 40 nt, approximately 12 nt to approximately 30 nt, approximately 12 nt to approximately 25 nt, approximately 12 nt to approximately 20 nt, approximately 12 nt to approximately 19 nt, approximately 12 nt to approximately 18 nt, approximately 12 nt to approximately 17 nt, approximately 12 nt to approximately 16 nt, or approximately 12 nt to approximately 15 nt. Alternatively, the DNA targeting segment may have a length of approximately 18nt to 20nt, 18nt to 25nt, 18nt to 30nt, 18nt to 35nt, 18nt to 40nt, 18nt to 45nt, 18nt to 50nt, 18nt to 60nt, 18nt to 70nt, 18nt to 80nt, 18nt to 90nt, 18nt to 100nt, 20nt to 25nt, 20nt to 30nt, 20nt to 35nt, 20nt to 40nt, 20nt to 45nt, 20nt to 50nt, 20nt to 60nt, 20nt to 70nt, 20nt to 80nt, 20nt to 90nt, or 20nt to 100nt.

[0194] In some embodiments, the nucleic acid targeting region of the complementary nucleic acid (e.g., the spacer region) is 20 nucleotides long. In some embodiments, the nucleic acid targeting region of the complementary nucleic acid (e.g., the spacer region) is 19 nucleotides long. In some embodiments, the nucleic acid targeting region of the complementary nucleic acid (e.g., the spacer region) is 18 nucleotides long. In some embodiments, the nucleic acid targeting region of the complementary nucleic acid (e.g., the spacer region) is 17 nucleotides long. In some embodiments, the nucleic acid targeting region of the complementary nucleic acid (e.g., the spacer region) is 16 nucleotides long. In some embodiments, the nucleic acid targeting region of the complementary nucleic acid (e.g., the spacer region) is 21 nucleotides long. In some embodiments, the nucleic acid targeting region of the complementary nucleic acid (e.g., the spacer region) is 22 nucleotides long. The protospacer sequence is identified in some embodiments by identifying the PAM within the region of interest and selecting a region of a desired size upstream or downstream of the PAM as the protospacer. The corresponding spacer sequence is designed by determining the complementary sequence of the protospacer region. In some embodiments, the spacer sequence is identified using a computer program (e.g., machine-readable code). In some embodiments, the computer program uses variables such as predicted melting temperature, secondary structure formation, and predicted annealing temperature, sequence identity, genomic status, chromatin accessibility, %GC, frequency of genome development, methylation status, and presence of SPs. The complementarity percentage between the nucleic acid targeting sequence (e.g., spacer sequence) and the nuclease recognition sequence (e.g., protospacer) in the target nucleic acid is, in some embodiments, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%. In some embodiments, the complementarity percentage between the nucleic acid targeting sequence and the nuclease recognition sequence in the target nucleic acid is at least 60% over approximately 20 consecutive nucleotides.In some embodiments, the complementary nucleic acid chain includes modifications or sequences that provide further desirable features (e.g., modified or regulated stability; intracellular targeting; tracking by fluorescent labeling; protein or protein complex binding sites; etc.). Examples of such modifications include, for example, 5' caps (e.g., 7-methylguanylate caps (m7G)), 3' polyadenylated tails (i.e., 3' poly(A) tails), riboswitch sequences (e.g., to enable regulated stability and / or regulated accessibility by proteins and / or protein complexes), stability control sequences, sequences that form dsRNA double helixes (i.e., hairpins), modifications or sequences that target RNA to intracellular locations (e.g., nucleus, mitochondria, chloroplasts, etc.), modifications or sequences that provide tracking (e.g., direct binding to fluorescent molecules, complexation to regions that facilitate fluorescence detection, sequences that enable fluorescence detection, etc.), or modifications or sequences that provide binding sites for proteins (e.g., DNA-acting proteins including transcription activators, transcription repressors, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, etc.), and combinations thereof). Complementary nucleic acids are provided in any form, for example, in the form of RNA, as either two molecules (e.g., separate crRNA and tracrRNA) or one molecule (e.g., sgRNA). In some embodiments, the complementary nucleic acids are provided in the form of a complex with a nuclease protein. Alternatively, the complementary nucleic acids are also provided in the form of RNA-coding DNA. The DNA encoding the complementary nucleic acids alternatively encodes a single-stranded complementary nucleic acid (e.g., sgRNA) or separate RNA molecules (e.g., separate crRNA and tracrRNA). In the latter case, the DNA encoding the complementary nucleic acids is provided as separate DNA molecules encoding crRNA and tracrRNA, respectively. In some embodiments, the DNA encoding the complementary nucleic acids is stably integrated into the cellular genome and optionally operably linked to an active promoter within the cell. In some embodiments, the DNA encoding the complementary nucleic acids is operably linked to a promoter in an expression construct. The complementary nucleic acids are prepared by any suitable method.For example, complementary nucleic acids are prepared by in vitro transcription using, for instance, T7 RNA polymerase. In some embodiments, complementary nucleic acids are also synthetically produced molecules prepared by chemical synthesis.

[0195] Nuclease Nucleases that recognize targeted sequences are known to those skilled in the art and include, but are not limited to, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), clustered and regularly arranged short palindromic repeat (CRISPR) nucleases, and meganucleases. Nucleases found in compositions and useful in the methods disclosed herein are described in more detail below.

[0196] Zinc finger nuclease (ZFN) A "zinc finger nuclease" or "ZFN" is a fusion between Fokl's cleavage domain and a DNA recognition domain containing three or more zinc finger motifs. Heterodimation of two individual ZFNs with precise orientation and spacing at specific locations on DNA results in a double-strand break in the DNA. In some cases, the ZFN fuses the cleavage domain to the C-terminus of each zinc finger domain. To allow the two cleavage domains to dimerize and cleave the DNA, the two individual ZFNs bind to the opposite strand of DNA, with their C-terminuses separated by a certain distance. In some cases, the linker sequence between the zinc finger domain and the cleavage domain requires that the 5' edges of each binding site be separated by approximately 5–7 bp. Examples of ZFNs useful in this invention include Urnov et al., Nature Reviews Genetics, 2010, 11:636-646; Gaj et al., Nat Methods,2012,9(8):805-7;US Patent No. 6,534,261;US Patent No. 6,607,882;US Patent No. 6,746,838;US Patent No. 6,794,136; 6,824,978; 6,866,997; 6,933,113; 6,979,539; 7,013,219; 7,030,215; Examples of such inventions include, but are not limited to, those described in U.S. Patent Publications No. 7,220,719; No. 7,241,573; No. 7,241,574; No. 7,585,849; No. 7,595,376; No. 6,903,185; No. 6,479,626, and U.S. Patent Publications No. 2003 / 0232410 and 2009 / 0203140. In some embodiments, the ZFN is a zinc finger nickase, which is an engineered ZFN that induces site-directed single-strand DNA breaks or nicks. Descriptions of zinc finger nickase can be found, for example, in Ramirez et al., Nucl Acids Res, 2012, 40(12):5560-8; and Kim et al., Genome Res, 2012, 22(7):1327-33.

[0197] TALEN "TALEN" or "TAL effector nuclease" is an engineered transcriptional activator-like effector nuclease that contains a central domain of DNA-binding tandem repeats, a nuclear localization signal, and a C-terminal transcriptional activation domain. In some examples, the DNA-binding tandem repeats contain 33-35 amino acids in length and include two hypervariable amino acid residues at positions 12 and 13 that recognize one or more specific DNA base pairs. TALENs are produced by fusing a TAL effector DNA-binding domain to a DNA cleavage domain. For example, the TALE protein can be fused to a nuclease such as a wild-type or mutant Fokl endonuclease or the catalytic domain of Fokl. For example, several mutations to Fokl have been created for use in TALENs to improve cleavage specificity or activity. Such TALENs are engineered to bind to any desired DNA sequence. TALENs are often used to generate gene modifications by creating double-strand breaks in the target DNA sequence, which then undergoes NHEJ or HDR. In some cases, a single-strand donor DNA repair template is provided to facilitate HDR. Detailed descriptions of TALENs and their use for gene editing can be found, for example, in U.S. Patent Nos. 8,440,431; 8,440,432; 8,450,471; 8,586,363; and 8,697,853; Scharenberg et al., Curr Gene Ther, 2013, 13(4):291-303; Gaj et al., Nat Methods, 2012, 9(8):805-7; Beurdeley et al., Nat Commun, 2013, 4:1762; and Joung and Sander, Nat Rev Mol Cell Biol, 2013, 14(l):49-55. DNA

[0198] Guide nuclease A "DNA guide nuclease" is a nuclease that directs another nuclease to the correct location within a genome by hybridizing with a single-stranded DNA complementary nucleotide to another nucleic acid, such as a target nucleic acid within the cell's genome. In some embodiments, the DNA guide nuclease includes an argonaut nuclease. In some embodiments, the DNA guide nuclease is selected from TtAgo, PfAgo, and NgAgo. In some embodiments, the DNA guide nuclease is NgAgo.

[0199] Meganuclease In certain embodiments, "meganuclease" is a highly specific rare-cut endonuclease or homing endonuclease that recognizes DNA target sites in the range of at least 12 base pairs long, for example, 12 to 40 base pairs or 12 to 60 base pairs long.

[0200] In this specification, I-Scel, I-Scell, I-SceIII, I-SceIV, I-SceV, I-SceVI, I-SceVII, I-Ceul, I-CeuAIIP, I-Cre l, I-CrepsblP, I-CrepsbllP, I-CrepsbIIIP, I-CrepsbIVP, I-Tlil, I-Ppol, PI-PspI, F-Scel, F-Scell , F-Suvl, F-Tevl, F-TevII, I-Amal, I-Anil, I-Chul, I-Cmoel, I-Cpal, I-CpaII, I-Csml, I-Cvul, I-Cvu AIP, I-Ddil, I-DdiII, I-Dirl, I-Dmol, I-Hmul, I-HmuII, I-HsNIP, I-Llal, I-Msol, I-Naal, I-Nanl, I- NcIIP, I-NgrIP, I-Nitl, I-Njal, I-Nsp236IP, I-Pakl, I-PboIP, I-PcuIP, I-PcuAI, I-PcuVI, I-PgrlP, 1-PobIP, I-Porl, I-PorIIP, I-PbpIP, I-SpBetaIP, I-Scal, I-SexIP, 1-SneIP, I-Spoml, I-SpomCP, I-S pomIP, I-SpomIIP, I-SquIP, I-Ssp6803I, I-SthPhiJP, I-SthPhiST3P, I-SthPhiSTe3bP, I-TdeIP, I-Te vl, I-TevII, I-TevIII, I-UarAP, I-UarHGPAIP, I-UarHGPA13P, I-VinlP, 1-ZbiIP, PI-MtuI, PI-MtuHIP Any meganuclease is intended to be used, including but not limited to PI-MtuHIIP, PI-PfuI, PI-PfuII, PI-PkoI, Pl-PkoII, PI-Rma43812IP, PI-SpBetaIP, PI-SceI, PI-Tful, PI-TfuII, PI-Thyl, PI-Tlil, PI-THII, I-Crel meganuclease, I-Ceul meganuclease, I-Msol meganuclease, I-Scel meganuclease, or any active variant, fragment, mutant, or derivative thereof.

