Lactobacillus strain of short-fermenting agent and its use

The Lactobacillus brevis strain addresses the limitations of current antidepressants by providing a safe and effective gut colonization agent that alleviates depression symptoms, offering a new approach for mental disorder intervention.

JP2026519936APending Publication Date: 2026-06-19IBIOME BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
IBIOME BIOTECHNOLOGY CO LTD
Filing Date
2024-04-07
Publication Date
2026-06-19

AI Technical Summary

Technical Problem

Current antidepressants have significant side effects and variable efficacy, with approximately 30% of patients not achieving sufficient relief, and existing probiotics like Lactobacillus brevis have unclear effects on depression.

Method used

A short-fermentation agent strain of Lactobacillus brevis (ibiome003) is developed, which is deposited and used in pharmaceutical compositions and nutritional supplements, exhibiting high colonization efficiency in the gut and alleviating depressive-like behaviors in various models.

Benefits of technology

The Lactobacillus brevis strain effectively alleviates depression-like symptoms in mice models without adverse effects, demonstrating potential for antidepressant foods and pharmaceuticals, with broad application prospects for mental disorders.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026519936000001_ABST
    Figure 2026519936000001_ABST
Patent Text Reader

Abstract

This invention provides a short-fermentation agent strain of Lactobacillus brevis ibiome003, and further provides a drug composition, a fungal agent composition, and a food composition containing the strain. Furthermore, it has been found that the fungal agent can effectively prevent, treat, and alleviate depression caused by various factors.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This invention relates to the field of biotechnology, and more specifically to a short-fermentation agent, Lactobacillus brevis, and its use. [Background technology]

[0002] The brain-gut axis is a complex reflex network composed of the central nervous system (CNS), neuroendocrine and neuroimmune systems, the sympathetic and parasympathetic nervous systems (ANS), the enteric nervous system (ENS), and the gut microbiota. Through a bidirectional regulatory network, signals from the brain can influence gut motility, sensation, and secretion, while the gut microbiota can also influence brain function. Existing studies have shown changes in gut microbial composition in depressed patients and have reported a correlation between the gut microbiota and quality of life and depression. Germ-free mice exhibit a depression-like phenotype compared to SPF mice, and numerous studies have demonstrated a close link between gut microbiota and depression and stress-related disorders, offering a new target for the treatment of depression.

[0003] Currently, the most commonly used antidepressants primarily act on monoamine neurotransmitters, increasing their concentration in the synaptic cleft to improve mood, boost motivation, and alleviate depressive symptoms. These include monoamine oxidase inhibitors (MAOIs), norepinephrine-dopamine reuptake inhibitors (NDRIs), selective serotonin reuptake inhibitors (SSRIs), serotonin-norepinephrine reuptake inhibitors (SNRIs), serotonin antagonists / reuptake inhibitors (SARIs), and tricyclic and tetracyclic antidepressants. However, in addition to obvious side effects such as headache, dizziness, gastrointestinal disorders, sexual dysfunction, and addiction, there is considerable variability in clinical improvement among patients, with approximately 30% of patients not achieving sufficient relief, and even in the same patient, drug efficacy may be unstable over time.

[0004] Currently, several patents and publications report on the improvement of depression using probiotics. Patent CN110157647B discloses that Lactobacillus brevis (the former name for the short-fermentation agent Lactobacillus) has excellent GABA production ability and is effective in reducing anxiety and improving sleep in mice, showing remarkable effects in mining tests, elevated cross maze tests, and pentobarbital sodium-induced sleep prolongation tests. However, its effect on alleviating depression is not clear. Patent TWI750788B Lactobacillus brevis GKJOY and its compositions are disclosed, which similarly produce GABA and promote neuronal function by increasing dopamine and / or serotonin content in brain tissue, but no data on their physiological function in mice and humans have been presented. [Overview of the project]

[0005] This invention relates to a short-fermentation agent strain of Lactobacillus brevis ibiome003. This strain is deposited with the China Center for the Preservation of Typical Cultures (address: Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province) on March 21, 2023, with deposit number CCTCC NO: M2023387. This invention further provides a mixture of this short-fermentation agent Lactobacillus in any proportion.

