Method for inducing lipid nanoparticles in vivo

Abstract

Compositions and methods for enhancing payload-based gene therapy by increasing the proportion of the payload delivered to a target non-liver target by blocking the binding of LDL to the LDL receptor (LDLR) in the liver, and then administering a payload-based therapy targeting non-liver tissue. The present invention aims to improve gene therapy by partially blocking or reducing off-target effects of the delivery vehicle to the liver. The compositions and methods can be used as a platform to enhance the tropism of gene therapy, thereby improving the efficacy and safety of gene therapy.

Description

Technical Field

[0001] This application claims priority to U.S. Provisional Application No. 63 / 469,156, filed May 26, 2023, which is hereby incorporated by reference in its entirety.

[0002] This application contains a Sequence Listing that was electronically submitted in XML format, which is hereby incorporated by reference in its entirety. The XML copy created on May 22, 2024, is named "01245-0041-00PCT.xml" and is 15,986,166 bytes in size. The Sequence Listing contained in this XML file is part of this specification and is hereby incorporated by reference in its entirety.

Background Art

[0003] Introduction and Summary Genetic modification as a therapeutic has become more common as pharmaceutically acceptable compositions (e.g., small interfering RNAs (siRNAs), messenger RNAs (mRNAs), antisense oligonucleotides (ASOs), and CRISPR-Cas systems) and is being implemented efficiently in human subjects. However, such molecules and systems typically require the use of delivery systems to protect the therapeutic from in vivo degradation. A current problem with current delivery systems is their inherent tropism for undesired in vivo targets (e.g., the liver).

[0004] Adeno-associated virus (AAV) vectors are promising candidates for in vivo gene therapy due to their broad tissue tropism, non-pathogenicity, and low immunogenicity. Currently, 12 AAV serotypes and over 100 variants have been identified in human and non-human primate populations. Gene therapy vectors using AAV in vivo can infect both dividing and quiescent cells and persist extrachromosomally without being integrated into the host cell genome. These characteristics make AAV an attractive candidate for use as a delivery system. However, AAV vectors are limited by several factors (e.g., small package size). Furthermore, current limitations on using AAV for gene transfer include potential safety concerns (e.g., potential off-target toxicity). After administration, in addition to local and targeted delivery, most serotypes of AAV can also achieve off-target gene transfer, which can lead to the introduction and expression of the target gene into undesirable cells or tissues (e.g., the liver). Once AAV vectors reach the bloodstream, the circulatory system delivers them throughout the body (e.g., liver, skeleton and cardiomyocytes, pancreas, and adrenal glands). Different AAV serotypes may exhibit different tissue distribution patterns after administration, but the liver is the most common organ to carry large amounts of mistargeted AAV vectors. Recent animal in vivo distribution studies have shown widespread in vivo distribution of vector DNA and green fluorescent protein (GFP) expression despite direct cerebrospinal fluid administration. See: Meseck et al., doi.org / 10.1101 / 2021.11.28.470258, BioRxiv.org (published November 28, 2021). Part of that study evaluated the introduction and expression of scAAV9-CB-GFP in CNS and peripheral tissues after a single intrathecal injection into cerebrospinal fluid. Vector DNA and GFP expression were found to be highest in the spinal cord, dorsal root ganglia, and systemic tissues (e.g., liver), and low in many brain regions. Recently, in 2020-2021, clinical trials of gene therapy using AAV gene therapy were temporarily suspended, primarily due to the deaths of subjects who developed complications of liver failure. See below: NCT03199469 (using AAV serotype 8 vector).Therefore, in this field of technology, it is necessary to reduce hepatotoxicity caused by the delivery of gene drugs via AAV. Nonviral delivery systems (e.g., lipid nanoparticles (LNPs) and lipoplexes) offer attractive and promising alternatives to AAVs for in vivo gene drug delivery. Specifically, LNPs are ideal candidates because they offer, at the very least, efficient biocompatibility, delivery of oligonucleotides to target cells, structural flexibility, rapid removal after the target function has been performed, low toxicity and immunogenicity, and ease of large-scale preparation. However, LNPs are known to have some of the same drawbacks as AAV delivery systems, particularly in off-target delivery to undesirable tissues (e.g., the liver). See, for example, Dilliard, SA and Siegward, DJ, 2022, Nature Biomedical Engineering, 6:106-107. [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Meseck et al., doi.org / 10.1101 / 2021.11.28.470258, BioRxiv.org [Non-Patent Document 2] Dilliard, SA and Siegward, DJ, 2022, Nature Biomedical Engineering, 6:106-107 [Overview of the project]

[0006] The present invention aims to improve gene therapy by blocking or reducing off-target effects of the hepatic delivery vehicle. For example, off-target hepatic delivery and toxicity can be blocked or reduced by using a drug (e.g., siRNA or antisense oligonucleotide) as a preconditioning therapy before or concurrently with the administration of a therapeutic "payload" encapsulated in or associated with an LNP or lipoplex, to knock down or block the binding of low-density lipoprotein (LDL) to the low-density lipoprotein receptor (LDLR). RNAi-based preconditioning can be administered before the LNP or lipoplex carrying the therapeutic payload and then cleared from the body, so as to effectively and transiently block the binding of LDL to LDLR in the liver, thereby increasing the tropism of the payload to the intended non-hepatic target without long-term effects. The composition and method can be used as a platform for enhancing the tropism of gene therapy, thereby improving the efficacy and safety of gene therapy.

[0007] Therefore, the following non-limiting embodiments are provided: Embodiment 1 is a composition comprising a drug that blocks the binding of low-density lipoprotein (LDL) to low-density lipoprotein receptors (LDLR) and a delivery molecule, wherein the delivery molecule is capable of delivering the drug to the liver. Embodiment 2 is the composition according to Embodiment 1, further comprising a payload. Embodiment 3 is the composition according to Embodiment 2, wherein the payload comprises a therapeutic agent. Embodiment 4 is the composition according to Embodiment 2 or 3, wherein the payload comprises a component of the CRISPR / Cas system or a nucleic acid, biologic, or small molecule encoding one or more components of the CRISPR / Cas system, and optionally the component of the CRISPR / Cas system comprises a nucleic acid encoding one or more guide RNAs, one or more scaffolds, and / or one or more endonucleases. Embodiment 5 is the composition according to any one of Embodiments 2 to 4, further comprising lipid nanoparticles (LNPs) or lipoplex, wherein the LNPs or lipoplex encapsulate a payload. Embodiment 6 is the composition according to any one of Embodiments 1 to 5, wherein the delivery molecule comprises lipid nanoparticles (LNPs) or lipoplex. Embodiment 7 is the composition according to any one of Embodiments 1 to 5, wherein the delivery molecule comprises one or more of the following: lactose, galactose, N-acetylgalactosamine (GalNAc), galactosamine, N-formylgalactosamine, N-acetylgalactosamine, N-propionylgalactosamine, N-butanoylgalactosamine, N-isobutanoylgalactosamine, and cholesterol, or derivatives thereof. Embodiment 8 is the composition according to Embodiment 7, wherein the delivery molecule comprises N-acetylgalactosamine (GalNAc). Embodiment 9 is a composition according to any one of Embodiments 1 to 8, wherein the drug comprises RNAi. Embodiment 10 is the composition according to Embodiment 9, wherein RNAi is a small interfering RNA (siRNA), an antisense oligonucleotide (ASO), a microRNA (miRNA), a double-stranded RNA (dsRNA), a short hairpin RNA (shRNA), or an RNA-coding expression cassette. Embodiment 11 is the composition according to Embodiment 9, wherein the drug comprises siRNA. Embodiment 12 is the composition according to Embodiment 11, wherein the siRNA is bound to a nucleic acid comprising any one nucleotide sequence of sequence numbers 350 to 352, or its reverse complementary sequence. Embodiment 13 is the composition according to Embodiment 11, wherein the siRNA comprises at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 consecutive nucleic acids of any one nucleic acid sequence of Table 3A or 3B. Embodiment 14 is the composition according to Embodiment 11, wherein the siRNA is at least 80%, at least 85%, at least 90%, or at least 95% identical to any one of the nucleic acid sequences in Table 3A or 3B. Embodiment 15 is the composition according to Embodiment 11, wherein the siRNA comprises at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 consecutive amino acids of an amino acid sequence selected from SEQ ID NOs. 4300 to 4309. Embodiment 16 is the composition according to Embodiment 11, wherein the siRNA is at least 80%, at least 85%, at least 90%, or at least 95% identical to an amino acid sequence selected from SEQ ID NOs. 4300-4309. Embodiment 17 is the composition according to Embodiment 12, wherein the drug comprises an antisense oligonucleotide (ASO). Embodiment 18 is the composition according to any one of Embodiments 1 to 17, wherein the LDLR comprises an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of the sequences of SEQ ID NOs. 353 to 355. Embodiment 19 is the composition according to Embodiment 4, wherein the components of the CRISPR / Cas system include one or more guide RNAs and a nucleic acid encoding Cas9, and the nucleic acid molecule includes the following: a. A first nucleic acid encoding one or more guide RNAs selected from any one of sequence numbers 1-35, 1000-1078, or 3000-3069, and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9); or b. A first nucleic acid encoding one or more guide RNAs selected from any one of sequence numbers 100-225, 2000-2116, or 4000-4251, and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9); or c. A first nucleic acid encoding one or more guide RNAs, each containing at least 20 consecutive nucleotides of a guide RNA selected from one of sequence numbers 1-35, 1000-1078, or 3000-3069, and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9); or d. A first nucleic acid encoding one or more guide RNAs, each containing at least 20 consecutive nucleotides of a guide RNA selected from one of sequence numbers 100-225, 2000-2116, or 4000-4251, and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9); or e. A first nucleic acid encoding one or more guide RNAs that are at least 90% identical to one of sequence numbers 1-35, 1000-1078, or 3000-3069, and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9); or f. A first nucleic acid encoding one or more guide RNAs that are at least 90% identical to one of sequence numbers 100-225, 2000-2116, or 4000-4251, and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9); or g. The following guide RNA pairs: SEQ ID NOs: 1020 and 23; 1023 and 23; 1023 and 1037; 1024 and 1055; 1025 and 23; 1025 and 1055; 1026 and 23; 1028 and 1055; 1029 and 1055; 1029 and 1037; 1031 and 1037; 1032 and 1037; 101029 and 1027; 1037 and 1048; 1037 and 1051; 1037 and 105 A first nucleic acid encoding a guide RNA pair, comprising first and second guide RNAs selected from any one of the following: 3;20 and 23;1038 and 23;21 and 23;1040 and 23;1042 and 1037;1043 and 1037;1044 and 1037;1045 and 1037;1046 and 1037;24 and 1037;1047 and 1055; or 1055 and 1022; and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9); or h. Guide RNA pairs: A first nucleic acid encoding a guide RNA pair, comprising a first and second guide RNA selected from one of the following: SEQ ID NOs: 1170 and 179; 172 and 179; 179 and 183; 179 and 185; 179 and 187; 179 and 188; 179 and 189; 179 and 193; 179 and 195; 179 and 196; 179 and 197; 200 and 174; or 200 and 176; and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9). i. For exon 44 targeting, the following guide RNA pairs: a first nucleic acid encoding a guide RNA pair, comprising first and second guide RNAs selected from any one of the following: SEQ ID NOs: 117 and 121; 117 and 122; 120 and 121; 120 and 123; 120 and 124; 120 and 125; 122 and 126; 122 and 123; 122 and 124; 122 and 125; or 122 and 126; and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9). For targeting exon 50, the following guide RNA pairs are used: a first nucleic acid encoding a guide RNA pair, comprising a first and second guide RNA selected from one of the following: 155 and 156; 155 and 158; 155 and 162; 155 and 163; 162 and 157; 162 and 159; 162 and 164; 162 and 166; or 162 and 167; and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9). For targeting k. exon 53, the following guide RNA pairs: a first nucleic acid encoding a guide RNA pair, comprising a first and second guide RNA selected from one of the following: SEQ ID NOs: 211 and 223; 211 and 225; 214 and 224; 216 and 223; 216 and 225; 220 and 224; 204 and 223; 223 and 224; or 204 and 225; and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9). For targeting exon 53, the following guide RNA pairs are used: a first nucleic acid encoding a guide RNA pair, comprising first and second guide RNAs selected from one of the following: SEQ ID NOs: 1068 and 32; 1069 and 32; 1070 and 1075; 1071 and 32; 29 and 1075; 1072 and 27; 1072 and 28; 1072 and 32; 1072 and 33; 1073 and 1076; 1073 and 35; 221 and 1077; 1074 and 27; 1074 and 28; 1074 and 33; 32 and 1077; 1075 and 1076; 1075 and 35; 1076 and 26; or 35 and 26; and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9). The following guide RNA pairs: SEQ ID NOs: 148 and 134; 149 and 135; 150 and 135; 131 and 136; 151 and 136; 139 and 131; 139 and 151; 140 and 131; 140 and 151; 141 and 148; 144 and 149; 144 and 150; 145 and 131; 145 and 151; 146 and 148; 134 and 148; 135 and 149; 135 and 15 A first nucleic acid encoding a guide RNA pair, comprising a first and second guide RNA selected from any one of the following: 0;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and a second nucleic acid encoding Staphylococcus lugdunensis (SaCas9); or n. The following guide RNA pairs: SEQ ID NOs: 10 and 15; 10 and 16; 12 and 16; 1001 and 1005; 1001 and 15; 1001 and 16; 1003 and 1005; 16 and 1003; 12 and 1010; 12 and 1012; 12 and 1013; 10 and 1016; 1017 and 1005; 1017 and 16; 1018 and 16; 15 and 10; 16 and 10; 16 and 12; 1005 A first nucleic acid encoding a guide RNA pair, comprising a first and second guide RNA selected from any one of the following: 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9). Embodiment 20 is a method comprising (a) administering to a subject requiring it an agent that blocks the binding of LDL to low-density lipoprotein receptors (LDLRs), and simultaneously or subsequently, (b) administering to the subject an LNP or lipoplex containing a payload, wherein the agent reduces off-target delivery of the LNP or lipoplex to the liver. Embodiment 21 is a method for increasing the proportion of a payload delivered to a target non-liver target, comprising: (a) a preconditioning step of administering to a target a composition comprising an agent that blocks the binding of LDL to low-density lipoprotein receptors (LDLRs) in the liver; and (b) administering to a target LNP or lipoplex and a payload. Embodiment 22 is the method according to any one of Embodiments 20 to 21, wherein step (a) comprises administering the composition described in any one of Embodiments 1 and 6 to 18 to a subject. Embodiment 23 is a method for reducing the hepatic tropism of a payload administered with LNP or lipoplex in a subject, comprising (a) administering a composition described in any one of Embodiments 1 and 6 to 18 to a subject, followed by (b) administering LNP or lipoplex and a payload to the subject. Embodiment 24 is the method of any of Embodiments 20 to 23, wherein a composition comprising a drug that blocks the binding of LDL to low-density lipoprotein receptors (LDLRs) in the liver is administered to the target, thereby temporarily blocking the interaction of a delivery molecule with LDLRs in the liver. Embodiment 25 is the method according to any of Embodiments 20-24, wherein the administration of a composition and / or agent that blocks the binding of LDL to low-density lipoprotein receptors (LDLRs) in the liver is performed about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 days prior to the administration of the LNP or lipoplex and payload. Embodiment 26 is the method according to any one of Embodiments 20-24, wherein the administration of a composition and / or agent that blocks the binding of LDL to low-density lipoprotein receptors (LDLRs) in the liver is performed about 1, 2, 3, 4, 5, 6, or 7 days before the administration of the LNP or lipoplex and payload. Embodiment 27 is the method according to any of Embodiments 20 to 24, wherein the administration of a composition and / or agent that blocks the binding of LDL to low-density lipoprotein receptors (LDLRs) in the liver is performed about 8, 9, 10, 11, 12, 13, or 14 days before the administration of the LNP or lipoplex and payload. Embodiment 28 is the method according to any one of Embodiments 20 to 24, wherein the composition described in any one of Embodiments 1 and 6 to 18 is administered to the subject immediately before administration of the LNP or lipoplex and payload. Embodiment 29 is the method according to any one of Embodiments 20 to 24, wherein the composition described in any one of Embodiments 1 and 6 to 18 is administered in combination with LNP or lipoplex and payload. Embodiment 30 is the method according to any one of Embodiments 20 to 24, wherein the delivery molecule is a lipid nanoparticle (LNP). Embodiment 31 is the method according to any one of Embodiments 20 to 24, wherein the payload is a nucleic acid, biologic, or small molecule encoding a component of the CRISPR / Cas system or one or more components thereof, and optionally the component of the CRISPR / Cas system comprises one or more guide RNAs, one or more scaffolds, and / or nucleic acids encoding one or more endonucleases. Embodiment 32 is the method according to Embodiment 31, wherein the components of the CRISPR / Cas system include one or more guide RNAs and a nucleic acid encoding Cas9, and the nucleic acid molecule includes the following: a. A first nucleic acid encoding one or more guide RNAs selected from any one of sequence numbers 1-35, 1000-1078, or 3000-3069, and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9); or b. A first nucleic acid encoding one or more guide RNAs selected from any one of sequence numbers 100-225, 2000-2116, or 4000-4251, and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9); or c. A first nucleic acid encoding one or more guide RNAs comprising at least 20 consecutive nucleotides of a guide RNA selected from any one of SEQ ID NOs: 1-35, 1000-1078, or 3000-3069, and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9); or d. A first nucleic acid encoding one or more guide RNAs comprising at least 20 consecutive nucleotides of a guide RNA selected from any one of SEQ ID NOs: 100-225, 2000-2116, or 4000-4251, and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9); or e. A first nucleic acid encoding one or more guide RNAs that are at least 90% identical to any one of SEQ ID NOs: 1-35, 1000-1078, or 3000-3069, and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9); or f. A first nucleic acid encoding one or more guide RNAs that are at least 90% identical to any one of SEQ ID NOs: 100-225, 2000-2116, or 4000-4251, and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9); or g. The following guide RNA pairs: SEQ ID NOs: 1020 and 23; 1023 and 23; 1023 and 1037; 1024 and 1055; 1025 and 23; 1025 and 1055; 1026 and 23; 1028 and 1055; 1029 and 1055; 1029 and 1037; 1031 and 1037; 1032 and 1037; 101029 and 1027; 1037 and 1048; 1037 and 1051; 1037 and 105 A first nucleic acid encoding a guide RNA pair, comprising first and second guide RNAs selected from any one of the following: 3;20 and 23;1038 and 23;21 and 23;1040 and 23;1042 and 1037;1043 and 1037;1044 and 1037;1045 and 1037;1046 and 1037;24 and 1037;1047 and 1055; or 1055 and 1022; and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9); or h. Guide RNA pairs: A first nucleic acid encoding a guide RNA pair, comprising a first and second guide RNA selected from one of the following: SEQ ID NOs: 1170 and 179; 172 and 179; 179 and 183; 179 and 185; 179 and 187; 179 and 188; 179 and 189; 179 and 193; 179 and 195; 179 and 196; 179 and 197; 200 and 174; or 200 and 176; and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9). i. For exon 44 targeting, the following guide RNA pairs: a first nucleic acid encoding a guide RNA pair, comprising first and second guide RNAs selected from any one of the following: SEQ ID NOs: 117 and 121; 117 and 122; 120 and 121; 120 and 123; 120 and 124; 120 and 125; 122 and 126; 122 and 123; 122 and 124; 122 and 125; or 122 and 126; and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9). j. A first nucleic acid encoding a guide RNA pair comprising a first and a second guide RNA selected from any one of the following guide RNA pairs for exon 50 targets: 155 and 156; 155 and 158; 155 and 162; 155 and 163; 162 and 157; 162 and 159; 162 and 164; 162 and 166; or 162 and 167, and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9), k. A first nucleic acid encoding a guide RNA pair comprising a first and a second guide RNA selected from any one of the following guide RNA pairs for exon 53 targets: SEQ ID NO: 211 and 223; 211 and 225; 214 and 224; 216 and 223; 216 and 225; 220 and 224; 204 and 223; 223 and 224; or 204 and 225, and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9), l. A first nucleic acid encoding a guide RNA pair comprising a first and a second guide RNA selected from any one of the following guide RNA pairs for exon 53 targets: SEQ ID NO: 1068 and 32; 1069 and 32; 1070 and 1075; 1071 and 32; 29 and 1075; 1072 and 27; 1072 and 28; 1072 and 32; 1072 and 33; 1073 and 1076; 1073 and 35; 221 and 1077; 1074 and 27; 1074 and 28; 1074 and 33; 32 and 1077; 1075 and 1076; 1075 and 35; 1076 and 26; or 35 and 26, and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9), The following guide RNA pairs: SEQ ID NOs: 148 and 134; 149 and 135; 150 and 135; 131 and 136; 151 and 136; 139 and 131; 139 and 151; 140 and 131; 140 and 151; 141 and 148; 144 and 149; 144 and 150; 145 and 131; 145 and 151; 146 and 148; 134 and 148; 135 and 149; 135 and 15 A first nucleic acid encoding a guide RNA pair, comprising a first and second guide RNA selected from any one of the following: 0;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and a second nucleic acid encoding Staphylococcus lugdunensis (SaCas9); or n. The following guide RNA pairs: SEQ ID NOs: 10 and 15; 10 and 16; 12 and 16; 1001 and 1005; 1001 and 15; 1001 and 16; 1003 and 1005; 16 and 1003; 12 and 1010; 12 and 1012; 12 and 1013; 10 and 1016; 1017 and 1005; 1017 and 16; 1018 and 16; 15 and 10; 16 and 10; 16 and 12; 1005 A first nucleic acid encoding a guide RNA pair, comprising a first and second guide RNA selected from any one of the following: 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9). Embodiment 33 is the method according to any one of Embodiments 20 to 32, wherein the payload is encapsulated within lipid nanoparticles (LNPs). Embodiment 34 is the method according to any one of Embodiments 20 to 33, wherein the method comprises co-administering another drug that promotes increased drug uptake in the liver. Embodiment 35 is the method of any of Embodiments 20-34, wherein blocking the binding of LDL to the low-density lipoprotein receptor (LDLR) in the liver in step (a) is not transient. Embodiment 36 is the method according to any one of Embodiments 20 to 35, wherein the payload is located within the LNP, and the LNP targets the brain, spinal cord, eye, retina, bone, cardiac muscle, skeletal muscle, smooth muscle, lung, pancreas, heart, and / or kidney. Embodiment 37 is the method according to any one of Embodiments 20 to 36, wherein administering the composition in step (a) increases the proportion of the payload delivered to non-liver targets. Embodiment 38 is the method according to any one of Embodiments 20 to 37, wherein the method increases the payload in a non-hepatic target by at least 10%, 30%, 50%, 75%, 100%, 125%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 600%, 700%, 800%, 900%, or 1000% compared to the payload in the corresponding tissue of a control subject to which the payload was administered but to which no agent blocking the binding of LDL to low-density lipoprotein receptors (LDLRs) in the liver was administered. Embodiment 39 is the method according to Embodiment 38, wherein the method increases the intramuscular payload by at least 10%, 30%, 50%, 75%, 100%, 125%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 600%, 700%, 800%, 900%, or 1000% compared to the corresponding intramuscular payload of a control subject that was administered a payload but was not administered a drug that blocks the binding of LDL to low-density lipoprotein receptors (LDLRs) in the liver. Embodiment 40 is the method according to any one of Embodiments 20 to 39, wherein the drug comprises RNAi. Embodiment 41 is the method according to Embodiment 40, wherein RNAi is a small interfering RNA (siRNA), an antisense oligonucleotide (ASO), a microRNA (miRNA), a double-stranded RNA (dsRNA), a short hairpin RNA (shRNA), or an RNA-coding expression cassette. Embodiment 42 is the method according to Embodiment 41, wherein the drug comprises siRNA. Embodiment 43 is the method of Embodiment 42, wherein the siRNA is bound to a nucleic acid comprising any one of the nucleotide sequences described in SEQ ID NOs. 350 to 352, or its reverse complementary sequence. Embodiment 44 is the method according to Embodiment 42, wherein the siRNA comprises at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 consecutive nucleic acids of any one of the nucleic acid sequences in Table 3A or 3B. Embodiment 45 is the method of Embodiment 42, wherein the siRNA is at least 80%, at least 85%, at least 90%, or at least 95% identical to any one of the nucleic acid sequences in Table 3A or 3B. Embodiment 46 is the method according to Embodiment 42, wherein the siRNA comprises at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 consecutive amino acids of an amino acid sequence selected from SEQ ID NOs. 4300 to 4309. Embodiment 47 is the method according to Embodiment 42, wherein the siRNA is at least 80%, at least 85%, at least 90%, or at least 95% identical to an amino acid sequence selected from SEQ ID NOs. 4300-4309. Embodiment 48 is the method of Embodiment 42, wherein the agent comprises an antisense oligonucleotide (ASO). Embodiment 49 is the method according to any of Embodiments 20 to 48, wherein the subject is a human subject. Embodiment 50 is the method according to any one of Embodiments 20 to 49, wherein the drug is administered intravenously or subcutaneously. Embodiment 51 is a composition comprising an siRNA containing a nucleotide sequence selected from SEQ ID NOs: 4300 to 15629. Embodiment 52 is the composition according to Embodiment 51, wherein the siRNA comprises a nucleotide sequence selected from any one of SEQ ID NOs. 4300 to 4309. [Brief explanation of the drawing]

