Virus-like particles containing a circular mRNA expression system and method of use thereof

Abstract

The present invention relates to virus-like particles (VLPs). A virus-like particle comprises a circular RNA molecule comprising a first ligation sequence; an internal ribosome entry site (IRES) coupled to an RNA molecule encoding one or more peptides, wherein the internal ribosome entry site (IRES) coupled to the RNA molecule encoding one or more peptides is located at 3' of the first ligation sequence; and a plurality of one or more proteins that can self-assemble into nanoparticles. Compositions and methods for producing and using such virus-like particles are also disclosed. TIFF2026519817000069.tif153128

Description

[Technical Field]

[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 506,997, filed on 8 June 2023, which is incorporated herein by reference in its entirety.

[0002] This invention was made with government support under 1F31NS125945-04 granted by the National Institute of Neurological Disorders and Stroke in the United States. The government has certain rights to this invention.

[0003] field The present invention relates to virus-like particles containing a circular mRNA expression system and to a method for using the same. [Background technology]

[0004] background All mRNA therapeutics have a limited duration of expression due to the relatively short half-life of mRNA in the cytoplasm. This problem can be mitigated by synthesizing in vitro synthesized mRNA as circular mRNA (Wesselhoeft et al., “Engineering Circular RNA for Potent and Stable Translation in Eukaryotic Cells,” Nat. Commun. 9:2629 (2018) (Non-patent Literature 1)). Circular mRNA is synthesized by enzymatic methods or by ligating the 3' and 5' ends using permuted self-splicing introns (Qu et al., “Circular RNA Vaccines against SARS-CoV-2 and Emerging Variants,” Cell 185:1728-1744.e16 (2022) (Non-Patent Literature 2); Puttaraju et al., “Group I Permuted Intron-Exon (PIE) Sequences Self-Splice to Produce Circular Exons,” Nucleic Acids Res. 20:5357-5364 (1992) (Non-Patent Literature 3); and Obi et al., “The Design and Synthesis of Circular RNAs,” Methods 196:85-103 (2021) (Non-Patent Literature 4). Because circular mRNA lacks a 5' cap, it utilizes an internal ribosome entry site (IRES) to recruit the translation mechanism (Chen & Sarnow, “Initiation of Protein Synthesis by the Eukaryotic Translational Apparatus on Circular RNAs,” Science 268:415-417 (1995) (Non-patent Literature 5).Circular RNAs are known to be very stable (Cocquerelle et al., “Mis-Splicing Yields Circular RNA Molecules,” Faseb J 7:155-160 (1993) (Non-Patent Literature 6) and Jeck et al., “Circular RNAs are Abundant, Conserved, and Associated with ALU Repeats,” RNA 19:141-157 (2013) (Non-Patent Literature 7)), because they cannot be degraded by exonucleases (Ibrahim et al., “RNA Recognition by 3'-to-5' Exonucleases: The Substrate Perspective,” Biochim Biophys Acta 1779:256-265 (2008) (Non-Patent Literature 8)). Therefore, therapeutic circular mRNA can be used in place of linear mRNA to achieve sustained expression of the encoded protein (Wesselhoeft et al., “Engineering Circular RNA for Potent and Stable Translation in Eukaryotic Cells,” Nat. Commun. 9:2629 (2018) (Non-Patent Literature 9); Qu et al., “Circular RNA Vaccines against SARS-CoV-2 and Emerging Variants,” Cell 185:1728-1744.e16 (2022) (Non-Patent Literature 2); and Chen et al., “Engineering Circular RNA for Enhanced Protein Production,” Nat. Biotechnol. 41:293 (2023) (Non-Patent Literature 10)).

[0005] Another major challenge with mRNA therapeutics is achieving mRNA delivery to specific cell types. When administered systemically, mRNA is primarily taken up by the liver (Pardi et al., “Expression Kinetics of Nucleoside-Modified mRNA Delivered in Lipid Nanoparticles to Mice by Various Routes,” J. Control Release 217:345-351 (2015) (Non-Patent Literature 11)). Since many applications require mRNA delivery to other tissues, devising strategies for cell-type-specific delivery of therapeutic mRNA beyond the liver is a crucial objective.

[0006] One novel approach to delivering mRNA to specific cell types is virus-like particles (VLPs). VLPs contain the major structural proteins of the virus required to organize the viral capsid, but do not package viral genomic material. VLPs can be designed to package and deliver specific mRNA (Lu et al., “Delivering SaCas9 mRNA by Lentivirus-Like Bionanoparticles for Transient Expression and Efficient Genome Editing,” Nucleic Acids Research 47:e44-e44 (2019) (Non-patent Literature 12) and Prel et al., “Highly Efficient In Vitro and In Vivo Delivery of Functional RNAs Using New Versatile MS2-Chimeric Retrovirus-Like Particles,” Molecular Therapy - Methods & Clinical Development 2:15039 (2015) (Non-patent Literature 13)). mRNA is not synthesized in vitro; rather, mRNA is expressed in mammalian cells and instructed to enter VLPs during tissue formation. These VLPs are generated using nucleocapsid proteins fused to MS2 coat protein (MCP).Subsequently, the nucleocapsid protein recruits MS2 hairpin-containing mRNA into the VLP (Lu et al., “Delivering SaCas9 mRNA by Lentivirus-Like Bionanoparticles for Transient Expression and Efficient Genome Editing,” Nucleic Acids Research 47:e44-e44 (2019) (Non-patent Literature 12); Prel et al., “Highly Efficient In Vitro and In Vivo Delivery of Functional RNAs Using New Versatile MS2-Chimeric Retrovirus-Like Particles,” Molecular Therapy - Methods & Clinical Development 2:15039 (2015) (Non-patent Literature 13); and Segal et al., “Mammalian Retrovirus-Like Protein PEG10 Packages its own mRNA and can be Pseudotyped for mRNA Delivery,” Science 373:882-889). (2021) (Non-Patent Document 14); this is incorporated herein by reference in its entirety).

[0007] A major advantage of VLPs is that they can be "pseudotyped," which is a process of altering VLP tropism by replacing surface proteins (Cronin et al., “Altering the Tropism of Lentiviral Vectors Through Pseudotyping,” Curr. Gene Ther. 5:387-398 (2005) (Non-Patent Literature 15); Naldini et al., “In Vivo Gene Delivery and Stable Transduction of Nondividing Cells by a Lentiviral Vector,” Science 272:263-267 (1996) (Non-Patent Literature 16); and Hamilton et al., “Targeted Delivery of CRISPR-Cas9 and Transgenes Enables Complex Immune Cell Engineering,” Cell Rep 35:109207 (2021) (Non-Patent Literature 17)). An additional advantage is that VLPs deliver mRNA into the cytosol rather than into endosomes (Stein et al., “pH-Independent HIV Entry into CD4-Positive T Cells Via Virus Envelope Fusion to the Plasma Membrane,” Cell 49:659-668 (1987) (Non-Patent Literature 18). When mRNA is delivered using lipid nanoparticles, only a small amount of mRNA "escapes" from endosomes into the cytoplasm (Maugeri et al., “Linkage Between Endosomal Escape of LNP-mRNA and Loading into EVs for Transport to Other Cells,” Nature Communications 10:4333 (2019) (Non-Patent Literature 19)). Because VLPs deliver mRNA into the cytosol, mRNA expression in target cells can be achieved using relatively small amounts of mRNA.

[0008] If delivering circular mRNA instead of linear mRNA can extend the expression duration of therapeutic proteins, then VLPs would become a more useful technology. To achieve this, circular mRNA needs to be generated within the cell. Previous studies have found that a standard method for producing large circular RNAs, known as the backsplicing system (Liang et al., “Short Intronic Repeat Sequences Facilitate Circular RNA Production,” Genes Dev. 28:2233-2247 (2014) (Non-Patent Literature 20); this is incorporated herein by reference in its entirety), does not efficiently generate circular mRNA species and is therefore likely to be an inefficient method for producing circular mRNA-containing VLPs (Jiang et al., “Overexpression-Based Detection of Translatable Circular RNAs is Vulnerable to Coexistent Linear RNA Byproducts,” Biochem. Biophys. Res. Commun. 558:189-195 (2021) (Non-Patent Literature 21) and Ho-Xuan et al., “Comprehensive Analysis of Translation from Overexpressed Circular RNAs Reveals Pervasive Translation from Linear Transcripts,” Nucleic Acids Res. 48:10368-10382 (2020) (Non-Patent Literature 22); these are incorporated herein by reference in their entirety).

[0009] This invention is aimed at overcoming these and other drawbacks in the art. [Prior art documents] [Non-patent literature]

[0010] [Non-Patent Document 1] Wesselhoeft et al., “Engineering Circular RNA for Potent and Stable Translation in Eukaryotic Cells,” Nat. Commun. 9:2629 (2018) [Non-Patent Document 2] Qu et al., “Circular RNA Vaccines against SARS-CoV-2 and Emerging Variants,” Cell 185:1728-1744.e16 (2022) [Non-Patent Document 3] Puttaraju et al., “Group I Permuted Intron-Exon (PIE) Sequences Self-Splice to Produce Circular Exons,” Nucleic Acids Res. 20:5357-5364 (1992) [Non-Patent Document 4] Obi et al., “The Design and Synthesis of Circular RNAs,” Methods 196:85-103 (2021) [Non-Patent Document 5] Chen & Sarnow, “Initiation of Protein Synthesis by the Eukaryotic Translational Apparatus on Circular RNAs,” Science 268:415-417 (1995) [Non-Patent Document 6] Cocquerelle et al., “Mis-Splicing Yields Circular RNA Molecules,” Faseb J 7:155-160 (1993) [Non-Patent Document 7] Jeck et al., “Circular RNAs are Abundant, Conserved, and Associated with ALU Repeats,” RNA 19:141-157 (2013) [Non-Patent Document 8] Ibrahim et al., “RNA Recognition by 3'-to-5' Exonucleases: The Substrate Perspective,” Biochim Biophys Acta 1779:256-265 (2008) [Non-Patent Document 9] Wesselhoeft et al., “Engineering Circular RNA for Potent and Stable Translation in Eukaryotic Cells,” Nat. Commun. 9:2629 (2018) [Non-Patent Document 10] Chen et al., “Engineering Circular RNA for Enhanced Protein Production,” Nat. Biotechnol. 41:293 (2023) [Non-Patent Document 11] Pardi et al., “Expression Kinetics of Nucleoside-Modified mRNA Delivered in Lipid Nanoparticles to Mice by Various Routes,” J. Control Release 217:345-351 (2015) [Non-Patent Document 12] Lu et al., “Delivering SaCas9 mRNA by Lentivirus-Like Bionanoparticles for Transient Expression and Efficient Genome Editing,” Nucleic Acids Research 47:e44-e44 (2019) [Non-Patent Document 13] Prel et al., “Highly Efficient In Vitro and In Vivo Delivery of Functional RNAs Using New Versatile MS2-Chimeric Retrovirus-Like Particles,” Molecular Therapy - Methods & Clinical Development 2:15039 (2015) [Non-Patent Document 14] Segal et al., “Mammalian Retrovirus-Like Protein PEG10 Packages its own mRNA and can be Pseudotyped for mRNA Delivery,” Science 373:882-889 (2021) [Non-Patent Document 15] Cronin et al., “Altering the Tropism of Lentiviral Vectors Through Pseudotyping,” Curr. Gene Ther. 5:387-398 (2005) [Non-Patent Document 16] Naldini et al., “In Vivo Gene Delivery and Stable Transduction of Nondividing Cells by a Lentiviral Vector,” Science 272:263-267 (1996) [Non-Patent Document 17] Hamilton et al., “Targeted Delivery of CRISPR-Cas9 and Transgenes Enables Complex Immune Cell Engineering,” Cell Rep 35:109207 (2021) [Non-Patent Document 18] Stein et al., “pH-Independent HIV Entry into CD4-Positive T Cells Via Virus Envelope Fusion to the Plasma Membrane,” Cell 49:659-668 (1987)

Non-Patent Document 19

Non-Patent Document 20

Non-Patent Document 21

Non-Patent Document 22

Summary of the Invention

[0011] Summary The first aspect of this disclosure relates to virus-like particles (VLPs). A virus-like particle is a circular RNA molecule comprising: a first ligation sequence; an internal ribosome entry site (IRES) coupled to an RNA molecule encoding one or more peptides, wherein the internal ribosome entry site coupled to the RNA molecule encoding one or more peptides is located at 3' of the first ligation sequence; and a circular RNA molecule comprising a plurality of proteins, one or more of which can self-assemble into nanoparticles.

[0012] Another aspect of this disclosure relates to a vector encoding a translation system. The vector comprises a promoter and a nucleic acid sequence encoding an RNA molecule comprising: a nucleic acid sequence comprising: a first ribozyme; a first ligation sequence positioned 3' of the first ribozyme; an internal ribosome entry site (IRES) coupled to an RNA molecule encoding one or more peptides, wherein the internal ribosome entry site coupled to the RNA molecule encoding one or more peptides is positioned 3' of the first ligation sequence; a second ligation sequence positioned 3' of the internal ribosome entry site; and a second ribozyme positioned 3' of the second ligation sequence.

[0013] Another aspect of this disclosure relates to a system for producing virus-like particles (VLPs) containing a circular RNA translation system. The system includes a packaging vector encoding one or more proteins that can self-assemble into nanoparticles; an envelope vector; and a vector encoding a translation system according to this disclosure.

[0014] Another aspect of the present disclosure relates to a method for producing VLPs comprising a circular RNA translation system. The method comprises the steps of: providing host cells; transfecting the host cells with a system according to the present disclosure; and culturing the host cells under conditions suitable for expressing a packaging vector, an envelope vector, and a circular RNA expression vector in the host cells, wherein the culture generates virus-like particles comprising the circular RNA translation system.

[0015] Another aspect of this disclosure relates to a method for inducing an immune response to a pathogen. This method involves administering an effective dose of virus-like particles (VLPs) according to this disclosure, VLPs manufactured using a system according to this disclosure, or VLPs manufactured using a method according to this disclosure to a target.

[0016] Another aspect of the Disclosure relates to a method for treating a subject. This method comprises the steps of administering to a subject in need a virus-like particle (VLP) according to the Disclosure, a VLP produced using a system according to the Disclosure, or a VLP produced using a method according to the Disclosure, wherein, after the administration, one or more peptides are expressed in the cells of the subject, thereby treating the subject.

[0017] Another aspect of the present disclosure relates to a method for performing gene editing on a subject. The method comprises administering to a subject in need of gene editing a virus-like particle (VLP) according to the present disclosure, a VLP produced using a system according to the present disclosure, or a VLP produced using a method according to the present disclosure, wherein one or more peptides comprise one or more gene-editing proteins, and after administration, the gene-editing proteins are expressed in the cells of the subject, thereby editing the genome of the subject.

[0018] Another aspect of this disclosure relates to an RNA molecule comprising: a first ribozyme; a first ligation sequence located at 3' of the first ribozyme; an internal ribosome entry site (IRES) coupled to an RNA molecule encoding one or more peptides, wherein the internal ribosome entry site coupled to the RNA molecule encoding one or more peptides is located at 3' of the first ligation sequence, and the IRES sequence is selected from the group consisting of SEQ ID NO: 1-8 or derivatives thereof; a second ligation sequence located at 3' of the internal ribosome entry site; and a second ribozyme located at 3' of the second ligation sequence.

[0019] Another aspect of this disclosure relates to a circular RNA molecule comprising: a first ligation sequence; an internal ribosome entry site (IRES) coupled to an RNA molecule encoding one or more peptide sequences, wherein the internal ribosome entry site coupled to the RNA molecule encoding the peptide sequences is located at 3' of the first ligation sequence, and the IRES sequence is selected from the group consisting of SEQ ID NO: 1-8 or derivatives thereof; and a second ligation sequence located at 3' of the internal ribosome entry site coupled to the RNA molecule encoding the peptide sequences. [Brief explanation of the drawing]

