tRNA-based methods and related compositions

Abstract

The present invention relates to methods for determining the effect of a drug on tRNA acylation, methods for determining the acylation state or efficiency of tRNA, and methods for producing polypeptides. The present invention also relates to split tRNA, fusion RNA molecules, and labeled tRNA or portions of tRNA. The present invention further relates to nucleic acid constructs comprising nucleic acids encoding cyclically substituted transcripts. Furthermore, the present invention relates to proteins, enzymes, and synthases obtained by the methods disclosed herein or by using the products disclosed herein.

Description

[Technical Field] 【0001】 The present invention relates to methods for determining the effect of a drug on tRNA acylation, methods for determining the acylation state or efficiency of tRNA, and methods for producing polypeptides. The present invention also relates to split tRNA, fusion RNA molecules, and labeled tRNA or tRNA portions. The present invention further relates to nucleic acid constructs comprising nucleic acids encoding a circularly permuted transcript. Furthermore, the present invention relates to proteins, enzymes, and synthases obtained by the methods disclosed herein or by using the products disclosed herein. [Background technology] 【0002】 The genetic code of living cells is synthesized through site-specific incorporation of hundreds of non-canonical amino acids (ncAAs) into proteins (Dumas, A., Lercher, L., Spicer, CD & Davis, BG Designing logical codon reassignment - Expanding the chemistry in biology. Chem Sci 6, 50-69, doi:10.1039 / c4sc01534g (2015), Young, DD & Schultz, PG Playing with the molecules of life. ACS chemical biology 13, 854-870 (2018)), as well as the encoded synthesis of non-canonical polymers, macrocyclic peptides, and depsipeptides (Chin, JW Expanding and reprogramming the genetic code. Nature 550, 53-60, doi:10.1038 / nature24031 (2017), De La Torre, D. & Chin, JW Reprogramming the genetic code. Nature Reviews Genetics 22, 169-184, doi:10.1038 / s41576-020-00307-7 (2021), Robertson, WE et al. Sense codon reassignment enables viral resistance and encoded polymer synthesis. Science 372, 1057-1062 (2021), Spinck, M. et al. Genetically programmed cell-based synthesis of non-natural peptide and depsipeptide macrocycles. Nature Chemistry 15, 61-69 (2023)) are being reprogrammed to enable this.Despite significant advances, monomers that can be site-specifically incorporated into proteins within cells are essentially limited to α-L amino acids with variant side chains, and closely related hydroxy acids. A wider range of monomers are being incorporated into in vitro translation reactions (Ellman, JA, Mendel, D. & Schultz, PG Site-specific incorporation of novel backbone structures into proteins. Science 255, 197-200 (1992), Mendel, D., Cornish, VW & Schultz, PG Site-directed mutagenesis with an expanded genetic code. Annual review of biophysics and biomolecular structure 24, 435-462 (1995), Hecht, SM Expansion of the genetic code through the use of modified bacterial ribosomes. Journal of molecular biology 434, 167211 (2022), Katoh, T. & Suga, H. In vitro genetic code reprogramming for the expansion of usable noncanonical amino acids. Annual Review of Biochemistry 91, 221-243). (2022)) (mainly for short peptides), these in vitro techniques cannot be extended to living cells. (S)β. 3 -parabromo-homophenylalanine((S)β 3-pBrhF) has been incorporated at very low levels in competition with Phe at Phe codons in Escherichia coli (E. coli) using forced phenylalanine (Phe) starvation conditions (Melo Czekster, C., Robertson, WE, Walker, AS, Soll, D. & Schepartz, A. In Vivo Biosynthesis of a beta-Amino Acid-Containing Protein. J Am Chem Soc 138, 5194-5197, doi:10.1021 / jacs.6b01023 (2016)); this method yields a mixture of amino acids at all Phe codons and (S)β at a single position corresponding to a single codon, which is necessary to reprogram the gene code. 3 - Does not enable site-specific integration of pBrhF. 【0003】 The encoded, site-specific incorporation of non-canonical monomers (ncMs) by cellular translation requires both acylation of orthogonal tRNAs using ncMs by orthogonal synthases and ribosomal polymerization of ncMs into polymer chains (Figure 1). Current methods for modifying aminoacyl-tRNA synthetases to acylate novel monomers rely on translational readouts (Santoro, SW, Wang, L., Herberich, B., King, DS & Schultz, PG An efficient system for the evolution of aminoacyl-tRNA synthetase specificity. Nature biotechnology 20, 1044-1048 (2002), Chin, JW, Martin, AB, King, DS, Wang, L. & Schultz, PG Addition of a photocrosslinking amino acid to the genetic code of Escherichia coli. Proceedings of the National Academy of Sciences 99, 11020-11024 (2002)), and therefore, for frequent incorporation at specific sites in proteins, the monomer must be a ribosomal substrate. Many of the target noncanonical amino acids (ncMs) are weak ribosomal substrates (Katoh, T. & Suga, H. In vitro genetic code reprogramming for the expansion of usable noncanonical amino acids. Annual Review of Biochemistry 91, 221-243 (2022), Melo Czekster, C., Robertson, WE, Walker, AS, Soll, D. & Schepartz, A. In Vivo Biosynthesis of a beta-Amino Acid-Containing Protein.).J Am Chem Soc 138, 5194-5197, doi:10.1021 / jacs.6b01023 (2016)、Tan, Z., Forster, A. C., Blacklow, S. C. & Cornish, V. W. Amino Acid Backbone Specificity of the Escherichia coli Translation Machinery. Journal of the American Chemical Society 126, 12752-12753 (2004)、Pavlov, M. Y. et al. Slow peptide bond formation by proline and other N-alkylamino acids in translation. Proceedings of the National Academy of Sciences 106, 50-54 (2009)、Katoh, T., Tajima, K. & Suga, H. Consecutive Elongation of D-Amino Acids in Translation. Cell Chem Biol 24, 46-54, doi:10.1016 / j.chembiol.2016.11.012 (2017)、Katoh, T. & Suga, H. Ribosomal Incorporation of Consecutive beta-Amino Acids. J Am Chem Soc 140, 12159-12167, doi:10.1021 / jacs.8b07247 (2018)、Dedkova, L. M. et al. beta-Puromycin selection of modified ribosomes for in vitro incorporation of beta-amino acids. Biochemistry 51, 401-415, doi:10.1021 / bi2016124 (2012)), this leads to an evolutionary deadlock in cells; orthogonal synthases cannot evolve to acylate orthogonal tRNAs using ncM, a weak ribosomal substrate, and ribosomes cannot evolve to polymerize ncM, which cannot acylate on orthogonal tRNAs. 【0004】 The inventors previously described tRNA elongation (tREX), a rapid and scalable method for determining the user-defined aminoacylation state of tRNA from cells (Cervettini, D. et al. Rapid discovery and evolution of orthogonal aminoacyl-tRNA synthetase-tRNA pairs. Nat Biotechnol, doi:10.1038 / s41587-020-0479-2 (2020)). In this method, total tRNA is isolated from cells, and the 2',3' diols on the 3' end ribose of non-acylated tRNA are selectively oxidized to the dialdehyde, while acylated tRNA is protected from diol oxidation. A fluorophore-supported DNA probe is then annealed to the 3' end of the target tRNA under conditions that facilitate deacylation of acylated tRNA, exposing the free diol at its 3' end. This allows for polymerase-mediated elongation of unoxidized (acylated) tRNA. The resulting mass difference between oxidized, unelongated tRNA and unoxidized, elongated tRNA is broken down by gel electrophoresis, enabling the differentiation of acylated tRNA from free tRNA. 【0005】 Another previous method is disclosed in Saito et al. (the EMBO Journal, Vol. 20, No. 7, pp 1797-1806, 2001). This method relies on a biotinylated substrate and is performed in vitro. [Prior art documents] [Non-patent literature] 【0006】 [Non-licensed document 1] Dumas, A., Lercher, L., Spicer, CD & Davis, BG Designing logical codon reassignment - Expanding the chemistry in biology. Chem Sci 6, 50-69, doi:10.1039 / c4sc01534g (2015) 【Non-licensed Document 2】 Young, DD & Schultz, PG Playing with the molecules of life. ACS chemical biology 13, 854-870 (2018) [Non-licensed document 3] Chin, JW Expanding and reprogramming the genetic code. Nature 550, 53-60, doi:10.1038 / nature24031 (2017) 【Non-licensed Document 4】 De La Torre, D. & Chin, JW Reprogramming the genetic code. Nature Reviews Genetics 22, 169-184, doi:10.1038 / s41576-020-00307-7 (2021) 【Non-licensed Document 5】 Robertson, WE et al. Sense codon reassignment enables viral resistance and encoded polymer synthesis. Science 372, 1057-1062 (2021) 【Non-licensed Document 6】 Spinck, M. et al. Genetically programmed cell-based synthesis of non-natural peptide and depsipeptide macrocycles. Nature Chemistry 15, 61-69 (2023) [Non-Patent Document 7] Ellman, JA, Mendel, D. & Schultz, PG Site-specific incorporation of novel backbone structures into proteins. Science 255, 197-200 (1992) [Non-Patent Document 8] Mendel, D., Cornish, VW & Schultz, PG Site-directed mutagenesis with an expanded genetic code. Annual review of biophysics and biomolecular structure 24, 435-462 (1995) [Non-Patent Document 9] Hecht, SM Expansion of the genetic code through the use of modified bacterial ribosomes. Journal of molecular biology 434, 167211 (2022) [Non-Patent Document 10] Katoh, T. & Suga, H. In vitro genetic code reprogramming for the expansion of usable noncanonical amino acids. Annual Review of Biochemistry 91, 221-243 (2022) [Non-Patent Document 11] Melo Czekster , C. , Robertson , WE , Walker , AS , Soll , D. & Schepartz , A. In Vivo Biosynthesis of a Beta-Amino Acid-Containing Protein . J Am Chem Soc 138, 5194–5197. 【Outdoor Tools 12】 Santoro , SW , Wang , L. , Herberich , B. , King , DS & Schultz , PG An efficient system for the evolution of aminoacyl-tRNA synthetase specificity . Nature biotechnology 20, 1044–1048 (2002). 【Outdoor Tools13】 Chin , JW , Martin , AB , King , DS , Wang , L. & Schultz , PG Addition of a photocrosslinking amino acid to the genetic code of Escherichia coli . Proceedings of the National Academy of Sciences 99, 11020–11024 (2002) 【Outdoor Tools 14】 Tan , Z. , Forster , AC , Blacklow , SC & Cornish , VW Amino Acid Backbone Specificity of the Escherichia coli Translation Machinery . Journal of the American Chemical Society 126, 12752–12753 (2004). 【Outdoor Tools 15】 Pavlov, MY et al. Slow peptide bond formation by proline and other N-alkylamino acids in translation. Proceedings of the National Academy of Sciences 106, 50-54 (2009) [Non-Patent Document 16] Katoh, T., Tajima, K. & Suga, H. Consecutive Elongation of D-Amino Acids in Translation. Cell Chem Biol 24, 46-54, doi:10.1016 / j.chembiol.2016.11.012 (2017) [Non-Patent Document 17] Katoh, T. & Suga, H. Ribosomal Incorporation of Consecutive beta-Amino Acids. J Am Chem Soc 140, 12159-12167, doi:10.1021 / jacs.8b07247 (2018) [Non-Patent Document 18] Dedkova, LM et al. beta-Puromycin selection of modified ribosomes for in vitro incorporation of beta-amino acids. Biochemistry 51, 401-415, doi:10.1021 / bi2016124 (2012) [Non-Patent Document 19] Cervettini, D. et al. Rapid discovery and evolution of orthogonal aminoacyl-tRNA synthetase-tRNA pairs. Nat Biotechnol, doi:10.1038 / s41587-020-0479-2 (2020) [Non-Patent Document 20] Saito et al. (the EMBO Journal, Vol. 20, No. 7, pp 1797-1806, 2001) [Overview of the Initiative] [Means for solving the problem] 【0007】 In the first aspect, a method for determining the effect of a target polypeptide (polypeptide-of-interest) or target nucleic acid (nucleic-acid-of-interest) on tRNA acylation or the acylation state of tRNA, i) A step of incubating a target polypeptide or target nucleic acid, tRNA, and a substrate capable of acyling tRNA under conditions that promote tRNA acylation, wherein the tRNA is split into at least two parts, one of which is part of a fusion RNA molecule that also includes a sequence encoding the target polypeptide or target nucleic acid; ii) Exposing tRNA to conditions that allow acylated tRNA to be labeled; and iii) A step to identify whether the target polypeptide or target nucleic acid is associated with the labeled tRNA. A method is provided that includes this. 【0008】 In a second embodiment, a split tRNA is provided comprising a first strand and a second strand, wherein the first strand comprises a portion of the first tRNA and a first stem region, and the second strand comprises a portion of the second tRNA and a second stem region. 【0009】 In one embodiment, a split tRNA comprising a first strand and a second strand, The first strand comprises a portion of the first tRNA and a first stem region, and the second strand comprises a portion of the second tRNA and a second stem region; The first tRNA portion corresponds to the 5' portion of the parent tRNA separated by the anticodon, and the second tRNA portion corresponds to the 3' portion of the parent tRNA separated by the anticodon; The first stem region is located at the 3' end of the first tRNA portion, and the second stem region is located at the 5' end of the second tRNA portion; The first stem region and the second stem region are complementary. Split tRNA is provided. 【0010】 In a third embodiment, an RNA molecule is provided that includes a sequence encoding a target polypeptide or a target nucleic acid and also includes a tRNA portion. 【0011】 In the fourth aspect, a method for determining the acylation state of tRNA or the efficiency of tRNA acylation, i) Incubating tRNA and a substrate capable of acylating tRNA under conditions that promote tRNA acylation; ii) The step of exposing tRNA to conditions that can block the 3' end of free tRNA; and iii) A step of exposing tRNA to a condition that results in the addition of a nucleotide to the 3' end of an unblocked tRNA, wherein at least one nucleotide contains a label. A method is provided that includes this. 【0012】 In a fifth embodiment, a tRNA is provided which includes an additional nucleotide at its 3' end, and at least one nucleotide is labeled. 【0013】 In the sixth embodiment, a nucleic acid is provided that encodes a split tRNA of any of the second embodiment or an RNA molecule of any of the third embodiment. 【0014】 In one embodiment, the nucleic acid includes, from 5' to 3', a sequence encoding a second stem region, a sequence encoding a portion of a second tRNA, a sequence encoding a loop, a sequence encoding a portion of a first tRNA, and a sequence encoding a first stem region, where the sequence encoding the first stem region and the sequence encoding the second stem region encode complementary stem region sequences. 【0015】 A seventh aspect provides a method for producing a polypeptide, comprising the steps of: i) providing a sequence of a target polypeptide identified by any suitable method disclosed herein; and ii) producing a polypeptide corresponding to the sequence. 【0016】 In one embodiment, a method is provided for producing polypeptides or nucleic acids, comprising: i) providing a library comprising a plurality of sequences encoding a polypeptide or nucleic acid of interest, wherein each sequence in the library is ligated to a portion of tRNA; ii) incubating each of the polypeptides or nucleic acids of interest together with tRNAs comprising a portion of tRNA ligated to a sequence encoding each of the polypeptides or nucleic acids of interest, under conditions that promote acylation, wherein the incubation comprises a substrate capable of acylation of tRNAs; iii) exposing the tRNAs to conditions that can label the acylated tRNAs; and iv) identifying whether each of the polypeptides or nucleic acids of interest is bound to the labeled tRNAs; and v) producing polypeptides matching the sequences of the identified polypeptides or nucleic acids of interest. 【0017】 Furthermore, the use of acyl-tRNA synthetases disclosed herein in a method for genetically incorporating monomers into polymers is also provided. 【0018】 Also provided are methods for producing polymers, comprising i) the use of an acyl-tRNA synthetase disclosed herein for acylation of tRNA with a monomer, and ii) the incorporation of the monomer into a polymer chain. [Brief explanation of the drawing] 【0019】 [Figure 1] The cellular uptake of encoded non-standard monomers into proteins and non-standard polymers requires both tRNA acylation and ribosomal polymerization. Site-specific incorporation of encoded non-standard monomers (ncM, yellow asterisk) by cellular translation requires both acylation of orthogonal tRNA using ncM by orthogonal synthase and ribosomal polymerization of ncM onto polymer chains. Current methods for modifying aminoacyl-tRNA synthases to acylate novel monomers rely on translational readouts, and therefore require the monomer to be a ribosomal substrate. For ncM, which is a weak ribosomal substrate, this codependency leads to an evolutionary deadlock in the cell; orthogonal synthases cannot evolve to acylate orthogonal tRNA using ncM, which is a weak ribosomal substrate, and ribosomes cannot evolve to polymerize ncM, which cannot be acylated on orthogonal tRNA. To overcome this impasse, the inventors developed a direct selection of orthogonal synthases for aminoacylation of their congeneral orthogonal tRNAs using ncM, regardless of whether ncM is a ribosomal substrate or not. [Figure 2]The acylation-dependent incorporation of modified nucleotides during tRNA elongation enables highly sensitive detection and selective isolation of acylated tRNAs. a) Fluorescent tRNA elongation (fluoro-tREX) and biotin-tRNA elongation (bio-tREX). tRNAs are isolated from cells using mild phenol lysis and oxidized with sodium periodate. The diol functional group of the 3' ribose on non-acylated tRNAs is oxidized to a dialdehyde. The acyl group of charged tRNAs protects the diol functional group of the 3' ribose, preventing oxidation to a dialdehyde. A Cy3-labeled DNA probe complementary to the 3' end of the target tRNA is annealed, and creno-exo(-) and modified nucleotides are added. This results in selective elongation and labeling of acylated tRNAs. For fluoro-tREX, Cy5-labeled nucleotides were incorporated, and after gel electrophoresis, Cy3 and Cy5 fluorescence was visualized. Acylated tRNA yielded Cy5 and Cy3 signals, while non-acylated tRNA yielded only a Cy3 signal. For bio-tREX, biotinylated nucleotides were incorporated, and the resulting mixture was bound to streptavidin beads. After washing the beads, the biotinylated tRNA was released by heating in formamide; selective isolation of acylated tRNA could be visualized by SYBR gold staining after gel electrophoresis. b. Fluoro-tREX detected acylation of tRNAPyl CUA in the presence of its homologous aminoacylRNA synthetase (PylRS) and its ncAA substrate, BocK(1). Cells carrying tRNAPyl CUA were grown in the presence (+) and absence (-) of PylRS and BocK(1). The Cy3 signal was generated as a result of specific annealing of a Cy3-labeled probe to tRNAPyl CUA, detecting the presence of this tRNA. The Cy5 signal was generated as a result of elongation of pre-acylated tRNA using Cy-5-dCTP and was dependent on PylRS and BocK(1). c, bio-tREX enables selective isolation of pre-acylated tRNA.Cells carrying tRNAPyl CUA were grown in the presence (+) and absence (-) of PylRS and BocK(1). The tRNA and bound probes were isolated and visualized: RNA by SYBR gold staining, and the probes by Cy3 fluorescence. [Figure 3]Transcription, assembly, maturation, and acylation of split tRNA expressed from split or circulatingly substituted genes. a. Schematic diagram for producing trans split tRNA from two genes. The tRNA gene is split by an anticodon loop, and the anticodon stem sequence is extended for optimal assembly of the transcribed RNA in vivo; this creates two genes: one for the 5' half of the split tRNA and one for the 3' half. The genes for each half of the tRNA are transcribed, and the split tRNA is assembled, matured, and acylated in the cell. b. Schematic diagram for producing cis split tRNA from a single gene. The tRNA sequence is circulatingly substituted by connecting the 3' half containing the "loop" sequence to the 5' half, splitting the sequence by an anticodon, and extending the anticodon stem. Transcription, cis assembly, and maturation result in a functional split tRNA. c. In vivo transcription, assembly, maturation, and acylation of split tRNAPyls produced from genes relating to the 5' and 3' halves. Cells were grown in the presence or absence of PylRS, BocK(1), and genes relating to one or both halves of the tRNA. Expression of only half of both tRNAPyls resulted in a BocK(1)-dependent acylation signal as determined by fluoro-tREX. Note that the purification conditions used to isolate these stRNAs differed from those used to isolate intact tRNA or cis-transcribed stRNAs. Under these conditions, we did not observe the Cy3 probe. d. Loop region selection is crucial for the efficient expression, maturation, and acylation of circulating-displaced split tRNAs in cells. Six circulating-displaced split tRNAPyls with different loop sequences were assayed by fluoro-tREX.For the argY-argZ and leuP-leuV loops (derived from the intergenetic regions of paired tRNA genes in E. coli), the fluoro-tREX signals for split tRNA production (Cy3) and acylation (Cy5) were equivalent to the corresponding signals for intact tRNAPyl (Figure 11). [Figure 4]stmRNA couples the acylated phenotype with the aminoacyl-tRNA synthetase genotype, enabling efficient and selective isolation of PylRS variants with broad activity. a. Schematic diagram of the cis-split tRNA-mRNA fusion (stmRNA) gene. In cells, this gene is transcribed and processed to produce stmRNA in which the 3' half of the split tRNA is covalently linked to the PylRS mRNA. The PylRS mRNA is translated to produce the PylRS enzyme, which acylates the stmRNA in the presence of its substrate (yellow star). This creates a physical link between the acylated phenotype and genotype of the PylRS mRNA. b. BocK(1)-dependent acylation of stmRNA visualized by fluorescent mRNA elongation (fluoro-mREX). Cells carrying the stmRNA gene encoding wild-type (wt) PylRS (stmRNAwt) and cells carrying the stmRNA gene encoding attenuated PylRS (stmRNAat) were grown in the presence and absence of the PylRS substrate BocK(1). Fluoro-mREX yielded a BocK(1)-dependent Cy5 fluorescence band of the expected length for stmRNAwt, but not for stmRNAat. These results demonstrate that the stmRNA gene is functionally expressed in cells, converted to mature stmRNA, and leads to the production of an active PylRS enzyme that acylates stmRNA. 16S (1.5kb) and 23S rRNA (2.9kb) were used as loading controls and size markers. The fusion of the 3' half of tRNA with mRNA is 1.5kb. The fluoro-mREX signal was visualized on a denatured gel under conditions where the non-covalent bond of the Cy3-labeled probe was broken, and as a result, only Cy5 fluorescence was visualized in fluoro-mREX. c. Schematic diagram of biotin mRNA elongation (bio-mREX). bio-mREX is based on the same principle as bio-tREX. Biotinylated stmRNA, obtained as a result of elongation of unoxidized, pre-acylated stmRNA using biotinylated dNTPs, is bound to streptavidin beads and washed with stringent.Next, the PylRS mRNA within the beads was reverse transcribed and quantified by qPCR. Previously acylated stmRNA should yield high molecular counts for cDNA, while unacylated stmRNA is expected to yield only background signals. d. Efficient and selective isolation of cDNA of active PylRS variants by bio-mREX. Cells carrying stmRNAwt constructs or stmRNAat were grown in the presence and absence of BocK(1), and bio-mREX was performed. The number of cDNA molecules derived from wt stmRNA constructs in the presence of BocK(1) was 100 times greater than in the absence of BocK(1), and 300 times greater than from stmRNAat in the presence of BocK(1). There was minimal difference in the number of cDNA molecules derived from stmRNAat with and without BocK(1). Furthermore, the isolated RNA samples from each pulldown were reverse transcribed to measure the total number of stmRNA molecules used as input for bio-mREX (Figure 12b). In the presence of BocK(1), 2.5% of input stmRNA molecules were recovered. The dashed line represents 2.5% input (calculated from the average of all input samples). e. Adjustment of the 5'UTR of PylRS mRNA within the stmRNA resulted in a stronger correlation between stmRNA acylation by the PylRS enzyme variant encoded therein and amber stop codon read-through by the same PylRS enzyme variant when paired with tRNAPyl CUA (original RBS: R2 value = 0.4694, p value = 0.3148; RBS_2: R2 value = 0.9742, p value = 0.013). Cells carrying stmRNA genes encoding four different PylRS variants (PylRS(CbzK1-4)) along with either the original 5'UTR (Orig.RBS) or the designed 5'UTR (RBS2-stmRNAvol2) were grown in the presence of CbzK(2) and bio-mREX was performed.The measured cDNA molecules were plotted against the fluorescence intensity of GFP(150CbzK)His6, which was obtained by read-through of the amber codon in GFP(150TAG)His6 by each PylRS variant paired with tRNAPyl CUA in cells provided with CbzK(2). [Figure 5-1] ~ [Figure 5-2]tRNA display enables the direct selection of orthogonal aminoacyl-tRNA synthetases that aminoacylate their congeneral orthogonal tRNAs using ncAAs. a. Schematic diagram of tRNA display, a translation-independent strategy for selecting aaRS enzymes that aminoacylate specific tRNAs using desired monomers. In tRNA display, a library of stmRNAs is transformed into cells and grown in multiple repeats in the presence and absence of the non-standard monomer of interest (indicated by yellow asterisks). The library contains PylRS variants that are active and selective for ncM (yellow), PylRS variants that are inactive in cells for both ncM and standard amino acids (light blue), and PylRS variants that are active in cells for one or more standard amino acids but not selective for ncM (dark blue). Bio-mREX is performed on each repeat, and the cDNA is submitted for next-generation sequencing (NGS). The results were analyzed by plotting selectivity (the ratio of the relative abundance of a particular sequence in the positive sample (+ncM) divided by the relative abundance in the negative sample (-ncM)) against enrichment (the ratio of the same sequence in the positive sample divided by the relative abundance in the input library) for all observed sequences; this yields a fusiform plot (hereafter referred to as the fusiform plot). Active and selective PylRS variants are expected to be highly selective and enriched (yellow dots - upper right quadrant), active but non-selective variants are expected to be non-selective but highly enriched (dark blue dots), and inactive PylRS variants are expected to be non-selective and unenriched (light blue dots). b. Structure of non-standard α-alpha-amino acids used in this study.N6-((benzyloxy)carbonyl)-L-lysine (CbzK)(2), N6-((propa-2-in-1-yloxy)carbonyl)-L-lysine (AlkyneK)(3), N6-benzoyl-L-lysine (BenzK)(4), 3-([2,2'-bipyridine]-5-yl)-2-aminopropanoic acid (BiPyA)(5), Nτ-methyl-L-histidine (NτmH)(6), (S)-2-amino-3-(thiophen-3-yl)propanoic acid (3-ThiA)(7) ), (S)-2-amino-3-(pyridine-3-yl)propanoic acid (PyA)(8), (S)-2-amino-3-(4-iodophenyl)propanoic acid (pIF)(9), (S)-2-amino-3-(4-bromothiophen-2-yl)propanoic acid (BrThiA)(10), (2S)-2-amino-3-(((2-((1-(6-nitrobenzo[d][1,3]dioxol-5-yl)ethyl)thio)ethoxy)carbonyl)amino)propanoic acid (pcDAP)(11). c, tRNA display containing the PylRS library (stmRNAvol2_lib1). This library has three positions mutated to all other standard amino acids (Y306X, L309X, and N346X). The spindle plot shows the results of tRNA display selection for CbzK(2) using a one-step parallel selection outlined in (a). Samples were run in three replicates and data were processed as described in the methods. Red dots indicate 65 clones that were further characterized. d, GFP fluorescence measured in cells containing the corresponding PylRS variant / tRNAPyl CUA pair, GFP(150TAG)His6 and CbzK(2) against ln(enrichment, +2) (red dot in (c)) of the PylRS variant derived from tRNA display. The dotted line represents a linear regression on the displayed data points; R2=0.6611, p<0.0001. e~j, (left) white bars: GFP fluorescence derived from cells containing GFP(150TAG)His6, the displayed PylRS variant / tRNAPyl CUA pair, and the displayed ncAA. Gray bars: wtPylRS / tRNAPyl CUA pairs having the same ncAA.Fluorescence is shown as a fraction of fluorescence produced by wt PylRS / tRNAPyl CUA pairs using 2 mM BocK(1) and GFP(150TAG)His6. (Right) ESI-MS of GFP(150X)His6 (X is the shown ncAA). f, measured mass: 27922.0 Da, expected mass: 27923.3 Da; g, measured mass: 27944.8 Da, expected mass: 27945.5 Da; h, measured mass: 27867.6 Da, expected mass: 27866.4 Da; i, measured mass: 27862.0 Da, expected mass: 27861.4 Da; j, measured mass: 27986.4 Da, expected mass: 27986.2 Da; k, measured mass: 27945.6 Da, expected mass: 27944.3 Da. [Figure 6-1] ~ [Figure 6-3]tRNA display allows for the selection of orthogonal aminoacyl-tRNA synthetases to charge non-standard monomers. a. Structures of the non-standard monomers used in this study. (S)-3-amino-3-(3-bromophenyl)propanoic acid ((S)β3mBrF)(12), (S)-3-amino-6-(((benzyloxy)carbonyl)amino)hexanoic acid ((S)-β3CbzK)(13), (S)-6-acetamido-3-aminohexanoic acid ((S)-β3AcK)(14), BocAhx(15), 6-(((benzyloxy)carbonyl) mino)hexanoic acid (CbzAhx)(16), 3-amino-2-((1-ethyl-1H-imidazole-5-yl)methyl)propanoic acid (β2NeH(17)), 3-amino-4-(4-bromophenyl)butanoic acid (β3pBrhF)(18), 2-benzyl-3-hydroxypropanoic acid (β2OH-F)(19), 3-amino-3-phenylpropanoic acid (β3F)(20). b. Fluoro-tREX for the indicated PylRS variants. The experiment was repeated three times using tRNA extracted from cells carrying the pMB1 plasmid encoding each PylRS variant and TRNAPyl CUA in the presence and absence of 4 mM 15. c-d. Fluoro-tREX for the indicated PylRS variants derived from primary selection (panel c) and after further evolution (panel d). The experiment was repeated three times using tRNA extracted from cells carrying the respective PylRS variants and the pMB1 plasmid encoding tRNAPyl CUA, in the presence and absence of 4 mM 12. The selected PylRS variant acylates tRNAPyl CUA using 12. LC-MS traces on AQC-induced eluate from tRNA pulldowns derived from cells expressing the indicated PylRS variants (scanning ion mode for the AQC adduct of substrate 12). Cells carrying the corresponding PylRS variants and the pMB1 plasmid encoding tRNAPyl CUA (or tRNA(-) only as a control) were grown in the presence of substrate 12, and tRNA pulldowns were performed using a biotinylated probe for tRNAPyl CUA.f. Quantification of relative acylation of tRNAPyl CUA by selected PylRS variants. e. Integrated sub-peak area of ​​LC-MS traces shown. g. GFP fluorescence from cells containing GFP(150TAG)His6, PylRS(12_1) or PylRS(12_1evol1), and tRNAPyl CUA, grown in or without substrate 12. Fluorescence is shown as a fraction of fluorescence produced by wt PylRS / tRNAPyl CUA pairs using 2 mM BocK(1) and GFP(150TAG)His6. h. Intact ESI-MS of GFP(150(S)β3mBrF)His6 purified from cells carrying PylRS(12_1evol1), tRNAPyl CUA, and GFP(150TAG)His6, grown in the presence of 4 mM 12. Measured mass: 27939.0 Da, predicted mass: 27,938.2 Da. i. Close-up of residue 150 of GFP(150(S)β3mBrF)His6, derived from the crystal structure determined at 1.5 Å. The 2Fo-Fc map is shown at the contour level of sigma=2 (PDB code 8OVY). The electron density (blue) confirms the incorporation of 12 at position 150, clearly demonstrating the extension of the peptide backbone by a single methylene group and the stereochemistry of the β-amino acids in the protein. [Figure 7]The DNA probes used throughout this study are specific to Mm tRNAPyl CUA and, when fluorescently labeled, provide a loading control for the relative concentration of Mm tRNAPyl CUA in fluoro-tREX experiments. a, Northern blot showing the relative amounts of Mm tRNAPyl CUA used in fluoro-tREX experiments shown in panel b. The inventors isolated tRNA from DH10β cells carrying the pMB1 plasmid encoding Mm tRNAPyl CUA, or not from cells not carrying the plasmid. tRNA samples isolated from cells containing Mm tRNAPyl CUA were used undiluted and diluted in tRNA isolated from cells without Mm tRNAPyl CUA at ratios of 1:4, 1:16, and 1:64. Northern blotting was performed on the tRNA samples using the previously validated (see Cervettini, D. et al. Rapid discovery and evolution of orthogonal aminoacyl-tRNA synthetase-tRNA pairs. Nat Biotechnol, doi:10.1038 / s41587-020-0479-2 (2020)) Mm tRNAPyl CUA-specific probe 5'(Btn)-TGGCGGAAACCCCGGGAATCTAACCCGGCT-3' (SEQ ID NO: 103). The data show a dilution series of Mm tRNAPyl CUA, confirming that the Northern blot signal depends on the presence of Mm tRNAPyl CUA in the tRNA sample. The inventors performed experiments in biological replicates and obtained similar results. b) The Cy3 signal in fluoro-tREX decreases with dilution of Mm tRNAPyl CUA. Fluoro-tREX was performed on the tRNA sample characterized in a. Briefly, the fluorescently labeled DNA probe 5'GGGCCCATTAACATCACCTGGCGGAAACCCCGGGAATCTAACCCGGCT-3'Cy3 (SEQ ID NO: 104) was annealed to Mm tRNAPyl CUA, and the probe was extended by Kleno-(Exo-) in the presence of Cy5-dCTP.The inventors visualized Cy3 and Cy5 fluorescence by electrophoresis of a urea PAGE gel. c. Correlation between the Cy3 signal and the fluorescence signal determined by Northern blotting. Band intensity was determined by concentration measurement using ImageJ. The two signals showed a strong and significant correlation (R² = 0.9935, p = 0.0032). d. Correlation between the observed Cy3 signal and the theoretical amount of Mm tRNAPyl CUA; this is the relative amount of Mm tRNAPyl CUA predicted to be present in each sample based on the dilution series (1, 1:4, 1:6, 1:64). Cy3 fluorescence strongly reflects the amount of loaded tRNA (R² = 0.9657, p = 0.0173). The experiment was performed in two biological replicates and similar results were obtained. [Figure 8]Characterization of acylation activity of PylRS variants supporting amber repression activity exceeding two orders of magnitude by fluoro-tREX. a. Production of GFP150CbzKHis6 derived from