[0008] [Figure 1A] This shows knockdown of LDLR mRNA in Hepa1-6 cells by 10 different siRNAs. The plots show 10 dose-response points for each of the 10 siRNAs evaluated. [Figure 1B] This shows knockdown of LDLR mRNA in Hepa1-6 cells by 10 different siRNAs. The plots show 10 dose-response points for each of the 10 siRNAs evaluated. [Figure 1C] This shows knockdown of LDLR mRNA in Hepa1-6 cells by 10 different siRNAs. The plots show 10 dose-response points for each of the 10 siRNAs evaluated. [Figure 1D] This shows knockdown of LDLR mRNA in Hepa1-6 cells by 10 different siRNAs. The plots show 10 dose-response points for each of the 10 siRNAs evaluated. [Figure 1E] This shows knockdown of LDLR mRNA in Hepa1-6 cells by 10 different siRNAs. The plots show 10 dose-response points for each of the 10 siRNAs evaluated. [Figure 1F] This shows knockdown of LDLR mRNA in Hepa1-6 cells by 10 different siRNAs. The plots show 10 dose-response points for each of the 10 siRNAs evaluated. [Figure 1G] This shows knockdown of LDLR mRNA in Hepa1-6 cells by 10 different siRNAs. The plots show 10 dose-response points for each of the 10 siRNAs evaluated. [Figure 1H] This shows knockdown of LDLR mRNA in Hepa1-6 cells by 10 different siRNAs. The plots show 10 dose-response points for each of the 10 siRNAs evaluated. [Figure 1I]This shows knockdown of LDLR mRNA in Hepa1-6 cells by 10 different siRNAs. The plots show 10 dose-response points for each of the 10 siRNAs evaluated. [Figure 1J] This shows knockdown of LDLR mRNA in Hepa1-6 cells by 10 different siRNAs. The plots show 10 dose-response points for each of the 10 siRNAs evaluated. [Figure 1K-1] The siRNA sequence identity, species conservation, and potency values ​​calculated from the dose-response curve are presented. [Figure 1K-2] Same as above. [Figure 2] This shows knockdown of LDLR mRNA in Hepa1-6 cells by different siRNAs. The plot traces show the multiplicative change in LDLR mRNA levels compared to untreated samples, measured by qPCR 48 hours after treatment with 2.5 nM (left column of modalities) and 50 nM siRNA (right column corresponding to treatment with one modality). The dashed black line indicates the 50% mRNA expression level. The bar height represents the mean of the technical replicates, and the error bars correspond to the standard deviation of the group. The positive control is a commercially available siRNA targeting LDLR (Invitrogen AM16708-"Invt"). All siRNAs were transfected into cells using the standard RNAiMax protocol. Negative control: Non-targeted siRNA (51-01-19-08, Integrated DNA Technologies) used as a negative control. Untreated: Samples were not treated with lipofectamine. [Figure 3] This shows a simplified graphical representation of the design and analysis of in vivo studies to investigate the dynamics of LDLR protein knockdown. [Figure 4] This shows in vivo data for LNP siRNA that induces sustained knockdown of LDLR mRNA up to day 7. [Figure 5A]In vivo data showing that siRNA-LNP leads to sustained knockdown of LDLR protein up to day 7 compared to PBS are presented. Representative Jess blot images of selected samples and recombinant LDLR protein from day 1 are shown. [Figure 5B] This paper presents in vivo data showing that siRNA-LNP results in sustained knockdown of LDLR protein up to day 7 compared to PBS. Normalized LDLR protein expression levels from mouse liver at each time point are shown. Samples were normalized to the mean values ​​of PBS-treated animals at a given time point. [Figure 6] This shows in vivo data demonstrating that LDL-c (low-density lipoprotein cholesterol) functions as a biomarker for LDLR knockdown. Animals administered with LDLR-targeting substances show elevated LDL-c levels. Each point on the graph represents the LDL-c level of one animal. The bar height represents the group mean, and the error bars represent the group standard deviation. The control PBS includes results from IV and SC ROA. Results from one animal were excluded due to experimental failure. [Figure 7] This is a simplified graphical representation of the design and analysis of in vivo studies to investigate LDLR-LNP doses. Various doses of liver-targeting LDLR-targeting siRNA-LNPs will be administered to mice, and tissue samples will be collected 4–48 hours after administration to assess LDLR protein levels by Western blotting. The figure corresponds to the study in Example 3. [Figure 8] This is a simplified graphical representation of the design and analysis of an in vivo study to investigate the LDLR protein knockdown dynamics from the optimal dose corresponding to the study in Example 4. [Figure 9] This is a simplified graphical representation of the design and analysis of an in vivo proof-of-concept study to investigate the efficiency of LNP detargeting strategies. The study corresponds to the study in Example 5. [Modes for carrying out the invention]

[0009] The following references will be made in detail to specific embodiments of the present invention. Although the present invention is described in conjunction with the illustrated embodiments, it will be understood that the present invention is not intended to be limited to those embodiments. Rather, the present invention is intended to include all substitutes, modifications, and equivalents, which may be included within the present invention as defined by the appended claims and the embodiments included.

[0010] Before describing this instruction in detail, it should be understood that this disclosure is not limited to specific compositions or process steps, as they may vary. It should be noted that, as used herein and in the appended claims, the singular forms "a," "an," and "the" also include plural references unless otherwise explicitly stated in the context. Thus, for example, a reference to "guide" includes multiple guides, a reference to "cell" includes multiple cells, and so on.

[0011] A number range includes the numbers that define that range. Measured values ​​and measurable values ​​are understood to be approximations, taking into account significant figures and errors associated with the measurement. Furthermore, the use of “comprise,” “comprises,” “comprising,” “contain,” “contains,” “containing,” “include,” “includes,” and “including” is not intended to be limiting. It should be understood that both the general and detailed explanations above are illustrative and descriptive only and do not limit this instruction.

[0012] Unless otherwise specifically stated herein, embodiments of this specification describing "comprising" various components are also intended to describe "consisting of" or "consisting essentially of" the components described (this substitutability does not apply to the use of these terms in the claims). The term "or" is used in an inclusive sense, i.e., equivalent to "and / or", unless another meaning is explicitly stated in the context.

[0013] The headings used herein are for structural purposes only and should not be construed as limiting the desired subject matter in any way. If any material incorporated by reference conflicts with any terminology defined herein or any other express content herein, the foregoing shall prevail. While these instructions are written in relation to various embodiments, they are not intended to be limited to such embodiments. Rather, these instructions include various substitutes, modifications, and equivalents, as will be understood by those skilled in the art.

[0014] I. Definition Unless otherwise specified, the following terms and phrases used herein are intended to have the following meanings:

[0015] "Polynucleotide," "nucleic acid," and "nucleic acid molecule" are used herein to refer to a polymeric compound comprising a nucleoside or nucleoside analog having nitrogen-containing heterocyclic bases or base analogs linked together along a backbone, including ordinary RNA, DNA, mixed RNA-DNA, and polymers which are analogs thereof. The nucleic acid "backbone" can consist of a wide variety of linkages, including one or more of sugar-phosphodiester links, peptide-nucleic acid links ("peptide nucleic acid" or PNA; PCT No. WO95 / 32305), phosphorothioate links, methylphosphonate links, or combinations thereof. The sugar portion of the nucleic acid may be ribose, deoxyribose, or similar compounds with substitutions, e.g., 2'-methoxy or 2'-halide substitutions. Nitrogen bases include conventional bases (A, G, C, T, U), their analogues (e.g., modified uridines, e.g., 5-methoxyuridine, pseudouridine, or N1-methylpsoiduridine); inosine; and derivatives of purines or pyrimidines (e.g., N1). 4 -methyldeoxyguanosine, deaza- or aza-purine, deaza- or aza-pyrimidine, pyrimidine bases substituted at position 5 or 6 (e.g., 5-methylcytosine), purine bases substituted at position 2, 6, or 8, 2-amino-6-methylaminopurine, O 6 -Methylguanine, 4-thiopyrimidine, 4-aminopyrimidine, 4-dimethylhydrazinepyrimidine, and O 4 -Alkylpyrimidines (US Patent No. 5,378,825 and PCT No. WO93 / 13121). For general considerations, see: The Biochemistry of the Nucleic Acids 5-36, Adams et al., ed., 11 th(ed., 1992). Nucleic acids can contain one or more "debased" residues in the polymer structure that do not contain nitrogen-containing bases at any position (possibly multiple positions) (U.S. Patent No. 5,585,481). Nucleic acids can contain only the sugars, bases, and bonds of normal RNA or DNA, or they can contain both normal components and substitutions (e.g., polymers containing both normal bases with 2'-methoxy bonds, or normal bases and one or more base analogs). Nucleic acids also contain analogs called "locked nucleic acids" (LNAs), which contain one or more LNA nucleotide monomers with bicyclic furanose units locked in a sugar conformation that mimics RNA, thereby increasing hybridization affinity to complementary RNA and DNA sequences (Vester and Wengel, 2004, Biochemistry 43(42):13233-41). RNA and DNA can be distinguished by having different sugar moieties, with RNA containing uracil or its analogues, or DNA containing thymine or its analogues. This disclosure provides a number of exemplary nucleotide sequences herein, and intends to provide reverse complementary sequences of these nucleotide sequences, as well as RNA and / or DNA equivalents of any of these sequences. For example, the RNA equivalent of any of the DNA sequences disclosed herein will contain uracil instead of thymine in the sequence, while the DNA equivalent of any of the RNA sequences disclosed herein will contain thymine instead of uracil.

[0016] As used herein, the “CRISPR” system and the “RNA-targeted endonuclease” or “Cas nuclease” include the type II CRISPR systems of S. pyogenes, S. aureus, and other prokaryotes (see, for example, the list in the following paragraphs), and modified (e.g., manipulated or mutated) versions thereof. See, for example, US2016 / 0312198A1, US2016 / 0312199A1. In certain embodiments, the RNA-targeted endonuclease is a type II CRISPR Cas enzyme. Other examples of Cas nucleases include the Csm complex or Cmr complex or its subunits Cas10, Csm1, or Cmr2 from the type III CRISPR system, and the Cascade complex or its Cas3 subunit from the type I CRISPR system. In some embodiments, the Cas nuclease may be derived from the type IIA, type IIB, or type IIC system. For discussions on various CRISPR systems and Cas nucleases, see, for example, the following: Makarova et al., Nat. Rev. Microbiol., 9:467-477 (2011); Makarova et al., Nat. Rev. Microbiol., 13:722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015).

[0017] Non-limiting examples of cas nucleases that may be derived include: Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Listeria innocua, Lactobacillus gasseri, Francisella novicida, Wolinella succinogenes, Sutterella wadsworthensis, Gammaproteobacterium, Neisseria meningitidis, Campylobacter jejuni, Pasteurella multocida, Fibrobacter succinogene, Rhodospirillum rubrum, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Lactobacillus buchneri, Treponema denticola, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp.、Crocosphaera watsonii、Cyanothece sp.、Microcystis aeruginosa、Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohlobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Streptococcus pasteurianus, Neisseria cinerea, Campylobacter lari, Parvibaculum lavamentivorans, Corynebacterium diphtheria, Acidaminococcus sp.、Lachnospiraceae bacterium ND2006、、Acaryochloris marina。.

[0018] The terms “guide RNA,” “guide RNA,” and simply “guide” are used interchangeably herein to refer to either crRNA (also called CRISPR RNA) or a combination of crRNA and trRNA (also called tracrRNA). crRNA and trRNA may be associated as a single RNA molecule (single guide RNA, sgRNA) or as two separate RNA molecules (dual guide RNA, dgRNA). “Guide RNA” or “guide RNA” refers to either type. trRNA may be a naturally occurring sequence or a trRNA sequence that is modified or mutated compared to a naturally occurring sequence. For clarity, the terms “guide RNA” or “guide” as used herein may refer to an RNA molecule (containing A, C, G, and U nucleotides) or a DNA molecule (containing A, C, G, and T nucleotides) encoding such an RNA molecule or its complementary sequence, unless otherwise specifically stated. In general, for a DNA nucleic acid construct encoding a guide RNA, a U residue in any of the RNA sequences described herein may be replaced with a T residue, and for a guide RNA construct encoded by any of the DNA sequences described herein, a T residue may be replaced with a U residue.

[0019] As used herein, a “spacer sequence” (which may also be referred to herein and in the literature as a “spacer,” “protospacer,” “guide sequence,” or “target-directed sequence”) refers to a sequence within the guide RNA that is complementary to the target sequence and functions to guide the guide RNA to the target sequence for cleavage by Cas9. The length of the guide sequence may be 24, 23, 22, 21, 20 base pairs or less, for example, in the case of Staphylococcus lugdunensis (i.e., SluCas9) or Staphylococcus aureus (i.e., SaCas9) and associated Cas9 homologs / orthologues. In preferred embodiments, the guide / spacer sequence in the case of SluCas9 or SaCas9 is at least 20 base pairs long, more specifically, 20–25 base pairs long (see, for example, Schmidt et al., 2021, Nature Communications, “Improved CRISPR genome editing using small highly active and specific engineered RNA-guided nucleases”). For example, shorter or longer sequences, such as 15-nucleotide, 16-nucleotide, 17-nucleotide, 18-nucleotide, 19-nucleotide, 20-nucleotide, 21-nucleotide, 22-nucleotide, 23-nucleotide, 24-nucleotide, or 25-nucleotide lengths, can also be used as guides. For example, in some embodiments, the guide sequence includes at least 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleotides of a sequence selected from SEQ ID NOs. 1-35 (for SaCas9) and 100-225 (for SluCas9). In some embodiments, the target sequence is located, for example, within a gene or on a chromosome and is complementary to the guide sequence. In some embodiments, the degree of complementarity or identity between the guide sequence and its corresponding target sequence may be about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the guide array and the target region may be 100% complementary or identical.In other embodiments, the guide sequence and target region may contain at least one mismatch. For example, the guide sequence and target sequence may contain one, two, three, or four mismatches, in which case the total length of the target sequence is at least 17, 18, 19, 20, or more base pairs. In some embodiments, the guide sequence and target region may contain one to four mismatches, in which case the guide sequence contains at least 17, 18, 19, 20, or more nucleotides. In some embodiments, the guide sequence and target region may contain one, two, three, or four mismatches, in which case the guide sequence contains 20 nucleotides. In some embodiments, the guide sequence and target region do not contain any mismatches.

[0020] As used herein, the terms “about” or “approximately” mean a tolerance for a particular value as determined by those skilled in the art, which depends to some extent on the method of measuring or determining the value.

[0021] As used herein, “AAV” refers to adeno-associated virus vectors. As used herein, “AAV” refers to any AAV serotype and variant (e.g., but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh10 (e.g., SEQ ID NO: 81 in US9,790,472 (the whole is incorporated herein by reference)), AAVrh74 (e.g., SEQ ID NO: 1 in US2015 / 0111955 (the whole is incorporated herein by reference)), AAV9 vector, AAV9P vector also known as AAVMYO (e.g., Weinmann et al., 2020, Nature Communications, 11:5432), and Myo-AAV vectors described in Tabebordbar et al., 2021, Cell, 184:1-20 (e.g., MyoAAV The terms 1A, 2A, 3A, 4A, 4C, or 4E refer to the AAV serotype, where the number after AAV indicates the AAV serotype. The term "AAV" can also refer to any known AAV(vector) system. In some embodiments, the AAV vector is a single-stranded AAV (ssAAV). In some embodiments, the AAV vector is a double-stranded AAV (dsAAV). Any variant of the AAV vector or its serotype (e.g., self-complementary AAV (scAAV) vector) is encompassed by the general terms AAV vector, AAV1 vector, etc. For a detailed discussion of various AAV vectors, see, for example, McCarty et al., Gene Ther. 2001;8:1248-54, Naso et al., BioDrugs 2017;31:317-334 and the references cited therein. Structurally, AAV is a small (25 nm) single-DNA non-enveloped virus with an icosahedral capsid. As used herein, "AAV" refers to naturally occurring or engineered AAV serotypes and recombinant AAV (rAAV) and variants, which differ in the composition and structure of their capsid proteins and possess various tropisms (i.e., the ability to introduce different cell types). When combined with an active promoter, this tropism determines the site of gene expression.

[0022] As used herein, “payload-based gene therapy” means the administration of a gene editing payload composition comprising a tissue-specific promoter (containing one or more Cas9 nucleases and one or more guide RNAs, or nucleic acids encoding one or more Cas9 nucleases and one or more guide RNAs) to facilitate the administration of gene therapy, which may include any gene editing system known in the art. The promoters described herein may also be “cell-specific.” This means that a particular promoter selected for a payload can induce the expression of a selected transgene / nucleotide sequence of interest in a particular cell or cell type. In some embodiments, for example, the promoter is a muscle-specific promoter (e.g., a muscle creatine kinase promoter, a desmin promoter, an MHCK7 promoter, or an SPc5-12 promoter). In some embodiments, the muscle-specific promoter is a CK8 promoter. In some embodiments, the muscle-specific promoter is a CK8e promoter. Muscle-specific promoters are described in detail, for example, US2004 / 0175727A1, Wang et al., Expert Opin Drug Deliv. (2014) 11, 345-364, and Wang et al., Gene Therapy (2008) 15, 1489-1499. In some embodiments, tissue-specific promoters are neuron-specific promoters such as enolase promoters. For a detailed discussion of tissue-specific promoters (e.g., neuron-specific promoters), see, for example, Naso et al., BioDrugs 2017;31:317-334; Dashkoff et al., Mol Ther Methods Clin Dev. 2016;3:16081 and the references cited therein. Any known promoter can be used in combination with a payload to deliver gene therapy to the intended target tissue or cells. As used herein, “non-liver payload-based gene therapy” includes treating or preventing a disease or disorder using a payload-based gene therapy that is not a liver disease or disorder.

[0023] As used herein, “low-density lipoprotein receptor” or “LDLR” or “LDL-R” or “LDL receptor” are used interchangeably to refer to the LDL receptor protein. LDLR has the Uniprot accession number H0YMD1. Synonyms for LDLR also include FHC, LDLCQ2, and LDLR_HUMAN. LDLR is a protein synthesized in the endoplasmic reticulum (ER), as studies have shown, where it is folded and partially glycosylated. Studies have then revealed that LDLR is further glycosylated in the Golgi apparatus to become a mature protein. LDLR consists of five functionally distinct domains: the N-terminal ligand-binding domain, the epidermal growth factor (EGF) precursor homology domain, the O-linked sugar-containing domain, the transmembrane domain, and the C-terminal cytoplasmic domain.

[0024] In this specification, “blocking LDL binding to LDLR” means temporarily or permanently reducing, inhibiting, or blocking the ability of the LDL molecule to bind to the LDL receptor. In some embodiments, “blocking” means downregulating the gene expression of LDLR, resulting in reduced LDLR expression in cells treated with the “blocking” drug (e.g., LDLR-specific siRNA) compared to control cells of the same cell type that are not treated with the “blocking” drug. In some embodiments, “blocking” means contacting LDLR with a drug (e.g., an antibody or small molecule) that blocks LDL binding to LDLR. In certain embodiments, the drug that blocks LDL binding to LDLR also inhibits the uptake of LNPs into hepatocytes or liver tissue.

[0025] As used herein, “blocking the uptake of LNPs into hepatocytes or tissues” means temporarily or permanently reducing, inhibiting, or blocking the ability of LNPs (e.g., payload-carrying LNPs) to be taken up by hepatocytes or liver tissues via LDL receptors. In certain embodiments, blocking the uptake of LNPs into hepatocytes or tissues is achieved by using a drug that blocks the binding of LDL to LDLR. In some embodiments, blocking the uptake of LNPs into hepatocytes or tissues is achieved by using a drug that downregulates LDLR expression (e.g., LDLR-specific siRNA or ASO), resulting in reduced LDLR expression in drug-treated cells compared to untreated control cells of the same cell type.

[0026] As used herein, “RNAi compound,” “RNAi molecule,” or “RNAi” are used interchangeably and refer to inhibitory RNA. RNAi refers to an antisense compound that acts to modulate a target nucleic acid and / or the protein encoded by the target nucleic acid. RNAi compounds include, but are not limited to, small interfering RNAs (siRNAs), single-stranded RNAs (ssRNAs), microRNAs (e.g., microRNA mimes), double-stranded RNAs (dsRNAs), short hairpin RNAs (shRNAs), and expression cassettes encoding RNA capable of inducing RNA interference. For example, an RNAi expression cassette can be transcribed in a cell to produce siRNAs, linear siRNAs with separate sense and antisense strands, or small hairpin RNAs that can function as miRNAs. As used herein, “RNAi” and “siRNA” refer to the broadest sense of the term and include, for example, any siRNA that is modified (e.g., chemical modification, addition of at least one receptor-binding ligand or moiety) insofar as the molecule retains the ability to bind to a target nucleic acid in a target cell and thereby reduces the expression of the target gene. RNAi molecules can be easily designed and generated using methods known in the art.

[0027] As used herein, “antisense oligonucleotide” or “ASO” refers to a short chain of DNA or RNA that binds to a complementary RNA sequence and thereby inhibits its function. By inhibiting a specific RNA sequence, an ASO can effectively downregulate or upregulate the production of a particular downstream protein and, theoretically, can be used in both selective loss-of-function and gain-of-function mutations. In relation to LDLRs, an ASO may be used to downregulate the expression of LDLRs.