[0020] [Figure 1A] Figures 1A and 1B are schematic diagrams illustrating the design of reporters for circular mRNA-specific translation. Figure 1A shows the design of a split nanoluciferase (nLuc system). Large BiT (LgBiT) and small BiT (SmBiT) can only produce luminescence when aggregated by a protein tether. [Figure 1B]Figures 1A and 1B are schematic diagrams illustrating the design of a reporter for circular mRNA-specific translation. Figure 1B shows the construct design of a Tornado translation system using a split nLuc ORF. LgBiT linked to SmBiT produces luminescence. CJ = circularization junction. [Figure 2A]Figures 2A–2F demonstrate that the Tornado translation system generates circular mRNA. Figure 2A is a schematic diagram showing aspects of the construct design of the Tornado translation system and the linear mRNA expression system. All three mRNAs contain the same ORF. Figure 2B is a Northern blot showing RNA from HEK293T cells transfected with plasmids expressing Tornado split nLuc mRNA (Tornado CMV-CVB3), linear cap-dependent split nLuc mRNA (linear (cap)), or linear cap-independent split nLuc mRNA (linear (CVB3)), treated with vehicle or RNase R to test whether the RNA is circular. A complete blot image is shown in (Figure 3B). Figure 2C shows the Tornado translation system with split nLuc mRNA (Tornado (CMV-CVB3)) and 3' The bar graph (left panel) and schematic diagram (right panel) show the luminescence from HEK293T cells transfected with plasmids expressing a similar transcript with a mutated Tornado ribozyme (referred to as "mutTornado(CMV-CVB3)"). Figure 2D shows the luminescence from HEK293T cells transfected with plasmids expressing the Tornado translation system (Tornado(CMV-CVB3)), the linear cap-dependent mRNA expression system (linear(cap)), and the linear CVB3-dependent mRNA expression system (linear(CVB3)). This is a rough sketch. Figure 2E is a bar graph showing luminescence from Figure 2D normalized to RNA expression from Figure 2B. Figure 2F is a pair of graphs showing RNA and protein expression from stable cell lines expressing a linear cap-dependent mRNA expression system (linear (cap)) (triangle marker, ▲), a linear CVB3-dependent mRNA expression system (linear (CVB3)) (square marker, ■), and a Tornado translation system (cyclic (CMV-CVB3)) (circular marker, ●) under a tetracycline-responsive promoter. Cell lines were pulsed with tetracycline, and then the medium was replaced with tetracycline-free medium, after which luminescence and RNA abundance were measured periodically.RNA was quantified by qRT-PCR using primers that amplify the 120 nt region of LgBiT. RLU = relative luminescence unit. CJ = circular junction. Data are presented as mean + / - 1SD (n=3 biological replicas). Significance was calculated using an independent two-sided Student's t-test. ****p<0.0001, ***p<0.001, **p<0.01, *p<0.05, ns p>0.05. [Figure 2B] See the explanation in Figure 2A. [Figure 2C] See the explanation in Figure 2A. [Figure 2D] See the explanation in Figure 2A. [Figure 2E] See the explanation in Figure 2A. [Figure 2F] See the explanation in Figure 2A. [Figure 3A] Figures 3A–3C demonstrate that successful RNase R treatment can be used to quantify RNA expression levels. Figure 3A shows ethidium bromide staining of Northern blots shown in Figures 2B and 7E. The disappearance of the rRNA band in the RNase R-treated sample indicates the success of the RNase R treatment. Ethidium bromide staining shows similar loading in the RNA sample. Figure 3B shows the complete blot image and quantification from the Northern blots in Figures 2B and 7E. The Northern blot was used to answer two questions. First, it can show whether the Tornado translation system RNA is in a circular morphology in Figure 2B. Second, it can show the RNA expression levels in Figures 3C and 7E. Figure 3C is a bar graph showing RNA quantification from the Northern blot. RNA quantification was performed by multiplying the average intensity by the band area from Figure 3B. [Figure 3B] See the explanation in Figure 3A. [Figure 3C] See the explanation in Figure 3A. [Figure 4A]Figures 4A–4L demonstrate that the Tornado translation system is a robust method for circular mRNA expression. Figure 4A is a schematic diagram of primer design for convergent and divergent primers. Convergent primers amplify sequences present when mRNA is in both linear and circular forms. Divergent primers amplify regions present only when mRNA is in circular form. [Figure 4B] Figures 4A–4L demonstrate that the Tornado translation system is a robust method for expressing circular mRNA. Figure 4B demonstrates that RT-PCR analysis confirms the Tornado translation system expresses circular mRNA. Gels of PCR reactions using convergent and divergent primers on cDNA from HEK293T cells transfected with linear (CVB3) and Tornado (CMV-CVB3) plasmids are shown. The divergent primers produce amplicons from cDNA from cells transfected with the Tornado (CMV-CVB3) plasmid, but not from cDNA from cells transfected with the linear (CVB3) plasmid. The divergent amplicons are of the expected size. It should be noted that the TapeStation ladder is consistently about 10 bp too small (see Figures 4K and 12A). [Figure 4C] Figures 4A-4L demonstrate that the Tornado translation system is a robust method for expressing circular mRNA. Figure 4C shows that Sanger sequencing confirms that the Tornado translation system expresses circular mRNA. The amplicon derived from Figure 4B was sequenced. The shown sequence (TGGACTGTAGAACCATGCCGAGT (SEQ ID NO: 80)) is aligned at the circularization junction. [Figure 4D]Figures 4A–4L demonstrate that the Tornado translation system is a robust method for circular mRNA expression. Figure 4D is a graph showing that the Tornado translation system does not increase the expression of innate immune genes compared to the linear mRNA expression system. RNA expression of innate immune markers RIG-I, IL6, and IFNβ was quantified by RT-PCR on HeLa cells transfected with plasmids encoding the Tornado translation system (Tornado(CMV-CVB3)), the linear cap-dependent mRNA expression system (linear(cap)), and the linear CVB3-dependent mRNA expression system (linear(CVB3)). PolyI:C was used as a positive control. RNA expression was normalized to GAPDH. The lower panel shows the same data as the upper panel, but without polyI:C. Data are presented as mean + / - 1SD (n=3 biological replicas). [Figure 4E] Figures 4A–4L demonstrate that the Tornado translation system is a robust method for circular mRNA expression. Figure 4E is a schematic diagram of the Tornado circularization junction variant. The short, medium, and long stems are 18, 26, and 49 base pairs, respectively. Each stem is designed to have a protrusion approximately every 10 nucleotides to prevent dicing. The stems are designed to facilitate circularization by being adjacent to the IRES(CVB3) and nLuc sequences. More efficient circularization is reflected by increased luminescence. [Figure 4F]Figures 4A–4L demonstrate that the Tornado translation system is a robust method for circular mRNA expression. Figure 4F is a bar graph demonstrating that extending the circular junction stem does not increase protein output from the Tornado translation system. Luminescence was quantified from HEK293T cells transfected with plasmids carrying Tornado translation systems with short, medium, and long stems. All three constructs were expressed using the CMV promoter, and translation of nLuc mRNA was driven using the CVB3 IRES. The three stems produced similar levels of luminescence. RLU = Relative Luminescence Units. Data are presented as mean + / - 1SD (n=3 biological replicas). Significance was calculated using unpaired two-sided Student's t-tests. ****p<0.0001, ***p<0.001, **p<0.01, *p<0.05, ns p>.05. [Figure 4G] Figures 4A–4L demonstrate that the Tornado translation system is a robust method for circular mRNA expression. Figure 4G is a graph showing that extending the circularization junction of the Tornado translation system does not increase the expression of innate immune genes. RNA expression of innate immune markers RIG-I, IL6, and IFNβ was quantified by RT-PCR on HeLa cells transfected with plasmids encoding short, medium, and long Tornado translation system circularization junctions. PolyI:C was used as a positive control. RNA expression was normalized to GAPDH. The lower panel shows the same data as the upper panel, but without polyI:C. Data are presented as mean + / - 1SD (n=3 biological replicas). [Figure 4H]Figures 4A–4L demonstrate that the Tornado translation system is a robust method for circular mRNA expression. Figure 4H is a bar graph demonstrating that the Tornado translation system can be used in multiple cell types. Luminescence was quantified from HepG2 and ZR-75-1 cells transfected with plasmids expressing the Tornado translation system (Tornado(CMV-CVB3)), the linear cap-dependent mRNA expression system (linear(cap)), and the linear CVB3-dependent mRNA expression system (linear(CVB3)). The Tornado translation system induced luminescence in HepG2 and ZR-75-1 cells. In particular, the Tornado translation system induced a similar level of luminescence in ZR-75-1 cells as the linear cap-dependent mRNA expression system. RLU = Relative Luminescence Units. Data are presented as mean + / - 1SD (n=3 biological replicas). Significance was calculated using an unpaired two-sided Student's t-test. ****p<0.0001, ***p<0.001, **p<0.01, *p<0.05, ns p>.05. [Figure 4I] Figures 4A–4L demonstrate that the Tornado translation system is a robust method for circular mRNA expression. Figure 4I is a bar graph showing that the Tornado translation system can circularize SARS-CoV-2 spike protein mRNA (4719 nt). HEK293T cells were transfected with plasmids expressing the Tornado translation system and a linear mRNA expression system containing the spike protein insert. RNA was treated with vehicle or RNase R and then quantified by qRT-PCR using primers that amplified the 124 nt region of the spike protein. The Tornado translation system produces circular RNA, as demonstrated by its resistance to RNase R compared to a linear control. Data are presented as mean + / - 1SD (n=3 biological replicas). Significance was calculated using an unpaired two-sided Student's t-test. ****p<0.0001, ***p<0.001, **p<0.01, *p<0.05, ns p>.05. [Figure 4J] Figures 4A–4L demonstrate that the Tornado translation system is a robust method for circular mRNA expression. Figure 4J shows that Northern blotting confirms qRT-PCR results. HEK293T cells were transfected with plasmids expressing the Tornado translation system and a linear mRNA expression system containing spike protein inserts. RNA was treated with vehicle or RNase R and then quantified by Northern blotting with probes for spike RNA. Tornado spike and linear spike RNA were run on the same gel, but halved for Northern blotting hybridization and downstream steps to ensure visualization of both Tornado spike and linear spike RNA. The Tornado translation system produces circular RNA, as demonstrated by its resistance to RNase R compared to a linear control. Circular RNA can be degraded by RNase R, but not as efficiently as linear RNA. This explains why Tornado spike RNA is partially degraded by RNase R. Ethidium bromide staining of the membrane shows successful RNase R treatment. [Figure 4K] Figures 4A–4L demonstrate that the Tornado translation system is a robust method for expressing circular mRNA. Figure 4K shows that RT-PCR confirms that the Tornado translation system expresses circular spike mRNA. The PCR reaction gel with divergent primers against cDNA from HEK293T cells transfected with Tornado spike plasmid was run. The divergent amplicon was of the expected size. It should be noted that the TapeStation ladder is always about 10 bp too low (see Figures 4B and 12A). [Figure 4L]Figures 4A–4L demonstrate that the Tornado translation system is a robust method for expressing circular mRNA. Figure 4L shows that Sanger sequencing confirms that the Tornado translation system expresses circular spike mRNA. The amplicon from Figure 4K was sequenced. The shown sequence (TGGACTGTAGAACCATGCCGAG (SEQ ID NO: 81)) is aligned at the circularization junction. [Figure 5A] Figures 5A–5C demonstrate that the Tornado translation system expresses more circular mRNA than the backsplicing system. Figure 5A is a schematic diagram of the backsplicing reaction. Intron homology drives the backsplicing reaction, which leads to the formation of circular RNA. [Figure 5B] Figures 5A–5C demonstrate that the Tornado translation system expresses more circular mRNA than the backsplicing system. Figure 5B is a bar graph showing luminescence from HEK293T cells transfected with plasmids expressing the Tornado translation (Tornado(CMV-CVB3)) and backsplicing (backsplicing(CMV-CVB3)) systems expressing split nLuc mRNA. RLU = Relative Luminescence Units. Data are presented as mean + / - 1SD (n=3 biological replicas). Significance was calculated using an unpaired two-tailed Student's t-test. ****p<0.0001, ***p<0.001, **p<0.01, *p<0.05, ns p>0.05. [Figure 5C]Figures 5A–5C demonstrate that the Tornado translation system expresses more circular mRNA than the backsplicing system. Figure 5C is a Northern blot electrophoresis using RNA from HEK293T cells transfected with plasmids expressing the Tornado translation (Tornado(CMV-CVB3)) and backsplicing (backsplicing(CMV-CVB3)) systems, which were treated with vehicle or RNase R to test whether the RNA was circular. The unspliced ​​linear precursor for the backsplicing system is 1.8 kb. The uncut linear precursor for the Tornado translation system is 1.9 kb. Both the cleaved linear precursor for the Tornado translation system and the forward-splicing linear RNA for the back-splicing system should migrate equivalently to their circular RNA counterparts, as previously described (Abe et al., “Circular RNA Migration in Agarose Gel Electrophoresis,” Mol. Cell 82:1768-1777 (2022); this is incorporated herein by reference in its entirety). The low molecular weight product derived from Tornado (CMV-CVB3) is thought to represent an alternative conformation / non-denatured product. The low molecular weight product derived from linear (capped) is thought to represent a partially degraded product. Ethidium bromide stained blots are shown (Figure 6B). [Figure 6A]Figures 6A–6B demonstrate that the Tornado translation system generates more circular RNA than the backsplicing system. Figure 6A shows that the Tornado translation system generates more circular RNA than the backsplicing system. HEK293T cells were transfected with plasmids expressing the Tornado translation system and the backsplicing system, which contain the ZKSCAN1 exon 2 / 3 insertion. RNA was treated with vehicle or RNase R to test whether it was circular. The Tornado translation system generates RNA that is primarily circular. The backsplicing system generates RNA that is primarily linear. Ethidium bromide stained blots show successful RNase R treatment. [Figure 6B] Figures 6A–6B demonstrate that the Tornado translation system generates more circular RNA than the backsplicing system. Figure 6B shows ethidium bromide staining of the Northern blot shown in Figure 5C. The disappearance of the rRNA band in the RNase R-treated sample indicates the success of the RNase R treatment. [Figure 7A]Figures 7A–7F show that the Tornado translation system generates the most protein using the CMV-CVB3 promoter and IRES combination. Figure 7A is a graph showing luminescence from HEK293T cells transfected with plasmids expressing CVB3 or EMCV IRES. Both constructs were expressed using a Pol II-driven (CMV) Tornado translation system with a split nLuc ORF. Figure 7B is a schematic diagram showing Pol III termination signal 1 (UCUUU sequence in termination signal 1 inset) and Pol III termination signal 2 (UUUU sequence in termination signal 2 inset). Mutations that make IRES compatible with the Pol III promoter are shown in each inset (the Termination Signal 1 inset shows a U→A termination signal mutation in mutEMCV; the Termination Signal 2 inset shows a U→C termination signal mutation in mutEMCV), and a compensatory mutation to preserve IRES function is shown in the Termination Signal 2 inset (an A→G compensatory mutation in mutEMCV). Mutant EMCV (referred to as "mutEMCV") contains the mutations identified in both insets for Termination Signals 1 and 2. SEQ ID NO: 82 (AGGGGUCUUUCCCCU) in inset 1 and SEQ ID NO: 83 (GAACCACGGGGACGUGGUUUU) in inset 2 are identified. Figure 7C is a bar graph showing luminescence from HEK293T cells transfected with plasmids expressing the EMCV IRES mutant. Both constructs were expressed using a Pol II-driven (CMV) Tornado translation system with a split nLuc ORF. Figure 7D is a bar graph showing luminescence from HEK293T cells transfected with plasmids expressing mutant EMCV (mutEMCV) and wild-type EMCV (EMCV)IRES. Both constructs were expressed using a Pol II-driven (CMV) Tornado translation system with a split nLuc ORF.Figure 7E shows the quantification of RNA from HEK293T cells transfected with plasmids expressing Pol II-driven (CMV-CVB3) and Pol III-driven (U6-mutEMCV) Tornado translation systems, calculated using Northern blotting and pixel intensity calculations with ImageLab software (Figures 3A-3C). The complete blot image is shown in Figure 3B. Figure 7F is a graph showing the luminescence from HEK293T cells transfected with plasmids expressing Pol II-driven (CMV-CVB3) and Pol III-driven (U6-mutEMCV) Tornado translation systems with split nLuc ORFs. RLU = Relative Luminescence Units. Data are presented as mean + / - 1SD (n=3 biological replicas). Significance was calculated using an unpaired two-sided Student's t-test. ****p<0.0001, ***p<0.001, **p<0.01, *p<0.05, ns p>0.05. [Figure 7B] See the explanation in Figure 7A. [Figure 7C] See the explanation in Figure 7A. [Figure 7D] See the explanation in Figure 7A. [Figure 7E] See the explanation in Figure 7A. [Figure 7F] See the explanation in Figure 7A. [Figure 8A]Figures 8A–8H demonstrate that the Pol III-driven Tornado translation system produces less protein than the Pol II-driven Tornado translation system. Figure 8A is a bar graph demonstrating that CVB3 IRES produces a similar amount of protein as HRV-B3 IRES. Luminescence was quantified from HEK293T cells transfected with plasmids expressing CVB3 or HRV-B3 IRES. Both constructs were expressed using a Pol II-driven (CMV) Tornado translation system with nLuc ORF. CVB3 and HRV-B3 IRES produced similar levels of luminescence. Using a P-value cutoff of <.1, CVB3 IRES produced more luminescence than HRV-B3 IRES. RLU = Relative Luminescence Units. Data are presented as mean + / - 1SD (n=3 biological replicas). Significance was calculated using an unpaired two-tailed Student's t-test. [Figure 8B] Figures 8A–8H demonstrate that the Pol III-driven Tornado translation system produces less protein than the Pol II-driven Tornado translation system. Figure 8B shows mFold structural predictions indicating that the falcon picornavirus maintains a stem-loop structure containing the EMCV termination signal 2 mutation but lacking the Pol III termination signal. The termination signal (TTTT), termination signal mutation (G), and compensatory mutation (C) are indicated by arrows. SEQ ID NO: 84 (CCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAA) and SEQ ID NO: 85 (CCCACCAGCCCACGGGAGTGGGCTTTCCTTAAA) are identified in the left and right panels, respectively. [Figure 8C]Figures 8A–8H demonstrate that the Pol III-driven Tornado translation system produces less protein than the Pol II-driven Tornado translation system. Figure 8C is a graph showing that mutEMCV produces more protein than wild-type CVB3 in the Pol III-driven Tornado translation system. Luminescence was quantified from HEK293T cells transfected with plasmids expressing CVB3 (U6-CVB3) and mutEMCV (U6-mutEMCV) IRESs. Both constructs were expressed using a Pol III-driven (U6) Tornado translation system with a split nLuc ORF. The mutEMCV IRES produced approximately 15 times more luminescence than the CVB3 IRES. RLU = Relative Luminescence Units. Data are presented as mean + / - 1SD (n=3 biological replicas). Significance was calculated using an unpaired two-tailed Student's t-test. ****p<0.0001, ***p<0.001, **p<0.01, *p<0.05, ns p>.05. [Figure 8D] Figures 8A–8H demonstrate that the Pol III-driven Tornado translation system produces less protein than the Pol II-driven Tornado translation system. Figure 8D is a schematic diagram showing that HCV IRES and CSFV IRES are structurally similar but not sequence-similar. CSFV has a similar structure to HCV IRES but lacks the Pol III termination element present in HCV. The Pol III termination signal in HCV IRES is shown in the inset in the left panel. SEQ ID NO: 86 is identified in Figure 8D. [Figure 8E]Figures 8A–8H demonstrate that the Pol III-driven Tornado translation system produces less protein than the Pol II-driven Tornado translation system. Figure 8E is a graph showing that mutEMCV produces more protein than CSFV in the Pol III-driven Tornado translation system. Luminescence was quantified from HEK293T cells transfected with plasmids expressing CSFV (U6-CSFV) and mutEMCV (U6-mutEMCV) IRESs. Both constructs were expressed using a Pol III-driven (U6) Tornado translation system with a split nLuc ORF. CSFV IRES produced three times less luminescence than mutEMCV IRES. RLU = Relative Luminescence Units. Data are presented as mean + / - 1SD (n=3 biological replicas). Significance was calculated using an unpaired two-sided Student's t-test. ****p<0.0001, ***p<0.001, **p<0.01, *p<0.05, ns p>.05. [Figure 8F]Figures 8A–8H demonstrate that the Pol III-driven Tornado translation system produces less protein than the Pol II-driven Tornado translation system. Figure 8F is an image showing that the Pol III-driven Tornado translation system exhibits similar nuclear and cytoplasmic distribution to the Pol II-driven Tornado translation system and the linear cap-dependent mRNA expression system. Since Pol III transcripts are generally retained in the nucleus, we evaluated whether the lower protein output from the Pol III-driven Tornado translation system was due to nuclear retention. Fluorescent in-situ hybridization was performed using a probe for the LgBiT region of mRNA (green) and a control probe for the nuclear non-coding RNA NEAT1 (red). DAPI staining is shown in blue. Magnified images show the boundary between the nucleus (white) and cytoplasm (yellow). As expected, NEAT1 was almost entirely located in the nucleus. However, the Pol III-driven Tornado translation system (U6-mutEMCV) is partially located in the cytoplasm and partially in the nucleus, which is similar to the distribution of the Pol II-driven Tornado translation system (CMV-CVB3) and the linear cap-dependent mRNA expression system (linear (cap)). Scale bar = 24 μm. [Figure 8G] Figures 8A–8H demonstrate that the Pol III-driven Tornado translation system produces less protein than the Pol II-driven Tornado translation system. Figure 8G is a graph showing that the Pol III-driven Tornado translation system exhibits a similar nuclear-to-cytoplasmic spot ratio to the Pol II-driven Tornado translation system and the linear cap-dependent mRNA expression system. The cytoplasmic-to-nuclear spot ratio was quantified from Figure 8F. The Pol III-driven Tornado translation system (U6-mutEMCV) is present at approximately 50% in the cytoplasm and 50% in the nucleus, which is similar to the distribution of the Pol II-driven Tornado translation system (CMV-CVB3) and the linear cap-dependent mRNA expression system (linear (cap)). [Figure 8H]Figures 8A–8H demonstrate that the Pol III-driven Tornado translation system produces less protein than the Pol II-driven Tornado translation system. Figure 8H is a graph showing that the constitutive transport element (CTE) RNA sequence does not increase protein expression from the Pol III-driven Tornado translation system. Luminescence was quantified from HEK293T cells transfected with plasmids expressing the Pol III-driven Tornado translation system (U6-mutEMCV) with and without the CTE RNA sequence. The CTE sequence did not increase protein expression from the Pol III-driven Tornado translation system. Therefore, the decrease in protein expression from the Pol III-driven Tornado translation system compared to the Pol II-driven Tornado translation system is not attributable to nuclear retention. RLU = Relative Luminescence Units. Data are presented as mean + / - 1SD (n=3 biological replicas). Significance was calculated using an unpaired two-sided Student's t-test. ****p<0.0001, ***p<0.001, **p<0.01, *p<0.05, ns p>.05. [Figure 9A]Figures 9A–9G demonstrate that continuous translation does not improve protein output from the Tornado translation system. Figure 9A is a schematic diagram showing the design of discontinuous and continuous translation systems. Figure 9B is a table showing that viral IRESs contain multiple stop codons in all frames. Figure 9C is a schematic diagram showing the mutations required to make HCV IRESs compatible with continuous translation. Stop codons (UAG in the left inset, UGA in the right inset, UAG in the right inset) are shown. Mutations to make IRESs compatible with continuous translation (G→C in the stop codon UAG in the left inset; U→G in the stop codon UGA in the right inset; G→U in the stop codon UAG in the right inset) and compensatory mutations (C→G in the left inset) are shown to preserve the predicted structure of the IRES. Mutant HCV (referred to as "mutHCV") contains identified stop codon mutations and compensatory mutations in mutHCV. SEQ ID NO: 87 (GCCUGAUAGGGU) is identified in Figure 9C. Figure 9D is a bar graph showing luminescence from HEK293T cells transfected with plasmids expressing the mutHCV discontinuous translation system (mutHCV termination) and the wild-type HCV (referred to as "wtHCV") discontinuous translation system (wtHCV termination). Both constructs were expressed using a Pol II-driven (CMV) Tornado translation system with a split nLuc ORF. Figure 9E is a bar graph showing luminescence from HEK293T cells transfected with plasmids expressing the mutHCV discontinuous translation system (mutHCV termination), the mutHCV continuous translation system (without mutHCV termination), and the CVB3 discontinuous translation system (CVB3 termination). All constructs were expressed using a Pol II-driven (CMV) Tornado translation system with a split nLuc ORF. Figure 9F is a bar graph showing the luminescence from HEK293T cells transfected with plasmids expressing the LIMA1 discontinuous translation system (LIMA1 termination), the LIMA1 continuous translation system (without LIMA1 termination), and the CVB3 discontinuous translation system (CVB3 termination).All constructs were expressed using a Pol II-driven (CMV) Tornado translation system with a split nLuc ORF. Figure 9G is a bar graph showing luminescence from HEK293T cells transfected with plasmids expressing a LIMA1 discontinuous translation system (LIMA1 termination), a LIMA1 continuous translation system (LIMA1 without termination), a LIMA1 continuous translation system with mutant AUG (LIMA1 mutAUG), and a continuous translation system without IRES (no IRES, no termination). All constructs were expressed using a Pol II-driven (CMV) Tornado translation system with a split nLuc ORF. RLU = relative luminescence units. Data are presented as mean + / - 1SD (n=3 biological replicas). Significance was calculated using an unpaired two-sided Student's t-test. ****p<0.0001, ***p<0.001, **p<0.01, *p<0.05, ns p>0.05. [Figure 9B] See the explanation in Figure 9A. [Figure 9C] See the explanation in Figure 9A. [Figure 9D] See the explanation in Figure 9A. [Figure 9E] See the explanation in Figure 9A. [Figure 9F] See the explanation in Figure 9A. [Figure 9G] See the explanation in Figure 9A. [Figure 10A] Figures 10A–10B demonstrate that the endogenous IRES element has minimal translational activity. Figure 10A is a nucleotide sequence alignment showing that the LIMA1 IRES contains only one start codon in frame with the split nLuc ORF. The start codon is indicated. SEQ ID NO: 88, SEQ ID NO: 89, and SEQ ID NO: 90 are shown in Figure 10A. [Figure 10B]Figures 10A–10B demonstrate that the endogenous IRES element has minimal translational activity. Figure 10B is a bar graph showing that alternative endogenous IRES elements do not produce more protein than LIMA1 IRES. Luminescence was quantified from HEK293T cells transfected with plasmids expressing putative IRESs from previous screenings. All constructs were expressed using a Pol II-driven (CMV) Tornado translation system with a serial split nLuc ORF. None of the IRES elements tested produced more protein than LIMA1 IRES. RLU = Relative Luminescence Units. Data are presented as mean + / - 1SD (n = 2 technical replicas). [Figure 11A]Figures 11A-11E demonstrate that VLPs generated using the Tornado translation system show increased levels and duration of protein expression compared to conventional VLPs. Figure 11A is a schematic diagram of the circular mRNA VLP system. Figure 11B is a bar graph showing that RNA derived from VLPs generated using the Tornado translation system (Tornado nLuc-MS2) or the linear mRNA expression system (linear nLuc-MS2) as the transfer plasmid was treated with a vehicle or RNase R to test whether the RNA was circular. RNA quantification was performed by qRT-PCR using primers that amplified the 126nt region of the nLuc gene. Figure 11C is a graph showing luminescence at 5, 24, 48, and 72 hours post-transduction from HEK293T cells transduced with VLPs generated using either the Tornado translation system (Tornado nLuc-MS2) (circular marker, ●) or the linear mRNA expression system (linear nLuc-MS2) (square marker, ■). HEK293T cells were transduced with equilevel VLP mRNA (Figure 12C). Figure 11D is a schematic diagram illustrating cell type-specific delivery of circular mRNA using spike pseudotype VLPs. Figure 11E is a bar graph showing luminescence from HEK293T cells transduced with VSV-G pseudotype or spike pseudotype VLPs containing circular nLuc mRNA, and from ACE2-expressing HEK293T cells. RLU = relative luminescence units. Data are presented as mean + / - 1SD (n=3 biological replicas). Significance was calculated using an unpaired two-tailed Student's t-test. ****p<0.0001, ***p<0.001, **p<0.01, *p<0.05, ns p>0.05. [Figure 11B] See the explanation in Figure 11A. [Figure 11C] See the explanation in Figure 11A. [Figure 11D] See the explanation in Figure 11A. [Figure 11E] See the explanation in Figure 11A. [Figure 12A]Figures 12A–12D demonstrate that the Tornado translation system can be used to package circular mRNA in VLPs. Figure 12A shows a gel with the results of RT-PCR analysis confirming that VLPs packaged using the Tornado translation system contain circular mRNA. The gel was run on an electrophoresis gel for a PCR reaction using divergent primers against cDNA derived from Tornado nLuc-MS2 viral RNA. The divergent amplicon is of the expected size. It should be noted that the TapeStation ladder is always about 10 bp too low (see Figures 4B and 4K). [Figure 12B] Figures 12A–12D demonstrate that the Tornado translation system can be used to package circular mRNA in VLPs. Figure 12B shows Sanger sequencing confirmation that VLPs packaged using the Tornado translation system package circular mRNA. The amplicon from Figure 12A was sequenced. The sequence is aligned at the circularization junction. SEQ ID NO: 91 (CGGTCGGCGTGGACTGTAGAACCATGCCGAGTGCG) is shown. [Figure 12C]Figures 12A–12D demonstrate that the Tornado translation system can be used to package circular mRNA into VLPs. Figure 12C is a bar graph showing VLP RNA titers. VLPs generated using the Tornado translation system and the linear mRNA expression system were titrated using RNA quantification. Viral RNA was extracted from equivolute viral supernatants generated using the Tornado translation system (Tornado nLuc-MS2) and the linear mRNA expression system (linear nLuc-MS2). QRT-PCR was then performed using primers that amplified the 126nt region of the nLuc gene. The linear mRNA expression system produced VLPs that were 15-fold enriched compared to those generated by the Tornado translation system. Data are presented as mean + / - 1SD (n=3 biological replicas). Significance was calculated using an unpaired two-tailed Student's t-test. ****p<0.0001, ***p<0.001, **p<0.01, *p<0.05, ns p>.05. [Figure 12D] Figures 12A–12D demonstrate that the Tornado translation system can be used to package circular mRNA in VLPs. Figure 12D is a bar graph demonstrating that VLPs produced using the Tornado translation system can be used to transduce SH-SY5Y cells. Luminescence 24 hours post-transduction was quantified from SH-SY5Y cells transduced with VLPs produced using either the Tornado translation system (Tornado nLuc-MS2) or the linear mRNA expression system (linear nLuc-MS2). Cells were transduced with equal levels of VLP mRNA. VLPs produced using the Tornado translation system can be used to transduce SH-SY5Y cells and produce approximately 5 times more luminescence than VLPs produced using the linear mRNA expression system. RLU = Relative Luminescence Units. Data are presented as mean + / - 1SD (n=3 biological replicas). Significance was calculated using an unpaired two-sided Student's t-test. ****p<0.0001, ***p<0.001, **p<0.01, *p<0.05, ns p>.05. [Modes for carrying out the invention]

[0021] Detailed explanation definition Unless otherwise indicated, the definitions and embodiments set forth in this and other sections are intended to be applicable to all aspects and aspects of the present disclosure described herein where they are applicable, as can be understood by those skilled in the art.

[0022] The singular forms “a,” “an,” and “the” refer to multiple objects unless the context clearly indicates otherwise. For example, a reference to “a method” includes one or more methods and / or steps of a type described herein and / or evident to those skilled in the art by reading this disclosure. In another example, a reference to “a compound” includes both a single compound and several different compounds.

[0023] The terms "about" or "approximately" imply that a value falls within a statistically meaningful range. Such a range may be within a single order of magnitude, such as within 50%, 20%, 10%, or 5% (or any quantity or range between 5% and 50%) of a given value or range. The acceptable variation encompassed by the terms "about" or "approximately" may depend on the context.

[0024] The term "and / or," as used herein, means that the listed features exist or are used individually or in combination. Substantively, the term means that "at least one" or "one or more" of the listed features are used or are present.