GFP150TAGHis6 in the presence and absence of 2 mM CbzK2 from cells carrying one of four different N6-((benzyloxy)carbonyl)-L-lysine (CbzK)2 variants of PylRS (RS1:Y306G, L305G; RS2:Y306G, N346G; RS3:Y306S; RS4:Y306G) and the pMB1 plasmid encoding Mm tRNAPyl CUA and the p15A plasmid encoding GFP150TAGHis6. PylRS variants 1-4 yield amber repression activity exceeding two orders of magnitude as measured by fluorescence of GFP150CbzKHis6. The dots represent the mean of three biological replicates, and the error bars indicate ±sd. b. The fluoro-tREX signal can degrade the aminoacylation activity of all CbzK PylRS variants characterized in panel a. We isolated total tRNA from DH10β cells carrying one of four PylRS variants (RS1, RS2, RS3, or RS4) and a pMB1 plasmid encoding Mm tRNAPyl CUA, and performed fluoro-tREX. c. Plots of GFP fluorescence against Cy5 signaling for CbzK-RS2, 3, and 4. The Cy5 fluorescence signals for these three variants agreed well with the observed levels of GFP expression, allowing for the identification and differentiation of low and high-activity PylRS variants by fluoro-tREX. Experiments were performed in two biological replicates and similar results were obtained. [Figure 9]Deacylation of tRNA after oxidation under alkaline conditions increases the acylation signal in fluoro-tREX, thereby enabling robust detection of acylation by hydroxy acids and carboxylic acids. a. Chemical structures of N6-(tert-butoxycarbonyl)-L-lysine (BocK)1, (S)-6-((tert-butoxycarbonyl)amino)-2-hydroxyhexanoic acid (OH-BocK)21, and 6-((tert-butoxycarbonyl)amino)hexanoic acid (BocAhx)15. MmPylRS is highly active with respect to BocK1 and OH-BocK(Dumas, A., Lercher, L., Spicer, CD & Davis, BG Designing logical codon reassignment - Expanding the chemistry in biology. Chem Sci 6, 50-69, doi:10.1039 / c4sc01534g (2015))21, and exhibits acylation activity with respect to BocAhx15 (Young, DD & Schultz, PG Playing with the molecules of life. ACS chemical biology 13, 854-870 (2018)). The free acids b, 1, 21, and 15 range in terms of estimated pKa. The rate constant for alkaline hydrolysis of esters to obtain fixed alcohols and variable carboxylic acids increases as the pKa of the obtained carboxylic acid decreases. Therefore, the inventors predict that when the acylation monomer is a simple carboxylic acid, such as an α-hydroxy acid (and β-amino acid), the hydrolysis rate of the acylated tRNA will be slower than when the acylation monomer is an α-amino acid. c, MmPylRS acylates Mm tRNAPyl in cells using BocK1, OH-BocK21, and BocAhx15, respectively. Northern blots of Mm tRNAPyl derived from tRNA isolated from cells carrying the pMB1 plasmid encoding the MmPylRS / Mm tRNAPyl pair in the presence and absence of BocK, OH-BocK, or BocAhx. Experiments were performed in three biological replicates and similar results were obtained.d. To robustly detect the acylation activity of MmPylRS by fluoro-tREX using a non-alpha amino acid substrate after oxidation, an acylation step under alkaline conditions is required. Fluoro-tREX was performed using the tRNA samples described in panel c, with and without 45 minutes of tRNA incubation with 50 mM bicine at pH 9.6 after oxidation. The acylation signals from OH-BocK and BocAhx depended on tRNA acylation prior to the kleno-(exo-) extension step of the protocol. Similar results were obtained in three biological replicates. [Figure 10]Split Mm tRNAPyl requires a 10-base paired stem region that is efficiently acylated by MmPylRS in cells when half of both tRNAs are expressed in trans. a-c, acylation of split Mm tRNAPyl in cells depended on the presence of half of both tRNAs and the 10-base paired region. tRNAs were isolated from DH10β cells carrying split tRNA constructs having 8, 10, or 14-base paired stems, with half of the 3' Mm tRNAPyl encoded on a pMB1 plasmid and half of the Mm tRNAPyl encoded on a p15A plasmid, and cells were grown in the presence and absence of BocK. For split tRNA constructs with a 10-base pair stem, cells were also grown with p15A plasmids lacking either pMB1, or 3', or 5' tRNA, respectively. Fluoro-tREX was performed using isolated tRNA. For 8-base pair stems, a weak acylation signal was observed by fluoro-tREX, while for 14-base pair stems, mainly cleavage products were observed by fluoro-tREX. The experiment was performed in three biological replicates, and similar results were obtained. d and a-c relate to a split tRNA construct with a 12-base pair stem region, which, compared to a 10-base pair stem, results in a weaker acylation signal and the observation of multiple bands, likely resulting from stem cleavage. For trans-produced split tRNA, the inventors purified and concentrated the extension reaction product before loading, following the general procedure for fluoro-tREX B. Under these conditions, the inventors did not observe a Cy3 signal for the probe bound to the extension product. [Figure 11]The loop region sequence of circulatingly substituted split tRNAs is crucial for robust expression and acylation of split tRNAs in cells. Split tRNAs were isolated from DH10β cells carrying a pMB1 plasmid encoding one of seven circulatingly substituted Mm tRNAPyl constructs (Cm.gln, Cm.gly, E. coli (Ec.)argY-argZ, Ec.alaW-alaX, Ec.leuP-leuV, Ec.glnW-metL) each possessing a different loop region in the presence and absence of 4 mM BocK1. Intact Mm tRNAPyl CUA was produced as a control. The isolated split tRNAs were subjected to fluoro-tREX. Split Mm tRNAPyl constructs containing loops from the E. coli intergenetic regions argY-argZ or leuP-leuV resulted in high acylation and split tRNA expression levels, as determined by Cy5 or Cy3 fluorescence, respectively, which were comparable to the signals observed for intact Mm tRNAPyl CUA. The mean Cy3 signals for Mm tRNAPyl were 10185±1102, 12063±630 for argZ-argY, and 13467±465 for leuP-leuV. The mean Cy5 signals for Mm tRNAPyl were 1656±62, 1397±66 for argZ-argY, and 1442±67 for leuP-leuV. Cy3 and Cy5 signals were determined by concentration measurements. Similar results were obtained in experiments performed in three biological replicates. [Figure 12]A. Protein production via amber stop codon read-through by wild-type (wt) and attenuated (at) PylRS / tRNAPyl CUA pairs. Production of GFPAllocKHis6 from GFP150TAGHis6 from cells carrying the pMB1 plasmid encoding wild-type (wt) MmPylRS or attenuated (at) variants (H338A, F342A, M344A, E396A, S399A) and Mm tRNAPyl CUA, as well as the p15A plasmid encoding GFP150TAGHis6, in the presence and absence of 2 mM AllocK. The dots represent the mean of three biological replicates, and the error bars indicate ±sd. B. Input samples for bio-mREX of wt and attenuated stmRNA. After reverse transcription of the purified stmRNA fraction, it was quantified by qPCR, as well as samples subjected to extension and pull-down using biotinylated nucleotides. The addition of BocK did not result in a significant difference in isolated stmRNA levels (attenuated PylRS: p-value = 0.1648, wt PylRS: p-value = 0.6390). [Figure 13]Relationship between acylation signals measured by bio-mREX for stmRNA and GFP fluorescence signals measured for intact, translatable tRNA. For stmRNA, active aminoacyl-tRNA synthetase (aaRS) results in acylation of the stmRNA they encode, which is then extended, separated, and ultimately reverse transcribed by bio-mREX. This yields cDNA of the active synthetase, which can be quantified by qPCR. In the case of inactive aaRS, stmRNA is not acylated, and no cDNA is produced in the bio-mREX experiment. Therefore, the activity of the synthetase in bio-mREX correlates with the number of cDNA molecules measured by qPCR. In standard translation, the active aaRS enzyme yields acylated, intact, congeneral tRNACUA, which is used in protein translation. The inactive aaRS enzyme yields unacylated tRNA, which is not used in protein translation. The production of GFP protein from GFP150TAGHis6, as measured by GFP fluorescence, reports tRNACUA acylation and other steps in protein production. [Figure 14]Degradation of PylRS variant activity in bio-mREX by 5'UTR modification. a. Nucleotide sequences of 5'UTR sequences RBS1-3 showing a given translation initiation rate. Sequences were generated and initiation rates were predicted by DeNovo DNA. b. Cells carrying plasmids encoding stmRNAs carrying PylRS CbzK variants under the control of the initial 5'UTR or one of three designed 5'UTR sequences (see Figure 8) were grown in the presence of 2 mM CbzK2 to induce stmRNA transcription over 20 minutes, total RNA was isolated by phenol-chloroform extraction, and bio-mREX was performed. For stmRNA constructs with the initial 5'UTR region (stmRNAvol1), low-activity PylRS variants (e.g., CbzK-RS2) resulted in saturation of the acylation signal. For all designed 5'UTR sequences intended to yield low translation levels, low-activity PylRS variants could be degraded by bio-mREX. RBS2-regulated stmRNA (stmRNAvol2) yielded a good correlation between PylRS activity, measured by amber repression of GFP150TAGHis6, and acylation data measured by bio-mREX (see Figure 4e), and was used for all future experiments. The dots represent the mean of three biological replicates, and the error bars indicate ±sd. [Figure 15]The PylRS libraries used in this study. a. Overview of the seven libraries designed and created. These libraries target a total of 11 amino acid residues and 7 types of degenerate codons used in the PylRS active site. NNK codons are depicted in dark red, DBK codons (+lysine codons) in blue, NDT codons in dark green, and NRT codons in yellow. For certain sites, custom residue mixes containing the most commonly observed mutations were used (1-7 mixes, depicted as gray spheres). All libraries were created using at least 10⁹ independent transformants. N=A,T,G,C;K=G,T;D=G,A,T;B=G,T,C;R=G,A. Custom mixes are described in the methods. b. The 11 amino acid residues targeted for mutagenesis in the PylRS active site are shown in red. Images were rendered using Pymol based on the PDB structure 2ZIN. [Figure 16]tRNA display identifies active and selective orthogonal aaRS variants from stmRNA libraries. a. Spindle plot derived from tRNA display selection using stmRNA libraries 1 and ncAA1. b. Identification of regions in the spindle plot enriched with active and selective clones. The inventors anticipate that the upper right quadrant of the spindle plot region is enriched with active and selective clones. Since selectivity is derived from the ratio of sequence counts +ncAA to -ncAA, enriched clones exhibiting negative selectivity values ​​correspond to specific enrichment of the clone under the -ncAA condition with respect to the +ncAA condition. The inventors hypothesized that many apparent enrichments of this type are spurious, and therefore regions of the spindle plot where positive selectivity values ​​are reflected by negative selectivity values ​​of the same magnitude may contain substantial noise. Based on this assumption, the inventors anticipated that active and ncAA-selective clones are most enriched in regions of the plot where selectivity is asymmetrical for a given positive enrichment value. To enrich this asymmetric population, the inventors binned the average selectivity values: the 5350 points in the spindle plot (Figure 5c) were divided into 500 equal bins along the enrichment + 1 dimension (163 bins contained data). The average selectivity of each bin was plotted against the natural logarithm of enrichment + 1. From this, an enrichment value was defined where the spindle plot is asymmetric along the selectivity axis, using a threshold of approximately 7.4 (corresponding to the logarithmic score value of 2). c, Experimental GFP fluorescence values ​​of 100 clones plotted against the natural logarithm of the enrichment score in the presence of 1. GFP was expressed from GFP150TAGHis6 in the presence of the MmPylRS variant clone, congener Mm tRNAPyl CUA, and ncAA(1). Points above the symmetry threshold are colored red (65 points), and points below it are colored blue (21 points).A strong positive correlation was observed between the tRNA display sequence data and the experimental expression data for the red dots (R² = 0.6611, p < 0.0001), but no significant correlation was found for the blue dots (R² = 0.0392, p = 0.397), which is consistent with our assumptions. The red dots are also shown in Figure 5c. In subsequent selection, based on this analysis, we focused primarily on identifying clones on the right-hand side of the spindle plot where, for a given enrichment value, the magnitude of the positive selectivity for a clone was greater than the magnitude of the negative selectivity for clones with the same enrichment value. d. The tRNA display identifies ncAA-specific PylRS variants. The plot, color-coded as shown in panel b, shows the selectivity derived from the spindle plot relative to the experimental selectivity for the clones shown in panel b. The experimental selectivity, as shown in panel b, is derived from GFP expression experiments but is + / -ncAA. [Figure 17]Schematic diagram of a tRNA display-based strategy for selecting PylRS variants that instruct ncAA incorporation into proteins. In the first round, naive stmRNA vol2 libraries 2, 13, 14, 3D, 4D, and 5D were transformed into BL21 cells and grown overnight. Libraries 3D and 4D were combined to produce library 3D4D. The five libraries were grown to an OD600 of 0.3–0.4, and 2.6 mL of the cell culture from each library was added to the stock solution of each ncAA; this yielded 50 samples (5 libraries × 10 ncAAs). Cells were grown for 40 minutes to induce stmRNA, and cells were grown for a further 20 minutes. Bio-mREX was performed on the isolated RNA for each of the 50 samples. For each reaction, cDNA was amplified using primers appropriate for Golden Gate assembly. Next, all amplicons from the selected libraries for the same ncAA were combined in equimolar ratios (resulting in a total of 10 combined libraries) and cloned into a fresh ColE1 vector backbone. This produced 10 pre-selected libraries. The 10 pre-selected libraries were transformed into BL21 cells and grown overnight. The pre-selected libraries of ncAA2-6 were combined to create a single cluster library. Similarly, the pre-selected libraries of ncAA7-11 were combined to create a second cluster library. 2.6 mL of the first cluster library was added to a solution of ncAA2-6. Also, 2.6 mL of the first cluster library was added to a sample without ncAA as a control. Cells were grown for 40 minutes to induce stmRNA, and the cells were grown for a further 20 minutes to isolate the RNA. Three RNA samples were converted to cDNA as bio-mREX input controls. Bio-mREX was performed on the isolated RNA. This generated seven samples (bio-mREX input, -ncAA control for bio-mREX, and five bio-mREX samples for ncAA2-6). The experiment was repeated three times, generating 21 samples.The cDNA from each sample was sequenced and analyzed by NGS to generate spindle plots and sequence listings. The second cluster was processed in the same way as the first cluster, using ncAA7-11 instead of 2-6. [Figure 18] Schematic diagram of the selection strategy for non-standard monomers. Library 14 was transformed into BL21 cells and grown overnight. Cells were grown to an OD600 of 0.3–0.4. 4 mL of library culture was added to the stock solution of each ncM. 4 mL of library culture was also added to wells without ncM. Cells were grown for 40 minutes to induce stmRNA, and then grown for a further 20 minutes to isolate the RNA. Bio-mREX was performed on the isolated RNA for each sample. The experiment was repeated four times to obtain 40 cDNA samples. Six more cDNA samples were generated for six of the RNA inputs to bio-mREX. The 46 obtained cDNA samples were sequenced by NGS and analyzed to generate spindle plots and sequence listings. [Figure 19] A schematic diagram of tRNA pulldown followed by LC-MS analysis to determine monomer identity on a target tRNA. tRNA is extracted from cells expressing the target tRNA and its congenerally orthogonal aaRS, and grown in the presence of ncM. Biotinylated probes are annealed to pull down the target tRNA. After washing, ncM is eluted by alkaline deacylation, derivatized by AQC, and detected using LC-MS. [Figure 20]Schematic diagram of a selection strategy for random mutagenesis selection using tRNA display. The inventors performed mutagenesis PCR reactions across the active site sequences of PylRS variants 12_1 and 12_2 using the GeneMorph II (Agilent) kit. Diversified PCR amplicons were cloned into fresh ColE1 plasmid backbone by Golden Gate assembly, and the mutagenesis stmRNA library was transformed into BL21 cells and grown overnight. Cells were grown to an OD600 of 0.3–0.4. 2.6 mL of library culture was added to 12 stock solutions to a concentration of 4 mM. 2.6 mL of library culture was also added to wells without ncM. Cells were grown for 40 minutes to induce stmRNA, and cells were grown for a further 20 minutes to isolate the RNA. Bio-mREX was performed on the isolated RNA for each sample. The experiment was repeated four times to obtain eight cDNA samples. Furthermore, four cDNA samples were generated for four of the RNA inputs to bio-mREX. The resulting 12 cDNA samples were sequenced and analyzed by NGS, and spindle plots and sequence listings were generated. [Figure 21]Schematic diagram of a two-step selection strategy for non-standard monomers. Library 14 was transformed into BL21 cells and grown overnight. Cells were grown to an OD600 of 0.3–0.4. 4 mL of library culture was added to the stock solution of each ncM. Cells were grown for 40 minutes to induce stmRNA, and then grown for a further 20 minutes to isolate the RNA. Bio-mREX was performed on the isolated RNA for each sample. The experiment was repeated four times. For each repeat, cDNA was amplified using primers appropriate for Golden Gate assembly. Then, all amplicons from the selected libraries for the same ncAA were combined in equimolar ratios and cloned into a fresh ColE1 vector backbone. This created one pre-selected library for each ncM. The pre-selected libraries were transformed into BL21 cells and grown overnight. Cells were grown to an OD600 of 0.3–0.4. For each ncM, 4 mL of the respective pre-selected library culture was added to the stock solution of each ncM. For each pre-selected library, 4 mL of the library culture was also added to the wells that did not contain an ncM. Cells were grown for 40 minutes to induce stmRNA, and then grown for a further 20 minutes to isolate the RNA. Bio-mREX was performed on the isolated RNA for each sample. The experiment was repeated three times to obtain six cDNA samples per ncM. Three more cDNA samples were generated for each ncM using three RNA inputs for bio-mREX of each pre-selected library. For each ncM, the nine obtained cDNA samples were sequenced and analyzed by NGS to generate spindle plots and sequence listings. [Figure 22-1] ~ [Figure 22-2]Screening of intergenic regions (IGRs) for 1R26, deltaClos, and Nitra PylRS stmRNAs. a) IGR screening for 1R26 stmRNA. b) Validation of the best IGR derived from a). c) IGR screening for deltaClos stmRNA. d) Evaluation of repeats of the best IGR derived from c) and evaluation of two additional best-functioning IGRs for MmPylRS stmRNA. e) IGR screening for Nitra stmRNA. Labels on the X axis (except for the Mm control) are the names of the natural or synthetic IGRs. Cultures inoculated at 1:20 in the presence or absence of 4 mM ncM (Mm and deltaClos: Allock, 1R26: CbzK, Nitra: NMH). StmRNA expression was induced at OD600=0.8 for 20 minutes. RNA isolation, acylation-dependent pulldown, reverse transcription, and qPCR were performed as described in the methods. The dots represent biological replicates (average of 3 qPCR replicates), the columns show their mean, and the error bars show the standard deviation. The Y-axis is scaled to match to highlight the different stmRNA acylation levels between systems. Note that the Mm control has a strongly reduced RBS intensity. The data in b), d), and e) are from the same experiment (one negative Mm sample was lost). [Figure 23-1] ~ [Figure 23-2]Exploration of attenuated 1R26 and Nitra PylRS sets. a) Screening of CbzK-specific 1R26, Nitra, and deltaClos PylRS based on active site grafts derived from MmPylRS variants and rationally designed derivatives thereof. b) and c) Selected sets of CbzK-selective 1R26 and Nitra variants encompass a broad activity range up to their respective wild-type levels (another experiment derived from a). a-c) Cells were transformed with a GFP(150-TAG) reporter, the respective uncplified tRNAs underlying the stmRNA constructs described above, and plasmids encoding variants carrying residues indicated in parentheses at positions homologous to wt PylRS or MmPylRS residues 306, 309, and 346, respectively. The main culture was inoculated at a 1:50 ratio and grown for 22 hours under reporter induction in either the presence or absence of 2 mM ncM (AllocK for wt PylRS, CbzK for active site mutants), after which it was measured in a plate reader. See the Methods section for details. Dots represent biological replicates, columns represent their mean, and error bars represent the standard deviation. [Figure 24] tRNA display with greedy1-1R26 stmRNA degrades a wide range of acylation activity. a) Quantification of qPCR stmRNA after acylation-dependent pulldown. Experiment above (2 mM CbzK), mean of 3 biological replicates (2 for GLG-CbzK), error bars: SD. b) +Cbzk data from a) plotted against corresponding GFP data from Figure 23ab. Error bars: SD. [Figure 25-1] ~ [Figure 25-2]Split and circulatingly substituted tRNAAla mature and maintain their activity and orthogonality. a) Structure of the split tRNAAla construct. b) Establishment of tRNAAla-specific fluoro-tREX for detecting tRNA acylation. c) Screening of split tRNAAla with three different intergenic regions. d) Validation of tRNAAla splits based on leuP-leuV. a-d) Cells were transformed with tRNA (PylT or AlaT) or constructs encoding tRNA and its congener aaRS. Cultures were inoculated at 1:50, cells were harvested at OD 0.6, and RNA was isolated by acidic chloroform / phenol extraction. Samples were oxidized (or as shown in b), or deacylated + oxidized or untreated to produce negative and positive controls, and concentrations were adjusted to a common denominator. Cy3-labeled probes were annealed, and 3' oxidation-sensitive tRNA elongation was performed in the presence of Cy5-dCTP. Urea PAGE was then performed, and the gel was imaged for Cy3 and Cy5 fluorescence. Nucleic acids were then stained with SYBR gold, and the gel was imaged again. [Figure 26-1] ~ [Figure 26-2]Identification of tRNA locations that can standardly accept tRNA splitting. a) Structural analysis reveals four regions not involved in secondary or tertiary structural interactions. The diagram is based on the alignment of PDB entries 3JXE and 2AKE. b) Assumed stem-stabilized split tRNA classes for systems exhibiting anticodon recognition. c) Incorporation of the tRNA identity element landscape resulted in identity elements for 10 standard splitting sites (black bars) that minimally interfere with tRNA structure and a total of 17 isoacceptor classes exhibiting anticodon recognition. tRNA is presented by aaRS class and subclass. Invariant locations are presented in gray. Red locations are conserved or nearly conserved strong identity elements for recognition by congener aaRS. Yellow locations are weak identity determinants or unconserved determinants in the three major domains of the organism. Red dashed lines indicate tertiary interactions involved in identity. Gray lines in the central standard map indicate tertiary interactions. Figure c) was largely adapted from Giege and Eriani (2023- The tRNA identity landscape for aminoacylation and beyond. Nucleic acids research 51, 1528-1570. https: / / doi.org / 10.1093 / nar / gkad007). [Figure 27-1] ~ [Figure 27-3]Design of split tRNAs for TrpRS / tRNATrp and ProRS / tRNAPro pairs under maintenance of tRNA identity elements including anticodons. a) Evaluation of the activity and tRNA orthogonality of model pairs by Amber repression assay using a GFP(150-TAG) reporter. Experiments were performed as described above and in the methods. tRNAPyl(Mm), homogeneous synthase: MmPylRS(wt; AllocK 2mM). tRNATrp, TrpTRS(5-OH-Trp 2mM). tRNATrp, homogeneous synthase: ProRS(wt substrate specificity; no ncM used). Dots indicate biological repeats, columns indicate their mean, and error bars indicate SD. b) General structure of the split tRNA construct. c) From 18 possible split site combinations (including stem-size compensatory deletions of one or more nucleotides between neighboring split sites), a subset of 10 splits was selected that encompass all split classes (i.e., all tRNA loops: D, A, V, T), all possible split sites, and all possible compensatory deletion sizes within each split class (split names are in black). Split nomenclature specifies the split class (D, A, V, or T), followed by the numbers of the two standard nucleotide positions on which the stem protrudes. Thus, two non-consecutive numbers in the name indicate a compensatory deletion of nucleotides between these positions. d) Mapping of selected split sites onto Trp and Pro tRNA identity element maps. The Trp and Pro systems each belong to two distinct existing aaRS classes that diverge in structure and tRNA binding mode. Figures c) and d) are modified from Giege and Eriani (2023). [Figure 28-1] ~ [Figure 28-2]Screening of diverse tRNA splitting sites reveals functional splitting adjacent to the anticodons for both tRNATrp and tRNAPro, and within the D-loop. a) Establishment of fluoro-tREX for detecting acylation of tRNATrp or b) tRNAPro by their congener aaRS. c) and d) Screening of tRNA splits shown on the lanes for the tryptophanyl system (c) and prolyl system (d) by fluoro-tREX. Experiments were performed as described in the previous and methods sections. Substrates: 2 mM 5-OH-Trp for the Trp system, no ncM for the Pro pair. Biological replicates of Figures a) and b) were performed in exactly the same way as c) using IGR leuW-glnU. [Figure 29] tRNA splits adjacent to different anticodons and in the D-loop maintain acylation to varying degrees, but generally improve orthogonality with respect to congeneral aaRS. Validation of identified splitting sites for a) tRNATrp and b) tRNAPro. Fluoro-tREX was performed as described above and in the methods. Substrates: 2 mM 5-OH-Trp for TrpRS, and no ncM for ProRS. Neighboring lanes under identical experimental conditions are biological replicates. [Figure 30] Screening of attenuated variants in p15a. [Figure 31] The second iteration of Figure 28a)b). [Figure 32] Screening of various tRNA splitting sites as shown in Figure 28. [Modes for carrying out the invention] 【0020】 The present inventors provide herein methods for measuring the degree of tRNA acylation. These methods enable the measurement of the effect of a drug on the tRNA acylation state. For example, the methods can be used to determine: i) whether a drug can charge tRNA; ii) to what extent or how efficiently a drug can charge tRNA; iii) whether a drug has an indirect effect on tRNA charging; or iv) whether a drug can chemically alter a substrate in a manner that affects charging or deacylation. The drug may be any polypeptide, nucleic acid, or condition that has, or is suspected to have, an effect on tRNA acylation. 【0021】 The method disclosed herein does not require the charged tRNA to be active in the ribosome. Therefore, the method enables the measurement of tRNA acylation using substrates that are incompatible with ribosome translation, substrates for which compatible ribosomes have not yet been identified, or substrates for which compatible ribosomes have not yet been developed. 【0022】 The inventors also provide molecules, tRNA, nucleic acid constructs, and labeled tRNA for use in conjunction with such methods. 【0023】 Methods involving split tRNA One aspect of this disclosure relates to the inventors' demonstration that tRNA can be split into two or more parts, functionally expressed in this form, and acylated in this split form. One advantage of splitting tRNA in this form is that the inventors demonstrate that additional sequences can be covalently ligated to at least one tRNA part. This then enables a method for measuring the identity of individual drugs capable of tRNA charging, even in large parallel libraries. 【0024】 As an example, the present inventors fuse an acyl-tRNA synthetase gene to a portion of tRNA. Under conditions in which tRNA is expressed and acyl-tRNA synthetase is expressed as a polypeptide, the acylation of tRNA can then be measured, and a direct link between the acylation state in question and acyl-tRNA synthetase can be established. 【0025】 Therefore, in the first embodiment, a method for determining the effect of a target polypeptide or target nucleic acid on tRNA acylation or the acylation state of tRNA, i) A step of incubating a target polypeptide or target nucleic acid, tRNA, and a substrate capable of acyling tRNA under conditions that promote tRNA acylation, wherein the tRNA is divided into at least two parts, one of which is part of a fusion RNA molecule that also includes a sequence encoding the target polypeptide or target nucleic acid; ii) Exposing tRNA to conditions that allow acylated tRNA to be labeled; and iii) A step to identify whether the target polypeptide or target nucleic acid is bound to the labeled tRNA. A method is provided that includes this. 【0026】 The target polypeptide or target nucleic acid may be any agent that has, or is suspected to have, an effect on the acylation state of tRNA. 【0027】 For example, the polypeptide of interest may be an acyl-tRNA synthetase, and the method can be used to determine whether the synthetase can charge tRNA, or to what extent or efficiently the synthetase can charge tRNA. In another example, the nucleic acid of interest may be a ribozyme that can acylate or assist in the acylation of tRNA, and this catalytic activity can be measured. 【0028】 In other examples, the deacylation of tRNA can be measured using the method. Thus, drugs suspected to have deacylation activity can be assayed. Such methods can also be extended to determine the activity of drugs suspected to protect acylated tRNA from deacylation. Examples of such drugs are EF-Tu or variants of EF-Tu. EF-Tu is involved in the transport of acylated tRNA into ribosomes and is likely important for monomers that are difficult to translate. EF-Tu is expected to increase the stability of acylated tRNA. Therefore, EF-Tu variants that protect acylated tRNA from deacylation can be selected using the method disclosed herein. As will be further discussed herein, such embodiments may include a conditional deacylation step different from any deacylation performed as part of tRNA labeling. 【0029】 The drug does not have to directly charge the tRNA itself, but may assist in charging or be somewhere upstream of the actual charging. For example, the drug may be part of a biosynthetic pathway for producing substrates for tRNA, such as an enzyme for the production of amino acids or non-natural amino acids, and thus the activity of the biosynthetic pathway can be assayed by measuring the degree of tRNA acylation. The substrate on which the tRNA is charged may be suitable for incorporation into a polymer by ribosomes, or it may be desirable for the substrate to be incorporated into a polymer by ribosomes. Alternatively, the substrate may be suitable for charging tRNA but not related to downstream incorporation into a polymer. Such embodiments are useful, for example, when evolving enzymes for the production of substrates not related to protein production. In such cases, tRNA display is used as a readout, but improvement of tRNA charging is not the ultimate goal. 【0030】 Alternatively, the drug may act on the substrate after the tRNA has been charged. For example, the drug may be an enzyme that chemically alters the substrate. The drug may alter the substrate to make it more or less resistant to deacylation. Examples of alterations that change the stability of the acyl bond include conversion of the alcohol moiety to the halogen moiety (e.g., the Appel reaction), removal of an amine, or addition of a CC bond. In some embodiments, the polypeptide of interest is an enzyme that can alter the substrate in a manner that affects its susceptibility to deacylation. As will be further discussed herein, such embodiments may include a conditional deacylation step different from any deacylation performed as part of tRNA labeling. 【0031】 The substrate used to acylate tRNA may be any suitable one. For example, in some cases, tRNA can be charged with one of 22 naturally occurring amino acids or one of 20 standard amino acids. In other cases, tRNA can be charged with a non-natural amino acid, such as an α-amino acid with a non-natural side chain. The substrate may be an α,α-disubstituted amino acid. The substrate may be a non-α-amino acid. The substrate may not be an amino acid at all; for example, the substrate may be a hydroxy acid, and optionally the hydroxy acid may be an α-hydroxy acid or a β-hydroxy acid. The method of this disclosure is compatible with substrates that may not be suitable for incorporation into polymers by ribosomes, and therefore the method of this disclosure is particularly advantageous when testing tRNA acylation using non-amino acid substrates. 【0032】 The tRNA may be based on or derived from naturally occurring or modified tRNA. For example, the tRNA may be modified to be compatible with a particular synthase, and it may or may not have a modified anticodon. In preferred embodiments, particularly when the method is performed in cells, the tRNA does not contain an anticodon. We have found that anticodon-free tRNA is not a ribosomal substrate, and that experimental tRNA lacking an anticodon interferes with endogenous cellular processes, albeit to a relatively small degree. 