[0028] As used herein, “delivery molecule” or “liver-targeting portion” includes, but is not limited to, any molecule, ligand, or conjugate (e.g., any known liver-targeting conjugate, e.g., N-acetylgalactosamine (GalNAc) conjugate) that can be applied to a drug (e.g., siRNA, RNAi, ASO, or anti-LDLR antibody) that blocks the binding of LDL to LDLR to enhance the delivery of the drug to the liver and / or its uptake by the liver, as well as any other delivery system for delivering a drug (e.g., siRNA or RNAi) to the liver or hepatocytes. Selecting a suitable molecule, ligand, or conjugate for causing siRNA to target a particular body system, organ, tissue, or cell is considered to be within the usual art of the art. For example, to cause siRNA to target hepatocytes, cholesterol may be bound to one or more ends of the siRNA molecule, including any combination of the 5' and 3' ends. The resulting cholesterol siRNA is delivered to hepatocytes in the liver, thereby providing a means for delivering siRNA to this target site. Other ligands useful for targeting siRNA to the liver include HBV surface antigen and low-density lipoprotein (LDL).

[0029] As used herein, “LNP” or “lipid nanoparticles” refers to lipid-based delivery compositions. LNPs are known in the art and refer to particles containing multiple (i.e., two or more) lipid molecules physically associated with each other by intermolecular forces. LNPs can be, for example, microspheres (monolayers and multilayer vesicles, e.g., “liposomes”—in some embodiments, substantially spherical layered lipid bilayers—in more specific embodiments, an aqueous core (e.g., containing a substantial portion of an RNA molecule)), dispersed phases in emulsions, micelles, or internal phases in suspensions. Emulsions, micelles, and suspensions can be compositions suitable for local and / or surface delivery. See, for example, WO2017173054A1 (the contents of which are incorporated herein by reference in their entirety). Any LNP known to those skilled in the art to be capable of targeting and delivering nucleotides (e.g., siRNA or other RNAi) may be used herein.

[0030] As used herein, “Lipoplex” (used interchangeably with “Lipid complex” or “Lipid:vector complex”) refers to a heterogeneous complex that self-assembles when nucleic acids (DNA, RNA) are mixed with cationic lipids. The lipid component of a lipoplex can facilitate the delivery of nucleic acids to cells and protect them from degradation in the extracellular environment. Non-limiting examples of lipoplex applications include gene therapy and vaccine development.

[0031] As used herein, “antibody” is used in its broadest sense and encompasses a variety of antibody structures (e.g., monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), nanobodies, and antibody or antigen-binding fragments) as long as they exhibit the desired antigen-binding activity. In this specification, “anti-LDLR antibody” refers to an antibody (as used in its broadest sense above) that blocks the interaction between LDL and LDLR.

[0032] The terms “composition” or “preparation” refer to a preparation in which the biological activity of the active ingredients contained herein is effective, and which does not contain additional ingredients that are unacceptably toxic to the subject to which the composition is administered.

[0033] The term “pharmaceutically acceptable carrier” or “pharmaceutically acceptable vehicle” refers to any diluent, adjuvant, excipient, or combination thereof in a pharmaceutical composition that facilitates the administration of the active ingredient contained therein. Non-limiting examples of substances that can generally function as pharmaceutically acceptable carriers include oils, glycols, polyols (e.g., glycerin, sorbitol, mannitol, and polyethylene glycol), esters, agar, buffers, water, isotonic salines, Ringer’s solution, ethyl alcohol, pH buffer solutions, and other non-toxic, suitable materials used in pharmaceutical preparations. Such carriers or vehicles must be non-toxic and must not interfere with the efficacy of the active ingredient. pharmaceutically acceptable carriers are well known and will be adapted by those skilled in the art depending on the nature, route, and manner of administration.

[0034] As used herein, “treatment” (and variations thereof, e.g., “to treat” or “to treat”) means the administration or application of a therapeutic agent to the disease or disorder of interest, including suppressing the disease or the onset of the disease (e.g., if the subject has a genotype that makes it likely to develop the disease, this may be done before or after the disease is formally diagnosed), preventing the onset of the disease, alleviating one or more symptoms of the disease, curing the disease, or preventing the recurrence of one or more symptoms of the disease. As used herein, “treatment” includes the administration of a therapeutic agent or treatment regimen (e.g., any adjuvant or preconditioning regimen) to achieve a therapeutic or preventive benefit. As used herein, “treatment” also includes “improvement,” which means any beneficial effect on a phenotype or symptom (e.g., reduction of severity, slowing or delaying its progression, stopping its progression, or partial or complete regression or elimination thereof).

[0035] "Preconditioning," "preconditioning," or "conditioning" are used interchangeably herein and refer to preparing a subject requiring non-liver payload-based gene therapy to a suitable state, which includes blocking the binding of LDL to LDL receptors in the liver prior to the subject receiving payload-based gene therapy.

[0036] As used herein, the term “administration” means the physical introduction of a drug into a subject using any of the various methods and delivery systems known to those skilled in the art. Examples of routes of administration of the drugs disclosed herein include intravenous, intramuscular, subcutaneous, intraperitoneal, spinal, or other parenteral routes of administration (e.g., by injection or infusion). As used herein, the term “parenteral administration” means any method of administration other than enteral and topical administration (usually by injection), and includes, but is not limited to, intravenous, intramuscular, intraarterial, intrathecal, lymphatic, intrafocal, intracapsular, orbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, intra-articular, subcapsular, subarachnoid, intraspinal, epidural, and intrasternal injections and infusions, as well as in vivo electroporation. In some embodiments, the drugs disclosed herein may be administered via parenteral routes (e.g., orally). Other parenteral routes include topical, cutaneous, or mucosal administration routes (e.g., intranasal, intravaginal, intrarectal, sublingual, or topical). As used herein, the term “systemic injection” refers non-exclusively to intravenous, intraperitoneal, subcutaneous, subnasal, sublingual, bronchoscopy, intravenous, intraarterial, intramuscular, intraocular, striatal, subcutaneous, intradermal, skin patch, skin patch, patch, intracerebrospinal fluid, intraportal, intracerebral, lymphatic system, intrapleural, posterior orbital, intradermal, intrasplenic, intralymphatic, etc. As used herein, “combined administration” means that multiple active ingredients are administered in sufficient time proximity to each other so that they work together. Combined administration includes administering active ingredients together in a single formulation and administering active ingredients in separate formulations in sufficient time proximity so that they work together.

[0037] As used herein, “Subject” means mammals (e.g., primates, ungulates (e.g., cattle, pigs, horses), cats, dogs, pets, or livestock). In some cases, mammals may be rabbits, pigs, horses, sheep, cattle, cats, dogs, or humans. In some embodiments, the subject is a human. In some embodiments, the subject is an adult human. In some embodiments, the subject is a young human. In some embodiments, the subject is over about 18 years of age, over about 25 years of age, or over about 35 years of age. In some embodiments, the subject is under about 18 years of age, under about 16 years of age, under about 14 years of age, under about 12 years of age, under about 10 years of age, under about 8 years of age, under about 6 years of age, under about 5 years of age, under about 4 years of age, under about 3 years of age, under about 2 years of age, under 1 year of age, or under about 6 months of age.

[0038] II. Composition This specification discloses compositions comprising one or more agents useful for blocking the binding of LDL to LDLR and / or inhibiting the uptake of LNPs into hepatocytes. In some embodiments, the composition comprises an agent that blocks the binding of LDL to LDLR and a delivery molecule for delivering the agent to the liver. In some embodiments, the composition comprises a) an agent that blocks the binding of LDL to LDLR and / or inhibits the uptake of LNPs into hepatocytes or tissues, and b) a delivery molecule for delivering the agent to the liver. In some embodiments, the composition further comprises a payload comprising a therapeutic agent optionally encapsulated within or associated with LNPs or lipoplexes.

[0039] In some embodiments, the composition can temporarily block the binding of LDL to LDLR in the liver and / or prevent the uptake of LNPs into hepatocytes or tissues (e.g., from about 48 hours to about 3 weeks). In some embodiments, the composition can permanently block the binding of LDL to LDLR in the liver and / or prevent the uptake of LNPs into hepatocytes or tissues. In some embodiments, the composition can block the binding of LDL to LDLR in the liver and / or prevent the uptake of LNPs into hepatocytes or tissues for about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, about 15 days, about 16 days, about 17 days, about 18 days, about 19 days, about 20 days, or about 21 days. In some embodiments, the composition can block the binding of LDL to LDLR in the liver and / or prevent the uptake of LNPs into hepatocytes or tissues for about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, or about 14 days. In some embodiments, the composition can block the binding of LDL to LDLR in the liver and / or prevent the uptake of LNPs into hepatocytes or tissues for about 1 to 28 days, 7 to 28 days, 14 to 28 days, 1 to 21 days, 7 to 21 days, 14 to 21 days, 1 to 14 days, 7 to 14 days, or about 1 to 7 days.

[0040] In some embodiments, the payload and LNP or lipoplex are administered during or after administration of the composition. In some embodiments, the composition can block the binding of LDL to LDLR in the liver and / or prevent the uptake of LNP into hepatocytes or tissues for extended periods (e.g., more than about 3 weeks, more than about 4 weeks, more than about 5 weeks, more than about 6 weeks, more than about 7 weeks, more than about 8 weeks, more than about 9 weeks, and more than about 10 weeks). In some embodiments, the composition can block the binding of LDL to LDLR in the liver and / or prevent the uptake of LNP into hepatocytes or tissues for extended periods (e.g., more than 10 weeks). In some embodiments, the composition can block the binding of LDL to LDLR in the liver and / or inhibit the uptake of LNP into hepatocytes or tissues for about 10–15 weeks, about 15–20 weeks, about 20–25 weeks, about 25–30 weeks, about 30–35 weeks, about 35–40 weeks, about 40–45 weeks, about 45–50 weeks, or about 50–55 weeks.

[0041] A. RNAi as a drug In some embodiments, RNA interference (RNAi) is a mechanism used by drugs to block the binding of LDL to LDLR in the liver and / or to prevent the uptake of LNPs into hepatocytes or tissues. RNA interference generally refers to sequence-specific or gene-specific repression of gene expression (protein synthesis) mediated by RNAi / siRNA in organisms, without suppressing other protein synthesis. RNAi induces RNA interference through interaction with RNA interference pathways in mammalian cells to sequence-specifically degrade or inhibit the translation of messenger RNA (mRNA) transcripts of transgenes. RNAi induced by major receptor proteins can lead to a decrease in the protein expression of the RNAi target (e.g., LDLR). RNAi can be achieved by using small interfering RNAs (siRNAs), microRNAs (miRNAs), double-stranded RNAs (dsRNAs), short hairpin RNAs (shRNAs), and expression cassettes encoding RNAs capable of inducing RNA interference.

[0042] In some embodiments, the agent that blocks the binding of LDL to LDLR and / or inhibits the uptake of LNPs into hepatocytes or tissues is a small interfering RNA (siRNA). Small interfering RNAs (siRNAs) are known for their ability to specifically inhibit protein expression at a target. siRNAs are designed to interact with a target ribonucleotide sequence, meaning they complement the target sequence to a sufficient extent to bind to it. siRNAs typically consist of 15–50 base pairs, preferably 21–25 base pairs, and encode the sequence of a target gene or RNA. siRNAs may have complete or partial identity (e.g., complementarity) with their target.

[0043] siRNAs are criticized for their transient nature due to their in vivo instability. However, in this context, the transient nature of siRNAs can be an advantage. As a result, a drug can block LDL from binding to LDLR and / or prevent the uptake of LNPs by hepatocytes or tissues only for the short time it takes for the payload and LNP or lipoplex to be delivered, thereby reducing off-target delivery of the payload to the liver.

[0044] In some embodiments, any of the agents (e.g., RNAi molecules and / or compositions disclosed herein) can temporarily block the binding of LDL to the LDL receptor (LDLR) and / or prevent the uptake of LNPs into hepatocytes or tissues (e.g., for about 48 hours to about 3 weeks). In some embodiments, the agents (e.g., RNAi molecules and / or compositions disclosed herein) can block the binding of LDL to LDLR and / or prevent the uptake of LNPs into hepatocytes or tissues for about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, about 15 days, about 16 days, about 17 days, about 18 days, about 19 days, about 20 days, or about 21 days. In some embodiments, a drug (e.g., an RNAi molecule and / or composition disclosed herein) can block the binding of LDL to LDLR and / or prevent the uptake of LNPs into hepatocytes or tissues for about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, and about 14 days. In some embodiments, a drug (e.g., an RNAi molecule and / or composition disclosed herein) can block the binding of LDL to LDLR and / or prevent the uptake of LNPs into hepatocytes or tissues for 1 to 28 days, 7 to 28 days, 14 to 28 days, 21 to 28 days, 1 to 21 days, 7 to 21 days, 14 to 21 days, 1 to 14 days, 7 to 14 days, or 1 to 7 days.

[0045] ATGAAGACCCTATTTCAGAAATACAACTATAAAAAAATAAATAAATCCTCCAGTCTGGATCGTTTGACGGGACTTCAGGTTCTTTCTGAAATCGCCGTGTTACTGTTGCACTGATGTCCGGAGAGACAGTGACAGCCTCCGTCAGACTCCCGCGTGAAGATGTCACAAGGGATTGGCAATTGTCCCCAGGGACAAAACACTGTGTCCCCCCCAGTGCAGGGAACCGTGATAAGCCTTTCTGGTTTCGGAGCACGTAAATGCGTCCCTGTACAGATAGTGGGGATTTTTTGTTATGTTTGCACTTTGTATATTGGTTGAAACTGTTATCACTTATATATATATATATACACACATATATATAAAATCTATTTATTTTTGCAAACCCTGGTTGCTGTATTTGTTCAGTGACTATTCTCGGGGCCCTGTGTAGGGGGTTATTGCCTCTGAAATGCCTCTTCTTTATGTACAAAGATTATTTGCACGAACTGGACTGTGTGCAACGCTTTTTGGGAGAATGATGTCCCCGTTGTATGTATGAGTGGCTTCTGGGAGATGGGTGTCACTTTTTAAACCACTGTATAGAAGGTTTTTGTAGCCTGAATGTCTTACTGTGATCAATTAAATTTCTTAAATGAACCAA。

[0046] In some embodiments, the drug (e.g., RNAi molecules and / or compositions disclosed herein) targets a transcript encoding an LDLR. In some embodiments, the transcript encoding an LDLR contains a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 351 and its complementary strand. In some embodiments, the drug (e.g., an RNAi molecule and / or composition disclosed herein) targets 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32 consecutive nucleotides of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of Sequence ID No. 351 or its reverse complementary sequence. In some embodiments, the drug (e.g., an RNAi molecule and / or composition disclosed herein) targets 19–32, 19–25, 19–22, or 20–21 consecutive nucleotides of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 351 or its reverse complementary sequence. GCCTGAATGTCTTACTGTGATCAATTAAATTTCTTAAATGAACCAA.

[0047] In some embodiments, the drug (e.g., RNAi molecules and / or compositions disclosed herein) targets a transcript encoding an LDLR. In some embodiments, the transcript encoding an LDLR contains a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 352 and / or its complementary strand. In some embodiments, the drug (e.g., an RNAi molecule and / or composition disclosed herein) targets 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32 consecutive nucleotides of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of Sequence ID No. 352 or its reverse complementary sequence. In some embodiments, the drug (e.g., an RNAi molecule and / or composition disclosed herein) targets 19–32, 19–25, 19–22, or 20–21 consecutive nucleotides of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 352 or its reverse complementary sequence.

[0048] In some embodiments, binding to the low-density lipoprotein receptor (LDLR) is blocked by a composition comprising an agent that blocks the binding of low-density lipoprotein (LDL) to LDLR and / or inhibits the uptake of LNP into hepatocytes or tissues. In some embodiments, the LDLR comprises an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 353. SEQ ID NO: 353: MGPWGWKLRWTVALLLAAAGTAVGDRCERNEFQCQDGKCISYKWVCDGSAECQDGSDESQETCLSVTCKSGDFSCGGRVNRCIPQFWRCDGQVDCDNGSDEQGCPPKTCSQDEFRCHDGKCISRQFVCDSDRDCLDGSDEASCPVLTCGPASFQCNSSTCIPQLWACDNDPDCEDGSDEWPQRCRGLYVFQGDSSPCSAFEFHCLSGECIHSSWRCDGGPDCKDKSDEENCAVATCRPDEFQCSDGNCIHGSRQCDREYDCKDMSDEVGCVNVTLCEGPNKFKCHSGECITLDKVCNMARDCRDWSDEPIKECGTNECLDNNGGCSHVCNDLKIGYECLCPDGFQLVAQRRCEDIDECQDPDTCSQLCVNLEGGYKCQCEEGFQLDPHTKACKAVGSIAYLFFTNRHEVRKMTLDRSEYTSLIPNLRNVVALDTEVASNRIYWSDLSQRMICSTQLDRAHGVSSYDTVISRDIQAPDGLAVDWIHSNIYWTDSVLGTVSVADTKGVKRKTLFRENGSKPRAIVVDPVHGFMYWTDWGTPAKIKKGGLNGVDIYSLVTENIQWPNGITLDLLSGRLYWVDSKLHSISSIDVNGGNRKTILEDEKRLAHPFSLAVFEDKVFWTDIINEAIFSANRLTGSDVNLLAENLLSPEDMVLFHNLTQPRGVNWCERTTLSNGGCQYLCLPAPQINPHSPKFTCACPDGMLLARDMRSCLTEAEAAVATQETSTVRLKVSSTAVRTQHTTTRPVPDTSRLPGATPGLTTVEIVTMSHQALGDVAGRGNEKKPSSVRALSIVLPIATELGLWSRGQLCDRACLSLQCSSSSFAWGSSFYGRTGGLRTSTASTLTTPSIRRPQRMRSTFATTRTATATPRDRWSVWRMTWREHLPGVPSLPRTLPETSPALFYSKTEKTKALPARALFYIFIHLGGRTGFGQCPCNGLGWDFGFFLSS。

[0049] In some embodiments, binding to the low-density lipoprotein receptor (LDLR) is blocked by a composition comprising a drug that blocks the binding of low-density lipoprotein (LDL) to LDLR and / or inhibits the uptake of LNP into hepatocytes or tissues. In some embodiments, the LDLR comprises an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 354. SEQ ID NO: 354: MGPWGWKLRWTVALLLAAAGTAVGDRCERNEFQCQDGKCISYKWVCDGSAECQDGSDESQETCLSVTCKSGDFSCGGRVNRCIPQFWRCDGQVDCDNGSDEQGCPPKTCSQDEFRCHDGKCISRQFVCDSDRDCLDGSDEASCPVLTCGPASFQCNSSTCIPQLWACDNDPDCEDGSDEWPQRCRGLYVFQGDSSPCSAFEFHCLSGECIHSSWRCDGGPDCKDKSDEENCAVATCRPDEFQCSDGNCIHGSRQCDREYDCKDMSDEVGCVNVTLCEGPNKFKCHSGECITLDKVCNMARDCRDWSDEPIKECGTNECLDNNGGCSHVCNDLKIGYECLCPDGFQLVAQRRCEDIDECQDPDTCSQLCVNLEGGYKCQCEEGFQLDPHTKACKAVGSIAYLFFTNRHEVRKMTLDRSEYTSLIPNLRNVVALDTEVASNRIYWSDLSQRMICSTQLDRAHGVSSYDTVISRDIQAPDGLAVDWIHSNIYWTDSVLGTVSVADTKGVKRKTLFRENGSKPRAIVVDPVHGFMYWTDWGTPAKIKKGGLNGVDIYSLVTENIQWPNGITLDLLSGRLYWVDSKLHSISSIDVNGGNRKTILEDEKRLAHPFSLAVFEDKVFWTDIINEAIFSANRLTGSDVNLLAENLLSPEDMVLFHNLTQPRGVNWCERTTLSNGGCQYLCLPAPQINPHSPKFTCACPDGMLLARDMRSCLTEAEAAVATQETSTVRLKVSSTAVRTQHTTTRPVPDTSRLPGATPGLTTVEIVTMSHQALGDVAGRGNEKKPSSVRALSIVLPIVLLVFLCLGVFLLWKNWRLKNINSINFDNPVYQKTTEDEVHICHNQDGYSYPSMVSLEDDVA。

[0050] In some embodiments, binding to the low-density lipoprotein receptor (LDLR) is blocked by a composition comprising a drug that blocks the binding of low-density lipoprotein (LDL) to LDLR and / or inhibits the uptake of LNP into hepatocytes or tissues. In some embodiments, the LDLR comprises an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 355. SEQ ID NO: 355: MGPWGWKLRWTVALLLAAAGTAVGDRCERNEFQCQDGKCISYKWVCDGSAECQDGSDESQETCLSVTCKSGDFSCGGRVNRCIPQFWRCDGQVDCDNGSDEQGCPPKTCSQDEFRCHDGKCISRQFVCDSDRDCLDGSDEASCPVLTCGPASFQCNSSTCIPQLWACDNDPDCEDGSDEWPQRCRGLYVFQGDSSPCSAFEFHCLSGECIHSSWRCDGGPDCKDKSDEENCAVATCRPDEFQCSDGNCIHGSRQCDREYDCKDMSDEVGCVNVTLCEGPNKFKCHSGECITLDKVCNMARDCRDWSDEPIKECGTNECLDNNGGCSHVCNDLKIGYECLCPDGFQLVAQRRCEDIDECQDPDTCSQLCVNLEGGYKCQCEEGFQLDPHTKACKAVGSIAYLFFTNRHEVRKMTLDRSEYTSLIPNLRNVVALDTEVASNRIYWSDLSQRMICSTQLDRAHGVSSYDTVISRDIQAPDGLAVDWIHSNIYWTDSVLGTVSVADTKGVKRKTLFRENGSKPRAIVVDPVHGFMYWTDWGTPAKIKKGGLNGVDIYSLVTENIQWPNGITLDLLSGRLYWVDSKLHSISSIDVNGGNRKTILEDEKRLAHPFSLAVFEDKVFWTDIINEAIFSANRLTGSDVNLLAENLLSPEDMVLFHNLTQPRGVNWCERTTLSNGGCQYLCLPAPQINPHSPKFTCACPDGMLLARDMRSCLTEAEAAVATQETSTVRLKVSSTAVRTQHTTTRPVPDTSRLPGATPGLTTVEIVTMSHQVLLVFLCLGVFLLWKNWRLKNINSINFDNPVYQKTTEDEVHICHNQDGYSYPSRQMVSLEDDVA。

[0051] In some embodiments, the drug (e.g., RNAi molecules and / or compositions disclosed herein) comprises an siRNA capable of knocking down LDLR. In some embodiments, the siRNA comprises a ribonucleotide sequence that is at least 80% identical to the ribonucleotide sequence derived from the LDLR. Preferably, the siRNA is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the target ribonucleotide sequence. In some embodiments, the siRNA is 100% identical to the target nucleotide sequence. However, siRNA molecules with insertions, deletions, or single point mutations relative to the target may also be effective. In some embodiments, the siRNA comprises a single strand. In some embodiments, the siRNA comprises a double-stranded siRNA. In some embodiments, the siRNA comprises a double-stranded siRNA comprising a sense ("passenger") strand and an antisense ("guide") strand. In some embodiments, the siRNA targets LDLR in the liver. Tools to assist in siRNA design are generally readily available and known in the art.