[0006] The present invention also relates to a drug, which comprises the short-fermentation agent Lactobacillus and pharmaceutically acceptable excipients, carriers, auxiliary materials, and pharmacokinetics. Examples of excipients, carriers, auxiliary materials, and fertilizers include, but are not limited to, anti-tacks, binders, coatings, compression aids, disintegrants, dyes, lubricants, emulsifiers, fillers (diluents), film-forming agents or coatings, flavoring agents, fragrances, fluidizers (flow aids), lubricants, adsorbents, suspending or dispersing agents, and sweeteners. Typical excipients, carriers, auxiliary materials, and fertilizers include, but are not limited to, the following. The ingredients are butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (monohydrogen), calcium stearate, cross-linked carboxymethylcellulose, cross-linked polyvinylpyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropylcellulose, hydroxypropylmethylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methylparaben, microcrystalline cellulose, polyethylene glycol, povidone, pre-gelatinized starch, propylparaben, retinyl palmitate, shellac, silica, sodium carboxymethylcellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol.

[0007] The drug is manufactured in the form of an injection or an oral preparation. The injection is classified into liquid injection, powder for injection, and tablet for injection depending on its state, and into intradermal injection, subcutaneous injection, intramuscular injection, intravenous injection, and intraspinal injection depending on the site of administration. Water for injection or physiological saline is preferably used as the solvent for the injection.

[0008] Oral preparations include tablets containing an active ingredient mixed with non-toxic, pharmaceutically acceptable excipients. The excipients include inert diluents or fillers (e.g., sucrose, sorbitol, sugar, mannitol, microcrystalline cellulose, starch containing potato starch, calcium carbonate, sodium chloride, lactose, calcium phosphate, calcium sulfate, or sodium phosphate), granulators and disintegrants (e.g., cellulose derivatives containing microcrystalline cellulose, starch containing potato starch, cross-linked sodium carboxymethylcellulose, alginates, or alginic acid), binders (e.g., sucrose, glucose, sorbitol, gum arabic, alginic acid, sodium alginate, gelatin, starch, pregelatinized starch, microcrystalline cellulose, magnesium aluminum silicate, sodium carboxymethylcellulose, methylcellulose, hydroxypropyl methylcellulose, ethylcellulose, polyvinylpyrrolidone, or polyethylene glycol), and lubricants, fluidizers, and anti-stickers (e.g., magnesium stearate, zinc stearate, stearic acid, silica, hydrogenated vegetable oil, or talc). Oral preparations may be in the form of chewable tablets, hard gelatin capsules (in which the active ingredient is mixed with an inert solid diluent (e.g., potato starch, lactose, microcrystalline cellulose, calcium carbonate, calcium phosphate, kaolin)), or soft gelatin capsules (in which the active ingredient is mixed with water or an oily medium (e.g., peanut oil, liquid paraffin, olive oil)). Powders, granules, and pills can be prepared using the same ingredients as tablets or capsules and by conventional methods such as using a mixer, fluid bed granulator, or spray dryer.

[0009] Other pharmaceutically acceptable excipients used in oral formulations include, but are not limited to, colorants, flavorings, plasticizers, humectants, and buffers. Oral formulations may also be in the form of chewable tablets, hard gelatin capsules (in which the active ingredient is mixed with an inert solid diluent (e.g., potato starch, lactose, microcrystalline cellulose, calcium carbonate, calcium phosphate, kaolin)), or soft gelatin capsules (in which the active ingredient is mixed with water or an oily medium (e.g., peanut oil, liquid paraffin, olive oil)). Powders, granules, and pills can be prepared using the same components as tablets or capsules and by conventional methods such as using a mixer, fluid bed granulator, or spray dryer.

[0010] In some embodiments, administration includes the administration of the drugs described herein by intramuscular, intravenous (e.g., in the form of a sterile solution, using a solvent system suitable for intravenous administration), intradermal, intraarterial, intraperitoneal, intralesional, intracranial, intraarticular, intraprostatic, intrapleural, intratracheal, intranasal, intravitreous, intravaginal, intrarectal, percutaneous, intratumoral, transperitoneal, subcutaneous, subconjunctival, intrasacral, transmucosal, intrapericardial, intraumbilical, intraocular, oral (e.g., tablets, capsules, capsule tablets, capsule-like tablets, syrups), perdermal (e.g., creams, gels, lotions, ointments), topical, inhalation, injection or infusion (e.g., continuous infusion of cream or lipid preparations, direct immersion into target cells, local perfusion, catheter placement, lavage).