[0025] As will be understood by those skilled in the art, for any purpose, including with respect to the provision of written explanations, all scopes disclosed herein also encompass any possible sub-scopes and combinations thereof. Any enumerated scope can be readily recognized as sufficiently described and implementable to be divided into at least half, one-third, one-quarter, one-fifth, one-tenth, etc. As a non-limiting example, each scope considered herein can be readily divided into the lower third, middle third, upper third, etc. Also as will be understood by those skilled in the art, all phrases such as “up to,” “at least,” etc., include the stated number and refer to a scope or a specific value within it that can subsequently be divided into sub-scopes as discussed above. Finally, as will be understood by those skilled in the art and as discussed above, a scope includes individual values.

[0026] In understanding the scope of this disclosure, the term "contains" and its derivatives are intended, as used herein, to be open-ended terms that express the presence of described features, elements, components, bases, integers, and / or steps, but do not exclude the presence of other undescribed features, elements, components, bases, integers, and / or steps. The foregoing also applies to similar words such as the terms "contains," "accompany," "have," and their derivatives. The term "consists of" and its derivatives are intended, as used herein, to be closed terms that express the presence of described features, elements, components, bases, integers, and / or steps, but exclude the presence of other undescribed features, elements, components, bases, integers, and / or steps. The term "essentially consists of" is intended, as used herein, to express the presence of described features, elements, components, bases, integers, and / or steps, as well as features, elements, components, bases, integers, and / or steps that do not substantially affect the fundamental and novel properties of those features, elements, components, bases, integers, and / or steps. In any aspect or claim in which the term "includes" (or similar) is used as a transitional clause, such aspect may also replace the term "includes" with the terms "consists of" or "essentially consists of." The methods, kits, systems, and / or compositions of the Disclosure include, are essentially composed of, or may consist of the components of the Disclosure.

[0027] In some embodiments including an “additional” or “second” component, the second component, as used herein, differs from the other components and the first component. The “third” component differs from the other, first, and second components, as do any further listed or “additional” components.

[0028] When used in relation to nucleic acids, the term "complementary" refers to the pairing of bases A with T or U, and G with C. The term "complementary" refers to nucleic acid molecules that are fully complementary, i.e., that form A-T or U pairs and G-C pairs throughout the entire reference sequence, as well as molecules that are partially complementary (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%).

[0029] The terms "nucleic acid" and "nucleotide" encompass both DNA and RNA unless otherwise specified.

[0030] The terms “polypeptide,” “peptide,” or “protein” are used synonymously and refer to polymers of amino acid residues. These terms encompass all types of natural and synthetic proteins, including protein fragments of all lengths, fusion proteins, and modified proteins, including glycoproteins indefinitely, as well as all other types of modified proteins (e.g., proteins resulting from phosphorylation, acetylation, myristoylation, palmitoylation, glycosylation, oxidation, formylation, amidation, polyglutamylation, ADP-ribosylation, pegylation, biotinylation, etc.).

[0031] The terms "express" and "expression" mean enabling or causing the generation of information in a DNA sequence, for example, generating RNA by activating cellular functions involved in the transcription of a DNA sequence.

[0032] As used herein, the term “virus-like particle” or “VLP” refers to a stable polymer assembly that contains the major structural proteins of a virus required to organize a viral capsid, but does not package viral genomic material. VLPs can be designed to package and deliver specific mRNA.

[0033] As used herein, the term “pseudotyping” refers to modifying a VLP tropism by replacing any component of a VLP with a component of a heterologous virus. “Pseudotyped VLP” means a recombinant VLP containing one or more heterologous envelope proteins. For example, a pseudotyped lentiviral VLP contains one or more envelope and / or spike proteins of non-lentiviral origin, or one or more envelope and / or spike proteins of a different species or subspecies of lentivirus.

[0034] As used herein, the term "circular RNA" refers to a single-stranded, covalently closed loop RNA molecule that does not have a 5′ or 3′ end.

[0035] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which the invention pertains. Any methods and materials similar to or equivalent to those described herein may also be used in the practice or testing of this disclosure, but only certain aspects of the methods and materials are described herein. All publications referenced herein are incorporated by reference to disclose and explain the methods and / or materials cited in those publications.

[0036] Before further describing this disclosure, it should be understood that this disclosure is not limited to the specific embodiments described and is therefore, naturally, subject to change. Furthermore, it should be understood that the terms used herein are for the purpose of describing specific embodiments only, and the scope of this disclosure is not intended to be restrictive, as it is limited solely by the appended claims.

[0037] Virus-like particles A major problem with mRNA therapeutics is that mRNA is typically degraded within a few hours of entering the cytosol. Novel approaches to in vitro synthesis of circular mRNA have increased the level and duration of protein synthesis from mRNA therapeutics, due to the long half-life of circular mRNA. However, genetically encoding circular mRNA in mammalian cells remains challenging.

[0038] This disclosure provides an improvement to virus-like particle technology in which circular mRNA, rather than linear mRNA, is packaged in VLPs. The disclosed “Tornado Translation System” utilizes the Tornado (Twister-optimized RNA for durable overexpression) circular RNA expression system to generate high levels of small circular RNA (Litke et al., “Highly Efficient Expression of Circular RNA Aptamers in Cells using Autocatalytic Transcripts,” Nat. Biotechnol. 37:667-675 (2019); this is incorporated herein by reference in its entirety). Examples of this disclosure show that the “Tornado Translation System” can be used to generate virus-like particles (VLPs) containing circular mRNA, resulting in VLPs that exhibit significantly longer protein synthesis compared to VLPs containing linear mRNA. Overall, these experiments provide a novel approach for delivering circular mRNA into target cells using VLPs.

[0039] Therefore, the first aspect of this disclosure relates to virus-like particles (VLPs). A virus-like particle is a circular RNA molecule comprising a first ligation sequence; an internal ribosome entry site (IRES) coupled to an RNA molecule encoding one or more peptides, wherein the internal ribosome entry site (IRES) coupled to the RNA molecule encoding one or more peptides is located at 3' of the first ligation sequence; and a plurality of proteins, one or more of which can self-assemble into nanoparticles.

[0040] As used herein, “internal ribosome entry site” or “IRES” refers to an internal region of an mRNA sequence that recruits a ribosome or other translation initiation mechanism to enable translation initiation.

[0041] An IRES may be a wild-type internal ribosome entry site or a modified internal ribosome entry site. A “modified IRES sequence” or “mutant IRES sequence” refers to an IRES sequence that includes one or more modifications, which may be additions, deletions, substitutions, and / or alterations of at least one (or more) nucleotides. Such modifications may result in the addition or deletion of structural elements (e.g., stop codons or transcription termination signals), elongation or shortening of existing stems, loops, cs, or pseudoknots, changes in the composition or structure of loops, stems, or pseudoknots, or any combination thereof.

[0042] Examples of IRES elements include, but are not limited to, CVB3 IRES (SEQ ID NO: 1), EMCV IRES (SEQ ID NO: 2), mutEMCV IRES (SEQ ID NO: 3), mutHCV IRES (SEQ ID NO: 4), CSFV IRES (SEQ ID NO: 5), HRV-B3 IRES (SEQ ID NO: 6), mutCVB3 IRES (SEQ ID NO: 7), and LIMA1 IRES (SEQ ID NO: 8).

[0043] In some embodiments, the IRES sequence is selected from the group consisting of SEQ ID NO: 1-8 or their derivatives (Table 1).

[0044] (Table 1) IRES sequence TIFF2026519817000002.tif155167TIFF2026519817000003.tif247167TIFF2026519817000004.tif136167

[0045] The Tornado system enables the conversion of expressed circular RNA into highly stable circular RNA, resulting in intracellular circular RNA expression at micromolar concentrations (see, for example, U.S. Patent No. 11,756,183 by Jaffrey et al., which is incorporated herein by reference in its entirety).

[0046] As will be explained in more detail below, the Pol III promoter expresses higher levels of RNA than the Pol II promoter. Therefore, Tornado translation systems according to this disclosure may benefit from using the Pol III promoter. Figure 7B shows that many commonly used IRES sequences, such as CVB3 (SEQ ID NO: 1), EMCV (SEQ ID NO: 2), and HRV-B3 (SEQ ID NO: 6), contain a Pol III termination signal (e.g., UUUU, UCUUU, or UUUAU). Therefore, in some embodiments, the IRES lacks a Pol III termination element. Such an IRES sequence may be wild-type or modified IRES sequence. For example, an IRES sequence may be a modified IRES sequence that has been modified to remove one or more Pol III termination signals. According to such an embodiment, the modified IRES is mutEMCV IRES (SEQ ID NO: 3).

[0047] Serial translation of circular RNA molecules requires an open reading frame (ORF) (e.g., an RNA molecule encoding one or more peptides) lacking a stop codon and an in-frame IRES. The term “stop codon” refers to a nucleotide triplet within mRNA that signals the termination of translation. Exemplary stop codons include, for example, UAG (in RNA) / TAG (in DNA) (also known as the “amber” stop codon), UAA / TAA (also known as the “ochre” stop codon), and UGA / TGA (also known as the “opal” or “umber” stop codon). Thus, in some embodiments, the IRES lacks a stop codon.

[0048] In some embodiments of the compositions, systems, and / or methods of the present disclosure, a portion of a first ligation sequence is complementary to a portion of a second ligation sequence. According to such embodiments, the 3' portion of the first ligation sequence is complementary to the 5' portion of the second ligation sequence. The portion of the first ligation sequence complementary to the portion of the second ligation sequence may be at least 18, at least 26, or at least 49 nucleotides long.

[0049] In the Tornado circular RNA expression system, RNA ligases such as RtcB can catalyze the ligation of a first ligation sequence containing a 5'-OH terminus with a second ligation sequence containing a 2',3'-cyclic phosphate terminus to form a circular RNA molecule (see, for example, Litke and Jaffrey, “Highly Efficient Expression of Circular RNA Aptamers in Cells using Autocatalytic Transcripts,” Nat. Biotechnol. 37(6):667-675 (2019); this is incorporated herein by reference in its entirety). Thus, after ligation by RNA ligase, the first ligation sequence is bound to the second ligation sequence.

[0050] In some embodiments, one or more peptides are selected from the group consisting of antibodies; antigens such as cancer neoepitopes and viral antigens; enzymes or gene-editing proteins such as Cas family proteins; reverse transcriptases; transposases / recombinases; transcription factors; chemokines; receptors such as chimeric antigen T cell receptors; channels; structural proteins; motor proteins; transport proteins; signaling proteins; cytoskeletal proteins; chaperone proteins; or any combination thereof.

[0051] As used herein, the term “neoepitope” refers to a potentially immunogenic epitope present in a protein associated with a disease caused by a mutation in DNA. “Cancer neoepitope” refers to a tumor-specific antigen associated with somatic mutations (see, for example, Wickstrom et al., “Cancer Neoepitopes for Immunotherapy: Discordance Between Tumor-Infiltrating T Cell Reactivity and Tumor MHC Peptidome Display,” Front. Immunol. 10:2766 (2019); this is incorporated herein by reference in its entirety). In some embodiments, one or more peptides comprise an antigen, such as a cancer neoepitope.

[0052] As described herein, Cas family proteins form ribonucleoprotein complexes with guide RNA that directs the Cas protein to a target DNA sequence. Suitable Cas proteins include Cas nuclease (Cas) proteins (i.e., Cas proteins capable of introducing double-strand breaks into a target nucleic acid sequence), Cas nickase (nCas) proteins (i.e., Cas protein derivatives capable of introducing single-strand breaks into a target nucleic acid sequence), and nuclease-dead Cas (dCas) proteins (i.e., Cas protein derivatives that lack nuclease activity).

[0053] The Cas family proteins can be selected from the group consisting of Cas9, nCas9, dCas9, Cas12a, nCas12a, dCas12a, Cas12b, nCas12b, and dCas12b.

[0054] In some embodiments, the Cas family protein is the Cas9 protein. As used herein, the terms “Cas9 protein” or “Cas9” include any recombinant or native form of CRISPR-related protein 9 (Cas9) or its variants or homologs. In some embodiments, the Cas9 protein is substantially identical to the protein identified by UniProt reference numbers Q99ZW2, G3ECR1, J7RUA5, A0Q5Y3, or J3F2B0 (these are incorporated herein by reference in their entirety) or a variant or homolog substantially identical thereto. For example, the Cas family protein may be an nCas9 protein or a dCas9 protein.

[0055] In some embodiments, the Cas family protein is the Cas12a protein. As used herein, the terms “Cas12a protein” or “Cas12a” include any recombinant or native form of CRISPR-related protein 12 (Cas12a) or its variants or homologs. In some embodiments, the Cas12a protein is substantially identical to the protein identified by UniProt reference numbers A0Q7Q2, U2UMQ6, A0A7C6JPC1, A0A7C9H0Z9, or A0A7J0AY55 (these are incorporated herein by reference in their entirety) or a variant or homolog substantially identical thereto. For example, the Cas family protein may be the nCas12a protein or the dCas12a protein.

[0056] In some embodiments, the Cas family protein is the Cas12b protein. As used herein, the terms “Cas12b protein” or “Cas12b” include any recombinant or native form of CRISPR-related protein 12 (Cas12b) or its variants or homologs. In some embodiments, the Cas12b protein is substantially identical to the protein identified by UniProt reference numbers T0D7A2, A0A6I3SPI6, A0A6I7FUC4, A0A6N9TP17, A0A6M1UF64, A0A7Y8V748, A0A7X7KIS4, A0A7X8X2U5, or A0A7X8UMW7 (these are incorporated herein by reference in their entirety) or a variant or homolog substantially identical to them. For example, the Cas family protein may be the nCas12b protein or the dCas12b protein.

[0057] As used herein, the term “chimeric antigen T cell receptor” refers to a genetically modified T cell receptor. In some embodiments, one or more peptides comprise a chimeric antigen T cell receptor.

[0058] Figure 11A is a schematic diagram of one embodiment of a virus-like particle containing a circular mRNA according to the present disclosure. This virus-like particle is generated by a system for producing virus-like particles according to the present disclosure. Such a system relies on a specific interaction between a protein-binding RNA aptamer (e.g., RNA aptamer MS2) and its congener RNA-binding protein (e.g., MS2 coat protein (MCP)) to package the circular mRNA of interest; and includes an envelope vector (e.g., a plasmid encoding a viral envelope and / or spike protein), a vector encoding a translation system according to the present disclosure (e.g., a transfer plasmid encoding a circular mRNA molecule having a protein-binding RNA aptamer (e.g., an MS2 stem-loop in its 3'UTR)), and a packaging vector encoding one or more proteins that can be organized into nanoparticles (e.g., an integrase-deficient packaging plasmid expressing a congener RNA-binding protein (e.g., MCP) fused to the N-terminus of a nucleocapsid protein). The VLP generated by this system contains a nucleocapsid protein fused to an MS2 coat protein (MCP), and the MCP recruits MS2 hairpin-containing circular mRNA into the VLP.

[0059] In some embodiments of virus-like particles according to this disclosure, the circular RNA molecule further comprises a stem-loop that binds to a congener RNA-binding protein, the stem-loop positioned at the 3' end of an RNA molecule encoding one or more peptides. Suitable protein-binding RNA aptamers are well known in the art and are provided in Table 2.

[0060] (Table 2) Suitable RNA aptamer stem-loop sequences TIFF2026519817000005.tif31167

[0061] In such embodiments, the stem loop is selected from the group consisting of MS2, PP7, BoxB, and Com. In some embodiments, the stem loop is an MS2 stem loop sequence.

[0062] The RNA aptamer PP7 is bound by the Pseudomonas aeruginosa PP7 bacteriophage coat protein (see, for example, Lu et al., “Delivering SaCas9 mRNA by Lentivirus-Like Bionanoparticles for Transient Expression and Efficient Genome Editing,” Nucleic Acids Research 47:e44-e44 (2019) and Lim et al., “Translational Repression and Specific RNA Binding by the Coat Protein of the Pseudomas Phage PP7,” J. Biol. Chem. 276(25):22507-22513 (2001); these are incorporated herein by reference in their entirety). In some embodiments, the stem-loop is the PP7 stem-loop sequence.

[0063] The RNA aptamer boxB is bound by the λ bacteriophage N protein (see, for example, Braselmann et al., “Illuminating RNA Biology: Tools for Imaging RNA in Live Mammalian Cells,” Cell Chem. Biol. 27(8):891-903 (2020); this is incorporated herein by reference in its entirety). In some embodiments, the stem-loop is a boxB stem-loop sequence.

[0064] The RNA aptamer com is bound by the aptamer-binding protein Com (see, for example, Lyu and Lu et al., “New Advances in Using Virus-like Particles and Related Technologies for Eukaryotic Genome Editing Delivery,” Int. J. Mol. Sci. 23(15):8750 (2022); this is incorporated herein by reference in its entirety). In some embodiments, the stem-loop is a Com stem-loop.

[0065] Nanoparticles may be viral capsids or viral capsid-like structures. The term “viral capsid” or “capsid” refers to the proteinaceous shell or coat of a virion or virus-like particle. The term “viral nucleocapsid” or “nucleocapsid” refers to the capsid and the associated nucleic acid molecule (e.g., a circular RNA molecule as per this disclosure). In the context of this disclosure, viral capsids or nucleocapsids may contain, protect, transport, and / or release circular RNA molecules (e.g., circular mRNA molecules) into host cells.

[0066] In some embodiments, a polyprotein comprises one or more proteins that can self-assemble into nanoparticles. Viral polyproteins can be cleaved into individual enzymes by viral enzymes or cellular enzymes. In some embodiments, the polyprotein comprises one or more proteins selected from the group of proteins consisting of nucleocapsid proteins, capsid proteins, substrate proteins, reverse transcriptases, proteases, and integrase deficiencies.

[0067] Suitable polyproteins include, but are not limited to, retrovirus-specific antigen (Gag) polyproteins, mammalian-specific antigen (Gag)-like polyproteins, and their derivatives.

[0068] In some embodiments, retrovirus group-specific antigen (Gag) polyproteins are retroviral polyproteins. Retroviral Gag polyproteins are organized from the amino terminus to the carboxyl terminus, for example, in domains that are cleaved into substrates, capsids, and nucleocapsid proteins (see, e.g., Coffin JM, Hughes SH, Varmus HE, editors. Retroviruses. Cold Spring Harbor (NY): Cold Spring Harbor Laboratory Press; 1997. Virion Proteins; this is incorporated herein by reference in its entirety).

[0069] In some embodiments, the retrovirus group-specific antigen is the human immunodeficiency virus type 1 (HIV-1) group-specific antigen (Gag). The HIV-1 group-specific antigen (Gag) comprises four major structural domains (substrate, capsid, nucleocapsid, and p6) as well as two smaller spacer peptides (SP1 and SP2) (see, for example, Marie and Gordon, “The HIV-1 Gag Protein Displays Extensive Functional and Structural Roles in Virus Replication and Infectivity,” Int. J. Mol. Sci. 23(14): 7569 (2022); this is incorporated herein by reference in its entirety).

[0070] In some embodiments, the mammalian group-specific antigen (Gag)-like polyprotein is PEG10. PEG10 is a Gag homolog that preferentially binds to its own mRNA and promotes its vesicular secretion (Segel et al., “Mammalian retrovirus-like protein PEG10 packages its own mRNA and can be pseudotyped for mRNA delivery,” Science 373(6557): 822-889 (2021); this is incorporated herein by reference in its entirety). The mRNA cargo of PEG10 can be reprogrammed by adjoining the untranslated region of PEG10 to an RNA molecule encoding one or more peptides. The PEG10 untranslated region is shown in Table 3 below.

[0071] (Table 3) PEG10 untranslated region (UTR) sequence TIFF2026519817000006.tif121167

[0072] Multiple proteins, one or more types, that can self-assemble into nanoparticles may include one or more structural proteins. For example, one or more structural proteins may be selected from the group consisting of capsid proteins, nucleocapsid proteins, substrate proteins, and combinations thereof.

[0073] In some embodiments, the capsid protein is a non-retroviral capsid protein. Exemplary non-retroviral capsid proteins are selected from the group consisting of herpes simplex virus (HSV) VP23, herpes simplex virus (HSV) VP19C, hepatitis B virus (HBV) core antigen, human papillomavirus (HPV) L1, human papillomavirus (HPV) L2, and combinations thereof.

[0074] In some embodiments, at least one of a plurality of proteins capable of self-assembling into nanoparticles contains or is fused to an RNA-binding protein / domain (e.g., an RNA aptamer-binding protein / domain). Suitable exemplary RNA-binding proteins and their amino acid sequences are identified in Table 4.

[0075] (Table 4) Suitable RNA-binding proteins TIFF2026519817000007.tif55167

[0076] In some embodiments, the RNA-binding protein domain is selected from the group consisting of MS2 coat protein (MCP), Com, PCP, and N22.

[0077] The RNA-binding domain may be located at the N-terminus or C-terminus of at least one of several proteins, one or more of which may be capable of self-assembling into nanoparticles containing or fused to the RNA-binding domain.

[0078] In some embodiments, the virus-like particle (VLP) further comprises one or more envelope and / or spike proteins.

[0079] Suitable viral envelope proteins include, but are not limited to, vesicular stomatitis virus envelope protein, rabies virus envelope protein, measles virus envelope protein, nipah virus envelope protein, chikungunya virus envelope protein, and sindobis virus envelope protein.

[0080] In some embodiments, one or more envelope and / or spike proteins are selected from the group consisting of vesicular stomatitis virus G (VSV G) protein, RabV-G, chikungunya virus E1 / E2, Sindbisvirus E1 / E2, measles virus H / F, and their derivatives.

[0081] In some embodiments, one or more envelope and / or spike proteins comprise a vesicular stomatitis virus G (VSV G) protein or a derivative thereof. According to such embodiments, one or more envelope and / or spike proteins may comprise mutant VSV-G(K47Q,R354A). In some embodiments, one or more envelope and / or spike proteins comprise mutant VSV-G(K47Q,R354A) in combination with an antibody or a targeting molecule such as scFv, TCR, or MHC peptide pair.

[0082] In some embodiments, one or more envelope and / or spike proteins include coronavirus spike proteins (e.g., SARS-CoV-2 spike proteins).

[0083] One or more envelope and / or spike proteins may include fusion proteins.

[0084] In some embodiments of virus-like particles according to this disclosure, the VLP further comprises a protein that is transported to the virus particle and / or cell surface membrane. According to such embodiments, the protein that is transported to the virus particle and / or cell surface membrane is a ligand or target-binding protein.

[0085] Proteins transported to viral particles and / or cell surface membranes may be selected from the group consisting of single-chain MHC fused to β2-microglobulin (B2M) and covalent peptides; single-chain antibody variable fragments fused to transmembrane domains; and antigens fused to transmembrane domains.

[0086] Vectors that code the translation system Another aspect of this disclosure relates to a vector encoding a translation system. The vector comprises a promoter and a nucleic acid sequence encoding an RNA molecule comprising: a nucleic acid sequence comprising: a first ribozyme; a first ligation sequence positioned 3' of the first ribozyme; an internal ribosome entry site (IRES) coupled to an RNA molecule encoding one or more peptides, wherein the internal ribosome entry site coupled to the RNA molecule encoding one or more peptides is positioned 3' of the first ligation sequence; a second ligation sequence positioned 3' of the internal ribosome entry site; and a second ribozyme positioned 3' of the second ligation sequence.

[0087] The term "vector" is used synonymously with "expression vector." The term "vector" can refer to a viral or nonviral, prokaryotic or eukaryotic, DNA or RNA sequence that can be transfected into a cell (called a "host cell"), resulting in the transcription of all or part of its sequence. Vectors are often assembled as a complex of elements derived from different viruses, bacteria, and mammalian genes. Vectors contain a variety of coding and non-coding sequences, such as sequences encoding selectable markers, sequences promoting growth within bacteria, or one or more transcription units expressed only in specific cell types. For example, mammalian expression vectors often contain both a prokaryotic sequence that promotes vector growth in bacteria and one or more eukaryotic transcription units expressed only in eukaryotic cells. It is recognized by those skilled in the art that the design of an expression vector may depend on factors such as the selection of the host cell to be transformed and the desired level of protein expression.

[0088] Suitable IRES sequences are described in detail above. In some embodiments, the IRES sequence is selected from the group consisting of SEQ ID NO: 1-8 or their derivatives. For example, the IRES may be selected from the group consisting of CVB3 IRES (SEQ ID NO: 1), EMCV IRES (SEQ ID NO: 2), mutEMCV IRES (SEQ ID NO: 3), mutHCV IRES (SEQ ID NO: 4), CSFV IRES (SEQ ID NO: 5), HRV-B3 IRES (SEQ ID NO: 6), mutCVB3 IRES (SEQ ID NO: 7), and LIMA1 IRES (SEQ ID NO: 8), or their derivatives.