[0052] In some embodiments, the composition comprises an RNAi molecule having a length of 18 to 31 nucleotides. In some embodiments, the RNAi (e.g., siRNA) is 19 to 27 nucleotides long. In some embodiments, the RNAi (e.g., siRNA) is 19 to 25 nucleotides long. In some embodiments, the RNAi (e.g., siRNA) is 19 to 23 nucleotides long. In some embodiments, the RNAi (e.g., siRNA) is 19 to 21 nucleotides long. In some embodiments, the RNAi (e.g., siRNA) is 21, 25, or 31 nucleotides or less long. In some embodiments, the RNAi (e.g., siRNA) is 21 nucleotides long. In some embodiments, the RNAi is siRNA and comprises one of the sequences in Table 3A (SEQ ID NOs. 4300 to 9964). In some embodiments, the RNA is siRNA and comprises one of the sequences in SEQ ID NOs. 4300 to 4309 or 9965 to 9974. In some embodiments, the RNAi is a double-stranded siRNA containing one of the following sequence pairs: SEQ ID NOs: 4300 and 9965, 4301 and 9966, 4302 and 9967, 4303 and 9968, 4304 and 9969, 4305 and 9970, 4306 and 9971, 4307 and 9972, 4308 and 9973, or 4309 and 9974. In some embodiments, the siRNA contains exactly 19 consecutive nucleotides from either the sequence in Table 3A or 3B. In some embodiments, the siRNA contains exactly 19 consecutive nucleotides from either the sequence in either SEQ ID NOs: 4300-4309 or the sequence in either 9965-9974. In some embodiments, the RNAi is a double-stranded siRNA comprising a pair of sequences, each sequence containing exactly 19 consecutive nucleotides from any of the sequences 4300 and 9965, 4301 and 9966, 4302 and 9967, 4303 and 9968, 4304 and 9969, 4305 and 9970, 4306 and 9971, 4307 and 9972, 4308 and 9973, or 4309 and 9974. In some embodiments, the siRNA contains exactly 20 consecutive nucleotides from any of the sequences in Table 3A or 3B.In some embodiments, the siRNA contains exactly 20 consecutive nucleotides from any one of the sequences of sequence numbers 4300-4309 or 9965-9974. In some embodiments, the RNAi is a double-stranded siRNA containing a pair of sequences, each sequence containing exactly 20 consecutive nucleotides from any one of the sequences of sequence numbers 4300 and 9965, 4301 and 9966, 4302 and 9967, 4303 and 9968, 4304 and 9969, 4305 and 9970, 4306 and 9971, 4307 and 9972, 4308 and 9973, or 4309 and 9974. In some embodiments, the siRNA contains exactly 21 consecutive nucleotides from any one of the sequences in Table 3A or 3B. In some embodiments, the siRNA contains exactly 21 consecutive nucleotides from any one of the sequences of sequence numbers 4300-4309 or 9965-9974. In some embodiments, the RNAi is a double-stranded siRNA comprising a pair of sequences, each sequence containing exactly 21 consecutive nucleotides of any of the sequences SEQ ID NOs. 4300 and 9965, 4301 and 9966, 4302 and 9967, 4303 and 9968, 4304 and 9969, 4305 and 9970, 4306 and 9971, 4307 and 9972, 4308 and 9973, or 4309 and 9974. SEQ ID NOs. 4300–9964 in Table 3A reflect exemplary sequences of the sense or antisense 5' to 3' strands of the siRNA.

[0053] In some embodiments, the composition comprises an RNAi molecule (e.g., siRNA) containing 13 to 21 consecutive nucleic acids of any one nucleic acid sequence in Table 3A or 3B. In some embodiments, the RNAi (e.g., siRNA) contains 14 to 21 consecutive nucleic acids of any one nucleic acid sequence in Table 3. In some embodiments, the RNAi (e.g., siRNA) contains a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one nucleic acid sequence in Table 3A or 3B. In some embodiments, the RNAi (e.g., siRNA) contains a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of sequence numbers 4300-4309 or 9965-9974. In some embodiments, the RNAi (e.g., siRNA) comprises a sequence pair, each sequence being at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to each nucleic acid sequence in the pairs SEQ ID NOs. 4300 and 9965, 4301 and 9966, 4302 and 9967, 4303 and 9968, 4304 and 9969, 4305 and 9970, 4306 and 9971, 4307 and 9972, 4308 and 9973, or 4309 and 9974. In some embodiments, the RNAi (e.g., siRNA) comprises at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 consecutive nucleic acids of sequences that are at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of the nucleic acid sequences in Table 3A or 3B.In some embodiments, the RNAi (e.g., siRNA) comprises at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 consecutive nucleic acids of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of sequence numbers 4300-4309 or 9965-9974. In some embodiments, the RNAi (e.g., siRNA) comprises a pair of sequences, each sequence comprising at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 consecutive nucleic acids of sequences that are at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to each nucleic acid sequence of sequence 44300 and 9965, 4301 and 9966, 4302 and 9967, 4303 and 9973, or 4309 and 9974. In some embodiments, the RNAi (e.g., siRNA) comprises at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 consecutive nucleic acids with sequences identical to either one of the nucleic acid sequences in Table 3A or 3B. In some embodiments, the RNAi (e.g., siRNA) comprises at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 consecutive nucleic acids with sequences identical to either one of sequence numbers 4300-4309 or 9965-9974.In some embodiments, RNAi (e.g., siRNA) comprises a sequence pair, each sequence comprising at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 consecutive nucleic acids of the same sequence as each nucleic acid sequence in the pairs SEQ ID NOs. 4300 and 9965, 4301 and 9966, 4302 and 9967, 4303 and 9968, 4304 and 9969, 4305 and 9970, 4306 and 9971, 4307 and 9972, 4308 and 9973, or 4309 and 9974. In some embodiments, RNAi (e.g., siRNA) targets a sequence of nucleic acids 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, or 14-25 of which are at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of the nucleic acid sequences in Table 3A or 3B. In some embodiments, RNAi (e.g., siRNA) targets a sequence of nucleic acids 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 14-19, 14-20, 14-21, 14-22, 14-22, 14-23, 14-24, or 14-25 of sequences that are at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of the nucleic acid sequences of sequence numbers 4300-4309 or 9965-9974.In some embodiments, RNAi (e.g., siRNA) comprises a sequence pair, where each sequence is one of the nucleic acid sequences in the pair: SEQ ID NOs: 4300 and 9965, 4301 and 9966, 4302 and 9967, 4303 and 9968, 4304 and 9969, 4305 and 9970, 4306 and 9971, 4307 and 9972, 4308 and 9973, or 4309 and 9974. The target is a sequence of nucleic acids 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, or 14-25 that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of 14-25. In some embodiments, the RNAi (e.g., siRNA) comprises 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, or 14-25 consecutive nucleic acids of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 4300. In some embodiments, the RNAi (e.g., siRNA) comprises 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, or 14-25 consecutive nucleic acids of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 4301. In some embodiments, the RNAi (e.g., siRNA) comprises 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, or 14-25 consecutive nucleic acids of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 4302.In some embodiments, the RNAi (e.g., siRNA) comprises 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, or 14-25 consecutive nucleic acids of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 4303. In some embodiments, the RNAi (e.g., siRNA) comprises 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, or 14-25 consecutive nucleic acids of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 4304. In some embodiments, the RNAi (e.g., siRNA) comprises 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, or 14-25 consecutive nucleic acids of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 4305. In some embodiments, the RNAi (e.g., siRNA) comprises 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, or 14-25 consecutive nucleic acids of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 4306.In some embodiments, the RNAi (e.g., siRNA) comprises 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, or 14-25 consecutive nucleic acids of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 4307. In some embodiments, the RNAi (e.g., siRNA) comprises 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, or 14-25 consecutive nucleic acids of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 4308. In some embodiments, the RNAi (e.g., siRNA) comprises 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, or 14-25 consecutive nucleic acids of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 4309. In some embodiments, the RNAi (e.g., siRNA) comprises 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, or 14-25 consecutive nucleic acids of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 9965.In some embodiments, the RNAi (e.g., siRNA) comprises 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, or 14-25 consecutive nucleic acids of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 9966. In embodiments, the RNAi (e.g., siRNA) comprises 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, or 14-25 consecutive nucleic acids of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 9967. In some embodiments, the RNAi (e.g., siRNA) comprises 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, or 14-25 consecutive nucleic acids of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 9968. In some embodiments, the RNAi (e.g., siRNA) comprises 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, or 14-25 consecutive nucleic acids of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 9969. In some embodiments, the RNAi (e.g., siRNA) comprises 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, or 14-25 consecutive nucleic acids of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 9970.In some embodiments, the RNAi (e.g., siRNA) comprises 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, or 14-25 consecutive nucleic acids of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 9971. In some embodiments, the RNAi (e.g., siRNA) comprises 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, or 14-25 consecutive nucleic acids of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 9972. In some embodiments, the RNAi (e.g., siRNA) comprises 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, or 14-25 consecutive nucleic acids of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 9973. In some embodiments, the RNAi (e.g., siRNA) comprises 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, or 14-25 consecutive nucleic acids of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 9974.

[0054] In some embodiments, the transcript encoding the LDLR contains a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 350 or its complementary strand. In some embodiments, the RNAi (e.g., siRNA) targets 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32 consecutive nucleotides of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 350 or its reverse complementary sequence. In some embodiments, the RNAi (e.g., siRNA) targets 19–32, 19–25, 19–22, or 20–21 consecutive nucleotides of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of sequence number 350 or its reverse complementary sequence.

[0055] In some embodiments, the transcript encoding the LDLR contains a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 351 or its complementary strand. In some embodiments, the RNAi molecule targets 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32 consecutive nucleotides of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 351 or its reverse complementary sequence. In some embodiments, the RNAi molecule targets 19–32, 19–25, 19–22, or 20–21 consecutive nucleotides of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 351 or its reverse complementary sequence.

[0056] In some embodiments, the transcript encoding the LDLR contains a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 352 or its complementary strand. In some embodiments, the RNAi molecule targets 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32 consecutive nucleotides of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 352 or its reverse complementary sequence. In some embodiments, the RNAi molecule targets 19–32, 19–25, 19–22, or 20–21 consecutive nucleotides of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 352 or its reverse complementary sequence.

[0057] In some embodiments, the RNAi molecule is single-stranded. In some embodiments, the RNAi molecule is double-stranded. It should be noted that any nucleotide length of any RNAi molecule listed in this application refers to a single strand of the RNAi molecule, even if that single strand is part of a double-stranded RNAi molecule. For example, if an RNAi molecule is 21 nucleotides long and double-stranded (without overhangs), the molecule will contain a total of 42 nucleotides (21 nucleotides per strand). In some embodiments, the RNAi molecule is double-stranded and contains blunt ends. In some embodiments, the RNAi molecule is double-stranded and contains overhangs of one or more nucleotides. In some embodiments, only a portion of the RNAi molecule is double-stranded. For example, in some embodiments, a double-stranded RNAi molecule contains overhangs of 1, 2, 3, 4, or 5 or more nucleotides on the sense strand and / or antisense strand. In some embodiments, a double-stranded RNAi molecule contains overhangs of 1, 2, or 3 nucleotides on the sense strand and / or antisense strand. B. In some embodiments, any of the RNAi molecules (e.g., siRNAs disclosed herein) include a nucleotide sequence that shares complementarity (e.g., 100% complementarity) with the target sequence in the LDLR RNA transcript. In some embodiments, the RNAi molecule includes at least 17, 18, 19, 20, or 21 nucleotides that are complementary to the target sequence in the LDLR RNA transcript. In some embodiments, the RNAi molecule includes at least 17, 18, 19, 20, or 21 nucleotides that are complementary to the target sequence in the LDLR RNA transcript, but one or more nucleotides at the 3' end of the RNAi molecule are not complementary to the target sequence in the LDLR RNA transcript. In some embodiments, the RNAi molecule includes at least 17, 18, 19, 20, or 21 nucleotides that are complementary to the target sequence in the LDLR RNA transcript, but one or more nucleotides at the 5' end of the RNAi molecule are not complementary to the target sequence in the LDLR RNA transcript. In some embodiments, the RNAi molecule contains at least 17, 18, 19, 20, or 21 nucleotides complementary to the target sequence in the LDLR RNA transcript, but one or more nucleotides at the 3' and 5' ends of the RNAi molecule are not complementary to the target sequence in the LDLR RNA transcript. Antisense oligonucleotides as pharmaceuticals

[0058] In some embodiments, antisense oligonucleotides (ASOs) are agents used to block the binding of LDL to LDLR in the liver and / or to inhibit the uptake of LNPs into hepatocytes or tissues. ASOs may be single-stranded or double-stranded DNA or RNA, or chimeric mixtures, derivatives, or modified versions thereof. As is known in the art, for antisense oligonucleotides to sufficiently inhibit target sequences as efficiently as possible, there must be some degree of complementarity between the antisense oligonucleotide and the corresponding target sequence. Chemical modifications of ASOs are known in the art to enhance resistance to various nucleases and binding affinity to RNA targets. Phosphothioate (PS) modifications in which the unbridged oxygen in the phosphate backbone is substituted with a sulfur atom, 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (MOE) modifications, restricted ethyl (cEt) modifications, and bicyclic nucleoside modifications commonly called locked nucleic acid (LNA) modifications (e.g., 2',4'-methylene-bridged nucleic acids) are not limited examples. Therefore, in some embodiments, the antisense oligonucleotide includes a modified sequence. In some embodiments, the ASO contains MOE or LNA modification.

[0059] In some embodiments, antisense oligonucleotides are conjugated to ligands or conjugates known in the art and / or described herein, or delivered by nonviral tissue-specific delivery vehicles, which may be used, for example, to increase the intracellular uptake of antisense oligonucleotides.

[0060] In some embodiments, any of the ASOs disclosed herein are administered "naked" (i.e., without molecules intended for cell or tissue-specific delivery). For example, in some embodiments, the drug is administered "naked" in a pharmaceutically acceptable buffer (e.g., buffered saline, e.g., PBS).

[0061] In some embodiments, any of the ASOs disclosed herein is at least 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides long. In some embodiments, the length of any of the ASOs disclosed herein is 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, or 25 nucleotides or less. In some embodiments, any of the ASOs disclosed herein is 14-35, 14-30, 14-25, 14-20, 20-35, 20-30, 20-25, 25-35, or 25-30 nucleotides long.

[0062] In some embodiments, antisense oligonucleotides are administered unconjugated or without a nonviral tissue-specific delivery vehicle. In some embodiments, antisense oligonucleotides are administered without the use of a nonviral tissue-specific delivery vehicle and are administered in a composition containing a pharmaceutically acceptable carrier.

[0063] In some embodiments, the antisense oligonucleotide targets a transcript encoding an LDLR. In some embodiments, the transcript encoding the LDLR contains a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 350 and its complementary strand. In some embodiments, the transcript encoding the LDLR contains a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 351 and its complementary strand. In some embodiments, the transcript encoding the LDLR contains a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of sequence number 352 or its complementary strand.

[0064] In some embodiments, the antisense oligonucleotide targets 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32 consecutive nucleotides of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of the sequences of SEQ ID NOs: 350, 351, or 352, or its reverse complementary sequence. In some embodiments, the antisense oligonucleotide targets 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32 consecutive nucleotides of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of Sequence ID No. 350 or its reverse complementary sequence. In some embodiments, the antisense oligonucleotide targets 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32 consecutive nucleotides of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of Sequence ID No. 351 or its reverse complementary sequence. In some embodiments, the antisense oligonucleotide targets 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32 consecutive nucleotides of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of Sequence ID No. 352 or its reverse complementary sequence.

[0065] In some embodiments, the antisense oligonucleotide targets 16 to 32 consecutive nucleotides of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of the sequences of SEQ ID NO: 350, 351, or 352, or its reverse complementary sequence. In some embodiments, the antisense oligonucleotide targets 19 to 32, 19 to 25, 19 to 22, or 20 to 21 consecutive nucleotides of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 350, or its reverse complementary sequence. In some embodiments, the antisense oligonucleotide targets 19-32, 19-25, 19-22, or 20-21 consecutive nucleotides of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 351 or its reverse complementary sequence. In some embodiments, the antisense oligonucleotide targets 19-32, 19-25, 19-22, or 20-21 consecutive nucleotides of a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 352 or its reverse complementary sequence.

[0066] C. Non-RNAi drugs In some embodiments, the agents that block LDL binding to LDLR and / or inhibit or reduce the interaction between LDL and the receptor and / or prevent the uptake of LNPs into hepatocytes or tissues are small molecules, antibodies, or soluble receptors. In some embodiments, non-RNAi agents target LDLR.

[0067] D. Drug delivery In some embodiments, the composition comprises a) a drug that blocks the binding of LDL to the LDL receptor (LDLR) and / or inhibits the uptake of LNPs into hepatocytes or tissues, and b) a delivery molecule that delivers the drug to the liver. In some embodiments, the delivery molecule comprises lipid nanoparticles (LNPs), lipoplexes, adenovirus vectors, or AAVs. In some embodiments, the delivery molecule comprises an AAV, where the AAV is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh10, AAVrh74, AAV9, AAV9P, or Myo-AAV. In some embodiments, the delivery molecule comprises a lipoplex. In some embodiments, the delivery molecule comprises an LNP. In some embodiments, the LNP is hepatotropic LNP. In some embodiments, the LNP comprises LP-01. In some embodiments, the LNP comprises MC3. In some embodiments, the LNP comprises an ionizable lipid. In some embodiments, the LNP contains helper lipids (e.g., 1,2-distearoyl-sn-glycero-3-phosphorylcholine (DSPC) or N-(hexadecanoyl)-sphingo-4-enin-1-phosphocholine (egg sphingomyelin [ESM])). In some embodiments, the LNP contains PEGylated lipids. In some embodiments, the LNP contains ionizable lipids / helper lipids / cholesterol / PEG lipids in a molar ratio of 50:10:38.5:1.5, respectively. In some embodiments, LNP contains ionizable lipids / helper lipids / cholesterol / PEG lipids in molar ratios of 20:44.25:34.25:1.5 mol / mol, 30:38.5:30:1.5, 40:33:25.5:1.5, 50:27.25:21.25:1.5 mol / mol, or 55:24.5:19:1.5 mol / mol. In some embodiments, LNP contains DSPC. In some embodiments, LNP contains cholesterol. In some embodiments, LNP contains myristoyl diglycerides. In some embodiments, LNP contains PEGylated myristoyl diglycerides. In some embodiments, LNP contains DMG-PEG2000.In some embodiments, LNP comprises LP-01 (BP-26809, BroadPharm), DSPC (850365, Avanti Polar Lipids), cholesterol (C3045, Milipore Sigma), and DMG-PEG2000 (880151, Avanti Polar Lipids). In some embodiments, LNP comprises about 50% LP-01, about 39% cholesterol, about 9% DSPC, and about 2% DMG-PEG2000. In some embodiments, LNP comprises PEG-carbamoyl-1,2-dimyristyloxypropylamine, DLin-DMA, DSPC, and cholesterol in a molar ratio of 2:40:10:4. In some embodiments, LNP comprises lipidoid 98N12-5(1)4HCl, cholesterol, and mPEG2000-DMG in a molar ratio of 42:48:10. In some embodiments, the LNP comprises DLin-MC3-DMA, cholesterol, and mPEG2000-DMG in a molar ratio of 42:48:10. In some embodiments, the LNP is one of the LNPs described below: Xu et al., 2023, ACS Nano, 17, 5, 4942-4957 (the whole is incorporated herein).

[0068] In some embodiments, the delivery molecule is conjugated with a drug (e.g., RNAi, ASO, or siRNA) and functions to deliver the drug to the liver. As used herein, the “liver-targeting moiety” for enhancing delivery to and / or uptake by the liver includes, but is not limited to, any conjugate (e.g., any known conjugate) that can be applied to any drug (e.g., siRNA, ASO, or RNAi) that blocks the binding of LDL to LDLR and / or inhibits the uptake of LNPs into hepatocytes or tissues. Lipid moieties (e.g., lipid-conjugated siRNA or ASO), e.g., cholesterol-conjugated siRNA or ASO, and other conjugate groups or moieties known in the art to effectively target the liver can also be used. In some embodiments, the delivery molecule contains lipids. In some embodiments, the composition contains a lipid-conjugated drug (e.g., siRNA or ASO).

[0069] In some embodiments, the delivery molecule comprises at least one galactose or galactose derivative. In some embodiments, the composition comprises siRNA conjugated to at least one galactose or galactose derivative. The galactose or galactose derivative may target hepatocytes by binding to asialoglycoprotein receptors (ASGPr), which are specific to hepatocytes and highly expressed on the surface of hepatocytes. Binding of the galactose moiety to ASGPr facilitates the intracellular entry of the cell-specific target of the transport polymer into hepatocytes and the intracellular entry of the delivery polymer into hepatocytes. Examples of galactose or galactose derivatives include lactose, galactose, N-acetylgalactosamine (GalNAc), GalNAc-6 (doi:10.1038 / s41467-023-37465-1), galactosamine, N-formylgalactosamine, N-acetylgalactosamine, N-propionylgalactosamine, Nn-butanoylgalactosamine, and N-isobutanoylgalactosamine (Iobst, ST and Drickamer, K. JBC 1996, 271, 6686). In some embodiments, the delivery molecule comprises N-acetylgalactosamine (GalNAc). In some embodiments, the delivery molecule comprises GalNAc-6. In some embodiments, the composition comprises a GalNAc conjugate (e.g., siRNA or ASO).

[0070] As is known in the art, drugs that block the binding of LDL to LDLR and / or inhibit the uptake of LNPs into hepatocytes or tissues can be delivered by nonviral, tissue-specific delivery vehicles. In some embodiments, the delivery molecule includes nanoparticles, liposomes, ribonucleoproteins, positively charged peptides, small RNA conjugates, aptamer RNA chimeras, and RNA fusion protein complexes. In some embodiments, the delivery molecule includes lipid nanoparticles (LNPs).

[0071] LNPs refer to any particle with a diameter of 1000 nm, 500 nm, 250 nm, 200 nm, 150 nm, 100 nm, 75 nm, 50 nm, or less than 25 nm. Alternatively, the size of nanoparticles can range from 1 to 1000 nm, 1 to 500 nm, 1 to 250 nm, 25 to 200 nm, 25 to 100 nm, 35 to 75 nm, or 25 to 60 nm.