[0201] CRISPR The CRISPR (clustered, regularly arranged, short palindromic sequence repeats) / Cas (CRISPR-related protein) nuclease system is an engineered nuclease system based on bacterial systems used in genome manipulation. It is partially based on the adaptive immune response of many bacteria and archaea. When a virus or plasmid invades a bacterium, a segment of the invader's DNA is converted to CRISPR RNA (crRNA) by the "immune" response. The crRNA then associates with another type of RNA called tracrRNA via a partially complementary region, guiding the Cas (e.g., Cas9) nuclease to a region homologous to the crRNA in target DNA called a "protospacer." The Cas (e.g., Cas9) nuclease cleaves the DNA, producing a blunt end with a double-strand break at a site specified by the 20-nucleotide complementary strand sequence contained within the crRNA transcript. In some embodiments, the Cas (e.g., Cas9) nuclease requires both crRNA and tracrRNA for site-specific DNA recognition and cleavage. In certain embodiments, this system combines crRNA and tracrRNA into a single molecule, a "single guide RNA" or "sgRNA," where the crRNA equivalent portion of the single guide RNA is engineered to guide a Cas (e.g., Cas9) nuclease to target any desired sequence (see, e.g., Jinek et al. (2012) Science 337:816-821; Jinek et al. (2013) eLife 2:e00471; Segal (2013) eLife 2:e00563). Thus, the CRISPR / Cas system can be engineered to create double-strand breaks at desired targets within the cell's genome and to repair the induced breaks by homologous recombination repair (HDR) or non-homologous end joining (NHEJ) using the cell's endogenous mechanisms. In some embodiments, the Cas nuclease has DNA cleavage activity. In some embodiments, the Cas nuclease directs cleavage of one or both strands at a location within the target DNA sequence. For example, in some embodiments, the Cas nuclease is a nickasase having one or more hexavalent catalytic domains that cleave a single strand of a target DNA sequence.Non-limiting examples of Cas nucleases include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas1O, Cpf1, C2c3, C2c2 and C2c1Csyl, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, and Cs Examples include m3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Cpf1, Csb1, Csb2, Csb3, Csx17, Csx14, Csx1O, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, their homologs, their variants, their mutants, and their derivatives. Cas nucleases have three main types (type I, type II, and type III) and 10 subtypes, including 5 type I, 3 type II, and 2 type III proteins (see, for example, Hochstrasser and Doudna, Trends Biochem Sci, 2015:40(l):58-66). Type II Cas nucleases include, but are not limited to, Cas1, Cas2, Csn2, and Cas9. These Cas nucleases are known to those skilled in the art. For example, the amino acid sequence of the wild-type Cas9 polypeptide of Streptococcus pyogenes is described, for example, in NBCI Ref.Seq.No.NP 269215, and the amino acid sequence of the wild-type Cas9 polypeptide of Streptococcus thermophilus is described, for example, in NBCI Ref.Seq.No.WP_011681470. In some embodiments, the Cas nuclease, e.g., the Cas9 polypeptide, is derived from various bacterial species. "Cas9" refers to an RNA-guided double-strand DNA binding nuclease protein or nickase protein. The wild-type Cas9 nuclease has two functional domains, e.g., RuvC and HNH, which cleave different DNA strands. Cas9 can induce double-strand breaks in genomic DNA (target DNA) when both functional domains are active.In some embodiments, the Cas9 enzyme is used to target Corynebacter, Sutterella, Legionella, Treponema, and Filif Actol. It contains one or more catalytic domains of the Cas9 protein derived from bacteria belonging to the group consisting of Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flavobacterium, Sphaerochaeta, Azospirillum, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, and Campylobacter. In some embodiments, Cas9 is a fusion protein, where, for example, two catalytic domains originate from different bacterial species. Useful variants of Cas9 nucleases include a single inactive catalytic domain, e.g., RuvC. - or HNH -The Cas9 nuclease or nickase is included. The Cas9 nickase has only one active functional domain and, in some embodiments, cleaves only one strand of target DNA, thereby creating a single-strand break or nick. In some embodiments, a mutant Cas9 nuclease having at least the D10A mutation is a Cas9 nickase. In other embodiments, a mutant Cas9 nuclease having at least the H840A mutation is a Cas9 nickase. Other examples of mutations present in Cas9 nickase include, but are not limited to, N854A and N863A. When at least two DNA-targeting RNAs targeting opposing DNA strands are used, a double-strand break is introduced using the Cas9 nickase. The double nick-induced double-strand break is repaired by NHEJ or HDR. This gene editing strategy favors HDR, which reduces the frequency of indel mutations at off-target DNA sites. In some embodiments, the Cas9 nuclease or nickase is codon-optimized for target cells or target organisms. In some embodiments, the Cas nuclease is a Cas9 polypeptide containing two silencing mutations in the RuvCl and HNH nuclease domains (D10A and H840A), referred to as dCas9. In one embodiment, a dCas9 polypeptide derived from Streptococcus pyogenes contains at least one mutation at the positions of D10, G12, G17, E762, H840, N854, N863, H982, H983, A984, D986, A987, or any combination thereof. A description of such dCas9 polypeptides and their variants is provided, for example, in International Patent Publication WO 2013 / 176772. In some embodiments, the dCas9 enzyme contains mutations at D10, E762, H983 or D986, and mutations at H840 or N863. In some cases, the dCas9 enzyme contains the D10A or DION mutation. Alternatively, the dCas9 enzyme may contain the H840A, H840Y, or H840N mutations.In some embodiments, the dCas9 enzyme of the present invention includes D10A and H840A; D10A and H840Y; D10A and H840N; DION and H840A; DION and H840Y; or DION and H840N substitutions. The substitutions are alternatively conserved or non-conservative substitutions to catalytically inactivate the Cas9 polypeptide, allowing it to bind to target DNA. For genome editing methods, the Cas nuclease in some embodiments includes a Cas9 fusion protein such as a polypeptide containing the catalytic domain of the IIS-type restriction enzyme Fokl linked to dCas9. The FokI-dCas9 fusion protein (fCas9) can bind to a single strand of target DNA using two guide RNAs, thereby causing a double-strand break.

[0202] delivery The gene delivery vehicle of the present invention may be administered to a patient. Such administration may be “in vivo” or “ex vivo.” Those skilled in the art will be able to determine an appropriate dosage. The term “administration” includes delivery by viral or nonviral technology.

[0203] Non-viral vectors are a heterogeneous group of delivery vectors, including polyplexes, lipid nanoparticles, non-lipid nanoparticles, virus-like particles, or combinations thereof. Compared to viral vectors, this group is characterized by a lower cytotoxicity, immunogenicity, and mutagenicity profile. Furthermore, they also exhibit high cargo capacity (Zu & Gao (2021) APPS J.23-78).

[0204] Most lipids consist of positively charged head groups that bind to the anionic phosphate groups of nucleic acids via electrostatic interactions to form lipid nanoparticles.

[0205] When polyanionic nucleic acids are compressed with a polycationic polymer, a polyplex is formed.

[0206] Non-lipid nanoparticles may include carbon or metal-based nanoparticles, examples of which include carbon nanotubes, graphene or carbon quantum dots (CQDs) and gold or iron oxide nanoparticles.

[0207] Virus-like particles are virus-derived structures made of one or more different molecules that have the ability to self-assemble by mimicking the morphology and size of viral particles. Therefore, they retain the ability to transduce into target cells but lack viral genetic material (Nooraei et al (2021) Journal of Nanobiotechnology, 19-59).

[0208] Examples of viral delivery mechanisms include, but are not limited to, adenovirus vectors, adeno-associated virus (AAV) vectors, herpesvirus vectors, retrovirus vectors, lentivirus vectors, integrase-deficient lentivirus vectors, and baculovirus vectors. Non-viral delivery systems include DNA transfection, such as electroporation, lipid-mediated transfection, and compressed DNA-mediated transfection. Liposomes, immunoliposomes, lipofectins, cationic amphiphilic substances (CFAs), and combinations thereof. Delivery of one or more therapeutic genes by the vector system according to the present invention can be used alone or in combination with other treatments or therapeutic components.

[0209] Any suitable delivery method is intended to be used to deliver the compositions of this disclosure. In some embodiments, the individual components of the HITI system (e.g., nucleases and / or exogenous DNA sequences) are delivered simultaneously or separated in time. The choice of method of genetic modification depends on the type of cells being transformed and / or the circumstances under which the transformation is being performed (e.g., in vitro, ex vivo, or in vivo). A general consideration of these methods can be found in Ausubel, et al., Short Protocols in Molecular Biology, 3rd ed., Wiley & Sons, 1995.

[0210] The term “contacting cells” includes all delivery methods disclosed herein. In some embodiments, the methods disclosed herein include contacting target DNA or introducing one or more nucleic acids, including complementary nucleic acids (e.g., gRNA), site-specific modified polypeptides (e.g., Cas proteins), and / or nucleotide sequences encoding exogenous DNA sequences, into cells (or a population of cells). Suitable nucleic acids including nucleotide sequences encoding complementary nucleic acids and / or site-specific modified polypeptides include expression vectors, and expression vectors including nucleotide sequences encoding complementary nucleic acids and / or site-specific modified polypeptides are recombinant expression vectors. Non-limiting examples of delivery methods or transformations include, for example, viral or bacteriophage infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran-mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct microinjection, and nanoparticle-mediated nucleic acid delivery (see, for example, Panyam et., al Adv Drug Deliv Rev. 2012 Sep. 13. pii:50169-409X(12)00283-9. doi:10.1016 / j.addr. 2012.09.023). In some embodiments, the present invention provides a method comprising delivering one or more polynucleotides, for example, one or more vectors described herein, one or more transcripts thereof, and / or one or more proteins transcribed therefrom, to a host cell. In some embodiments, the disclosure further provides cells produced by such methods, and organisms (e.g., animals, plants, or fungi) containing or produced from such cells. In some embodiments, nuclease proteins combined with and optionally complexed with complementary sequences are delivered to the cells. Conventional viral and nonviral-based gene transfer methods are intended to be used to introduce nucleic acids into mammalian cells or target tissues.Such methods are used to administer nucleic acids encoding components of the HITI system to cells in culture or in a host organism. Non-viral vector delivery systems include DNA plasmids, RNA (e.g., transcripts of vectors described herein), naked nucleic acids, and nucleic acids complexed with delivery vehicles such as liposomes. Viral vector delivery systems may include DNA and RNA viruses that may have either episomes or integrated genomes after delivery to cells. For a review of gene therapy procedures, see Anderson, Science 256:808-813 (1992); Nabel & Feigner, TIBTECH 11:211-217 (1993); Mitani & Caskey, TIBTECH 11:162-166 (1993); Dillon, TIBTECH 11:167-175 (1993); Miller, Nature 357:455-460 (1992); Van Brunt, Biotechnology 6(10):1149-1154 (1988); Vigne, Restorative Neurology and Neuroscience 8:35-36 (1995); Kremer & Perricaudet, British Medical Bulletin 51(l):31-44 (1995); Haddada et al., in Current Topics in Microbiology and Immunology See Doerfler and Bohm (eds) (1995); and Yu et al., Gene Therapy 1:13-26 (1994). Methods of nonviral delivery of nucleic acids may include lipofection, nucleofection, microinjection, electroporation, bioristics, virosomes, liposomes, immunoliposomes, polycations or lipids: nucleic acid conjugates, naked DNA, artificial virions, and drug-enhancing uptake of DNA. Lipofection is described, for example, in U.S. Patents No. 5,049,386, No. 4,946,787; and No. 4,897,355), and lipofection reagents are commercially available (e.g., Transfectam.™ and Lipofectin.™).Cationic and neutral lipids suitable for efficient receptor-recognition lipofection of polynucleotides include those described in Feigner, International Publication 91 / 17424; International Publication 91 / 16024. Delivery is considered to be to cells (e.g., in vitro or ex vivo administration) or target tissues (e.g., in vivo administration). The preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known (e.g., Crystal, Science 270:404-410 (1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et al., Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995); Ahmad et al., Cancer See Res.52:4817-4820(1992); U.S. Patent Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, and 4,946,787). RNA or DNA virus-based systems are used to target specific cells in the body and deliver a viral payload to the cell nucleus. Viral vectors are alternatively administered directly (in vivo), or they are used to treat cells in vitro, and modified cells are administered, in some cases (ex vivo). Virus-based systems include, but are not limited to, retroviruses, lentiviruses, adenoviruses, adeno-associated virus, and herpes simplex virus vectors for gene transfer. Integration into the host genome occurs in some embodiments using retrovirus, lentivirus, and adeno-associated virus gene transfer methods, which in some embodiments results in long-term expression of the inserted transgene. High transduction efficiencies are observed in many different cell types and target tissues. Adenovirus-based systems are used in some embodiments.Adenovirus-based systems, in some embodiments, result in transient expression of the transgene. Adenovirus-based vectors enable high transduction efficiency in cells and, in some embodiments, do not require cell division. High titers and expression levels are possible with adenovirus-based vectors. In some embodiments, adeno-associated virus ("AAV") vectors are used to transduce target nucleic acids into cells, for example, in the in vitro production of nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures (see, for example, West et al., Virology 160:38-47 (1987); U.S. Patent No. 4,797,368; International Publication No. 93 / 24641; Kotin, Human Gene Therapy 5:793-801 (1994); Muzyczka, J. Clin. Invest. 94:1351 (1994). For the construction of recombinant AAV vectors, see U.S. Patent No. 5,173,414; Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985); Tratschin, et al. This has been described in numerous publications, including al., Mol.Cell.Biol.4:2072-2081(1984); Hermonat & Muzyczka, PNAS 81:6466-6470(1984); and Samulski et al., J.Virol.63:03822-3828(1989). Packaging cells are used in some embodiments to form viral particles that can infect host cells. Such cells include, but are not limited to, 293 cells (for example, to package adenoviruses) and psi; 2 cells or PA317 cells (for example, to package retroviruses). Viral vectors are prepared by creating cell lines that package nucleic acid vectors into viral particles. In some cases, the vector contains the minimum viral sequence necessary for packaging and subsequent integration into a host. In some cases, the vector contains other viral sequences that are replaced by expression cassettes for the polynucleotides to be expressed.In some embodiments, the missing viral function is supplied trans by a packaging cell line. For example, in some embodiments, the AAV vector contains an ITR sequence derived from the AAV genome necessary for packaging and integration into the host genome. The viral DNA is packaged into a cell line that lacks the ITR sequence but contains helper plasmids encoding other AAV genes, namely rep and cap. Alternatively, the cell line is infected with an adenovirus as a helper. The helper virus promotes the replication of the AAV vector and the expression of AAV genes from the helper plasmid. Adenovirus contamination is reduced, for example, by heat treatment in which the adenovirus is more susceptible than AAV.