【0033】 tRNA is split into at least two parts. This means that tRNA is composed of at least two separate RNA strands that bind to form tRNA. This can be called “split” tRNA, and it is when the parental tRNA is modified such that part of the tRNA resides on one RNA strand and the other part of the tRNA resides on another RNA strand or multiple strands. In certain examples, tRNA is split into two, and therefore one part resides on one RNA strand and the other part resides on a second RNA strand; these can be called the first tRNA strand and the second tRNA strand. In some embodiments, tRNA is split into two parts and no more. In such embodiments, the two parts can charge and form a complete tRNA, which may contain the entire sequence of the parental tRNA other than that at the split site. 【0034】 The split should be located at a site not recognized by drugs that acylate tRNA. This is such that the split itself does not affect tRNA acylation. In some cases, tRNA splits at the anticodon. Therefore, tRNA can split at the anticodon position in the parent tRNA; the parent tRNA is the tRNA from which the split tRNA originates. The parent tRNA may be wild-type tRNA or a modified tRNA based on the split tRNA. 【0035】 In some examples of embodiments in which the tRNA is split at the anticodon, the tRNA may be a tRNA that can be charged by an aminoacyl-tRNA synthetase that does not recognize the anticodon. An example of a synthetase that does not recognize the anticodon is pyrrolysyl-tRNA synthetase, and thus the tRNA may be compatible with pyrrolysyl-tRNA synthetase, or the compatibility with such a synthetase may be desirable or undesirable. The portion of the tRNA may be a portion of the tRNA that is appropriate for being charged by the agent being tested, suspected of being appropriate for being charged, where charging is desirable, or where charging is undesirable. The portion of the tRNA may be a portion of the tRNA Pyl as well. In the example, the tRNA Pyl is Methanosarcina mazei (Mm) tRNA Pyl , Candidatus Methanomethylophilus sp. 1R26 (1R26) tRNA Pyl , Clostridiales bacterium (deltaClos) I2B72 tRNA Pyl , or Nitrososphaeria archaeon (Nitra) Int6C10 tRNA Pyl . 【0036】 A pure example of a sequence encoding a portion of the split tRNA is TCCGTTCAGCCGGGTTAGATTCCCGGGGTTTCCGCCA (SEQ ID NO: 1), which is the 3'-half of Methanosarcina mazei (Mm) tRNA Pyl , and GGAAACCTGATCATGTAGATCGAATGGA (SEQ ID NO: 2), which is the 5'-half of Mm tRNA Pyl . 【0037】 Other examples include: 1R26 tRNA PylThe 3' portion ACCTGTAAGCGGGGTTCGACCCCCCGGCCTTTCGCCA (SEQ ID NO: 23) and 1R26 tRNA encode the 3' half of the tRNA. Pyl The 5' portion GGAGGGCGCTCCGGCGAGCAAACGGGT (sequence number 24) codes the 5' side half. 【0038】 deltaClos tRNA Pyl The 3' portion TCCGCGAACAACGGGTGAAACTCCCGTACACCTCGCCA (SEQ ID NO: 25) and deltaClos tRNA encode the 3' half of the deltaClos tRNA. Pyl The 5' side half is coded as part GGGGTGTAGATCGGATTGATCGCGTGGA (sequence number 26). 【0039】 Nitra tRNA Pyl The 3' portion GCCACGTTAGCCGGGTTCAACTCCCGGGTTCATCGCCA (SEQ ID NO: 27) and Nitra tRNA encode the 3' half of the tRNA. Pyl The 5' portion GGTGAACTGGTCCGGGACCACCAGGC (sequence number 28) codes for the 5' side half. 【0040】 tRNA may be split at the anticodon, Leu tRNA Ala , or tRNA Ser The tRNA may be derived from any domain, from a prokaryote, or from a bacterial or archaeal species. 【0041】 A pure example of a non-PylRS tRNA split by an anticodon is shown below. This example is tRNA Leu tRNA Ala , or tRNA Ser This is a typical example of a tRNA related to one of the following, but is usually charged by Ala. AlaAGGCGGAGACGAGGGTTCAATTCCCTCCCGGACCACCA (SEQ ID NO: 46) and tRNA, which encode the 3' half of the tRNA. Ala GGTCCGGTAGATCAGTGGAAGATCGCCGCTT (sequence number 47) codes the 5' side half of it. 【0042】 In other examples, the tRNA is not split at the anticodon. This is particularly relevant to embodiments in which the anticodon of the tRNA is recognized, at least partially, by the relevant acyl-tRNA synthetase. 【0043】 In some embodiments, the tRNA is split in the D-loop, in the anticodon loop and at the 5' end of the anticodon, in the variable loop, or in the T-loop. In certain embodiments, the tRNA is split at one of the sites shown in Figure 27c. tRNA can be split between residues D15 and D16, D15 and D17, D15 and D18, D16 and D17, D16 and D18, D17 and D18, A31 and A32, A31 and A33, A32 and A33, V45 and V46, V45 and V47, V45 and V48, V46 and V47, V46 and V48, V47 and V48, T56 and T57, T56 and T58, or T57 and T58 (as shown in Figure 27c, Giege and Eriani (2023 - The tRNA identity landscape for aminoacylation and beyond. Nucleic acids research 51, 1528-1570). (As defined at https: / / doi.org / 10.1093 / nar / gkad007). tRNA can be split between residues D15 and D17, D15 and D18, D16 and D17, A31 and A33, A32 and A33, V45 and V48, V46 and V48, V47 and V48, T56 and T57, or T56 and T58. tRNA may originate from any of these domains, from prokaryotes, or from bacterial or archaeal species. 【0044】 In some embodiments, tRNA is tRNATrp or tRNA Pro tRNA Trp or tRNA Pro It can be split in the D-loop, in the anticodon loop and at the 5' end of the anticodon, in the variable loop, or in the T-loop. In certain embodiments, tRNA Trp or tRNA Pro It is divided at one of the sites shown in Figure 27c. tRNA Trp or tRNA Pro It can be divided among residues D15 and D16, D15 and D17, D15 and D18, D16 and D17, D16 and D18, D17 and D18, A31 and A32, A31 and A33, A32 and A33, V45 and V46, V45 and V47, V45 and V48, V46 and V47, V46 and V48, V47 and V48, T56 and T57, T56 and T58, or T57 and T58. tRNATrp or tRNAPro can be split between D15 and D17, D15 and D18, D16 and D17, A31 and A33, A32 and A33, V45 and V48, V46 and V48, V47 and V48, T56 and T57, or T56 and T58. tRNATrp can be split between A32 and A33, D15 and D17, or D16 and D17. tRNAPro can be split between A31 and A33, A32 and A33, D15 and D17, or D15 and D18. tRNA may originate from any domain, from a prokaryote, or from a bacterial or archaeal species. 【0045】 tRNA that is divided outside the anticodon Pro Examples of arrays that code include the following: 【0046】 It is an A31 / A32 split, with the 3' portion CTAAACCACGCGGTTATGGGTTCAAATCCCATCTTCTCAACCA (SEQ ID NO: 48) and the 5' portion GAGAAGTAGCACAATTTGGTAGTGCACGTGGT (SEQ ID NO: 49). 【0047】 It is an A32 / A33 split, with the 3' portion being CTAAACCACGCGGTTATGGGTTCAAATCCCATCTTCTCAACCA (Sequence ID 50) and the 5' portion being TGAGAAGTAGCACAATTTGGTAGTGCACGTGGTT (Sequence ID 51). 【0048】 This is a D15 / D17 split, with the 3' portion TGGTAGTGCACGTGGTTCTAAACCACGCGGTTATGGGTTCAAATCCCATCTTCTCAACCA (Sequence ID 52) and the 5' portion TGAGAGTAGCACAAT (Sequence ID 53). 【0049】 This is a D15 / D18 split, with the 3' portion being GGTAGTGCACGTGGTTCTAAACCACGCGGTTATGGGTTCAAATCCCATCTTCTCAACCA (Sequence ID 54) and the 5' portion being TGAGAAGTAGCACAAT (Sequence ID 55). 【0050】 tRNA that is divided outside the anticodon Trp Examples of arrays that code include the following: 【0051】 This is an A32 / A33 split, with the 3' portion being TCTAGACGCGTAGAACCCCGTTCGAGCCGGGGAGCCCTCACCA (Sequence ID 56) and the 5' portion being GGGGGCTTAGTGAAACTGGCATCACGACGCGC (Sequence ID 57). 【0052】 This is a D15 / D17 split, with the 3' portion TGGGATCACGACGAGCTCTAGACTCGTAGAACCCCGTTCGAGCCGGGGAGCCCTCACCA (Sequence ID 58) and the 5' portion GGGGGCTTAGTGAAA (Sequence ID 59). 【0053】 This is a D15 / D18 split, with the 3' portion being GGCATCACGACGAGCTCTAGACTCGTAGAACCCCGTTCGAGCCGGGGAGCCCTCACCA (Sequence ID 60) and the 5' portion being GGGGGCTTAGTGAAA (Sequence ID 61). 【0054】 This is a D16 / D17 split, with the 3' portion TGGCATCACGACGAGCTCTAGACTCGTAGAACCCCGTTCGAGCCGGGGAGCCCTCACCA (Sequence ID 62) and the 5' portion GGGGGCTTAGTGAAAC (Sequence ID 63). 【0055】 The fragmentation of tRNA provides a site that can contain additional nucleic acid sequences. Therefore, one or more portions of tRNA can be fused to additional nucleic acid sequences. In other words, the fusion RNA molecule may contain one of the tRNA portions and additional sequences. The additional sequences may include sequences encoding drugs that can perform either tRNA charging or tRNA acylation, as will be discussed further herein. Thus, the additional sequences may encode the polypeptide of interest or the nucleic acid of interest. In this way, the drug sequence is physically ligated to the tRNA being assayed for charging. 【0056】 In embodiments in which tRNA is split by an anticodon, each portion may include a stem region in which the stem region of the respective portion is complementary. The inventors demonstrate that the presence of such a stem region assists in the assembly and stability of tRNA. The stem region is positioned so that it results in the extension of tRNA into the anticodon stem loop. The stem region may be 8-14, 8-12, or 10-12 nucleotides long. This means that a region of 8-14, 8-12, or 10-12 complementary base pairs is bound to each portion of tRNA at the anticodon split site. The stem region may be 10 nucleotides long. The stem region may be 12 nucleotides long. 【0057】 The stem region may include, or be identical to, the sequences encoded by TAGCGACGTAGC (SEQ ID NO: 3) on one strand and GCTACGTCGCTA (SEQ ID NO: 4) on the other strand. For example, in an embodiment in which tRNA is split by an anticodon, the sequence described in SEQ ID NO: 3 can be bound to the 3' end of the portion of tRNA derived from the 5' side of the anticodon, and the sequence described in SEQ ID NO: 4 can be bound to the 5' end of the portion of tRNA derived from the 3' side of the anticodon. 【0058】 In a preferred embodiment, the stem region may include, or be consistent with, the sequences encoded by TAGCGACGTA (SEQ ID NO: 5) on one strand and TACGTCGCTA (SEQ ID NO: 6) on the other strand. For example, in an embodiment in which the tRNA is split by an anticodon, the sequence described in SEQ ID NO: 5 can be bound to the 3' end of the portion of the tRNA derived from the 5' side of the anticodon, and the sequence described in SEQ ID NO: 6 can be bound to the 5' end of the portion of the tRNA derived from the 3' side of the anticodon. 【0059】 In another embodiment, the stem region may include, or be consistent with, the sequences encoded by GTACGACCCA (SEQ ID NO: 7) on one strand and TGGGTCGTAC (SEQ ID NO: 8) on the other strand. For example, in an embodiment in which the tRNA is split by an anticodon, the sequence described in SEQ ID NO: 7 can be bound to the 3' end of the portion of the tRNA derived from the 5' side of the anticodon, and the sequence described in SEQ ID NO: 8 can be bound to the 5' end of the portion of the tRNA derived from the 3' side of the anticodon. 【0060】 In another embodiment, the stem region may include, or be consistent with, the sequences encoded by TAGCGACGTAG (SEQ ID NO: 64) on one strand and TTATGTCGCTA (SEQ ID NO: 65) on the other strand. For example, in an embodiment in which the tRNA is split by an anticodon, the sequence described in SEQ ID NO: 64 can be bound to the 3' end of the portion of the tRNA derived from the 5' side of the anticodon, and the sequence described in SEQ ID NO: 65 can be bound to the 5' end of the portion of the tRNA derived from the 3' side of the anticodon. 【0061】 Embodiments in which the tRNA is split outside the anticodon may also include stem regions attached to each portion. The stem regions of each portion may be complementary. The stem regions may be 8-25, 10-23, 12-22, 13-21, 14-20, 15-19, or 16-18 nucleotides long. This means that a region of 8-25, 10-23, 12-22, 13-21, 14-20, 15-19, or 16-18 base pairs is attached to each portion of the tRNA at the split site. The stem region may be 17 nucleotides long. For example, the stem region may include, or be identical to, the sequences encoded by GGCGGATAGCGACGTAG (SEQ ID NO: 66) on one strand and TTATGTCGCTATCCGCC (SEQ ID NO: 67) on the other strand. For example, the sequence described in SEQ ID NO: 66 can be bound to the 3' end of the tRNA portion derived from the 5' side of the split, and the sequence described in SEQ ID NO: 67 can be bound to the 5' end of the tRNA portion derived from the 3' side of the split. 【0062】 A sequence encoding the target polypeptide or target nucleic acid can be bound to tRNA via a stem region. Therefore, the fusion RNA molecule may include a sequence encoding the target polypeptide or target nucleic acid, a stem region, and a tRNA portion, where the stem region is located between the sequence encoding the target polypeptide or target nucleic acid and the tRNA portion. A linker sequence may be present between the sequence encoding the target polypeptide or target nucleic acid and the stem region. The linker may be a region of nucleic acid that provides flexibility. The experimental data disclosed herein demonstrate that the linker is not essential. An exemplary sequence encoding a linker is provided below: GCTTAATTAGCTGACCTACTAGTCGGCCGGCGGATGAGAGAAGATTTTCAGCCTGATAC (SEQ ID NO: 9). 【0063】 A sequence encoding the target polypeptide or target nucleic acid can be attached to the 5' portion or the 3' portion of the tRNA. In embodiments, the sequence encoding the target polypeptide or target nucleic acid may be a fusion RNA portion containing, from 5' to 3', the sequence encoding the target polypeptide / target nucleic acid, a stem region, and a portion of tRNA from 3' to the split. In certain embodiments where the tRNA is split by an anticodon, the sequence encoding the target polypeptide or target nucleic acid can be attached to the portion of tRNA that is 3' relative to the anticodon in the parent molecule. Thus, the sequence encoding the target polypeptide or target nucleic acid may be a fusion RNA portion containing, from 5' to 3', the sequence encoding the target polypeptide / target nucleic acid, a stem region, and a portion of tRNA from 3' to the anticodon. In particular, the fusion RNA may contain, from 5' to 3', the sequence encoding the target polypeptide / target nucleic acid, a linker, a stem region, and a portion of tRNA from 3' to the split. 【0064】 Examples of stem regions fused to tRNA are provided below. In these sequences, the underlined portion represents the stem region, and the tRNA portion is shown in regular text. The first example is Mm tRNA fused to a stem region. Pyl The sequence encoding the 3' half is shown. The second example is Mm tRNA fused to the stem region. Pyl This shows the sequence that codes for the 5' side half. TACGTCGCTA TCCGTTCAGCCGGGTTAGATTCCCGGGGTTTCCGCCA (Sequence No. 11) GGAAACCTGATCATGTAGATCGAATGGA TAGCGACGTA (Sequence ID 12) 【0065】 Other examples are as follows. In these sequences, the underlined portion represents the stem region, and the tRNA portion is shown in regular text. The first example is a 1R26 tRNA fused to the stem region. Pyl The second example shows the sequence encoding the 3' half of the tRNA. The second example shows 1R26 tRNA fused to the stem region. Pyl This shows the sequence that codes for the 5' side half. TACGTCGCTA ACCTGTAAGCGGGGTTCGACCCCCCGGCCTTTCGCCA (Sequence No. 38) GGAGGGCGCTCCGGCGAGCAAACGGGT TAGCGACGTA (Sequence ID 39) 【0066】 Further examples include the following: The underlined portion represents the stem region, and the tRNA portion is shown in regular text. Each pair in the first set is the 3' portion of the tRNA fused to the stem region, and each pair in the second set is the 5' portion of the tRNA fused to the stem region. TACGTCGCTA TCCGCGAACAACGGGTGAAACTCCCGTACACCTCGCCA(Sequence ID 68-deltaClos tRNA) Pyl ) GGGGTGTAGATCGGATTGATCGCGTGGA TAGCGACGTA(SEQ ID NO: 69-deltaClos tRNA) Pyl ) TACGTCGCTA GCCACGGTTAGCCGGGTTCAACTCCCGGGTTCATCGCCA(Sequence ID 70 - Nitra tRNA) Pyl ) GGTGAACTGGTCCGGGACCACCAGGC TAGCGACGTA (Sequence ID 71-Nitra tRNA) Pyl ) TTATGTCGCTA AGGCGGAGACGAGGGTTCAATTCCCTCCCGGACCACCA(Sequence No. 72 tRNA Ala ) GGTCCGGTAGATCAGTGGAAGATCGCCGCTT TAGCGACGTAG (Sequence ID 73-tRNA Ala ) TTATGTCGCTATCCGCC CTAAACCACGCGGTTATGGGTTCAAATCCCATCTTCTCAACCA(Sequence ID 74-tRNA Pro (A31 / A32 split) GAGAAGTAGCACAATTTGGTAGTGCACGTGGT GGCGGATAGCGACGTAG (Sequence ID 75-tRNA Pro (A31 / A32 split) TTATGTCGCTATCCGCC CTAAACCACGCGGTTATGGGTTCAAATCCCATCTTCTCAACCA(Sequence ID 76-tRNA Pro (A32 / A33 split) TGAGAAGTAGCACAATTTGGTAGTGCACGTGGTT GGCGGATAGCGACGTAG (Sequence ID 77-tRNA Pro (A32 / A33 split) TTATGTCGCTATCCGCC TGGTAGTGCACGTGGTTCTAAACCACGCGGTTATGGGTTCAAATCCCATCTTCTCAACCA(Sequence No. 78-tRNA) Pro (D15 / D17 split) TGAGAAGTAGCACAAT GGCGGATAGCGACGTAG (Sequence ID 79-tRNA Pro(D15 / D17 split) TTATGTCGCTATCCGCC GGTAGTGCACGTGGTTCTAAACCACGCGGTTATGGGTTCAAATCCCATCTTCTCAACCA(Sequence ID 80-tRNA Pro (D15 / D18 split) TGAGAAGTAGCACAAT GGCGGATAGCGACGTAG (Sequence ID 81-tRNA Pro (D15 / D18 split) TTATGTCGCTATCCGCC TCTAGACGCGTAGAACCCCGTTCGAGCCGGGGAGCCCTCACCA(SEQ ID NO: 82-tRNA Trp (A32 / A33 split) GGGGGCTTAGTGAAACTGGCATCACGACGCGC GGCGGATAGCGACGTAG (Sequence ID 83-tRNA Trp (A32 / A33 split) TTATGTCGCTATCCGCC TGGGATCACGACGAGCTCTAGACTCGTAGAACCCCGTTCGAGCCGGGGAGCCCTCACCA (Sequence No. 84-tRNA) Trp (D15 / D17 split) GGGGGCTTAGTGAAA GGCGGATAGCGACGTAG (Sequence ID 85-tRNA Trp (D15 / D17 split) TTATGTCGCTATCCGCC GGCATCACGACGAGCTCTAGACTCGTAGAACCCCGTTCGAGCCGGGGAGCCCTCACCA(Sequence ID 86-tRNA Trp (D15 / D18 split) GGGGGCTTAGTGAAA GGCGGATAGCGACGTAG (Sequence ID 87-tRNA Trp (D15 / D18 split) TTATGTCGCTATCCGCC TGGCATCACGACGAGCTCTAGACTCGTAGAACCCCGTTCGAGCCGGGGAGCCCTCACCA (Sequence No. 88-tRNA) Trp (D16 / D17 split) GGGGGCTTAGTGAAAC GGCGGATAGCGACGTAG (Sequence ID 89-tRNATrp (D16 / D17 split) 【0067】 tRNA and / or fusion RNA can be expressed from a construct disclosed in a sixth aspect of the present invention. tRNA and / or fusion RNA can be expressed from a nucleic acid construct encoding a cyclically substituted transcript. 【0068】 Two pure examples of constructs encoding split tRNA are provided below. In these sequences, the underlined portion represents the stem region, the tRNA portion is shown in regular text, and the loop region is shown in bold. The loop region exemplified for SEQ ID NO: 13 is SEQ ID NO: 19, which will be discussed further in relation to the sixth aspect. The loop region exemplified for SEQ ID NO: 14 is SEQ ID NO: 17, which will be discussed further in relation to the sixth aspect. TIFF2026519275000002.tif47170 【0069】 Other pure examples of constructs encoding split tRNA are provided below. In these sequences, the underlined portion represents the stem region, the tRNA portion is shown in regular text, and the loop region is shown in bold. The loop region will be discussed further in relation to the sixth aspect. 【0070】 Step i) of the method of the first embodiment includes incubating the polypeptide / nucleotide of interest, tRNA, and a substrate capable of acylating tRNA under conditions that promote tRNA acylating. Such conditions may be intracellular. Thus, the polypeptide / nucleotide of interest and tRNA can be expressed intracellularly, for example, from one or more vectors. In some embodiments, the tRNA and mRNA of the polypeptide of interest are expressed from the same DNA construct, after which the mRNA of the polypeptide of interest is translated. In other embodiments, a portion of tRNA and mRNA of the polypeptide of interest are expressed from the same DNA construct, after which the mRNA of the polypeptide of interest is translated. As discussed, the mRNA of the polypeptide of interest can be fused directly or indirectly to a portion of tRNA. The substrate can be produced intracellularly or provided exogenously. Cells can be cultured in a normal environment under conditions that allow for tRNA charging with the substrate. In some examples, the cells are prokaryotic cells, bacterial cells, or E. coli cells. 【0071】 As discussed herein, the polypeptide or nucleic acid of interest may be an agent that acts on a substrate after tRNA has been acylated to alter the sensitivity of the substrate-tRNA to deacylation. In such embodiments, step i) may include incubating the tRNA and substrate under conditions that promote tRNA acylation, and then incubating the acylated tRNA with the polypeptide or nucleic acid of interest; these incubations may be simultaneous or performed in cells expressing the relevant molecule. In such embodiments, the method may include exposing the tRNA to deacylation conditions between step i) and step ii), where the deacylation conditions are such that only the more stable substrate is retained or only the less stable substrate is removed. This step may be referred to as a conditional deacylation step. 【0072】 In some cases, it is desirable to determine whether the polypeptide of interest encodes an enzyme that acts on the substrate in the substrate-tRNA complex to increase the stability of the substrate-tRNA complex. The tRNA is charged with the substrate and exposed to the enzyme, and then exposed to conditions that deacylate the substrate if its stability has not increased. The method may then proceed to step ii), which allows for the identification of whether such an enzyme can increase the stability of the substrate because the enzyme binds to the substrate-holding tRNA and is therefore labeled. As discussed herein, the labeling step ii) may also include a deacylation step. This second deacylation step should remove all substrate to allow the labeling process to proceed. 【0073】 Step ii) of the method according to the first embodiment includes exposing tRNA to conditions that can label acylated tRNA. This step may be carried out by any suitable method, for example, by labeling a substrate that acylates tRNA, and thus step ii) can be carried out simultaneously with step i). The substrate can be labeled directly or indirectly with a label. The label may be an optically detectable label, such as a fluorescent label, or a physically detectable label, such as biotin or magnetic beads. A physically detectable label may bind to a fixed or magnetic portion to allow separation of the labeled molecule. The substrate can be labeled with a first label containing a ligand-receptor pair ligand or receptor in the substrate, for example, biotin. The first label can then be further labeled with a second label that can bind to the first label, such as streptavidin. For example, a biotinylated substrate can be further labeled with a fluorescent molecule bound to streptavidin. Alternatively, the biotinylated substrate-tRNA complex can be separated from other components using immobilized streptavidin. In some embodiments, the label is either not part of the substrate or is not bound to the substrate. 【0074】 The method for labeling tRNA may be as disclosed in the fourth aspect of the present invention. 【0075】 In a preferred embodiment, tRNA is labeled by its own elongation. For example, additional nucleotides can be added to the 3' end of pre-acylated tRNA. To ensure that only acylated tRNA is labeled, tRNA can be exposed to conditions that block the 3' end of free tRNA but not the 3' end of acylated tRNA. Any conditions that prevent subsequent elongation of tRNA by adding nucleotides to the 3' end are suitable, one example being exposure to sodium periodate under oxidative conditions. Such conditions do not block acylated tRNA because it is protected by the substrate acylated to the tRNA. 【0076】 Next, the tRNA can be deacylated. The tRNA can be exposed to conditions suitable for the removal of the acylated substrate, such that previously acylated tRNA has an intact 3' ribose to which additional nucleotides can be added, while unacylated tRNA is blocked. 【0077】 As discussed herein, some embodiments relate to a polypeptide or nucleic acid of interest that is tested to determine whether the polypeptide or nucleic acid of interest can be modified to alter the tendency toward deacylation of the substrate-tRNA complex. Such embodiments may include a first deacylation step, which is a conditional deacylation step. For example, the condition is selected not to deacylate more stable substrate-tRNA complexes, or the condition is selected to deacylate only substrate-tRNA complexes that did not become more stable. In such embodiments, a condition is applied after the first deacylation step that blocks the 3' end of free tRNA but not the 3' end of acylated tRNA. After the blocking step, a second deacylation step is performed to remove all substrates that have acylated the tRNA. 【0078】 Nucleotide addition can be achieved by annealing of an oligonucleotide protruding from the 3' end of tRNA to the 3' end of tRNA, followed by elongation of tRNA by polymerization based on the template provided by the oligonucleotide. The oligonucleotide can be fluorescently labeled. Elongation of the 3' end of tRNA may be by the tREX method described in (Cervettini, D. et al. Rapid discovery and evolution of orthogonal aminoacyl-tRNA synthetase-tRNA pairs. Nat Biotechnol, doi:10.1038 / s41587-020-0479-2 (2020)), which is incorporated herein by reference. 【0079】 In embodiments where tRNA is labeled by extension with additional nucleotides, the labeled tRNA can be identified based on its length, for example, by using gel electrophoresis. Alternatively, tRNA can be labeled by extension with a specific nucleotide sequence that can be identified. For example, a specific nucleic acid sequence can be identified by binding a fluorescently labeled complementary probe, or by subsequently sequencing the tRNA and identifying the additional sequence. The additional sequence may include a barcode. The additional nucleic acid sequence may include a primer binding site, thus enabling amplification of the acylated tRNA. tRNA can be labeled by extension with at least one nucleotide containing the label. The label may be directly detectable by optical means, for example. The label may be a fluorescent label. The label may be a first label containing the ligand or receptor of a ligand-receptor pair. For example, the first label can be bound with a second label containing the respective receptor or ligand and an optically detectable portion such as a fluorescent moiety. The first label can be ligated by an immobilized second label that enables tRNA capture. The first label can also be ligated by a second label that includes a physically detectable portion, such as a magnetic bead, that enables tRNA pulldown. A suitable ligand-receptor example is biotin-streptavidin, but other ligand-receptor pairs are also suitable for use with the present invention. Interactions with intermediate molecules or multiple intermediate molecules between the first and second labels, such as an adapter molecule or multiple adapter molecules, are also included. 【0080】 A method of the first embodiment may include the capture of a labeled tRNA or RNA fusion molecule via a first label or a second label conjugated to the first label. The capture of tRNA may involve capturing only one portion of the tRNA, and it is not necessary to capture the entire portion. In some embodiments, the capture includes the capture of an RNA fusion molecule containing a portion of tRNA and a sequence encoding the polypeptide of interest or the nucleic acid of interest. Examples of suitable labels for capture are discussed herein and include biotin, magnetic moieties, or other ligand-receptor pairs to which one portion is immobilized. As used for any embodiment herein, “capture” means that the molecule is physically separated from other components. For example, the captured molecule may be retained in place while other components are removed. Or, the captured molecule may be removed and retained, for example, by magnetism, while other components remain in place. 【0081】 The method of the first embodiment includes the step of identifying whether the polypeptide of interest or the nucleic acid of interest is bound to the labeled tRNA. This makes it possible to determine whether a particular drug can affect the charging state of the tRNA, or whether a particular drug cannot affect the charging state of the tRNA. This information may include whether the drug results in an increase or decrease in the level of charging compared to a control or reference standard. The information may also include whether the drug results in an increase or decrease in the sensitivity of the substrate-tRNA complex to deacylation. In embodiments where the polypeptide of interest is an acyl-tRNA synthetase, it can be determined whether the synthetase can charge the tRNA with a particular substrate, or whether the variant has increased or decreased charging functional groups. It can also be determined whether the synthetase cannot charge the tRNA with a particular substrate. 【0082】 In some cases, a library of target polypeptides or nucleic acids can be tested simultaneously to identify variants with specific characteristics. In other cases, multiple synthases can be tested to identify synthases that have activity for specific tRNAs and substrates but not for other tRNAs and substrates. Thus, a set of synthases that do not cross-react and can therefore be used cooperatively can be identified. For this reason, a set of orthogonal synthase-tRNA pairs can be identified using the methods of this disclosure. 【0083】 The identification of the target polypeptide or target nucleic acid may be by sequencing the barcode bound to the labeled tRNA. For example, the barcode is part of an additional nucleotide added as part of the labeling reaction within the tRNA, or is contained within a sequence fused to a split site. Alternatively, the sequence encoding the target polypeptide or target nucleic acid itself can be sequenced at least partially or completely. Thus, any target polypeptide / target nucleic acid bound to a pre-charged tRNA can be directly identified. 【0084】 As discussed, if tRNA is pre-charged, it can be labeled in a manner that allows for the physical separation of the tRNA. The sequence bound to the physically separated tRNA can be sequenced, and therefore the sequence bound to the charged tRNA can be identified. The physical separation may be only of the portion of the tRNA fused to the sequence encoding the target polypeptide / target nucleic acid. Therefore, the physical separation may be of the fusion RNA molecule containing both the portion of the tRNA and the sequence encoding the target polypeptide / target nucleic acid. 【0085】 Alternatively, all sequences bound to tRNA, whether labeled or unlabeled, can be sequenced, and the sequences bound to tRNA can be identified using labels. For example, all fusion RNA molecules can be sequenced partially or entirely, and the sequences bound to the charged tRNA can be identified using additional nucleic acid sequences attached as labels. Such sequencing may include sequencing all or part of the sequence encoding the polypeptide / nucleotide of interest. 【0086】 Split tRNA As discussed in connection with the first aspect, the inventors have developed a split tRNA useful in a method for determining the acylation state of tRNA or the efficiency of tRNA acylation. 【0087】 Accordingly, a second aspect of the present invention provides a split tRNA comprising a first strand and a second strand, wherein the first strand comprises a portion of the first tRNA and a first stem region, and the second strand comprises a portion of the second tRNA and a second stem region. 【0088】 The split tRNA may be any of those discussed in relation to the first embodiment. 【0089】 In a particular embodiment, a split tRNA is provided comprising a first strand and a second strand, wherein the first strand comprises a portion of the first tRNA and a first stem region, and the second strand comprises a portion of the second tRNA and a second stem region, the portion of the first tRNA corresponds to the 5' portion of the parental tRNA split by an anticodon, the portion of the second tRNA corresponds to the 3' portion of the parental tRNA split by an anticodon, the first stem region is located at the 3' end of the portion of the first tRNA, the second stem region is located at the 5' end of the portion of the second tRNA, and the first and second stem regions are complementary. 【0090】 As discussed in relation to the first embodiment, a split tRNA is a tRNA that has been split into at least two parts, meaning that the tRNA consists of at least two distinct RNA strands that bind together to form the tRNA. In certain examples, the tRNA is split into two parts and no more. In such embodiments, the two parts can charge together to form a complete tRNA, which may contain the entire sequence of the parental tRNA other than that at the split site. 【0091】 In some embodiments of the second aspect, the tRNA is split at the anticodon. Thus, the tRNA is split at the position of the anticodon in the parent tRNA; the parent tRNA is the tRNA from which the split tRNA originates. The parent tRNA may be wild-type tRNA or a modified tRNA based on the split tRNA. 【0092】 The split tRNA may be compatible with pyrrolidyl tRNA synthetase, or compatibility with such synthetase may be desirable or undesirable. The split tRNA may contain a portion of tRNA that is suitable for charging, suspected to be suitable for charging, desirable to charge, or undesirable to charge with the drug under test. Pyl The part may also be included. In the example, tRNA Pyl is mm tRNA Pyl , 1R26 tRNA Pyl deltaClos tRNA Pyl , or Nitra tRNA Pyl That is the case. 【0093】 In other examples, tRNA may be split at the anticodon, Leu tRNA Ala , or tRNA Ser The tRNA may be derived from any domain, from a prokaryote, or from a bacterial or archaeal species. 