[0072] LNPs can be prepared from cationic lipids, anionic lipids, or neutral lipids. Neutral lipids (e.g., membrane-fusion phospholipid DOPE or membrane component cholesterol) may be included in LNPs as "helper lipids" to enhance transfection activity and nanoparticle stability. Limitations of cationic lipids include low efficacy due to their low stability and rapid clearance, and the occurrence of inflammatory or anti-inflammatory responses. LNPs can also consist of hydrophobic lipids, hydrophilic lipids, or both hydrophobic and hydrophilic lipids. Any lipid or combination of lipids known in the art can be used to produce LNPs. Examples of lipids used to produce LNPs include DOTMA, DOSPA, DOTAP, DMRIE, DC cholesterol, DOTAP-cholesterol, GAP-DMORIE-DPyPE, and GL67A-DOPE-DMPE-polyethylene glycol (PEG). Examples of cationic lipids include 98N12-5, C12-200, DLin-KC2-DMA(KC2), DLin-MC3-DMA(MC3), XTC, MD1, and 7C1. Examples of neutral lipids include DPSC, DPPC, POPC, DOPE, and SM. Examples of PEG-modified lipids include PEG-DMG, PEG-CerC14, and PEG-CerC20. In certain embodiments, the LNP comprises DOSPA (2,3-dioleoyloxy-N-[2(sperminecarboxamide)ethyl]-N,N-dimethyl-1-propaniminium trifluoroacetate) and DOPE (dioleoylphosphatidylethanolamine). Lipids can be combined in any molar ratio to produce the LNP. In some embodiments, the LNP comprises a 3:1 mixture of DOSPA and DOPE. Furthermore, polynucleotides can be combined with lipids in a wide range of molar ratios to produce LNPs. In some embodiments, the LNPs are "off-the-shelf" LNPs (e.g., lipofectamines).

[0073] E. Payload In some embodiments, the drug, which blocks the binding of LDL to LDLR and / or inhibits the uptake of LNPs into hepatocytes or tissues, and is delivered to the liver by a delivery molecule, further comprises a payload. In some embodiments, the payload comprises a therapeutic agent. In some embodiments, the payload is administered with LNPs or a lipoplex. In some configurations, the payload is encapsulated in lipid nanoparticles (LNPs). In some embodiments, the payload is encapsulated in a lipoplex.

[0074] In some embodiments, administering either an agent that blocks the binding of LDL to LDLR and / or inhibits the uptake of LNPs into hepatocytes or tissues increases the proportion of the payload delivered to non-liver targets. In some embodiments, administering either an agent that blocks the binding of LDL to LDLR and / or inhibits the uptake of LNPs into hepatocytes or tissues decreases the proportion of the payload delivered to the liver. Accordingly, the present invention intends to administer a single payload or multiple payloads and / or compositions having non-liver targets in optionally one or more LNPs. In certain embodiments, the agent that blocks the binding of LDL to LDLR and / or inhibits the uptake of LNPs into hepatocytes or tissues is administered separately from the payload (e.g., in another LNP).

[0075] In certain embodiments, the payload is associated with LNPs or lipoplexes. Lipid nanoparticles (LNPs) and lipoplexes are known means for delivering nucleotide and protein cargo and may be used for the delivery of payloads, guide RNAs, compositions, or pharmaceutical formulations disclosed herein. In some embodiments, LNPs or lipoplexes deliver nucleic acids, proteins, or nucleic acids and proteins together.

[0076] In some embodiments, the payload includes CRISPR-Cas components, any of which are known in the art. In some embodiments, the payload includes nucleic acids, biologics, or small molecules encoding one or more components of the CRISPR / Cas system, and optionally, the components of the CRISPR / Cas system include nucleic acids encoding one or more guide RNAs, one or more scaffolds, and / or one or more endonucleases. In some embodiments, the payload includes nucleic acids encoding the Cas9 protein. Such embodiments include, for example, nucleic acids encoding Streptococcus pyogenes (SpCas9), Staphylococcus aureus (SaCas9), and / or Staphylococcus lugdunensis (SluCas9), and further include a payload containing nucleic acids encoding one or more guide RNAs. In such embodiments, the nucleic acid encoding the Cas9 protein is under the control of the CK8e promoter. In some embodiments, the nucleic acid encoding the guide RNA sequence is under the control of the hU6c promoter. In some embodiments, in addition to the guide RNA and Cas9 sequence, one or more vectors further include nucleic acids that do not encode the guide RNA. These nucleic acids do not encode the guide RNA and Cas9 and include, but are not limited to, promoter, enhancer, and regulator sequences. In some embodiments, the payload includes crRNA, trRNA, or one or more nucleotide sequences encoding crRNA and trRNA.

[0077] In some embodiments, the muscle cell-specific promoter is a variant of the CK8 promoter and is called CK8e. In some embodiments, the size of the CK8e promoter is 436 bp. In some embodiments, the CK8e promoter contains a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 302. [ka]

[0078] In some embodiments, the promoter for the expression of any of the nucleic acids disclosed herein is the U6 promoter. In some embodiments, the U6 promoter is the hU6c promoter, which includes a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 303. GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACC.

[0079] In some embodiments, the promoter for the expression of any of the nucleic acids disclosed herein is an H1 promoter. In some embodiments, the H1 promoter includes a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 304. [ka]

[0080] In some embodiments, the promoter for the expression of any of the nucleic acids disclosed herein is the 7SK2 promoter. In some embodiments, the 7SK promoter is the 7SK2 promoter and includes a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 305. CTGCAGTATTTAGCATGCCCCACCCATCTGCAAGGCATTCTGGATAGTGTCAAAACAGCCGGAAATCAAGTCCGTTTATCTCAAACTTTAGCATTTTGGGAATAAATGATATTTGCTATGCTGGTTAAATTAGATTTTAGTTAAATTTCCTGCTGAAGCTCTAGTACGATAAGCAACTTGACCTAAGTGTAAAGTTGAGACTTCCTTCAGGTTTATATAGCTTGTGCGCCGCTTGGGTACCTC.

[0081] In some embodiments, the payload includes one or more guide RNAs. In some embodiments, the guide RNAs are chemically modified. Guide RNAs containing one or more modified nucleosides or nucleotides are referred to as “modified” guide RNAs or “chemically modified” guide RNAs to describe the presence of one or more non-natural and / or naturally occurring components or structures used in place of, or in addition to, the canonical A, G, C, and U residues. A discussion of modified guide RNAs can be found in WO2022 / 056000 (which is incorporated herein in its entirety). In some embodiments, the guide RNAs are unmodified.

[0082] In some embodiments, the payload includes multiple nucleic acids encoding multiple guide RNAs. In some embodiments, the payload includes two nucleic acids encoding two guide RNA sequences.

[0083] In some embodiments, the payload includes a nucleic acid encoding the Cas9 protein (e.g., SaCas9 or SluCas9 protein), a nucleic acid encoding a first guide RNA, and a nucleic acid encoding a second guide RNA. In some embodiments, the payload does not include nucleic acids encoding more than two guide RNAs. In some embodiments, the nucleic acid encoding the first guide RNA is the same as the nucleic acid encoding the second guide RNA. In some embodiments, the nucleic acid encoding the first guide RNA is different from the nucleic acid encoding the second guide RNA. In some embodiments, the payload includes a single nucleic acid molecule, the single nucleic acid molecule including a nucleic acid encoding the Cas9 protein, a nucleic acid encoding the first guide RNA, and a nucleic acid that is inversely complementary to the coding sequence of the second guide RNA. In some embodiments, the payload includes a single nucleic acid molecule, the single nucleic acid molecule including a nucleic acid encoding the Cas9 protein, a nucleic acid that is inversely complementary to the coding sequence of the first guide RNA, and a nucleic acid that is inversely complementary to the coding sequence of the second guide RNA. In some embodiments, the nucleic acid encoding the Cas9 protein (e.g., SaCas9 or SluCas9 protein) is under the control of the CK8e promoter. In some embodiments, the first guide is under the control of the 7SK2 promoter, and the second guide is under the control of the H1m promoter. In some embodiments, the first guide is under the control of the H1m promoter, and the second guide is under the control of the 7SK2 promoter. In some embodiments, the first guide is under the control of the hU6c promoter, and the second guide is under the control of the H1m promoter. In some embodiments, the first guide is under the control of the H1m promoter, and the second guide is under the control of the hU6c promoter.In some embodiments, the nucleic acids encoding the Cas9 protein are: a) between nucleic acids encoding guide RNAs, b) between nucleic acids that are the reverse complementary strand to the coding sequence of the guide RNA, c) between the nucleic acid encoding the first guide RNA and the nucleic acid that is the reverse complementary strand to the coding sequence of the second guide RNA, d) between the nucleic acid encoding the second guide RNA and the nucleic acid that is the reverse complementary strand to the coding sequence of the first guide RNA, e) the 5' end of the nucleic acid encoding the guide RNA, f) the 5' end of the nucleic acid that is the reverse complementary strand to the coding sequence of the guide RNA, g) the 5' end of the nucleic acid encoding one of the guide RNAs and the 5' end of the nucleic acid that is the reverse complementary strand to the coding sequence of the other guide RNA, h) the 3' end of the nucleic acid encoding the guide RNA, i) the 3' end of the nucleic acid that is the reverse complementary strand to the coding sequence of the guide RNA, or j) the 3' end of the nucleic acid encoding one of the guide RNAs and the 3' end of the nucleic acid that is the reverse complementary strand to the coding sequence of the other guide RNA.

[0084] In some embodiments, the payload includes nucleic acids encoding at least a first guide RNA and a second guide RNA. In some embodiments, the nucleic acids include a spacer coding sequence for the first guide RNA, a scaffold coding sequence for the first guide RNA, a spacer coding sequence for the second guide RNA, and a scaffold coding sequence for the second guide RNA. In some embodiments, the spacer coding sequence for the first guide RNA (e.g., encoding one of the spacer sequences disclosed herein) is identical to the spacer coding sequence for the second guide RNA. In some embodiments, the spacer coding sequence for the first guide RNA (e.g., encoding one of the spacer sequences disclosed herein) is different from the spacer coding sequence for the second guide RNA. In some embodiments, the scaffold coding sequence for the first guide RNA is identical to the scaffold coding sequence for the second guide RNA. In some embodiments, the scaffold coding sequence for the first guide RNA is different from the scaffold coding sequence of the nucleic acid encoding the second guide RNA.

[0085] In some embodiments, the payload includes, 5' to 3' relative to the plus strand, a reverse complementary sequence of a first sgRNA scaffold sequence, a reverse complementary sequence of a nucleic acid encoding a first sgRNA guide sequence, a reverse complementary sequence of a promoter for the expression of the nucleic acid encoding the first sgRNA, a promoter for the expression of the nucleic acid encoding SaCas9 (e.g., CK8e), the nucleic acid encoding SaCas9, a polyadenylated sequence, a promoter for the expression of a second sgRNA, a second sgRNA guide sequence, and a second sgRNA scaffold sequence. In some embodiments, the promoter for the expression of the nucleic acid encoding the first and / or second sgRNA is an hU6c promoter or a 7SK2 promoter. In some embodiments, the promoter for the expression of the nucleic acid encoding the second sgRNA is an H1m promoter. In some embodiments, the promoter for SaCas9 is a CK8e promoter. In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to the nucleic acid sequence encoding a nuclear localization sequence (NLS). In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to two nucleic acid sequences, each encoding a nuclear localization sequence (NLS). In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to three nucleic acid sequences, each encoding a nuclear localization sequence (NLS). In some embodiments, one or more NLSs are SV40 NLSs. In some embodiments, one or more NLSs are c-Myc NLSs. In some embodiments, the NLSs are fused to SaCas9 with a linker.

[0086] In some embodiments, the payload is directed to liver and non-liver targets. In some embodiments, the non-liver target is muscle. In such embodiments, non-liver payload-based gene therapy is used to treat DMD.

[0087] In some embodiments, the Cas protein contains an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of Sequence ID No. 320 (referred to herein as SpCas9):

[0088] In some embodiments, the nucleic acid encoding SaCas9 encodes SaCas9 having an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 306.

[0089] In some embodiments, SaCas9 contains an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of Sequence ID No. 307 (denoted herein as SaCas9-KKH or SACAS9KKH):

[0090] In some embodiments, the nucleic acid encoding SluCas9 encodes SluCas9 comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 308.

[0091] In some embodiments, the Cas protein is one of the engineered Cas proteins described below: Schmidt et al., 2021, Nature Communications, “Improved CRISPR genome editing using small highly active and specific engineered RNA-guided nucleases”.

[0092] In some embodiments, Cas9 contains an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of sequence number 309 (denoted herein as sRGN1):

[0093] In some embodiments, Cas9 contains an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of Sequence ID No. 310 (denoted herein as sRGN2):

[0094] In some embodiments, Cas9 contains an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of Sequence ID No. 311 (denoted herein as sRGN3):

[0095] In some embodiments, Cas9 contains an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of Sequence ID No. 312 (denoted herein as sRGN3.1):

[0096] In some embodiments, Cas9 contains an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of Sequence ID No. 313 (denoted herein as sRGN3.2):

[0097] In some embodiments, Cas9 contains an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of Sequence ID No. 314 (denoted herein as sRGN3.3):

[0098] In some embodiments, Cas9 contains an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of Sequence ID No. 315 (denoted herein as sRGN4):

[0099] In some embodiments, the payload includes a single-molecule guide RNA (sgRNA). The sgRNA may include, in the 5' to 3' direction, an optional spacer extension sequence, a spacer sequence, a minimal CRISPR repeat sequence, a single-molecule guide linker, a minimal tracrRNA sequence, a 3' tracrRNA sequence, and / or an optional tracrRNA extension sequence. The optional tracrRNA extension may include elements that contribute to additional functions (e.g., stability) of the guide RNA. The single-molecule guide linker can ligate the minimal CRISPR repeat and the minimal tracrRNA sequence to form a hairpin structure. The optional tracrRNA extension may include one or more hairpins. In certain embodiments, the disclosure provides an sgRNA including a spacer sequence and a tracrRNA sequence.

[0100] An exemplary scaffold sequence suitable for use with SaCas9, following the 3' end of the guide sequence, is GTTTAAGTACTCTGTGCTGGAAACAGCACAGAATCTACTTAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGGCGAGA (SEQ ID NO: 500) with 5' to 3' orientation. In some embodiments, the exemplary scaffold sequence for use with SaCas9, following the 3' end of the guide sequence, is a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 500, or a sequence that differs from SEQ ID NO: 500 by 1, 2, 3, 4, 5, 10, 15, 20, or 25 or fewer nucleotides.

[0101] In some embodiments, variants of the SaCas9 scaffold sequence may be used. In some embodiments, the SaCas9 scaffold that follows the guide sequence at its 3' end is called "SaScaffoldV1" and is GTTTTAGTACTCTGGAAACAGAATCTACTAAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGGCGAGAT (SEQ ID NO: 501) with 5' to 3' orientation. In some embodiments, exemplary scaffold sequences for use with SaCas9 that follow the 3' end of the guide sequence are sequences that are at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 910, or sequences that differ from SEQ ID NO: 910 by 1, 2, 3, 4, 5, 10, 15, 20, or 25 or fewer nucleotides.

[0102] In some embodiments, variants of the SaCas9 scaffold sequence may be used. In some embodiments, the SaCas9 scaffold that follows the guide sequence at its 3' end is called "SaScaffoldV2" and is GTTTAAGTACTCTGTGCTGGAAACAGCACAGAATCTACTTAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGGCGAGAT (SEQ ID NO: 502) with 5' to 3' orientation. In some embodiments, exemplary scaffold sequences for use with SaCas9 that follow the 3' end of the guide sequence are sequences that are at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 911, or sequences that differ from SEQ ID NO: 911 by 1, 2, 3, 4, 5, 10, 15, 20, or 25 or fewer nucleotides.

[0103] In some embodiments, variants of the SaCas9 scaffold sequence may be used. In some embodiments, the SaCas9 scaffold that follows the guide sequence at its 3' end is called "SaScaffoldV3" and is GTTTAAGTACTCTGGAAACAGAATCTACTTAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGGCGAGAT (SEQ ID NO: 503) with 5' to 3' orientation. In some embodiments, exemplary scaffold sequences for use with SaCas9, following the 3' end of the guide sequence, are sequences that are at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 912, or sequences that differ from SEQ ID NO: 912 by 1, 2, 3, 4, 5, 10, 15, 20, or 25 or fewer nucleotides.

[0104] In some embodiments, variants of the SaCas9 scaffold sequence may be used. In some embodiments, the SaCas9 scaffold that follows the guide sequence at its 3' end is called "SaScaffoldV5" and is GTTTCAGTACTCTGGAAACAGAATCTACTGAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGGCGAGAT (SEQ ID NO: 932) with 5' to 3' orientation. In some embodiments, the exemplary scaffold sequence used in SaCas9 to follow the 3' end of the guide sequence is a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 932, or a sequence that differs from SEQ ID NO: 932 by 1, 2, 3, 4, 5, 10, 15, 20, or 25 nucleotides or less.

[0105] Two exemplary scaffold sequences suitable for use with SluCas9 following the 3' end of the guide sequence are, in the 5'→3' direction, GTTTTAGTACTCTGGAAACAGAATCTACTGAAACAAGACAATATGTCGTGTTTATCCCATCAATTTATTGGTGGGAT (Sequence ID 900) and GTTTAAGTACTCTGTGCTGGAAACAGCACAGAATCTACTGAAACAAGACAATATGTCGTGTTTATCCCATCAATTTATTGGTGGGA. In some embodiments, the exemplary sequence used in SluCas9 following the 3' end of the guide sequence is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 900 or sequence number 601, or a sequence that differs from sequence number 900 or sequence number 601 by 1, 2, 3, 4, 5, 10, 15, 20, or 25 nucleotides or less.

[0106] An exemplary scaffold sequence suitable for use with SluCas9, which follows the guide sequence at its 3' end, is also shown below in 5' to 3' orientation. [Table 1-1] [Table 1-2]

[0107] In some embodiments, a scaffold sequence suitable for use with SluCas9, following the 3' end of the guide sequence, is 5' to 3 orientation and selected from any one of sequence numbers 900 or 601, or 901-917 (see below). In some embodiments, an exemplary sequence for use with SluCas9, following the 3' end of the guide sequence, is a sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 900 or 601, or any one of 901-917, or a sequence that differs from sequence number 900 or 601, or any one of 901-917 by 1, 2, 3, 4, 5, 10, 15, 20, or 25 or fewer nucleotides.

[0108] In some embodiments, a scaffold sequence suitable for use with SluCas9, following the 3' end of the guide sequence, is selected from any one of sequence numbers 901-917 in 5'-3 orientation (see below). In some embodiments, an exemplary sequence for use with SluCas9, following the 3' end of the guide sequence, is a sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of sequence numbers 901-917, or a sequence that differs from any one of sequence numbers 901-917 by 1, 2, 3, 4, 5, 10, 15, 20, or 25 or fewer nucleotides.

[0109] In some embodiments, the nucleic acid encoding gRNA or a pair of gRNAs includes a sequence containing SEQ ID NO: 900. In some embodiments, the nucleic acid encoding gRNA or a pair of gRNAs includes a sequence containing SEQ ID NO: 601. In some embodiments, the nucleic acid encoding gRNA or a pair of gRNAs includes a sequence containing SEQ ID NO: 900. In some embodiments, the nucleic acid encoding gRNA or a pair of gRNAs includes a sequence containing SEQ ID NO: 901. In some embodiments, the nucleic acid encoding gRNA or a pair of gRNAs includes a sequence containing SEQ ID NO: 902. In some embodiments, the nucleic acid encoding gRNA or a pair of gRNAs includes a sequence containing SEQ ID NO: 903. In some embodiments, the nucleic acid encoding gRNA or a pair of gRNAs includes a sequence containing SEQ ID NO: 904. In some embodiments, the nucleic acid encoding gRNA or a pair of gRNAs includes a sequence containing SEQ ID NO: 905. In some embodiments, the nucleic acid encoding gRNA or a pair of gRNAs includes a sequence containing SEQ ID NO: 906. In some embodiments, the nucleic acid encoding gRNA or a pair of gRNAs includes a sequence containing SEQ ID NO: 907. In some embodiments, the nucleic acid encoding gRNA or a pair of gRNAs includes a sequence containing SEQ ID NO: 908. In some embodiments, the nucleic acid encoding gRNA or a pair of gRNAs includes a sequence containing SEQ ID NO: 909. In some embodiments, the nucleic acid encoding gRNA or a pair of gRNAs includes a sequence containing SEQ ID NO: 910. In some embodiments, the nucleic acid encoding gRNA or a pair of gRNAs includes a sequence containing SEQ ID NO: 911. In some embodiments, the nucleic acid encoding gRNA or a pair of gRNAs includes a sequence containing SEQ ID NO: 912. In some embodiments, the nucleic acid encoding gRNA or a pair of gRNAs includes a sequence containing SEQ ID NO: 913.In some embodiments, the nucleic acid encoding a gRNA or a pair of gRNAs includes a sequence containing sequence number 914. In some embodiments, the nucleic acid encoding a gRNA or a pair of gRNAs includes a sequence containing sequence number 915. In some embodiments, the nucleic acid encoding a gRNA or a pair of gRNAs includes a sequence containing sequence number 916. In some embodiments, the nucleic acid encoding a gRNA or a pair of gRNAs includes a sequence containing sequence number 917. In some embodiments including a pair of gRNAs, one of the gRNAs includes a sequence selected from sequence number 900 or 601, or any one of 901-917. In some embodiments including a pair of gRNAs, both gRNAs include a sequence selected from sequence number 900 or 601, or any one of 901-917. In some embodiments including a pair of gRNAs, the 3' nucleotides of the gRNA guide sequences are the same. In some embodiments including a pair of gRNAs, the 3' nucleotides of the gRNA guide sequences are different.

[0110] In some embodiments, the scaffolding array includes one or more variations of stem loop 1 compared to stem loop 1 of a wild-type SluCas9 scaffolding array (e.g., a scaffolding including the array of sequence number 900) or a reference SluCas9 scaffolding array (e.g., a scaffolding including the array of sequence number 901). In some embodiments, the scaffolding array includes one or more variations of stem loop 2 compared to stem loop 2 of a wild-type SluCas9 scaffolding array (e.g., a scaffolding including the array of sequence number 900) or a reference SluCas9 scaffolding array (e.g., a scaffolding including the array of sequence number 901). In some embodiments, the scaffolding array includes one or more variations of tetraloops compared to tetraloops of a wild-type SluCas9 scaffolding array (e.g., a scaffolding including the array of sequence number 900) or a reference SluCas9 scaffolding array (e.g., a scaffolding including the array of sequence number 901). In some embodiments, the scaffolding array includes one or more variations in the repeat region compared to the repeat region of a wild-type SluCas9 scaffolding array (e.g., a scaffolding array containing sequence number 900) or a reference SluCas9 scaffolding array (e.g., a scaffolding array containing sequence number 901). In some embodiments, the scaffolding array includes one or more variations in the anti-repeat region compared to the anti-repeat region of a wild-type SluCas9 scaffolding array (e.g., a scaffolding array containing sequence number 900) or a reference SluCas9 scaffolding array (e.g., a scaffolding array containing sequence number 901). In some embodiments, the scaffolding array includes one or more variations in the linker region compared to the linker region of a wild-type SluCas9 scaffolding array (e.g., a scaffolding array containing sequence number 900) or a reference SluCas9 scaffolding array (e.g., a scaffolding array containing sequence number 901). For an explanation of the scaffolding area, see, for example, Nishimasu et al., 2015, Cell, 162:1113-1126.

[0111] When tracrRNA is used, in some embodiments, the tracrRNA includes a second complementarity domain and a proximal domain (from 5' to 3'). In the case of sgRNA, the guide sequence, together with additional nucleotides (e.g., SEQ ID NOs. 500, or 910-912 (for SaCas9), and 900 or 601, or 901-917 (for SluCas9)), forms or encodes the sgRNA. In some embodiments, the sgRNA includes at least a spacer sequence, a first complementarity domain, a ligation domain, a second complementarity domain, and a proximal domain (from 5' to 3'). The sgRNA or tracrRNA may further include a tail domain. The ligation domain may form a hairpin. For a detailed discussion and examples of crRNA and gRNA domains (e.g., second complementarity domain, ligation domain, proximal domain, and tail domain), see, for example, US2017 / 0007679.