[0211] AAV serotype To date, dozens of different AAV variants (serotypes) have been identified and classified (Srivastava A, Curr Opin Virol. 2016 Dec;21:75-80). All known serotypes can infect cells from multiple diverse tissue types. Tissue specificity is determined by the capsid serotype, and pseudotyping of AAV vectors to alter their tropism range is likely to be important for their use in therapy. Pseudotyped AAV vectors contain the genome of one AAV serotype in the capsid of a second AAV serotype; for example, an AAV2 / 8 vector contains the AAV8 capsid and the AAV2 genome (Auricchio et al. (2001) Hum. Mol. Genet. 10(26):3075-81). Such vectors are also known as chimeric vectors.

[0212] serotype 2 Serotype 2 (AAV2) has been the most widely tested to date. AAV2 exhibits innate affinity for neurons, vascular smooth muscle cells, and hepatocytes. Three cell receptors for AAV2: heparan sulfate proteoglycan (HSPG), a Vβ5 integrin and fibroblast growth factor receptor 1 (FGFR-1) have been described. The first receptor functions as a primary receptor, while the latter two have co-receptor activity, allowing AAV to enter cells via receptor-mediated endocytosis. These findings have been discussed by Qiu, Handa, et al. Although HSPG functions as a primary receptor, its abundance in the extracellular matrix may trap AAV particles and impair infection efficiency.

[0213] Other serotypes AAV2 is the most common serotype in various AAV-based studies, but other serotypes have been shown to be more effective as gene delivery vectors. For example, AAV6 appears to be far superior in infecting airway epithelial cells, AAV7 shows a very high transduction rate in mouse skeletal muscle cells (similar to AAV1 and AAV5), AAV8 is very superior in transduction into hepatocytes and photoreceptors, and AAV1 and 5 have been shown to be very efficient in gene delivery to vascular endothelial cells. In the brain, most AAV serotypes are neurotropic, but AAV5 also transduces astrocytes. AAV6, a hybrid of AAV1 and AAV2, also shows lower immunogenicity than AAV2. Serotypes can differ in terms of the receptors they bind to. For example, transduction of AAV4 and AAV5 can be inhibited by soluble sialic acid (different forms for each of these serotypes), and AAV5 has been shown to enter cells via platelet-derived growth factor receptors. Novel AAV variants, such as the quadruple tyrosine mutant or AAV 2 / 7m8, have been shown to transduce from the vitreous humor to the outer retina in small animal models (Dalkara D et al., Sci Transl Med. 2013 Jun 12;5(189):189ra76; Petrs-Silva H et al., Mol Ther. 2011 Feb;19(2):293-301). Another AAV mutant, named ShH10, is an AAV6 variant that shows improved glial targeting after intravitreous administration (Klimczak RR et al., PLoS One. 2009 Oct 14;4(10):e7467). A further AAV mutant with particularly favorable affinity for the retina is AAV2 (quad YF) (Hickey DG et al., Gene Ther. 2017 Dec;24(12):787-800). Within the scope of the present invention, AAV virus particles contain the capsid protein of an AAV serotype selected from one or more of the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and AAV10, preferably AAV2 or AAV8 serotype.

[0214] Any suitable vector compatible with the host cell is intended to be used in conjunction with the method of the present invention. Non-limiting examples of vectors for eukaryotic host cells include pXTl, pSG5, pSVK3, pBPV, pMSG, and pSVLSV40. In some embodiments, the nucleotide sequence encoding the complementary nucleic acid and / or site-specific modified polypeptide is operably linked to a regulatory element, such as a transcriptional regulatory element, such as a promoter. In some embodiments, the transcriptional regulatory element is functional in either eukaryotic cells, such as mammalian cells, or prokaryotic cells (e.g., bacterial or archaeal cells). In some embodiments, the nucleotide sequence encoding the complementary nucleic acid and / or site-specific modified polypeptide is operably linked to a plurality of regulatory elements that enable the expression of the nucleotide sequence encoding the complementary nucleic acid and / or site-specific modified polypeptide in prokaryotic cells and / or eukaryotic cells. Depending on the host / vector system used, one of several appropriate transcriptional and translational regulatory elements, including constitutive and inducible promoters, transcriptional enhancer elements, and transcriptional terminators, may be used in the expression vector (e.g., U6 promoter, HI promoter, etc.; see above) (e.g., Bitter et al. (1987) Methods in Enzymology, 153:516-544). In some embodiments, the complementary nucleic acid and / or site-specific modified polypeptide is provided as RNA. In such cases, the RNA encoding the complementary nucleic acid and / or site-specific modified polypeptide can be produced directly by chemical synthesis or transcribed in vitro from the DNA encoding the complementary nucleic acid. The complementary nucleic acid and / or RNA encoding the site-specific modified polypeptide is synthesized in vitro using RNA polymerase enzymes (e.g., T7 polymerase, T3 polymerase, SP6 polymerase, etc.). Once synthesized, RNA is introduced into cells either by direct contact with target DNA or by using any appropriate technique for introducing nucleic acids into cells (e.g., microinjection, electroporation, transfection, etc.).Complementary nucleic acids (introduced as either DNA or RNA) and / or site-directed modified polypeptides (introduced as DNA or RNA) and / or nucleotides encoding exogenous DNA sequences are delivered to cells using appropriate transfection techniques; see, for example, Angel and Yanik (2010) PLoS ONE 5(7):el 1756, and commercially available Qiagen TransMessenger.RTM reagents, Stemgent RNA Transfection Kits, and Minis Bio LLC TransIT.RTM.-mRNA Transfection Kits. Complementary nucleic acids and / or site-directed modified polypeptides and / or chimeric site-directed modified polypeptides and / or nucleic acids encoding exogenous DNA sequences can be delivered on DNA vectors. Many vectors useful for transferring nucleic acids into target cells are available, such as plasmids, cosmids, minicircles, phages, viruses, etc. In some embodiments, the nucleic acid-containing vector is maintained episomatically as, for example, plasmids, minicircle DNA, viruses such as cytomegalovirus and adenovirus, or they are incorporated into the target cell genome via homologous recombination or random insertion, for example, retroviral vectors such as MMLV, HIV-1, and ALV.

[0215] Additionally, AAV serotype derivatives can be used. Serotype derivatives can be obtained using three main approaches to capsid modification: natural diversity, directed evolution, and mutants. Natural primate AAV diversity includes major and unique AAV clades. Directed evolution begins with parental serotypes, which are then diversified by recombinant-based technologies (Viruses. 2021 Jul;13(7):1336. Adeno-Associated Virus (AAV) Gene Delivery: Dissecting Molecular Interactions upon Cell Entry. Edward E. Large, Mark A. Silveria, Grant M. Zane, Onellah Weerakoon, and Michael S. Chapman).

[0216] Methods for modifying genomic DNA This specification provides homology-independent targeted integration (HITI) and microhomology-mediated end joining (MMEJ) methods and compositions for making modifications to nucleic acids, such as genomic DNA, in non-dividing or terminally differentiated cells. The cells referred to herein are preferably non-dividing cells, more preferably terminally differentiated cells or quiescent cells. The methods herein are homology-independent by using non-homologous end joining to insert exogenous DNA into target DNA, such as genomic DNA, in cells such as non-dividing or terminally differentiated cells. In some embodiments, the methods herein include a method for integrating an exogenous DNA sequence into the genome of a non-dividing cell, comprising contacting the non-dividing cell with a composition comprising a targeted construct containing the exogenous DNA sequence and a targeted sequence, an oligonucleotide complementary to the targeted sequence, and a nuclease, wherein the exogenous DNA sequence contains at least one nucleotide difference compared to the genome, and the targeted sequence is recognized by the nuclease. In some embodiments of the HITI methods disclosed herein, the exogenous DNA sequence is a fragment of DNA containing a desired sequence to be inserted into the genome of a target cell or host cell. At least a portion of the exogenous DNA sequence has sequences homologous to a portion of the genome of the target cell or host cell, and at least a portion of the exogenous DNA sequence has sequences homologous to a portion of the genome of the target cell or host cell. For example, in some embodiments, the exogenous DNA sequence may contain a portion of a host cell genome DNA sequence that has mutations in it. Thus, when the exogenous DNA sequence is incorporated into the genome of a host cell or target cell, the mutations found in the exogenous DNA sequence are carried into the genome of the host cell or target cell. In some embodiments of the HITI methods disclosed herein, the exogenous DNA sequence is adjacent to at least one targeting sequence. In some embodiments, the exogenous DNA sequence is adjacent to two targeting sequences. The targeting sequences include a specific DNA sequence that is recognized by at least one nuclease. In some embodiments, the targeting sequences are recognized by a nuclease in the presence of an oligonucleotide complementary to the targeting sequence.In some embodiments, the HITI methods disclosed herein include a targeting sequence comprising a nucleotide sequence recognized and cleaved by a nuclease. Nucleases that recognize the targeting sequence are known to those skilled in the art and include, but are not limited to, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and clustered and regularly arranged short palindromic sequence repeat (CRISPR) nucleases. In some embodiments, ZFNs include a zinc finger DNA-binding domain and a DNA-cleaving domain fused together to produce a sequence-specific nuclease. In some embodiments, TALENs include a TAL effector DNA-binding domain and a DNA-cleaving domain fused together to produce a sequence-specific nuclease. CRISPR nucleases, in some embodiments, are naturally occurring nucleases that recognize DNA sequences homologous to clustered and regularly arranged short palindromic sequence repeats commonly found in prokaryotic DNA. CRISPR nucleases include, but are not limited to, Cas9 Cpf1, C2c3, C2c2, and C2c1. Conveniently, the Cas9 of this invention is SpCas9 D10A (Ran, FA, et al., Genome engineering using the CRISPR-Cas9 system. Nat Protoc, 2013. 8(11): p.2281-2308). (SpCas9 N863A, accompanied by inactivation of RuvC domain cleavage activity) (Ran, FA, et al., Genome engineering using the CRISPR-Cas9 system. Nat Protoc, 2013.8(11):p.2281-2308) (Inactivation of HNH domain cleavage activity), SpCas9-HF1 (Kleinstiver, BP, et al., High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature, 2016. 529(7587): p.490-5) (Reduction of Cas9 binding energy by protein engineering), eSpCas9 (laymaker, IM, et al., Rationally engineered Cas9 nucleases with improved specificity. Science, 2016. 351(6268): p.84-8) (Reduction of positive charge of Cas9), EvoCas9 (asini, A., et al., A highly specific SpCas9 variant is identified by in vivo screening in yeast. Nat Biotechnol, 2018.36(3):p.265-271) (mutaogenesis of the REC3 domain) and KamiCas9 (Merienne, N., et al., The Self-Inactivating KamiCas9 System for the Editing of CNS Disease Genes. Cell Rep, 2017.20(12):p.2980-2991) (knockout of Cas9 after expression) are variants with reduced target activity.