【0094】 In other embodiments, the tRNA is not split at the anticodon. This is particularly relevant to embodiments in which the anticodon of the tRNA is recognized, at least partially, by the relevant acyl-tRNA synthetase. In some embodiments, the tRNA is split in the D-loop, in the anticodon loop and at the 5' end of the anticodon, in the variable loop, or in the T-loop. In certain embodiments, the tRNA is split at one of the sites shown in Figure 27c. tRNA can be split between residues D15 and D16, D15 and D17, D15 and D18, D16 and D17, D16 and D18, D17 and D18, A31 and A32, A31 and A33, A32 and A33, V45 and V46, V45 and V47, V45 and V48, V46 and V47, V46 and V48, V47 and V48, T56 and T57, T56 and T58, or T57 and T58 (as illustrated in Figure 27c and defined in Giege and Eriani (2023)). tRNA can be split between residues D15 and D17, D15 and D18, D16 and D17, A31 and A33, A32 and A33, V45 and V48, V46 and V48, V47 and V48, T56 and T57, or T56 and T58. tRNA may originate from any of these domains, from prokaryotes, or from bacterial or archaeal species. In some embodiments, tRNA is tRNA Trp or tRNA Pro tRNA Trp or tRNA Pro It can be split in the D-loop, in the anticodon loop and at the 5' end of the anticodon, in the variable loop, or in the T-loop. In certain embodiments, tRNA Trp or tRNA Pro It is divided at one of the sites shown in Figure 27c. tRNA Trp or tRNA ProThe tRNA can be divided between residues D15 and D16, D15 and D17, D15 and D18, D16 and D17, D16 and D18, D17 and D18, A31 and A32, A31 and A33, A32 and A33, V45 and V46, V45 and V47, V45 and V48, V46 and V47, V46 and V48, V47 and V48, T56 and T57, T56 and T58, or T57 and T58. Trp or tRNA Pro It can be divided between D15 and D17, D15 and D18, D16 and D17, A31 and A33, A32 and A33, V45 and V48, V46 and V48, V47 and V48, T56 and T57, or T56 and T58. tRNATrp can be divided between A32 and A33, D15 and D17, or D16 and D17. Pro This can be divided between A31 and A33, A32 and A33, D15 and D17, or D15 and D18. The tRNA may originate from any of the domains, from a prokaryote, or from a bacterial or archaeal species. 【0095】 Examples of the tRNA portion are encoded by SEQ ID NOs: 1 and 2, SEQ ID NOs: 23 and 24, SEQ ID NOs: 25 and 26, SEQ ID NOs: 27 and 28, SEQ ID NOs: 46 and 47, SEQ ID NOs: 48 and 49, SEQ ID NOs: 50 and 51, SEQ ID NOs: 52 and 53, SEQ ID NOs: 54 and 55, SEQ ID NOs: 56 and 57, SEQ ID NOs: 58 and 59, SEQ ID NOs: 60 and 61, and SEQ ID NOs: 62 and 63. These sequences will be discussed further in relation to the first embodiment. 【0096】 The first strand of the split tRNA includes a first stem region located at the 3' end of the first tRNA portion, and the second strand of the split tRNA includes a second stem region located at the 5' end of the second tRNA portion. The first and second stem regions may form a complementary extension of the tRNA to the anticodon stem loop. The first and second stem regions may be 8-14, 8-12, or 10-12 nucleotides long. The first and second stem regions may be 10 nucleotides long. The first and second stem regions may be 12 nucleotides long. 【0097】 The first stem region may include or be equivalent to the sequence coded by sequence number 3, and the second stem region may include or be equivalent to the sequence coded by sequence number 4. In a preferred embodiment, the first stem region may include or be equivalent to the sequence coded by sequence number 5, and the second stem region may include or be equivalent to the sequence coded by sequence number 6. The first stem region may include or be equivalent to the sequence coded by sequence number 7, and the second stem region may include or be equivalent to the sequence coded by sequence number 8. The first stem region may include or be equivalent to the sequence coded by sequence number 64, and the second stem region may include or be equivalent to the sequence coded by sequence number 65. 【0098】 Embodiments in which the tRNA is split outside the anticodon may include stem regions attached to each portion. The stem regions of each portion may be complementary. The stem regions may be 8-25, 10-23, 12-22, 13-21, 14-20, 15-19, or 16-18 nucleotides long. This means that a region of 8-25, 10-23, 12-22, 13-21, 14-20, 15-19, or 16-18 base pairs is attached to each portion of the tRNA at the split site. The stem region may be 17 nucleotides long. For example, the stem region may include, or be identical to, the sequences encoded by GGCGGATAGCGACGTAG (SEQ ID NO: 66) on one strand and TTATGTCGCTATCCGCC (SEQ ID NO: 67) on the other strand. For example, the sequence encoded by sequence number 66 can be bound to the 3' end of the tRNA portion derived from the 5' side of the split, and the sequence encoded by sequence number 67 can be bound to the 5' end of the tRNA portion derived from the 3' side of the split. 【0099】 In certain embodiments, the first and / or second strands include additional sequences that can be bound to the stem region. In certain embodiments, the second strand includes additional sequences located 5' relative to the second stem region. The additional sequences may encode a barcode or any related sequence. In certain embodiments, the additional sequences may include sequences encoding the polypeptide of interest or the nucleic acid of interest. The polypeptide of interest or the nucleic acid of interest may be any of those described in the first aspect of this disclosure. In certain embodiments, the sequences encode acyl-tRNA synthetase. 【0100】 A sequence encoding the target polypeptide or target nucleic acid can be directly linked to the stem region. Alternatively, a linker sequence may be present between the sequence encoding the target polypeptide or target nucleic acid and the stem region. The linker may be a region of nucleic acid that provides flexibility. The linker may be one of those described in the first embodiment. 【0101】 Examples of split tRNA are provided in connection with the first embodiment. In particular, examples of tRNA portions include those encoded by SEQ ID NOs: 1 and 2. Examples of tRNA portions fused to a stem region are provided in SEQ ID NOs: 11 and 12. Examples of constructs encoding split tRNA are provided in SEQ ID NOs: 13 and 14. 【0102】 Other examples encoding portions of tRNA include SEQ ID NOs. 23 and 24, which are exemplarily fused to the stem region in SEQ ID NOs. 38 and 39. An exemplary construct encoding this split tRNA is presented in SEQ ID NO. 40. These examples are purely illustrative, and other examples disclosed herein are also relevant. 【0103】 RNA fusion molecules As discussed in relation to the first aspect, the inventors have developed split tRNAs that allow for additional fused sequences and can be further charged. For example, the split tRNAs may include additional nucleic acid sequences encoding a protein or nucleic acid. As discussed in the second aspect, these split RNAs may include an RNA molecule containing a portion of tRNA and a sequence encoding the polypeptide / nucleotide of interest. 【0104】 Therefore, a third aspect of the present invention provides an RNA molecule comprising a sequence encoding a target polypeptide or target nucleic acid, and including a portion of tRNA. 【0105】 The target polypeptide or target nucleic acid may be any of those described in the first aspect of this disclosure. 【0106】 The tRNA portion is part of a tRNA and not an intact tRNA. This portion may be the portion relative to the 5'-side of the split site in the parent tRNA from which the portion is derived, or the portion may be the portion relative to the 3'-side of the split site in the parent tRNA from which the portion is derived. The portion may be a portion of a tRNA that is suitable for being charged, suspected of being suitable for being charged, where charging is desirable, or not induced by a drug being tested for charging. 【0107】 The portion may be a portion relative to one side of the anticodon site in the parent tRNA from which the portion is derived. The parent tRNA may be a wild-type tRNA or a modified tRNA. This portion may be the portion relative to the 5'-side of the anticodon site in the parent tRNA from which the portion is derived, or the portion may be the portion relative to the 3'-side of the anticodon site in the parent tRNA from which the portion is derived. In certain embodiments, the portion is the portion relative to the 3'-side of the anticodon site in the parent tRNA from which the portion is derived. The portion may be a portion of a tRNA that is suitable for being charged, suspected of being suitable for being charged, where charging is desirable, or not induced by a drug being tested for charging. 【0108】 The portion may be a portion of a tRNA that is compatible with pyrrolysyl-tRNA synthetase, where compatibility with pyrrolysyl-tRNA synthetase is desirable, or for compatibility with pyrrolysyl-tRNA synthetase. The portion may be a portion of a tRNA Pyl In an example, the tRNA Pyl is mm tRNA Pyl , 1R26 tRNA Pyl , deltaClos tRNA Pyl , or Nitra tRNA Pyl is. <, 【0109】 In other examples, the portion may be derived from a tRNA split by an anticodon, tRNA Leu tRNA Ala or tRNA SerThe tRNA may originate from any domain, from a prokaryote, or from a bacterial or archaeal species. 【0110】 The exemplary portion is coded by the array provided as Array 1. Other examples include Array 23, Array 25, Array 27, and Array 46. 【0111】 In other examples, the portion is derived from tRNA that is not split at the anticodon. This is particularly relevant to embodiments in which the anticodon of the tRNA is recognized, at least partially, by the relevant acyl-tRNA synthetase. In some embodiments, the portion is derived from tRNA that is split in the D-loop, in the anticodon loop and at the 5' end of the anticodon, in the variable loop, or in the T-loop. In certain embodiments, the portion is derived from tRNA that is split at one of the sites shown in Figure 27c. The portion may be derived from tRNA split between residues D15 and D16, D15 and D17, D15 and D18, D16 and D17, D16 and D18, D17 and D18, A31 and A32, A31 and A33, A32 and A33, V45 and V46, V45 and V47, V45 and V48, V46 and V47, V46 and V48, V47 and V48, T56 and T57, T56 and T58, or T57 and T58 (as shown in Figure 27c and defined in Giege and Eriani (2023)). The portion may be derived from tRNA split between D15 and D17, D15 and D18, D16 and D17, A31 and A33, A32 and A33, V45 and V48, V46 and V48, V47 and V48, T56 and T57, or T56 and T58. The portion may be derived from tRNA from any of the domains, which may be prokaryotes, or from bacterial or archaeal species. 【0112】 In some embodiments, the portion is tRNA. Trp or tRNA ProIt is derived from tRNA. The portion is tRNA split in the D loop, in the anticodon loop and on the 5' side of the anticodon, in the variable loop, or in the T loop Trp or tRNA Pro and may be derived therefrom. In certain embodiments, the portion is tRNA split at one of the sites shown in FIG. 27c Trp or tRNA Pro and is derived therefrom. The portion is tRNA split between residues D15 and D16, D15 and D17, D15 and D18, D16 and D17, D16 and D18, D17 and D18, A31 and A32, A31 and A33, A32 and A33, V45 and V46, V45 and V47, V45 and V48, V46 and V47, V46 and V48, V47 and V48, T56 and T57, T56 and T58, or T57 and T58 Trp or tRNA Pro and may be derived therefrom. The portion is tRNA split between D15 and D17, D15 and D18, D16 and D17, A31 and A33, A32 and A33, V45 and V48, V46 and V48, V47 and V48, T56 and T57, or T56 and T58 Trp or tRNA Pro and may be derived therefrom. The portion is tRNA split between A32 and A33, D15 and D17, or D16 and D17 Trp and may be derived therefrom. The portion is tRNA split between A31 and A33, A32 and A33, D15 and D17, or D15 and D18 Pro and may be derived from tRNA that may be from any domain, may be prokaryotic, or may be from a bacterial or archaeal species 【0113】 Exemplary portions are encoded by the sequences provided as SEQ ID NO: 48, 50, 52, 54, 56, 58, 60 and 62 【0114】 The RNA molecule of the third embodiment may include a stem region, which may be one of those disclosed in the first embodiment. The stem region may be 8-14, 8-12, or 10-12 nucleotides long. The stem region may be 10 or 12 nucleotides long. The stem region may include, or match, the sequence encoded by SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, or SEQ ID NO: 64. In certain embodiments, the stem region matches the sequence encoded by SEQ ID NO: 6. The stem region may be arranged to result in an extension to an anticodon stem loop. 【0115】 Embodiments in which the tRNA portion is derived from tRNA that is split outside the anticodon may also include a stem region. The stem region may be 8-25, 10-23, 12-22, 13-21, 14-20, 15-19, or 16-18 nucleotides long. The stem region may be 17 nucleotides long. For example, the stem region may include or be identical to the sequence encoded by Sequence ID No. 66. 【0116】 The stem region may be located between the sequence encoding the target polypeptide or target nucleic acid and the tRNA portion. 【0117】 In certain embodiments, the RNA molecule of the third embodiment includes a stem region attached to a portion of the tRNA that is the 3' portion of the split site in the parent tRNA. Thus, the RNA molecule includes the 3' half of the tRNA that has been split and is attached to the elongated portion of the stem region. Pure examples are provided as RNAs encoded by SEQ ID NOs: 11, 38, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, and 88. 【0118】 In certain embodiments, the RNA molecule of the third embodiment includes a stem region attached to a portion of the tRNA that is the portion of the anticodon site in the parent tRNA that is 3' to the side of the anticodon site. Thus, the RNA molecule includes the 3' half of the tRNA that is split at the anticodon and attached to the elongated portion of the stem region. Pure examples are provided as the RNAs encoded by SEQ ID NO: 11, SEQ ID NO: 38, SEQ ID NO: 68, SEQ ID NO: 70, and SEQ ID NO: 72. 【0119】 The sequence encoding the target polypeptide or target nucleic acid can be directly linked to the stem region. Alternatively, a linker sequence may be present between the sequence encoding the target polypeptide or target nucleic acid and the stem region. The linker may be a region of nucleic acid that provides flexibility. The linker is optional, and suitable examples are discussed in the first and second embodiments. 【0120】 In certain embodiments, the RNA molecule may include, from 5' to 3', a sequence encoding the target polypeptide or target nucleic acid, optionally a linker, a stem region, and a portion of tRNA corresponding to the 3' portion of the split parent tRNA. 【0121】 Method for determining the acylation state or efficiency of tRNA acylation The inventors have further developed methods for labeling acylated tRNA. These methods enable the identification of charged tRNA and are particularly sensitive. 【0122】 Embodiments of these methods are referred to herein as fluoro-tREX. This method allows specific acylated tRNAs derived from a pool of tRNAs isolated from cells to be labeled by primer extension using fluorescent dNTPs. 【0123】 Another embodiment of these methods is referred to herein as bio-tREX. Bio-tREX enables the selective isolation of specific acylated tRNAs by using primer extension with biotinylated dNTPs and streptavidin pulldown. 【0124】 Therefore, in a fourth aspect of the present invention, a method for determining the acylation state of tRNA or the efficiency of tRNA acylation, i) Incubating tRNA and a substrate capable of acylating tRNA under conditions that promote tRNA acylation; ii) The step of exposing tRNA to conditions that can block the 3' end of free tRNA; and iii) A step of exposing tRNA to a condition that results in the addition of a nucleotide to the 3' end of an unblocked tRNA, wherein at least one nucleotide contains a label. A method is provided that includes this. 【0125】 The tRNA may be naturally occurring or modified. The tRNA may be intact. The tRNA may be modified to be compatible with a specific synthase, and it may have a modified anticodon or not. In preferred embodiments, particularly when the method is performed in cells, the tRNA does not contain an anticodon. We have found that anticodon-free tRNA is not a ribosomal substrate, and that experimental tRNA lacking an anticodon interferes with endogenous cellular processes, albeit to a relatively small degree. 【0126】 tRNA may be any of those described in relation to the first or second aspect of this disclosure, or may be formed from any of the RNA molecules described in the third aspect of this disclosure. For example, tRNA may be split tRNA, tRNA may be split at an anticodon, tRNA may be derived from pyrrolidyl-tRNA synthetase-compatible tRNA, and tRNA may be tRNA PylIt may also be, or may be derived from tRNA Pyl It may be derived. In the example, tRNA Pyl is mm tRNA Pyl , 1R26 tRNA Pyl deltaClos tRNA Pyl or Nitra tRNA Pyl In other examples, the portion may be derived from tRNA split by an anticodon, and the tRNA Leu tRNA Ala or tRNA Ser The tRNA may be derived from any domain, may be a prokaryote, or may be derived from a bacterial species or an archaeal species. 【0127】 The substrate may be any of those described in connection with the first aspect of the present invention. 【0128】 Step i) may be as described for the first aspect. For example, the conditions may be intracellular. Thus, tRNA can be expressed intracellularly, for example, from one or more vectors. The substrate can be produced intracellularly or provided exogenously. The cells can be cultured under conditions that allow charging of tRNA with the substrate in a normal environment. In some examples, the cells are prokaryotic cells, bacterial cells, or Escherichia coli cells. 【0129】 Step i) may include exposure to an agent that has, or is suspected of having, an effect on the acylation state of tRNA. The agent can be any polypeptide, nucleic acid, or condition that has, or is suspected of having, an effect on the acylation state of tRNA. In particular, the agent can be any polypeptide or nucleic acid of interest for any of the purposes discussed for the first aspect. 【0130】 As discussed herein, step i) may include charging tRNA with a substrate and exposing the substrate-tRNA complex to an agent that can chemically modify the substrate. For example, the agent may increase or decrease the susceptibility of the substrate-tRNA complex to deacylation. Thus, there may be a conditional deacylation step between step i) and step ii). 【0131】 In step ii) of the fourth aspect, the tRNA is exposed to conditions that can block the 3' end of the free tRNA. The 3' end of the acylated tRNA is not blocked under such conditions. Any condition that prevents subsequent elongation of the tRNA by addition of nucleotides to the 3' end is suitable, and one example is exposure to sodium periodate under oxidative conditions. Such conditions do not block the acylated tRNA because it is protected by the substrate acylated to the tRNA. Then, the previously acylated tRNA can be exposed to conditions suitable for removal of the substrate that acylated the tRNA such that the acylated tRNA has an intact 3' ribose to which additional nucleotides can be added, while the non-acylated tRNA is blocked. Thus, after step ii), the method may include deacylation of the tRNA. In some embodiments, the method includes a conditional deacylation step prior to step ii), and in such embodiments, the deacylation step after step ii) is a second deacylation step. 【0132】 In step iii) of the fourth embodiment, the tRNA is exposed to conditions that result in the addition of a nucleotide to the 3' end of an unblocked tRNA, wherein at least one nucleotide contains a label. As discussed in relation to the first embodiment, the addition of the nucleotide can be achieved by annealing of the oligonucleotide protruding from the 3' end of the tRNA to the 3' end of the tRNA, and by the extension of the tRNA by polymerization based on the template provided by the oligonucleotide. The oligonucleotide can be labeled, for example, fluorescently labeled. The extension of the 3' end may follow the tREX method (Cervettini, D. et al. Rapid discovery and evolution of orthogonal aminoacyl-tRNA synthetase-tRNA pairs. Nat Biotechnol, doi:10.1038 / s41587-020-0479-2 (2020)). 【0133】 The nucleotide at the 3' end of the tRNA, or at least one nucleotide, contains at least one label. This allows for the detection of previously acylated tRNA. Prior art methods detect acylated tRNA by using labeled substrates (Saito et al., 2001), but this has drawbacks. For example, the synthase does not need to be compatible with the labeled substrate, and it is impossible to specifically optimize it for unlabeled substrates. Other prior art methods detect tRNA based on its size rather than by direct detection of a label bound to at least one nucleotide (Cervettini, D. et al. Rapid discovery and evolution of orthogonal aminoacyl-tRNA synthetase-tRNA pairs. Nat Biotechnol, doi:10.1038 / s41587-020-0479-2 (2020)). Such methods have low sensitivity. 【0134】 The label may be directly detectable by optical means, for example. The label may be a fluorescent label. The label may be a first label containing the ligand or receptor of a ligand-receptor pair. For example, the first label may be conjugated by a second label containing an optically detectable portion, such as a fluorescent moiety. The first label may be conjugated by an immobilized second label that enables tRNA capture. The first label may be conjugated by a second label conjugated to a physically detectable portion, such as a magnetic bead that enables tRNA pulldown. A suitable ligand-receptor example is biotin-streptavidin, but other ligand-receptor pairs are also suitable for use with the present invention. Interactions with intermediate molecules or multiple intermediate molecules between the first label and the second label, such as an adapter molecule or multiple adapter molecules, are also included. 【0135】 In one embodiment, at least one nucleotide includes a first label which includes a fluorescent label or which can be bound by a second label which includes a fluorescent moiety. In another embodiment, at least one nucleotide includes a first label which includes a physically detectable moiety or which can be bound by a second label which includes a physically detectable moiety. Thus, the method may, after step iii), include the step of contacting the tRNA with a second label which can be bound to the first label. 【0136】 The method of the fourth embodiment may include the capture of labeled tRNA via a first label or a second label bound to the first label. In embodiments in which the tRNA is a split tRNA, the capture of the tRNA may involve capturing only one portion of the tRNA, and it is not necessary to capture the entire portion. Examples of suitable labels for capture are discussed herein and include biotin, magnetic moieties, or other ligand-receptor pairs to which one portion is immobilized. 【0137】 Labeled tRNA As will be discussed in relation to the fourth aspect, the inventors provide labeled tRNA. 【0138】 Accordingly, a fifth aspect of the present invention provides a tRNA comprising an additional nucleotide at its 3' end, wherein at least one nucleotide comprises a label. The tRNA may be any of those discussed in relation to the fourth aspect. The label may be any of those discussed in relation to the fourth aspect. 【0139】 Nucleic acid construct A sixth aspect of the present invention provides a nucleic acid encoding a split tRNA according to any of the second aspects or an RNA molecule according to the third aspect. 【0140】 The nucleic acid may be a DNA construct. The nucleic acid may be a portion of the vector. Thus, a vector comprising nucleic acid according to the sixth embodiment is provided. The vector may be present inside cells such as prokaryotic cells, bacterial cells, or E. coli cells. 【0141】 The inventors hereby demonstrate that split tRNA can be produced from a single gene in which two halves of tRNA are cyclically substituted and linked by an intervening sequence. The primary transcript of this gene is processed in cells to obtain functional split tRNA that is acylated by acyl-tRNA synthetase. 【0142】 Therefore, in a particular embodiment, a nucleic acid is provided that includes, from 5' to 3', a sequence encoding a second stem region, a sequence encoding a second tRNA portion, a sequence encoding a loop, a sequence encoding a first tRNA portion, and a sequence encoding a first stem region, wherein the sequence encoding the first stem region and the sequence encoding the second stem region encode complementary stem region sequences. 【0143】 In certain embodiments, a nucleic acid is provided comprising, from 5' to 3', i) a sequence encoding the polypeptide or nucleic acid of the choice, optionally ii) a sequence encoding a linker, iii) a sequence encoding a second stem region, iv) a sequence encoding a portion of the second tRNA, v) a sequence encoding a loop, vi) a sequence encoding a portion of the first tRNA, and vii) a sequence encoding the first stem region, wherein the sequence encoding the first stem region and the sequence encoding the second stem region encode complementary stem region sequences. 【0144】 Loops are suitable for generating split RNA from a cyclically substituted transcript. Loops may be removed, spliced, or cleaved during RNA processing. The resulting RNA can be split into two strands, one containing features i), optionally ii), iii), and iv), and the other containing features vi) and vii). 【0145】 The loop may be or may be derived from an intergeneric region of a naturally occurring tRNA operon. The tRNA operon may be derived from a tRNA operon of a cell in which the method of this disclosure is performed. The tRNA operon may be an Escherichia coli tRNA operon. The intergeneric region can be identified by a tRNA operon generator disclosed in (Dunkelmann, DL, Oehm, SB, Beattie, AT & Chin, JW A 68-codon genetic code to incorporate four distinct non-canonical amino acids enabled by automated orthogonal mRNA design. Nat Chem, doi:10.1038 / s41557-021-00764-5 (2021)), which is incorporated herein by reference. The loop may be or may originate from an intergeneric region in the E. coli tRNA operon between glyW-cysT, argY-argZ, or leuP-leuV. 【0146】 Examples of suitable loop regions include TCGTCCT TAAATCGTGCATGGATTCACACAATTATAAA (SEQ ID NO: 15) AATTTTGCACCCAGCAAACTTGGTACGTAAACGCATCGT (SEQ ID NO: 16) TCTCTTACTTGATATGGCTTTAGTAGCGGTATCAATATCAGCAGTAAAATAAATTTCCCGAT (SEQ ID NO: 17) AGATTGTTTCTTCG (SEQ ID NO: 18) AACGAGGCGATATCAAAAAAAGTAAGATGACTGT (SEQ ID NO: 19) GTTTAAAAGACATCGGCGTCAAGCGGATGTCTGGCTGAAAGGCCTGAAGAATTT (SEQ ID NO: 20) AATTAGACAGCTATACAATC (SEQ ID NO: 21) TAATTCACCACAAAAACGCAGTGCTGCCGCTAAGT (SEQ ID NO: 22) and the like. 【0147】 In a preferred embodiment, the loop region is SEQ ID NO: 17, SEQ ID NO: 19, or SEQ ID NO: 21. 【0148】 The polypeptide or nucleic acid of interest to be encoded may be any of those disclosed herein. In certain examples, the nucleic acid encodes an acyl-tRNA synthetase. The linker to be encoded may be any of those disclosed herein. The first stem region and the second stem region to be encoded may be any of those disclosed herein. 【0149】 The first and second tRNA portions to be encoded may be any of those disclosed herein. For example, the second tRNA portion may be the 3' portion of tRNA separated by an anticodon, and the first tRNA portion may be the 5' portion of tRNA separated by an anticodon. The tRNA portions may be derived from tRNAPyl. In the example, tRNA Pyl is mm tRNA Pyl , 1R26 tRNA Pyl deltaClos tRNA Pyl , or Nitra tRNA Pyl The tRNA part is tRNA. Leu tRNA Ala , or tRNA Ser It may also be derived from other sources. Examples are SEQ ID NOs: 1 and 2, respectively. Other examples are SEQ ID NOs: 23 and 24, SEQ ID NOs: 25 and 26, SEQ ID NOs: 27 and 28, and SEQ ID NOs: 46 and 47. In other examples, the tRNA portion is derived from tRNA that is not split by an anticodon. Such embodiments are described further elsewhere (see, for example, the first embodiment). Examples are SEQ ID NOs: 48 and 49, SEQ ID NOs: 50 and 51, SEQ ID NOs: 52 and 53, SEQ ID NOs: 54 and 55, SEQ ID NOs: 56 and 57, SEQ ID NOs: 58 and 59, SEQ ID NOs: 60 and 61, and SEQ ID NOs: 62 and 63. 【0150】 The construct may include a 5' untranslated region (UTR). In a preferred embodiment, the 5'UTR is CTCTGTCTGCCCCCCTACCGAAG (SEQ ID NO: 10). Other examples include TTGTCCACCCACTCAAGGC (SEQ ID NO: 33) or GTCAGAGTATAACAATCATACCCCGAG (SEQ ID NO: 34). Another 5'UTR is CCTCTAGAAGGAGATGGAAAA (SEQ ID NO: 35). The 5'UTR is located 5' to the sequence encoding the polypeptide or nucleic acid of interest. 【0151】 The nucleic acid of the sixth embodiment is applicable to any other embodiment of the present disclosure characterized by a split tRNA. Therefore, the nucleic acid of the sixth embodiment can be used to encode a split tRNA relating to any of the other embodiments. 【0152】 An exemplary construct is provided below. The italicized position is at the 5'UTR, the "N" region codes for the target polypeptide or nucleic acid (which may be of any length), the bold and italicized portion codes for an arbitrary linker, the underlined portion codes for the stem region, the regular text portion codes for the tRNA portion, and the bold portion codes for the loop. TIFF2026519275000003.tif189170 (Sequence ID 29 - Not included in the list due to an undefined gap (ST.26 paragraph 37)) TIFF2026519275000004.tif131170 (Sequence ID 30 - Not included in the list due to an undefined gap (ST.26 paragraph 37)) TIFF2026519275000005.tif131170 (Sequence ID 31 - Not included in the list due to an undefined gap (ST.26 paragraph 37)) TIFF2026519275000006.tif131170 (Sequence ID 32 - Not included in the list due to an undefined gap (ST.26 paragraph 37)) (Sequence ID 41 - Not included in the list due to an undefined gap (ST.26 paragraph 37)) TIFF2026519275000007.tif39170 (Sequence ID 101 - Not included in the list due to an undefined gap (ST.26 paragraph 37)) TIFF2026519275000008.tif39170 (Sequence ID 102 - Not included in the list due to an undefined gap (ST.26 paragraph 37)) 【0153】 The construct may be a 5'UTR, any sequence encoding the target polypeptide or the target nucleic acid, optionally a linker disclosed herein, a stem region disclosed herein or shown above, a portion of tRNA disclosed herein or shown above, a loop disclosed herein or shown above, a portion of tRNA disclosed herein or shown above, and a stem region disclosed herein or shown above. 【0154】 Method for producing polypeptides or nucleic acids A seventh aspect of the present invention provides a method for producing a polypeptide or nucleic acid, comprising the steps of providing a sequence of a target polypeptide or nucleic acid to be identified by a screening method of any of the first aspects or a labeling method of the fourth aspect, and producing a polypeptide or nucleic acid matching the sequence. 【0155】 In one embodiment, the method may include the steps of performing the method according to the first or fourth aspect of the present invention, and then producing the identified polypeptide or nucleic acid. 【0156】 Therefore, in one embodiment, the method is a method for producing polypeptides or nucleic acids, i) Providing a library comprising multiple sequences encoding a target polypeptide or a target nucleic acid, wherein each sequence in the library is ligated to a portion of tRNA; ii) A step of incubating each target polypeptide or target nucleic acid together with tRNA containing a portion of tRNA linked to a sequence encoding each target polypeptide or target nucleic acid under conditions that promote acylation, wherein the incubation includes a substrate capable of acylation of tRNA; iii) Exposing the tRNA to conditions that allow for the labeling of the acylated tRNA; iv) A step of identifying whether each target polypeptide or target nucleic acid is bound to the labeled tRNA; and v) Step of producing a polypeptide or nucleic acid that matches the sequence of the identified polypeptide or nucleic acid of interest. This method includes [something]. 【0157】 Features of the first, second, third, fourth, fifth, or sixth aspects of the present invention are applicable to the seventh aspect. The tRNA may be any of those disclosed herein. For example, the tRNA may be a tRNA that is split at an anticodon and includes a stem region which is an extension of the anticodon stem-loop. The tRNA can be split outside the anticodon. A sequence encoding the target polypeptide or target nucleic acid can optionally be directly bound to the stem region via a linker. The stem region and linker may be any of those disclosed herein. The construct encoding the split tRNA may be one of those described in the sixth aspect. 【0158】 Step iii) may include any method or technique for labeling the acylated tRNA as disclosed herein. 【0159】 Step iv) may include quantifying the number of tRNAs bound to a specific target sequence that is being labeled. Thus, step iv) can determine the efficiency or state of acylation. Step iv) may include any method for identifying the target sequence disclosed herein. For example, sequence information can be obtained completely or partially for the target polypeptide or target nucleic acid bound to the labeled tRNA. In some examples, portions of tRNA linked to sequences encoding the target polypeptide or target nucleic acid can be captured if they are bound to the labeled tRNA, and sequence information can be obtained. 【0160】 Step v) may include the step of preparing a polypeptide or nucleic acid that can be charged with a specific substrate. Step v) may include the step of preparing a polypeptide or nucleic acid that can be charged with a specific substrate with the highest efficiency, specificity, or combination of efficiency and specificity in a library. The method may be performed multiple times, and step v) may include the step of preparing a polypeptide or nucleic acid that can be charged with a specific substrate but cannot be charged with other tRNAs, or cannot be charged with other substrates, and can therefore be used in an orthogonal system. Step v) may include the step of preparing a polypeptide or nucleic acid that can alter the chemical properties of the substrate in a desired manner. For example, the polypeptide or nucleic acid can be identified by embodiments in which the charged tRNA is exposed to the polypeptide / nucleic acid, and it can be determined whether the polypeptide / nucleic acid can alter the substrate in a manner that affects its sensitivity to substrate-tRNA deacylation. 