[0089] As described in more detail above, IRES can be a wild-type internal ribosome entry site or a modified internal ribosome entry site.

[0090] The term “promoter” is used synonymously with “promoter element” and “promoter sequence.” Similarly, the term “enhancer” is used synonymously with “enhancer element” and “enhancer sequence.” The term “promoter” refers to the smallest sequence of a transgene that is sufficient to initiate transcription of the transgene’s coding sequence. Promoters can be constitutive or inductive. A constitutive promoter is considered a strong promoter if it drives transgene expression at a level comparable to that of the cytomegalovirus promoter (CMV) (Boshart et al., “A Very Strong Enhancer is Located Upstream of an Immediate Early Gene of Human Cytomegalovirus,” Cell 41:521 (1985); this is incorporated herein by reference in its entirety). Promoters can be synthetic promoters, modified promoters, or hybrid promoters. Promoters can be bound to other regulatory sequences / elements that, when bound to appropriate intracellular regulators, promote ("enhancer") or repress ("repressor") promoter-dependent transcription. A promoter, enhancer, or repressor is said to be "functionally linked" to a transgene if such an element controls or influences the transcription rate or efficiency of the transgene. For example, a promoter sequence located adjacent to the 5′ end of a transgene coding sequence is typically functionally linked to the transgene. As used herein, the term “regulatory element” is used synonymously with “regulatory sequence” and refers to promoters, enhancers, and other expression regulatory elements, or any combination of such elements.

[0091] The promoter is located 5′ (upstream) of the gene it controls. Many eukaryotic promoters contain two types of recognition sequences: the TATA box and the upstream promoter element. Located 25–30 bp upstream of the transcription start site, the TATA box is thought to be involved in directing RNA polymerase II to begin RNA synthesis at the correct site. In contrast, the upstream promoter element determines the rate at which transcription is initiated. These elements can act in any direction, but they must be located within 100–200 bp upstream of the TATA box.

[0092] Enhancer elements can stimulate transcription from linked homogeneous or heterogeneous promoters up to 1000 times. Enhancer elements often maintain their activity even when their direction is reversed (Li et al., “High Level Desmin Expression Depends on a Muscle-Specific Enhancer,” J. Bio. Chem. 266(10):6562-6570 (1991); this is incorporated herein by reference in its entirety). Furthermore, unlike promoter elements, enhancers can remain active even when located downstream from the transcription start site, for example, within an intron, or even quite far from the promoter (Yutzey et al., “An Internal Regulatory Element Controls Troponin I Gene Expression,” Mol. Cell. Bio. 9(4):1397-1405 (1989); this is incorporated herein by reference in its entirety).

[0093] RNA polymerase II (Pol II) is a complex 12-subunit enzyme that transcribes all protein-coding genes and many non-coding RNAs in eukaryotic genomes (Schier and Taatjes, “Structure and mechanism of the RNA polymerase II transcription machinery,” Genes Dev. 34(7-8): 465-488 (2020); this is incorporated herein by reference in its entirety). Suitable Pol II promoters include, but are not limited to, CMV, SV40, PGK, and HSV-TK. Suitable Pol II promoter sequences are shown in Table 5 below.

[0094] (Table 5) Suitable Pol II promoter sequences TIFF2026519817000008.tif237167

[0095] In some embodiments, the IRES is selected from the group consisting of CVB3 IRES (SEQ ID NO: 1), HRV-B3 IRES (SEQ ID NO: 6), EMCV IRES (SEQ ID NO: 2), mutHCV IRES (SEQ ID NO: 3), and LIMA1 IRES (SEQ ID NO: 8), or their derivatives.

[0096] Figures 7A and 8A demonstrate that when IRES constructs are expressed from the Pol II CMV promoter in the Tornado translation system, CVB3 IRES (SEQ ID NO: 1) produces more protein than EMCV IRES (SEQ ID NO: 2) and slightly more protein than HRV-B3 IRES (SEQ ID NO: 6). Therefore, in some embodiments, the Pol II promoter is the CMV promoter.

[0097] In some embodiments, the promoter is a Pol III promoter. Preferred Pol III promoter sequences are provided in Table 6 below.

[0098] (Table 6) Suitable Pol III promoter sequences TIFF2026519817000009.tif97167

[0099] Suitable Pol III promoters include, but are not limited to, U6, 7SK, H1, and their derivatives.

[0100] In some embodiments, if the vector contains a Pol III promoter, the IRES may be selected from the group consisting of mutEMCV or swine cholera virus (CSFV) IRES (SEQ ID NO: 5), mutEMCV IRES (SEQ ID NO: 3), mutCVB3 IRES (SEQ ID NO: 7), and their derivatives.

[0101] In some embodiments, the IRES lacks a Pol III termination element and / or signal.

[0102] The term "ribozyme" refers to an RNA sequence that hybridizes to a complementary sequence in substrate RNA and cleaves the substrate RNA sequence-specifically at the substrate cleavage site. Typically, a ribozyme contains a catalytic region adjacent to two binding regions. The ribozyme binding region hybridizes to the substrate RNA, and the catalytic region cleaves the substrate RNA at the substrate cleavage site, producing a cleaved RNA product. The nucleotide sequence of the ribozyme binding region may be fully or partially complementary to the substrate RNA sequence to which the ribozyme hybridizes.

[0103] In some embodiments of the vectors according to this disclosure, a portion of the first ligation sequence is complementary to a portion of the first ribozyme, and a portion of the second ligation sequence is complementary to a portion of the second ribozyme (see, for example, U.S. Patent No. 11,756,183 by Jaffrey et al., which is incorporated herein by reference in its entirety).

[0104] In some embodiments, a portion of the first ligation sequence is complementary to a portion of the second ligation sequence. The portion of the first ligation sequence complementary to the portion of the second ligation sequence may be at least 18, at least 26, or at least 49 nucleotides long.

[0105] In some embodiments, each of the first and second ribozymes contains a sequence that can be cleaved to produce a 5'-OH terminus and a 2',3'-cyclic phosphate terminus. According to such embodiments, each of the first and second ribozymes is a self-cleaving ribozyme. Self-cleaving ribozymes are known in the art and are characterized by different active site structures and differing but similar biochemical properties. The cleavage activity of self-cleaving ribozymes is highly dependent on divalent cations, pH, and base-specific mutations, which can cause changes in nucleotide arrangement and / or electrostatic potential around the cleavage site (see, for example, Weinberg et al., “New Classes of Self-Cleaving Ribozymes Revealed by Comparative Genomics Analysis,” Nat. Chem. Biol. 11(8): 606-610 (2015) and Lee et al., “Structural and Biochemical Properties of Novel Self-Cleaving Ribozymes,” Molecules 22(4):E678 (2017); these are incorporated herein by reference in their entirety).

[0106] The first and second ribozymes may be independently selected from the group consisting of Hammerhead, Hairpin, Hepatitis delta virus (HDV), Varkud Satellite (VS), Vg1, glucosamine-6-phosphate synthase (glmS), Twister, Twister Sister, Hatchet, Pistol ribozymes, synthetic ribozymes, or their derivatives (see, for example, Harris et al., “Biochemical Analysis of Pistol Self-Cleaving Ribozymes,” RNA 21(11):1852-8 (2015); this is incorporated herein by reference in its entirety).

[0107] In some embodiments, the first ribozyme is a P3 twister ribozyme, and the second ribozyme is a P1 twister ribozyme. A twister ribozyme contains three essential stems (P1, P2, and P4), with up to three additional stems (P0, P3, and P5) optionally present. Three distinct types of twister ribozymes have been identified depending on whether the terminus is located at stem P1 (P1 type), stem P3 (P3 type), or stem P5 (P5 type) (see, for example, Roth et al., “A Widespread Self-Cleaving Ribozyme Class is Revealed by Bioinformatics,” Nature Chem. Biol. 10(1):56-60 (2014); this is incorporated herein by reference in its entirety). The folding of the twister ribozyme is predicted to involve two pseudoknots (T1 and T2, respectively) formed by two long-range tertiary interactions (see Gebetsberger et al., “Unwinding the Twister Ribozyme: from Structure to Mechanism,” WIREs RNA 8(3):e1402 (2017); this is incorporated herein by reference in its entirety).

[0108] In some embodiments, one or more peptides are selected from the group consisting of antibodies; antigens such as cancer neoepitopes and viral antigens; enzymes or gene-editing proteins such as Cas family proteins; reverse transcriptases; transposases / recombinases; transcription factors; chemokines; receptors such as chimeric antigen T cell receptors; channels; structural proteins; motor proteins; transport proteins; signaling proteins; cytoskeletal proteins; chaperone proteins; or any combination thereof.

[0109] In some embodiments, the RNA molecule further encodes a stem-loop that binds to a congener RNA-binding protein, the stem-loop located at 3' of the ligation sequence. Preferred stem-loops are described above and include, but are not limited to, MS2, PP7, BoxB, and Com.

[0110] IRES may or may not contain a stop codon.

[0111] Pharmaceutical composition containing virus-like particles Virus-like particles according to this disclosure may be formulated as a pharmaceutical composition for administration to a subject.

[0112] The pharmaceutical composition may include a “pharmaceutically acceptable inert carrier,” which is intended to include one or more inert excipients, such as, but not limited to, starch, polyol, granulator, microcrystalline cellulose, diluent, lubricant, binder, and disintegrant. If necessary, the tablet dosage forms of the disclosed compositions may be coated by standard aqueous or non-aqueous techniques. The “pharmaceutically acceptable carrier” also includes controlled release means.

[0113] The pharmaceutical composition may also optionally contain other therapeutic ingredients, anticaking agents, preservatives, sweeteners, colorants, flavorings, desiccants, plasticizers, dyes, etc. Any such optional ingredients must be compatible with the cyclic RNA molecules or DNA constructs disclosed herein to ensure the stability of the formulation. The composition may optionally contain other additives, such as lactose, glucose, fructose, galactose, trehalose, sucrose, maltose, raffinose, maltitol, melegitose, stachyose, lactitol, palatinite, starch, xylitol, mannitol, myo-inositol, etc., and their hydrates, as well as amino acids, such as alanine, glycine, and betaine, and peptides and proteins, such as egg white.

[0114] Examples of pharmaceutically acceptable carriers and pharmaceutically acceptable inert carriers and excipients used as the aforementioned additional components include, but are not limited to, binders, fillers, disintegrants, lubricants, antimicrobial agents, and coatings.

[0115] The pharmaceutical compositions provided herein include compositions containing virus-like particles in accordance with this disclosure in a therapeutically effective amount, i.e., an amount effective to achieve its intended purpose. The actual amount effective for a particular use depends, in particular, on the disease, condition, or disorder being treated. When administered in a manner for treating a disease, condition, or disorder, such compositions contain an amount of virus-like particles disclosed herein to achieve a desired outcome, e.g., induction of an immune response, or targeted treatment of the disease or condition (e.g., by reducing, eliminating, or slowing the progression of the symptoms of the disease or condition). Determining the therapeutically effective amount of virus-like particles disclosed herein is well within the capabilities of those skilled in the art, particularly in light of the detailed disclosure herein.

[0116] Suitable drug dosage forms for injection or infusion may include sterile aqueous solutions or dispersions or sterile powders containing the virus, with sterile powders being suitable for the immediate preparation of sterile injection or infusion solutions or dispersions. In all cases, the final dosage form should be sterile, fluid, and stable under manufacturing and storage conditions. The liquid carrier or vehicle may be a solvent or liquid dispersion medium, for example, containing water, ethanol, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.), vegetable oils, non-toxic glyceryl esters, and suitable mixtures thereof. Adequate fluidity is maintained, for example, by liposome formation, maintenance of the required particle size in the case of dispersions, or the use of surfactants. Prevention of the action of undesirable microorganisms can be achieved by various antimicrobial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. In many cases, it is preferable to include isotonic agents, such as sugars, buffers, or sodium chloride.

[0117] Sterile injection solutions are prepared by incorporating the required amount of virus-like particles, along with various other components listed above, into a suitable solvent, and subsequently performing filtration sterilization as necessary.

[0118] Suitable liquid carriers include water, alcohol or glycol, or water-alcohol / glycol blends, in which the virus can be effectively dissolved or dispersed with the optional help of a non-toxic surfactant. Auxiliaries such as fragrances and additional antibacterial agents can be added to optimize the properties for a given application. The resulting liquid composition can be applied from an absorbent pad, used to impregnate bandages and other dressings, or sprayed onto the affected area using a pump or aerosol spray.

[0119] A system for producing VLPs including a circular RNA translation system. Another aspect of this disclosure relates to a system for producing virus-like particles (VLPs) containing a circular RNA translation system. The system includes a packaging vector encoding one or more proteins that can self-assemble into nanoparticles; an envelope vector; and a vector encoding a translation system according to this disclosure.

[0120] A system for producing virus-like particles according to this disclosure relies on the self-assembly of viral structural proteins (e.g., capsid, nucleocapsid, substrate, envelope, and / or spike protein) within the virus-like particles, as well as on the specific interaction between RNA aptamers (e.g., protein-binding RNA aptamers) and their related RNA-binding proteins (e.g., RNA aptamer-binding proteins).

[0121] Viral capsid proteins are structural components of viruses or virus-like particles that can bind to nucleic acid molecules and package them. In some embodiments of a system for producing virus-like particles according to this disclosure, the VLP comprises a viral capsid protein that has self-assembled into a viral capsid or viral capsid-like structure. In such embodiments, the viral capsid protein is fused to an RNA-binding protein that recognizes a congener RNA aptamer.

[0122] Multiple proteins, one or more of which can self-assemble into nanoparticles, can constitute a polyprotein. Preferred polyproteins are described above. In some embodiments, the polyprotein is selected from the group consisting of retrovirus group-specific antigen (Gag) polyproteins (e.g., human immunodeficiency virus type 1 (HIV-1) group-specific antigen (Gag)), mammalian group-specific antigen (Gag)-like polyproteins (e.g., PEG10), and their derivatives.

[0123] As described above, a polyprotein may include one or more proteins selected from the group of proteins consisting of nucleocapsid proteins, capsid proteins, substrate proteins, reverse transcriptases, proteases, and integrase deficiencies.

[0124] In some embodiments, a plurality of one or more types of proteins that can self-assemble into nanoparticles include one or more structural proteins. For example, the one or more structural proteins may be selected from the group consisting of capsid proteins, nucleocapsid proteins, substrate proteins, and combinations thereof. In such embodiments, the capsid protein is a non-retroviral capsid protein. Suitable exemplary non-retroviral capsid proteins may be selected from the group consisting of herpes simplex virus (HSV) VP23, herpes simplex virus (HSV) VP19C, hepatitis B virus (HBV) core antigen, human papillomavirus (HPV) L1, human papillomavirus (HPV) L2, and combinations thereof.

[0125] Suitable RNA aptamers and their related RNA-binding proteins are well known in the art (see, for example, Jiang et al., “Multiplexed Gene Engineering Based on dCas9 and gRNA-tRNA Array Encoded on Single Transcript,” Int. J. Mol. Sci. 24(10): 8535 (2023); this is incorporated herein by reference in its entirety) and are provided in Table 7.

[0126] (Table 7) Protein-binding RNA aptamers and their related RNA-binding proteins TIFF2026519817000010.tif31164

[0127] In some embodiments, the RNA-binding protein is selected from the group consisting of MS2 coat protein (MCP), Com, PCP, and N22.

[0128] In a system for producing virus-like particles according to this disclosure, at least one of a plurality of one or more proteins capable of self-assembling into nanoparticles contains or is fused to an RNA-binding protein domain. In some embodiments, the RNA-binding protein domain is located at the N-terminus or C-terminus of at least one of a plurality of one or more proteins capable of self-assembling into nanoparticles containing or fused to an RNA-binding domain.

[0129] Figure 11A shows an exemplary system according to this disclosure, comprising a packaging vector encoding one or more species of proteins (e.g., a capsid, a nucleocapsid, and a substrate protein) that can self-assemble into nanoparticles, an envelope vector encoding a viral envelope and / or spike protein, and a vector encoding a translation system according to this disclosure. In this exemplary system, the packaging vector encodes a nucleocapsid protein fused to an MS2 coat protein (MCP), and the vector encoding the translation system encodes a circular mRNA molecule containing an MS2 aptamer sequence. Because it contains an MS2 aptamer sequence, upon expression, this RNA is packaged into the VLP by binding to the MCP domain in the nucleocapsid protein.

[0130] According to the system for producing virus-like particles in accordance with this disclosure, the envelope vector may encode one or more envelope and / or spike proteins. Suitable viral envelope and / or spike proteins are provided in Table 8.

[0131] (Table 8) Suitable viral envelope and / or spike proteins TIFF2026519817000011.tif203163TIFF2026519817000012.tif251163

[0132] Suitable viral envelope proteins include, but are not limited to, vesicular stomatitis virus envelope protein, rabies virus envelope protein, measles virus envelope protein, nipah virus envelope protein, chikungunya virus envelope protein, and sindobis virus envelope protein.

[0133] In some embodiments, one or more envelope and / or spike proteins are selected from the group consisting of vesicular stomatitis virus G (VSV G) protein, RabV-G, chikungunya virus E1 / E2, Sindbisvirus E1 / E2, measles virus H / F, and their derivatives.

[0134] In some embodiments, one or more envelope and / or spike proteins include vesicular stomatitis virus G (VSV G) proteins or derivatives thereof. For example, one or more envelope and / or spike proteins may include mutant VSV-G (K47Q, R354A).

[0135] In some embodiments, one or more envelope and / or spike proteins include coronavirus spike proteins.

[0136] In some embodiments, one or more envelope and / or spike proteins include a fusion protein.

[0137] In some embodiments, the system further comprises a vector encoding a protein that is transported to the viral particle and / or the cell surface membrane. In such embodiments, the protein transported to the viral particle and / or the cell surface membrane is a ligand or target-binding protein.

[0138] Proteins transported to viral particles and / or cell surface membranes may be selected from the group consisting of single-chain MHC fused to β2-microglobulin (B2M) and covalent peptides; single-chain antibody variable fragments fused to transmembrane domains; and antigens fused to transmembrane domains.

[0139] Method for producing VLPs containing a circular RNA translation system Another aspect of the present disclosure relates to a method for producing VLPs comprising a circular RNA translation system. The method comprises the steps of: providing host cells; transfecting the host cells with a system according to the present disclosure; and culturing the host cells under conditions suitable for expressing a packaging vector, an envelope vector, and a circular RNA expression vector in the host cells, wherein the culture generates virus-like particles comprising the circular RNA translation system.

[0140] Host cells may contain endogenous RNA ligases. In some embodiments, endogenous RNA ligases have the ability to catalyze the cyclization of ribonucleic acid molecules having a 5'-OH and a 2',3'-cyclic phosphate. According to some embodiments, the endogenous RNA ligase is RtcB. It is recognized that there are several enzymes whose function is related to RtcB, but whose sequence is not related to RtcB. In some embodiments, the RNA ligase is any RNA ligase that detects a 5'-OH and a 2'-3'-cyclic phosphate terminus.

[0141] The cells may be eukaryotic cells. Examples of eukaryotic cells include yeast cells, insect cells, fungal cells, plant cells, and animal cells (e.g., mammalian cells). Suitable mammalian cells include, but are not limited to, human, non-human primate, cat, dog, sheep, goat, cattle, horse, pig, rabbit, and rodent cells. The host cells are preferably present in a cell culture (ex vivo) or within a fully viable organism (in vivo).

[0142] In some embodiments, the host cell is a mammalian cell line. Suitable mammalian cell lines are well known in the art and include, but are not limited to, HEK293T cells, HEK293FT cells, and their derivatives.

[0143] Suitable methods for introducing RNA molecules into cells are well known in the art and include, but are not limited to, the use of transfection reagents (e.g., FuGENE® transfection reagents), electroporation, microinjection, calcium phosphate transfection, DEAE-dextran, and liposome-mediated transfection.

[0144] The culture of host cells can be carried out under known culture conditions. For example, when the host cells are mammalian cells or derived from mammalian cells, culture at a temperature of 30–37°C, humidity of 95%, and CO2 concentration of 5–10% is exemplified, but the methods for producing virus-like particles according to this disclosure are not limited to such conditions. Culture can also be carried out at temperatures, humidity, or CO2 concentrations outside the above ranges, as long as the desired host proliferation or the desired production of virus-like particles by the host cells can be achieved. The culture period is also not particularly limited and may be any culture period for which the desired host cell proliferation or the desired production of virus-like particles can be achieved. In some embodiments, the culture is carried out for at least 6 hours to at least 12 hours to at least 168 hours, or any time in between. Thus, in some embodiments, the culture is carried out for at least 12 hours, at least 24 hours, at least 36 hours, at least 48 hours, at least 60 hours, at least 72 hours, at least 84 hours, at least 96 hours, at least 108 hours, at least 120 hours, at least 132 hours, at least 144 hours, at least 156 hours, or at least 168 hours. In some embodiments, the culture is performed for 72 hours.

[0145] In some embodiments, culturing transfected host cells involves culturing the host cells in cell culture medium after transfection and then changing the cell culture medium. In such embodiments, the cell culture medium may be changed at least once at about 6 hours after transfection, about 12 hours after transfection, about 18 hours after transfection, or about 24 hours after transfection. In some embodiments, the cell culture medium is changed at least once at about 24 hours after transfection of the host cells.

[0146] In some embodiments, culturing transfected host cells results in the secretion of virus-like particles into the cell culture medium. Therefore, in some embodiments, the method further involves collecting the cell culture medium and purifying the generated virus-like particles, including the circular RNA translation system, from the cell culture medium. The cell culture medium may be collected at least once, at least twice, or at least three times after host cell transfection. According to such embodiments, the cell culture medium may be collected at any time after host cell transfection. In some embodiments, the cell culture medium is collected at about 24 hours, about 36 hours, about 48 hours, about 60 hours, about 72 hours, about 84 hours, or about 96 hours after transfection. For example, the cell culture medium may be collected at about 72 hours after transfection.

[0147] Methods for purifying virus-like particles after collection of cell culture medium from transfected host cells are well known in the art and include, but are not limited to, centrifugation, ultracentrifugation, filtration, ion exchange chromatography, and dialysis (see, for example, Gonzalez-Dominguez et al., “A Four-Step Purification Process for Gag VLPs: From Culture Supernatant to High-Purity Lyophilized Particles,” Vaccines 9(10): 1154 (2021) and Arevalo et al., “Expression and Purification of Virus-Like Particles for Vaccination,” J. Vis. Exp. 112: 54041 (2016); these are incorporated herein by reference in their entirety).

[0148] In some embodiments, purifying virus-like particles after collection of cell culture medium involves removing cellular debris. This can be done, for example, by centrifugation at approximately 500 g for approximately 10 minutes, followed by, for example, ultracentrifugation, concentration, diafiltration, filtration, ion exchange chromatography, dialysis, and / or a combination thereof.

[0149] Methods for inducing an immune response against pathogens Another aspect of this disclosure relates to a method for inducing an immune response to a pathogen. This method involves administering an effective dose of virus-like particles (VLPs) according to this disclosure, VLPs manufactured using a system according to this disclosure, or VLPs manufactured using a method according to this disclosure to a target.

[0150] In some embodiments, the pathogen is a viral pathogen, a prokaryotic pathogen, or a eukaryotic pathogen.

[0151] Suitable viral pathogens include, but are not limited to, adenovirus, Andes virus, Chikungunya virus, Coconut Creek virus, Coxsackievirus, Crimean-Congo hemorrhagic fever virus, cytomegalovirus, dengue virus, Eastern equine encephalitis virus, Ebola virus, Epstein-Barr virus, Hantavirus, Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, Hepatitis D virus, Hepatitis E virus, Herpes simplex virus 1 (HSV-1), Herpes simplex virus 2 (HSV-2), Human immunodeficiency virus 1 (HIV-1), Human immunodeficiency virus 2 (HIV-2), and Human papillomavirus (HPV). These include influenza A virus, influenza B virus, Japanese encephalitis virus, Junin virus, Lacrosse virus, Lassa fever virus, Marburg virus, measles virus, MERS-CoV, mumps virus, Nipah virus, norovirus, parvovirus B19, poliovirus, rabies virus, respiratory syncytial virus (RSV), rhinovirus, Ross River virus, rotavirus, rubella virus, SARS-CoV, SARS-CoV-2, severe fever with thrombocytopenia syndrome virus, varicella-zoster virus (VZV), Venezuelan encephalitis virus, West Nile virus, yellow fever virus, and Zika virus.