[0011] The present invention also relates to pharmaceutical compositions comprising the short-fermentation agent Lactobacillus and a co-administered drug, wherein the co-administered drug is another substance that exhibits synergistic action with the short-fermentation agent Lactobacillus, and includes, but is not limited to, other bacterial strains. For example, L. casei, L. acidophilus, L. plantarum, L. helveticus, L. fermentum, L. curvatus, L. sake, L. bulgaricus, Streptococcus thermophilus, Streptococcus lactis, Streptococcus cremoris These include Bifidobacterium cremoris, B. longum, Bifidobacterium breve, Bifidum, Bifidobacterium infantis, and Bifidobacterium adolescentis. Alternatively, the active ingredients of other medications such as serotonin reuptake inhibitors (SSRIs), serotonin-norepinephrine reuptake inhibitors (SNRIs), tricyclic antidepressants (TACs), monoamine oxidase inhibitors (MAOIs), tetracyclic antidepressants (TeCAs), and noradrenergic and specific serotonergic antidepressants (NaSSAs) can also be used.

[0012] [Dosage] The dosage of the drug / pharmaceutical composition is 10 7 ~10 12 It is CFU. The administration cycle is based on the time it takes effect and may include, but is not limited to, taking the medication 1 to 3 times daily for 3 to 7 days a week. It is also related to the effective concentration of the specific formulation.

[0013] [Fermentation agents, functional microbial agents] A fermentation composition, fermentation agent, or functional microbial agent containing the short-fermentation agent Lactobacillus, comprising a bacterial solution obtained by producing the short-fermentation agent Lactobacillus bacterial solution, or a powder or granule obtained by further processing. The fermentation agent may further contain one or more non-antagonistic microbial agents, and a complex microbial agent may be obtained by selecting one or more from acid-resistant Lactobacillus, Plantarum Lactobacillus, Bulgaricus Lactobacillus, etc. Effective bacterial concentration, number of viable bacteria: 10 7 ~10 12 It is CFU. Fermentation agents or functional microorganisms can also be used as functional foods and nutritional supplements.

[0014] [Nutritional composition] A nutritional composition comprising the short-fermentation agent Lactobacillus, comprising the short-fermentation agent Lactobacillus and a food, nutritional product, supplement, probiotic, or synbiotic. The aforementioned food product contains the short-fermentation agent Lactobacillus and auxiliary substances that realize the food function, and the labeling format includes, but is not limited to, "nutritional supplement" and "fermented food." The aforementioned nutritional supplement contains a bacterial solution obtained by producing the short-fermentation agent Lactobacillus bacterial solution, or a powder obtained by further processing, and is further processed by adding nutrients such as cellulose, vitamins, and minerals. The fermented foods include dairy products, soy products, or fruit and vegetable products. The dairy products include milk, sour cream, or cheese. The soy products include soy milk, fermented black beans, or miso. The fruit and vegetable products include cucumber, carrot, beet, celery, or cabbage products. The aforementioned probiotics refer to live microorganisms that are beneficial to the host's health when administered in appropriate amounts. The symbiotics refer to foods containing a mixture of probiotics and prebiotics. These usually include prebiotic components that promote the growth and / or metabolic activity of probiotics, and generally include, but are not limited to, the probiotic effects of combinations such as short-fermenting Lactobacillus and fructooligosaccharides or galactooligosaccharides.