【0161】 The target polypeptide or target nucleic acid may be any of those disclosed herein. In certain embodiments, the target polypeptide is an acyl-tRNA synthetase. A library containing multiple sequences encoding the target polypeptide may be a library of variant acyl-tRNA synthetases. For example, the acyl-tRNA synthetase may contain random mutations. The acyl-tRNA synthetase may be pyrrolidyl-tRNA synthetase. The acyl-tRNA synthetase may be a variant of pyrrolidyl-tRNA synthetase or may be based thereon. Thus, the library may be a library of pyrrolidyl-tRNA synthetase variants. Alternatively, the acyl-tRNA synthetase may be tRNA Leu tRNA Ala , or tRNA Ser , or may be suitable for use with modified versions thereof. In further examples, acyl-tRNA synthetase is used with tRNA Trp or tRNA ProIt is suitable for use in conjunction with [another product / service]. 【0162】 Therefore, in one embodiment, a method for producing acyl-tRNA synthetase, i) Providing a library comprising multiple sequences encoding variant acyl-tRNA synthetase, wherein each sequence in the library is ligated to a portion of tRNA; ii) A step of incubating each acyl-tRNA synthetase together with a tRNA containing a portion of tRNA linked to the sequence encoding each acyl-tRNA synthetase under conditions that promote acylation, wherein the incubation includes a substrate capable of acylation of the tRNA; iii) Exposing the tRNA to conditions that allow for the labeling of the acylated tRNA; iv) A step to identify whether each acyl-tRNA synthetase is bound to the labeled tRNA; and v) A method is provided which includes the step of producing an acyl-tRNA synthetase that matches the sequence of an identified acyl-tRNA synthetase. 【0163】 Beta-amino acid-acyl-tRNA synthetase The inventors have identified acyl-tRNA synthetases capable of acylating tRNA with beta-amino acids using the methods and means disclosed herein. This demonstrates that the methods disclosed herein are functional and can be used for the intended purpose. Further details of these experiments are provided in the priority documents (European Patent Application No. 2306393.6 filed on 28 April 2023 and European Patent Application No. 2400299.0 filed on 9 January 2024, respectively, which are incorporated herein by reference). 【0164】 α,α-disubstituted amino acid-acyl-tRNA synthetase The inventors have identified acyl-tRNA synthetases capable of acylating tRNA with α,α-disubstituted amino acids using the methods and means disclosed herein. This demonstrates that the methods disclosed herein are functional and can be used for the intended purpose. Further details of these experiments are provided in the priority documents (European Patent Application No. 2306393.6 filed on 28 April 2023 and European Patent Application No. 2400299.0 filed on 9 January 2024, respectively, which are incorporated herein by reference). 【0165】 Beta-hydroxy acid acyl-tRNA synthetase The inventors have identified acyl-tRNA synthetases capable of acylating tRNA with a beta-hydroxy acid using the methods and means disclosed herein. This demonstrates that the methods disclosed herein are functional and can be used for the intended purpose. Further details of these experiments are provided in the priority documents (European Patent Application No. 2306393.6 filed on 28 April 2023 and European Patent Application No. 2400299.0 filed on 9 January 2024, respectively, which are incorporated herein by reference). 【0166】 All of the features described herein (including the appended claims, abstract and drawings), and / or all of the steps of any method or process so disclosed herein, may be combined with any of the above embodiments in any combination, except for any combination in which at least part of such features and / or steps are mutually exclusive. 【0167】 For a better understanding of the present invention and to illustrate how its embodiments can be carried out, examples are referenced herein that are not intended to limit the invention in any sense. [Examples] 【0168】 Summary of Examples The genetic code of living cells has been reprogrammed to enable site-specific incorporation of hundreds of non-standard amino acids (ncAAs) into proteins, as well as the encoded synthesis of non-standard polymers, macrocyclic peptides, and depsipeptides. Current methods for modifying orthogonal (O)-aminoacyl-tRNA synthetases to acylate novel monomers rely on translational readouts and therefore require the monomer to be a ribosomal substrate. O-synthetases cannot evolve to acylate O-tRNA using non-standard monomers (ncMs) that are weak ribosomal substrates (and ribosomes cannot evolve to polymerize ncMs that cannot acylate on O-tRNA); this codependency creates an evolutionary deadlock that limits the scope of translation in living cells to alpha-L-amino acids and closely related hydroxy acids. Here, we break this deadlock by developing direct selection of O-synthetases that acylate congeneral O-tRNAs using ncMs, regardless of whether the ncMs are ribosomal substrates. The inventors have developed a split tmRNA consisting of a non-covalent assembly between the 5' half of an O-tRNA, the 3' half of an O-tRNA, and an mRNA encoding a congenerase; this couples the synthase genotype with split tmRNA acylation in cells. The inventors have also developed a method for specifically isolating and enriching acylated split tmRNA. The inventors combine these advantages in a tRNA display to enable direct, rapid, and scalable selection of O-synthetases that acylate their congenerase O-tRNA; this method uses 1 / 50th of the ncM of translation-based selection, and the inventors parallelize the tRNA display to efficiently select synthetases for eight ncAAs. Using the tRNA display, the inventors directly select O-synthetases that acylate congenerase O-tRNA using β-amino acids. Based on this advance, the inventors demonstrate the genetically encoded, site-specific cellular integration of β-amino acids into proteins, thereby expanding the chemical range of the E. coli gene code. 【0169】 Introduction Here, the inventors have developed a derivative of tREX that isolates specific acylated tRNAs from cells and labels them with dNTP analogs by primer extension; this enables fluorescence imaging (fluoro-tREX) or capture (bio-tREX) of acylated tRNAs. The inventors have also developed a cyclically substituted metanosarcina mazeipyrrolidine tRNA by joining the 5' and 3' ends via an intervening sequence and by creating new 5' and 3' ends with an anticodon. CUA (MmtRNA Pyl CUA , hereafter tRNA Pyl CUA (The inventors have identified a gene called cissplit(s)tRNA) Pyl It produces a gene. The intercalating sequence is processed from the transcript and acylated by Mmpyrrolidyl-tRNA synthetase (hereafter referred to as PylRS), a homologous aminoacyl-tRNA synthetase of the parent tRNA, to produce a split stRNA consisting of a 5' half and a 3' half. 【0170】 The inventors have identified the PylRS gene as cis-stRNA Pyl By fusing it with the gene, cis-stmRNA Pyl By creating this, the genotype responsible for acylation is associated with acylation itself. The inventors demonstrate that they can selectively enrich (by more than 300 times) stmRNA encoding an active PylRS variant with respect to a variant of attenuated activity using bio-mREX (a modification of bio-tREX applied to stmRNA). The inventors increase the dynamic range of PylRS enrichment by maximizing stmRNA transcription while minimizing translation of the PylRS mRNA encoded within the stmRNA. 【0171】 The inventors generate stmRNA libraries containing combinations of mutations in the PylRS gene and rapidly and scalably define active and selective PylRS variants by a process they call tRNA display, using parallel bio-mREX-based enrichment, reverse transcription, and NGS, both in the presence and absence of ncAA. The inventors have used tRNA display to identify carboxylic acids and weak ribosomal substrates that are generally considered to be unable to function in translation (Katoh, T. & Suga, H. In vitro genetic code reprogramming for the expansion of usable noncanonical amino acids. Annual Review of Biochemistry 91, 221-243 (2022), Melo Czekster, C., Robertson, WE, Walker, AS, Soll, D. & Schepartz, A. In Vivo Biosynthesis of a beta-Amino Acid-Containing Protein. J Am Chem Soc 138, 5194-5197, doi:10.1021 / jacs.6b01023 (2016), Tan, Z., Forster, AC, Blacklow, SC & Cornish, VW Amino Acid Backbone Specificity of the Escherichia coli Translation Machinery. Journal of the American Chemical Society 126). 12752-12753 (2004), Pavlov, MY et al. Slow peptide bond formation by proline and other N-alkylamino acids in translation. Proceedings of the National Academy of Sciences 106, 50-54 (2009), Katoh, T., Tajima, K. & Suga, H.Consecutive Elongation of D-Amino Acids in Translation. Cell Chem Biol 24, 46-54, doi:10.1016 / j.chembiol.2016.11.012 (2017), Katoh, T. & Suga, H. Ribosomal Incorporation of Consecutive beta-Amino Acids. J Am Chem Soc 140, 12159-12167, doi:10.1021 / jacs.8b07247 (2018), Dedkova, LM et al. beta-Puromycin selection of modified ribosomes for in vitro incorporation of beta-amino acids. Biochemistry 51, 401-415, doi:10.1021 / bi2016124 (2012)) We select an orthogonal aminoacyl-tRNA synthetase (aaRS) of the ncM class that specifically acylates congeneral orthogonal tRNAs using β-amino acids. Furthermore, using β-amino acid pairs, we demonstrate site-specific co-translational incorporation of β-amino acids into recombinant proteins. [Examples] 【0172】 High-sensitivity detection and efficient isolation of acylated tRNAs The inventors have demonstrated that they can determine the aminoacylation state of specific tRNA isolated from cells by selective, primer-mediated extension of non-oxidized tRNA using periodate oxidation followed by a nucleotide derivative supporting a fluorophore (Cy5) or biotin (Figure 2a). 【0173】 The present inventors have identified PylRS and a known and efficient substrate for PylRS (N ε tRNA in the presence and absence of -((tert-butoxy)carbonyl)-L-lysine (BocK, 1) Pyl CUAtRNA was isolated from cells expressing tRNA. The inventors oxidized the isolated tRNA with sodium periodate and tRNA Pyl The 3' end of the tRNA was annealed to a DNA probe containing a 3' Cy3 and a 5' poly-G stretch. The inventors used a dNTP mix in which kleno-exo(-) and dCTP were replaced with Cy5-labeled dCTP to protect tRNA from periodate oxidation as a result of aminoacylation-mediated protection. Pyl CUA The free 3' end was extended. The inventors visualized the fluorescence signal after gel electrophoresis. The inventors examined the extended tRNA from cells expressing PylRS and providing BocK(1). Pyl CUA A strong Cy5-labeled band corresponding to the selected product was detected; in contrast, tRNA from cells not provided with PylRS or BocK(1) yielded minimal Cy5 signaling (Figure 2b). The Cy3 signal resulting from the tRNA-DNA probe hybrid provided a measure of tRNA abundance (Figure 7). It should be noted that under our electrophoretic conditions, we did not degrade the non-extended primer from the labeled extension product, which was necessary for tREX (extended and non-extended products were indistinguishable by fluorescence), but not for our novel method (where the extension reaction generates new fluorescence). These experiments demonstrate that our method, which we have named fluorescent tREX (fluoro-tREX), can track tRNA acylation by generating a fluorescent signal. 【0174】 To evaluate the dynamic range of fluoro-tREX, the inventors of this invention used GFP(150TAG) His6 In response to the amber codon in N ε -(carbobenzyloxy)-L-lysine (CbzK, 2), tRNA Pyl CUA Using four PylRS variants that instruct mediated integration; these PylRS variants reflect their different activities, ranging from 200 times to GFP (150 CbzK). His6This resulted in fluorescence levels. The Cy5 signal of these PylRS variants in fluoro-tREX was GFP (150 CbzK). His6 The expression levels were consistent with those of (Figure 8). We conclude that fluoro-tREX can detect the activity of synthase variants that may have a broad dynamic range, produce low protein yields, and have low activity. 【0175】 When the inventors attempted to use a tRNA elongation-based method to detect acylated tRNA using monomers beyond α-L-amino acids, they desired to confirm that a certain range of monomers could be cleaved from tRNA after periodate oxidation, as required for the 3' elongation step that generates a signal in the tREX-based method. The cleavage of monomers from tRNA depends on the rate of cleavage and the pK of the monomer acylating the tRNA. a This is ester hydrolysis that is expected to be inversely correlated with (Barton, P., Laws, AP & Page, MI Structure-activity relationships in the esterase-catalysed hydrolysis and transesterification of esters and lactones. Journal of the Chemical Society, Perkin Transactions 2, 2021-2029 (1994)). The inventors determined by Northern blotting that α-L-amino acid BocK(1), its hydroxy acid analog, and its desaminocarboxylic acid analog were converted to tRNA by PylRS. Pyl CUAIt was confirmed that it can be bound to (Figure 9) (Kobayashi, T., Yanagisawa, T., Sakamoto, K. & Yokoyama, S. Recognition of non-alpha-amino substrates by pyrrolysyl-tRNA synthetase. J Mol Biol 385, 1352-1360, doi:10.1016 / j.jmb.2008.11.059 (2009)). pK of carboxylic acid in α-L-amino acids a The pK of hydroxy acids is approximately 2.3. a The pK of desaminocarboxylic acid is approximately 3.7. a The pK of β-amino acids is approximately 4.6. The inventors were able to detect acylation by α-amino acids using their initial fluoro-tREX protocol, but fluoro-tREX could not observe acylation of tRNA by hydroxy acids or simple carboxylic acids. By treating tRNA with a base after oxidation, the inventors improved the detection of acylation using L-amino acids, hydroxy acids, and carboxylic acids. a The pK of hydroxy acids a and the pK of carboxylic acid a Because it lies between these two points, the inventors anticipated that the protocol they devised would also detect β-amino acids bound to tRNA. 【0176】 Next, the inventors created biotin-tREX (bio-tREX) by replacing Cy5-dCTP with biotinylated dCTP (bio-dCTP) in the fluoro-tREX extension step. The inventors selectively captured the biotinylated extension product (obtained from a tRNA molecule protected from periodate oxidation by its aminoacylation) on magnetic streptavidin beads, washed the beads, and eluted the bound tRNA extension product. tRNA in the eluate Pyl CUAThe presence of the elongation product depended on the presence of PylRS and BocK(1) in the cell, and the addition of bio-dCTP to the elongation reaction (Figure 2c). We conclude that biotin-tREX enabled the selective capture of tRNA elongation products from aminoacylated tRNA. [Examples] 【0177】 Split tRNA: In vivo assembly, maturation, and acylation Next, the present inventors used the anticodon to form tRNA Pyl CUA By splitting the gene, split tRNA is produced. Pyl (stRNA Pyl The inventors sought to determine whether it was possible to create a system in which the 5' and 3' halves of a split tRNA are transcribed, assembled in vivo by non-covalent interactions (including base pairing), matured by cellular tRNA processing mechanisms, recognized by PylRS, and efficiently acylated (Figure 3a, b). 【0178】 The inventors first designed a series of constructs that split a tRNA gene into two parts using an anticodon. Pyl CUA The anticodon stem-loop sequence in each half of the gene is replaced with an 8-14 nucleotide elongation; the elongations within each pair of halves of the tRNA are base-paired with each other to form a split (s)tRNA. Pyl The design was created to form a stem that stabilizes the stRNA. The inventors believe that a stem of minimal length assists efficient stRNA assembly, while a stem that is too long is detrimental to stRNA assembly by cellular RNAse targeting double-stranded RNA. Pyl We hypothesized that this could lead to its decomposition. 【0179】 The inventors expressed half of each pair of tRNA in trans (from two different plasmids) in the presence or absence of PylRS and BocK(1), and stRNA Pyl The inventors isolated stRNA.Pyl As a measure of assembly and function, stRNA by fluoro-tREX Pyl The acylation of stRNAs with a stem length of 8 base pairs was analyzed. Pyl Regarding this, the inventors observed a reduction in acylation, and this construct cannot be stably assembled in cells. stRNA having a stem longer than 12 base pairs. Pyl Regarding this, the inventors observed gel bands consistent with degradation products (Figure 10). Stems of 10 or 12 base pairs resulted in robust aminoacylation, which depended on the presence of half of both tRNAs, PylRS, and BocK(1) (Figure 3c). The inventors concluded that a 10-base-pair stem is sufficient to facilitate the binding of half of the two tRNAs, minimize degradation, and enable robust aminoacylation of the assembled tRNA. The inventors therefore recommend stRNAs carrying a 10-base-pair stem. Pyl All subsequent experiments were conducted using this method. To the best of our knowledge, this data represents the first example of split tRNA that assembles, matures, and is acylated in cells. 【0180】 Next, the inventors ensure (1) equimolar stoichiometry of half of both tRNAs, and (2) spatial proximity, thereby facilitating the assembly of half of both tRNAs into an acylated tRNA body. PylWe focused on designing an optimal expression system for this purpose. Certain organisms, such as the archaeon Cyanidioschyzon merolae, have tRNAs that are expressed as circulating substitutions where the tRNA gene is split in either an anticodon stem-loop, T-loop, or D-loop and joined together at the acceptor stem via an intervening sequence (Soma, A. et al. Permuted tRNA genes expressed via a circular RNA intermediate in Cyanidioschyzon merolae. Science 318, 450-453 (2007)); in these organisms, post-transcriptional maturation by splicing and processing results in topologically regular tRNAs. Inspired by this innate expression strategy, we hypothesized that cis-tRNAs could be produced from one transcript by creating a circulating substitution of parental tRNAs that can be processed to obtain stRNAs by inserting an intervening sequence between the halves of two tRNAs (Figure 3b). 【0181】 The inventors noticed that the intergenetic regions of the polycistronic tRNA operon in Escherichia coli connect the 3' half of one tRNA to the 5' half of the following tRNA (El Yacoubi, B., Bailly, M. & de Crecy-Lagard, V. Biosynthesis and function of posttranscriptional modifications of transfer RNAs. Annual review of genetics 46, 69-95 (2012)); therefore, these intergenetic regions have a topology similar to that of the intervening sequence in Cyanidioschiszon merola. Using a tRNA operon generator (Dunkelmann, DL, Oehm, SB, Beattie, AT & Chin, JW A 68-codon genetic code to incorporate four distinct non-canonical amino acids enabled by automated orthogonal mRNA design. Nat Chem, doi:10.1038 / s41557-021-00764-5 (2021)), the inventors have developed a tRNA operon generator. Pyl CUA Three E. coli intergeneric regions (glyW-cysT, leuP-leuV, and argY-argZ) were selected from tRNAs exhibiting high sequence similarity to the target gene. The inventors used these intergeneric regions and two intermodal sequences derived from circularly substituted archaeal tRNA (Soma, A. et al. Permuted tRNA genes expressed via a circular RNA intermediate in Cyanidioschyzon merolae. Science 318, 450-453 (2007)) as intermodal sequences in testing the inventors' circular substitution strategy. 【0182】 The inventors of this invention have identified stRNA PylThe 3' half of the gene is connected to the 5' half of the split tRNA gene via one of five "loop" sequences (two archaeal intercellular sequences and three E. coli intergenetic regions), forming a cis-stRNA. Pyl The inventors created a gene. The inventors also created a cis-stRNA gene in the presence and absence of BocK(1) along with PylRS. Pyl Cells carrying the construct were grown. tRNA was isolated, and then fluoro-tREX was used to isolate cis-stRNA. Pyl Efficient expression of stRNA from genes (Cy3 signaling), and cis-stRNA Pyl stRNA produced from genes Pyl The substantive, BocK-dependent acylation (Cy5 signaling) of this molecule was revealed (Figure 3d). This is a cis-stRNA derived from E. coli that possesses an intergenetic region. Pyl Genes are tRNA Pyl CUA stRNA at the same level Pyl It produces stRNA Pyl is tRNA Pyl CUA It was acylated to a level equivalent to that (Figure 12A). The inventors then used the E. coli intergenetic region leuP-leuV for all further experiments. The inventors used tRNA Pyl CUA We conclude that the split tRNA can be split and expressed cis-form from a single transcript, and that the split tRNA functions as an efficient substrate for acylation by PylRS. [Examples] 【0183】 Covalent linkage between acylation phenotype and genotype Next, the inventors used the PylRS coding sequence and linker sequence as cis-stRNA. Pyl The 3' half of the expression cassette is fused to the 5' end, and the stmRNA is attached. Pyl A cassette was created (Figure 4a). To maximize expression, the inventors used stmRNA PylThe entire cassette was placed under the control of an inducible T7 promoter and terminator. The inventors hypothesized that the transcription, processing, and maturation of this construct would result in a split tRNA in which the mRNA encoding the synthase was covalently bound to the 5' end of the 3' half of the tRNA (the 3' end of the 3' half acylated by the synthase). stmRNA Pyl Translation of the synthetic enzyme mRNA within the body occurs in the presence of its congener ncM, and stmRNA Pyl This process generates a synthase protein that acylates the tRNA. This creates a covalent linkage between the monomer bound to the tRNA and the mRNA of the synthase gene that catalyzed the binding. 【0184】 To test our hypothesis, we grew cells carrying wt stmRNA in the presence and absence of BocK(1), isolated the total RNA, and performed fluoro-mREX, a modified version of fluoro-tREX optimized for larger RNAs (by using an mRNA-compatible RNA isolation method and an agarose gel for analysis). Notably, for wt stmRNA, we observed a BocK(1)-dependent fluorescence (Cy5) band in fluoro-mREX, and the electrophoretic mobility was consistent with the length of the stmRNA construct. This is consistent with the encoded synthase that aminoacylates stmRNA using its substrate. 【0185】 To further confirm that the fluoro-mREX signal arises from the activity of synthase encoded in the stmRNA construct, we have developed a novel construct (stmRNA) containing a (at.)PylRS variant with significantly reduced activity as determined by a GFP expression assay. at The inventors generated stmRNA in fluoro-mREX. atNo fluorescence signal was observed (Figure 4b). This provides further evidence that the fluoro-mREX signal observed by the inventors for wt stmRNA arises from aminoacylation of split tRNA by synthase encoded on the same construct. 【0186】 The inventors conclude that their stmRNA construct is functional. This construct is transcribed and processed to produce a split tRNA in which the 3' half is fused to synthase mRNA. The synthase gene is transcribed, and the resulting protein catalyzes the acylation of the 3' end of the 3' half of the stmRNA. In fluoro-mREX, acylation is converted into a fluorescent "phenotype" by the addition of a fluorescent nucleotide to the RNA chain containing synthase mRNA. This creates a physical link between the synthase mRNA sequence, its genotype, and the fluorescent "phenotype," which are produced as a result of synthase activity. [Examples] 【0187】 Efficient acylation-specific enrichment of the PylRS genotype Next, the inventors aimed to selectively isolate acylated stmRNA from non-acylated stmRNA and directly obtain the cDNA of the PylRS gene responsible for acylation by reverse transcribing the isolated PylRS mRNA within the stmRNA (Figure 4c). The inventors then hypothesized that the obtained cDNA could be used as a direct readout in quantitative (q)PCR to be converted into DNA for further selection and directional evolution, or sequenced. 【0188】 To selectively isolate acylated stmRNA from non-acylated stmRNA, the inventors created bio-mREX (Figure 4c), which is an adaptation of bio-tREX to stmRNA. In this method, the inventors used the same method to isolate the RNA used for fluoro-mREX. After periodate oxidation of the isolated RNA, the inventors added a DNA probe, kleno-exo(-), and dNTPs in which dCTP was replaced with bio-dCTP. The aminoacylated stmRNA was tagged with biotin, captured on streptavidin beads, and the beads were washed to remove nonspecific binders. PylRS mRNA was then directly reverse transcribed from the captured stmRNA on the beads to produce PylRS cDNA. The PylRS cDNA was released by RNase H treatment and heating, and then quantified by a qPCR-based method. 【0189】 To test our method, we grew E. coli cells carrying the wt stmRNA construct in the presence and absence of BocK(1) and performed bio-mREX. Surprisingly, we recovered more than 100 times more cDNA molecules in the presence of BocK(1) (Figure 4d). To further demonstrate that bio-mREX selectively recovers active PylRS variants, we performed bio-mREX with and without BocK(1) on cell-derived stmRNA at And it was compared with wt stmRNA. The inventors of this invention compared stmRNA at Compared to using BocK(1), we recovered 300 times more DNA molecules from wt stmRNA (Figure 4d, Figure 12B). Furthermore, in the presence of BocK(1), we recovered approximately 2.5% of the wt stmRNA molecules placed in the pull-down, which was consistent with minimal loss of acylation signaling. We conclude that bio-mREX enables efficient and selective recovery of stmRNA and the genes of synthases that acylate the split tRNAs within them. 【0190】 To test the dynamic range of bio-mREX, we created stmRNA constructs for a set of four PylRS(CbzK) variants (PylRS variants that instruct the incorporation of CbzK, 2). Pyl CUA And when paired with 2, these PylRS variants are GFP(150TAG) His6 The resulting GFP fluorescence is derived from the PylRS variant, and the level of GFP fluorescence produced by the PylRS variant can reach two orders of magnitude (Figure 4e). The GFP signal indicates that the PylRS(CbzK) variant is its homologous tRNA. Pyl CUA Assuming that the efficiency of aminoacylation is the primary factor, we ideally would observe a correlation between GFP fluorescence and the number of molecules recovered by bio-mREX (Figure 13). However, when assayed with bio-mREX, we observed similarly high recovery of cDNA for the three most active PylRS variants; this suggested that, above the threshold activity, the first-generation bio-mREX could not effectively distinguish between different acylation activities (Figures 14, 4e). 【0191】 The maximum potential dynamic range of bio-mREX is defined by the number of stmRNAs in the cell, as this defines the number of split tRNA substrates, and therefore the number of acylation events that can occur before all stmRNAs in the cell are acylated. We expressed stmRNA from a strong T7 promoter to maximize stmRNA transcription and thus the potential dynamic range. However, in stmRNA, PylRS mRNA resides on the same transcript as the split tRNA substrate of the PylRS enzyme; therefore, an increase in stmRNA transcription is likely to increase the concentration of the PylRS enzyme. At high PylRS enzyme concentrations, the enzyme, which is inherently less active, may acylate the split tRNA substrate to completion (by mass action), resulting in a compression of the bio-mREX dynamic range. These considerations suggested that high stmRNA levels and low PylRS enzyme levels maximize the experimental dynamic range of bio-mREX. 【0192】 PylRS production is a function of the abundance of stmRNA transcript and the efficiency of translation of PylRS mRNA within this transcript. Since translation efficiency in E. coli can be controlled by the efficiency of ribosome binding sites (RBS), we embarked on selectively adjusting the concentration of the PylRS enzyme by modifying RBS. Using a de novo DNA RBS calculator (Salis, HM, Mirsky, EA & Voigt, CA Automated design of synthetic ribosome binding sites to control protein expression. Nature biotechnology 27, 946-950 (2009)), we designed 5'UTR sequences with attenuated translation rates and introduced them into the mRNA of PylRS(CbzK) variants within stmRNA. For all predicted RBS sequences, the correlation between GFP expression resulting from amber repression and the number of molecules recovered by bio-mREX improved with respect to the original construct (Figure 14, Figure 4e). RBS2 showed a good correlation, and the inventors then used stmRNA for all subsequent experiments. vol2 This uses stmRNA that utilizes RBS, which is called [name of RBS]. 【0193】 In conclusion, stmRNA vol2 By combining the construct with bio-mREX, we have developed a pulldown that can selectively isolate cDNA of active PylRS variants over a wide dynamic range, beyond inactive variants. [Examples] 【0194】 Direct selection for cellular acylation by tRNA display Next, the inventors devised a novel method for directly selecting synthases based on their tRNA acylation activity. The inventors hypothesized that active and selective PylRS variants could be efficiently detected by performing selection based on parallel bio-mREX coupled with next-generation sequencing (NGS) deep sequencing (Figure 5a). In such experiments, a PylRS active site library was compared with stmRNA vol2 During construction, the selected monomers were cloned and transformed into E. coli cells. The cultures were then diluted in culture medium in the presence (positive sample) and absence (negative sample) of the selected monomers overnight, and bio-mREX was performed. After performing the experiment in multiple replicates, the cDNAs of the positive and negative samples, as well as the cDNA reverse-transcribed from the input library, were barcoded and sequenced by NGS (Figure 5a). The inventors referred to this selection method as tRNA display. 【0195】 NGS data from sample selection allows for the calculation of two key parameters: (1) enrichment, defined as the average abundance of the same sequence in positive samples compared to the abundance of a particular sequence in the input RNA; and (2) selectivity, defined as the ratio of the abundance of the same sequence in positive samples compared to the abundance of a given sequence in negative samples. Desired PylRS variants correspond to sequences that are both highly enriched and highly selective. Plotting the natural logarithm of enrichment against the natural logarithm of selectivity yields a spindle-shaped distribution. We anticipate that all desirable sequences lie in the upper right quadrant of the spindle plot (Figure 5a) (highly enriched and highly selective). 【0196】 To test tRNA display, the inventors used stmRNA vol2As a construct, we generated a small PylRS library in which we expect many sequences to be active. The library contains mutations previously identified that enable efficient incorporation of CbzK(2) (Yanagisawa, T. et al. Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered Pyrrolysyl-tRNA Synthetase. Cell Chem Biol 26, 936-949 e913, doi:10.1016 / j.chembiol.2019.03.008 (2019), Dunkelmann, DL, Willis, JCW, Beattie, AT & Chin, JW Engineered triply orthogonal pyrrolysyl-tRNA synthetase / tRNA pairs enable the genetic encoding of three distinct non-canonical amino acids. Nat Chem 12, 535-544, doi:10.1038 / s41557-020-0472-x). (2020), the Y306, L309, and N346 positions of PylRS were targeted (Figures 5b and 15). The inventors transformed E. coli cells with this library and performed one round of tRNA display. The inventors observed a large population of highly enriched and selective variant PylRS sequences in spindle plots derived from sequencing of this experiment (Figure 5c). 【0197】 To evaluate the predictive power of tRNA display, the inventors identified tRNAs that are considered potential hits based on their position on the spindle plot. Pyl CUA and GFP(150TAG) in the presence of 65 PylRS variants His6We measured the in vivo production of GFP (150CbzK) from the sample (Figure 16). We observed a positive correlation between the enrichment derived from NGS data and the translational activity derived from GFP production for these hits (Figure 5d), and the majority of these hits were selective (Figure 16). 【0198】 The inventors concluded that tRNA display enables the direct, translation-independent identification of active and selective PylRS enzymes from a library of PylRS sequences. [Examples] 【0199】 High-throughput selection of ncAAs using tRNA display To further validate the usefulness of tRNA display, the inventors performed parallel selection (Figure 17) using six independent, highly diverse PylRS active site libraries (Figure 15) and ten ncAAs, 2–11 (Figure 5b). After two rounds of selection, the inventors analyzed spindle plots derived from NGS data and identified individual PylRS variants for enriched and selective ncAAs 2, 3, 4, 7, 8, 9, 10, and 11; the enriched and selective variants for each of these ncAAs exhibited convergent sequence motifs (data are illustrated in Supplementary Figures 12–22 of the priority document, European Patent Application No. 2400299.0, filed on 9 January 2024 – Note: The following references to European Patent Application No. 2400299.0 are to this document). 【0200】 The inventors of this invention have identified tRNA Pyl CUAThe incorporation of ncAAs 3, 4, 7, 8, 9, 10, and 11 in response to the amber codon in GFP(150TAG)His6 in cells containing the corresponding PylRS variants identified by tRNA display was demonstrated. GFP production was ncAA-dependent, and ESI-MS confirmed the incorporation of each ncAA in GFP (as illustrated in Figures 5e-i - Supplementary Figures 13-22 of European Patent Application No. 2400299.0). The inventors note that their results include aminoacyl-tRNA synthetase for 7, enabling the first incorporation of this thiophene-containing ncAA into the protein. Of the 30 characterized variants having selectivity scores higher than or equal to 10 and enrichment scores higher than or equal to 5, 27 were active in protein expression for their homologous ncAAs (20 variants had at least 50% of the activity of PylRS with BocK(1)). All 27 variants, as determined by mass spectrometry, selectively incorporated their respective ncAA substrates (as illustrated in Figures 5e-i - Supplementary Figures 13-22 of European Patent Application No. 2400299.0). 