[0152] Suitable prokaryotic pathogens include, without limitation, Gram-positive and Gram-negative bacteria. In some aspects, the pathogens include Bacillus anthracis, Bacillus cereus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Clostridium tetani, Corynebacterium diphtheriae, Enterococcus faecalis, Enterococcus faecium, Erysipelothrix rhusiopathiae, Gardnerella vaginalis, Group A Streptococcus, and Group B Streptococcus. Streptococcus), Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Nocardia asteroids, Propionibacterium acnes, Rhodococcus equi, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus saprophyticus, Staphylococcus haemolyticus, Staphylococcus lugdunensis, Staphylococcus saprophyticus, Streptococcus agalactia agalactiae, Streptococcus mutansIt is a Gram-positive bacterium selected from the group consisting of Streptococcus mutans, Streptococcus pneumoniae, and Streptococcus pyogenes.

[0153] In some ways, the pathogens include Acinetobacter baumannii, Bordetella pertussis, Brucella abortus, Burkholderia pseudomallei, Burkholderia mallei, Campylobacter fetus, Campylobacter jejuni, Coxiella burnetii, Enterobacter aerogenes, Enterobacter cloacae, Escherichia coli, Francisella tularensis, Haemophilus influenzae, and Helicobacter pylori. * Neisseria pylori*, * Klebsiella oxytoca*, * Klebsiella pneumoniae*, * Legionella pneumophila*, * Neisseria gonorrhoeae*, * Neisseria meningitidis*, * Pseudomonas aeruginosa*, * Rickettsia prowazekii*, * Salmonella enterica*, * Salmonella typhi*, * Shigella dysenteriae*, * Shigella flexneri*, * Shigella sonnei*, * Vibrio cholerae*, * Yersinia enterocolitica*, * Yersinia pestis* It is a Gram-negative bacterium selected from the group consisting of Mycobacterium pestis and Mycobacterium pseudotuberculosis (Yersinia pseudotuberculosis).

[0154] In some aspects, the pathogen is a eukaryotic pathogen. Suitable eukaryotic pathogens include, but are not limited to, protozoan parasites such as Cryptosporidium spp., Cyclospora cayetanenensis, Entamoeba histolytica, Giardia intestinalis, Plasmodium falciparum, Plasmodium malariae, Toxoplasma gondii, and Trypanosoma cruzi (see, for example, Hague, R., “Human Intestinal Parasites,” J. Health Popul. Nutr. 25(4): 384-391 (2007); this is incorporated herein by reference in its entirety).

[0155] Additional suitable eukaryotic pathogens include, but are not limited to, helminthic parasites such as Ancylostoma duodenale, Ascaris lumbricoides, Necator americanus, and Trichuris trichiura (see, for example, Geiger et al., “Necator americanus and Helminth Co-Infections: Further Down-Modulation of Hookworm-Specific Type 1 Immune Responses,” PLoS Negl. Trop. Dis. 5(9): e1280 (2011); this is incorporated herein by reference in its entirety).

[0156] In some embodiments of the methods for inducing an immune response to a pathogen according to this disclosure, the term “subject” means any subject, in particular human, for which an induction of an immune response to a pathogen is desired. The subject may be a mammalian subject, for example, a human subject. Preferred human subjects include, but are not limited to, children, adults, and elderly subjects. The mammalian subject may also be non-human, such as cattle, sheep, pigs, cats, horses, mice, dogs, rabbits (lapines), etc. In some embodiments, the subject is a non-human primate.

[0157] In some embodiments, the subject is a non-mammalian subject, such as a bird or an insect.

[0158] As used herein, the term “immune response” refers to the development of humoral and / or cellular immune responses in a subject. “Humoral immune response” refers to an immune response mediated by antibody molecules, and “cellular immune response” refers to an immune response mediated by T lymphocytes and / or other leukocytes.

[0159] The immune response may include one or more of the following effects: antibody production by B cells, and / or activation of suppressor, cytotoxic, or helper T cells and / or T cells specifically directed to antigens present in the composition of interest or vaccine. These responses may help neutralize infectivity and / or provide protection to the immunized host by mediating antibody-complement or antibody-dependent cell-mediated cytotoxicity (ADCC). Such responses can be determined using standard immunoassays and neutralization assays well known in the art.

[0160] The step of administering an effective dose of virus-like particles (VLPs) according to this disclosure, VLPs manufactured using a system according to this disclosure, or VLPs manufactured using a method according to this disclosure may be effective in inducing humoral and / or cellular immune responses to a pathogen in a subject.

[0161] In some embodiments of the methods for inducing an immune response described herein, the immune response is a humoral immune response. The presence of a humoral immune response can be determined and monitored by examining a biological sample from the subject (e.g., blood, plasma, serum, urine, saliva, feces, CSF, or lymph) for the presence of antibodies directed at components of virus-like particles administered to the subject, or for example, antibodies directed at a pathogen of interest.

[0162] In some embodiments of the methods for inducing an immune response described herein, the immune response is a cellular immune response. The presence of a cell-mediated immune response can be determined by proliferation assays (CD4+ T cells) or CTL (cytotoxic T lymphocyte) assays, which are known in the art.

[0163] Methods for treating the target Another aspect of this disclosure relates to a method for treating a subject. This method comprises the steps of administering to a subject in need a virus-like particle (VLP) according to this disclosure, a VLP produced using a system according to this disclosure, or a VLP produced using a method according to this disclosure, wherein, after administration, one or more peptides are expressed in the cells of the subject, thereby treating the subject.

[0164] The terms “to treat,” “to treat,” “treatment,” and their grammatical variations mean providing an individual subject to a protocol, regimen, process, or treatment in which a physiological response or outcome is desired in that subject, e.g., a patient. In particular, the methods and compositions of the present invention can be used to slow the development of disease symptoms, delay the onset of a disease or condition, or halt the progression of disease development. However, since not all treated subjects may respond to a particular treatment protocol, regimen, process, or treatment, a treatment does not require that the desired physiological response or outcome be achieved in all subjects or subject populations, e.g., patient populations. Thus, a given subject or subject population, e.g., patient populations, may not respond to a treatment, or may respond inadequately.

[0165] In some embodiments of the methods of treating subjects pursuant to this disclosure, the term “subject” means any mammalian subject, in particular human, for which diagnosis, treatment, or therapy is desired. Subjects may be mammalian subjects, amphibian subjects, avian subjects, fish, or reptile subjects.

[0166] In some embodiments, the subject is a mammalian subject. With respect to the subject of the methods described herein, the term “mammal” or “mammalian subject” means any animal classified as a mammal, including humans, non-human primates, livestock and agricultural animals, as well as zoo, sport, or pet animals, such as dogs, horses, cats, cows, sheep, goats, pigs, camels, etc.

[0167] In some embodiments, the mammalian subject is the human subject. The human subject may be an infant, child, adolescent, adult, or elderly person.

[0168] In some embodiments, the methods of the present disclosure have applications in laboratory animals, in veterinary applications, and in the development of animal models, including but not limited to rodents such as mice, rats, and hamsters, and primates.

[0169] According to the methods of this disclosure, the term “administer” means to a subject by oral administration, suppository administration, topical contact, intravenous, parenteral, intraperitoneal, intramuscular, intrafocal, intrathecal, intracranial, intranasal or subcutaneous administration, or implantation of a sustained-release device, such as a miniature osmotic pump. Administration is by any route, including parenteral and transmucosal (e.g., buccal, sublingual, palatal, gingival, transnasal, transvaginal, rectal, or transdermal). Parenteral administration includes, for example, intravenous, intramuscular, intraarteriole, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial. Other modes of delivery include, but are not limited to, the use of liposomal formulations, intravenous injection, and transdermal patches.

[0170] The VLPs or VLP-containing pharmaceutical compositions of this disclosure may be administered to a subject alone or in combination. Co-administration is intended to include simultaneous or sequential administration of (one or more compounds or drugs) the VLPs or VLP-containing pharmaceutical compositions of this disclosure individually or in combination. Accordingly, the VLPs or VLP-containing pharmaceutical compositions of this disclosure may be combined with other active substances as needed (for example, to induce an immune response or to treat a subject). The VLPs or VLP-containing pharmaceutical compositions of this disclosure may be formulated as applicator sticks, solutions, suspensions, emulsions, gels, creams, ointments, pastes, jellies, paints, powders, and aerosols. Oral preparations include tablets, pills, powders, dragees, capsules, liquids, lozenges, cachets, gels, syrups, slurries, suspensions, etc., suitable for ingestion by a patient. Preparations in solid form include powders, tablets, pills, capsules, cachets, suppositories, and dispersible granules. Preparations in liquid form include solutions, suspensions, and emulsions, such as water or water / propylene glycol solutions. The VLPs or VLP-containing pharmaceutical compositions of this disclosure may further include components for providing sustained release and / or comfort. Such components include high molecular weight anionic mucus-mimicking polymers, gelling polysaccharides, and micronized drug carrier substrates. These components are described in more detail in U.S. Patents 4,911,920; 5,403,841; 5,212,162; and 4,861,760, which are incorporated herein by reference in their entirety. The VLPs or VLP-containing pharmaceutical compositions of this disclosure may also be delivered as microspheres for sustained release in the body.For example, microspheres can be administered via intradermal injection of drug-containing microspheres that are gradually released subcutaneously (see, e.g., Rao, J. Biomater Sci. Polym. Ed. 7:623-645 (1995); this is incorporated herein by reference in its entirety); as a biodegradable and injectable gel formulation (see, e.g., Gao Pharm. Res. 12:857-863 (1995); this is incorporated herein by reference in its entirety); or as microspheres for oral administration (see, e.g., Eyles, J. Pharm. Pharmacol. 49:669674, 1997; this is incorporated herein by reference in its entirety).

[0171] The dosage and frequency (single or multiple doses) administered to mammals may vary depending on various factors, such as whether the mammal has another disease and its route of administration; the recipient's size, age, sex, health, weight, body mass index, and diet; the nature and severity of the symptoms of the disease being treated (e.g., symptoms of neurodegenerative diseases such as cardiomyopathy or Parkinson's disease, and the severity of such symptoms), the type of concurrent treatment, and complications from the disease being treated or other health-related problems. Other treatment plans or therapeutic agents may be used in conjunction with the methods and compounds of this disclosure. Established dosage adjustments and manipulations (e.g., frequency and duration) are well within the capabilities of those skilled in the art.

[0172] For any VLP or VLP-containing pharmaceutical composition described herein, the therapeutically effective dose can be first determined from a cell culture assay. The target concentration is the concentration of the active compound that enables the method described herein, as measured using methods described herein or known in the art.

[0173] The therapeutically effective dose for use in humans can also be determined from animal models. For example, the dose for humans can be formulated to achieve a concentration that has been proven effective in animals. The dose in humans can be adjusted, as described above, by monitoring the efficacy of the compound and adjusting the dose upward or downward. Adjusting the dose to achieve the maximum effect in humans based on the methods described above and other methods is well within the capabilities of those skilled in the art.

[0174] The dosage may vary depending on the requirements of the subject and the VLP or VLP-containing pharmaceutical composition used. The dose administered to the subject should be sufficient to produce a favorable response over time in the context of this disclosure. The size of the dose is also determined by the presence, nature, and severity of adverse side effects. Determining the appropriate dosage for a particular situation is within the skill of the practitioner. Generally, treatment is initiated with a lower dose, which is below the optimal dose of the compound. The dose is then gradually increased until the optimal effect is achieved under the circumstances.

[0175] Dosage and intervals can be individually adjusted to provide levels of the administered compound that are effective for the specific clinical indication being treated. This provides a treatment regimen that is appropriate to the severity of the individual's disease state.

[0176] Methods for performing gene editing on a target Another aspect of the present disclosure relates to a method for performing gene editing on a subject. The method comprises administering to a subject in need of gene editing a virus-like particle (VLP) according to the present disclosure, a VLP produced using a system according to the present disclosure, or a VLP produced using a method according to the present disclosure, wherein one or more peptides comprise one or more gene-editing proteins, and after administration, the gene-editing proteins are expressed in the cells of the subject, thereby editing the genome of the subject.

[0177] In some embodiments, one or more gene-editing proteins comprise Cas family proteins. Suitable Cas family proteins are well known in the art and include, but are not limited to, dCas proteins and nCas proteins as described above. In some embodiments, the Cas family protein is a dCas family protein.

[0178] In some embodiments, one or more gene-editing proteins are fused to additional proteins. The additional proteins may be selected from the group consisting of reverse transcriptases, adenosine deaminases, cytidine deaminases, and transposases / recombinases.

[0179] The method may further include the step of administering guide RNA. As used herein, the terms “guide RNA” or “gRNA” refer to a ribonucleotide sequence that can bind to a nucleoprotein and thereby form a ribonucleoprotein complex. Guide RNA may include (i) a DNA targeting sequence complementary to the target nucleic acid sequence, and (ii) a binding sequence for a Cas protein (e.g., Cas9 nuclease, Cas9 nickasase, dCas9, Cas12a nuclease, Cas12a nickasase, or dCas12a).

[0180] In some embodiments, the VLP further includes guide RNA packaged within the VLP using a lentiviral packaging signal (psi).

[0181] Suitable subjects include, without limitation, mammalian subjects (e.g., human subjects). In some embodiments, the subjects are non-mammalian subjects. Suitable mammalian and non-mammalian subjects are described above.

[0182] RNA molecule Another aspect of this disclosure relates to an RNA molecule comprising: a first ribozyme; a first ligation sequence located at 3' of the first ribozyme; an internal ribosome entry site (IRES) coupled to an RNA molecule encoding one or more peptides, wherein the internal ribosome entry site coupled to the RNA molecule encoding one or more peptides is located at 3' of the first ligation sequence, and the IRES sequence is selected from the group consisting of SEQ ID NO: 1-8 or derivatives thereof; a second ligation sequence located at 3' of the internal ribosome entry site; and a second ribozyme located at 3' of the second ligation sequence.

[0183] Preferred first ribozyme sequence, first ligation sequence, IRES sequence, RNA molecule encoding one or more peptides, second ligation sequence, and second ribozyme sequence are described above.

[0184] IRES can be a wild-type internal ribosome entry site or a modified internal ribosome entry site. In some embodiments, IRES lacks a Pol III termination element.

[0185] In some embodiments, a portion of the first ligation sequence may be complementary to a portion of the first ribozyme, and a portion of the second ligation sequence may be complementary to a portion of the second ribozyme.

[0186] In some embodiments, a portion of the first ligation sequence is complementary to a portion of the second ligation sequence. The portion of the first ligation sequence complementary to the portion of the second ligation sequence may be at least 18 nucleotides long, at least 26 nucleotides long, and at least 49 nucleotides long.

[0187] In some embodiments, each of the first ribozyme and the second ribozyme contains a sequence that can be cleaved to produce a 5'-OH terminus and a 2',3'-cyclic phosphate terminus.

[0188] Each of the first and second ribozymes may be independently selected from the group consisting of hammerhead, hairpin, hepatitis delta virus (HDV), bulk satellite (VS), Vg1, glucosamine-6-phosphate synthase (glmS), twister, twister sister, hatchet, pistol ribozyme, synthetic ribozymes, or derivatives thereof. In some embodiments, the first ribozyme is a P3 twister ribozyme, and the second ribozyme is a P1 twister ribozyme.

[0189] In some embodiments, one or more peptides are selected from the group consisting of antibodies; antigens such as cancer neoepitopes and viral antigens; enzymes or gene-editing proteins such as Cas family proteins; reverse transcriptases; transposases / recombinases; transcription factors; chemokines; receptors such as chimeric antigen T cell receptors; channels; structural proteins; motor proteins; transport proteins; signaling proteins; cytoskeletal proteins; chaperone proteins; or any combination thereof.

[0190] The RNA molecule may further contain a stem-loop that binds to a congener RNA-binding protein, the stem-loop being located at the 3' of the ligation sequence. For example, the stem-loop is selected from the group consisting of MS2, PP7, BoxB, and Com.

[0191] In some embodiments, IRES lacks a stop codon.

[0192] Circular RNA molecule Another aspect of this disclosure relates to a circular RNA molecule comprising: a first ligation sequence; an internal ribosome entry site (IRES) coupled to an RNA molecule encoding one or more peptide sequences, wherein the internal ribosome entry site coupled to the RNA molecule encoding the peptide sequences is located at 3' of the first ligation sequence, and the IRES sequence is selected from the group consisting of SEQ ID NO: 1-8 or derivatives thereof; and a second ligation sequence located at 3' of the internal ribosome entry site coupled to the RNA molecule encoding the peptide sequences.

[0193] RNA molecules relating to this disclosure may be synthesized (e.g., by chemical synthesis) or transcribed in vitro (e.g., from a Tornado vector) (see, for example, Litke and Jaffrey, “Highly Efficient Expression of Circular RNA Aptamers in Cells using Autocatalytic Transcripts,” Nat. Biotechnol. 37(6):667-675 (2019) and Jaffrey et al., U.S. Patent Application Publication No. 2021 / 0340542; these are incorporated herein by reference in their entirety). The circular RNA can then be purified by standard methods.

[0194] Preferred first ligation sequence, IRES sequence, RNA molecule encoding one or more peptides, and second ligation sequence are described above.

[0195] IRES can be a wild-type internal ribosome entry site or a modified internal ribosome entry site. In some embodiments, IRES lacks a Pol III termination element.

[0196] In some embodiments, the IRES lacks a Pol III termination element.

[0197] In some embodiments, a portion of the first ligation sequence is complementary to a portion of the second ligation sequence. The portion of the first ligation sequence complementary to the portion of the second ligation sequence may be at least 18 nucleotides long, at least 26 nucleotides long, and at least 49 nucleotides long.

[0198] In some embodiments, one or more peptides are selected from the group consisting of antibodies; antigens such as cancer neoepitopes and viral antigens; enzymes or gene-editing proteins such as Cas family proteins; reverse transcriptases; transposases / recombinases; transcription factors; chemokines; receptors such as chimeric antigen T cell receptors; channels; structural proteins; motor proteins; transport proteins; signaling proteins; cytoskeletal proteins; chaperone proteins; or any combination thereof.

[0199] The RNA molecule may further contain a stem-loop that binds to a congener RNA-binding protein, the stem-loop being located at the 3' of the ligation sequence. For example, the stem-loop may be selected from the group consisting of MS2, PP7, BoxB, and Com.

[0200] In some embodiments, IRES lacks a stop codon. [Examples]

[0201] The following embodiments are intended to illustrate, but not to limit, the scope of, the embodiments of the present disclosure.

[0202] Materials and methods of Examples 1-10 Cell lines and cultures HepG2 (ATCC HB-8065, male, hepatocellular carcinoma), HEK293T (ATCC CRL-11268, sex unknown, embryonic kidney tissue), Flip-In-293 cells (ThermoFisher #R75007, sex unknown, embryonic kidney tissue), and HeLa cells (ATCC CCL-2, female, cervical cancer) were cultured under standard tissue culture conditions using ×1 DMEM (ThermoFisher #11995-065) containing 10% fetal bovine serum (FBS), 100 U / ml penicillin, and 100 μg / ml streptomycin. ZR-75-1 (ATCC CRL-1500, female, breast cancer) was cultured under standard tissue culture conditions using RPMI 1640 medium containing 10% fetal bovine serum (FBS), 100 U / ml penicillin, and 100 μg / ml streptomycin, without phenol red (ThermoFisher #11835030). SH-SY5Y (ATCC CRL-2266, female, metastatic bone tumor) was cultured using F-12 / DMEM (ThermoFisher #11320033), 20% fetal bovine serum (FBS), 100 U / ml penicillin, and 100 μg / ml streptomycin. Cells were cultured at 37°C and 5% CO2 and passaged every 2-3 days. Cell lines were not authenticated.

[0203] Reagents and Resources Unless otherwise specified, all reagents were manufactured by Sigma-Aldrich, with the exception of cell culture reagents manufactured by Invitrogen. These reagents were used without further purification. Table 9 lists the reagents and resources used in Examples 1-10.

[0204] (Table 9) Reagents and Resources TIFF2026519817000013.tif161164TIFF2026519817000014.tif156164 1 Liang & Wilusz, “Short Intronic Repeat Sequences Facilitate Circular RNA Production,” Genes Dev 28:2233-2247 (2014); 2Crawford et al., “Protocol and Reagents for Pseudotyping Lentiviral Particles with SARS-CoV-2 Spike Protein for Neutralization Assays,” Viruses 12 (2020); 3 Didier Trono; 4 Lu et al., “Delivering SaCas9 mRNA by Lentivirus-Like Bionanoparticles for Transient Expression and Efficient Genome Editing,” Nucleic Acids Research 47:e44-e44 (2019); 5 Litke, JL & Jaffrey, SR, “Highly Efficient Expression of Circular RNA Aptamers in Cells Using Autocatalytic Transcripts,” Nature Biotechnology 37:667-675 (2019); 6 Chan et al., “Engineering Human ACE2 to Optimize Binding to the Spike Protein of SARS Coronavirus 2,” Science 369:1261-1265 (2020).

[0205] (Table 10) Primers, plasmids, and gene blocks TIFF2026519817000015.tif239159TIFF2026519817000016.tif246159TIFF2026519817000017.tif247159TIFF2026519817000018.tif246159TIFF2026519817000019.tif247159TIFF2026519817000020.tif247159TIFF2026519817000021.tif247159TIFF2026519817000022.tif243159TIFF2026519817000023.tif247159TIFF2026519817000024.tif247159TIFF2026519817000025.tif247159TIFF2026519817000026.tif247159TIFF2026519817000027.tif247159TIFF2026519817000028.tif247159TIFF2026519817000029.tif247159TIFF2026519817000030.tif247159TIFF2026519817000031.tif247159TIFF2026519817000032.tif247159TIFF2026519817000033.tif243159TIFF2026519817000034.tif247159TIFF2026519817000035.tif247159TIFF2026519817000036.tif247159TIFF2026519817000037.tif247159TIFF2026519817000038.tif247159TIFF2026519817000039.tif247159TIFF2026519817000040.tif247159TIFF2026519817000041.tif247159TIFF2026519817000042.tif247159TIFF2026519817000043.tif247159TIFF2026519817000044.tif247159TIFF2026519817000045.tif247159TIFF2026519817000046.tif243159TIFF2026519817000047.tif247159TIFF2026519817000048.tif247159TIFF2026519817000049.tif247159TIFF202 6519817000050.tif247159TIFF2026519817000051.tif247159TIFF2026519817000052.ti f247159TIFF2026519817000053.tif247159TIFF2026519817000054.tif247159TIFF20265 19817000055.tif247159TIFF2026519817000056.tif247159TIFF2026519817000057.tif2 47159TIFF2026519817000058.tif247159TIFF2026519817000059.tif247159TIFF2026519 817000060.tif247159TIFF2026519817000061.tif247159TIFF2026519817000062.tif247 159TIFF2026519817000063.tif247159TIFF2026519817000064.tif247159TIFF202651981 7000065.tif247159TIFF2026519817000066.tif247159TIFF2026519817000067.tif47159.

[0206] Tornado stem design The Tornado annular junction stem was designed using mfold (http: / / www.unafold.org / mfold / applications / rna-folding-form.php). The stem was designed to have protrusions approximately every 10 bp.

[0207] Split nLuc design Split nLuc ORFs were codon-optimized using a codon optimization tool from Integrated DNA Technologies to avoid Pol III termination signals. The frame of the Tornado cyclized stem was selected to avoid stop codons. To improve the sensitivity of protein readout, the split nLuc contained 2x glutamine degron at the C-terminus.

[0208] Cloning of Pol III transcript Split nLuc, IRES, and partial Tornado sequences were chemically synthesized as gene blocks (Integrated DNA Technologies) and then cloned into the NotI and SacII sites of the pAV-U6+27-Tornado-Broccoli plasmid (Addgene #124360). The split nLuc ORF was codon-optimized to be compatible with the Pol III promoter. Modifications to the IRES were made by cloning gene blocks into the EcoRI and BsiWI internal restriction sites. All plasmids were sequenced (Psomagen) to verify identity.