[0112] In some embodiments, the payload comprises a nucleic acid molecule containing at least two guide RNAs, which, when expressed in vivo or otherwise, excise a portion of their exons, with the size of the excised portion being 8 to 167 nucleotides.

[0113] In some embodiments, the guide RNA includes, as an example, guide sequences disclosed in Tables 1A, 1B, and 2 below. For example, if the payload contains SaCas9, one or more guide sequences are selected from any one of SEQ ID NOs: 1-35, 1000-1078, and 3000-3069, or if the payload contains SluCas9, one or more guide sequences are selected from any one of SEQ ID NOs: 100-225, 2000-2116, and 4000-4251 (from the table below). Additional exemplary payload compositions (e.g., variations of RNP complexes (containing one or more guide RNAs including saCas9 or sluCas9, or mutant Cas9 proteins)) are disclosed elsewhere in WO2022 / 056000 and are incorporated herein by reference.

[0114] In some embodiments, the payload comprises one or more guide RNAs and a nucleic acid molecule encoding Cas9, wherein the nucleic acid molecule comprises a first nucleic acid encoding one or more guide RNAs selected from any one of sequence numbers 1-35, 1000-1078, or 3000-3069, and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9).

[0115] In some embodiments, the payload comprises one or more guide RNAs and a nucleic acid molecule encoding Cas9, wherein the nucleic acid molecule comprises a first nucleic acid encoding one or more guide RNAs selected from any one of sequence numbers 100-225, 2000-2116, or 4000-4251, and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9).

[0116] In some embodiments, the payload comprises one or more guide RNAs and a nucleic acid molecule encoding Cas9, wherein the nucleic acid molecule comprises a first nucleic acid encoding one or more guide RNAs, each containing at least 20 consecutive nucleotides of a guide RNA selected from one of sequence numbers 1-35, 1000-1078, or 3000-3069, and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9).

[0117] In some embodiments, the payload comprises one or more guide RNAs and a nucleic acid molecule encoding Cas9, wherein the nucleic acid molecule comprises a first nucleic acid encoding one or more guide RNAs, each containing at least 20 consecutive nucleotides of a guide RNA selected from any one of sequence numbers 100-225, 2000-2116, or 4000-4251, and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9).

[0118] In some embodiments, the payload comprises one or more guide RNAs and a nucleic acid molecule encoding Cas9, wherein the nucleic acid molecule comprises a first nucleic acid encoding one or more guide RNAs that are at least 90% identical to one of sequence numbers 1-35, 1000-1078, or 3000-3069, and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9).

[0119] In some embodiments, the payload comprises one or more guide RNAs and a nucleic acid molecule encoding Cas9, wherein the nucleic acid molecule comprises a first nucleic acid encoding one or more guide RNAs that are at least 90% identical to one of sequence numbers 100-225, 2000-2116, or 4000-4251, and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9).

[0120] In some embodiments, the payload comprises one or more guide RNAs and a nucleic acid molecule encoding Cas9, wherein the nucleic acid molecule is one of the following guide RNA pairs: SEQ ID NOs: 1020 and 23; 1023 and 23; 1023 and 1037; 1024 and 1055; 1025 and 23; 1025 and 1055; 1026 and 23; 1028 and 1055; 1029 and 1055; 1029 and 1037; 1031 and 1037; 1032 and 1037; 1029 and 1027; 1037 The first nucleic acid encoding a guide RNA pair, comprising a first and second guide RNA selected from any one of the following: 1048; 1037 and 1051; 1037 and 1053; 20 and 23; 1038 and 23; 21 and 23; 1040 and 23; 1042 and 1037; 1043 and 1037; 1044 and 1037; 1045 and 1037; 1046 and 1037; 24 and 1037; 1047 and 1055; or 1055 and 1022; and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9).

[0121] In some embodiments, the payload comprises one or more guide RNAs and a nucleic acid molecule encoding Cas9, wherein the nucleic acid molecule comprises a first nucleic acid encoding a guide RNA pair including a first and second guide RNA selected from any one of the following guide RNA pairs: SEQ ID NOs: 170 and 179; 172 and 179; 179 and 183; 179 and 185; 179 and 187; 179 and 188; 179 and 189; 179 and 193; 179 and 195; 179 and 196; 179 and 197; 200 and 174; or 200 and 176; and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9).

[0122] In some embodiments, the payload comprises one or more guide RNAs and a nucleic acid molecule encoding Cas9 for exon 44 targeting, the nucleic acid molecule comprising a first nucleic acid encoding a guide RNA pair including first and second guide RNAs selected from any one of the following: SEQ ID NOs: 117 and 121; 117 and 122; 120 and 121; 120 and 123; 120 and 124; 120 and 125; 122 and 126; 122 and 123; 122 and 124; 122 and 125; or 122 and 126, and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9).

[0123] In some embodiments, the payload comprises a nucleic acid molecule encoding one or more guide RNAs for exon 50 targeting and Cas9, wherein the nucleic acid molecule comprises a first nucleic acid encoding a guide RNA pair, which includes first and second guide RNAs selected from any one of the following guide RNA pairs: 155 and 156; 155 and 158; 155 and 162; 155 and 163; 162 and 157; 162 and 159; 162 and 164; 162 and 166; or 162 and 167, and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9).

[0124] In some embodiments, the payload comprises one or more guide RNAs and a nucleic acid molecule encoding Cas9 for exon 53 targeting, the nucleic acid molecule comprising a first nucleic acid encoding a guide RNA pair, which includes first and second guide RNAs selected from any one of the following guide RNA pairs: SEQ ID NOs: 211 and 223; 211 and 225; 214 and 224; 216 and 223; 216 and 225; 220 and 224; 204 and 223; 223 and 224; or 204 and 225, and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9).

[0125] In some embodiments, the payload comprises one or more guide RNAs and a nucleic acid molecule encoding Cas9 for exon 53 targeting, wherein the nucleic acid molecule comprises a first nucleic acid encoding a guide RNA pair, which includes first and second guide RNAs selected from any one of the following guide RNA pairs: SEQ ID NOs: 1068 and 32; 1069 and 32; 1070 and 1075; 1071 and 32; 29 and 1075; 1072 and 27; 1072 and 28; 1072 and 32; 1072 and 33; 1073 and 1076; 1073 and 35; 221 and 1077; 1074 and 27; 1074 and 28; 1074 and 33; 32 and 1077; 1075 and 1076; 1075 and 35; 1076 and 26; or 35 and 26, and Staphylococcus aureus It contains a second nucleic acid that encodes Cas9 (SaCas9).

[0126] In some embodiments, the payload comprises one or more guide RNAs and a nucleic acid molecule encoding Cas9, wherein the nucleic acid molecule is one of the following guide RNA pairs: SEQ ID NOs: 148 and 134; 149 and 135; 150 and 135; 131 and 136; 151 and 136; 139 and 131; 139 and 151; 140 and 131; 140 and 151; 141 and 148; 144 and 149; 144 and 150; 145 and 131; 145 and 151; 146 and 14 The first nucleic acid encoding a guide RNA pair, which includes a first and second guide RNA selected from any one of 8;134 and 148;135 and 149;135 and 150;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145;and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9).

[0127] In some embodiments, the payload comprises one or more guide RNAs and a nucleic acid molecule encoding Cas9, wherein the nucleic acid molecule is one of the following guide RNA pairs: SEQ ID NOs: 10 and 15; 10 and 16; 12 and 16; 1001 and 1005; 1001 and 15; 1001 and 16; 1003 and 1005; 16 and 1003; 12 and 1010; 12 and 1012; 12 and 1013; 10 and 1016; 1017 and 1005; 1017 and 16; 1018 and 1 The material comprises a first nucleic acid encoding a guide RNA pair, which includes first and second guide RNAs selected from any one of 6;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018; and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9).

[0128] Generally, in the case of a DNA nucleic acid construct encoding a guide RNA, the U residue may be substituted with a T residue in any of the RNA sequences described herein, and in the case of a guide RNA construct encoded in DNA, the T residue may be substituted with a U residue. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6] [Table 3-7] [Table 3-8] [Table 3-9] [Table 3-10] Table 3-11 Table 3-12 Table 3-13 Table 3-14 Table 4-1 Table 4-2 Table 4-3 Table 4-4 Table 4-5 Table 4-6 Table 4-7 Table 4-8 Table 4-9 Table 4-10 Table 4-11 Table 4-12 Table 4-13 [Table 4-14] [Table 4-15] [Table 4-16] [Table 4-17] [Table 4-18]

[0129] In some embodiments, the payload comprises a single nucleic acid molecule which comprises i) a nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9) or Staphylococcus lugdunensis (SluCas9) and at least one, at least two, or at least three guide RNAs; or ii) a nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9) or Staphylococcus lugdunensis (SluCas9) and 1 to n guide RNAs (where n is less than or equal to the maximum number of guide RNAs that can be expressed from the nucleic acid); or iii) a nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9) or Staphylococcus lugdunensis (SluCas9) and 1 to 3 guide RNAs.

[0130] In some embodiments, the payload comprises at least two nucleic acid molecules, each comprising a first nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9) or Staphylococcus lugdunensis (SluCas9), and a second nucleic acid that does not encode SaCas9 or SluCas9 and encodes one of the following: i) at least 1, at least 2, at least 3, at least 4, at least 5, or at least 6 guide RNAs; or ii) 1 to n guide RNAs (where n is less than or equal to the maximum number of guide RNAs that can be expressed from the nucleic acid); or iii) 1 to 6 guide RNAs.

[0131] In some embodiments, the payload comprises at least two nucleic acid molecules, each comprising: a first nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9) or Staphylococcus lugdunensis (SluCas9), i) at least one, at least two, or at least three guide RNAs, or ii) 1 to n guide RNAs (where n is less than or equal to the maximum number of guide RNAs that can be expressed from the nucleic acid), or iii) 1 to 3 guide RNAs; or a second nucleic acid that does not encode SaCas9 or SluCas9 (optionally, the second nucleic acid comprises any one of i) at least one, at least two, at least three, at least four, at least five, or at least six guide RNAs, or ii) 1 to n guide RNAs (where n is less than or equal to the maximum number of guide RNAs that can be expressed from the nucleic acid), or iii) 1 to 6 guide RNAs).

[0132] In some embodiments, the payload comprises at least two nucleic acid molecules, which include a first nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9) or Staphylococcus lugdunensis (SluCas9) and at least one, at least two, or at least three guide RNAs; and a second nucleic acid that does not encode SaCas9 or SluCas9 but encodes 1 to 6 guide RNAs.

[0133] In some embodiments, the payload comprises at least two nucleic acid molecules, including a first nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9) or Staphylococcus lugdunensis (SluCas9) and at least two guide RNAs (at least one guide RNA binding upstream of the sequence to be excised and at least one guide RNA binding downstream of the sequence to be excised), and a second nucleic acid that does not encode SaCas9 or SluCas9 but encodes at least one additional copy of the guide RNA encoded in the first nucleic acid. In some embodiments, the guide RNA excises a portion of the DMD gene, optionally an exon, intron, or exon / intron junction.

[0134] In some embodiments, a payload is provided comprising, consisting of, or essentially comprising at least two nucleic acid molecules, each comprising a first nucleic acid encoding first and second guide RNAs that function to excise a portion of the DMD gene, along with Staphylococcus aureus Cas9 (SaCas9) or Staphylococcus lugdunensis (SluCas9), and a second nucleic acid encoding at least two or at least three copies of the first guide RNA and at least two or at least three copies of the second guide RNA.

[0135] In some embodiments, a payload is provided comprising, consisting of, or essentially comprising one or more nucleic acid molecules encoding an endonucleases and guide RNA pairs, each guide RNA targeting a different sequence within the DMD gene, and the endonucleases and guide RNA pairs are capable of excising target sequences in DNA that are 5 to 250 nucleotides long. In some embodiments, the endonucleases are class 2, type II Cas endonucleases. In some embodiments, the class 2, type II Cas endonucleases are SpCas9, SaCas9, or SluCas9. In some embodiments, the endonucleases are not class 2, type V Cas endonucleases. In some embodiments, the excised target sequences include splice acceptor sites or splice donor sites. In some embodiments, the excised target sequences include immature stop codons in the DMD gene. In some embodiments, the excised target sequences do not include entire exons of the DMD gene. In some embodiments, none of the methods and / or ribonucleoprotein complexes disclosed herein disrupt / specifically alter the sequence of splice acceptor sites, splice donor sites, or early stop codon sites.

[0136] III. Method This specification discloses a method comprising (a) administering to a subject in need an agent that blocks the binding of LDL to low-density lipoprotein receptors (LDLRs) and / or inhibits the uptake of LNPs into hepatocytes or tissues, and simultaneously or sequentially, (b) administering to the subject an LNP or lipoplex containing a payload, wherein the agent reduces off-target delivery of the LNP or lipoplex to the liver.

[0137] This specification discloses a method for increasing the proportion of a payload delivered to a target non-hepatic target, comprising: (a) a preconditioning step of administering to a target a composition comprising an agent that blocks the binding of LDL to low-density lipoprotein receptors (LDLRs) in the liver; and (b) administering to a target LNP or lipoplex and payload.

[0138] This specification discloses a method for reducing the hepatic tropism of a payload administered to a subject by LNP or lipoplex, the method comprising (a)i) administering to a subject a composition comprising an agent that blocks the binding of low-density lipoprotein (LDL) to low-density lipoprotein receptors (LDLR) and / or inhibits the uptake of LNP into hepatocytes or tissues, and ii) a delivery molecule that delivers the agent to the liver, and subsequently (b) administering to the subject the LNP or lipoplex and payload.

[0139] In some embodiments, administration of a composition containing a drug that blocks the binding of LDL to LDLR (e.g., ASO) temporarily blocks the interaction of delivery molecules (e.g., LNP) with LDLR in the liver. In some embodiments, administration of a composition containing a drug that blocks the binding of LDL to LDLR (e.g., ASO) increases the proportion of the drug delivered to non-hepatic targets.

[0140] In some embodiments, the method involves administering a drug that blocks the binding of LDL to LDL receptors (LDLRs) and a delivery molecule that delivers the drug to the liver to induce a prolonged (e.g., longer than about three weeks) blockage of LDL binding to LDLRs. In some embodiments, the blockage of LDL binding to LDL receptors in the liver is not transient. In some embodiments, the blockage of LDL binding to LDL receptors in the liver is transient.

[0141] In some embodiments, the administration of a composition for blocking the binding of LDL to LDL receptors and / or inhibiting the uptake of LNPs into hepatocytes or tissues to a subject requiring such treatment is performed before the administration of LNPs or lipoplex and payload (for example, at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 days before the administration of LNPs or lipoplex and payload). In some embodiments, the Disclosure provides a method for administering a composition for blocking the binding of LDL to LDL receptors and / or inhibiting the uptake of LNPs into hepatocytes or tissues to a subject requiring such administration, which is performed before administering the LNPs or lipoplex and payload (e.g., 1-2, 1-3, 2-5, 4-7, 6-9, 8-11, 10-13, or 12-15 days before administering the LNPs or lipoplex and payload). In some embodiments, the Disclosure provides a method for administering a composition for blocking the binding of LDL to LDL receptors and / or inhibiting the uptake of LNPs into hepatocytes or tissues to a subject requiring such administration, which is performed before administering the LNPs or lipoplex and payload (e.g., at least 2-21 days, at least 2-3 days, at least 3-5 days, at least 7-14 days, at least 10-14 days, or at least 14-21 days before administering the LNPs or lipoplex and payload). In some embodiments, prior to the administration of the payload, the subject is administered multiple doses (e.g., two, three, or four) of a drug that blocks the binding of LDL to LDLR and / or inhibits the uptake of LNP into hepatocytes or tissues. In some embodiments, the administration of a composition for blocking the binding of LDL to the LDL receptor and / or inhibiting the uptake of LNP into hepatocytes or tissues is performed immediately before the administration of the LNP or lipoplex and the payload.In some embodiments, a composition for blocking the binding of LDL to the LDL receptor and / or inhibiting the uptake of LNPs into hepatocytes or tissues is administered in combination with LNPs or lipoplex and payload. In some embodiments, a composition containing an agent that blocks the binding of LDL to the LDL receptor (LDLR) and / or inhibits the uptake of LNPs into hepatocytes or tissues is administered simultaneously with LNPs or lipoplex and payload. In some embodiments, a composition containing an agent that blocks the binding of LDL to the LDL receptor (LDLR) and / or inhibits the uptake of LNPs into hepatocytes or tissues is administered sequentially with LNPs or lipoplex and payload.

[0142] In some embodiments, a composition that blocks the binding of LDL to the LDL receptor (LDLR) and / or inhibits the uptake of LNPs into hepatocytes or tissues comprises RNAi (e.g., siRNA or ASO). In some embodiments, a composition that blocks the binding of LDL to the LDL receptor (LDLR) and / or inhibits the uptake of LNPs into hepatocytes or tissues comprises antisense oligonucleotides (ASO). In some embodiments, a composition that blocks the binding of LDL to the LDL receptor (LDLR) and / or inhibits the uptake of LNPs into hepatocytes or tissues comprises siRNA. In some embodiments, a composition that blocks the binding of LDL to the LDL receptor (LDLR) and / or inhibits the uptake of LNPs into hepatocytes or tissues comprises non-RNAi (e.g., small molecules, antibodies, soluble receptors, or non-antibody inhibitors).

[0143] This method results in the non-liver payload being more efficiently transported to its intended target by reducing its direct homing to the liver.

[0144] In some embodiments, the drug, delivered systemically or topically, is delivered to induce a transient gene expression knockdown effect of approximately 50%, 60%, 70%, or 80% over approximately 24 to 48 hours, or more than 10 days. After the drug is administered and transient knockdown of LDLR is induced, non-hepatic payload-based therapy can be performed.

[0145] In some embodiments, the method involves administering an agent capable of temporarily blocking the binding of LDL to the LDL receptor and / or inhibiting the uptake of LNPs into hepatocytes or tissues (e.g., for about 48 hours to 3 weeks). In some embodiments, RNAi molecules (e.g., either siRNA or ASO disclosed herein) and / or compositions are capable of blocking the binding of LDL to LDLR and / or inhibiting the uptake of LNPs into hepatocytes or tissues for about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 days. In some embodiments, RNAi molecules (e.g., either siRNA or ASO disclosed herein) and / or compositions can block the binding of LDL to LDLR and / or prevent the uptake of LNPs into hepatocytes or tissues for about 7, 8, 9, 10, 11, 12, 13, and 14 days. In some embodiments, a drug (e.g., an RNAi molecule and / or composition disclosed herein) can block the binding of LDL to the LDL receptor in the liver and / or prevent the uptake of LNPs into hepatocytes or tissues for 1 to 28 days, 2 to 28 days, 3 to 28 days, 7 to 28 days, 10 to 28 days, 14 to 28 days, 1 to 21 days, 2 to 21 days, 3 to 21 days, 7 to 21 days, 10 to 21 days, 14 to 21 days, 1 to 14 days, 2 to 14 days, 3 to 14 days, 7 to 14 days, 1 to 10 days, 2 to 10 days, 3 to 10 days, 7 to 10 days, 1 to 7 days, 2 to 7 days, 3 to 7 days, 1 to 4 days, 1 to 3 days, or for about 24 to about 48 hours.

[0146] In some embodiments, the drug (e.g., RNAi molecules and / or compositions disclosed herein) knocks down an LDLR and contains a ribonucleotide sequence that is at least 80% identical to the ribonucleotide sequence from the LDLR. Preferably, the drug is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the target ribonucleotide sequence or its complementary sequence. In some embodiments, the drug is 100% identical to the nucleotide sequence of the target sequence or its complementary strand. However, RNAi drugs with insertions, deletions, or single point mutations to the target may also be effective. Tools to assist in siRNA design are generally readily available and known in the art.

[0147] In some embodiments, subjects are administered an amount of the drug that knocks down the level of LDLR in the liver by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% compared to a control subject that has not received the drug. In some embodiments, subjects are administered an amount of the drug that knocks down the level of LDLR in the liver by 80-100%, 80-95%, 10-90%, 10-70%, 10-50%, 10-30%, 30-90%, 30-70%, 30-50%, 50-90%, 50-70%, or 70-90% compared to a control subject that has not received the drug.

[0148] In some embodiments, the target is administered a dose of the drug that knocks down the level of LDLR in the liver for 1 to 28 days, 2 to 28 days, 3 to 28 days, 7 to 28 days, 10 to 28 days, 14 to 28 days, 1 to 21 days, 2 to 21 days, 3 to 21 days, 7 to 21 days, 10 to 21 days, 14 to 21 days, 1 to 14 days, 2 to 14 days, 3 to 14 days, 7 to 14 days, 1 to 10 days, 2 to 10 days, 3 to 10 days, 7 to 10 days, 1 to 7 days, 2 to 7 days, 3 to 7 days, 1 to 4 days, 1 to 3 days, or over a period of approximately 24 to 48 hours.

[0149] In some embodiments, subjects are administered an amount of ASO or siRNA that knocks down the level of LDLR in the liver by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% compared to a control subject that has not been administered ASO or siRNA. In some embodiments, subjects are administered an amount of ASO that knocks down the level of LDLR in the liver by 80-100%, 80-95%, 10-90%, 10-70%, 10-50%, 10-30%, 30-90%, 30-70%, 30-50%, 50-90%, 50-70%, or 70-90% compared to a control subject that has not been administered ASO or siRNA.

[0150] In some embodiments, subjects are administered an amount of ASO or siRNA that knocks down the level of LDLR in the liver for 1–28 days, 2–28 days, 3–28 days, 7–28 days, 10–28 days, 14–28 days, 1–21 days, 2–21 days, 3–21 days, 7–21 days, 10–21 days, 14–21 days, 1–14 days, 2–14 days, 3–14 days, 7–14 days, 1–10 days, 2–10 days, 3–10 days, 7–10 days, 1–7 days, 2–7 days, 3–7 days, 1–4 days, 1–3 days, or over a period of approximately 24 to 48 hours. In some embodiments, subjects are administered an amount of ASO or siRNA that knocks down the level of LDLR in the liver for 1–14 days, 2–14 days, 3–14 days, 7–14 days, 1–10 days, 2–10 days, 3–10 days, 7–10 days, 1–7 days, 2–7 days, 3–7 days, 1–4 days, 1–3 days, or approximately 24 to approximately 48 hours.

[0151] In some embodiments, the method involves administering a drug in a delivery molecule (e.g., either siRNA or ASO as disclosed herein). In some embodiments, the delivery molecule is a lipid nanoparticle (LNP), lipoplex, adenovirus vector, or AAV, and optionally, the AAV is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh10, AAVrh74, AAV9, AAV9P, or Myo-AAV. In some embodiments, the method enhances delivery to and / or uptake by the liver. In some embodiments, the method involves administering lipid-conjugated siRNA (e.g., cholesterol-conjugated siRNA). In some embodiments, the method includes administering siRNA conjugated to at least one galactose or galactose derivative (e.g., but not limited to lactose, galactose, N-acetylgalactosamine (GalNAc), GalNAc-6 (doi:10.1038 / s41467-023-37465-1), galactosamine, N-formylgalactosamine, N-acetylgalactosamine, N-propionylgalactosamine, Nn-butanoylgalactosamine, and N-isobutanoylgalactosamine (Iobst, ST and Drickamer, K. JBC 1996, 271, 6686)). In some embodiments, the method includes administering GalNAc-conjugated siRNA. In some embodiments, the method includes administering GalNAc-6-conjugated siRNA.