【0201】 In summary, the inventors demonstrated parallel, scalable, and rapid selection of PylRS variants using diverse libraries and ncAAs via tRNA display. The inventors note that the amount of ncAA used in each tRNA display selection is 1 / 100 to 1 / 50 of the amount used in current methods for synthase selection. [Examples] 【0202】 Searching for β-amino acid-specific PylRS variants using tRNA display Next, the inventors attempted tRNA display to search for synthases for a class of ncMs known to be untranslatable or weak ribosomal substrates from in vitro testing (Figure 6) (Katoh, T. & Suga, H. In vitro genetic code reprogramming for the expansion of usable noncanonical amino acids. Annual Review of Biochemistry 91, 221-243 (2022), Melo Czekster, C., Robertson, WE, Walker, AS, Soll, D. & Schepartz, A. In Vivo Biosynthesis of a beta-Amino Acid-Containing Protein. J Am Chem Soc 138, 5194-5197, doi:10.1021 / jacs.6b01023 (2016), Tan, Z., Forster, AC, Blacklow, SC & Cornish, VW Amino Acid Backbone Specificity of the Escherichia coli Translation Machinery. Journal of the American Chemical Society 126, 12752-12753 (2004), Pavlov, MY et al. Slow peptide bond formation by proline and other N-alkylamino acids in translation. Proceedings of the National Academy of Sciences 106, 50-54 (2009), Katoh, T., Tajima, K. & Suga, H. Consecutive Elongation of D-Amino Acids in Translation. Cell Chem Biol 24, 46-54, doi:10.1016 / j.chembiol.2016.11.012 (2017), Katoh, T.Suga, H. Ribosomal Incorporation of Consecutive beta-Amino Acids. J Am Chem Soc 140, 12159-12167, doi:10.1021 / jacs.8b07247 (2018), Dedkova, LM et al. beta-Puromycin selection of modified ribosomes for in vitro incorporation of beta-amino acids. Biochemistry 51, 401-415, doi:10.1021 / bi2016124 (2012). The inventors focused on nine ncMs (12-20, Figure 6a), but these monomers exhibit β-stoichiometry that fluctuates. 2 and β 3 It contains β-hydroxy acids and carboxylic acids, which are amino acids. 6-((tert-butoxycarbonyl)amino)hexanoic acid (BocAhx, 15) is a known substrate for wt PylRS (Kobayashi, T., Yanagisawa, T., Sakamoto, K. & Yokoyama, S. Recognition of non-alpha-amino substrates by pyrrolysyl-tRNA synthetase. J Mol Biol 385, 1352-1360, doi:10.1016 / j.jmb.2008.11.059 (2009)) and provided a control for the inventors' ncM selection. 【0203】 To select PylRS variants for these monomers, we performed parallel tRNA display selection (Figure 18) using highly diverse libraries (Figure 15) with mutations in residues 300, 302, 305, 306, 309, 344, 346, 348, and 401 in the PylRS active site, and their respective ncMs. We identified enriched and selective PylRS variants by analyzing spindle plots derived from NGS data for each ncM (data are illustrated in Supplementary Figures 24-32 of European Patent Application No. 2400299.0). For 12 and 15, we identified enriched and selective sequences, and the most selective hits converged to different sequence patterns for each of these ncMs. 【0204】 The inventors identified sequences similar to the wild-type PylRS sequence for ncM 15,6-((tert-butoxycarbonyl)amino)hexanoic acid (BocAhx), demonstrating that the selection converged on the active synthase for this monomer. Four of the most selective and active hits from the selection, PylRS(15_1) to PylRS(15_4), differed from the wild-type sequence by a point mutation at V401; the inventors demonstrated that all of these selected sequences were active and selective for 15 using fluoro-tREX (Figure 6b - also illustrated in Supplementary Figure 27 of European Patent Application No. 2400299.0). Since 15 is expected to be more difficult to cleave from tRNA than other monomers containing β-amino acids (Figure 9), this result provided confidence that tRNA display would enable the selection of synthases for a wide range of other monomers containing β-amino acids. 【0205】 Notably, two PylRS variants, PylRS(12_1) and PylRS(12_2), identified by tRNA display selection, were determined by fluoro-tREX. Pyl CUA (S)-3-amino-3-(3-bromophenyl)propanoic acid (β 3-mBrF, 12)-dependent acylation was instructed (as illustrated in Figure 6c - Supplementary Figure 24 of European Patent Application No. 2400299.0). To verify the identity of the monomers bound to tRNA by PylRS(12_1) and PylRS(12_2), the inventors used tRNA Pyl CUA Biotinylated probes for acylated tRNA on streptavidin beads Pyl CUA The beads were then washed, and ncM was eluted by heating under alkaline conditions; the inventors then derivatized the free ncM and analyzed the sample by LC-MS (Figure 19). Using this method, the inventors determined that both PylRS variants use ncM12 to elute tRNA Pyl CUA We confirmed that it charges (Figure 6e, f). To the best of our knowledge, PylRS(12_1) / tRNA Pyl CUA and PylRS(12_2) / tRNA Pyl CUA This is the first β-amino acid-specific orthogonal aminoacyl-tRNA synthetase / tRNA pair ever described. 【0206】 Next, the inventors increased the activity of PylRS(12_1) and PylRS(12_2) by random mutagenesis of the active site region of the PylRS gene within the stmRNA construct, followed by selection based on tRNA display (Figure 20 and Supplementary Figures 34, 35 of European Patent Application No. 2400299.0). From the resulting spindle plots, the inventors identified sequences carrying 1 to 3 additional mutations relative to the parental clone, which were enriched and selective. Three of the most enriched and selective hits were PylRS(12_1) evol1~3 ) was a derivative of PylRS(12_1). The inventors used 12 to tRNA by both fluoro-tREX and their LC-MS-based assay. Pyl CUA PylRS(12_1) for acylation evol1~3The specificity of ) was confirmed (Figures 6d, f, g, and also shown in Supplementary Figure 36 of European Patent Application No. 2400299.0, Figure 19). PylRS(12_1 evol1~3 ) is a tRNA that uses 12 rather than PylRS(12_1). Pyl CUA It showed significantly higher activity during acylation (Figure 6c, d, e, f). 【0207】 Next, the inventors of the present invention have found that PylRS(12_1) or PylRS(12_1) in cells evol1 ) to tRNA Pyl CUA and GFP150TAG His6It is possible that β-link fragments can be synthesized and isolated (Katoh, T. & Suga, H. In vitro genetic Annual Review of Biochemistry 91 , 221–243 ( 2022 ) Melo Czekster , C. , Robertson , WE , Walker , AS , Soll , D. & Schepartz , A. In Vivo Biosynthesis of a Beta-Amino Acid-Containing Protein Soc 138, 5194–5197, doi:10.1021 / jacs.6b01023 (2016);Tan, Z., Forster, AC, Blacklow, SC & Cornish, VW Amino Acid Backbone Specificity of the Escherichia coli Translation Machinery. Proceedings of the National Academy of Sciences 106, 50-54 (2009) Pavlov, MY et al., Consecutive Elongation of D-Amino Acids in Translation Cell Chem Biol 24, 46–54;Ribosomal Incorporation of Consecutive beta-Amino Acids. J Am Chem Soc 140, 12159-12167, doi:10.1021 / jacs.8b07247 (2018), Dedkova, LM et al. beta-Puromycin selection of modified ribosomes for in vitro incorporation of beta-amino acids. Biochemistry 51, 401-415, doi:10.1021 / bi2016124 (2012)), the inventors found that GFP production depends on the addition of 12 to cells. GFP fluorescence is more pronounced than PylRS(12_1). evol1 ) is three times higher, and PylRS(12_1 evol1 This was consistent with the higher acylation activity of PylRS(12_1) or PylRS(12_1) by ESI-MS and MS / MS. evol1 GFP purified from cells containing ) His6 I confirmed 12 embedded items in the 150th position. 【0208】 In the absence of 12, the inventors observe some GFP production resulting from Phe integration. However, in the presence of 12 (as illustrated in Figure 6g, h - Supplementary Figure 37 of European Patent Application No. 2400299.0), the inventors produce more GFP, and the inventors detect only the integration of 12 by intact MS and MS / MS. The inventors conclude that in the presence of 12, the background integration of Phe observed in the absence of 12 is effectively overcome. Similar observations have been made previously regarding efficient and selective ncAA integration systems (Wang, K., Neumann, H., Peak-Chew, SY & Chin, JW Evolved orthogonal ribosomes enhance the efficiency of synthetic genetic code expansion. Nat Biotechnol 25, 770-777, doi:10.1038 / nbt1314 (2007)), and it is also known that the fidelity of the natural code relies on competition (Fredens, J. et al. Total synthesis of Escherichia coli with a recoded genome. Nature 569, 514-518, doi:10.1038 / s41586-019-1192-5 (2019)). The inventors of this invention have developed GFP3TAG His6In experiments using this method, the incorporation of 12 at the 3-position of GFP was not observed (as illustrated in Supplementary Figure 37 of European Patent Application No. 2400299.0), and β-amino acids are weak ribosomal substrates (Katoh, T. & Suga, H. In vitro genetic code reprogramming for the expansion of usable noncanonical amino acids. Annual Review of Biochemistry 91, 221-243 (2022), Melo Czekster, C., Robertson, WE, Walker, AS, Soll, D. & Schepartz, A. In Vivo Biosynthesis of a beta-Amino Acid-Containing Protein. J Am Chem Soc 138, 5194-5197, doi:10.1021 / jacs.6b01023 (2016), Tan, Z., Forster, AC, Blacklow, SC & Cornish, VW Amino Acid Backbone Specificity of the Escherichia coli Translation Machinery. Journal of the American Chemical Society 126, 12752-12753 (2004), Pavlov, MY et al. Slow peptide bond formation by proline and other N-alkylamino acids in translation. Proceedings of the National Academy of Sciences 106, 50-54 (2009), Katoh, T., Tajima, K. & Suga, H. Consecutive Elongation of D-Amino Acids in Translation. Cell Chem Biol 24, 46-54, doi:10.1016 / j.chembiol.2016.11.012 (2017), Katoh, T. & Suga, H.Note that this finding was consistent with "Ribosomal Incorporation of Consecutive beta-Amino Acids. J Am Chem Soc 140, 12159-12167, doi:10.1021 / jacs.8b07247 (2018)" and "Dedkova, LM et al. beta-Puromycin selection of modified ribosomes for in vitro incorporation of beta-amino acids. Biochemistry 51, 401-415, doi:10.1021 / bi2016124 (2012)," and note that β-amino acids are not permissible at all positions in proteins. 【0209】 Next, the inventors performed two rounds of selection using lib14 and ncM A1, A2, A3, A4, A5 (β-amino acids with altered side chains), A6 (α,α-disubstituted amino acid), and A7 (β-hydroxy acid) (as illustrated in Figures 45a and 47 of European Patent Application No. 2400299.0). From the resulting spindle plots (as illustrated in Figures 48-54 of European Patent Application No. 2400299.0), the inventors identified enriched and selective sequences, and the most selective hits converged to different sequence patterns for each ncM. The inventors note that the selected synthases for all six β-amino acids differ in sequence but contain common mutations M300D and A302H (see Figures 29 and 48-52 of European Patent Application No. 2400299.0). The sequence pattern observed for β-hydroxy acid A7 is similar to that observed for β-amino acids. However, the residue at position 300, which may be directly adjacent to the amine / hydroxyl group, is changed from aspartic acid to asparagine (see Figure 54 of European Patent Application No. 2400299.0). The PylRS variant identified by tRNA display selection, as determined by fluoro-tREX and our LC-MS-based assays, shows tRNA from its homologous monomer. Pyl CUAThe inventors instructed specific acylation of (see Figures 45d-45q of European Patent Application No. 2400299.0). The inventors quantified the acylation fraction as a function of ncM concentration (see Figure 55 of European Patent Application No. 2400299.0). To the best of the inventors' knowledge, they have searched for the first specific aminoacyl-tRNA synthetase / tRNA pairs for three different classes of ncM: β-amino acids, α,α-disubstituted amino acids, and β-hydroxy acids. [Examples] 【0210】 ncM coding (enoding) in proteins To investigate the incorporation of β-amino acids, α,α-disubstituted amino acids, and β-hydroxy acids into proteins, the inventors searched for orthogonal synthase / orthogonal tRNA pairs in cells for eight types of ncM, 12, A1, A2, A3, A4, A5, A6, and A7, and used GFP150TAG. His6In combination with the above, a congeneral ncM was added. The inventors observed ncM-dependent GFP production for 12, A2, A5, and A6, with isolated yields ranging from 3 to 35 mg per liter of culture. Mass spectrometry confirmed the incorporation of these β-amino acids and α,α-disubstituted amino acids into GFP (as illustrated in Figure 6h - also illustrated in Figures 42, 45r, 45s, 56, and 57 of European Patent Application No. 2400299.0). In the absence of 12, the inventors observed some GFP production resulting from the incorporation of native amino acids. However, in the presence of 12, the inventors produced more GFP, and the inventors detected only the incorporation of 12 by intact MS and MS / MS (as illustrated in Figures 42 and 56 of European Patent Application No. 2400299.0). The inventors concluded that in the presence of 12, background incorporation observed in the absence of 12 was effectively overridden; the inventors made similar observations for A2, A5, and A6 (as illustrated in Figures 45s, 42, and 56 of European Patent Application No. 2400299.0, Figure 6h). Similar observations have been previously made for efficient and selective ncAA incorporation systems, and it is also known that the fidelity of the natural code relies on competition. The inventors conclude that 12, A2, A5, and A6 are incorporated site-specifically with high fidelity. The inventors also found that GFP at position 3 (GFP3TAG) His6 Although we did not observe the incorporation of ncM 12, A2, A5, or A6 (as illustrated in Figure 57 of European Patent Application No. 2400299.0), this indicates that these ncMs are not permissible at all locations in the protein; similar site-dependent incorporation efficiencies have been previously observed for ncAA. 【0211】 The present inventors have found that when cells are provided with A1, A3, A4, or A7 and their homologous orthogonal synthase / orthogonal tRNA pairs, GFP150TAG is produced using these ncMs. His6 or GFP3TAG His6It should be noted that we did not observe an ncM-dependent increase in GFP production from (as illustrated in Figures 45r and 57 of European Patent Application No. 2400299.0). These observations are consistent with these ncMs being weak substrates for ribosome polymerization. For A4 and A7, we observed a decrease in GFP production upon addition of the ncM (as illustrated in Figure 45r of European Patent Application No. 2400299.0); this is consistent with these ncMs inhibiting amber codon readthrough once acylated on orthogonal tRNA. Searching for orthogonal synthases specific to these ncMs provides a starting point for selecting ribosomes to polymerize them. [Examples] 【0212】 Structure of β-amino acid proteins To further characterize the 12 incorporations at position 150 of GFP, the inventors performed X-ray crystallography to determine GFP(150(S)β) at 1.5 Å. 3 mBrF His6 The structure of (protein PylRS(12_1) and tRNA was elucidated.) Pyl CUA (Purified from cells carrying the protein) (Figure 6i). The electron density indicates two consecutive carbon atoms (C2 and C3) in the protein backbone at position 150; the metabromophenyl substituent is bonded to C3 of the β-amino acid, and the stereochemistry at C3 corresponds to the expected (S) stereoisomer. Our structure is the expected (S)β to the protein. 3 Confirm site-specific integration of mBrF amino acids. (S)β 3The introduction of mBrF results in a significant twist in the beta barrel of GFP compared to the wild-type protein (illustrated in Supplementary Figure 38 of the priority document). Interestingly, the hydrogen bonding network of the residues immediately preceding and following the β-amino acid in the polypeptide chain remains essentially unperturbed; this indicates that this beta barrel can accommodate a β3-amino acid at this position (illustrated in Supplementary Figure 38 of European Patent Application No. 2400299.0). To the best of our knowledge, this is the first structure of an in vivo-produced protein containing a β-amino acid. Taken together, our data demonstrate site-specific incorporation of a β-amino acid in a protein produced in cells. [Examples] 【0213】 Consideration In vivo incorporation of main-chain modified monomers has long been an unresolved challenge in expanding the range of encoded cellular polymer synthesis beyond α-L amino acids and their close analogues (De La Torre, D. & Chin, JW Reprogramming the genetic code. Nature Reviews Genetics 22, 169-184, doi:10.1038 / s41576-020-00307-7 (2021), Arranz-Gibert, P., Vanderschuren, K. & Isaacs, FJ Next-generation genetic code expansion. Current Opinion in Chemical Biology 46, 203-211 (2018)).tRNA acylation (Santoro, SW, Wang, L., Herberich, B., King, DS & Schultz, PG An efficient system for the evolution of aminoacyl-tRNA synthetase specificity. Nature biotechnology 20, 1044-1048 (2002), Chin, JW, Martin, AB, King, DS, Wang, L. & Schultz, PG Addition of a photocrosslinking amino acid to the genetic code of Escherichia coli. Proceedings of the National Academy of Sciences 99, 11020-11024 (2002)) or tRNA acylation and ribosome polymerization in translational readouts commonly used for selection for ribosome polymerization (Schmied, WH et al. Controlling orthogonal ribosome subunit interactions enables evolution of new function. Nature 564, 444-448, The codependency of doi:10.1038 / s41586-018-0773-z (2018)) creates an evolutionary deadlock; this deadlock has so far limited the range of monomers that can be used to acylate specific orthogonal tRNAs in vivo. 【0214】 tRNA display breaks this deadlock based on codependency. It achieves this by creating a selectable acylation phenotype and coupling this phenotype to the sequence of the corresponding synthase gene; this allows for the direct selection of orthogonal aminoacyl-tRNA synthetases that acylate their homologous orthogonal tRNAs using ncM, without requiring ncM to be a ribosomal substrate or to function in translation. Using tRNA display, the inventors rapidly and scalably selected efficient aaRS systems for eight ncAAs. These selections consume orders of magnitude fewer compounds than previous methods. Furthermore, the inventors used tRNA display to select and improve upon tRNA acylation systems for ncMs; these systems could not be explored using previous methods. 【0215】 The tRNA display generates numerous synthase sequences whose activity and selectivity can be predicted by the inventors; therefore, the data generated from the inventors' method may enable the de novo design of active sites for novel ncMs. The inventors note that the tRNA display can be extended to many other aaRS / tRNA pairs, and immediate targets include quintuple orthogonal PylRS / tRNA pairs (Beattie, AT, Dunkelmann, DL, Chin, JW Quintuply orthogonal pyrrolysyl-tRNA synthetase / tRNAPyl pairs. Nature Chemistry In press (accepted) (2023)), as well as pairs for Ala, Leu, and Ser, including those that exhibit minimal anticodon recognition. Furthermore, methods can be extended to search for active sites that recognize one ncM but not the other, as required for the encoded synthesis of non-standard heteropolymers (Robertson, WE et al. Sense codon reassignment enables viral resistance and encoded polymer synthesis. Science 372, 1057-1062 (2021)). The inventors note that extensions to tRNA display can be used to select genes (e.g., ncM-specific EF-Tu variants) that either instruct the biosynthesis of ncM or bind to and protect tRNA acylated with ncM. 【0216】 tRNA Pyl CUASince it has been established that ncM12 is acylated in cells, the inventors were able to identify a site in GFP where this incorporation of ncM is permissible to achieve genetically encoded incorporation of a β-amino acid in the protein. In future research, the inventors will utilize cellular acylation of tRNA using ncM to enable translation-based selection for orthogonal ribosomes that can polymerize ncM over a wider range of sites (Wang, K., Neumann, H., Peak-Chew, SY & Chin, JW Evolved orthogonal ribosomes enhance the efficiency of synthetic genetic code expansion. Nat Biotechnol 25, 770-777, doi:10.1038 / nbt1314 (2007), Schmied, WH et al. Controlling orthogonal ribosome subunit interactions enables evolution of new function. Nature 564, 444-448, doi:10.1038 / s41586-018-0773-z (2018), Rackham, O. & Chin, JW A network of orthogonal ribosome x mRNA pairs. Nat Chem Biol 1, 159-166, doi:10.1038 / nchembio719 (2005), Neumann, H., Wang, K., Davis, L., Garcia-Alai, M. & Chin, JW Encoding multiple unnatural amino acids via evolution of a quadruplet-decoding ribosome. Nature 464, 441-444, doi:10.1038 / nature08817 (2010)).Translation-based selection (Schmied, WH et al. Controlling orthogonal ribosome subunit interactions enables evolution of new function. Nature 564, 444-448, doi:10.1038 / s41586-018-0773-z (2018)) can also generate orthogonal ribosomes that facilitate the cellular synthesis of polymers composed of a wider variety of ncMs.The inventors have developed a method for directly encoding ncM, and a clear method for increasing the chemical range of peptides and proteins through post-translational modification and protein ligation (Morinaka, BI et al. Natural noncanonical protein splicing yields products with diverse β-amino acid residues. Science 359, 779-782 (2018), Lakis, E., Magyari, S. & Piel, J. In Vivo Production of Diverse β‐Amino Acid‐Containing Proteins. Angewandte Chemie 134, e202202695 (2022), Camarero, JA & Muir, TW Native chemical ligation of polypeptides. Current Protocols in Protein Science 15, 18.14. 11-18.14. 21 (1999), Niquille, DL et al. Nonribosomal biosynthesis of backbone-modified peptides. Nature We anticipate that combining this with Chemistry 10, 282-287 (2018) and Arnison, PG et al. Ribosomally synthesized and post-translationally modified peptide natural products: overview and recommendations for a universal nomenclature. Natural Product Reports 30, 108-160 (2013) will further expand the repertoire of ncMs that can be used to construct modified proteins and non-standard polymers. 【0217】 Gene coding of β-amino acids can enable the creation of protease-resistant proteins in cells (Seebach, D. et al. β-Peptides: Synthesis by Arndt-Eistert homologation with concomitant peptide coupling. Structure determination by NMR and CD spectroscopy and by X-ray crystallography. Helical secondary structure of a β-hexapeptide in solution and its stability towards pepsin. Helvetica Chimica Acta 79, 913-941 (1996), Hintermann, T. & Seebach, D. The Biological Stability of β-Peptides: No Interactions between β-and β-Peptidic Structures? Chimia 51, 244-244 (1997), Seebach, D. et al. Biological and pharmacokinetic studies with β-peptides. Chimia 52, 734-734 (1998)).Future developments will involve strategies for encoding non-standard polymers in cells (Robertson, WE et al. Sense codon reassignment enables viral resistance and encoded polymer synthesis. Science 372, 1057-1062 (2021)) and foldamers composed of β-amino acids and other ncMs that can form secondary, tertiary, and quaternary structures (Horne, WS, Price, JL & Gellman, SH Interplay among side chain sequence, backbone composition, and residue rigidification in polypeptide folding and assembly. Proceedings of the National Academy of Sciences 105, 9151-9156 (2008), Wang, PS & Schepartz, A. β-Peptide bundles: Design. Build. Analyze. Biosynthesize. Chemical Communications 52, 7420-7432 (2016)), such as foldamers (Gellman, SH Foldamers: a manifesto. Accounts of chemical research 31, This may be combined with an expansion of the range of monomers that can be encoded to enable encoded biosynthesis (173-180 (1998)). The inventors anticipate that the design and directed evolution of genetically encoded foldomers can complement and enhance the standard functions of cells. 【0218】 In addition to ncM12, using tRNA display, the inventors searched for orthogonal synthase / orthogonal tRNA pairs that are selective for eight novel ncMs, including β-amino acids, α,α-disubstituted amino acids, and β-hydroxy acids, thereby directly facilitating gene coding and site-specific incorporation of β-amino acids and α,α-disubstituted amino acids into proteins in living organisms. [Examples] 【0219】 Confirmation of the feasibility of using tRNA display in non-mazei PylRS systems. To confirm the feasibility of tRNA display in non-mazei PylRS systems, we selected a set containing MmPylRS, 1R26 PylRS, Nitra PylRS, N-terminal domain-deficient Clos PylRS, and the corresponding quadruple orthogonal tRNA. Subsequently, we named the three non-mazei PylRS systems "1R26," "deltaClos," and "Nitra." 【0220】 To extend tRNA display to 1R26, deltaClos, and Nitra PylRS, their previously identified divisible tRNAs g1(1R26), I2B72(deltaClos), and Int6C10(Nitra) were screened for appropriate intergenetic regions (IGRs) to generate functional stmRNA fusion constructs (Figure 22). The relevant sequences are SEQ ID NOs. 23 and 24, 25 and 26, and 27 and 28, respectively. 【0221】 The intergene regions evaluated were a) those proposed based on tRNA homology by a tRNA operon generator constructed for the design of non-split tRNA operons (Dunkelmann, DL, Oehm, SB, Beattie, AT & Chin, JW A 68-codon genetic code to incorporate four distinct non-canonical amino acids enabled by automated orthogonal mRNA design. Nat Chem, doi:10.1038 / s41557-021-00764-5 (2021) or International Publication No. 2023285596), b) those designed in silico, or c) the best intergene regions for MmPylRS-stmRNA. 【0222】 Screening was performed by evaluating stmRNA enrichment in the presence and absence of model substrates. For this purpose, the amount of pulled-down stmRNA was measured by qPCR after reverse transcription. For deltaClos, its wt sequence was used, but a 1R26 PylRS active site mutant specific to carbobenzyloxy-L-lysine (CbzK) and a Nitra mutant specific to N-methyl-L-histidine (NMH) were used. This was because the latter two mutants exhibited higher activity or lower misacylation than their wt counterparts, respectively. 【0223】 Several highly active intergenetic regions were identified for 1R26, one of which (synthetic IGR greedy1-sequence number 21) significantly surpassed the enrichment facilitated by optimized Mm stmRNA (138x and 359x) in two separate experiments (360x and 678x; Figure 22ab). For deltaClos and Nitra, several active intergenetic regions were similarly found, but the enrichment achieved by any of the screened intergenetic regions (including the highly active intergenetic regions in the context of 1R26 and / or MmPylRS) was significantly lower for these two systems than for the Mm stmRNA control (Figures 22c-e). The highest enrichment observed for deltaClos was 22x and 12x for Nitra. Combining the four experiments for deltaClos and Nitra, IGR argY-argZ (sequence number 17) appears to be the most promising candidate for both systems. In the experiments of this set, the term "enrichment" refers to a comparison of -ncM and +ncM conditions, and therefore, rather than serving as a substitute for the near-optimal tRNA display selectivity value achievable for these systems, it should be noted that there are few tRNA display enrichment metrics that are quantitatively linked but functionally different. 【0224】 Another interesting observation in the intergenetic region screening was the significant difference in the counts of acylated molecules for the systems evaluated. They were two to three orders of magnitude higher for the highly active IR26 stmRNA compared to MmPylRS stmRNA (which itself is based on IGR leuP-leuV-SEQ ID NO: 19), but this difference is likely due to the fact that the final Mm construct characterized a significantly attenuated RBS strength (predicted in silico as 5 a.u., in contrast to 831 a.u. for RBS currently inducing R26 stmRNA translation). However, while the counts of acylated stmRNAs in qPCR for deltaClos were still slightly lower than for the Mm control, the deltaClos stmRNA construct supported a 20-fold potent RBS (105 a.u.). Despite the evaluated Nitra construct having a 50-fold stronger RBS (251a.u.), this observation was even more stringent for Nitra. 【0225】 To ensure that acylation-dependent pulldown can degrade different PylRS variant activities across a wide range of activities through differential enrichment of the encoding stmRNA, we performed optimization of the RBS in MmPylrRS stmRNA. For the original potent RBS present in the initial MmPylrRS stmRNA repeats, the expressed PylRS levels appeared to saturate the stmRNA population available for acylation, so no substantial enrichment differences were observed for moderate to high-activity PylRS variants. Compared to the final Mm construct, it was inferred that a similar saturation effect could occur, hindering tRNA display evolution, due to 1000-fold higher acylation for greedy1-based 1R26 stmRNA. 【0226】 In particular, to address this possibility not only for 1R26 but also for the other systems, it was necessary to obtain PylRS variants for these three systems, encompassing their activity ranges spanning several orders of magnitude. To this end, active sites (more specifically, residues 306, 309, and 346) derived from MmPylRS variants from previous CbzK selections and rationally designed derivatives were transplanted to homologous positions in (non-stmRNA) wt1R26, deltaClos, and Nitra PylRS based on sequence alignment. The activity of these variants, including the underlying (non-split) tRNA of each stmRNA construct, was then evaluated by a GFP amber repression assay (Figure 23a). 【0227】 For deltaClos, no useful set of attenuated variants was identified in the context of the p15a backbone, which empirically often facilitates an increase in signal levels in this assay, either in the inventors' standard pMB1 system or in the context of the p15a backbone. However, for both the 1R26 system and the Nitra PylRS system, CbzK-specific variants were found that encompassed a broad activity range up to their respective wt levels (Figure 23bc). 【0228】 The GFP amber repression data also support the finding that Nitra PylRS is significantly less active than 1R26, and especially the MmPylRS system, as previously suggested by stmRNA qPCR experiments. This contradicts our other data, which were resolved by repeated active-site graft screening using PylRS expression from p15a (Figure 30). All evaluated variants for all three systems showed a much stronger signal when expressed from p15a to saturation at approximately 20,000 a.u. (equivalent to the signal levels of Mm wt and the most active 1R26 variant in pMB1). This suggests that the GFP assay induced from p15a is unable to degrade PylRS amber repression activity beyond 20% (or even lower) of the wt Mm PylRS signal due to the saturation phenomenon. When this observation is combined with qPCR data from IGR screening, which showed that Nitra and deltaClos had significantly lower numbers of acylated stmRNAs than 1R26, and even lower than MmPylRS stmRNAs with weak RBS, it is likely that the weak enrichment previously observed for Nitra and deltaClos is a result of much lower PylRS activity compared to 1R26 and MmPylRS. 【0229】 To evaluate whether tRNA display by 1R26 stmRNA can degrade a wide range of acylation activities, the identified CbzK-selective active site was cloned into greedy1-based stmRNA. Acylation-dependent pull-down experiments were then repeated as before. For the unattenuated active site, an 830-fold enrichment was again achieved, far exceeding the enrichment previously observed for the Mm system. Comparison with the most strongly attenuated variant (5-fold enrichment) highlights the importance of highly active synthases in setting up tRNA display (Figure 24a). Importantly, for the most active 1R26 variant, saturation of acylated molecule counts could not be detected; instead, a strong correlation with corresponding Amber repression activity data was observed (Figure 24b). Therefore, greedy1-1R26 stmRNA should be ready for tRNA display selection. [Examples] 【0230】 Extension of tRNA display to non-PylRS aaRS / tRNA pairs While the establishment of tRNA display for additional PylRS may provide the easiest access to the evolution of orthogonal active sites, extending tRNA display to non-pyrrolidyl systems promises to broaden the range of ncM substrates that can evolve to a significantly greater extent. Currently, tRNA display utilizes the absence of anticodon recognition by PylRS to enable tRNA Pyl The mRNA fusion is established within the anticodon loop. Therefore, it is reasonable to consider that tRNA display can be extended to aaRS, which does not even rely on anticodon binding to recognize the identity of congeneral tRNAs. This is the case with leucyl, alanyl, and ceryl aaRS, and therefore serves as the next step in the tRNA display journey. 【0231】 The split construct obtained by splitting tRNA under anticodon loop removal and simultaneous cyclic replacement is in silico designed tRNA Ala We prepared the following (Figure 25a - relevant sequences include SEQ ID NOs: 46 and 47, SEQ ID NOs: 72 and 73, and SEQ ID NO: 92). A Cy3-labeled DNA probe complementary to the 3' end of alanyl-tRNA was designed as described by (Cervettini, D. et al. Rapid discovery and evolution of orthogonal aminoacyl-tRNA synthetase-tRNA pairs. Nat Biotechnol, doi:10.1038 / s41587-020-0479-2 (2020)), its specificity was validated, and a fluoro-tREX assay was set up based on this probe. Alanyl-tRNA was produced at high levels, and the designed probe selectively bound to non-split alanyl-tRNA, allowing for the detection of acylation of this tRNA (Figure 25b). Therefore, tRNA Ala The ability to split the tRNA was then evaluated using this fluoro-tREX assay. Three different IGRs were screened for this purpose: argY-argZ, leuP-leuV, and ileV-alaV (the latter proposed by the operon generator, while the other two had previously been proven robust to the pyrrolidyl system). All three were split tRNAs, as indicated by acylation-dependent probe-mediated Cy5 incorporation at the tRNA 3' end. Ala This facilitated the successful maturation of leuP-leuV based split tRNA. Ala While the activity and orthogonality of non-split tRNAs were maintained (Figure 25d), some variation was observed between repeats. 