[0209] Cloning of Pol II transcripts Split nLuc, nLuc, spike, IRES, and Tornado sequences were chemically synthesized as gene blocks (Integrated DNA Technologies). These gene blocks were cloned into the BamHI and XhoI sites of the pcDNA3.1+ vector backbone. IRES modifications were performed by cloning gene blocks into the EcoRI and BsiWI internal restriction sites. Minor modifications, such as stop codon insertions or IRES point mutations, were performed using the QuikChange Site-directed mutagenesis kit II (Agilent #200523) according to the manufacturer's instructions. All plasmids were sequenced (Psomagen) to verify identity.

[0210] Cloning of backsplicing system sequences A gene block containing the exact same sequence as the CMV-CVB3 Tornado translation system was synthesized (Integrated DNA Technologies) and cloned into the EcoRV and SacII restriction sites of a pcDNA3.1(+) CircRNA Mini Vector (Addgene #60648). The Tornado circularized stem was included at the 5' end of the sequence to ensure that the ORF from the Tornado translation system matched the ORF from the backsplicing-based system. After cloning, the plasmid was sequenced (Psomagen) to verify identity.

[0211] Cell culture and transfection HepG2 (ATCC HB-8065), HEK293T (ATCC CRL-11268), and HeLa cells (ATCC CCL-2) were cultured under standard tissue culture conditions using ×1 DMEM (ThermoFisher #11995-065) containing 10% fetal bovine serum (FBS), 100 U / ml penicillin, and 100 μg / ml streptomycin. ZR-75 (ATCC CRL-1500) was cultured under standard tissue culture conditions using RPMI 1640 medium containing 10% fetal bovine serum (FBS), 100 U / ml penicillin, and 100 μg / ml streptomycin, but without phenol red (ThermoFisher #11835030). SH-SY5Y (ATCC CRL-2266) was cultured in F-12 / DMEM (ThermoFisher #11320033), 20% fetal bovine serum (FBS), 100 U / ml penicillin, and 100 μg / ml streptomycin. Cells were cultured at 37°C and 5% CO2 and subcultured every 2-3 days. Cells were lifted for subculture using TrypLE Express (ThermoFisher #12604013). Cells were transfected 20 hours prior to transfection (2 x 10⁶ cells). 4 cells / cm 2Cells were plated at the specified density. Cells were transfected in OptiMEM I Reduced Serum Media (ThermoFisher, #31985) with a 3:1 ratio of FuGENE (Promega #E5911) versus DNA. Unless otherwise specified, all cells were harvested 72 hours post-transfection for downstream application.

[0212] Protein expression analysis Cells were harvested by directly lifting them with ×1 phosphate-buffered saline (PBS) (ThermoFisher, no. 10010031). Unless otherwise specified, cells were harvested 72 hours after transfection for the luminescence assay. The culture medium was aspirated from the cells, and then the cells were resuspended in PBS. 50 μl of the cell suspension was transferred to a flat-bottomed white-walled 96-well plate (Corning). The Nano-Glo Luciferase Assay System (Promega #N1110) reagent was prepared according to the manufacturer's instructions. 50 μl of Nano-Glo reagent was added to each well of the cell suspension. The plate was gently shaken, and then luminescence detection was performed using a SpectraMax iD3 (Molecular Devices) instrument with SoftMax Pro (v.7.1) software, with luminescence acquisition settings (endpoint luminescence, 96-well standard opaque plate, integration time 1000 ms, 1 mm read height).

[0213] RNA extraction RNA was extracted from cultured cells by removing the culture medium and enzymatically detaching the cells or by directly lifting them with ×1 phosphate-buffered saline (PBS) (ThermoFisher, #10010031). The cell suspension was mixed with TRIzol LS reagent (Invitrogen, no. 10296010) according to the manufacturer's instructions, and then frozen and stored at -20°C or immediately purified.

[0214] RNase R reaction After RNA extraction, RNA concentration was quantified using NanoDrop 2000 (Thermo Scientific). Equal concentrations of RNA were added to two tubes and treated with RNase R (Biosearch Technologies RNR07250) according to the manufacturer's instructions. After the RNase R reaction, RNA was purified using the RNA Clean & Concentrator Kit (Zymo Research, no. R1015).

[0215] Northern blot After RNA extraction or RNase R reaction, RNA was blotted using a NorthernMax kit (ThermoFisher #AM1940) according to the manufacturer's instructions. Antisense DNA probes designed to bind to either LgBiT, ZKSCAN1 exon 2 / 3, or spike RNA were synthesized using 5' biotin (Integrated DNA Technologies). Band detection was performed using a Chemiluminescent Nucleic Acid Detection Module (ThermoFisher #89880) according to the manufacturer's instructions. The blots were imaged using a ChemiDoc MP imager (Bio-Rad) with chemiluminescent band detection settings. RNA quantification from the Northern blots was performed using Image Lab (v.5.2.1) software.

[0216] qRT-PCR on split nLuc After RNA extraction or RNase R reaction, RNA was treated with DNase (ThermoFisher #EN0521) according to the manufacturer's instructions. The RNA was then used directly for cDNA synthesis using the Superscript III kit (ThermoFisher #12574026). The cDNA was diluted 1:10 and added to an Eppendorf twin.tec 96 real-time PCR Plate (Eppendorf #0030132700) with iQ Syber Green Supermix (Bio-Rad #1708880) and primers. Primers designed to amplify the 150nt region within the LgBiT region, and a reference primer for GAPDH, were chemically synthesized (Integrated DNA Technologies). qPCR was performed using an Eppendorf Realplex qPCR instrument. 2 -[ΔCt(標的) - ΔCt(参照)] RNA quantification was performed using the specified method.

[0217] RT-PCR and Sanger sequencing using divergent primers RNA was reverse transcribed as described above. Convergent primers amplified the region within the ORF of the RNA. Divergent primers amplified the region across the circular junction (see Table 10 for exact primer sequences). PCR was performed using Phusion High-Fidelity DNA polymerase (NEB #M0530S), and then electrophoresis was performed on High Sensitivity D1000 ScreenTape (Agilent #5067-5584) using a 4150 TapeStation system (Agilent #G2992AA). For sequencing, the PCR reaction product was purified by PCR using the QIAquick PCR Purification Kit (Qiagen #28104) and then submitted to Psomagen for Sanger sequencing.

[0218] NCBI BLAST Search The EMCV IRES sequence was aligned against the viral (taxid:10239) reference genomes (refseq_genomes) using the somewhat similar (blastn) program on NCBI BLAST.

[0219] RNA / Protein Half-Life Experiment Flip-In-293 cells (ThermoFisher #R75007) were cultured under standard tissue culture conditions using ×1 DMEM (ThermoFisher #11995-065) containing 10% fetal bovine serum (FBS), 100 U / ml penicillin, and 100 μg / ml streptomycin. Cell lines stably expressing Tornado (CMV-CVB3), linear (CVB3), and linear (cap) mRNAs were generated by using the Flp-In T-Rex Core Kit (ThermoFisher #K6500-01). Cells were plated at a density of 2x10 4 cells / cm 2 16 hours prior to tetracycline treatment. The cells were then treated with 1 μg / mL tetracycline (Santa Cruz Biotechnology) for 12 hours, and then the medium was replaced with tetracycline-free medium. Cells were harvested at 0, 5, 10, 24, 48, and 72 hours after tetracycline removal. Cells were harvested by directly lifting the cells with ×1 phosphate-buffered saline (PBS) (ThermoFisher #10010031), and then split in half for both protein quantification and RNA quantification.

[0220] qRT-PCR RNA quantification normalizes the target RNA level against the reference RNA level. This means that as HEK293T cells divide to produce more GAPDH while the tet-inducible gene is no longer expressed, the level of tet-inducible RNA expression appears to decline over time. Therefore, RNA quantification was adjusted to the cell number at each time point. The cell number was obtained using a Countess 3 Automated Cell Counter (ThermoFisher). Furthermore, the RNA expression level needs to be normalized against the level of RNA expressed when tetracycline is not added. The equation for this normalization is as follows: TIFF2026519817000068.tif11128where x is the time when the RNA was harvested, and RNA expression was calculated using the qRT-PCR method for split nLuc.

[0221] VLP production The MCP-modified packaging plasmid pspAX2-D64-NC-MCP (Addgene #122944), the VSVg envelope plasmid pMD2.G (Addgene #12259) or the spike envelope plasmid (Addgene #158762), and the transfer plasmid Tornado / Linear nLuc-MS2 were transfected into 80% confluent HEK293T cells at a ratio of 3:1.5:4.5. 3 μg of total DNA was transfected into each well of a 6-well plate. The cells were transfected using a 3:1 ratio of FuGENE (Promega #E5911) to DNA in OptiMEM I Reduced Serum Media (ThermoFisher, #31985). The medium was changed 24 hours after transfection. Three days after transfection, VLPs were harvested and filtered through a 45-micron filter.

[0222] VLP transduction Dilute the un浓缩VLP in fresh medium according to the viral RNA titer (see "RNA isolation from VLP and RT-qPCR analysis"), and add it to 5 x 10 4 cells in a 12-well plate. At the first collection, the cells were washed with 1 ml of ×1 phosphate-buffered saline (PBS) (ThermoFisher #10010031) before harvesting. After the first collection time point, the medium for subsequent time points was replaced with fresh medium. At each collection time point, the cells were harvested and subjected to protein expression analysis (see the "Protein expression analysis" section).

[0223] Generation of ACE-2 HEK293T cells Transfect 2 μg / well of the plasmid encoding ACE-2 (Addgene #145171) into HEK293T cells in a 6-well plate, and then, 24 hours after transfection, replate into a 12-well plate (GenClone #25-106) using medium containing geneticin (Thermo Fisher #10131035). The cells were treated with VLP 24 hours later.

[0224] RNA isolation from VLP and RT-qPCR analysis RNA from VLPs was extracted using the QIAmp Viral RNA Mini Kit (Qiagen #52904) according to the manufacturer's instructions. The RNA was then treated with RNase R (see RNase R reaction section) followed by DNAse (ThermoFisher #EN0521) according to the manufacturer's instructions. The RNA was then used directly for cDNA synthesis using the Superscript III kit (ThermoFisher #12574026). The cDNA was diluted 1:10 and added to an Eppendorf twin.tec 96 real-time PCR Plate (Eppendorf #0030132700) with iQ Syber Green Supermix (Bio-Rad #1708880) and primers. Primers for amplifying the 125nt amplicon within the nLuc gene were designed using Integrated DNA Technologies. Reference without RNA control, 2 -[ΔCt(標的) - ΔCt(参照)] The amount of RNA was calculated using an equation. For the RNase R reaction, 2 -(Ct +RNase R - Ct -RNase R) RNA was quantified using an equation.

[0225] RNA FISH FISH was performed according to the ViewRNA® ISH Cell Assay Kit protocol (Thermo Fisher QVC0001). FISH probes for LgBiT RNA were designed using a custom branched DNA probe set tool. HEK293T cells were transfected with plasmids encoding Tornado(U6-mutEMCV), Tornado(CMV-CVB3), and a linear (capped) expression system, and then subcultured 24 hours after transfection in glass-bottom 24-well plates (MatTek Corporation P24G-1.5-13-F) coated with poly-D-lysine (Cultrex 3429-100-01) and then further coated with Cultrex Mouse Laminin I (Thermo Fisher 340001002). Fluorescence images were acquired using a CoolSnap HQ2 CCD camera through a 403 air objective lens (NA 0.75) mounted on a Nikon Eclipse TE2000-E microscope and analyzed with NIS-Elements software. The LgBiT probe is a TYPE 4 probe (FITC) imaged using 488 nm excitation. The NEAT1 probe is a TYPE 1 probe (TRITC) imaged using 550 nm excitation. DAPI was imaged using 358 nm excitation (DAPI). Cell distribution was calculated by counting the number of cytoplasmic and nuclear spots, and then dividing the number of nuclear spots by the total number of spots.

[0226] immunogenicity assay HeLa cells (ATCC CCL-2) were transfected in 2x10⁶ well plates (Greiner #657160) 20 hours prior to transfection. 4 cells / cm 2Plating was performed at the specified density. HeLa cells were transfected with 2 μg of plasmids encoding Tornado(CMV-CVB3), linear (capped), linear (CVB3), Tornado(short), Tornado(medium), and Tornado(long) expression systems, or 0.02 ug of poly(I:C)HMW (InvivoGen tlrl-pic) in OptiMEM I Reduced Serum Media (ThermoFisher, #31985) using a 3:1 ratio of FuGENE (Promega #E5911) versus DNA. RNA was extracted 20 hours after transfection. RIG-I, IFNβ1, and IL6 expression were quantified by RT-qPCR and normalized to GAPDH expression.

[0227] Quantification and statistical analysis All data are expressed as mean ± standard deviation, and the number of independent experiments (n) is recorded for each experiment. Statistical analysis was performed using Excel (Microsoft) and Prism (GraphPad).

[0228] Example 1 - Design of a reporter for circular mRNA-specific translation First, we developed a construct that allows circular mRNA, rather than precursor linear mRNA, to translate the reporter. This construct uses a split nanoluciferase (nLuc) composed of large BiT (LgBiT) and small BiT (SmBiT) (Dixon et al., “NanoLuc Complementation Reporter Optimized for Accurate Measurement of Protein Interactions in Cells,” ACS Chem. Biol. 11:400-408 (2016); this is incorporated herein by reference in its entirety). These components have low affinity for one another and only produce luminescence when artificially brought together, for example, by two proteins or by a protein linker (Figure 1A). This design was incorporated into the Tornado system, which involves the synthesis of linear RNA containing ribozymes at the 5' and 3' ends of the transcript. After the ribozyme undergoes autocatalytic cleavage, the 5' and 3' ends are ligated by the endogenous RNA ligase RtcB (Litke et al., “Highly Efficient Expression of Circular RNA Aptamers in Cells using Autocatalytic Transcripts,” Nat. Biotechnol. 37:667-675 (2019); this is incorporated herein by reference in its entirety). In this design, luminescence occurs only if the mRNA is circularized and the circularized junction can be translated into a protein that links SmBiT and LgBiT (Figure 1B).

[0229] To confirm that this construct generates circular mRNA, a plasmid expressing the construct with RNA polymerase II cytomegalovirus (CMV) promoter in the Tornado translation system was cloned. Coxsackievirus B3 (CVB3) IRES, previously used to drive translation of in vitro transcribed circular mRNA, was employed (Wesselhoeft et al., “Engineering Circular RNA for Potent and Stable Translation in Eukaryotic Cells,” Nat. Commun. 9:2629 (2018); this is incorporated herein by reference in its entirety). This construct is referred to as the CMV-CVB3 Tornado translation system. Following transfection into HEK293T cells, a single major band was revealed by Northern blotting with a probe for LgBiT (Figure 2B). To determine whether this was a precursor linear RNA or circular RNA, we used RNase R, which preferentially degrades linear RNA (Abe et al., “Circular RNA Migration in Agarose Gel Electrophoresis,” Mol. Cell 82:1768-1777 (2022); this is incorporated herein by reference in its entirety). This band was found to be resistant to RNase R, while the control linear RNA encoding the split nLuc (Figure 2A) was largely degraded by RNase R treatment (Figure 2B).

[0230] To ensure that RNA RNase R resistance was not due to the structure of the CVB3 IRES, an additional linear control containing the CVB3 IRES was included (Figure 2A). Similarly, linear CVB3-driven RNA was found to be degraded by RNase R. Finally, RT-PCR was performed on the circularized junction, yielding bands of the expected size and sequence (Figures 4A-4C). These data are consistent with the idea that the Tornado translation system primarily generates circular mRNA.

[0231] As a final control to confirm that the luminescence originated from circular RNA, the 3' ribozyme sequence was deleted. This prevented the formation of the 2',3'-cyclic phosphate at the 3' end of the RNA, which is necessary for RtcB-mediated cyclization. This construct is called "mutTornado". Cells transfected with the mutTornado plasmid did not produce luminescence (Figure 2C).

[0232] While intracellularly generated circular RNA does not stimulate the innate immune system (Chen et al., “N6-Methyladenosine Modification Controls Circular RNA,” Immunity. Mol. Cell 76:96-109 (2019); this is incorporated herein by reference in its entirety), we next investigated whether the Tornado translation system stimulates the innate immune system. The Tornado translation system was found to stimulate the innate immune system less than the linear mRNA expression system (Figure 4D).

[0233] Since the Tornado system was originally designed to circularize small RNAs, we investigated whether extending the circularization junction would increase circular mRNA production. The length of the circularization junction was increased from 18 base pairs (bp), the length in the original Tornado construct, to 26 and 49 bp (Figure 4E). Conventional nLuc was used instead of split nLuc to ensure that different peptides encoded by the circularization junction did not affect luminescence. It was found that 26 or 49 bp circularization junctions did not result in a statistically significant increase in luminescence compared to the 18 bp circularization junction (Figure 4F). Importantly, extending the circularization junction did not increase the immunogenicity of the RNA (Figure 4G). Although not statistically significant, the 26 bp stem produced the greatest luminescence and was therefore used in subsequent experiments.

[0234] Example 2 - The Tornado translation system provides a lower but more sustained level of protein synthesis compared to the linear mRNA translation system. Next, the overall protein expression levels of the Tornado translation system were compared with those of the linear cap-dependent mRNA translation system (Figure 2A). The Tornado translation system was found to produce approximately five times less luminescence than the linear mRNA translation system (Figure 2D).

[0235] To determine whether the lower protein output from the Tornado translation system was due to reliance on the CVB3 IRES compared to the 5' cap of linear RNA, circular RNA was compared to a linear construct reliant on CVB3-dependent translation (Figure 2A). The CVB3-dependent linear construct had the same split nLuc open reading frame (ORF) and CVB3 IRES as the Tornado translation system, but was in a linear form. To ensure that the CVB3-dependent linear translation system did not undergo cap-dependent translation, an upstream ORF ending with a stop codon was included (Figure 2A). Protein expression from the linear cap-dependent translation system was then compared to that from the linear CVB3-dependent translation system. The linear CVB3-dependent translation system was found to produce approximately 10 times less luminescence than the linear cap-dependent translation system (Figure 2D).

[0236] Next, the expression levels of each tested transcript were determined. To measure this, RNA levels were quantified from the Northern blots in Figure 2B. The linear cap-dependent translation system showed approximately a 10-fold increase in RNA expression compared to the linear CVB3-dependent transcript and approximately a 3-fold increase in RNA expression compared to the Tornado translation system (Figure 3B). After normalizing the luminescence relative to RNA expression, both the linear and circular CVB3-dependent translation systems were found to show less than 3-fold lower luminescence (Figure 2E). Therefore, the decrease in protein expression from the Tornado translation system is due to a combination of decreased RNA expression of transcripts containing CVB3 IRES and decreased translational activity of CVB3 IRES compared to cap-dependent translation.

[0237] Next, we investigated whether the Tornado translation system extends the duration of protein expression compared to a linear mRNA expression system. Stable cell lines expressing the Tornado translation system, a linear cap-dependent translation system, and a linear CVB3-dependent translation system were created under a tetracycline-responsive promoter. The stable cell lines were then pulsed with tetracycline for 12 hours to induce transcription, followed by washing. Cells were harvested at 0, 5, 10, 24, 48, and 72 hours and assayed for RNA expression and luminescence. The Tornado translation system was found to provide approximately 10 times longer durations of luminescence and mRNA expression compared to both the linear cap-dependent and CVB3-dependent translation systems (Figure 2F). Therefore, the Tornado translation system extends the duration of protein expression compared to a linear mRNA expression system encoding the same protein.

[0238] Next, we determined whether the Tornado translation system could be used in other cell types. HepG2 and ZR-75-1 cells were transfected with the Tornado translation system (CMV-CVB3), and luminescence was detected in both of these cell lines (Figure 4H). Lower luminescence levels are thought to be due to lower transfection efficiency.

[0239] Example 3 - The Tornado translation system can circularize long mRNAs. To test whether the Tornado system can circularize long mRNAs, we constructed a Tornado construct designed to express a circular mRNA encoding a SARS-CoV-2 spike protein (Huang et al., “Structural and Functional Properties of SARS-CoV-2 Spike Protein: Potential Antivirus Drug Development for COVID-19,” Acta Pharmacol. Sin. 41:1141-1149 (2020); this is incorporated herein by reference in its entirety). This circular mRNA, containing the CVB3 IRES, is 4719 nt long. HEK293T cells were transfected with either a plasmid expressing Tornado spike mRNA or a plasmid expressing linear spike RNA. The Tornado system proved to circularize the spike mRNA, as evidenced by its resistance to RNase R compared to linear spike mRNA (Figure 4I, Figure 4J). Furthermore, RT-PCR and Sanger sequencing of the circularized junction further confirmed that the spike RNA was circular (Figure 4K, Figure 4L). In summary, these results suggest that the Tornado system can be used to circularize long mRNAs.

[0240] Example 4 - The Tornado translation system generates more circular mRNA than the backsplicing system. The amount of circular mRNA generated by the Tornado system was compared with that of the backsplicing system. The backsplicing system uses an exon containing the gene of interest and an intron sequence from ZKSCAN1, a gene that normally generates circular RNA through an endogenous backsplicing event (Figure 5A) (Liang et al., “Short Intronic Repeat Sequences Facilitate Circular RNA Production,” Genes Dev. 28:2233-2247 (2014); which is incorporated herein by reference in its entirety). For the implementation of the backsplicing system, the same split nLuc ORF and IRES (CVB3) were cloned from the Tornado translation system into the plasmid backbone (Liang et al., “Short Intronic Repeat Sequences Facilitate Circular RNA Production,” Genes Dev. 28:2233-2247 (2014); which is incorporated herein by reference in its entirety). Surprisingly, the Tornado translation system produced 220-fold more luminescence compared to the backsplicing system (Figure 5B).

[0241] This result was verified by measuring the amount of circular mRNA produced by the two systems. Northern blotting was performed, and RNA was treated with RNase R to identify the circular product. The Tornado translation system primarily expressed circular products, while the backsplicing system produced mainly linear bands, as evidenced by the disappearance of the band after RNase R treatment (Figure 5C). Therefore, the main product of the backsplicing system is linear RNA. To confirm that the Tornado translation system produces more circular RNA than the backsplicing system, Northern blotting experiments were repeated using the ZKSCAN1 exon 2 / 3 sequence as an alternative insertion. As expected, the Tornado translation system was found to produce a single dominant band, which is circular RNA, based on its resistance to RNase R. However, the backsplicing system produced mainly linear bands (Figure 6A).

[0242] In particular, two studies have recently reported that backsplicing systems express some linear transcripts (Jiang et al., “Overexpression-Based Detection of Translatable Circular RNAs is Vulnerable to Coexistent Linear RNA Byproducts,” Biochem. Biophys. Res. Commun. 558:189-195 (2021) and Ho-Xuan et al., “Comprehensive Analysis of Translation from Overexpressed Circular RNAs Reveals Pervasive Translation from Linear Transcripts,” Nucleic Acids Res. 48:10368-10382 (2020); these are incorporated herein by reference in their entirety). Thus, backsplicing systems produce most RNAs in linear form, while Tornado systems primarily produce circular mRNA. These data suggest that Tornado translation systems are more effective for cell-based synthesis of circular mRNA for VLPs or other applications.

[0243] Example 5 - Selection of Pol II-compatible IRES To maximize protein expression from Tornado-expressed circular mRNA, the following IRESs were compared. Recent studies have shown that CVB3 IRESs produce more protein than EMCV IRESs in in vitro transcribed circular mRNA (Wesselhoeft et al., “Engineering Circular RNA for Potent and Stable Translation in Eukaryotic Cells,” Nat. Commun. 9:2629 (2018); this is incorporated in its entirety by reference). The related human rhinovirus B3 (HRV-B3) IRES has been reported to provide more protein production than CVB3 IRESs (Chen et al., “Engineering Circular RNA for Enhanced Protein Production,” Nature Biotechnology (2022); this is incorporated in its entirety by reference). Therefore, these IRESs were compared in the Tornado translation system. Each construct was expressed from a Pol II (CMV) promoter. CVB3 IRESs were found to produce more protein than EMCV IRESs and slightly more protein than HRV-B3 IRESs (Figures 7A and 8A). Therefore, CVB3 IRESs yield the highest protein expression levels from the Pol II-driven Tornado translation system.