[0217] The HITI and MMEJ methods disclosed herein can, in some embodiments, introduce mutations into a host genome or target genome, and repair mutations within a host genome or target genome. In some embodiments of the methods described herein, the mutation or wild-type sequence is found in an exogenous DNA sequence inserted into the host genome or target genome. Mutations are known to those skilled in the art and include single base pair changes or point mutations, insertions, and deletions. In some embodiments, a single base pair change results in a missense mutation that produces a codon encoding an amino acid different from the wild-type sequence in the transcribed mRNA. In some embodiments, a single base pair change results in a nonsense mutation encoding a stop codon in the transcribed mRNA. In some embodiments, a stop codon in the transcribed RNA results in premature shortening of the protein translated from the mRNA. In some embodiments, a single base pair change results in a silent mutation that does not result in any change of amino acid encoded by mRNA transcribed from the host genome or target genome. In some embodiments, the silent mutation is located in an intron. In some embodiments, the silent mutation is located in an exon and produces a codon encoding the same amino acid as the wild-type sequence. In some embodiments, silent mutations are located in promoters, enhancers, 5'UTR, 3'UTR, or other non-coding regions of the host or target genome. In some embodiments, silent mutations result in abnormal splicing of mRNA transcripts. In some embodiments, silent mutations disrupt RNA splice donor or splice acceptor sequences. In some embodiments, silent mutations result in abnormal RNA export. In some embodiments, silent mutations result in abnormal or reduced mRNA translation. In some embodiments, silent mutations result in abnormal or reduced RNA transcription. In some embodiments, the mutation includes insertion into the host or target genome.In some embodiments, the insertion includes a specific number of nucleotides in the range of 1 to 4,700 base pairs, for example, 1 to 10, 5 to 20, 15 to 30, 20 to 50, 40 to 80, 50 to 100, 100 to 1000, 500 to 2000, or 1000 to 4,700 base pairs. In some embodiments, the method includes removing at least one gene or fragment thereof from a host genome or target genome. In some embodiments, the method includes introducing an exogenous gene (also defined herein as an exogenous DNA sequence or the gene of interest) or fragment thereof into a host genome or target genome. In some embodiments, the method includes replacing a mutant gene or fragment thereof in a host genome or target genome with a wild-type gene or fragment thereof. In some embodiments, the host gene is silenced and replaced with a wild-type gene or its coding sequence. In some embodiments, the method alters at least one nucleotide in a host genome or target genome, resulting in increased gene expression. In some embodiments, the method alters at least one nucleotide in the host genome or target genome to reduce gene expression. In some embodiments, the method alters gene expression by introducing an exogenous promoter into the host genome or target genome. In some embodiments, the promoter is an inducible promoter. The HITI methods disclosed herein have an increased ability to alter genomic DNA in non-dividing cells.Non-dividing cells include cells of the anterior part of the eye, such as retinal cells, preferably retinal ganglion cells, bipolar cells, amacrine cells, retinal pigment epithelium, horizontal cells, rod and cone cells, or iris pigment epithelium, corneal epithelium, corneal fibroblasts, neurons, oligodendrocytes, microglia and ependymal cells; central nervous system cells including sensory transducer cells; autonomic neuron cells; sensory organ and peripheral neuron supporting cells; retinal cells including photoreceptors, rods and cones; kidney cells including parietal cells, glomerular podocytes, proximal tubular brush margin cells, pennate segmented cell loops, distal tubular cells and collecting duct cells; hematopoietic cells including lymphocytes, monocytes, neutrophils, eosinophils, basophils and platelets; hepatocytes, liver cells Cells of the liver, including stellate cells, Kupffer cells, and hepatic endothelial cells; pancreatic endocrine cells, including α, β, δ, γ, and ε cells; respiratory epithelial cells, including ciliated cells, basal cells, goblet cells, and alveolar cells; germ cells, including oophores / oocytes, spermatocytes, spermatocytes, spermatogonia, and spermatogonia; bone cells, including osteocytes, osteoclasts, and osteoblasts; cardiac cells, including cardiomyocytes and cardiac pacemaker cells; thyroid follicular cells; upper gastrointestinal tract cells, including serous cells, mucinous cells, and taste buds; cells in the stomach, including parietal cells, chief cells, and enteroendocrine cells; and cells of the central nervous system, including endothelial cells, epithelial cells, adipocytes, bone marrow cells, inner ear cells, dermal cells, smooth muscle cells, and skeletal muscle cells. In some embodiments, the HITI methods disclosed herein are methods for modifying genomic DNA in dividing cells and provide methods that are more efficient than previously disclosed methods in the art. The divided cells include, but are not limited to, hematopoietic stem cells, mesenchymal stem cells, neural stem cells, hepatic stem cells, muscle satellite cells, epidermal cells, glial cells, and astrocytes. In some embodiments, the polynucleotides encoding the targeted construct, complementary oligonucleotide, and / or nuclease for the HITI method described herein are introduced into target cells or host cells by a virus. In some embodiments, the virus infects the target cells, expresses the targeted construct, complementary oligonucleotide, and nuclease, and enables the integration of the exogenous DNA of the targeted construct into the host genome.In some embodiments, the virus includes Sendai virus, retrovirus, lentivirus, baculovirus, adenovirus, or adeno-associated virus. In some embodiments, the virus is a pseudotyped virus. In some embodiments, the polynucleotide encoding the targeted construct, complementary oligonucleotide, and / or nuclease for the HITI method described herein is introduced into a target cell or host cell by a nonviral gene delivery method. In some embodiments, the nonviral gene delivery method delivers genetic material (including DNA, RNA, and proteins) to a target cell, allowing for the expression of the targeted construct, complementary oligonucleotide, and nuclease, and the integration of the exogenous DNA of the targeted construct into the host genome. In some embodiments, the nonviral method includes mRNA or protein of the DNA or a transfection reagent (including nanoparticles) for electroporation.

[0218] Methods of treating diseases Methods and compositions for treating diseases such as hereditary disorders are also provided herein. Hereditary disorders are caused by mutations in hereditary DNA. In some embodiments, hereditary disorders are caused by mutations in genomic DNA. Gene mutations are known to those skilled in the art and include single base pair changes or point mutations, insertions and deletions. In some embodiments, methods provided herein are methods for treating a genetic disorder in a subject requiring treatment of the genetic disorder, wherein the genetic disorder is caused by a mutant gene having at least one altered nucleotide compared to the wild-type gene, and the method includes contacting at least one cell of the subject with a composition comprising a targeting construct containing a DNA sequence homologous to the wild-type gene and a targeting sequence, an oligonucleotide complementary to the targeting sequence, and a nuclease, wherein the targeting sequence is recognized by the nuclease such that the mutant gene or a fragment thereof replaces the wild-type gene or a fragment thereof.Hereditary disorders treated by the methods disclosed herein include, but are not limited to, autosomal dominant disorders in which at least one mutant allele is replaced by the correct copy of the gene provided by the donor DNA, preferably autosomal dominant disorders in which both the mutant allele and the wild-type allele are replaced by the correct copy of the gene provided by the donor DNA, or hereditary disorders and general disorders resulting from the acquisition of toxic function, preferably including retinal dystrophy, which preferably includes retinitis pigmentosa, cone dystrophy or cone-rod dystrophy, macular degeneration, e.g., Stargardt disease (ELOVL4), von Hippel-Lindau, retinoblastoma. Cell tumors, RP4 (RHO; see OMIM:180380), RP63 (see OMIM:614494), CORD1 (cone-rod dystrophy 1; see OMIM:600624), CORD17 (cone-rod dystrophy 17; see OMIM:615163), BEST1 (Bestrophage-1; Best Disease; vitiligo macular dystrophy protein 2; see OMIM:607854), OPA1 (OPA1 mitochondrial dynamin-like GTPase; see OMIM:605290), neurological diseases, liver diseases, lipofuscinosis (such as Batten's disease), metabolic disorders, preferably autosomal dominant ocular diseases, such as retinal degeneration, preferably retinitis pigmentosa, neurological diseases, and liver diseases. Retinal diseases that can be treated in this invention include, for example, retinitis pigmentosa (caused by mutations in RHO, AIPL1, IMPDH1, RDS, PDE6B or other genes), cone-rod dystrophy (CRX), Stargardt disease (ELOVL4), von Hippel-Lindau, and retinoblastoma.

[0219] In some embodiments, the hereditary disorders treated by the methods disclosed herein include hereditary and common disorders resulting from recessive or loss-of-function hereditary disorders in which at least one allele is replaced with the correct copy of the gene provided by donor DNA, preferably including hemophilia, diabetes mellitus, lysosomal storage disorders including mucopolysaccharidosis (MPSI, MPSII, MPSIIIA, MPSIIIB, MPSIIIC, MPSIVA, MPSIVB, MPSVII), sphingolipidosis (Fabry disease, Gaucher disease, Niemann-Pick disease, GM1 gangliosides), lipofuscinosis (Batten disease, etc.), mucolipidosis, adenilosuccinate deficiency, hemophilia A and B, ALA dehydration deficiency, and adrenoleukodystrophy.

[0220] The methods for treating genetic disorders disclosed herein preferably use an exogenous DNA sequence that includes at least a portion of the wild-type DNA sequence corresponding to the DNA sequence of the mutated gene, thereby replacing the mutated DNA sequence with the wild-type DNA sequence.