【0232】 The results of these experiments suggest that tRNA display can be extended to aaRS / tRNA pairs without using anticodon recognition. [Examples] 【0233】 Extension of tRNA display to aRS / tRNA pairs using anticodon recognition The inventors hereby disclose a broadly generalizable strategy for establishing the necessary phenotypic-genotype linkage, thereby enabling the extension of tRNA display to aRS / tRNA pairs using anticodon recognition. In a structural approach, 10 positions were identified that are typically acceptable for tRNA splits due to the lack of participation in secondary or tertiary structural interactions, while minimizing interference with the tRNA identity element for any of the 17 tRNA isoacceptor classes exhibiting anticodon recognition (Figure 26). 【0234】 All of these splitting sites have at least one more adjacent site that can enable splitting (based on nucleotide positions important for structure and recognition), and therefore these splitting sites were also considered appropriate to allow deletions between these adjacent sites to compensate for the steric requirements of the stabilizing stem. The 10 identified sites, which include such compensatory deletions of one or two nucleotides between adjacent splitting sites, thus result in a total of 18 possible splits classified into four classes: 6 D-loop splits (Class D), 3 splits on the anticodon side (Class A), 6 variable-loop splits (Class V), and 3 T-loop splits (Class T). Across a total of 17 isoacceptor classes, these 10 sites were found to be identical elements only (tRNA) in 5 cases. Ile and tRNA Gly position 16, tRNA Pro position 37, tRNA Phe Position 31, and tRNA Gln It should be noted that adjacent to position 46), the availability of multiple splitting sites and potential compensatory deletions for all of them increases the likelihood of the presence of a non-perturbative split. 【0235】 To evaluate the cleavage tolerance of these sites and to get an impression of their generalizability, two systems were selected as models. These two systems encompass class I aaRS(Trp) and class II aaRS(Pro), and therefore represent two structurally distinct classes exhibiting different tRNA binding modes. The activity and tRNA orthogonality of both systems were evaluated by the Amber repression assay, and both were considered sufficient as the aRS / tRNA pairs showed activity close to that of the MmPylRS system and considerable tRNA activity (Figure 27a). 【0236】 Figures 27b-d summarize the rationale behind the split construct: the 11 bp stabilizing stems of the pyrrolidyl and alanyl tRNA splits were extended by three GC pairs to compensate for the reduced contiguous stem (the stabilizing stem protrudes directly from the anticodon stem upon removal of the anticodon loop). IGR leuP-leuV (SEQ ID NO: 19) was selected for both tRNAs based on its previous robust function across several systems. For one system, a second IGR (leuW-glnU), proposed by the tRNA operon generator, was also evaluated. From 18 possible split site combinations, a subset of 10 splits was selected that encompassed all split classes (i.e., all tRNA loops), all possible split sites, and all possible compensatory deletion sizes within each split class (Figure 27cd). RNA secondary structure prediction predicted D-loop collapse, so tRNA Pro Regarding D16 / 17, we did not clone them. tRNA Trp Regarding this, we were unable to clone variants A31 / 33 for either IGR, which suggests toxicity to the endogenous translation system. Furthermore, split tRNA and tRNA for the pyrrolidyl system Ala —In other words, we also designed controls that faithfully summarize the design of a split that removes the entire anticodon loop, and examined the possibility of setting up tRNA display in its established form for these systems regardless of its synthase anticodon recognition. 【0237】 A fluoro-tREX assay based on probes specific to each tRNA was set up as before (Figure 28ab; Figure 31 shows the second biological repeat). The probes were specific to those tRNAs, and tRNA acylation was detectable. Both tRNAs were considered orthogonal (compare lanes 11 and 12), but tRNA Pro Although substantially higher, the tRNA observed in the Amber suppression assay Trp The orthogonality was not carried over to the expected extent, almost certainly due to motility phenomena that were not well reflected in the endpoint measurement, the GFP assay. The activity of both synthases remained after the Mm system, but this was not considered problematic for the purpose of the experiment. tRNA Pro The probe was thought to dissociate during urea PAGE because no Cy3 signal was observed, but a probe-dependent Cy5 signal was detected. Therefore, fluoro-tREX screening for split tRNA was then followed for both systems (Figure 28ab). 【0238】 Neither the tryptophanyl nor the prolyl system yielded active tRNA when split by current tRNA display techniques that completely remove the anticodon loop. This suggests that a different strategy is needed to extend tRNA display to any aaRS / tRNA pair where the anticodon is the tRNA identity element. Trp Regarding the splits, transcripts were detected for many constructs (the absence of T-loop split transcripts may be an artifact, as the probe reaches from the 3' end of the tRNA to the variable loop). No acylation was observed for any Trp constructs rearranged by leuW-glnU (Figure 32), but three splits (A32 / 33, D15 / 17, and D16 / 17) retained their ability to be acylated by leuP-leuV (Figure 28c). Interestingly, tRNA ProThis observation is very similar, and acylation was also facilitated with respect to the splitting sites adjacent to the anticodons (A31 / A33 and A32 / 33) and within the D-loop (D15 / 17 and, though weakly, D15 / 18) of the tRNA. Pro -With the exception of D15 / 18, these hits were therefore examined more carefully. 【0239】 Divisible tRNA Trp and tRNA Pro To investigate whether the orthogonality is maintained or whether the observed acylation is caused by endogenous synthases, the identified hits were analyzed in the presence and absence of their respective homologous synthases (Figure 29). 【0240】 It was confirmed that the 5' end of the anticodon and the splitting site in the D-loop facilitate tRNA maturation and acylation for both tRNAs. A significant decrease in acylation was observed for the tryptophanyl system, particularly for tRNAs. Pro The (anticodon-retaining) split within the anticodon loop retained a high acylation signal. Interestingly, the split did not result in a decrease in orthogonality; instead, all splits increased the orthogonality of the split tRNA toward its aaRS. 【0241】 By screening only a subset of the division site combinations proposed above, and combining this with the identification of similar division sites across two tRNA isoacceptor classes belonging to aaRS derived from both class I and II, this observation suggests that tRNA displays can indeed be extended to orthogonal pairs that exhibit anticodon recognition based on these design principles. [Examples] 【0242】 method buffer solution Resuspension buffer (RB): 100mM NaOAc, 50mM NaCl, 0.1mM EDTA, pH5.0 Deacylation buffer (DB): 50mM Bicine pH9.6, 1mM EDTA Buffer D(D): 50 NaOAc pH5, 150 NaCl, 10mM Mg2Cl, 0.1mM EDTA Hybridization buffer (HB): 10 mM Tris-HCl, 25 mM NaCl, pH 7.4 Kreno-Exo(-) Master Mix with Cy5-11-dCTP (KMM-Cy5): 17 μL water, 5 μL 2.0 10x NE buffer, 1 μL Kreno-Exo(-), 1 μL dNTPS-dCTP (10 mM), 1 μL Cy5-11-dCTP (20 μM) Orange loading pigment (OLD): 8M urea, Orange G Cy5-11-dCTP Mini with Creno-(Exo-) Master Mix (KMM-Cy5-Mini): 1.1 μL water, 1.2 μL 10x NE Buffer 2.0, 2 μL Creno-Exo(-), 0.5 μL dNTPS-dCTP (5 mM), 1 μL Cy5-11-dCTP (5 μM) Creno-Exo(-) Master Mix (KMM-Bio) with Bio-11-dCTP: 17 μL water, 5 μL 10x NE buffer 2.0, 1 μL Creno-Exo(-), 1 μL dNTPS-dCTP (10 mM), 1 μL Bio-11-dCTP (20 μM) Wash buffer (WB): 10mM Tris-HCl, 150mM LiCl, 1mM EDTA, 0.05%v / v Tween20, pH7.5 Binding buffer (BB): 20mM Tris-HCl, 1M LiCl, 2mM EDTA, 0.05%v / v Tween20, pH7.5 Formamide loading buffer (FMB): 90% formamide SDS lysis buffer (SLB): 100mM NaOAc, 50mM NaCl, 0.1mM EDTA, pH5.0, 1% (m / w) SDS Alkaline washing buffer (AWB): 25 mM NaOH, 4 mM EDTA, 0.05% Tween20 Reverse transcription hybridization mix (RHM): 1 μL of DNA primer (2 μM), 1 μL of 10 mM dNTPs, 1 μL of 10xHB, 10 μL of water RT Master Mix (RMM): 4 μL SSIV buffer, 1 μL RNAse Out, 1 μL SSIV RT, 1 μL 0.1 M dithiothreitol (DTT) Acidic washing buffer 1 (aWB1): 100 mM NaOAc pH 5 Acidic wash buffer 1+Tween20 (aWB1-T): 100mM NaOAc pH5, 0.01% (v / v) Tween-20 Acidic washing buffer 2 (aWB2): 20 mM NaOAc pH 5 【0243】 Culture medium SOC: Super Optimal Broth + Glucose Yeast extract tryptone supplemented with 2xYT-s: 75 μg / mL spectinomycin. 2xYT-st: Tryptone yeast extract supplemented with 75 μg / mL spectinomycin and 10 μg / mL tetracycline. 2xYT-s-ap: Tryptone yeast extract supplemented with 75 μg / mL of spectinomycin and 50 μg / mL of apramycin. Yeast extract tryptone supplemented with 2xYT-am: 75 μg / mL ampicillin. 【0244】 chemicals NcM1 and 2 were purchased from Bachem. NcM4 was purchased from Fluorochem. NcM5 was purchased from Ambeed. NcM6, 8, 13, 17, and 18 were purchased from Enamine. NcM7 was purchased from aaBlocks. NcM9, 10, 15, and 16 were purchased from Merck. NcM12 and 20 were purchased from BLD. NcM14 was purchased from Advanced ChemBlock. NcM19 was purchased from AstaTech. NcM3 was synthesized as previously described (Spinck, M. et al. Genetically programmed cell-based synthesis of non-natural peptide and depsipeptide macrocycles. Nature Chemistry 15, 61-69 (2023)), and ncM11 was custom synthesized as previously described (Tang, S. et al. Nature 602, 701-707 (2022)). NcM13 and 18 were deprotected with Boc in concentrated HCl in dioxane. 【0245】 Cloning of DNA constructs Standard cloning was performed by Gibson assembly using NEBuilder® HiFi DNA Assembly Master Mix (NEB) in accordance with the manufacturer's guidelines. As previously described, libraries were generated by enzymatic inverse PCR. Briefly, the template plasmid was amplified by PCR using two primers (see primer list) containing degenerate codons at the desired mutagenesis site and BsaI cleavage site. In the case of custom mixes, primers containing different codons were manually mixed and used for the PCR reaction. The PCR products were gel-purified and digested with BsaI and DpnI. Subsequently, the samples were purified, ligated using T4 ligase, and transformed into electrocompetent E. coli DH10β cells. 9The minimum transformation efficiency was ensured. Individual colonies (more than 10) were evaluated using Sanger sequencing for quality control of library assembly. Total plasmid DNA was prepared from the resulting culture, sequenced in bulk using Sanger sequencing, and used for subsequent experiments. 【0246】 General protocol Isolation and oxidation of tRNA (Protocol A) Using this protocol, tRNA was isolated from 1–10 mL of cell culture. Chemically competent DH10β cells were transformed with pMB1 plasmid encoding a PylRS variant and tRNA, or a circulating, displaced split tRNA, and rescued in 1 mL of SOC at 37°C and 700–1000 r.pm for 1 hour. Cells were transferred to selective 2xYT-s medium and grown overnight. The overnight cultures were diluted in a ratio of 1:20–1:40 and diluted to 0.5–1 OD. 600The cells were grown to [a certain size]. The cells were centrifuged at 4200 rcf for 12 minutes at 4°C, transferred to 200 μL of RB, transferred to a 96-well plate, and centrifuged again at 4200 rcf for 12 minutes at 4°C. The cells were resuspended in 135 μL of RB and 15 μL of liquid phenol was added. After lysing the cells by shaking at 650 rpm for 20 minutes, the cells were centrifuged at 4200 rcf for 20 minutes at 4°C; the cell lysate was added to 40 μL of chloroform, and the resulting suspension was mixed by pipetting up and down. The mixture was centrifuged at 4200 rcf for 10 minutes at 4°C, and the 115 μL aqueous layer was transferred to 6 μL of 0.1 M NaIO4. The isolated RNA was oxidized on ice for 1 hour, and the oxidation reaction was quenched by adding 8 μL of 0.1 M DTT. tRNA was purified using a Zymo Research ZR-96 Oligo Clean & Concentrator. Briefly, 250 μL of oligo-binding buffer was added to the oxidation reaction, followed by 400 μL of isopropanol, and the mixture was transferred to a 96-well silica column plate. The plate was centrifuged at 4200 rcf for 2 minutes at room temperature, and 800 μL of oligo-wash buffer was added. The plate was centrifuged at 4200 rcf for 2 minutes at room temperature, aerated, and then centrifuged again at 4200 rcf for 4 minutes at room temperature. Finally, the RNA was eluted by centrifugation at 4200 rcf for 4 minutes at room temperature in 14 μL of water if the sample was not processed, or in 50 μL of water if the sample was further deacylated. 【0247】 tRNA isolation and oxidation (Protocol B) Using the volumes described in this protocol, tRNA was isolated from 5–25 mL of cell culture as previously described. Briefly, cells were grown as described in Protocol A, washed with 800 μL of RB, and transferred to 1.5 mL of Eppendorf tubes. Cells were placed in 225 μL of RB and 25 μL of liquid phenol was added. Cells were lysed by incubation for 20 minutes with vortexing and inversion mixing for 1 minute. Lysed cells were centrifuged at 20000 rcf for 15 minutes at room temperature, the cell lysate was added to 250 μL of chloroform, the sample was vortexed for 1 minute, and then centrifuged at 2000 rcf for 10 minutes at room temperature. 200 μL of aqueous layer was transferred to 10 μL of 0.1 M NaIO4 and the RNA was oxidized on ice for 1 hour. Finally, the oxidized RNA was added to 440 μL of EtOH and allowed to settle at -20°C for at least 20 minutes. The sample was centrifuged at 20,000 rcf for 25 minutes at 4°C and aspirated. The RNA pellet was dried at room temperature for 10 minutes and dissolved in water or buffer D. 【0248】 tRNA deacylation 45 μL of isolated RNA was added to 5 μL of 10x DB, and the tRNA was deacylated at 42°C for 36 minutes. The deacylation reaction was quenched by adding 6 μL of 3M NaOAc, and the tRNA was purified using a Zymo Research ZR-96 Oligo Clean & Concentrator as described in Protocol A for tRNA isolation and oxidation (except for using 100 μL of oligo-binding buffer instead of 250 μL). The deacylated tRNA was eluted in 14 μL of water. 【0249】 Fluoro-tREX Using this protocol, the experiments shown in Figures 3c and 10 were performed. The RNA concentration was adjusted to the least common denominator, and 10 μL of RNA was added to 2.5 μL of 10x HB, then added to 11.5 μL of water and 1 μL of extension primer (2 μM). The DNA primer was hybridized at 65°C for 5 minutes, then 25 μL of KMM-Cy5 was added and extended at 37°C for 6 minutes. The sample was purified using 10 μg of NEB Monarch RNA clean-up Kit (NEB) and eluted in 12 μL of water. 12 μL of OLD was added, and the sample was loaded onto Novex TBE 6M urea, 10 or 15% PAGE gel (Invitrogen) and electrophoresed in 0.5x Tris-borate-EDTA (TBE) buffer at 270 V for 36 minutes. The gels were imaged on an Amersham Typhoon Biomolecular Imager (GE) using Cy3 and Cy5 emission filters. The gels were then stained with SYBR Gold (Invitrogen) and imaged again using the same filters. 【0250】 Mini-Fluoro-tREX Unless otherwise specified, all fluoro-tREX experiments were performed using the mini-fluoro-tREX protocol. RNA concentrations were adjusted to match the lowest concentrations in the samples being compared. 6 μL of RNA was added to 0.5 μL of 10xHB and 0.5 μL of extension primer (2 μM). After hybridizing the DNA primer at 65°C for 5 minutes, 5 μL of KMM-Cy5-mini was added and the mixture was extended at 37°C for 6 minutes. The samples were analyzed as described for fluoro-tREX. 【0251】 bio-tREX The RNA concentration was adjusted to match the lowest concentration in the samples being compared. 10 μL of RNA was added to 2.5 μL of 10xHB, 11.5 μL of water, and 1 μL of extension primer (2 μM). After hybridizing the DNA probe at 65°C for 5 minutes, 25 μL of KMM-bio was added and the mixture was extended at 37°C for 6 minutes. 10 μL of Dynabeads MyOne Streptavidin C1 magnetic beads (Invitrogen) per reaction were washed three times in 200 μL of WB and resuspended in 50 μL of BB; the beads were added to the extension reaction and binding was carried out at 4°C for at least 30 minutes with inversion mixing. The supernatant was removed and the beads were washed four times in 200 μL of WB. The washed beads were resuspended in 10 μL of FLB and heated at 98°C for 3 minutes to release tRNA. The beads were removed, and the supernatant was directly loaded onto Novex TBE 6M urea, 10 or 15% PAGE gels (Invitrogen) and electrophoresed in 0.5x TBE at 270V for 36 minutes. The gels were stained with SYBR Gold (Invitrogen) and imaged on an Amersham Typhoon Biomolecular Imager (GE) using a Cy2 emission filter. 【0252】 Northern Blotting tRNA was isolated according to general protocol A or B, omitting oxidation with NaIO4. 2-3 μg of RNA was loaded onto an acidic urea PAGE gel (9% acrylamide (19:1), 100 mM sodium acetate, pH 5, 8 M urea), and the gel was run 12-16 times at a constant power of 6 watts using 100 mM NaOAc as the electrophoresis buffer. The gel was stained with SYBR gold (Invitrogen) to identify the tRNA, a suitable piece of the gel was cut, and blotted using the iBlot DNA Transfer Stack (Invitrogen) containing the iBlot Dry Blotting System. The tRNA was crosslinked to a membrane (Stratalinker UV Crosslinker 2400) and blocked in Ambion ULTRAhyb-Oligo buffer (Invitrogen) for 30 minutes. Biotinylated DNA probes were added at a final concentration of 0.2 μg / mL and hybridized overnight at 37°C at 160 r.pm. The membranes were washed three times with 20 mL of 0.5x TBE buffer, transferred to 15 mL of Odyssey blocking buffer for 20 minutes, and then IRDye® 800CW streptavidin (LI-COR) was added at a final concentration of 0.2 μg / mL. Finally, the membranes were washed three times with 20 mL of 0.5x TBE buffer and imaged on an Amersham Typhoon Biomolecular Imager (GE) using an IR long-range emission filter. 【0253】 mRNA extraction and oxidation (A) The given volume was suitable for 2-3 mL cell cultures and was proportionally adjusted as needed. Chemically competent BL21 cells were transformed with the pColE1 plasmid encoding an stmRNA construct under the control of the T7 promoter and T7 terminator, rescued in SOC, shaken at 220 r.pm for 1 hour at 37°C, diluted in 2xYT-am, and grown overnight. The overnight culture was diluted in 2xYT-am in a 1:20 ratio in the absence or presence of ncM and incubated at 37°C, 220 r.pm, at an OD of 0.5-0.8. 600The cells were grown to this extent. PylRS production was increased by adding isopropyl β-D-1-thiogalactopyranoside (IPTG) to a final concentration of 1 mM, and the cells were grown at 37°C for 20 minutes at 220 r.pm. 【0254】 Cells were centrifuged at 4200 rcf for 12 minutes at 4°C, resuspended in 800 μL of RB, transferred to a 96-well plate, and centrifuged again at 4200 rcf for 12 minutes at 4°C. Subsequently, the procedure outlined in the user manual for the Agencourt® RNAdvance® Cell v2 RNA Isolation Kit (Beckman) was followed. Briefly, cells were lysed at room temperature for 1 hour using 200 μL of LBE containing 10 μL of proteinase K. 244 μL of BBC beads were mixed with 266 μL of isopropanol and added to the lysate, allowing RNA to bind to the beads at room temperature for 10 minutes. The beads were washed three times with 200 μL of 80% EtOH, and after the final wash, the beads were carefully dried, and the RNA was eluted in 80 μL of water. 【0255】 70 μL of RNA solution was added to 40 μL of RB and 7.5 μL of 0.1 M NaIO4. Oxidation was performed on ice for 1 hour, and the RNA was quenched with 10.5 μL of 100 mM DTT. The oxidized RNA was resuspended by adding 1.5 μL of 1.6 M Na2CO3 and 16.5 μL of DNAseI buffer (Ambion I DNAse, Thermofisher). Subsequently, 18 μL of DNAseI was added, and the RNA was incubated at 37°C for 30 minutes. The digest was cooled on ice, and 300 μL of Agencourt RNAClean XP beads (Beckman) were added, and the RNA was bound with rt for 10 minutes. The beads were washed three times with 80% EtOH. After the final wash, the beads were carefully dried, and the RNA was eluted in 25 μL of water. 【0256】 mRNA extraction and oxidation (B) A protocol similar to that outlined in Procedure A was followed, but RNA was isolated using acid-phenol / chloroform extraction. Briefly, BL21 E. coli carrying stmRNA was isolated in 0.5-0.9 OD. 600Cells were grown in 5 mL of 2xYT-am in or without ncM until stmRNA expression was induced by adding 1 M IPTG to a final concentration of 1 mM. After 20 minutes, cells were collected by centrifugation at 4200 rcf for 12 minutes at 4°C. The cell pellet was resuspended in 800 μL of RB, transferred to a 1.5 mL Eppendorf tube, and centrifuged at 4200 rcf for 3 minutes at room temperature. The supernatant was removed, and the pellet was resuspended in 500 μL of SLB. 500 μL of acid phenol was rapidly added, the tube was vortexed for 1 minute, and the cell pellet was centrifuged at 21,000 rcf for 6 minutes at room temperature. 450 μL of aqueous layer was collected, and 50 μL of 2.5 M KCl was added. Acid phenol chloroform extraction was repeated, and 400 μL of aqueous layer was collected. 400 μL of chloroform was added, and the sample was vortexed for 1 minute, then centrifuged at 21,000 RCF for 6 minutes at room temperature. 300 μL of the aqueous layer was collected, and chloroform extraction was repeated using 300 μL of chloroform. 200 μL of the aqueous phase was transferred to a new 1.5 mL Eppendorf tube, and 10 μL of 0.1 M NaIO4 was added. The oxidation reaction was carried out on ice for 1 hour. 440 μL of ethanol was added, and the RNA was allowed to precipitate at -20°C for at least 20 minutes. The RNA was precipitated by centrifugation at 21,000 RCF for 30 minutes at 4°C. The supernatant was removed, and the pellet was air-dried for 10 minutes. The RNA was resuspended in 50 μL of water. 30 μL of each RNA sample was digested in 120 μL of 1x Ambion DNAse I buffer containing 12 μL of Ambion DNAse I enzyme. The sample was purified using 50 μg of NEB Monarch RNA clean-up Kit (NEB) and eluted in 20 μL of water. The inventors note that when RNA is isolated by acid phenol chloroform extraction, an additional deacylation step in deacylation buffer (DB) is necessary to measure the acylation of stmRNA using non-α-amino acid monomers. 【0257】 Fluoro-mREX The RNA concentration of all samples was adjusted to match the lowest concentration in the samples being compared. 6–12 μg of RNA was added to a mixture of 1 μL of DNA probe (2 μM), 2.5 μL of 10x HB, and water (to a final volume of 25 μL). The primers were annealed at 65°C for 5 minutes. 25 μL of KMM-Cy5 was added. The primers were extended at 37°C for 6 minutes. The samples were purified using 10 μg of NEB Monarch RNA clean-up Kit (NEB) and eluted in 12 μL of water. 12 μL of GLB was added to each sample. Gel electrophoresis was performed at 135 V for 42 minutes using 1% agarose gels in NorthernMax MOPS electrophoresis buffer (added using NorthernMax MOPS electrophoresis buffer). The gels were stained with SYBR Gold (Invitrogen) and imaged on an Amersham Typhoon Biomolecular Imager (GE) using Cy2 and Cy5 emission filters. 【0258】 bio-mREX The RNA concentration of all samples was adjusted to match the lowest concentration in the samples being compared. 6–12 μg of RNA was added to a mixture of 1 μL of DNA probe (2 μM), 2.5 μL of 10x HB, and water (to a final volume of 25 μL). The primers were annealed at 65°C for 5 minutes. 25 μL of KMM-bio was added. The primers were extended at 37°C for 6 minutes. 10 μL of Dynabeads MyOne C1 streptavidin beads (Invitrogen) were washed twice with WB and added to the extension reaction in 50 μL of BB. Biotinylated stmRNA was bound to the beads at 4°C for 1 hour while inverting and mixing. 【0259】 The beads were washed on a magnetic stand three times with 200 μL of WB, twice with 200 μL of AWB, once with 200 μL of WB, and once with 200 μL of water, and finally resuspended in 13 μL of RHM. After washing with AWB and the final wash with WB, the beads were transferred to a new plastic tube. The primers were annealed at 65°C for 5 minutes. 7 μL of RMM was added, and the RNA was reverse transcribed at 50°C for 10 minutes. 1 μL of RNAseH was added, and the mixture was heated at 37°C for 15 minutes and then at 98°C for 3 minutes to release cDNA from the beads. Finally, the cDNA was separated from the beads and used as a template for quantification by qPCR, NGS, or for further cloning. 【0260】 qPCR of cDNA from bio-tREX qPCR reactions were performed three times for each bio-mREX sample, each consisting of 2 μL of cDNA, 10 μL of PowerUp SYBR Green Master Mix (Applied Biosystems), 0.4 μL of each primer, and 7.2 μL of water. Standards were generated by PCR of the MmPylRS gene and quantified using a Qubit 2 fluorometer (Life Technologies) and a Qubit 1x dsDNA HS assay kit (Invitrogen). qPCR standard curves were generated using five 5-fold serial dilutions. This allowed for calculation of qPCR efficiency and the number of molecules in each sample. qPCR was performed on a ViiA 7 Real-Time PCR System (Applied Biosystems) using the standard supplier protocol for SYBR Green (Invitrogen). 【0261】 Preparation of cDNA from bio-tREX for NGS Half of the cDNA from a 20 μL reverse transcription reaction of bio-tREX was added to a PCR mix containing a predetermined mix of 25 μL of Q5® High-Fidelity 2X Master Mix, 12 μL of water, and 2 μL of 10 μM indicator primers. A standard PCR program was used with 29 amplification cycles and an annealing temperature of 60°C. Extension times were adjusted to match the amplicon length according to the manufacturer's guidelines. The DNA was bound to 100 μL of Agencourt AMPure XP (Beckman) over 10 minutes, and the beads were washed three times with 200 μL of 80% EtOH. The beads were dried, and the DNA was eluted in 25 μL of water. DNA concentration was measured using a Qubit 2 fluorometer (Life Technologies) and a Qubit 1x dsDNA HS assay kit (Invitrogen), and 80 ng of each amplicon was mixed into an NGS library. The combined library was diluted to a concentration of 2 nM in HT1 hybridization buffer (Illumina). PhiX (Illumina) was added to increase the library diversity by 20% molar ratio. 12 μL of the library was added to 18 μL of HT1 hybridization buffer (Illumina), and a 20 μL diluted mixture was used for NGS analysis. 【0262】 Cloning of cDNA from bio-tREX for further evolution Half of the cDNA from a 20 μL reverse transcription reaction of bio-tREX was added to a PCR mix containing 25 μL of Q5® High-Fidelity 2X Master Mix, 12 μL of water, and a predetermined mix of 2 μL of 10 μM Golden Gate assembly primers. A touchdown PCR program was used. The initial annealing temperature of 65°C was decreased by 0.5°C per cycle for 10 cycles. Subsequently, 20 normal cycles were performed using an annealing temperature of 58°C. The extension time was adjusted to the length of the amplicon according to the manufacturer's guidelines. The DNA was bound to 100 μL of Agencourt AMPure XP (Beckman) for 10 minutes, and the beads were washed three times with 200 μL of 80% EtOH. The beads were dried, and the DNA was eluted in 25 μL of water. Next, the amplicon was cloned into a new pColE1 backbone that had been pre-amplified using a two-piece Golden Gate assembly with a Golden Gate primer, in accordance with NEB (New England Biolabs) guidelines. 【0263】 NGS Data Analysis NGS was performed on a MiSeq system (for test evolutions using Library 1 and Substrate 1) or a NextSeq2000 system (for all other cases). cDNA obtained from tRNA display was amplified by PCR using oligo-NGS_A(1-8) and NGS_B(1-8) containing different combinations of Nextera sequencing barcodes. Samples were purified, quantified, and combined in equimolar amounts. Paired-end reads were initially paired using PEAR (Ellman, JA, Mendel, D. & Schultz, PG Site-specific incorporation of novel backbone structures into proteins. Science 255, 197-200 (1992)) and aligned with the MmPylRS reference sequence using Bowtie2 (Mendel, D., Cornish, VW & Schultz, PG Site-directed mutagenesis with an expanded genetic code. Annual review of biophysics and biomolecular structure 24, 435-462 (1995)). Relevant library locations were extracted, translated into amino acids, and the resulting variants were counted using an R script. The frequency of each variant in each library was used for subsequent operations, and the count value was calculated by dividing by the total count in that library. Enrichment and selectivity scores were calculated for all variants using an R script as follows: Firstly, variants present only in all positive repeats were considered (tables were merged using the AND operator). Assuming that highly enriched sequences could not potentially be included in the negative and input samples, but could be desirable, negative and naive repeats were merged into the positive table using the OR operator. If a replica did not contain a particular variant, a placeholder value of 0.95 was used.Using the obtained dataset, the mean enrichment in the presence and absence of each substrate was calculated and expressed as a quotient of the mean frequencies under one condition and the input condition. Using the obtained positive and negative enrichments, the selectivity value (equal to the quotient of positive and negative frequencies) for each variant was calculated. For further analysis, the variants were filtered using a threshold empirically determined for the normalized standard deviation of the positive frequency (plus the variance error under the substrate condition). 【0264】 Identification of ncMs by tRNA pulldown and LC-MS tRNA was isolated from 8 mL of cells according to general protocol B, which omits oxidation with NaIO4. The RNA pellet was resuspended in 90 μL of buffer D, and the RNA concentration was adjusted to match the lowest concentration in the samples being compared. 0.5 μL of biotinylated DNA probe (100 μM) was added to the RNA, and the DNA probe was hybridized at 65°C for 5 minutes. 40 μL of Streptavidin Dynabeads MyOne C1 (Invitrogen) was washed twice with buffer DT and added to 10 μL of buffer D. The beads were added to the hybridization reaction, and the probe was bound to the beads at 4°C for a minimum of 30 minutes while inverting and mixing. The samples were washed three times with 200 μL of acW1-T, twice with 200 μL of acW1, three times with 200 μL of acW2, and once with 200 μL of water, all on a magnetic stand. 24 μL of DB and beads were added and incubated at 42°C for 1 hour. 12 μL of the deacylation mix was added to 3 μL of 6-aminoquinolyl-N-hydroxysuccinimidylcarbamate (3 mg / mL in AQC-acetonitrile), and the reaction was incubated at 55°C for 15 minutes. The samples were analyzed on an Agilent Technologies 6130 Quadrupole LC / MS using single-ion monitoring. 【0265】 GFP (150X) His6 and GFP(3X) His6 (In the formula, X represents any ncM) Activity assay GFP150TAG His6 or GFP3TAG His6 Chemically competent DH10β cells carrying a p15A plasmid encoding (two versions of the p15A plasmid containing tetracycline or apramycin-resistant cassettes, which yield similar results, were used interchangeably) were rescued in MmPylRS or its variants, and MmtRNA rescued in SOC and grown overnight in 2xYTs-t or 2xYTs-ap. Pyl CUA Cells were transformed with the pMB1 plasmid encoding .20 μL of overnight culture was diluted in 480 μL of 2xYTs-t or 2xYTs-ap containing 0.2% L-arabinose in the presence and absence of 2–4 mM of each ncM in a 96-well plate. Cells were grown at 700 r.pm for 16–20 hours at 37°C. The plates were centrifuged at 4200 rcf for 12 minutes at 4°C, and the cells were resuspended in 150 μL of PBS. 100 μL of the resuspended cells were transferred to a Costar 96-well flat-bottom plate and OD 600 GFP fluorescence was measured using a PHERAstar FS plate reader. 【0266】 GFP (150X) for MS analysis His6 Isolation The three repeats of the protein produced as described above were mixed in a 1.5 mL Eppendorf tube, centrifuged at 4200 rcf for 3 minutes, frozen at -20°C, thawed, and resuspended in 150 μL of BugBuster (Millipore). The cells were lysed for 1 hour with inversion mixing. The lysed cells were centrifuged at 20000 rcf at 4°C for 20 minutes, and the lysate was added to 20 μL of NiNTA beads. GFP(150) His6 The protein was allowed to bind to the beads at room temperature for 20 minutes while being mixed by inversion. The beads were washed six times with 60 μL of 30 mM imidazole in PBS, and the protein was eluted five times with 30 μL of 300 mM imidazole in PBS. 【0267】 For the low-activity mutant of ncM12, 5–15 mL of cell culture was used for protein production. The volume of Bug Buster was adjusted proportionally, while all other volumes were kept constant. 【0268】 mass spectrometry ESI-MS as well as MS / MS were acquired as previously described (Dunkelmann, DL, Oehm, SB, Beattie, AT & Chin, JW A 68-codon genetic code to incorporate four distinct non-canonical amino acids enabled by automated orthogonal mRNA design. Nat Chem, doi:10.1038 / s41557-021-00764-5 (2021), Dunkelmann, DL, Willis, JCW, Beattie, AT & Chin, JW Engineered triply orthogonal pyrrolysyl-tRNA synthetase / tRNA pairs enable the genetic encoding of three distinct non-canonical amino acids. Nat Chem 12, 535-544, doi:10.1038 / s41557-020-0472-x (2020)). 