[0244] Example 6 - Selection of Pol II-compatible IRES Because the Pol III promoter expresses higher levels of RNA than the Pol II promoter, the Tornado translation system can benefit from using the Pol III promoter (Dieci, G. & Sentenac, A. “Facilitated Recycling Pathway for RNA Polymerase III,” Cell 84:245-252 (1996); this is incorporated herein by reference in its entirety). The problem with the Pol III promoter is that the Pol III termination signal, i.e., closely related sequences such as UUUU, UCUUU, or UUUAU (Orioli et al., “Widespread Occurrence of Non-Canonical Transcription Termination by Human RNA Polymerase III,” Nucleic Acids Research 39:5499-5512 (2011); this is incorporated herein by reference in its entirety), is found in commonly used IRESs such as CVB3 and EMCV. EMCV, CVB3, and HRV-B3 IRES have 2, 3, and 4 Pol III termination signals, respectively (Figure 7B, Table 2).The highly conserved U-stretch in CVB3 and HRV-B3 IRESs is responsible for direct binding to 18S rRNA (Bailey & Tapprich, “Structure of the 5′ Nontranslated Region of the Coxsackievirus B3 Genome: Chemical Modification and Comparative Sequence Analysis,” Journal of Virology 81:650-668 (2007) and Yang et al., “A Shine-Dalgarno-like Sequence Mediates in Vitro Ribosomal Internal Entry and Subsequent Scanning for Translation Initiation of Coxsackievirus B3 RNA,” Virology 305:31-43 (2003); these are incorporated herein by reference in their entirety). Mutations in this sequence cause loss of IRES activity (Yang et al., “A Shine-Dalgarno-like Sequence Mediates in Vitro Ribosomal Internal Entry and Subsequent Scanning for Translation Initiation of Coxsackievirus B3 RNA,” Virology 305:31-43 (2003); this is incorporated herein by reference in its entirety). Therefore, we focused on EMCV IRES.

[0245] EMCV IRES contains two Pol III termination signals (Figure 7B). The first contains a sequence (UCUUU) that binds to polypyrimidine tract-binding protein (PTB), which is considered important for IRES function (Figure 7B) (Kaminski & Jackson, “The Polypyrimidine Tract Binding Protein (PTB) Requirement for Internal Initiation of Translation of Cardiovirus RNAs is Conditional Rather than Absolute,” RNA 4:626-638 (1998); this is incorporated herein by reference in its entirety). PTB can bind to several U-rich sequences, the most common of which is UUCUCU,32, which is not a Pol III termination signal (Orioli et al., “Widespread Occurrence of Non-Canonical Transcription Termination by Human RNA Polymerase III,” Nucleic Acids Research 39:5499-5512 (2011); this is incorporated herein by reference in its entirety). Therefore, the Pol III termination element was replaced with UUCUCU, as well as UCUCU (which was also described as a PTB-binding motif, 32) and UCUAU (which is not a standard PTB-binding motif) (Figure 7B) (Xue et al., “Genome-Wide Analysis of PTB-RNA Interactions Reveals a Strategy used by the General Splicing Repressor to Modulate Exon Inclusion or Skipping,” Mol. Cell 36:996-1006 (2009); this is incorporated herein by reference in its entirety). To determine IRES activity, each EMCV variant was cloned into a Pol II-driven Tornado translation system.Surprisingly, the UCUAU mutant produced the highest luminescence despite not having a standard PTB binding sequence (Figure 7C).

[0246] To mutate the second Pol III termination signal, we identified a related IRES, falcon picornavirus, that has a relevant sequence in this region but lacks the Pol III termination element (Figure 8B). Next, we incorporated the falcon picornavirus sequence in place of the Pol III termination signal in the wild-type EMCV (wtEMCV) IRES (Figure 7B).

[0247] Next, we compared EMCVs incorporating both mutations (mutEMCV) with the parental EMCV IRES. Protein output was measured using a Pol II Tornado translation system that transcribes regardless of the Pol III termination element. wtEMCV IRES was found to produce approximately three times more luminescence than mutEMCV IRES (Figure 7D). Therefore, the mutations reduced the translational activity of the IRES, while mutEMCV IRES still maintained translational activity.

[0248] Next, the protein output of mutEMCV IRES was compared with that of WT CVB3 IRES in a Tornado translation system driven by the Pol III promoter U6. MutEMCV was found to produce approximately 15 times more luminescence than CVB3 IRES, which is thought to be due to the Pol III termination signal in CVB3 IRES interfering with full-length RNA transcription (Figure 8C). In summary, these results suggest that mutEMCV IRES can be used to drive translation from a Pol III-driven expression system.

[0249] Finally, the translational activity of mutEMCV IRES was compared to IRES that do not naturally contain a Pol-III termination signal. Swine cholera virus (CSFV) IRES lacks the Pol III termination element and is therefore compatible with Pol III (Figure 8D) (Sizova et al., “Specific Interaction of Eukaryotic Translation Initiation Factor 3 with the 50 Nontranslated Regions of Hepatitis C Virus and Classical Swine Fever Virus RNAs,” J. Virol. 72:4775-4782 (1998); this is incorporated herein by reference in its entirety). mutEMCV IRES was found to give more than three times more luminescence than CSFV IRES (Figure 8E). Therefore, mutEMCV is the best Pol III compatible IRES tested.

[0250] Example 7 - The Tornado translation system generates the most protein using the CMV-CVB3 promoter and IRES combination. Next, we investigated whether protein expression was more efficient in HEK293T cells using Pol II and wild-type IRES, or Pol III and mutant IRES. Northern blotting with probes for LgBiT showed a single prominent band in both constructs (Figure 7E). The Pol III-driven (U6) Tornado translation system expressed more than 10 times more RNA than the Pol II-driven (CMV) Tornado translation system (Figure 7E). However, luminescence from the Pol II-driven system was approximately 6 times higher than that from the Pol III-driven system (Figure 7F). This is partly due to the reduced translational activity of the mutEMCV IRES (Figure 7D). However, the 10-fold higher RNA level from the Pol III system is expected to result in higher protein expression despite the approximately 3-fold reduced translational activity of the mutEMCV IRES.

[0251] We investigated the possibility of nuclear retention of circular RNA when expressed using Pol III. Therefore, we quantified the nuclear and cytoplasmic localization of Pol II and Pol III-driven Tornado translation systems using fluorescence in situ hybridization. The distribution of circular RNA was found to be similar in both systems (Figure 8F, Figure 8G). Furthermore, the distribution was similar to that of the linear cap-dependent translation system (Figure 8F, Figure 8G). Adding a constitutive transport element (CTE) from Mason-Pfizer monkey virus 34 to the Pol III-driven (U6) Tornado translation system did not increase luminescence (Figure 8H). Therefore, an unknown factor other than nuclear retention explains the decrease in protein output from the Pol III-driven Tornado translation system. Thus, the Pol III system generates more circular RNA, but this RNA is not efficiently translated due to IRES and potentially other factors.

[0252] Example 8 - Continuous translation constructs do not improve protein output. Next, we investigated whether protein synthesis could be increased using continuous translation. When the ORF lacks a stop codon, continuous translation can occur in circular RNA, and the ribosome continues translating across the ORF to the IRES and then back to the ORF (Abe et al., “Rolling Circle Amplification in a Prokaryotic Translation System using Small Circular RNA,” Angew. Chem. Int. Ed. Engl. 52:7004-7008 (2013); this is incorporated herein by reference in its entirety). Continuous translation requires an ORF lacking a stop codon and an in-frame IRES. In this way, ribosomes can endlessly circulate circular RNA, resulting in high protein production (Figure 9A) (Abe et al., “Rolling Circle Translation of Circular RNA in Living Human Cells,” Sci. Rep. 5:16435 (2015) and Costello et al., “Continuous Translation of Circularized mRNA Improves Recombinant Protein Titer,” Metab. Eng. 52:284-292 (2019); this is incorporated herein by reference in its entirety). Inclusion of a viral P2A sequence that induces ribosome skipping and thus cleaves polypeptide chains (Liu et al., “Systematic Comparison of 2A Peptides for Cloning Multi-Genes in a Polycistronic Vector,” Sci. Rep. 7:2193 (2017); this is incorporated herein by reference in its entirety) can ensure that the protein polymer produced by continuous translation is separated into functional protein monomers.

[0253] Most IRES sequences cannot be used for sequential translation because they contain multiple stop codons in all three reading frames (Figure 9B). The HCV IRES contains only three stop codons in one of its reading frames, which is the fewest number of stop codons in any frame among the exemplified IRESs (Figure 9B). The first stop codon appears in a stem that is structurally conserved but not sequence-conserved in the associated IRES (Honda et al., “A Phylogenetically Conserved Stem-Loop Structure at the 5' Border of the Internal Ribosome Entry Site of Hepatitis C Virus is Required for Cap-Independent Viral Translation,” J. Virol. 73:1165-1174 (1999); this is incorporated herein by reference in its entirety). Therefore, a mutation from UAG to UAC and a complementary base mutation were performed to preserve the stem structure (Figure 9C). The second set of two stop codons are adjacent (UGA UAG) and contain a conserved loop sequence (GAUA) (Figure 9C) (Brown et al., “Secondary structure of the 5' Nontranslated Regions of Hepatitis C Virus and Pestivirus Genomic RNAs,” Nucleic Acids Res. 20:5041-5045 (1992); this is incorporated herein by reference in its entirety). To remove both stop codons while preserving both the conserved region sequence and the GU fluctuation base pair at the loop base, the UGAUAG loop was mutated to GGAUAU (Figure 9C). These two mutations were used to create mutant HCV (mutHCV) IRESs that are usable for continuous translation.

[0254] To verify whether mutHCV IRES exhibits reduced translational activity compared to wild-type HCV (wtHCV) IRES, mutHCV and wtHCV IRES were cloned into a Pol II discontinuous Tornado translation system (Figure 9A) containing a stop codon at the terminal end of a split nLuc ORF. MutHCV IRES were found to produce similar luminescence levels to wtHCV IRES (Figure 9D). Therefore, mutHCV IRES retain the ability to drive translation and can be used for continuous translation.

[0255] Next, we tested the efficiency of the mutHCV continuous translation system. mutHCV IRESs were cloned into a continuous Tornado translation system, and the IRESs and split nLuc ORFs did not contain stop codons. The P2A sequence was included downstream of the IRES (Figure 9A). Next, protein expression from the mutHCV continuous translation system was compared to that from the mutHCV non-continuous translation system. Interestingly, only a 50% increase in luminescence was observed by using the continuous translation system, suggesting that the ribosomes were only able to complete about 1-2 cycles (Figure 9E). This is thought to reflect a highly structured HCV IRES, as the structure can halt translation (Wen et al., “Following Translation by Single Ribosomes One Codon at a Time,” Nature 452:598-603 (2008); Chen et al., “Dynamics of Translation by Single Ribosomes through mRNA Secondary Structures,” Nat. Struct. Mol. Biol. 20:582-588 (2013); and Zheng et al., “Genome-Wide Double-Stranded RNA Sequencing Reveals the Functional Significance of Base-Paired RNAs in Arabidopsis,” PLoS Genet. 6:e1001141 (2010); these are incorporated herein by reference in their entirety). Furthermore, the CVB3 discontinuous translation system was found to produce approximately 10 times more luminescence than the continuous mutHCV translation system (Figure 9E). Therefore, the mutHCV continuous translation system does not improve protein output from the Tornado translation system.

[0256] Recently, high-throughput screening has discovered thousands of endogenous IRES elements that drive circular RNA translation (Chen et. al., “Structured Elements Drive Extensive Circular RNA Translation,” Mol. Cell 81:4300-4318 (2021); this is incorporated herein by reference in its entirety). These endogenous IRESs drive translation using a small stem-loop structure. Furthermore, many of the IRESs identified in the screening do not contain a stop codon in at least one frame due to their short length (<200 nt). The combined advantages of having a simple structure and not requiring mutations suggest that these endogenous IRESs may be able to drive continuous translation.

[0257] From the screening, we selected LIMA1 IRES, a candidate IRES exhibiting high translational activity and lacking a stop codon in at least one frame (Chen et. al., “Structured Elements Drive Extensive Circular RNA Translation,” Mol. Cell 81:4300-4318 (2021); this is incorporated herein by reference in its entirety). LIMA1 IRES was cloned into continuous or discontinuous Pol II-driven Tornado translation systems using a split nLuc ORF, and the translation output was compared. Interestingly, an approximately 90-fold increase in luminescence was observed from the LIMA1 continuous translation system compared to the LIMA1 discontinuous translation system (Figure 9F). However, the LIMA1 continuous translation system produced more than 15-fold less luminescence compared to the CVB3 discontinuous translation system (Figure 9F). Thus, while continuous translation significantly increases the protein output of LIMA1 IRES, its overall activity remains very low compared to the CVB3 discontinuous system.

[0258] Next, we investigated the identity of the AUG used in the LIMA1 continuous translation system. Because the LIMA1 continuous translation system does not have a stop codon, any start codon within the same frame as the split nLuc can function as a start codon, even if it is not included in the IRES. To identify the AUG, we created a construct in which the AUG downstream of the LIMA1 IRES was mutated to CCC (LIMA1 mutAUG no stop) and a construct in which the entire LIMA1 IRES was deleted (no IRES no stop). Importantly, the mutated AUG was the only AUG within the LIMA1 IRES that was in the ORF and in frame (Figure 10A). Interestingly, the LIMA1 mutAUG continuous translation system showed a 2.6-fold increase in luminescence signal compared to the LIMA1 continuous translation system, while the no-IRES continuous translation system showed a similar luminescence signal to the LIMA1 continuous translation system (Figure 9G). This suggests that protein output from the LIMA1 continuous translation system may occur through a combination of a non-AUG start codon within the IRES and an AUG outside the LIMA1 IRES. This further supports the hypothesis that LIMA1-dependent translation is close to the background level of the Tornado translation system.

[0259] We investigated whether alternative endogenous IRES elements from the aforementioned screening (Chen et. al., “Structured Elements Drive Extensive Circular RNA Translation,” Mol. Cell 81:4300-4318 (2021); this is incorporated herein by reference in its entirety) had higher translational output than LIMA1 IRES. To test this, we selected three additional endogenous IRESs (CEP50, TGFBRG, and CHD2) that showed high translational activity according to the screening (Chen et. al., “Structured Elements Drive Extensive Circular RNA Translation,” Mol. Cell 81:4300-4318 (2021); this is incorporated herein by reference in its entirety) and lacked a stop codon in at least one frame. None of these endogenous IRESs were found to produce more luminescence than the LIMA1 continuous translation system (Figure 10B). Therefore, even if endogenous IRES elements are capable of undergoing serial translation, they are unlikely to produce meaningful protein expression levels.

[0260] Example 9 - The Tornado translation system can be used to produce circular mRNA-containing VLPs. Next, to achieve longer durations of heterologous protein expression, we developed a VLP that carries circular mRNA. To package the circular mRNA, we used an mRNA-containing lentivirus VLP system (Lu et al., “Delivering SaCas9 mRNA by Lentivirus-Like Bionanoparticles for Transient Expression and Efficient Genome Editing,” Nucleic Acids Res. 47:e44 (2019); this is incorporated herein by reference in its entirety). This system comprises an envelope plasmid; a transfer plasmid containing the gene of interest with an MS2 stem-loop at its 3'UTR; and an integrase-deficient packaging plasmid expressing MCP fused to the N-terminus of nucleocapsid protein 11 (Figure 11A). We modified this system to package circular mRNA within the VLP. To do this, we constructed the transfer plasmid by cloning the MS2 stem-loop to the 3'UTR of a CMV-CVB3 Tornado translation system expressing the nLuc gene (Figure 11A). Because it contains the MS2 sequence, this RNA is packaged within the VLP by binding to the MCP domain in the nucleocapsid protein.

[0261] The Tornado translation system primarily expresses circular mRNA (see Figure 1C), but we investigated the possibility of linear precursors being packaged within VLPs. To test this, RNA from VLPs generated using the Tornado translation system was subjected to RNase R. As a control, a linear mRNA VLP system with the same nLuc ORF and MS2 sequences as the circular mRNA was included. Viral RNA from VLPs packaged using the Tornado translation system was found to be resistant to RNase R, while viral RNA from control VLPs made with linear RNA was degraded (Figure 11B). To further confirm that the viral RNA from VLPs packaged using the Tornado translation system is circular, RT-PCR was performed on the cyclic junction, and the amplicon was sequenced. The amplicon was of the expected size and sequence (Figures 12A, 12B). Therefore, VLPs generated by the Tornado translation system package circular mRNA.

[0262] Example 10 - VLPs with circular mRNA exhibit increased levels and duration of protein expression. Next, we evaluated whether VLPs generated using the Tornado translation system exhibited a longer protein expression duration compared to VLPs generated using the linear mRNA expression system. To test this, HEK293T cells were transduced with equal amounts of infectious VLPs, as determined by the nLuc mRNA levels within the VLPs measured by qRT-PCR (Figure 12C). At the first 5 hours, cells transduced with VLPs generated using the Tornado translation system produced similar levels of luminescence as cells transduced with VLPs generated using the linear mRNA expression system (Figure 11C). However, after 24 hours from transduction, VLPs generated using the Tornado translation system produced more than five times greater luminescence than VLPs generated using the linear mRNA expression system (Figure 11C). This result is consistent with the longer half-life of circular mRNA, which allows for prolonged protein synthesis and accumulation.

[0263] We also investigated whether these VLPs could be used in other cell types. SH-SY5Y neuroblastoma cells showed a similar approximately five-fold increase in luminescence when using VLPs generated using the Tornado translation system compared to VLPs generated using a linear mRNA expression system (Figure 12D).

[0264] To demonstrate that VLPs generated using the Tornado translation system can be pseudotyped to achieve cell type specificity, VLPs were pseudotyped using a spike protein from SARS-CoV-2 that enables infection of ACE-2 expressing cells (Crawford et al., “Protocol and Reagents for Pseudotyping Lentiviral Particles with SARS-CoV-2 Spike Protein for Neutralization Assays,” Viruses 12:513 (2020); this is incorporated herein by reference in its entirety). Luminescence from HEK293T cells transduced with spike pseudotyped VLPs containing circular nLuc mRNA and ACE-2 expressing HEK293T cells (Chan et al., “Engineering Human ACE2 to Optimize Binding to the Spike Protein of SARS Coronavirus 2,” Science 369:1261-1265 (2020); this is incorporated herein by reference in its entirety) was then compared (Figure 12D). Spike pseudotyped cells showed selective delivery into ACE-2 expressing cells (Figure 11E). Therefore, VLPs generated using the Tornado translation system can be pseudotyped to achieve cell type specificity.

[0265] Discussion of Examples 1-10 Examples 1–10 describe the development of VLPs with circular mRNA, which allow VLPs to exhibit longer protein expression durations compared to VLPs with linear mRNA. This approach is made possible by a previously developed Tornado RNA circulation approach for circularizing small RNA aptamers (Litke et al., “Highly Efficient Expression of Circular RNA Aptamers in Cells using Autocatalytic Transcripts,” Nat. Biotechnol. 37:667-675 (2019); this is incorporated herein by reference in its entirety). Through several different types of optimization, modified sequence requirements for Tornado RNA, as well as specific promoters and IRESs resulting in translatable circular mRNA efficiently packaged into VLPs, were identified. Using this approach, VLPs generated using a Tornado translation system were shown to increase protein expression duration and levels, thus demonstrating the potential use of this technique in mRNA delivery.

[0266] As part of this study, we evaluated circular mRNA produced by a back-splicing system (Liang et al., “Short Intronic Repeat Sequences Facilitate Circular RNA Production,” Genes Dev. 28:2233-2247 (2014); this is incorporated herein by reference in its entirety). This method generates circular RNA by utilizing molecular mechanisms occurring in endogenous genes such as ZKSCAN1. The examples disclosed herein demonstrate that the main product is linear RNA, which is thought to reflect a more efficient forward-splicing reaction. Other groups have similarly found that back-splicing systems generate linear forward-splicing products (Jiang et al., “Overexpression-Based Detection of Translatable Circular RNAs is Vulnerable to Coexistent Linear RNA Byproducts,” Biochem. Biophys. Res. Commun. 558:189-195 (2021) and Ho-Xuan et al., “Comprehensive Analysis of Translation from Overexpressed Circular RNAs Reveals Pervasive Translation from Linear Transcripts,” Nucleic Acids Res. 48:10368-10382 (2020); these are incorporated herein by reference in their entirety). In contrast, the Tornado system according to this disclosure readily generates large circular mRNAs (up to 4719 bp) with minimal detectable linear precursors. This reflects the highly efficient nature of cyclization using the Tornado approach. Therefore, the Tornado approach should be used for experiments that require the generation of small or large RNA rings in cells.

[0267] VLP systems have the advantage of being able to be pseudotyped to enable cell type-specific infection (Cronin et al., “Altering the Tropism of Lentiviral Vectors Through Pseudotyping,” Curr. Gene Ther. 5:387-398 (2005); Naldini et al., “In Vivo Gene Delivery and Stable Transduction of Nondividing Cells by a Lentiviral Vector,” Science 272:263-267 (1996); and Hamilton et al., “Targeted Delivery of CRISPR-Cas9 and Transgenes Enables Complex Immune Cell Engineering,” Cell Rep. 35:109207 (2021); these are incorporated herein by reference in their entirety). A recent variant of a VLP system using endogenous retrotransposons (Segal et al., “Mammalian Retrovirus-Like Protein PEG10 Packages its own mRNA and can be Pseudotyped for mRNA Delivery,” Science 373:882-889 (2021); this is incorporated herein by reference in its entirety) may be particularly useful for delivering mRNA without the undesirable immunological effects that may result from repeated administration of current VLPs.

[0268] Using the Pol III promoter generates more circular mRNA compared to using the Pol II promoter, the CMV promoter. Mutation of the IRES to remove the Pol III termination element resulted in decreased IRES activity. Therefore, the Pol III Tornado translation system should be used when a large amount of RNA is desired, such as for the expression of non-coding RNA. The Pol II Tornado translation system should be used when the highest level of protein expression is desired. In the future, to leverage the high RNA expression observed in the Pol III system, the development of Pol III-compatible IRESs with high efficiency in translation initiation will be crucial.

[0269] The cellular expression of circular mRNA may have value in other applications as well. For example, plasmid therapeutics rely on the expression of the encoded mRNA, but the plasmid DNA is often epigenetically silenced (Chen et al., “Silencing of Episomal Transgene Expression by Plasmid Bacterial DNA Elements in Vivo,” Gene Ther. 11:856-864 (2004); this is incorporated herein by reference in its entirety), limiting their duration of action. Adenovirus vectors similarly deliver DNA that is readily silenced (Brooks et al., “Transcriptional Silencing is Associated with Extensive Methylation of the CMV Promoter Following Adenoviral Gene Delivery to Muscle,” J. Gene Med. 6:395-404 (2004); this is incorporated herein by reference in its entirety). Plasmid and adenovirus vector-based therapeutics may have longer durations of action by using circular mRNA expressed using the Tornado translation system.

[0270] While preferred embodiments have been described and explained in detail herein, it will be apparent to those skilled in the art that various modifications, additions, substitutions, etc., can be made without departing from the spirit of the invention, and that these are therefore considered to fall within the scope of the invention as defined in the following claims.

Claims

1. First ligation sequence; An internal ribosome entry site (IRES) coupled to an RNA molecule encoding one or more peptides, wherein the internal ribosome entry site coupled to the RNA molecule encoding one or more peptides is located at the 3' position of the first ligation sequence; A second ligation sequence located at 3' of the internal ribosome entry site coupled to the RNA molecule encoding one or more peptides. A circular RNA molecule containing, Multiple proteins, one or more of which can self-assemble into nanoparticles Virus-like particles (VLPs), including those containing virus-like particles.

2. The virus-like particle (VLP) according to claim 1, wherein the IRES sequence is selected from the group consisting of SEQ ID NO: 1 to 8 or derivatives thereof.

3. A virus-like particle (VLP) according to claim 1 or 2, wherein the IRES is a wild-type internal ribosome entry site.

4. A virus-like particle (VLP) according to claim 1 or 2, wherein the IRES is a modified internal ribosome entry site.

5. A virus-like particle (VLP) according to any one of claims 1 to 4, wherein the IRES lacks a Pol III termination element.