[0015] [Pharmaceuticals, Therapeutic Uses] Use of the short-fermenting Lactobacillus or composition according to the present invention in the manufacture of a drug or fermented bacterial agent for the treatment, alleviation, and prevention of depression and / or anxiety. The symptoms of the depression include, but are not limited to, the following. a) Abandoning the hope of escape b) Desperate behavior c) Unable to escape from a bad environment d) Lack of happiness e) Lack of interest in reward stimuli f) Long-term mood swings, sadness, nihilism, despair g) Decrease in thinking ability, decrease in reactivity, decrease in memory and attention h) Decrease in self-evaluation, powerlessness, despair, and worthlessness i) Feeling guilty and sick j) Hallucinations, auditory hallucinations, visual hallucinations k) Showing no interest or enjoyment in most activities l) Decrease in conscious activity, slow, passive, lazy behavior, not wanting to do things, not wanting to contact people around, always sitting alone or sleeping all day, staying alone at home, being estranged from friends, or avoiding social interaction m) Symptoms such as nausea, vomiting, palpitations, chest compression, sweating, etc. n) Significant weight loss or gain without dieting, and consistent decrease or increase in appetite o) Insomnia or hypersomnia p) Always restless, always feeling fatigue or weakness These may be caused by physically induced environmental factors, chemical factors, specific foods, etc. Specifically, chronic restraint stress ( CRS ), chronic unpredictable stress animal model (CUMS), learned helplessness (LH), social dissatisfaction (SD), amino acid-deficient diet (AAD), corticosterone (CORT), genetic (family history or gene-related, the first-degree relatives of patients (parents, children, siblings) have a risk of depression about 2 to 10 times higher, and the heritability is 31% to 42%), medical (in cases of other physical diseases or traumas such as Parkinson's disease, seizure disorders, digestive diseases, hypothyroidism, etc., or when taking certain drugs, depression may occur), psychological (including how the patient perceives others and themselves, and how they relate to the outside world. Psychological characteristics that may induce depression include reduced stress tolerance, helplessness, anger, despair, lack of confidence, etc.), environmental (referring to external events or phenomena that may cause depression, among which relatively common social factors include family problems (e.g., marital conflicts), life stresses such as unemployment, traumatic experiences such as traffic accidents or the death of a loved one, neglect, abuse, childhood psychological traumas such as early parental death, cultural background, etc.), factors, etc., but are not limited to these.

[0016] The short-fermentation agent Lactobacillus strain is also expected to have similar preventive or alleviating effects in other nervous system diseases, such as: depression, anxiety disorder, autism, schizophrenia, obsessive-compulsive disorder, phobia, bipolar disorder, personality disorder, mania, delusional disorder, psychosis, neurasthenia, mental retardation, dementia, insomnia, psychosomatic disorder, mood disorder, delusional disorder, mental disorder associated with alcohol dependence, mental disorder associated with substance dependence, reactive mental disorder (acute stress reaction, post-traumatic stress disorder, adjustment disorder), sexual dysfunction (paraphilia, gender dysphoria, pedophilia, homosexuality, etc.), personality disorder (antisocial personality disorder, impulsive personality disorder), cognitive disorder, Alzheimer's disease, epilepsy, Parkinson's disease, etc.

[0017] [Beneficial effects] This invention discloses a method for producing and using a short-fermentation Lactobacillus strain that alleviates depression-like symptoms in mice. The short-fermentation Lactobacillus strain is obtained by isolation from the intestinal tract of healthy humans, its origin is safely controllable, and it is easily cultured in vitro. Furthermore, it exhibits relatively high colonization efficiency in the intestinal tract and can significantly improve depressive-like behavior in various depression models, making it suitable for use in the production of antidepressant foods, health foods, and pharmaceuticals. This provides a new approach to clinical intervention and the control of related mental disorders such as depression, offering promising and broad application prospects. Simultaneously, the short-fermentation Lactobacillus strain is widely present in fermented foods and the human intestinal tract, and this invention demonstrates that the strain has no adverse effects on body weight, internal organs, liver, and intestinal tissue, indicating relatively high safety. It also shows relatively good tolerance to simulated gastric juice at pH 3.0 and simulated intestinal juice containing 0.3% bile salt, demonstrating excellent acid and bile salt tolerance, which is advantageous for the development of therapeutic effects after formulation.

[0018] [Explanation of Biological Deposits] The short-fermentation agent is Lactobacillus brevis ibiome003, deposited on March 21, 2023, at the China Center for the Preservation of Typical Cultures (address: Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province), with deposit number CCTCC NO: M2023387. [Brief explanation of the drawing]