[0221] As used herein, the terms “a,” “an,” or “the” include not only embodiments having one component but also embodiments having two or more components. For example, the singular forms “a,” “an,” and “the” include multiple referents unless the context clearly indicates otherwise. Thus, for example, a reference to “cell” includes multiple such cells, a reference to “drug” includes a reference to one or more active substances known to those skilled in the art, etc. The term “genome editing” refers to a type of genetic engineering in which DNA is inserted, replaced, or removed from target DNA, e.g., the genome of a cell, using one or more nucleases and / or nickases. Nucleases create specific double-strand breaks (DSBs) at desired locations in the genome and utilize the cell’s endogenous mechanisms to repair breaks induced by non-homologous end joining (NHEJ). Nickases produce specific single-strand breaks at desired locations in the genome. In one non-limiting example, two nickases can be used to produce two single-strand breaks on opposing strands of target DNA, thereby generating blunt or sticky ends. Any suitable nuclease, including but not limited to CRISPR-related protein (Cas) nucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, other endonucleases or exonucleases, their variants, their fragments, and their combinations, can be introduced into cells to induce genome editing of a target DNA sequence. The term "non-homologous end joining" or "NHEJ" refers to a pathway for repairing double-strand DNA breaks in which the broken ends are directly joined without requiring a homologous template. The terms "polynucleotide," "oligonucleotide," "nucleic acid," "nucleotide," and "nucleic acid molecule" may be used interchangeably to refer to deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and polymers thereof in single-stranded, double-stranded, or multi-stranded forms. This term includes, but is not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purines and / or pyrimidine bases or other natural, chemically modified, biochemically modified, unnatural, synthetic, or derivatized nucleotide bases.It also includes modifications such as methylation and / or capping, as well as unmodified forms of polynucleotides. More specifically, the terms “polynucleotide,” “oligonucleotide,” “nucleic acid,” and “nucleic acid molecule” include polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), any other type of polynucleotide which is an N- or C-glycoside of a purine or pyrimidine base, and other polymers containing a non-nucleotide backbone, such as polyamides (e.g., peptide nucleic acid (PNA)) and polymorpholino (commercially available from Anti-Virals, Inc., Corvallis, Oreg as Neugene), as well as other synthetic sequence-specific nucleic acid polymers which provide the polymer with nucleic acid bases in a configuration that allows for base pairing and base stacking as found in DNA and RNA. In some embodiments, nucleic acids may include DNA, RNA, and mixtures thereof. Unless specifically limited, the term includes nucleic acids which contain known analogues of native nucleotides that have similar binding properties to a reference nucleic acid and are metabolized in a similar manner to naturally occurring nucleotides. Unless otherwise indicated, a given nucleic acid sequence implicitly includes its conservedly modified variants (e.g., degenerate codon substitutions), alleles, orthologues, single nucleotide polymorphisms (SNPs), and complementary sequences, as well as explicitly indicated sequences. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is replaced with a mixed base and / or deoxyinosine residue. The term nucleic acid is used interchangeably with gene, cDNA, and mRNA encoded by a gene. The terms “gene” or “nucleotide sequence encoding a polypeptide” mean a segment of DNA involved in the production of a polypeptide chain. A DNA segment may include the regions before and after the coding region (leader and trailer) involved in the transcription / translation and regulation of transcription / translation of a gene product, as well as intervening sequences (introns) between individual coding segments (exons).The terms “polypeptide,” “peptide,” and “protein” are used interchangeably herein and refer to polymers of amino acid residues. This term applies to amino acid polymers, where one or more amino acid residues are artificial chemical mimics of corresponding natural amino acids, as well as natural and non-natural amino acid polymers. As used herein, this term encompasses amino acid chains of any length, including full-length proteins, where amino acid residues are linked by covalent peptide bonds. A “recombinant expression vector” is a recombinant or synthetically constructed nucleic acid construct having a set of specific nucleic acid elements that enable the transcription of a particular polynucleotide sequence in a host cell. An expression vector may be part of a plasmid, viral genome, or nucleic acid fragment. Typically, an expression vector contains polynucleotides that are transcribed and operably linked to a promoter. “Operatably linked” in this context means two or more gene elements, such as a polynucleotide coding sequence and a promoter, positioned in relative positions to enable the proper biological function of the elements, such as a promoter that directs the transcription of the coding sequence. The term “promoter” is used herein to refer to an array of nucleic acid regulatory sequences that direct the transcription of a nucleic acid. As used herein, a promoter includes the necessary nucleic acid sequence near the transcription start site, for example, the TATA element in the polymerase type II promoter. The promoter may also include distal enhancer or repressor elements, which may be located several thousand base pairs from the transcription start site. Other elements that may be present in an expression vector include those that enhance transcription (e.g., enhancers) and those that terminate transcription (e.g., terminators), as well as those that confer certain binding affinity or antigenicity to recombinant proteins produced from the expression vector. The term "single nucleotide polymorphism" or "SNP" refers to a single nucleotide alteration by a polynucleotide, including within an allele. This may include the substitution of one nucleotide with another, as well as the deletion or insertion of a single nucleotide. Most typically, SNPs are diallelelic markers, but triallelelic and tetraallelelic markers may also exist. As a non-limiting example, a nucleic acid molecule containing SNP A / C may contain C or A at the polymorphic position.The terms “subject,” “patient,” and “individual” are used interchangeably herein to include humans or animals. For example, animal subjects may be mammals, primates (e.g., monkeys), domestic animals (e.g., horses, cattle, sheep, pigs, or goats), companion animals (e.g., dogs, cats), laboratory animals (e.g., mice, rats, guinea pigs, birds), animals of veterinary importance, or animals of economic importance. Where used herein, the term “administration” includes oral administration, topical contact, administration as a suppository, intravenous, intraperitoneal, intramuscular, intrafocal, intrathecal, intranasal, or subcutaneous administration to a subject. Administration may be by any route, including parenteral and transmucosal (e.g., buccal, sublingual, palate, gingiva, nose, vagina, rectum, or percutaneous). Parenteral administration may include, for example, intravenous, intramuscular, intraarteriole, intradermal, subcutaneous, intraperitoneal, ventricular, and intracranial. Other modes of delivery include, but are not limited to, the use of liposomal formulations, intravenous infusions, and transdermal patches. The term “treatment” refers to an approach to obtain beneficial or desired results, including, but not limited to, therapeutic and / or preventive benefits. Therapeutic benefits mean therapeutically relevant improvement or effect on one or more diseases, conditions, or symptoms during treatment. For preventive benefits, a composition may be administered to subjects at risk of developing a particular disease, condition, or symptom, or to subjects who may not yet have a disease, condition, or symptom but report one or more physiological symptoms of the disease. The terms “effective dose” or “sufficient dose” refer to a sufficient amount of the drug (e.g., DNA nuclease) to produce a beneficial or desired result. The therapeutically effective dose may vary depending on one or more of the subjects and disease conditions being treated, the subject’s weight and age, the severity of the disease condition, the mode of administration, etc., which can be readily determined by those skilled in the art. The specific amount may vary depending on one or more of the following: the particular active ingredient selected, the type of target cell, the location of the target cell in the target, the drug regimen to be followed, whether it is administered in combination with other compounds, the timing of administration, and the physical delivery system on which it is carried.

[0222] The term "pharmaceutically acceptable carrier" refers to a substance that assists in the delivery of a drug (e.g., a DNA nuclease) to a cell, organism, or subject. A "pharmaceutically acceptable carrier" refers to a carrier or excipient that can be included in a composition or formulation and does not cause significant adverse toxic effects to the patient. Non-limiting examples of pharmaceutically acceptable carriers include water, NaCl, physiological saline, Ringer's lactate solution, usually sucrose, usually glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavorings, and colorants. Those skilled in the art will recognize that other pharmaceutical carriers may be useful in the present invention.

[0223] The term "approximately" in relation to a reference number can include values ​​within a range of plus or minus 10% of that value. For example, the quantity "approximately 10" includes the quantities 9 through 11, including the reference numbers 9, 10, and 11. The term "approximately" in relation to a reference number can also include values ​​within a range of plus or minus 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of that value.

[0224] As used herein, the term “derivative” also refers to longer or shorter polynucleotides / proteins and / or, for example, having a percentage of identity of at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, more preferably at least 99% with the sequences disclosed herein. In the present invention, “at least 70% identity” means that the identity may be at least 70%, or 75%, or 80%, or 85%, or 90%, or 95%, or 100% sequence identity with the sequence referred to. This applies to all identity percentages described. Preferably, the identity percentage is with respect to the full length of the sequence referred to. The derivatives of the present invention also include “functional variants” of polypeptides or polynucleotides, which are polypeptides or polynucleotides that are produced by mutating one or more amino acids or nucleotides in a sequence and maintain their activity. In the present invention, “functional” means, for example, “maintaining their activity.” Polynucleotides having the same nucleotide sequence as the polynucleotides exemplified herein, except for nucleotide substitutions, additions, or deletions in the polynucleotide sequence, are also within the scope of the invention, provided that these variant polynucleotides retain substantially the same relevant functional activity as the polynucleotides specifically exemplified herein (for example, they encode the same amino acid sequence or a protein having the same functional activity as encoded by the exemplified polynucleotides). Therefore, the polynucleotides disclosed herein should be understood to include the variants, derivatized variants, and fragments of the specifically exemplified sequences discussed above. The present invention also aims to create polynucleotide molecules having sequences sufficiently homologous to the polynucleotide sequences of the present invention so as to enable hybridization with their sequences under standard stringent conditions and standard methods (Maniatis, T. et al., 1982).

[0225] 2A self-cleaving peptide The 2A peptide is an 18-22 aa-length peptide that can induce the cleavage of recombinant proteins within cells. The 2A peptide originates from the 2A region in the viral genome.

[0226] The four members of the 2A peptide family are frequently used in life science research. They are P2A, E2A, F2A, and T2A. F2A is derived from foot-and-mouth disease virus 18; E2A is derived from equine rhinitis A virus; P2A is derived from porcine tescovirus-1 2A; and T2A is derived from Tosea assigna virus 2. The peptides preferably contain or consist of the following sequences.

[0227] [Table 4]

[0228] Any ribosome skip sequence can be used within the scope of the present invention. T2A or P2A are preferred.

[0229] Splice acceptor array RNA splicing is a form of RNA processing in which newly created precursor messenger RNA (pre-mRNA) transcripts are converted into mature messenger RNA (mRNA). During splicing, introns (non-coding regions) are removed and exons (coding regions) are joined together.

[0230] Within an intron, a donor site (the 5' end of the intron), a branching site (near the 3' end of the intron), and an acceptor site (the 3' end of the intron) are necessary for splicing. The splice donor site, located at the 5' end of the intron, contains a nearly immutable sequence GU within a larger, less highly conserved region. The splice acceptor site at the 3' end of the intron terminates the intron with a nearly immutable AG sequence. Upstream of AG (in the 5' direction) is a region rich in pyrimidines (C and U) or polypyrimidine tracts. Further upstream of the polypyrimidine pathway is a branching point.

[0231] A "splice acceptor sequence" is a nucleotide sequence that can function as an acceptor site at the 3' end of an intron. The consensus sequence and frequency of human splice regions are described in Ma, SL, et al., 2015. PLoS One, 10(6), p.e0130729.

[0232] Appropriately, the splice acceptor sequence may include the nucleotide sequence (Y)nNYAG (wherein n is 10 to 20) or a variant having at least 90% or at least 95% sequence identity. Appropriately, the splice acceptor sequence may include the sequence (Y)nNCAG (wherein n is 10 to 20) or a variant having at least 90% or at least 95% sequence identity.

[0233] Degradation signal sequence The degradation signal sequence is preferably a CL1, CL2, CL6, CL9, CL10, CL11, CL12, CL15, CL16, SL17, SMN, CIITA, ODc7, ecDHFR, PEST, or Mini ecDHFR sequence. The sequence preferably includes or consists of the following sequences or sequences encoding the following sequences.

[0234] [Table 5]

[0235] For sequences CL2 to SL17, please refer to Gilon, T., Chomsky, O. and Kulka, RG (1998), Degradation signals for ubiquitin system proteolysis in Saccharomyces cerevisiae. The EMBO Journal, 17:2759-2766, https: / / doi.org / 10.1093 / emboj / 17.10.2759 (incorporated herein by reference). For sequences ecDHFR to ODC7, please refer to Tornabene P, Trapani I, Centrulo M, Marrocco E, Minopoli R, Lupo M, Iodice C, Gesualdo C, Simonelli F, Surace EM, Auricchio A. Inclusion of a degron reduces levels of undesired inteins after AAV-mediated protein trans-splicing in the retina. Mol Ther Methods Clin Dev. 2021 Oct See 19;23:448-459.doi:10.1016 / j.omtm.2021.10.004.PMID:34786437;PMCID:PMC8571531 (incorporated herein by reference).

[0236] In some embodiments, the decomposition signal sequence is as follows: - A C-terminal destabilizing peptide that shares structural similarities with misfolded proteins and is therefore recognized by the ubiquitination system, where ubiquitin, through its N-terminal fusion with the donor protein, mediates either direct or both direct proteolysis via the N-terminal ordered pathway, and the N-terminal PB29 degron, like CL1 degron, is a 9-amino acid peptide predicted to fold an artificial stop codon in a structure recognized by enzymes of the ubiquitination pathway, causing premature termination of mRNA, microRNA (miR) targeting sequences; -N-degron and / or C-degron. In some embodiments, N-degron and / or C-degron are independently CL1, PB29, SMN, CIITA, or ODC-degron. Such degradation signals are described in International Publication No. 2016 / 13932, which is incorporated herein by reference as relating to degradation signals.

[0237] Another example of a degradation signal is the degron derived from Escherichia coli dihydrofolate reductase (ecDHFR), as described in International Publication No. 2020 / 079034 (incorporated herein by reference). Further degradation signals include the FKBP12 degradation domain (Banaszynski et al., Cell 126:995-1004, 2006), the PEST degradation domain (Rechsteiner and Rogers, Trends Biochem Sci. 21:267-271, 1996), the UbR tag ubiquitination signal (Chassin et al., Nat Commun. 10:2013, 2019), and destabilizing mutations in human ELRBD (Miyazaki et al., J.Am.Chem.Soc., 134:3942-3945, 2012).

[0238] Adjustment element The constructs of the present invention may include one or more regulatory elements that act pre-transcriptionally or post-transcriptionally. One or more regulatory elements may promote expression in the cells of the present invention.

[0239] A "regulatory element" is any nucleotide sequence that promotes polypeptide expression, for example, by increasing transcript expression or enhancing mRNA stability. Suitable regulatory elements include, for example, promoters, enhancer elements, post-transcriptional regulatory elements, and polyadenylation sites.

[0240] The present invention also relates to constructs that may include regulatory elements that are functional in the intended host cells in which the construct-containing vector will be expressed. Those skilled in the art can select regulatory elements for use in suitable host cells, such as mammalian or human host cells. Examples of regulatory elements include promoters, transcription termination sequences, translation termination sequences, enhancers, signal peptides, degradation signals, and polyadenylation elements.

[0241] The constructs of the present invention may optionally contain transcription termination sequences, translation termination sequences, signal peptide sequences, internal ribosome entry sites (IRESs), enhancer elements, and / or post-transcriptional regulators such as woodchuck hepatitis virus (WHV) post-transcriptional regulators (WPREs). Transcription termination regions can typically be obtained from the 3' untranslated region of a eukaryotic or viral gene sequence. Transcription termination sequences can be positioned downstream of the coding sequence to provide efficient termination. The systems of the present invention typically include transcription termination sites.

[0242] Regulatory elements after transcription The nucleic acid constructs of the present invention may include post-transcriptional regulators. Preferably, a protein-coding sequence is operably linked to one or more further post-transcriptional regulators that can enhance gene expression.