【0269】 Protein expression, purification, and crystallization GFP150TAG His6 The p15A plasmid encoding MmPylRS(12_1) and MmtRNA Pyl Chemically competent DH10β cells carrying the pMB1 plasmid encoding the pMB1 plasmid were transformed, rescued in SOC, and grown overnight in 2xYTs-ap. 10 mL of the overnight culture was diluted in 1 L of 2xYTs-ap containing 0.2% L-arabinose in the presence of 5 mM 12. 【0270】 GFP150(S)β3 A bacterial pellet of mBrF-His6 expression culture (1 L) was lysed by sonication, centrifuged at 142,000 rcf for 30 minutes, and the supernatant was conjugated to Ni-NTA beads (Qiagen). After washing the beads three times, the protein was eluted and further purified by gel filtration using a Superdex 75 HiLoad 26 / 60 pg column (GE Healthcare) in 25 mM Tris pH 7.4, 200 mM NaCl, and 0.06% NaN3. The purified protein was concentrated to 6 mg / mL using Vivaspin 20, 10,000 MWCO (Sartorius). The sample was trypsin-digested with Sequencing Grade Modified Trypsin (Promega) in a 50:1 ratio. The sample was incubated at 37°C for 1 hour, centrifuged at 21,000 rcf for 10 minutes, and then seeded into a crystal tray. Crystallization tests using multiple commercially available crystallization kits were performed at 18°C ​​in a 96-well sitting drop vapor diffusion plate (Molecular Dimensions) and set up using a Mosquito HTS robot (TTP Labtech). The drop ratio of 0.2 μL protein solution + 0.2 μL reservoir solution was used for screening. The only useful dataset was collected from crystals taken from a Fusion screen (Molecular Dimensions) with the following composition: 37.5% PEG3350 / PEG 1K / MPD (1:1:1), 0.1 M bicine / trisma pH 8.5, 0.8% (w / v) Morpheus III alkaloids, and 0.12 M Morpheus alcohol. Crystals were collected and briefly frozen in liquid nitrogen. 【0271】 Diffraction data collection, processing, and structural analysis. Diffraction data was collected using ESRF on beamline ID23-2 at an energy of 14.2 keV. The data was processed using XDS via pipeline autoProc (Global Phasing ltd.). The structure was elucidated by molecular substitution with MolRep using the homolog model PDB 2B3P. Interaction construction was performed using Coot, refinement using REFMAC5, and verification using Molprobity. Structural drawings were prepared using PyMOL (PyMOL Molecular Graphics System, Schrodinger, LLC). 【0272】 ncAA selection Selection was performed as shown in Figure 17. RNA was isolated and oxidized as described in General Procedure A. Bio-mREX was performed as specified in General Procedure. After the first selection, a new library was assembled from the amplified cDNA described above. After the second selection, an NGS sample was prepared from the isolated cDNA described above, and NGS was performed using a P2 600-cycle cartridge, and the data was analyzed as specified above. 【0273】 ncM selection Selection was performed as shown in Figure 18. RNA was isolated and oxidized as described in General Procedure A. Bio-mREX was performed as specified in General Procedure. NGS samples were prepared from the isolated cDNA described above, and NGS was performed using a P1 600-cycle cartridge, with data analyzed as specified above. 【0274】 Selection of substrate 12 using a random mutagenesis library The concentrations of the pMB1 plasmid encoding PylRS hits 12_1 and 12_2 were measured using a Qubit 2 fluorometer (Life Technologies) and a Qubit 1x dsDNA HS assay kit (Invitrogen), and the plasmids were mixed in equimolar amounts. The combined plasmids were used for mutagenic PCR of the PylRS active site using Golden Gate primers and the GeneMorph II kit (Agilent) under conditions that yield the maximum number of random mutations. The amplicon was cloned into a new pColE1 backbone by a two-piece Golden Gate assembly according to NEB (New England Biolabs) guidelines. Selection was performed as schematic in Figure 20. RNA was isolated and oxidized as described in General Procedure A. Bio-mREX was performed as specified in General Procedure. NGS samples were prepared from the isolated cDNA described above, NGS was performed using a P2 600 cycle cartridge, and the data were analyzed as specified above. 【0275】 Code availability The code for analyzing tRNA display NGS data will be available at https: / / github.com / JWChin-Lab / tRNA_display upon release. 【0276】 References 1 Dumas, A., Lercher, L., Spicer, CD & Davis, BG Designing logical codon reassignment - Expanding the chemistry in biology. Chem Sci 6, 50-69, doi:10.1039 / c4sc01534g (2015) 2 Young, DD & Schultz, PG Playing with the molecules of life. ACS chemical biology 13, 854-870 (2018) 3 Chin, J. W. Expanding and reprogramming the genetic code. Nature 550, 53-60, doi:10.1038 / nature24031 (2017) 4 De La Torre, D. & Chin, J. W. Reprogramming the genetic code. Nature Reviews Genetics 22, 169-184, doi:10.1038 / s41576-020-00307-7 (2021) 5 Robertson, W. E. et al. Sense codon reassignment enables viral resistance and encoded polymer synthesis. Science 372, 1057-1062 (2021) 6 Spinck, M. et al. Genetically programmed cell-based synthesis of non-natural peptide and depsipeptide macrocycles. Nature Chemistry 15, 61-69 (2023) 7 Ellman, J. A., Mendel, D. & Schultz, P. G. Site-specific incorporation of novel backbone structures into proteins. Science 255, 197-200 (1992) 8 Mendel, D., Cornish, V. W. & Schultz, P. G. Site-directed mutagenesis with an expanded genetic code. Annual review of biophysics and biomolecular structure 24, 435-462 (1995) 9 Hecht, S. M. Expansion of the genetic code through the use of modified bacterial ribosomes. Journal of molecular biology 434, 167211 (2022) 10 Katoh, T. & Suga, H. In vitro genetic code reprogramming for the expansion of usable noncanonical amino acids. Annual Review of Biochemistry 91, 221-243 (2022) 11 Melo Czekster, C., Robertson, W. E., Walker, A. S., Soll, D. & Schepartz, A. In Vivo Biosynthesis of a beta-Amino Acid-Containing Protein. J Am Chem Soc 138, 5194-5197, doi:10.1021 / jacs.6b01023 (2016) 12 Santoro, S. W., Wang, L., Herberich, B., King, D. S. & Schultz, P. G. An efficient system for the evolution of aminoacyl-tRNA synthetase specificity. Nature biotechnology 20, 1044-1048 (2002) 13 Chin, J. W., Martin, A. B., King, D. S., Wang, L. & Schultz, P. G. Addition of a photocrosslinking amino acid to the genetic code of Escherichia coli. Proceedings of the National Academy of Sciences 99, 11020-11024 (2002) 14 Tan, Z., Forster, A. C., Blacklow, S. C. & Cornish, V. W. Amino Acid Backbone Specificity of the Escherichia coli Translation Machinery. Journal of the American Chemical Society 126, 12752-12753 (2004) 15 Pavlov, M. Y. et al. Slow peptide bond formation by proline and other N-alkylamino acids in translation. Proceedings of the National Academy of Sciences 106, 50-54 (2009) 16 Katoh, T., Tajima, K. & Suga, H. Consecutive Elongation of D-Amino Acids in Translation. Cell Chem Biol 24, 46-54, doi:10.1016 / j.chembiol.2016.11.012 (2017) 17 Katoh, T. & Suga, H. Ribosomal Incorporation of Consecutive beta-Amino Acids. J Am Chem Soc 140, 12159-12167, doi:10.1021 / jacs.8b07247 (2018) 18 Dedkova, L. M. et al. beta-Puromycin selection of modified ribosomes for in vitro incorporation of beta-amino acids. Biochemistry 51, 401-415, doi:10.1021 / bi2016124 (2012) 19 Cervettini, D. et al. Rapid discovery and evolution of orthogonal aminoacyl-tRNA synthetase-tRNA pairs. Nat Biotechnol, doi:10.1038 / s41587-020-0479-2 (2020) 20 Barton, P., Laws, A. P. & Page, M. I. Structure-activity relationships in the esterase-catalysed hydrolysis and transesterification of esters and lactones. Journal of the Chemical Society, Perkin Transactions 2, 2021-2029 (1994) 21 Kobayashi, T., Yanagisawa, T., Sakamoto, K. & Yokoyama, S. Recognition of non-alpha-amino substrates by pyrrolysyl-tRNA synthetase. J Mol Biol 385, 1352-1360, doi:10.1016 / j.jmb.2008.11.059 (2009) 22 Soma, A. et al. Permuted tRNA genes expressed via a circular RNA intermediate in Cyanidioschyzon merolae. Science 318, 450-453 (2007) 23 El Yacoubi, B., Bailly, M. & de Crecy-Lagard, V. Biosynthesis and function of posttranscriptional modifications of transfer RNAs. Annual review of genetics 46, 69-95 (2012) 24 Dunkelmann, D. L., Oehm, S. B., Beattie, A. T. & Chin, J. W. A 68-codon genetic code to incorporate four distinct non-canonical amino acids enabled by automated orthogonal mRNA design. Nat Chem, doi:10.1038 / s41557-021-00764-5 (2021) 25 Salis, H. M., Mirsky, E. A. & Voigt, C. A. Automated design of synthetic ribosome binding sites to control protein expression. Nature biotechnology 27, 946-950 (2009) 26 Yanagisawa, T. et al. Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered Pyrrolysyl-tRNA Synthetase. Cell Chem Biol 26, 936-949 e913, doi:10.1016 / j.chembiol.2019.03.008 (2019) 27 Dunkelmann, D. L., Willis, J. C. W., Beattie, A. T. & Chin, J. W. Engineered triply orthogonal pyrrolysyl-tRNA synthetase / tRNA pairs enable the genetic encoding of three distinct non-canonical amino acids. Nat Chem 12, 535-544, doi:10.1038 / s41557-020-0472-x (2020) 28 Wang, K., Neumann, H., Peak-Chew, S. Y. & Chin, J. W. Evolved orthogonal ribosomes enhance the efficiency of synthetic genetic code expansion. Nat Biotechnol 25, 770-777, doi:10.1038 / nbt1314 (2007) 29 Fredens, J. et al. Total synthesis of Escherichia coli with a recoded genome. Nature 569, 514-518, doi:10.1038 / s41586-019-1192-5 (2019) 30 Arranz-Gibert, P., Vanderschuren, K. & Isaacs, F. J. Next-generation genetic code expansion. Current Opinion in Chemical Biology 46, 203-211 (2018) 31 Schmied, W. H. et al. Controlling orthogonal ribosome subunit interactions enables evolution of new function. Nature 564, 444-448, doi:10.1038 / s41586-018-0773-z (2018) 32 Beattie, A. T., Dunkelmann, D. L., Chin, J. W. Quintuply orthogonal pyrrolysyl-tRNA synthetase / tRNAPyl pairs. Nature Chemistry In press (accepted) (2023) 33 Rackham, O. & Chin, J. W. A network of orthogonal ribosome x mRNA pairs. Nat Chem Biol 1, 159-166, doi:10.1038 / nchembio719 (2005) 34 Neumann, H., Wang, K., Davis, L., Garcia-Alai, M. & Chin, J. W. Encoding multiple unnatural amino acids via evolution of a quadruplet-decoding ribosome. Nature 464, 441-444, doi:10.1038 / nature08817 (2010) 35 Morinaka, B. I. et al. Natural noncanonical protein splicing yields products with diverse β-amino acid residues. Science 359, 779-782 (2018) 36 Lakis, E., Magyari, S. & Piel, J. In Vivo Production of Diverse β‐Amino Acid‐Containing Proteins. Angewandte Chemie 134, e202202695 (2022) 37 Camarero, J. A. & Muir, T. W. Native chemical ligation of polypeptides. Current Protocols in Protein Science 15, 18.14. 11-18.14. 21 (1999) 38 Niquille, D. L. et al. Nonribosomal biosynthesis of backbone-modified peptides. Nature chemistry 10, 282-287 (2018) 39 Arnison, P. G. et al. Ribosomally synthesized and post-translationally modified peptide natural products: overview and recommendations for a universal nomenclature. Natural product reports 30, 108-160 (2013) 40 Seebach, D. et al. β‐Peptides: Synthesis by Arndt‐Eistert homologation with concomitant peptide coupling. Structure determination by NMR and CD spectroscopy and by X‐ray crystallography. Helical secondary structure of a β‐hexapeptide in solution and its stability towards pepsin. Helvetica Chimica Acta 79, 913-941 (1996) 41 Hintermann, T. & Seebach, D. The Biological Stability of?-Peptides: No Interactions between?-and?-Peptidic Structures? Chimia 51, 244-244 (1997) 42 Seebach, D. et al. Biological and pharmacokinetic studies with β-peptides. Chimia 52, 734-734 (1998) 43 Gellman, S. H. Foldamers: a manifesto. Accounts of chemical research 31, 173-180 (1998) 44 Horne, W. S., Price, J. L. & Gellman, S. H. Interplay among side chain sequence, backbone composition, and residue rigidification in polypeptide folding and assembly. Proceedings of the National Academy of Sciences 105, 9151-9156 (2008) 45 Wang, P. S. & Schepartz, A. β-Peptide bundles: Design. Build. Analyze. Biosynthesize. Chemical Communications 52, 7420-7432 (2016)

Claims

[Claim 1] A method for determining the effect of a target polypeptide or target nucleic acid on tRNA acylation or the acylation state of tRNA, i) The step of incubating the target polypeptide or target nucleic acid, the tRNA, and a substrate capable of acyling the tRNA under conditions that promote acyling of the tRNA, wherein the tRNA is divided into at least two parts, and one of the parts of the tRNA is part of a fusion RNA molecule that also includes a sequence encoding the target polypeptide or target nucleic acid; ii) Exposing the tRNA to conditions that can label the acylated tRNA; and iii) A step of identifying whether the target polypeptide or target nucleic acid is bound to the labeled tRNA. The method, including the method described above. [Claim 2] The method according to claim 1, wherein the tRNA does not contain an anticodon. [Claim 3] The method according to claim 1 or 2, wherein the tRNA is split at the position of the anticodon in the parent tRNA from which the portion of the tRNA originates. [Claim 4] tRNA is tRNA Ｐｙｌ tRNA Ｌｅｕ tRNA Ａｌａ , or tRNA Ｓｅｒ The method according to any one of claims 1 to 3. [Claim 5] The tRNA is divided into a first tRNA strand and a second tRNA strand. The first tRNA strand includes a portion of the tRNA derived from the 5' side of the anticodon position in the parent tRNA from which the tRNA portion originates. The method according to any one of claims 1 to 4, wherein the second tRNA strand includes a portion of the tRNA derived from the 3' side of the anticodon position in the parent tRNA from which the tRNA portion originates. [Claim 6] a) The first tRNA strand contains the sequence encoded by SEQ ID NO: 2, and the second tRNA strand contains the sequence encoded by SEQ ID NO: 1; b) The first tRNA strand includes the sequence encoded by SEQ ID NO: 24, and the second tRNA strand includes the sequence encoded by SEQ ID NO: 23; c) The first tRNA strand includes the sequence encoded by SEQ ID NO: 26, and the second tRNA strand includes the sequence encoded by SEQ ID NO: 25; d) The first tRNA strand includes the sequence encoded by SEQ ID NO: 28, and the second tRNA strand includes the sequence encoded by SEQ ID NO: 27; or e) The first tRNA strand contains the sequence encoded by SEQ ID NO: 47, and the second tRNA strand contains the sequence encoded by SEQ ID NO: 46, The method according to claim 5. [Claim 7] The method according to claim 1, wherein the tRNA is split in a D-loop, in an anticodon loop and at the 5' end of the anticodon, in a variable loop, or in a T-loop. [Claim 8] The method according to claim 1 or 7, wherein the tRNA is divided among residues D15 and D16, D15 and D17, D15 and D18, D16 and D17, D16 and D18, D17 and D18, A31 and A32, A31 and A33, A32 and A33, V45 and V46, V45 and V47, V45 and V48, V46 and V47, V46 40 and V48, V47 and V48, T56 and T57, T56 and T58, or T57 and T58. [Claim 9] The method according to claim 8, wherein the tRNA is split between residues D15 and D17, D15 and D18, D16 and D17, A31 and A33, A32 and A33, V45 and V48, V46 and V48, V47 and V48, T56 and T57, or T56 and T58. [Claim 10] tRNA is tRNA Ｔｒｐ or tRNA Ｐｒｏ The method according to any one of claims 7 to 9. [Claim 11] The tRNA is divided into a first tRNA strand and a second tRNA strand. The first tRNA strand includes the portion of tRNA derived from the 5' side of the split in the parent tRNA from which the tRNA portion originates, The method according to any one of claims 1 and 7 to 10, wherein the second tRNA strand includes a portion of the tRNA derived from the 3' side of the split position in the parent tRNA from which the tRNA portion originates. [Claim 12] The method according to claim 11, wherein the first tRNA strand and the second tRNA strand each include sequences encoded by SEQ ID NOs. 49 and 48, SEQ ID NOs. 51 and 50, SEQ ID NOs. 53 and 52, SEQ ID NOs. 55 and 54, SEQ ID NOs. 57 and 56, SEQ ID NOs. 59 and 58, SEQ ID NOs. 61 and 60, or SEQ ID NOs. 63 and 62. [Claim 13] The method according to claim 5 or 6, wherein the 3' end of a first tRNA strand is attached to a first stem region, the first stem region comprising 8-14, 8-12, or 10-12 nucleotides, and the 5' end of a second tRNA strand is attached to a second stem region, the second stem region comprising 8-14, 8-12, or 10-12 nucleotides and complementary to the first stem region. [Claim 14] The method according to claim 13, wherein the first stem region and the second stem region each consist of a region having a length of 10 nucleotides. [Claim 15] a) The first stem region is coded by the sequence of sequence number 3, and the second stem region is coded by sequence number 4; or b) The first stem region is coded by the sequence of sequence number 5, and the second stem region is coded by sequence number 6; c) The first stem region is coded by the sequence of sequence number 7, and the second stem region is coded by sequence number 8; or d) The first stem region is coded by the sequence of sequence number 64, and the second stem region is coded by sequence number 65. The method according to claim 13. [Claim 16] The tRNA is divided into a first tRNA strand and a second tRNA strand. The first tRNA strand includes a portion of the tRNA originating from the 5' side of the split. The method according to any one of claims 1 to 15, wherein the second tRNA strand includes a portion of the tRNA derived from the 3' side of the split. [Claim 17] The method according to claim 16, wherein the 3' end of a first tRNA strand is connected to a first stem region, and the 5' end of a second tRNA strand is connected to a second stem region. [Claim 18] The method according to any one of claims 5, 6, 11, 12 and 13-17, wherein the second tRNA chain is part of a fusion RNA molecule that also includes a sequence encoding the target polypeptide or the target nucleic acid. [Claim 19] The method according to claim 18, wherein the connection between the second tRNA chain and the sequence encoding the target polypeptide or target nucleic acid is via a second stem region. [Claim 20] The tRNA is split into a first tRNA strand and a second tRNA strand, and the fusion RNA molecule moves from 5' to 3'. A sequence encoding the target polypeptide or target nucleic acid, a sequence encoding the second tRNA strand, and a sequence encoding the first tRNA strand. The method according to any one of claims 1 to 19, expressed by a nucleic acid construct containing [Claim 21] The tRNA is divided into a first tRNA strand and a second tRNA strand, the first tRNA strand includes a first stem region, the second tRNA strand includes a second stem region, and the first stem region and the second stem region are complementary. The method according to claim 20, wherein the nucleic acid construct comprises, from 5' to 3', a sequence encoding the target polypeptide or target nucleic acid, optionally a linker, a sequence encoding the second stem region, a sequence encoding the second tRNA strand, a loop, a sequence encoding the first tRNA strand, and a sequence comprising the first stem region. [Claim 22] The method according to claim 21, wherein the loop is cleaved, removed, or spliced ​​during RNA processing. [Claim 23] The expression of nucleic acid constructs A fusion RNA molecule comprising, from 5' to 3', a sequence encoding the target polypeptide or target nucleic acid, optionally a linker, a second stem region, and a second tRNA chain; and From 5' to 3', a separate RNA molecule containing the first tRNA chain and the first stem region. The method according to claim 21 or 22, which brings about the following. [Claim 24] The conditions under which acylated tRNA can be labeled are as follows: a) Exposure to conditions that block the 3' end of free tRNA but not the 3' end of acylated tRNA. b) Exposure to conditions suitable for removing the substrate acylating tRNA; and c) Exposure to conditions that cause a label to bind to the 3' end of unblocked tRNA. The method according to any one of claims 1 to 23, wherein the condition includes the following: [Claim 25] The method according to claim 24, wherein step c) includes a condition that results in the addition of a nucleotide to the 3' end of an unblocked tRNA, and at least one nucleotide is labeled. [Claim 26] The method according to any one of claims 1 to 25, further comprising the step of capturing a fusion RNA molecule if it is bound to a labeled tRNA. [Claim 27] The method according to any one of claims 1 to 26, comprising the step of sequencing a barcode conjugated to either a labeled or captured fusion RNA molecule. [Claim 28] The method according to any one of claims 1 to 27, comprising the step of obtaining sequence information relating to at least one sequence fused to either a labeled or captured portion of tRNA. [Claim 29] The method according to any one of claims 1 to 28, comprising the step of obtaining sequence information relating to a target polypeptide or a sequence encoding a target nucleic acid. [Claim 30] The method according to any one of claims 1 to 29, wherein the target polypeptide is acyl-tRNA synthetase. [Claim 31] The method according to any one of claims 1 to 29, wherein step i) comprises incubating the tRNA and substrate under conditions that promote tRNA acylation, and incubating the acylated tRNA with the polypeptide of the choice or the nucleic acid of the choice. [Claim 32] The method according to claim 31, further comprising, prior to step ii), exposure to conditions suitable for conditionally deacylation of the acylated tRNA. [Claim 33] The method according to any one of claims 1 to 29, 31, and 32, comprising the step of determining whether the target polypeptide or target nucleic acid can chemically alter a substrate, or whether the target polypeptide or target nucleic acid can chemically alter the substrate. [Claim 34] A split tRNA comprising a first strand and a second strand, The first strand includes a portion of the first tRNA and includes a first stem region, The second strand includes a portion of the second tRNA and includes a second stem region. The aforementioned split tRNA. [Claim 35] A split tRNA comprising a first strand and a second strand, The first strand comprises a portion of the first tRNA and a first stem region, and the second strand comprises a portion of the second tRNA and a second stem region; The first portion of the tRNA corresponds to the 5' portion of the parent tRNA separated by the anticodon, and the second portion of the tRNA corresponds to the 3' portion of the parent tRNA separated by the anticodon; The first stem region is located at the 3' end of the first tRNA portion, and the second stem region is located at the 5' end of the second tRNA portion; The split tRNA wherein the first stem region and the second stem region are complementary. [Claim 36] a) The first tRNA portion contains the sequence encoded by SEQ ID NO: 2, and the second tRNA portion contains the sequence encoded by SEQ ID NO: 1; b) The first tRNA portion includes the sequence encoded by SEQ ID NO: 24, and the second tRNA portion includes the sequence encoded by SEQ ID NO: 23; c) The first tRNA portion includes the sequence encoded by SEQ ID NO: 26, and the second tRNA portion includes the sequence encoded by SEQ ID NO: 25; d) The first tRNA portion includes the sequence encoded by SEQ ID NO: 28, and the second tRNA portion includes the sequence encoded by SEQ ID NO: 27; or e) The first tRNA portion includes the sequence encoded by SEQ ID NO: 47, and the second tRNA portion includes the sequence encoded by SEQ ID NO: 46, The method according to claim 35. [Claim 37] The split tRNA according to any one of claims 34 to 36, wherein the first and second stem regions are 8 to 14, 8 to 12, or 10 to 12 nucleotides long. [Claim 38] a) The first stem region is coded by the sequence of sequence number 3, and the second stem region is coded by sequence number 4; or b) The first stem region is coded by the sequence of sequence number 5, and the second stem region is coded by sequence number 6; c) The first stem region is coded by the sequence of sequence number 7, and the second stem region is coded by sequence number 8; or d) The first stem region is coded by the sequence of sequence number 64, and the second stem region is coded by sequence number 65. The split tRNA according to any one of claims 34 to 37. [Claim 39] The portions of the first and second tRNAs are tRNA Ｐｙｌ , tRNA Ｌｅｕ , tRNA Ａｌａ , or tRNA Ｓｅｒ -derived, the split tRNA according to any one of claims 34 to 38. [Claim 40] The first tRNA portion corresponds to the 5' portion of the parent tRNA split at the split site, and the second tRNA portion corresponds to the 3' portion of the parent tRNA split at the split site; The split portion is located in a D-loop, in an anticodon loop, and on the 5' side of the anticodon, in a variable loop, or in a T-loop. The split tRNA according to claim 34. [Claim 41] The split tRNA according to claim 40, wherein the split site is located between residues D15 and D16, D15 and D17, D15 and D18, D16 and D17, D16 and D18, D17 and D18, A31 and A32, A31 and A33, A32 and A33, V45 and V46, V45 and V47, V45 and V48, V46 and V47, V46 40 and V48, V47 and V48, T56 and T57, T56 and T58, or T57 and T58. [Claim 42] The split tRNA according to claim 41, wherein the split site is located between residues D15 and D17, D15 and D18, D16 and D17, A31 and A33, A32 and A33, V45 and V48, V46 and V48, V47 and V48, T56 and T57, or T56 and T58. [Claim 43] The first and second tRNA portions are tRNA Ｔｒｐ or tRNA Ｐｒｏ The split tRNA according to any one of claims 40 to 42, which is derived from the split tRNA. [Claim 44] The split tRNA according to any one of claims 34 to 43, wherein the second strand is located 5' relative to the second stem region and the second tRNA portion and includes a sequence encoding the target polypeptide or the target nucleic acid. [Claim 45] An RNA molecule containing a sequence encoding the target polypeptide or target nucleic acid, and also containing a portion of tRNA. [Claim 46] The tRNA portion is In the anticodon; In a D-loop, in an anticodon loop, and on the 5' side of the anticodon, in a variable loop, or in a T-loop; Among residues D15 and D16, D15 and D17, D15 and D18, D16 and D17, D16 and D18, D17 and D18, A31 and A32, A31 and A33, A32 and A33, V45 and V46, V45 and V47, V45 and V48, V46 and V47, V46 40 and V48, V47 and V48, T56 and T57, T56 and T58, or T57 and T58; or Among residues D15 and D17, D15 and D18, D16 and D17, A31 and A33, A32 and A33, V45 and V48, V46 and V48, V47 and V48, T56 and T57, or T56 and T58; The RNA molecule according to claim 45, corresponding to the 3' portion of the split parent tRNA split. [Claim 47] The tRNA part is tRNA Ｐｙｌ tRNA Ｌｅｕ tRNA Ａｌａ tRNA Ｓｅｒ tRNA Ｔｒｐ , or tRNA Ｐｒｏ The RNA molecule derived from claim 45 or 46. [Claim 48] The RNA molecule according to any one of claims 45 to 47, wherein the tRNA portion includes a sequence encoded by any one of sequence numbers 1, 23, 25, 27, 46, 48, 50, 52, 54, 56, 58, 60, or 62. [Claim 49] The RNA molecule according to any one of claims 45 to 48, wherein the RNA molecule includes a stem region located at the 5' end of a portion of the tRNA, and a sequence encoding the target polypeptide or target nucleic acid is located 5' relative to the stem region. [Claim 50] The stem region is The length is 8 to 14, 8 to 12, or 10 to 12 nucleotides; or The RNA molecule according to claim 49, having a length of 8-25, 10-23, 12-22, 13-21, 14-20, 15-19, or 16-18 nucleotides. [Claim 51] The RNA molecule according to claim 49 or 50, wherein the stem region is encoded by SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 64, or SEQ ID NO:

66. [Claim 52] A method for determining the acylation state of tRNA or the efficiency of tRNA acylation, i) Incubating the tRNA and a substrate capable of acyling the tRNA under conditions that promote the acyling of the tRNA; ii) Exposing the tRNA to conditions that can block the 3' end of the free tRNA; and iii) A step of exposing the tRNA to a condition that results in the addition of a nucleotide to the 3' end of an unblocked tRNA, wherein at least one nucleotide contains a label. The method, including the method described above. [Claim 53] The method of claim 52, further comprising the step of exposing the tRNA to conditions that allow the substrate to which the tRNA has been acylated to be removed, prior to step iii). [Claim 54] The method according to claim 52 or 53, wherein the mark is an optically detectable portion or a physically detectable portion, or can be connected thereto. [Claim 55] The method according to claim 54, wherein the optically detectable portion is the fluorescent portion. [Claim 56] The method according to claim 54, wherein the physically detectable portion is a magnetic portion or a ligand or receptor of a ligand-receptor pair. [Claim 57] The method according to any one of claims 52 to 56, further comprising the step of capturing the tRNA if it is labeled. [Claim 58] The method according to any one of claims 52 to 57, wherein the tRNA is a split tRNA as described in any one of claims 34 to 44, or comprises an RNA molecule as described in any one of claims 45 to 51. [Claim 59] The method according to any one of claims 52 to 58, wherein the tRNA is executed in a cell and does not contain an anticodon. [Claim 60] A tRNA molecule containing an additional nucleotide at its 3' end, with at least one nucleotide containing a label. [Claim 61] The tRNA according to claim 60, wherein the label is an optically detectable portion or a physically detectable portion, or can be ligated thereto. [Claim 62] The tRNA according to claim 61, wherein the optically detectable portion is the fluorescent portion. [Claim 63] The tRNA according to claim 61, wherein the physically detectable portion is a magnetic portion or a ligand or receptor of a ligand-receptor pair. [Claim 64] A split tRNA according to any one of claims 34 to 44, or a tRNA according to any one of claims 60 to 63 comprising an RNA molecule according to any one of claims 45 to 51. [Claim 65] A nucleic acid encoding a split tRNA according to any one of claims 34 to 44 or an RNA molecule according to any one of claims 45 to 51. [Claim 66] From 5' to 3', The sequence that codes for the second stem region, The sequence that codes for the second tRNA portion, Array that codes for loops, The sequence encoding the first portion of tRNA, and Array encoding the first stem region nucleic acids containing, The nucleic acid wherein the sequence encoding the first stem region and the sequence encoding the second stem region optionally encode complementary stem region sequences. [Claim 67] From 5' to 3', A sequence encoding the target polypeptide or target nucleic acid, An array that arbitrarily codes for the linker, The sequence that codes for the second stem region, The sequence that codes for the second tRNA portion, Array that codes for loops, The sequence encoding the first portion of tRNA, and Array encoding the first stem region The nucleic acid according to claim 66, comprising: [Claim 68] The sequence encoding the second tRNA portion encodes the second tRNA portion corresponding to the 3' portion of the parent tRNA separated by the anticodon, and the sequence encoding the first tRNA portion encodes the first tRNA portion corresponding to the 5' portion of the parent tRNA separated by the anticodon; or The sequence encoding the second tRNA portion encodes the portion of the second tRNA corresponding to the 3' portion of the parent tRNA separated at the split site, and the sequence encoding the first tRNA portion encodes the portion of the first tRNA corresponding to the 5' portion of the parent tRNA separated at the split site. The aforementioned split portion is Located in a D-loop, in an anticodon loop, and on the 5' side of the anticodon, in a variable loop, or in a T-loop; Between residues D15 and D16, D15 and D17, D15 and D18, D16 and D17, D16 and D18, D17 and D18, A31 and A32, A31 and A33, A32 and A33, V45 and V46, V45 and V47, V45 and V48, V46 and V47, V46 40 and V48, V47 and V48, T56 and T57, T56 and T58, or T57 and T58; or Between residues D15 and D17, D15 and D18, D16 and D17, A31 and A33, A32 and A33, V45 and V48, V46 and V48, V47 and V48, T56 and T57, or T56 and T58, The nucleic acid according to claim 66 or 67. [Claim 69] The nucleic acid according to any one of claims 66 to 68, wherein the sequence encoding the loop includes a sequence that is removed, spliced, or cleaved during RNA processing. [Claim 70] The nucleic acid according to any one of claims 66 to 69, wherein the sequence encoding the loop includes or matches any one of sequence numbers 15 to 22 or TCGTCCT. [Claim 71] The nucleic acid according to any one of claims 66 to 70, wherein the sequence encoding the loop includes or matches sequence number 17 or sequence number 19. [Claim 72] A method for producing polypeptides or nucleic acids, i) Providing a library comprising a plurality of sequences encoding a target polypeptide or a target nucleic acid, wherein each sequence in the library is ligated to a portion of tRNA; ii) The step of incubating each of the target polypeptides or target nucleic acids together with a tRNA containing a portion of tRNA linked to a sequence encoding each of the target polypeptides or target nucleic acids under conditions that promote acylation, wherein the incubation comprises a substrate capable of acylation of the tRNA; iii) Exposing the tRNA to conditions that allow the acylated tRNA to be labeled; iv) A step of identifying whether each target polypeptide or target nucleic acid is bound to the labeled tRNA; and v) Step of producing a polypeptide that matches the sequence of the identified target polypeptide or target nucleic acid. The method, including the method described above. [Claim 73] A method for producing polypeptides, i) providing a sequence of the target polypeptide identified by any one of the screening methods described in claims 1 to 33 and claims 52 to 59, and ii) A step of producing a polypeptide that matches the sequence. The method, including the method described above. [Claim 74] The method according to claim 72 or 73, wherein the polypeptide is acyl-tRNA synthetase.

Images