[0019] [Figure 1] Figure 1 is a photograph of a single colony of Lactobacillus, a short-fermentation agent, in Example 2. [Figure 2] Figure 2 shows the morphology of Lactobacillus colonies from Example 2, after Gram staining and microscopic examination at 40x magnification. [Figure 3] Figure 3 shows the measurement results of the fixation ability of the short-fermentation agent Lactobacillus in Example 3, and the numbers between the groups in the figure represent the P-value between them. [Figure 4]Figure 4 shows the effects of colonization with the short-fermentation agent Lactobacillus 1 (ibiome003) on the forced swimming test (A), tail suspension test (B), and sucrose water palatability test (C) in mice in the CUMS-induced depression model of Example 4. The numbers between the groups in the figure represent the P-values ​​between the two tests. [Figure 5] Figure 5 shows the time course of weight change in mice in Example 5. [Figure 6] Figure 6 shows the effect of intraperitoneal administration of the short-fermentation agent Lactobacillus on morphological changes in the mouse liver. [Figure 7] Figure 7 shows the effects of intraperitoneal administration of the short-fermentation agent Lactobacillus on morphological changes in the mouse intestinal tract. [Figure 8] Figure 8 shows the effects of the short-fermentation agent Lactobacillus colonization on the forced swimming test (A), tail suspension test (B), and sucrose water preference test (C) in the AAD-induced depression model of Example 6. The numbers between the groups in the figure represent the P-values ​​between the two tests. [Figure 9] Figure 9 shows the effects of the short-fermentation agent Lactobacillus 1 (ibiome003) on serotonin (A), acetylcholine (B), and dopamine (C) in the mouse brain in the AAD-induced depression model of Example 7. [Figure 10] Figure 10 shows the effects of the short-fermentation agent Lactobacillus colonization on the forced swimming test (A), tail suspension test (B), and sucrose water palatability test (C) in the Cort-induced depression model of Example 8. The numbers between the groups in the figure represent the P-values ​​between the two tests. [Figure 11] Figure 11 shows the effects of colonization with multiple strains of the short-fermenting agent Lactobacillus on the forced swimming test (A) and tail suspension test (B) in mice in the CUMS-induced depression model of Example 9. The numbers between the groups in the figure represent the P-values ​​between the two tests. [Modes for carrying out the invention]

[0020] Example 1: Isolation and genetic testing of the short-fermentation agent Lactobacillus Isolation of the short-fermentation agent Lactobacillus from healthy human intestinal tract: Volunteer fecal samples (provided by employees of Hefei Han Microbiology Technology Co., Ltd.) were stored in 20% glycerophosphate buffer, and each sample was 10%. -5 , 10 -6 , 10 -7 The solution was serially diluted up to 1 / 2 the original concentration, and 100 μL of each concentration was collected and spread onto GAM broth medium (Solarbio LA4450) and MRS broth medium. Single colonies were cultured in the corresponding liquid medium and 16S rRNA general-purpose primers (upstream primer sequence 27F:AGAGTTTG ATCCTGGCTCAG (SEQ ID NO.2 ), downstream primer sequence 1492R:GGTTA CCTTGTTACGACTT(SEQ ID NO.3 The strain's genomic DNA was analyzed using )). The amplification conditions were as follows: (1) 95°C, 7 min, (2) 95°C, 15 sec, (3) 65°C, 15 sec, (4) 72°C, 30 sec, (5) return to step 2 and amplify by 9x, (6) 95°C, 15 sec, (7) 55°C, 15 sec, (8) 72°C, 30 sec, (9) return to step 6 and amplify by 32x, (10) 72°C, 5 min, (11) 12°C, 30 min. The samples were stored in glycerin at -80°C. The amplified products were sequenced, and 16S rDNA sequencing was performed at "General Biotechnology Co., Ltd." to identify the bacterial species. The sequence of the 16S rDNA was as follows.