[0243] The construct of the present invention may include a woodchuck hepatitis virus post-transcriptional regulator (WPRE). Preferably, an OAT coding sequence is operably linked to the WPRE.

[0244] Appropriate WPRE sequences will be well known to those skilled in the art (see, for example, Zufferey et al. (1999) Journal of Virology 73:2886-2892; Zanta-Boussif et al. (2009) Gene Therapy 16:605-619). Appropriately, the WPRE is either a wild-type WPRE or a mutant WPRE. For example, a WPRE can be mutated to disable translation of woodchuck hepatitis X protein (WHX) by, for example, mutating the WHX ORF translation start codon.

[0245] Homologous arms The nucleic acid constructs of the present invention may include one or more homologous arms. A “homologous arm” is intended to be a short sequence, typically 2 to 20 bases in length, that can hybridize to at least one sequence adjacent to the target gene.

[0246] Typically, a nucleic acid construct contains two homologous arms, each capable of hybridizing to a sequence adjacent to the target gene.

[0247] Homologous arms are typically present when the genome editing strategy used is MMEJ. [Examples]

[0248] Example 1 Materials and methods Cas9 effector plasmid for gRNA screening The gRNA was manually designed, taking into account the location of the target P23H mutation. The effector plasmid was constructed according to the protocol developed by Zhang's lab. Briefly, the gRNA was generated as Fwd and Rev single-stranded DNA oligonucleotides, which were then phosphorylated and annealed with T4 polynucleotide kinase and T4 ligation buffer (NEB). Correct gRNA annealing was confirmed on a 50% acrylamide gel stained with SYBR Gold Nucleic Acid Stain (ThermoFisher). Subsequently, the gRNA was cloned into the px458 plasmid (#48138;Addgene) using the BbsI site.

[0249] AAV vector plasmid construction A plasmid used for AAV vector production derived from the pAAV2.1 plasmid containing the ITR of AAV serotype 2. Specifically, the inventors used the pAAV2.1 plasmid generated by the inventors' group for a previous publication (4) The exact sequence is reported in the sequence file for reference.

[0250] AAV vector preparation and characterization AAV vectors were prepared using Innovavector SRL by triple transfection of HEK293 cells followed by two CsCl2 purifications. For each viral preparation, the physical titer (GC / mL) was determined by averaging the titers achieved by dot blot analysis and PCR quantification using TaqMan (Applied Biosystems, Carlsbad, CA, USA). The probes used for dot blot and PCR analysis were designed to anneal to the IRBP promoter of the pAAV2.1-IRBP-SpCas9-spA vector and the bGHpA region of the donor DNA vector. The probe lengths varied between 200 and 700 bp (12).

[0251] Culture and transfection of HEK293 cells HEK293 cells were maintained in DMEM containing 10% fetal bovine serum (FBS) and 2 mM L-glutamine (Gibco, Thermo Fisher Scientific, Waltham, MA, USA). Cells were then placed in a 6-well plate (1 × 10⁶). 6 The plasmid is seeded in cells ( / well) and, after 16 hours, is a plasmid encoding a template plasmid consisting of exon 1, intron 1, and exon 2 of a human rhodopsin sequence driven by Cas9, cytomegalovirus promoter (CMV), and different donor DNA, and is obtained by the calcium phosphate method (1 to 2 mg / 1 × 10⁻¹⁶). 6 Cells were transfected. The culture medium was changed after 4 hours. The maximum transfected material was 3 ug. In all cases, the amount of plasmid DNA between wells was balanced using empty vectors as needed.

[0252] Histology and optical and fluorescence microscopy To evaluate eGFP expression after HITI in vitro, 1 × 10 6 HEK293 cells plated in 6 wells at the specified density were transfected as described above. 72 hours after transfection, the cells were analyzed under Apotome (Carl Zeiss, Oberkochen, Germany) with ZEN software (Carl Zeiss) and appropriate excitation and detection settings for EGFP.

[0253] Cell fluorescence analysis HEK293 cells seeded in 6-well plates were washed once with PBS, detached with trypsin 0.05% EDTA (Thermo Fisher Scientific, Waltham, MA, USA), washed twice with PBS, and resuspended in a sorting solution containing PBS, 5% FBS, and 2.5 mM EDTA. Cells were analyzed using a BD FACS ARIA III (BD Biosciences, San Jose, CA, USA) equipped with BD FACSDiva software (BD Biosciences) with appropriate excitation and detection settings for EGFP. A threshold for fluorescence detection was set to untransfected cells, and a minimum of 10,000 cells / sample were analyzed. A minimum of 50,000 GFP+ cells were sorted and used for DNA extraction.

[0254] Animal models Mice were housed in a TIGEM animal house (Pozzuoli, Italy) and maintained under a 12-hour light / dark cycle. hRHO-P23H-TagRFP mice (8) (referred to as hRHO-P23H) were kindly provided by Prof. Theodore Wensel. Mice were maintained by mating homozygous females and males. Experimental heterozygous animals were created by crossing homozygous P23H mice with C57BL / 6 mice. The genotype of the mice was confirmed by PCR analysis of genomic DNA (extracted from the tip of the mouse phalanx). Homozygous mice presented a 975 bp PCR product, while heterozygous mice presented both 975 bp and 195 bp products. Wild-type mice presented only a 195 bp PCR product. The primers used for PCR amplification are listed in Table 1 below.

[0255] [Table 6]

[0256] Subretinal injection of AAV vector into hRHO-P23H mice This study was conducted in accordance with the Association for Research in Vision and Ophthalmology (ARVO) statement on the use of animals in ophthalmic and vision research and the Italian Ministry of Health regulations on animal treatment (Ministry of Health authorization number: 252 / 2022-PR).

[0257] Mice (1 or 4 weeks old) were anesthetized with an intraperitoneal injection of ketamine / xylazine at 2 mL / 100 g body weight and then an AAV2 / 8 vector was delivered subretinally via a transscleral choroidal approach as described by Liang et al. (13, 14). 1 μL of vector solution was injected into the eye. The AAV2 / 8 dose (GC / eye) was 1, 5 * 10 9 ~2, 5 * 10 9 GC; thus, co-injection resulted in a maximum of 3 - 5×10 9 GC / eye.

[0258] Electrophysiological recordings For electroretinogram analysis, hRHO-P23H mice were dark-adapted for 3 hours. The mice were anesthetized and placed in a stereotaxic apparatus under dim red light. The pupils were dilated with drops of 0.5% tropicamide (Visufarma, Rome, Italy), and the body temperature was maintained at 37.5°C.

[0259] Flash light was generated by a Ganzfeld stimulator (CSO, Costruzione Strumenti Oftalmici, Florence, Italy). The electrophysiological signal was recorded through a gold plate electrode inserted under the lower eyelid in contact with the cornea. The electrode for each eye was pointed at a needle electrode inserted subcutaneously at the level of the corresponding frontal area. Different electrodes were connected to a two-channel amplifier. After completion of the response obtained under dark-adapted conditions (dark), the recording session was continued for the purpose of dissecting the cone pathway mediating the light response (light). To minimize noise, different responses induced by light were averaged for each luminance step. The maximum dark responses of rods and cones were obtained with two flashes at 0.7 Hz and 20 cd s / m 2The photopic cone response was measured under dark conditions (scoping) with a light intensity of 0.7 Hz and 20 cd s / m 2 Light intensity of 50 cd / m 2 Separated under bright conditions with a continuous background of white light.

[0260] Retinal frozen sections and fluorescence imaging To evaluate eGFP expression in the retina after HITI in histological sections, hRHO-P23H mice were subretinally injected with IRBP-Cas9 and a donor DNA AAV vector. After one month, the mice were sacrificed, and the eyes were fixed overnight with 4% paraformaldehyde and infiltrated overnight with 30% sucrose. The cornea and lens were then dissected, and the visual target was embedded in an optimal cutting temperature compound (OCT matrix; Kaltek, Padua, Italy). Serial frozen retinal sections 10 micrometers thick were cut along the horizontal meridian, gradually distributed onto slides, and mounted with Vectashield containing DAPI (Vector Lab, Peterborough, UK). The frozen sections were then analyzed under a confocal LSM-700 microscope (Carl Zeiss, Oberkochen, Germany) using appropriate excitation and detection settings for eGFP, RFP, and DAPI, respectively. To evaluate HITI efficiency in frozen mouse retinal sections after AAV administration, the highest transduction regions were selected from three sections / eyes, acquired at 40x fold, and then analyzed using ImageJ software (http: / / rsbweb.nih.gov / ij / ). For each image, the minimum 500 PRs identified by DAPI staining were manually counted using the ImageJ plugin ITCN. PRs with signals consistent with eGFP expression were clearly identified based on their shape observed in the z-stack of the analyzed sections, as well as the presence of the eGFP+ve outer segment.

[0261] Optomotley The visual acuity of mice was measured using the OptoMotry eye movement system (www.cerebralmechanics.com). The mice were placed on a pedestal located in the center of a chamber consisting of four inwardly facing LCD monitors. After a few minutes of adaptation to the new environment, the test began. Patterns of grid lines rotating clockwise and counterclockwise appeared on the monitors, randomly determined by OptoMotry® software (version VR 1.4.0). A positive response was considered to occur when the mouse followed the direction of the grid rotation.

[0262] DNA extraction Samples (GFP+ selected HEK293 cells and retinal tissue) were lysed in either a commercially available lysis buffer (GeneArt® Genome Segmentation Detection Kit, Invitrogen, Carlsbad, California, United States) or a conventional lysis buffer for DNA extraction from tissue (400 mM NaCl, 1% SDS, 20 mM TRIS-CL (pH 8.0), 5 mM EDTA (pH 8.0)). Proteinase K was added to the lysis buffer, and the solution was dissolved at 80°C for 15 minutes before inactivation. 50 ng to 200 ng of DNA were used for PCR amplification of regions containing the Cas9 target site (the first intron of RHO) from either the pCMV-hRHO (exon 1-intron 1-exon 2) plasmid or the mouse genome. The primers used are shown in Table 2:

[0263] [Table 7]

[0264] Characterization of HITI junctions Junction PCR amplification DNA extracted from the retina was used for PCR amplification of the HITI junction. Both 5' and 3' junctions of the integration were amplified. For the 5' junction, the inventors used a forward primer that recognized the region downstream of the first intron of the hRHO gene prior to the cleavage site, and a reverse primer that recognized the splice acceptor Site-3XFLAG on the donor DNA. For the 3' junction, the inventors designed a forward primer that recognized the bGH polyA sequence of the donor DNA, and a reverse primer that recognized the sequence within intron 1 of the human RHO after the cleavage site.

[0265] [Table 8]

[0266] RNA extraction and hRHO expression Total RNA was extracted from both EGFP+ / DsRed- and EGFP+ / DsRed+ sorted HEK293 cells using RNeasy MiniKit (QIAGEN). RNA (5-15 ng) was used as a template for One-Step RT-qPCR (NEB, Massachusetts, USA) using a LightCycler 96 (Roche Molecular Systems, Inc.) according to the manufacturer's instructions. hRHO expression levels were normalized relative to the corresponding housekeeping gene (ACTB). Relative quantitative analysis was performed using the 2(-ΔΔCt) method. The primers used for real-time qPCR amplification are reported in Table 4.

[0267] [Table 9]

[0268] result Optimizing HITI donors leads to higher efficiency in vitro. The inventors designed an optimized (optm) HITI construct to enhance HITI efficiency. This HITI construct involves substituting three tandem stop codons and a translation initiation site (IRES / Kozak) with a CL1 degradation signal tagged with 3XFLAG; this signal is fused to an active fulin cleavage site to enhance the degradation of the cleaved RHO protein. Prior to this, an upstream splice acceptor sequence existed for efficient splicing at the target site of the RHO locus. Upon cleavage by CRISPR-Cas9 and integration in the correct orientation, the donor DNA will replace the endogenous RHO sequence at the genomic locus. Since the donor DNA is a promoter-free conditioning sequence (cds), it is expressed only upon correct integration from the endogenous promoter (Figure 2a). In addition to RHO cds, the HITI donor also possesses eGFP cds, allowing cells expressing eGFP to determine the efficiency of integration. For this purpose, HEK 293 cells were transfected with a newly designed HITI donor plasmid consisting of i) a Cas9 plasmid under the control of a CMV promoter, ii) a template plasmid driven by the CMV promoter that encodes human RHO exon 1, intron 1, and exon 2 lacking the polyadenylation signal described above, and iii) a U6 expression cassette consisting of either guide RNA (gRNA) or scrambled RNA sequence to the first intron. 72 hours after transfection, cells were imaged with a fluorescence microscope equipped with appropriate excitation and emission filters (to detect eGFP-positive cells) and collected for quantitative analysis of RHO transcripts by qPCR.