[0152] In some embodiments, the method involves administering a composition comprising siRNA delivered by a nonviral tissue-specific delivery vehicle (e.g., nanoparticles, liposomes, ribonucleoproteins, positively charged peptides, small RNA conjugates, aptamer-RNA chimeras, and RNA fusion protein complexes).

[0153] Exemplary modes of administration of compositions for blocking the binding of LDL to LDL receptors in the liver (e.g., conjugated siRNA or siRNA-LNP delivery systems) include oral administration, parenteral administration, injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intraventricular (ICV), etc.), and any other preferred modes of administration. In some embodiments, the administration of agents (e.g., siRNA) and compositions for blocking the binding of LDL to LDL receptors in the liver includes intraocular administration (e.g., intravitreous, intraretinal, subretinal, sub-Tenon's capsule, periorbital and posterior orbital, transcorneal, and transscleral administration). In some embodiments, siRNA may be administered to a patient by intravenous injection, subcutaneous injection, oral delivery, liposome delivery, or intranasal delivery. The siRNA may then accumulate in the patient's target body system, organ, tissue, or cell type.

[0154] In some embodiments, other drugs that promote increased uptake of the drug (e.g., siRNA) in the liver may also be administered in combination with the drug (e.g., siRNA) conjugated to a liver target region. In some embodiments, the method involves administering a cholesterol conjugate (e.g., siRNA) in combination with a statin to block the binding of LDL to LDLR in the liver. In some embodiments, the statin may be administered in combination with a cholesterol drug to enhance the uptake of the cholesterol conjugate in the liver. For a general consideration of administering statins in combination with cholesterol siRNA to increase the expression of LDL receptors on the surface of hepatocytes in the liver, see US20150361432A1. As a result of increased LDL receptor expression, plasma cholesterol levels decrease. While we do not wish to be bound by theory, administration of statins may reduce the level of competitive cholesterol in the plasma, increase the level of LDL receptors that bind to the cholesterol drug in the liver, and enable more efficient uptake of the cholesterol labeling agent by hepatocytes. Statins may be administered before, concurrently with, or after the administration of the cholesterol drug.

[0155] In some embodiments, the method involves administering an LNP or lipoplex containing a payload (including any of the payloads described herein) to a subject. In some embodiments, the payload targets tissues other than the liver. In some embodiments, the method involves administering a composition to a subject that blocks the binding of LDL to the LDL receptor (LDLR) and / or inhibits the uptake of LNPs into hepatocytes or tissues, either as part of a preconditioning treatment before the administration of the payload. In some embodiments, the payload is a nucleic acid, biologic, or small molecule encoding a component of the CRISPR / Cas system or one or more components thereof, and optionally, the components of the CRISPR / Cas system include one or more guide RNAs, one or more scaffolds, and / or one or more endonucleases. In some embodiments, the payload is for gene therapy induced in non-hepatic target tissues. In some embodiments, the composition for blocking the binding of LDL to the LDL receptor in the liver and / or inhibiting the uptake of LNPs into hepatocytes or tissues is administered to the subject at least once before the administration of a payload induced in a non-hepatic target tissue. In some embodiments, compositions for blocking the binding of LDL to LDL receptors in the liver and / or inhibiting the uptake of LNPs into hepatocytes or tissues are administered to the subject at least once prior to payload-based gene therapy as part of a preconditioning regimen that may include the administration of other drugs.

[0156] In some embodiments, the administered payload comprises nucleic acids, biologics, or small molecules encoding components of the CRISPR / Cas system or one or more of those components, and optionally, the components of the CRISPR / Cas system include nucleic acids encoding guide RNA and / or endonucleases for gene editing. Non-liver payload-based gene therapy involves treating or preventing a target disease or disorder (e.g., a genetic disorder or disorder) that is not a liver disease or disorder and requires it. In some embodiments, the payload targets the brain; central nervous system; spinal cord; eye; retina; bone, cardiac muscle, skeletal muscle, and / or smooth muscle; lung; pancreas; heart; and / or kidney. In some embodiments, the payload is for cardiac muscle, skeletal muscle, and / or smooth muscle.

[0157] In certain embodiments, the administered payload is contained within lipid nanoparticles (LNPs). In some embodiments, the LNPs target the brain; spinal cord; eye; retina; bone; cardiac muscle, skeletal muscle, and / or smooth muscle; lung; pancreas; heart; and / or kidney. In some embodiments, the LNPs target cardiac muscle, skeletal muscle, and / or smooth muscle.

[0158] In some embodiments, the method increases the proportion of payload delivered to non-liver targets. In some embodiments, the method increases the payload in a non-liver target (e.g., brain, spinal cord, eye, retina, bone, cardiac muscle, skeletal muscle, and / or smooth muscle, lung, pancreas, heart, and / or kidney) of a subject administered a drug that blocks the binding of LDL to LDL receptors (LDLR) in the liver and / or inhibits the uptake of LNPs into hepatocytes or tissues, and the subsequent payload, by at least 10%, 30%, 50%, 75%, 100%, 125%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 600%, 700%, 800%, 900%, or 1000% compared to a payload in the corresponding tissue of a control subject that was administered a payload but was not administered a drug that blocks the binding of LDL to LDL receptors (LDLR) in the liver and / or inhibits the uptake of LNPs into hepatocytes or tissues. In some embodiments, the method increases the payload in a non-liver target (e.g., brain, central nervous system, spinal cord, eye, retina, bone, cardiac muscle, skeletal muscle, smooth muscle, lung, pancreas, heart, and / or kidney) of a subject administered a drug that blocks the binding of LDL to the LDL receptor (LDLR) in the liver and / or inhibits the uptake of LNPs into hepatocytes or tissues, and the subsequent payload, by 10-50%, 50-100%, 100-250%, 250-500%, 500-750%, 750-1000%, or 1000-2000% compared to a payload in the corresponding tissue of a control subject that was administered a payload but was not administered a drug that blocks the binding of LDL to the LDL receptor (LDLR) in the liver and / or inhibits the uptake of LNPs into hepatocytes or tissues.

[0159] In some embodiments, the method increases the intramuscular payload of subjects administered with a drug that blocks the binding of LDL to LDL receptors (LDLRs) in the liver and / or inhibits the uptake of LNPs into hepatocytes or tissues, and subsequently the payload, by at least 10%, 30%, 50%, 75%, 100%, 125%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 600%, 700%, 800%, 900%, or 1000%, compared to intramuscular payloads of control subjects that were administered the payload but not the drug. In some embodiments, the method involves administering a drug that blocks the binding of hepatic LDL to LDL receptors (LDLRs) compared to a payload in the muscle of a control subject that was administered a payload but not the drug, and subsequently increasing the payload in the skeletal muscle of the payload-administered subject by 10–50%, 50–100%, 100–250%, 250–500%, 500–750%, 750–1000%, or 1000–2000%.

[0160] In some embodiments, non-liver payload-based therapies are used to treat hereditary diseases or disorders in which the disorder is a muscular disease or disorder. Muscular diseases or disorders may be selected from, for example, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), Emery-Dreyfus muscular dystrophy, myotonic dystrophy, limb-girdle muscular dystrophy, oculopharyngeal muscular dystrophy, congenital dystrophy, and familial periodic paralysis. In some embodiments, the muscular disease or disorder may be mitochondrial oxidative phosphorylation disorders or glycogen storage diseases (e.g., von Gierke disease, Pompe disease, Forbes-Coli disease, Andersen disease, McArdle disease, Haas disease, Tarui disease, or Fanconi-Bickel syndrome). In certain embodiments, non-liver payload-based gene therapy is used to treat DMD. In some embodiments, non-liver payload-based therapies are used to treat myotonic dystrophy.

[0161] In some embodiments, the method comprises administering a single or multiple payloads having a non-liver target. In some embodiments, payload-based therapy comprises administering CRISPR-Cas components, any of which are known in the art. In some embodiments, the method comprises administering one or more payloads containing nucleic acids encoding the Cas9 protein. Such embodiments include, for example, one or more nucleic acids encoding Staphylococcus aureus (SaCas9) and / or Staphylococcus lugdunensis (SluCas9), and further include nucleic acids encoding one or more guide RNAs. In such embodiments, the nucleic acid encoding the Cas9 protein is under the control of the CK8e promoter. In some embodiments, the nucleic acid encoding the guide RNA sequence is under the control of the hU6c promoter. In some embodiments, in addition to the guide RNA and the Cas9 sequence, the payload further includes nucleic acids that do not encode the guide RNA. In some embodiments, the payload vector includes one or more nucleotide sequences encoding crRNA, trRNA, or crRNA and trRNA. A discussion of various payload compositions useful for this method (including exemplary guide RNAs, promoters, and specific spacer sequences) is disclosed in WO2022 / 056000 and elsewhere in this specification.

[0162] In certain embodiments, the non-liver target is muscle, and the method includes administering a payload to the subject after administering an agent to the subject that blocks the binding of LDL to the LDL receptor (LDLR) in the liver and / or inhibits the uptake of LNPs into hepatocytes or tissues. In certain embodiments, the method includes administering a muscle-targeting payload after a preconditioning step which includes administering a composition to the subject that blocks the binding of LDL to the LDL receptor (LDLR) in the liver and / or inhibits the uptake of LNPs into hepatocytes or tissues, the preconditioning step which increases the proportion of the payload delivered to non-liver targets. In certain embodiments, a non-liver payload-based gene therapy is used to treat DMD. In such embodiments, the guide RNA includes, in non-limiting examples, the guide sequences disclosed in Tables 1A, 1B, and 2. For example, if the payload contains SaCas9, one or more spacer sequences are selected from any of the sequence numbers 1-35, 1000-1078, and 3000-3069, or if the payload vector contains SluCas9, one or more spacer sequences are selected from any of the sequence numbers 100-225, 2000-2116, and 4000-4251.

[0163] In some embodiments, the method further includes administering a payload containing molecules to enhance the tropism to target host cells or tissues. The uptake of the payload by vascular endothelial cells and other target cell types can be further enhanced by using a payload containing one or more molecules to further enhance the vector's tropism to specific target host cells. In some embodiments, the one or more molecules to enhance tropism are proteins. In some embodiments, the one or more molecules to enhance the tropism of the viral vector are peptides. In some embodiments, the one or more peptides target the viral vector to proteins that are upregulated in cells associated with a specific genetic disease or disorder to be treated. Such peptides and proteins are known in the art to enhance tropism to target host cells and can be incorporated into the payload by any of the various methods known in the art.

[0164] Exemplary modes of administration for non-hepatic payload-based gene therapy include oral, rectal, transmucosal, topical, transdermal, inhalation, parenteral (e.g., intravenous, subcutaneous, intradermal, intramuscular, and intra-articular), and direct tissue or organ injection, or intrathecal, direct intramuscular, intraventricular, intraperitoneal, intranasal, or intraocular injection. Injectable preparations can be prepared in conventional forms as liquid solutions or suspensions, solid forms suitable for dissolution or suspension in liquid before injection, or emulsions. Alternatively, the virus may be administered topically, for example, as a depot or sustained-release formulation.

[0165] In some embodiments, the subjects are human subjects. In some embodiments, the subjects are being treated for a genetic disorder or disorder that is not a liver disease or disorder. In some embodiments, the subjects are being treated for a muscle disease or disorder. In some embodiments, the subjects are being treated or are undergoing treatment with a non-liver payload-based gene therapy. [Examples]

[0166] The following embodiments are provided to illustrate specific embodiments disclosed and should not be construed as limiting the scope of this disclosure.

[0167] 1. Example 1: Study on the effects of LDLR mRNA knockdown in hepatocytes To evaluate the knockdown effect of anti-LDLRsiRNA in hepatocytes, hepatocyte models were transfected with LDLR-targeting siRNA (anti-LDLRsiRNA). Cells were lysed for mRNA and protein extraction, and subsequently, qRT-PCR (mRNA) analysis was performed to assess the degree of LDLR mRNA knockdown.

[0168] a) Dose response (CRO) Hepa1-6 cells were seeded at a density of 20,000 cells per well in 96-well tissue culture plates. Cells were immediately transfected with siRNA targeting mmLDLR (Musmusculus low-density lipoprotein receptor, gene ID: 16835) at 10 different doses using Lipofectamine 2000 (Invitrogen 11668027). A Quantigene 2.0 branched DNA (bDNA) probe set for the target mRNA was designed. Relative mmLDLR / mmGAPDH ratios were normalized to the mean ratios of mock-treated cells, and cells were transfected with control siRNA.

[0169] Figures 1A–1J show the effect of siRNA concentration on relative mRNA expression and present 10-point dose-response curves for each of the 10 evaluated siRNA sequences listed in Table 3A (each double-stranded siRNA shown contains an amino acid sequence pair of SEQ ID NOs: 4300 and 9965 [Figure 1A], 4301 and 9966 [Figure 1B], 4302 and 9967 [Figure 1C], 4303 and 9968 [Figure 1D], 4304 and 9969 [Figure 1E], 4305 and 9970 [Figure 1F], 4306 and 9971 [Figure 1G], 4307 and 9972 [Figure 1H], 4308 and 9973 [Figure 1I], or 4309 and 9974 [Figure 1J]). The best-performing mmLDLR-targeted siRNA was used in subsequent studies.

[0170] b) Screening of siRNA candidates for LDLR in Hepa1-6 cells Hepa1-6 cells were seeded at a rate of 15,000 cells per well in 96-well tissue culture plates and cultured for 48 hours in DMEM growth medium supplemented with 10% FBS and PenStrep. The following day, cells were treated with 2.5 nM (left column of modalities in Figure 2) or 50 nM (right column of modalities in Figure 2) siRNA mixed with Opti-MEM (GIBCO, 31985062), combined with a mixture of Lipofectamine RNAiMAx transfection reagent (Invitrogen, 13778150), and incubated at room temperature for 15 minutes according to the manufacturer's instructions. Untreated cells were left until the medium was changed.

[0171] 48 hours after administration, cells were frozen at -80°C and then lysed using the lysis buffer from the Cells-to-CT1-step TaqMan Kit (Invitrogen A25603). qPCR was performed on a Quantstudio6flex using the master mix from the Cells-to-CT1-step TaqMan Kit (Invitrogen A25603). Following the user manual, 20 µl of the reaction was performed for each RNA sample in technical 3 or 4 replicates. 2 µl of lysis solution was added to each reaction, and Taqman probes (Mus muscus): LDLR: FAM Mm01151337_m1 and Act-B: VICMm02619580_g1 were used. Delta-Delta Ct analysis was performed to examine the multiplicative changes compared to the untreated control sample.

[0172] Figure 2 shows the amount of relative multiplicative change in LDLR expression, normalized by scrambled averaging from the same concentration. In vivo studies to determine the dynamics of LDLR knockdown

[0173] 2. Example 2: Liver with GalNAc-conjugated siRNA or siRNA-LNP To evaluate the effect of anti-LDLR siRNA administration on hepatic LDLR knockdown in a mouse model, wild-type mice were preconditioned with either siRNA targeting LDLR containing GalNAc (anti-LDLR) (siRNA-GalNAc) or siRNA-LNP targeting the liver.

[0174] A single dose of siRNA-LNP or siRNA-GalNAc targeting LDLR was administered subcutaneously (siRNA-GalNAc) or intravenously (siRNA-LNP) at a dose of 20 mg / kg for siRNA-GalNAc and 3 mg / kg for siRNA-LNP. Mice were euthanized 1, 2, 3, 5, or 7 days after injection for sample analysis.

[0175] As described below, levels of LDL receptor (LDLR) protein in the liver were evaluated using the ProteinSimple "Jess" capillary gel electrophoresis system and relative RT-qPCR measurement of LDLR mRNA. LDL cholesterol levels were measured using the Fujifilm Wako colorimetric kit. Representative images of Jess blots of selected samples and recombinant LDLR proteins from day 1 are shown in Figure 5A.

[0176] a) LNP preparations The composition (moles) of the LNP lipids was 50% LP-01 (BP-26809, BroadPharm), 9% DSPC (850365, Avanti Polar Lipids), 39% cholesterol (C3045, Milpore Sigma), and 2% DMG-PEG2000 (880151, Avanti Polar Lipids) as ionizable lipids. A double-stranded siRNA containing a sense sequence with sequence number 4306 and an antisense sequence with sequence number 9971 was introduced as cargo.

[0177] b) Formulation An siRNA solution in 50 mM citrate buffer (pH 4.5 buffer) (aqueous phase) and a lipid mixture in ethanol (lipid phase) were introduced into a microfluidic mixing device (Ignite, NanoAssembler, Precision Nanosystems), and the mixture was mixed in a 3:1 ratio (RNA to lipid) at a total flow rate of 12 mL / min. LNPs were collected, allowed to mature at 4°C for 30 minutes, dialyzed with 50 mM Tris buffer (pH 7.5), concentrated, and frozen at -80°C with 100 mM sucrose.

[0178] c) LDLR mRNA knockdown Mouse liver tissue prepared as described above was frozen at -80°C at the corresponding time point. RNA was extracted from the tissue using the homogenization and lysis buffer of the Cells-to-CT1-step TaqMan Kit (Invitrogen A25603). qPCR was performed on Quantstudio 6 flex using the master mix of the Cells-to-CT1-step TaqMan Kit (Invitrogen A25603). Three technical replicates of 20 µl reaction were performed for each RNA sample according to the user manual. 2 µl of lysis solution was added to each reaction, and Taqman probes targeting LDL-rMm01151337_m1LDLR and B-actin (housekeeping gene): Mm02619580_g1 were used. Delta-Delta Ct analysis was performed to examine the multiplicative changes compared to the untreated control sample.

[0179] The results are shown in Figure 4.

[0180] d) LDLR protein knockdown The LDLR levels in the protein lysates derived from mouse liver tissue, prepared as described above, were quantified using a capillary Western blotting system, an automated plate-based, transfer-free system.

[0181] Briefly, a BeadRuptor bead mill homogenizer was used to extract proteins from frozen tissue (10 - 20 mg), which was then immersed in 10% SDS buffer supplemented with HALT protease inhibitor (1 mM EDTA (pH 8), 100 mM NaCl, 62.5 mM Tris (pH 6.5), 10% SDS, 10% glycerol, and water), and three homogenization cycles were performed at 6 m / s for 20 seconds. According to the manufacturer's recommendation, a BCA protein concentration kit (Thermofisher, 23225) was used to measure the concentration of the extracted protein lysate. After measuring the protein concentration, samples were prepared for the Jess Abby & Wes separation module (「Jess」) according to the manufacturer's protocol of SM-W001. The lysate was diluted to 0.5 mg / mL with 0.1× sample buffer and mixed with fluorescent master mix to a final concentration of 0.4 mg / mL. Next, 3 μL (total protein 1.2 μg) of each sample was added to the plate per well. Biotinylated molecular weight ladder (12 - 230 kDa), antibodies, and total protein detection reagents were prepared and pipetted onto the plate according to the protocol, and then the plate was placed into Jess. LDLR was detected using a commercially available primary antibody (Abcam ab30532) diluted 1:25 and a compatible ProteinSimple secondary antibody (anti-rabbit HRP, ProteinSimple, 042-206) at a ready-to-use dilution. Recombinant mouse LDLR protein was used as a substitute for the two QC level assay controls (R&D Systems, 2255-LD) at 750 ng / mL and 375 ng / mL.

[0182] Voltage was applied to induce separation based on protein migration and molecular weight, followed by detection of total protein by primary / secondary antibodies and electrochemiluminescence (ECL). The area under the curve (AUC) of the LDLR signal for all samples was normalized by the AUC of the total protein AUC. Next, the LDLR signal in the test substance-administered group was normalized by the mean LDLR signal in the vehicle-treated group.

[0183] The results are shown in Figs. 5A - B. Compared with PBS, siRNA - LNP results in a sustained knockdown of LDLR protein by day 7.

[0184] e) Blood cholesterol biomarker Briefly, into each well of a 96 - well microplate (if necessary), add 210 μL of Reagent 1 (993 - 00404, FUJIFILM Wako Chemicals), 2.4 μL of sample (fresh blood collected from the tail vein), calibrator (990 - 28011, FUJIFILM Wako Chemicals), or blank (0.9% saline), mix and incubate at 37 °C for 5 minutes, and measure the absorbance at a wavelength of 600 nm (microplate reader). Subsequently, add 70 μL of Reagent 2 (993 - 00504, FUJIFILM Wako Chemicals), incubate at 37 °C for 5 minutes, and measure the second absorbance at 600 nm. The LDL - c concentration in the sample is calculated by comparison with the results of the calibrator and normalized by the average PBS value of untreated animals at a given time point.

[0185] The results are shown in Fig. 6.

[0186] 3. Example 3: In vivo dose - range study As shown in Fig. 8, the efficacy of LDLR KD will be evaluated in 6 - to 8 - week - old wild - type (WT) mice for dose selection. The liver - targeted siRNA - LNP will be administered as a single dose in the range of 0.1 - 25 mg / kg, and the mice will be euthanized 4 - 48 hours after injection for sample analysis.

[0187] The level of LDL receptor (LDLR) protein in the liver will be assessed using the ProteinSimple "Jess" capillary gel electrophoresis system, and the mRNA expression level of LDLR in the liver will be assessed using RT-qPCR. Blood LDL cholesterol levels will be measured using colorimetric absorbance measurement with FUJIFILM Wako Chemicals USA, Corp.

[0188] The graph representation of the research is shown in Figure 7.

[0189] 4. Example 4: In vivo dynamics study In vivo studies will be conducted to investigate the dynamics of LDLR protein knockdown. The dynamics of LDLR KD will be evaluated in 6-8 week old wild-type (WT) mice. A single dose of LNP containing LDLR-targeted cargo will be administered at a dose selected from the dose range used in the in vivo studies described in Example 3 above, and the mice will be euthanized for sample analysis 4 hours to 10 days after injection.

[0190] The level of LDL receptor (LDLR) protein in the liver will be assessed using the ProteinSimple "Jess" capillary gel electrophoresis system, and the mRNA expression level of LDLR in the liver will be assessed using RT-qPCR. Blood LDL cholesterol levels will be measured using colorimetric absorbance measurement with FUJIFILM Wako Chemicals USA, Corp.

[0191] The graph representation of the research is shown in Figure 8.

[0192] 5. Example 5: Proof of Concept Study In short, as described in Example 3 above, wild-type (WT) mice were administered hepatotropic LNPs containing a cargo targeting LDLR (dosage and ROA were determined from in vivo studies of the dose range), and then therapeutic LNPs were administered at a time based on the most efficient LDLR knockdown time determined from in vivo kinetic studies as described in Example 4 above.

[0193] Animals will be euthanized 4 hours to 10 days after administration of therapeutic LNPs for tissue panel collection and analysis of the in vivo distribution of LDLR KD and therapeutic LNPs. Control animals will be administered PBS instead of hepatotropic LNPs containing cargo targeting LDLR and / or therapeutic LNPs, and will be killed at a predetermined time.

[0194] The graph representation of the research is shown in Figure 9.