6. A virus-like particle (VLP) according to any one of claims 1 to 5, wherein the IRES lacks a stop codon.

7. A virus-like particle (VLP) according to any one of claims 1 to 6, wherein a portion of the first ligation sequence is complementary to a portion of the second ligation sequence.

8. The virus-like particle (VLP) according to claim 7, wherein a portion of the first ligation sequence complementary to a portion of the second ligation sequence is at least 18 nucleotides long.

9. The virus-like particle (VLP) according to claim 7, wherein a portion of the first ligation sequence complementary to a portion of the second ligation sequence is at least 26 nucleotides long.

10. The virus-like particle (VLP) according to claim 7, wherein a portion of the first ligation sequence complementary to a portion of the second ligation sequence is at least 49 nucleotides long.

11. The virus-like particle (VLP) according to any one of claims 1 to 10, wherein the one or more peptides are selected from the group consisting of antibodies; antigens such as cancer neoepitopes and viral antigens; enzymes or gene editing proteins such as Cas family proteins; reverse transcriptases; transposases / recombinases; transcription factors; chemokines; receptors such as chimeric antigen T cell receptors; channels; structural proteins; motor proteins; transport proteins; signaling proteins; cytoskeletal proteins; chaperone proteins; or any combination thereof.

12. The virus-like particle (VLP) according to claim 11, wherein the one or more peptides comprise an antigen, and the antigen is a cancer neoepitope.

13. The virus-like particle (VLP) according to claim 11, wherein the Cas family protein is selected from the group consisting of Cas9, nCas9, dCas9, Cas12a, nCas12a, dCas12a, Cas12b, nCas12b, and dCas12b.

14. The virus-like particle (VLP) according to claim 11, wherein the one or more peptides comprise a chimeric antigen T cell receptor.

15. The virus-like particle (VLP) according to any one of claims 1 to 14, wherein the circular RNA molecule further comprises a stem loop that binds to a congener RNA-binding protein, and the stem loop is positioned at the 3' of the RNA molecule encoding one or more peptides.

16. The virus-like particle (VLP) according to claim 15, wherein the stem-loop is selected from the group consisting of MS2, PP7, BoxB, and Com.

17. A virus-like particle (VLP) according to any one of claims 1 to 16, wherein the nanoparticle is a viral capsid.

18. The virus-like particle (VLP) according to any one of claims 1 to 16, wherein the nanoparticle is a virus capsid-like structure.

19. A virus-like particle (VLP) according to any one of claims 1 to 18, wherein a polyprotein is composed of one or more types of proteins that can self-assemble into nanoparticles.

20. The virus-like particle (VLP) according to claim 19, wherein the polyprotein is selected from the group consisting of retrovirus group-specific antigen (Gag) polyproteins, mammalian group-specific antigen (Gag)-like polyproteins, and derivatives thereof.

21. The virus-like particle (VLP) according to claim 20, wherein the polyprotein comprises one or more proteins selected from the group consisting of nucleocapsid proteins, capsid proteins, substrate proteins, reverse transcriptases, proteases, and deficiency integrases.

22. The virus-like particle (VLP) according to claim 20 or 21, wherein the retrovirus group-specific antigen (Gag) polyprotein is human immunodeficiency virus type 1 (HIV-1) group-specific antigen (Gag).

23. The virus-like particle (VLP) according to claim 20 or 21, wherein the mammalian group-specific antigen (Gag)-like polyprotein is PEG10.

24. A virus-like particle (VLP) according to any one of claims 1 to 18, comprising one or more types of proteins that can self-assemble into nanoparticles, including one or more structural proteins.

25. The virus-like particle (VLP) according to claim 24, wherein one or more structural proteins are selected from the group consisting of capsid proteins, nucleocapsid proteins, substrate proteins, and combinations thereof.

26. The virus-like particle (VLP) according to claim 25, wherein the capsid protein is a non-retroviral capsid protein.

27. The virus-like particle (VLP) according to claim 26, wherein the nonretroviral capsid protein is selected from the group consisting of herpes simplex virus (HSV) VP23, herpes simplex virus (HSV) VP19C, hepatitis B virus (HBV) core antigen, human papillomavirus (HPV) L1, human papillomavirus (HPV) L2, and combinations thereof.

28. A virus-like particle (VLP) according to any one of claims 1 to 27, wherein at least one of a plurality of proteins capable of self-assembling into nanoparticles contains or is fused to an RNA-binding protein domain.

29. The virus-like particle (VLP) according to claim 28, wherein the RNA-binding protein domain is selected from the group consisting of MS2 coat protein (MCP), Com, PCP, and N22.

30. A virus-like particle (VLP) according to claim 28 or 29, wherein the RNA-binding domain is located at the N-terminus of at least one of a plurality of proteins, which can self-assemble into a nanoparticle containing or fused to the RNA-binding domain.

31. The virus-like particle (VLP) according to claim 30, wherein the RNA-binding domain is located at the C-terminus of at least one of a plurality of proteins, which can self-assemble into a nanoparticle containing or fused to the RNA-binding domain.

32. A virus-like particle (VLP) according to any one of claims 1 to 31, further comprising one or more envelope and / or spike proteins.

33. A virus-like particle (VLP) according to claim 32, wherein one or more envelope proteins are viral envelope and / or spike proteins.

34. The virus-like particle (VLP) according to claim 33, wherein one or more virus envelopes and / or spike proteins are selected from the group consisting of vesicular stomatitis virus envelope protein, rabies virus envelope protein, measles virus envelope protein, nipah virus envelope protein, chikungunya virus envelope protein, and Sindbis virus envelope protein.

35. A virus-like particle (VLP) according to claim 33 or 34, wherein one or more envelope and / or spike proteins include vesicular stomatitis virus G (VSV G) protein, RabV-G, chikungunya virus E1 / E2, Sindbisvirus E1 / E2, measles virus H / F, and derivatives thereof.

36. A virus-like particle (VLP) according to any one of claims 32 to 35, wherein one or more envelope and / or spike proteins comprise a mutated VSV-G (K47Q, R354A).

37. A virus-like particle (VLP) according to any one of claims 32 to 36, wherein one or more envelope and / or spike proteins comprise a fusion protein.

38. A virus-like particle (VLP) according to any one of claims 1 to 37, further comprising a virus particle and / or a protein that is transported to the cell surface membrane.

39. The virus-like particle (VLP) according to claim 38, wherein the protein transported to the virus particle and / or cell surface membrane is a ligand or target-binding protein.

40. A virus-like particle (VLP) according to claim 38 or 39, wherein the protein transported to the virus particle and / or cell surface membrane is selected from the group consisting of a single chain of MHC fused to β2-microglobulin (B2M) and a covalently bound peptide; a single-chain antibody variable fragment fused to a transmembrane domain; and an antigen fused to a transmembrane domain.

41. Promoter and Ribozyme 1; The first ligation sequence located at 3' of the first ribozyme: An internal ribosome entry site (IRES) coupled to an RNA molecule encoding one or more peptides, wherein the internal ribosome entry site coupled to the RNA molecule encoding one or more peptides is located at the 3' position of the first ligation sequence; A second ligation sequence located at 3' of the internal ribosome entry site; and The second ribozyme located at 3' of the second ligation sequence nucleic acid sequences encoding RNA molecules including A vector that includes a translation system.

42. The vector according to claim 41, wherein the IRES sequence is selected from the group consisting of SEQ ID NO: 1 to 8 or derivatives thereof.

43. The vector according to claim 41 or claim 42, wherein the IRES is a wild-type internal ribosome entry site.

44. The vector according to claim 41 or claim 42, wherein IRES is a modified internal ribosome entry site.

45. The vector according to any one of claims 41 to 44, wherein the promoter is a Pol II promoter.

46. The vector according to claim 45, wherein the Pol II promoter is selected from the group consisting of CMV, SV40, PGK, and HSV-TK.

47. The vector according to claim 45 or claim 46, wherein the IRES is selected from the group consisting of CVB3 IRES (SEQ ID NO:1), HRV-B3 IRES (SEQ ID NO:6), EMCV IRES (SEQ ID NO:2), mutHCV IRES (SEQ ID NO:3), and LIMA1 IRES (SEQ ID NO:8), or derivatives thereof.

48. The vector according to any one of claims 41 to 44, wherein the promoter is a Pol III promoter.

49. The vector according to claim 48, wherein the Pol III promoter is selected from the group consisting of U6, 7SK, H1, and their derivatives.

50. The vector according to claim 48 or claim 49, wherein the IRES is selected from the group consisting of mutEMCV or swine cholera virus (CSFV) IRES (SEQ ID NO: 5), mutEMCV IRES (SEQ ID NO: 3), mutCVB3 IRES (SEQ ID NO: 7), and derivatives thereof.

51. The vector according to any one of claims 48 to 50, wherein the IRES lacks a Pol III termination element and / or signal.

52. The vector according to any one of claims 41 to 51, wherein a portion of the first ligation sequence is complementary to a portion of the first ribozyme, and a portion of the second ligation sequence is complementary to a portion of the second ribozyme.

53. The vector according to any one of claims 41 to 52, wherein a portion of the first ligation sequence is complementary to a portion of the second ligation sequence.

54. The vector according to claim 53, wherein a portion of the first ligation sequence complementary to a portion of the second ligation sequence is at least 18 nucleotides long.

55. The vector according to claim 53, wherein a portion of the first ligation sequence complementary to a portion of the second ligation sequence is at least 26 nucleotides long.

56. The vector according to claim 53, wherein a portion of the first ligation sequence complementary to a portion of the second ligation sequence is at least 49 nucleotides long.

57. The vector according to any one of claims 41 to 56, wherein each of the first ribozyme and the second ribozyme comprises a sequence that can be cleaved to produce a 5'-OH terminus and a 2',3'-cyclic phosphate terminus.

58. The vector according to any one of claims 41 to 57, wherein each of the first ribozyme and the second ribozyme is independently selected from the group consisting of hammerhead, hairpin, hepatitis delta virus (HDV), bulk satellite (VS), Vg1, glucosamine-6-phosphate synthase (glmS), twister, twister sister, hatchet, pistol ribozyme, artificially synthesized ribozyme, or derivatives thereof.

59. The vector according to any one of claims 41 to 58, wherein the first ribozyme is a P3 twister ribozyme and the second ribozyme is a P1 twister ribozyme.

60. The vector according to any one of claims 41 to 59, wherein one or more peptides are selected from the group consisting of antibodies; antigens such as cancer neoepitopes and viral antigens; enzymes or gene editing proteins such as Cas family proteins; reverse transcriptases; transposases / recombinases; transcription factors; chemokines; receptors such as chimeric antigen T cell receptors; channels; structural proteins; motor proteins; transport proteins; signaling proteins; cytoskeletal proteins; chaperone proteins; or any combination thereof.

61. The vector according to any one of claims 41 to 60, wherein the RNA molecule further encodes a stem loop that binds to a congener RNA-binding protein, and the stem loop is positioned at the 3' of the RNA molecule encoding the one or more peptides.

62. The vector according to claim 61, wherein the stem loop is selected from the group consisting of MS2, PP7, BoxB, and com.

63. The vector according to any one of claims 41 to 62, wherein the IRES lacks a stop codon.

64. A system for producing virus-like particles (VLPs) including a circular RNA translation system, A packaging vector encoding one or more types of proteins that can self-assemble into nanoparticles, Envelope vectors and A vector encoding the translation system according to any one of claims 41 to 63 and The system including the above.

65. The system according to claim 64, wherein the nanoparticles are viral capsids.

66. The system according to claim 64, wherein the nanoparticles are viral capsid-like structures.

67. The system according to any one of claims 64 to 66, wherein a polyprotein is composed of one or more types of proteins that can self-assemble into nanoparticles.

68. The system according to claim 67, wherein the polyprotein is selected from the group consisting of retrovirus group-specific antigen (Gag) polyproteins, mammalian group-specific antigen (Gag)-like polyproteins, and derivatives thereof.

69. The system according to claim 68, wherein the polyprotein comprises one or more proteins selected from the group consisting of nucleocapsid proteins, capsid proteins, substrate proteins, reverse transcriptases, proteases, and deficiency integrases.

70. The system according to claim 68 or 69, wherein the retrovirus group-specific antigen (Gag) polyprotein is human immunodeficiency virus type 1 (HIV-1) group-specific antigen (Gag).

71. The system according to claim 68 or claim 69, wherein the mammalian group-specific antigen (Gag)-like polyprotein is PEG10.

72. The system according to any one of claims 64 to 66, wherein a plurality of one or more types of proteins that can self-assemble into nanoparticles include one or more structural proteins.

73. The system according to claim 72, wherein one or more structural proteins are selected from the group consisting of capsid proteins, nucleocapsid proteins, substrate proteins, and combinations thereof.

74. The system according to claim 73, wherein the capsid protein is a non-retroviral capsid protein.

75. The system according to claim 74, wherein the nonretroviral capsid protein is selected from the group consisting of herpes simplex virus (HSV) VP23, herpes simplex virus (HSV) VP19C, hepatitis B virus (HBV) core antigen, human papillomavirus (HPV) L1, human papillomavirus (HPV) L2, and combinations thereof.

76. The system according to any one of claims 64 to 75, wherein at least one of a plurality of proteins capable of self-assembling into nanoparticles includes or is fused to an RNA-binding protein domain.

77. The system according to claim 76, wherein the RNA-binding protein domain is selected from the group consisting of MS2 coat protein (MCP), Com, PCP, and N22.

78. The system according to claim 76 or 77, wherein the RNA-binding domain is located at the N-terminus or C-terminus of at least one of a plurality of proteins, which can self-assemble into nanoparticles containing or fused to the RNA-binding domain.

79. The system according to any one of claims 64 to 78, wherein the envelope vector encodes one or more envelope and / or spike proteins.

80. The system according to claim 79, wherein one or more envelope and / or spike proteins are viral envelope proteins.

81. The system according to claim 80, wherein one or more viral envelopes and / or spike proteins are selected from the group consisting of vesicular stomatitis virus envelope protein, rabies virus envelope protein, measles virus envelope protein, nipah virus envelope protein, chikungunya virus envelope protein, and sisdobis virus envelope protein.

82. The system according to claim 80 or claim 81, wherein one or more envelope and / or spike proteins include vesicular stomatitis virus G (VSV G) protein, RabV-G, chikungunya virus E1 / E2, Sindbisvirus E1 / E2, measles virus H / F, and derivatives thereof.

83. The system according to any one of claims 79 to 82, wherein one or more envelope and / or spike proteins comprise the mutant VSV-G (K47Q, R354A).

84. The system according to any one of claims 79 to 83, wherein one or more envelope and / or spike proteins comprise a fusion protein.

85. The system according to any one of claims 64 to 84, further comprising a vector encoding a protein to be transported to a viral particle and / or a cell surface membrane.

86. The system according to claim 85, wherein the protein transported to the viral particle and / or cell surface membrane is a ligand or target-binding protein.

87. The system according to claim 85 or 86, wherein the protein transported to the viral particle and / or cell surface membrane is selected from the group consisting of a single chain of MHC fused to β2-microglobulin (B2M) and a covalently bound peptide; a single-chain antibody variable fragment fused to a transmembrane domain; and an antigen fused to a transmembrane domain.

88. A method for producing a VLP containing a circular RNA translation system, wherein the method is The process of providing host cells, A step of transfecting the host cell with the system described in any one of claims 64 to 87, A step of culturing host cells under conditions suitable for expressing a packaging vector, an envelope vector, and a circular RNA expression vector in the host cells, wherein the culture generates virus-like particles containing a circular RNA translation system. The method, including the method described above.

89. The method according to claim 88, wherein the host cell is a eukaryotic host cell.

90. The method according to claim 89, wherein the host cell is a mammalian host cell.

91. The method according to claim 89, wherein the host cell is a mammalian cell line, and optionally the mammalian cell line is selected from the group consisting of HEK293T cells, HEK293FT cells, and their derivatives.

92. The method according to any one of claims 88 to 91, further comprising the step of purifying the generated virus-like particles containing a circular RNA translation system.

93. A method for inducing an immune response against a pathogen, A step of administering an effective dose of a virus-like particle (VLP) according to any one of claims 1 to 40, a VLP manufactured using the system according to any one of claims 64 to 87, or a VLP manufactured using the method according to any one of claims 88 to 92. The method, including the method described above.

94. The method according to claim 93, wherein the pathogen is a viral pathogen, a prokaryotic pathogen, or a eukaryotic pathogen.

95. The method according to claim 93 or claim 94, wherein the subject is a mammal.

96. The method according to any one of claims 93 to 95, wherein the subject is a human subject.

97. The method according to claim 93 or claim 94, wherein the subject is a non-mammalian subject.

98. The method according to claim 97, wherein the subject is a bird or an insect.

99. A method for treating an object, wherein the method is A step of administering to a subject in need of such treatment a virus-like particle (VLP) according to any one of claims 1 to 40, a VLP produced using the system according to any one of claims 64 to 87, or a VLP produced using the method according to any one of claims 88 to 92, wherein after the administration, one or more peptides are expressed in the cells of the subject, thereby treating the subject. Methods that include...

100. The method according to claim 99, wherein the subject is a mammal, an amphibian, a bird, a fish, or a reptile.

101. The method according to claim 100, wherein the subject is a human subject.

102. A method for performing gene editing on a target, wherein the method is A step of administering to a subject in need of such administration a virus-like particle (VLP) according to any one of claims 1 to 40, a VLP produced using the system according to any one of claims 64 to 87, or a VLP produced using the method according to any one of claims 88 to 92, wherein one or more peptides comprises one or more gene-editing proteins, The process involves the gene editing protein being expressed in the target cells after administration, thereby editing the target genome. The method, including the method described above.

103. The method according to claim 102, wherein one or more gene editing proteins comprise Cas family proteins.

104. The method according to claim 103, wherein one or more gene editing proteins comprise dead Cas family proteins.

105. The method according to any one of claims 102 to 104, wherein one or more gene-editing proteins are fused to an additional protein.

106. The method according to claim 105, wherein the additional protein is selected from the group consisting of reverse transcriptase, adenosine deaminase, cytidine deaminase, and transposase / recombinase.

107. The method according to any one of claims 103 to 106, further comprising the step of administering guide RNA.

108. The method according to any one of claims 102 to 107, wherein the VLP further comprises a guide RNA packaged in the VLP using a lentiviral packaging signal (psi).

109. The method according to any one of claims 102 to 108, wherein the subject is a mammal.

110. The method according to claim 109, wherein the subject is a human subject.

111. The method according to any one of claims 102 to 108, wherein the subject is a non-mammalian subject.

112. Ribozyme 1 and, The first ligation sequence located at 3' of the first ribozyme, An internal ribosome entry site (IRES) coupled to an RNA molecule encoding one or more peptides, wherein the internal ribosome entry site coupled to the RNA molecule encoding one or more peptides is located at 3' of the first ligation sequence, and the IRES sequence is selected from the group consisting of SEQ ID NO: 1 to 8 or derivatives thereof, The second ligation sequence located at 3' of the internal ribosome entry site, The second ribozyme located at 3' of the second ligation sequence and RNA molecules, including those containing this molecule.

113. The RNA molecule according to claim 112, wherein the IRES is a wild-type internal ribosome entry site.

114. The RNA molecule according to claim 112, wherein IRES is a modified internal ribosome entry site.

115. The RNA molecule according to any one of claims 112 to 114, wherein the IRES lacks a Pol III termination element.

116. An RNA molecule according to any one of claims 112 to 115, wherein a portion of the first ligation sequence is complementary to a portion of the first ribozyme, and a portion of the second ligation sequence is complementary to a portion of the second ribozyme.

117. An RNA molecule according to any one of claims 112 to 116, wherein a portion of the first ligation sequence is complementary to a portion of the second ligation sequence.

118. The RNA molecule according to claim 117, wherein a portion of the first ligation sequence complementary to a portion of the second ligation sequence is at least 18 nucleotides long.

119. The RNA molecule according to claim 117, wherein a portion of the first ligation sequence complementary to a portion of the second ligation sequence is at least 26 nucleotides long.

120. The RNA molecule according to claim 117, wherein a portion of the first ligation sequence complementary to a portion of the second ligation sequence is at least 49 nucleotides long.

121. The RNA molecule according to any one of claims 112 to 120, wherein each of the first ribozyme and the second ribozyme comprises a sequence that can be cleaved to produce a 5'-OH terminus and a 2',3'-cyclic phosphate terminus.

122. The RNA molecule according to any one of claims 112 to 121, wherein each of the first ribozyme and the second ribozyme is independently selected from the group consisting of hammerhead, hairpin, hepatitis delta virus (HDV), bulk satellite (VS), Vg1, glucosamine-6-phosphate synthase (glmS), twister, twister sister, hatchet, pistol ribozyme, artificially synthesized ribozyme, or derivatives thereof.

123. The RNA molecule according to any one of claims 112 to 122, wherein the first ribozyme is a P3 twister ribozyme and the second ribozyme is a P1 twister ribozyme.

124. The RNA molecule according to any one of claims 112 to 123, wherein one or more peptides are selected from the group consisting of antibodies; antigens such as cancer neoepitopes and viral antigens; enzymes or gene editing proteins such as Cas family proteins; reverse transcriptases; transposases / recombinases; transcription factors; chemokines; receptors such as chimeric antigen T cell receptors; channels; structural proteins; motor proteins; transport proteins; signaling proteins; cytoskeletal proteins; chaperone proteins; or any combination thereof.

125. The RNA molecule according to any one of claims 112 to 124, further comprising a stem loop that binds to a congener RNA-binding protein, wherein the stem loop is positioned at the 3' of the RNA molecule encoding one or more peptides.

126. The RNA molecule according to claim 125, wherein the stem-loop is selected from the group consisting of MS2, PP7, BoxB, and Com.

127. The RNA molecule according to any one of claims 112 to 126, wherein the IRES lacks a stop codon.

128. The first ligation sequence and An internal ribosome entry site (IRES) coupled to an RNA molecule encoding one or more peptide sequences, wherein the internal ribosome entry site coupled to the RNA molecule encoding the peptide sequence is located at 3' of the first ligation sequence, and the IRES sequence is selected from the group consisting of SEQ ID NO: 1 to 8 or derivatives thereof, and A second ligation sequence located at 3' of the internal ribosome entry site coupled to the RNA molecule encoding the peptide sequence and A circular RNA molecule containing this molecule.

129. The circular RNA molecule according to claim 128, wherein the IRES is a wild-type internal ribosome entry site.

130. The circular RNA molecule according to claim 128, wherein IRES is a modified internal ribosome entry site.

131. A circular RNA molecule according to any one of claims 128 to 130, wherein the IRES lacks a Pol III termination element.

132. A circular RNA molecule according to any one of claims 128 to 131, wherein a portion of the first ligation sequence is complementary to a portion of the second ligation sequence.

133. The circular RNA molecule according to claim 132, wherein a portion of the first ligation sequence complementary to a portion of the second ligation sequence is at least 18 nucleotides long.

134. The circular RNA molecule according to claim 132, wherein a portion of the first ligation sequence complementary to a portion of the second ligation sequence is at least 26 nucleotides long.

135. The circular RNA molecule according to claim 132, wherein a portion of the first ligation sequence complementary to a portion of the second ligation sequence is at least 49 nucleotides long.

136. A circular RNA molecule according to any one of claims 128 to 135, wherein one or more peptides are selected from the group consisting of antibodies; antigens such as cancer neoepitopes and viral antigens; enzymes or gene editing proteins such as Cas family proteins; reverse transcriptases; transposases / recombinases; transcription factors; chemokines; receptors such as chimeric antigen T cell receptors; channels; structural proteins; motor proteins; transport proteins; signaling proteins; cytoskeletal proteins; chaperone proteins; or any combination thereof.

137. The circular RNA molecule according to any one of claims 128 to 136, wherein the RNA molecule further comprises a stem loop that binds to a congener RNA-binding protein, and the stem loop is positioned at the 3' of the RNA molecule encoding one or more peptides.

138. The circular RNA molecule according to claim 137, wherein the stem-loop is selected from the group consisting of MS2, PP7, BoxB, and Com.

139. A circular RNA molecule according to any one of claims 128 to 138, wherein the IRES lacks a stop codon.

Images