[0269] By including the CL1 degradation signal, selective degradation of the 5'-terminus truncated endogenous RHO protein is achieved without affecting the production of the full-length protein (Figure 2b). This degradation signal is further fused to the ribosome skipping sequence P2A(12), which assists in the translation of the RHO coding sequence fused to the eGFP reporter protein via T2A, followed by WPRE and bovine growth hormone (BGH) polyA sequences. The inventors observed that the level of hRHO transcript was approximately 2-fold higher in cells transfected with the newly optimized HITI donor compared to cells transfected with the classical 3×STOP donor (Figure 2c), which correlated with higher fluorescence intensity in cells transfected with the optimized HITI donor compared to cells with the classical 3XSTOP HITI donor.

[0270] Evaluation of HITI efficiency in vivo The inventors evaluated the HITI efficiency in a recently reported P23H knock-in mouse model of autosomal dominant retinitis pigmentosa (RP4) in which the endogenous RHO allele is replaced by a red fluorescent protein-tagged (RFP) human RHO (hRHO-P23H-tagRFP) having a P23H mutation (11).

[0271] The inventors administered subretinal injections to 4-week-old hRHO-P23H-tagRFP heterozygous mice using two different AAV8 vectors, one encoding the nuclease Sp. Cas9, under control, was administered at doses of 1.5 × 10^9 per vector / eye, containing a photoreceptor-specific promoter, photoreceptor-retinoid-binding protein (IRBP), and a second AAV carrying HITI donor DNA (carrying both RHO and GFP to label the photoreceptor where integration occurred). The contralateral eye served as a control. Animals were sacrificed one month after treatment, and eyes were collected for further analysis. HITI efficiency was assessed by fluorescence microscopy imaging on retinal OCT sections by counting the number of GFP-positive cells in the outer granular layer (ONL) on DAPI-stained nuclei. The inventors observed a maximum HITI efficiency of 12 ± 8% in the transduction region (n=4; Figure 3a). Furthermore, the inventors also evaluated on-target HITI integration by performing HITI PCR amplification of both 5' and 3' junctions between the HITI donor and the endogenous locus. Sanger sequencing analysis showed that HITI occurred precisely.

[0272] Predictively, we plan to evaluate improvements in retinal phenotype (electroretinogram ERG, visual acuity, and morphology) at advanced time points and potential off-target editing events in both heterozygous and homozygous hRHO-P23H-tagRFP mice. Preliminary data from homozygous hRHO-P23H-tagRFP mice injected subretin with AAV-HITI gRNA (optimized HITI) at p7 (1 week of age) show an improved ERG response compared to AAV-HITI scRNA-treated eyes one month after treatment (Figure 3b).

[0273] Example 2 AAV-HITI therapeutic efficacy in hRHO-P23H-tagRFP heterozygous mice Heterozygous hRHO-P23H-tagRFP mice were injected subretinally at 4 weeks of age with two different AAV8 vectors, one of which encoded the nuclease Sp. Cas9 was under the control of a second AAV carrying a photoreceptor-specific promoter, photoreceptor-retinoid binding protein (IRBP), and one of the following donor DNA vectors: i. HITIgRNA ii. MMEJgRNA iii, at doses of 1.5 × 10^9 per vector / eye of scRNA. The construct used for HITIgRNA was p1501 (SEQ ID NO: 32), with p1503 (SEQ ID NO: 34) for each scRNA, and the construct used for MMEJgRNA was p1515 (SEQ ID NO: 72), with p1519 (SEQ ID NO: 73) for each scRNA.

[0274] To evaluate the improvement in the retinal phenotype, the inventors performed electroretinography (ERG) at different time points (p90-p150-p260-p360) and OCT analysis at p360 after AAV delivery.

[0275] In eyes injected with AAV-HITI gRNA and AAV-MMEJ gRNA expression cassettes, the inventors found significant improvement compared to eyes injected with AAV-scRNA, as measured by both ERG (Figure 4A-B) and OCT analysis (Figure 4C). Finally, the inventors also measured visual acuity using p360 and found significant improvement in eyes treated with AAV-HITI gRNA and AAV-MMEJ gRNA (Figure 4D).

[0276] References 1. Trapani I,Auricchio A.Seeing the Light after 25 Years of Retinal Gene Therapy.Trends Mol Med[Internet].2018 Aug 1;24(8):669-81.Available from:https: / / doi.org / 10.1016 / j.molmed.2018.06.006 2. Cong L,Ran FA,Cox D,Lin S,Barretto R,Habib N,et al.Multiplex Genome Engineering Using CRISPR / Cas Systems.Science(1979)[Internet].2013 Feb 15;339(6121):819-23.Available from:https: / / doi.org / 10.1126 / science.1231143 3. Yanik M,Muller B,Song F,Gall J,Wagner F,Wende W,et al.In vivo genome editing as a potential treatment strategy for inherited retinal dystrophies.Prog Retin Eye Res[Internet].2017;56:1-18.Available from:https: / / www.sciencedirect.com / science / article / pii / S1350946216300441 4. Hartong DT,Berson EL,Dryja TP.Retinitis pigmentosa.The Lancet[Internet].2006 Nov 18;368(9549):1795-809.Available from:https: / / doi.org / 10.1016 / S0140-6736(06)69740-7 5. Kaushal S,Khorana HG.Structure and Function in Rhodopsin.7.Point Mutations Associated with Autosomal Dominant Retinitis Pigmentosa.Biochemistry[Internet].1994 May 1;33(20):6121-8.Available from:https: / / doi.org / 10.1021 / bi00186a011 6. Suzuki K,Tsunekawa Y,Hernandez-Benitez R,Wu J,Zhu J,Kim EJ,et al.In vivo genome editing via CRISPR / Cas9 mediated homology-independent targeted integration.Nature[Internet].2016;540(7631):144-9.Available from:https: / / doi.org / 10.1038 / nature20565 7. Tornabene P,Ferla R,Llado-Santaeularia M,Centrulo M,Dell’Anno M,Esposito F,et al.Therapeutic homology-independent targeted integration in retina and liver.Nat Commun[Internet].2022;13(1):1963.Available from:https: / / doi.org / 10.1038 / s41467-022-29550-8 8. Robichaux MA,Nguyen V,Chan F,Kailasam L,He F,Wilson JH,et al.Subcellular localization of mutant P23H rhodopsin in an RFP fusion knock-in mouse model of retinitis pigmentosa.Dis Model Mech[Internet].2022 May 6;15(5):dmm049336.Available from:https: / / doi.org / 10.1242 / dmm.049336 9. Trapani I,Toriello E,de Simone S,Colella P,Iodice C,Polishchuk E v,et al.Improved dual AAV vectors with reduced expression of truncated proteins are safe and effective in the retina of a mouse model of Stargardt disease.Hum Mol Genet[Internet].2015 Dec 1;24(23):6811-25.Available from:https: / / doi.org / 10.1093 / hmg / ddv386 10. Gilon T,Chomsky O,Kulka RG.Degradation signals for ubiquitin system proteolysis in Saccharomyces cerevisiae.EMBO J[Internet].1998 May 15;17(10):2759-66.Available from:https: / / doi.org / 10.1093 / emboj / 17.10.2759 11. Thomas G.Furin at the cutting edge:from protein traffic to embryogenesis and disease.Nat Rev Mol Cell Biol[Internet].2002 Oct;3(10):753-66.Available from:https: / / pubmed.ncbi.nlm.nih.gov / 12360192 12. Doria M,Ferrara A,Auricchio A.AAV2 / 8 Vectors Purified from Culture Medium with a Simple and Rapid Protocol Transduce Murine Liver,Muscle,and Retina Efficiently.Hum Gene Ther Methods[Internet].2013 Sep 12;24(6):392-8.Available from:https: / / doi.org / 10.1089 / hgtb.2013.155 13. Liang FQ,Dejneka NS,Cohen DR,Krasnoperova N v.,Lem J,Maguire AM,et al.AAV-Mediated Delivery of Ciliary Neurotrophic Factor Prolongs Photoreceptor Survival in the Rhodopsin Knockout Mouse.Molecular Therapy.2001 Feb 1;3(2):241-8. 14. Liang FQ,Anand V,Maguire AM,Bennett J.Intraocular Delivery of Recombinant Virus.In:Rakoczy PE,editor.Vision Research Protocols[Internet].Totowa,NJ:Humana Press;2001.p.125-39.Available from:https: / / doi.org / 10.1385 / 1-59259-085-3:125 15. Ja-Hwan Seol,Eun Yong Shim and Sang Eun Lee.Microhomology-mediated end joining:Good,bad and ugly.Mutat Res.2018 May;809:81-87.

Claims

1. a) - Degradation signal sequence, - enzyme cleavage site, - Ribosome skipping sequence, - Exogenous DNA sequence A donor nucleic acid containing, The donor nucleic acid is adjacent to the inverse targeting sequence at 5' and 3', b) an oligonucleotide complementary to the targeting sequence, c) A nuclease that recognizes the target sequence, Gene editing systems, including those mentioned above.

2. The gene editing system according to claim 1, wherein the donor nucleic acid elements are in the enumerated 5'-3' order.

3. The gene editing system according to claim 1 or 2, wherein the donor nucleic acid preferably further comprises a splice acceptor sequence at 5' of the degradation signal sequence.

4. The gene editing system according to any one of claims 1 to 3, wherein the degradation signal sequence is selected from the group consisting of CL1, CL2, CL6, CL9, CL10, CL11, CL12, CL15, CL16, SL17, SMN, CIITA, ODc7, ecDHFR, PEST, and Mini ecDHFR sequences.

5. A gene editing system according to any one of claims 1 to 4, wherein the degradation signal sequence is CL1, and / or the enzyme cleavage site is a fulin cleavage site, preferably active, and / or optimized, and / or the ribosome skip sequence is a ribosome skip sequence derived from porcine tescovirus-12A (P2A).

6. The aforementioned targeting sequence is a sequence included in the rhodopsin (Rho) gene, Preferably, the targeting sequence is - Preferably the first intron of the RHO gene derived from human, mouse, or pig, - Preferably the first exon of the RHO gene derived from a human, mouse, or pig. Composed of within, and / or the exogenous DNA sequence comprises a coding sequence for a therapeutic protein, such as rhodopsin, preferably comprising one or more rhodopsin exons or fragments thereof. and / or the targeting sequence is a guide RNA (gRNA) target site, and / or the oligonucleotide complementary to the targeting sequence is a guide RNA that hybridizes to the targeting sequence of the gene or its complementary strand, and / or the oligonucleotide complementary to the targeting sequence is under the control of a promoter, preferably a U6 promoter. and / or the inverted targeting sequence is an inverted sequence with respect to the targeting sequence, and / or preferably contains a PAM sequence in its 3'. A gene editing system according to any one of claims 1 to 5.

7. The donor nucleic acid is - Preferably a linker between the enzyme cleavage site and the ribosome skipping sequence; - Preferably a further ribosome skipping sequence localized at 3' of the exogenous DNA sequence; - Preferably a post-transcriptional regulatory element localized to the 3' end of the exogenous DNA sequence or further ribosome skipping sequence; - A transcription termination sequence preferably localized to the 3' end of the post-transcriptional regulatory element or the 3' end of the exogenous DNA sequence or further ribosome skip sequence. It further includes one or more of the following: Preferably, the post-transcriptional regulatory element is a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), and / or the transcription termination sequence is a polyadenylation signal sequence, preferably bovine growth hormone polyA (BGH polyA), and / or the further ribosome skip sequence is a T2A sequence. A gene editing system according to any one of claims 1 to 6.

8. The donor nucleic acids are arranged in a 5'-3' order: - Inverted targeting sequence having a protospacer adjacent motif (PAM) sequence; - Splice acceptor array - Degradation signal sequence, preferably CL1 sequence, - Enzyme cleavage site, preferably fulin cleavage site, - Ribosome skip sequence, preferably P2A sequence, - Exogenous DNA sequence, preferably one or more rhodopsin exons, - Further ribosome skip sequences, preferably T2A, - Transcription termination sequence, and - Further inverse targeting sequences having the protospacer adjacent motif (PAM) sequence A gene editing system according to any one of claims 1 to 7, including the above.