[0195] This description and exemplary embodiments should not be construed as limiting. For the purposes of this specification and the appended claims, unless otherwise indicated, all digits representing quantities, percentages, or proportions, and other digits used herein and in the claims, should be understood in all cases as being "about" unless they are already modified by the term. Thus, unless otherwise explicitly stated, the digit parameters described below in this specification and the appended claims are approximations and may vary depending on the desired characteristic sought to be obtained. At least, without attempting to limit the application of the doctrine of equivalents to the claims, each digit parameter should be interpreted by applying ordinary rounding techniques, taking into account at least the reported number of significant figures.

[0196] As used in this specification and the appended claims, it is noted that the singular forms “a,” “an,” “the,” and the use of the singular form of any word include plural referents unless explicitly and specifically limited to one referent. As used herein, the term “comprising” and its grammatical variations are intended to be non-limiting, such that the listing of items in a list does not exclude other similar items that may be substituted or added in place of the listed items.

[0197] In Table 3A, the components of specific siRNA sequences are described using the following designations. These bases and modifications are to be construed as non-limiting. Capital letters (e.g., A, U, C, G) represent RNA bases. Lowercase letters (e.g., a, u, c, g) represent 2’O-methyl RNA bases. Letters beginning with “d” (“d_”) represent DNA bases. Letters beginning with “s” (“s_”) represent phosphorothioate linkages. [Table 5] [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4] [Table 6-5] [Table 6-6] [Table 6-7] [Table 6-8] [Table 6-9] Table 6-10 Table 6-11 Table 6-12 Table 6-13 Table 6-14 Table 6-15 Table 6-16 Table 6-17 Table 6-18 Table 6-19 Table 6-20 Table 6-21 Table 6-22 Table 6-23 Table 6-24 Table 6-25 Table 6-26 Table 6-27 Table 6-28 Table 6-29 Table 6-30 Table 6-31 Table 6-32 Table 6-33 Table 6-34 Table 6-35 Table 6-36 Table 6-37 Table 6-38 Table 6-39 Table 6-40 Table 6-41 Table 6-42 Table 6-43 Table 6-44 Table 6-45 Table 6-46 Table 6-47 Table 6-48 Table 6-49 Table 6-50 Table 6-51 Table 6-52 Table 6-53 Table 6-54 Table 6-55 Table 6-56 Table 6-57 Table 6-58 Table 6-59 Table 6-60 Table 6-61 Table 6-62 Table 6-63 Table 6-64 Table 6-65 Table 6-66 Table 6-67 Table 6-68 Table 6-69 Table 6-70 Table 6-71 Table 6-72 Table 6-73 Table 6-74 Table 6-75 Table 6-76 Table 6-77 Table 6-78 Table 6-79 Table 6-80 Table 6-81 Table 6-82 Table 6-83 Table 6-84 Table 6-85 Table 6-86 Table 6-87 Table 6-88 Table 6-89 Table 6-90 Table 6-91 Table 6-92 Table 6-93 Table 6-94 Table 6-95 Table 6-96 Table 6-97 Table 6-98 Table 6-99 Table 6-100 Table 6-101 Table 6-102 Table 6-103 Table 6-104 Table 6-105 Table 6-106 Table 6-107 Table 6-108 Table 6-109 Table 6-110 Table 6-111 Table 6-112 Table 6-113 Table 6-114 Table 6-115 Table 6-116 Table 6-117 Table 6-118 Table 6-119 Table 6-120 Table 6-121 Table 6-122 Table 6-123 Table 6-124 Table 6-125 Table 6-126 Table 6-127 Table 6-128 Table 6-129 Table 6-130 Table 6-131 Table 6-132 Table 6-133 Table 6-134 Table 6-135 Table 6-136 Table 6-137 Table 6-138 Table 6-139 Table 6-140 Table 6-141 Table 6-142 Table 6-143 Table 6-144 Table 6-145 Table 6-146 Table 6-147 Table 6-148 Table 6-149 Table 6-150 Table 6-151 Table 6-152 Table 6-153

Claims

1. A composition comprising a drug that blocks the binding of low-density lipoprotein (LDL) to low-density lipoprotein receptors (LDLRs) and a delivery molecule, wherein the delivery molecule is capable of delivering the drug to the liver.

2. Furthermore, the composition according to claim 1, comprising a payload.

3. The composition according to claim 2, wherein the payload comprises a therapeutic agent.

4. The composition according to claim 2 or 3, wherein the payload comprises a component of the CRISPR / Cas system or a nucleic acid, biologic, or small molecule encoding one or more components of the CRISPR / Cas system, and optionally, the component of the CRISPR / Cas system comprises a nucleic acid encoding one or more guide RNAs, one or more scaffolds, and / or one or more endonucleases.

5. Furthermore, the composition according to any one of claims 2 to 4, comprising lipid nanoparticles (LNPs) or lipoplex, wherein the LNPs or lipoplex encapsulate the payload.

6. The composition according to any one of claims 1 to 5, wherein the delivery molecule comprises lipid nanoparticles (LNPs) or lipoplex.

7. The composition according to claim 6, wherein the delivery molecule comprises an LNP containing LP-01, cholesterol, DSPC, and / or DMG-PEG2000.

8. The composition according to claim 7, wherein the LNP comprises about 50% LP-01, about 39% cholesterol, about 9% DSPC, and about 2% DMG-PEG2000.

9. The composition according to any one of claims 1 to 8, wherein the delivery molecule comprises one or more of the following: lactose, galactose, N-acetylgalactosamine (GalNAc), GalNAc-6, galactosamine, N-formylgalactosamine, N-acetylgalactosamine, N-propionylgalactosamine, N-butanoylgalactosamine, N-isobutanoylgalactosamine, and cholesterol, or derivatives thereof.

10. The composition according to claim 9, wherein the delivery molecule comprises N-acetylgalactosamine (GalNAc).

11. The composition according to claim 10, wherein the delivery molecule comprises GalNAc-6.

12. The composition according to any one of claims 1 to 11, wherein the drug comprises RNAi.

13. The composition according to claim 12, wherein the RNAi is a small interfering RNA (siRNA), an antisense oligonucleotide (ASO), a microRNA (miRNA), a double-stranded RNA (dsRNA), a short hairpin RNA (shRNA), or an expression cassette encoding RNA.

14. The composition according to claim 12, wherein the drug comprises siRNA.

15. The composition according to claim 14, wherein the siRNA is bound to a nucleic acid containing any one nucleotide sequence of sequence numbers 350 to 352, or its reverse complementary sequence.

16. The composition according to claim 14, wherein the siRNA comprises at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 consecutive nucleic acids of any one of the nucleic acid sequences in Table 3B.

17. The composition according to claim 14, wherein the siRNA is at least 80%, at least 85%, at least 90%, or at least 95% identical to any one of the nucleic acid sequences in Table 3B.

18. The composition according to claim 12, wherein the agent comprises an antisense oligonucleotide (ASO).

19. The composition according to any one of claims 1 to 18, wherein the LDLR contains an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of the sequences of sequence numbers 353 to 355.

20. The composition according to claim 4, wherein the components of the CRISPR / Cas system include one or more guide RNAs and nucleic acids encoding Cas9, and the nucleic acid molecule comprises the following: a. A first nucleic acid encoding one or more guide RNAs selected from any one of sequence numbers 1-35, 1000-1078, or 3000-3069, and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9); or b. A first nucleic acid encoding one or more guide RNAs selected from any one of sequence numbers 100-225, 2000-2116, or 4000-4251, and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9); or c. A first nucleic acid encoding one or more guide RNAs, each containing at least 20 consecutive nucleotides of a guide RNA selected from any one of sequence numbers 1-35, 1000-1078, or 3000-3069, and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9); or d. A first nucleic acid encoding one or more guide RNAs, each containing at least 20 consecutive nucleotides of a guide RNA selected from any one of sequence numbers 100-225, 2000-2116, or 4000-4251, and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9); or e. A first nucleic acid encoding one or more guide RNAs that are at least 90% identical to one of sequence numbers 1-35, 1000-1078, or 3000-3069, and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9); or f. A first nucleic acid encoding one or more guide RNAs that are at least 90% identical to one of sequence numbers 100-225, 2000-2116, or 4000-4251, and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9); or g. The following guide RNA pairs: SEQ ID NOs: 1020 and 23; 1023 and 23; 1023 and 1037; 1024 and 1055; 1025 and 23; 1025 and 1055; 1026 and 23; 1028 and 1055; 1029 and 1055; 1029 and 1037; 1031 and 1037; 1032 and 1037; 101029 and 1027; 1037 and 1048; 1037 and 1051; 1037 and 1053 A first nucleic acid encoding a guide RNA pair, comprising a first and second guide RNA selected from any one of the following: 20 and 23; 1038 and 23; 21 and 23; 1040 and 23; 1042 and 1037; 1043 and 1037; 1044 and 1037; 1045 and 1037; 1046 and 1037; 24 and 1037; 1047 and 1055; or 1055 and 1022; and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9); or h. A first nucleic acid encoding a guide RNA pair, comprising a first and second guide RNA selected from any one of the following guide RNA pairs: SEQ ID NOs: 1170 and 179; 172 and 179; 179 and 183; 179 and 185; 179 and 187; 179 and 188; 179 and 189; 179 and 193; 179 and 195; 179 and 196; 179 and 197; 200 and 174; or 200 and 176; and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9). i. For exon 44 targeting, the following guide RNA pairs: a first nucleic acid encoding a guide RNA pair comprising first and second guide RNAs selected from any one of the following: SEQ ID NOs: 117 and 121; 117 and 122; 120 and 121; 120 and 123; 120 and 124; 120 and 125; 120 and 125; 122 and 126; and a second nucleic acid encoding Staphylococcus lucdunensis (SluCas9), j. For exon 50 targeting, a first nucleic acid encoding a guide RNA pair comprising a first and second guide RNA selected from any one of the following: 155 and 156; 155 and 158; 155 and 162; 155 and 163; 162 and 157; 162 and 159; 162 and 164; 162 and 166; or 162 and 167; and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9). k. For exon 53 targeting, the following guide RNA pairs: a first nucleic acid encoding a guide RNA pair comprising first and second guide RNAs selected from any one of the following: SEQ ID NOs: 211 and 223; 211 and 225; 214 and 224; 216 and 223; 216 and 225; 220 and 224; 204 and 223; 223 and 224; or 204 and 225; and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9). l. For exon 53 targeting, a first nucleic acid encoding a guide RNA pair comprising first and second guide RNAs selected from any one of the following: SEQ ID NOs: 1068 and 32; 1069 and 32; 1070 and 1075; 1071 and 32; 29 and 1075; 1072 and 27; 1072 and 28; 1072 and 32; 1072 and 33; 1073 and 1076; 1073 and 35; 221 and 1077; 1074 and 27; 1074 and 28; 1074 and 33; 32 and 1077; 1075 and 1076; 1075 and 35; 1076 and 26; or 35 and 26; and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9), m. The following guide RNA pairs: SEQ ID NOs: 148 and 134; 149 and 135; 150 and 135; 131 and 136; 151 and 136; 139 and 131; 139 and 151; 140 and 131; 140 and 151; 141 and 148; 144 and 149; 144 and 150; 145 and 131; 145 and 151; 146 and 148; 134 and 148; 135 and 149; 135 and 150 A first nucleic acid encoding a guide RNA pair, comprising a first and second guide RNA selected from any one of the following: 136 and 131; 136 and 151; 131 and 139; 151 and 139; 131 and 140; 151 and 140; 148 and 141; 149 and 144; 150 and 144; 131 and 145; 151 and 145; and 148 and 146; and a second nucleic acid encoding Staphylococcus lugdunensis (SaCas9); or n. The following guide RNA pairs: SEQ ID NOs: 10 and 15; 10 and 16; 12 and 16; 1001 and 1005; 1001 and 15; 1001 and 16; 1003 and 1005; 16 and 1003; 12 and 1010; 12 and 1012; 12 and 1013; 10 and 1016; 1017 and 1005; 1017 and 16; 1018 and 16; 15 and 10; 16 and 10; 16 and 12; 1005 and A first nucleic acid encoding a guide RNA pair, comprising a first and second guide RNA selected from any one of the following: 1001; 15 and 1001; 16 and 1001; 1005 and 1003; 1003 and 16; 1010 and 12; 1012 and 12; 1013 and 12; 1016 and 10; 1005 and 1017; 16 and 1017; and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9).

21. The method comprises (a) administering to a subject requiring the method an agent that blocks the binding of LDL to low-density lipoprotein receptors (LDLRs), and simultaneously or subsequently, (b) administering to the subject an LNP or lipoplex containing a payload, wherein the agent reduces off-target delivery of the LNP or lipoplex to the liver.

22. A method for increasing the proportion of a payload delivered to a non-hepatic target of a subject, comprising: (a) a preconditioning step of administering to the subject a composition comprising an agent that blocks the binding of LDL to low-density lipoprotein receptors (LDLRs) in the liver; and (b) administering to the subject LNP or lipoplex and a payload.

23. The method according to any one of claims 21 to 22, wherein step (a) comprises administering the composition according to any one of claims 1, 6 to 20 to the subject.

24. A method for reducing the hepatic tropism of a payload administered with LNP or lipoplex to a subject, comprising: (a) administering to the subject a composition according to any one of claims 1 and 6 to 20; and (b) administering to the subject LNP or lipoplex and the payload.

25. The method according to any one of claims 21 to 24, wherein the subject is administered a composition comprising a drug that blocks the binding of LDL to low-density lipoprotein receptors (LDLRs) in the liver, thereby temporarily blocking the interaction of the delivery molecule with the LDLRs in the liver.

26. The method according to any one of claims 21 to 25, wherein the composition and / or agent that blocks the binding of LDL to low-density lipoprotein receptors (LDLRs) in the liver is administered to the subject about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 21, or about 21 days before the administration of the LNP or lipoplex and payload.

27. The method according to any one of claims 21 to 25, wherein the composition and / or agent that blocks the binding of LDL to low-density lipoprotein receptors (LDLRs) in the liver is administered to the subject about 1, 2, 3, 4, 5, 6, or 7 days before the administration of the LNP or lipoplex and payload.

28. The method according to any one of claims 21 to 25, wherein the composition and / or agent that blocks the binding of LDL to low-density lipoprotein receptors (LDLRs) in the liver is administered to the subject about 8, 9, 10, 11, 12, 13, or 14 days before the administration of the LNP or lipoplex and payload.

29. The method according to any one of claims 21 to 25, wherein the composition according to any one of claims 1 and 6 to 20 is administered to the subject immediately before the administration of the LNP or lipoplex and payload.

30. The method according to any one of claims 21 to 25, wherein the composition according to any one of claims 1 and 6 to 20, and the LNP or lipoplex and payload are administered in combination.

31. The method according to any one of claims 21 to 30, wherein the delivery molecule is lipid nanoparticles (LNPs).

32. The method according to any one of claims 21 to 31, wherein the payload is a nucleic acid, biologic, or small molecule encoding a component of the CRISPR / Cas system or one or more components thereof, and optionally, the component of the CRISPR / Cas system comprises one or more guide RNAs, one or more scaffolds, and / or nucleic acids encoding one or more endonucleases.

33. The method according to claim 32, wherein the components of the CRISPR / Cas system include one or more guide RNAs and nucleic acids encoding Cas9, and the nucleic acid molecule includes the following: a. A first nucleic acid encoding one or more guide RNAs selected from any one of sequence numbers 1-35, 1000-1078, or 3000-3069, and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9); or b. A first nucleic acid encoding one or more guide RNAs selected from any one of sequence numbers 100-225, 2000-2116, or 4000-4251, and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9); or c. A first nucleic acid encoding one or more guide RNAs, each containing at least 20 consecutive nucleotides of a guide RNA selected from any one of sequence numbers 1-35, 1000-1078, or 3000-3069, and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9); or d. A first nucleic acid encoding one or more guide RNAs, each containing at least 20 consecutive nucleotides of a guide RNA selected from any one of sequence numbers 100-225, 2000-2116, or 4000-4251, and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9); or e. A first nucleic acid encoding one or more guide RNAs that are at least 90% identical to one of sequence numbers 1-35, 1000-1078, or 3000-3069, and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9); or f. A first nucleic acid encoding one or more guide RNAs that are at least 90% identical to one of sequence numbers 100-225, 2000-2116, or 4000-4251, and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9); or g. The following guide RNA pairs: SEQ ID NOs: 1020 and 23; 1023 and 23; 1023 and 1037; 1024 and 1055; 1025 and 23; 1025 and 1055; 1026 and 23; 1028 and 1055; 1029 and 1055; 1029 and 1037; 1031 and 1037; 1032 and 1037; 101029 and 1027; 1037 and 1048; 1037 and 1051; 1037 and 1053 A first nucleic acid encoding a guide RNA pair, comprising a first and second guide RNA selected from any one of the following: 20 and 23; 1038 and 23; 21 and 23; 1040 and 23; 1042 and 1037; 1043 and 1037; 1044 and 1037; 1045 and 1037; 1046 and 1037; 24 and 1037; 1047 and 1055; or 1055 and 1022; and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9); or h. A first nucleic acid encoding a guide RNA pair, comprising a first and second guide RNA selected from any one of the following guide RNA pairs: SEQ ID NOs: 1170 and 179; 172 and 179; 179 and 183; 179 and 185; 179 and 187; 179 and 188; 179 and 189; 179 and 193; 179 and 195; 179 and 196; 179 and 197; 200 and 174; or 200 and 176; and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9). i. For exon 44 targeting, the following guide RNA pairs: a first nucleic acid encoding a guide RNA pair comprising first and second guide RNAs selected from any one of the following: SEQ ID NOs: 117 and 121; 117 and 122; 120 and 121; 120 and 123; 120 and 124; 120 and 125; 120 and 125; 122 and 126; and a second nucleic acid encoding Staphylococcus lucdunensis (SluCas9), j. For exon 50 targeting, a first nucleic acid encoding a guide RNA pair comprising a first and second guide RNA selected from any one of the following: 155 and 156; 155 and 158; 155 and 162; 155 and 163; 162 and 157; 162 and 159; 162 and 164; 162 and 166; or 162 and 167; and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9). k. For exon 53 targeting, the following guide RNA pairs: a first nucleic acid encoding a guide RNA pair comprising first and second guide RNAs selected from any one of the following: SEQ ID NOs: 211 and 223; 211 and 225; 214 and 224; 216 and 223; 216 and 225; 220 and 224; 204 and 223; 223 and 224; or 204 and 225; and a second nucleic acid encoding Staphylococcus lugdunensis (SluCas9). l. For exon 53 targeting, a first nucleic acid encoding a guide RNA pair comprising first and second guide RNAs selected from any one of the following: SEQ ID NOs: 1068 and 32; 1069 and 32; 1070 and 1075; 1071 and 32; 29 and 1075; 1072 and 27; 1072 and 28; 1072 and 32; 1072 and 33; 1073 and 1076; 1073 and 35; 221 and 1077; 1074 and 27; 1074 and 28; 1074 and 33; 32 and 1077; 1075 and 1076; 1075 and 35; 1076 and 26; or 35 and 26; and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9), m. The following guide RNA pairs: SEQ ID NOs: 148 and 134; 149 and 135; 150 and 135; 131 and 136; 151 and 136; 139 and 131; 139 and 151; 140 and 131; 140 and 151; 141 and 148; 144 and 149; 144 and 150; 145 and 131; 145 and 151; 146 and 148; 134 and 148; 135 and 149; 135 and 150 A first nucleic acid encoding a guide RNA pair, comprising a first and second guide RNA selected from any one of the following: 136 and 131; 136 and 151; 131 and 139; 151 and 139; 131 and 140; 151 and 140; 148 and 141; 149 and 144; 150 and 144; 131 and 145; 151 and 145; and 148 and 146; and a second nucleic acid encoding Staphylococcus lugdunensis (SaCas9); or n. The following guide RNA pairs: SEQ ID NOs: 10 and 15; 10 and 16; 12 and 16; 1001 and 1005; 1001 and 15; 1001 and 16; 1003 and 1005; 16 and 1003; 12 and 1010; 12 and 1012; 12 and 1013; 10 and 1016; 1017 and 1005; 1017 and 16; 1018 and 16; 15 and 10; 16 and 10; 16 and 12; 1005 and A first nucleic acid encoding a guide RNA pair, comprising a first and second guide RNA selected from any one of the following: 1001; 15 and 1001; 16 and 1001; 1005 and 1003; 1003 and 16; 1010 and 12; 1012 and 12; 1013 and 12; 1016 and 10; 1005 and 1017; 16 and 1017; and a second nucleic acid encoding Staphylococcus aureus Cas9 (SaCas9).

34. The method according to any one of claims 21 to 33, wherein the payload is encapsulated within lipid nanoparticles (LNPs).

35. The method according to any one of claims 21 to 34, wherein the method comprises co-administering another drug that promotes increased uptake of the drug in the liver.

36. The method according to any one of claims 21 to 35, wherein the blocking of LDL binding to low-density lipoprotein receptors (LDLRs) in the liver in step (a) is not transient.

37. The method according to any one of claims 21 to 36, wherein the payload is located within the LNP, and the LNP targets the brain, spinal cord, eye, retina, bone, cardiac muscle, skeletal muscle, smooth muscle, lung, pancreas, heart, and / or kidney.

38. The method according to any one of claims 21 to 37, wherein administering the composition in step (a) increases the proportion of the payload delivered to non-liver targets.

39. The method according to any one of claims 21 to 38, wherein the method increases the payload in a non-liver target by at least 10%, 30%, 50%, 75%, 100%, 125%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 600%, 700%, 800%, 900%, or 1000% compared to the payload in the corresponding tissue of a control subject that was administered the payload but was not administered the agent that blocks the binding of LDL to low-density lipoprotein receptors (LDLRs) in the liver.

40. The method according to claim 39, wherein the method increases the payload in skeletal muscle by at least 10%, 30%, 50%, 75%, 100%, 125%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 600%, 700%, 800%, 900%, or 1000% compared to the corresponding payload in muscle of a control subject that was administered the payload but was not administered the agent that blocks the binding of LDL to low-density lipoprotein receptors (LDLRs) in the liver.

41. The method according to any one of claims 21 to 40, wherein the drug comprises RNAi.

42. The method according to claim 41, wherein the RNAi is a small interfering RNA (siRNA), an antisense oligonucleotide (ASO), a microRNA (miRNA), a double-stranded RNA (dsRNA), a short hairpin RNA (shRNA), or an expression cassette encoding RNA.

43. The method according to any one of claims 21 to 40, wherein the drug comprises siRNA.

44. The method according to claim 43, wherein the siRNA binds to a nucleic acid containing any one nucleotide sequence of sequence numbers 350 to 352, or its reverse complementary sequence.

45. The method according to claim 43, wherein the siRNA comprises at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 consecutive nucleic acids of any one of the nucleic acid sequences in Table 3B.

46. The method according to claim 43, wherein the siRNA is at least 80%, at least 85%, at least 90%, or at least 95% identical to any one of the nucleic acid sequences in Table 3B.

47. The method according to any one of claims 21 to 40, wherein the agent comprises an antisense oligonucleotide (ASO).

48. The method according to any one of claims 21 to 47, wherein the subject is a human subject.

49. The method according to any one of claims 21 to 48, wherein the drug is administered intravenously or subcutaneously.

50. A composition comprising siRNA containing a nucleotide sequence selected from SEQ ID NOs: 4310-9964 or 9975-15629.

Images