9. The donor nucleic acid further comprises at least one homologous arm, preferably two homologous arms, more preferably, - Preferably a first homologous arm localized at 5' of the splice acceptor array, - Preferably a second homologous arm localized at 3' of the transcription termination sequence, A gene editing system according to any one of claims 1 to 8, including the above.

10. The donor nucleic acids are arranged in a 5'-3' order. - Inverted targeting sequence having a protospacer adjacent motif (PAM) sequence; - First homologous arm - Splice acceptor array - Degradation signal sequence, preferably CL1 sequence, - Enzyme cleavage site, preferably fulin cleavage site, - Ribosome skip sequence, preferably P2A sequence, - Exogenous DNA sequence, preferably one or more rhodopsin exons, - Further ribosome skip sequences, preferably T2A, - Transcription termination sequence, - Second homologous arm and - Further inverse targeting sequences having the protospacer adjacent motif (PAM) sequence The gene editing system according to claim 9, including the following:

11. a) A sequence in which the ribosome skip sequence has at least 80% identity with SEQ ID NO: 1 (GCCAACCAACTTCTCCCCTGCTGAAGCAGGCCCGCGAGAGGTGGAGAGAGAACCCCCGGGCCCC) or SEQ ID NO: 2 (GGAGCGGAGAGGGCAGAGGAAGTCCTGCTAACATGCGGGTGAACGTCGAGAGAGATCCCTGGACCT) Or a sequence that includes, or essentially contains, a functional fragment thereof, the sequence that codes for Sequence ID 3 (GSG) E G R G S L L T C G D V E E N P G P or the sequence that codes for Sequence ID 4 (GSG) A T N F S L L K Q A G D V E E N P G P, and / or b) The inverse targeting sequence contains, or essentially contains, a sequence or functional fragment thereof that has at least 95% identity with SEQ ID NO: 5 (ACACCAGAGACTTGGAACG), and / or contains the SpCas9 PAM sequence (CGG), and / or c) The guide RNA contains, or essentially contains, a sequence or functional fragment thereof that has at least 95% identity with sequence number 5 (ACACCAGAGACTTGGAACG), d) The oligonucleotide complementary to the targeting sequence contains, or essentially contains, a sequence or functional fragment thereof that has at least 95% identity with SEQ ID NO: 5 (ACACCAGAGACTTGGAACG), and / or e) The decomposition signal sequence contains, or essentially contains, a sequence that has at least 80% identity with SEQ ID NO: 6 (gccctgcaagaaactggtttcagcagccctgagccaccttcgtgaccacctg), and / or f) The enzyme cleavage site contains, or essentially contains, a sequence that is at least 95% identical to sequence number 7 (CGAAAAAAGAAGA), and / or g) The linker contains, or essentially contains, a sequence having at least 95% identity with ggaagcgga, and / or h) The splice acceptor sequence contains, or essentially contains, a sequence that has at least 80% identity with sequence number 9 (GATAGGCAACCTATTGGGTCTACTGAACATCCACACTTTGGCCTTTCTCTCCAACAGGTGT), and / or i) The exogenous DNA sequence is the following sequence: Sequence ID No. 10 (ATGAATGGCACAGAAGGCCCTAACTTCTACGTGCCCTTCTCCAATGCGACGGGTGTGGTACGCAGCCCCTTCGAGTACCCACAGTACTAC CTGGCTGAGCCATGGCAGTTCTCCATGCTGGCCGCCTACATGTTTCTGCTGATCGTGCTGGGCTTCCCCATCAACTTCCTCACGCTCTACG TCACCGTCCAGCACAAGAAGCTGCGCACGCCTCTCAACTACATCCTGCTCAACCTAGCCGTGGCTGACCTCTTCATGGTCCTAGGTGGCTT CACCAGCACCCTCTACACCTCTCTGCATGGATACTTCGTCTTCGGGCCACAGGATGCAATTTGGAGGGCTTCTTTGCCACCCTGGGCG), SEQ ID NO: 11 (GTGAAATTGCCCTGTGGTCCTTGGTGGTCCTGGCCATCGAGCGGTACGTGGTGGTGTGTAAGCCCATGAGCAACTTCCGCTTCGG GGAGAACCATGCCATCATGGGCGTTGCCTTCACCTGGGTCATGGCGCTGGCCTGCGCCGCACCCCACTCGCCGGCTGGTCCAG); Sequence ID 12 (GTACATCCCCGAGGGCCTGCAGTGCTCGTGTGGAATCGACTACTACACGCTCAAGCCGGAGGTCAAACAACGAGTCTTTTGTCA TCTACATGTTCGTGGTCCACTTCACCATCCCCATGATTATCATCTTTTTCTGCTATGGGCAGCTCGTCTTCACCGTCAAGGAG); Sequence ID 13 (GCCGCTGCCCAGCAGCAGGAGTCAGCCACCACACAGAAGGCAGAGAGAAGGAGGGTCACCCG CATGGTCATCATCATGGTCATCGCTTTCCTGATCTGCTGGGTGCCCTACGCCAGCGTGGCA TTCTACATCTTTCACCCACCAGGGCTCCAACTTCGGTCCCCATCTTCATGACCATCCCAGCGT TCTTTGCCAAGAGCGCCGCCATCTACAACCCTGTCATCTATATCATGATGAACAAGCAG); Sequence ID 14 A sequence that contains, or essentially contains, at least 80% identity with at least one of (TTCCCGGAACTGCATGCTCACCACCATCTGCTGCGGCAAGAACCCCACTGGGGTGGAACGAATGAGGCCTCCTGCTACCGTGTTCCAAGAACGGGAGAAGCCAGCAAGGGGGCACCACCA), and / or j) Woodchuck hepatitis virus post-transcriptional regulatory element (WPre) SEQ ID NO: 15 (Taagcttggatccaatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctc cttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttct cctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgt gcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggacttttcg ctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacagggctcggctgt tgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacct It contains, or essentially has, an array having at least 80% identity with (ggattctgcggggagacgtccttgctgctacgtacgtcccctggccctcggccctcgggccctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggcctcggc k) The bovine growth hormone polyadenylation signal (BGH pA) corresponds to Sequence ID No. 16 (GCCTCGACTGTGCCTTCTAGTTTGCCAGCCATCTGTTTGTGTTTGCCCTCCCTCGTGCCCTCTCTTGTGCCCCTGGGAAGGTGCCCACTCCCCACTGTTCCCTCTCTAATAAAAAATGAGGGAAAATGTGCCATTCGCCATGTGTGTGAGTTAGTGTGTCATATTTCTTTCTGGGGGGGTGGGGGTGGGCCAGCACAGCAAGCAAGGGGGGAAGGAATGTGGGAAGCAATAGCAGCCATGCCTGGGGGA) contains, or essentially contains, a sequence having at least 80% identity with (GCCTCGACTGTGTGTTAGTGTGCCAGCCATGTGGGGGA), and / or l) The homologous arm is sequence number 66 (ctccctgccgg) or sequence number 68 Table 1 A sequence that has at least 80% identity with respect to, or that essentially has, A gene editing system according to any one of claims 1 to 10.

12. The gene editing system according to any one of claims 1 to 11, wherein the nuclease is selected from CRISPR nuclease, TALEN, DNA guide nuclease, meganuclease, and zinc finger nuclease, and preferably the nuclease is a CRISPR nuclease selected from the group consisting of Cas9, Cpf1, Cas12b (C2cl), Cas13a (C2c2), Cas3, Csf1, Cas13b (C2c6), and C2c3 or their variants, for example, SaCas9 or VQR-Cas9-HF1.

13. A gene editing system according to any one of claims 1 to 12, or a vector comprising a donor nucleic acid and / or oligonucleotide complementary to the targeting sequence, and / or a nuclease that recognizes the targeting sequence as defined in any one of claims 1 to 12, wherein the vector is a viral vector, preferably selected from the group consisting of adeno-associated vectors (AAVs), adenovirus vectors, lentiviral vectors, integrase-deficient lentiviral vectors, retroviral vectors, or nonviral vectors, and preferably selected from the group consisting of polymer-based, particle-based, lipid-based, peptide-based delivery vehicles or combinations thereof, for example, selected from the group consisting of cationic polymers, micelles, liposomes, exosomes, microparticles, and nanoparticles including lipid nanoparticles (LNPs). Preferably, the viral vector further comprises a 5'-terminal repeat (5'-TR) nucleotide sequence and a 3'-terminal repeat (3'-TR) nucleotide sequence, preferably the 5'-TR being a 5'-inverted terminal repeat (5'-ITR) nucleotide sequence and the 3'-TR being a 3'-inverted terminal repeat (3'-ITR) nucleotide sequence, preferably the ITR being derived from the same or different viral serotypes, and preferably the virus being AAV, preferably serotype 2 AAV, in the vector.

14. A vector comprising a construct containing the donor nucleic acid and a complementary oligonucleotide, wherein the construct contains or essentially contains a sequence having at least 80, at least 85, at least 90, or at least 95% identity with SEQ ID NO: 32 or SEQ ID NO:

72.

15. A host cell comprising a gene editing system according to any one of claims 1 to 12 or a vector according to claim 13 or 14.

16. A virus particle comprising a gene editing system according to any one of claims 1 to 12, or a vector according to claim 13 or 14, wherein the virus particle preferably comprises an AAV capsid protein, and more preferably comprises an AAV capsid protein or derivative thereof of an AAV serotype selected from one or more of the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and AAV10, more preferably a capsid protein from an AAV2 or AAV8 serotype.

17. A pharmaceutical composition comprising a gene editing system according to any one of claims 1 to 12, or a vector according to claim 13 or 14, a host cell according to claim 15, a viral particle according to claim 16, and a pharmaceutically acceptable carrier.

18. A gene editing system according to any one of claims 1 to 12, or a vector according to claim 13 or 14, a host cell according to claim 15, a virus particle according to claim 16, or a pharmaceutical composition according to claim 17, for use as a pharmaceutical.

19. At least the mutant allele is replaced with a correct copy of the gene provided by the donor DNA, preferably both the mutant allele and the wild-type allele are replaced with a correct copy of the gene provided by the donor DNA, for use in the treatment of hereditary diseases and / or autosomal dominant hereditary diseases, or for use in the treatment of hereditary and general diseases resulting from the acquisition of toxic function, preferably including retinal dystrophy, such diseases: retinitis pigmentosa, cone dystrophy or cone-rod dystrophy, macular degeneration, e.g., Stargardt disease (ELOVL4), von Hippel-Lindau, retinoblastoma, RP4 (RHO; see OMIM: 180380), RP63 (see OMIM: 614494), CO A gene editing system according to any one of claims 1 to 12, selected from the group consisting of RD1 (cone-rod dystrophy 1; see OMIM: 600624), CORD17 (cone-rod dystrophy 17; see OMIM: 615163), BEST1 (bestrophin-1; see best disease; yolk-like macular dystrophy protein 2; see OMIM: 607854), OPA1 (OPA1 mitochondrial dynamin-like GTPase; see OMIM: 605290), neurological disorders, liver diseases, metabolic disorders, lipofuscinosis (such as Batten disease), preferably a dominant inherited eye, for example retinal degeneration, preferably retinitis pigmentosa, neurological disorders and liver diseases, or a vector according to claim 13 or 14, a host cell according to claim 15, a virus particle according to claim 16, or a pharmaceutical composition according to claim 17.

20. A gene editing system according to any one of claims 1 to 12, for use in the treatment of recessive genetic disorders in which at least one allele is replaced with a correct copy of the gene provided by the donor DNA, or for use in the treatment of genetic and general diseases resulting from loss of function, preferably the disease being hemophilia, diabetes mellitus, lysosomal storage disorders including mucopolysaccharidosis (MPSI, MPSII, MPSIIIIA, MPSIIIIB, MPSIIIIC, MPSIVA, MPSIVB, MPSVII), sphingolipidosis (Fabry disease, Gaucher disease, Niemann-Pick disease, GM1 gangliosides), lipofuscinosis (Batten disease, etc.), mucolipidosis, adenilosuccinate deficiency, hemophilia A and B, ALA dehydration deficiency, or adrenoleukodystrophy, or a vector according to claim 13 or 14, a host cell according to claim 15, a viral particle according to claim 16, or a pharmaceutical composition according to claim 17.

Images