[0021] Example 2: Identification of the short-fermentation agent Lactobacillus 2.1 Photographs of a single colony Figure 1 shows a single colony photograph taken after culturing the short-fermentation agent Lactobacillus in MRS medium for 48 hours. The colonies were circular, with a smooth and moist surface, regular margins, and a white appearance. 2.2 Smear microscopy The short-fermentation agent Lactobacillus was Gram-stained and examined under a 40x magnification microscope (Figure 2). This strain was Gram-positive, exhibited a short, rod-like morphology, and no spore formation was observed. 2.3 Testing of biochemical reactions based on sugar and alcohol fermentation 300 μL of frozen-stored short-fermentation agent Lactobacillus was reactivated in 1 mL of MRS medium, and the resulting liquid culture was purified on MRS solid medium. Single colonies were then collected and cultured in 1 mL of MRS liquid medium for 24 hours. The resulting liquid culture was again gradient-diluted, spread onto MRS solid medium, and cultured for 72 hours. After that, biochemical reactions based on sugar and alcohol fermentation were tested. Basic Characterization Reaction of Bacterial Strains: Measurement of Biochemical Reactions in Sugar and Alcohol Fermentation Single colonies were collected using sterile pipette tips and inoculated into commercially available bacterial biochemistry ampoule bottles (purchased from Qingdao Haibo Biotechnology Co., Ltd.; see Table 1 for product numbers). After inoculation, the cells were cultured anaerobically at 37°C for 48 hours, and the results were determined according to the kit's package insert (Table 1). [Table 1] The following was confirmed by the inspection of JPEG2026519936000016.jpg124170: The strain examined was found to belong to the short-fermenting Lactobacillus species (Levilactobacillus brevis). This strain was named Lactobacillus brevis ibiome003 and deposited with the China Center for the Preservation of Typical Cultures. Deposit location: China Center for the Preservation of Typical Cultures, Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province, Deposit date: March 21, 2023, Deposit number: CCTCC NO: M2023387.

[0022] Example 3: Effect of the short-fermentation agent Lactobacillus 1 (ibiome003) on colonization in the mouse intestinal tract. Ten 6-8 week old SPF-grade C57 / B6j male mice (purchased from "Jucui Yaokang") were randomly divided into two groups: one group consisted of normal mice + physiological saline (5 mice), and the other group consisted of normal mice + the short-fermenting agent Lactobacillus 1 (5 mice). After culturing the short-fermenting agent Lactobacillus in MRS medium, the mixture was centrifuged at 3000 rpm for 10 minutes, resuspended in 1×PBS to an OD of 1.0 (600 nm), and administered via gastric administration. The mice in the short-fermenting agent Lactobacillus 1 group received 200 μL of the short-fermenting agent Lactobacillus ibiome003 suspension (10 7 In the group of mice in the saline solution group, 200 μL of saline solution was administered once every two days for two consecutive weeks, and the colonization ability of the short-fermenting agent Lactobacillus 1 was measured. Specifically, mouse feces were collected in sterile EP tubes, weighed, and then DNA was extracted from the feces using organic solvents (20% SDS, phenol-chloroform, white polishing beads). 16S rDNA primer (upstream primer Levil-F AAACAACTGTGTATTCCCCA) (SEQ ID NO.4) ,Levil-R CAACTAATAGGATCACCCCC (SEQ ID NO.5) Internal reference primer, upstream primer 27F:AGAGTTTG ATCCTGGCTCAG (SEQ ID NO.6) Downstream primer 1492R:GGTTA CCTTGTTACGACTT (SEQ ID NO.7) The abundance of this strain in mouse feces was quantitatively analyzed by QPCR using (calculation formula: POWER(2,-ΔCt)×100%, where ΔCt = target gene - internal reference gene). The results are shown in Figure 3. This strain of Lactobacillus 1, a short-fermentation agent, showed relatively strong colonization ability in the mouse intestinal tract, suggesting its potential to contribute to its functional expression. The reaction conditions for QPCR are as follows: (1) 95°C, 2 minutes, (2) 95°C, 5 seconds, (3) 60°C, 30 seconds, (4) return to step 2, 40X, (5) 95°C, 10 seconds, (6) 65°C, 5 seconds, (7) 95°C, 5 minutes.

[0023] Example 4: Alleviation of the depressive-like phenotype in mice induced by chronic unpredictable stress (CUMS) by the colonization of short-fermenting Lactobacillus 1 (ibiome003) Twenty 6-8-week-old SPF-grade C57 / B6j male mice (purchased from “Jicuiyaokang”) were randomly divided into four groups: normal mice + saline group (5 mice), normal mice + short-fermenting Lactobacillus 1 group (5 mice), CUMS mice + saline group (5 mice), and CUMS mice + short-fermenting Lactobacillus 1 group (5 mice). After environmental adaptation, from day 0, the CUMS mouse group was subjected to chronic and unpredictable mild stress stimuli (mimicking chronic low-intensity stress in daily life) for 21 days. One type of stimulus was randomly selected from day and night every day, and the order was random and applied to the mice so that it was not repeated continuously, making it difficult to predict the stimulus. After 21 consecutive days of model establishment, the success of the depression model was confirmed by the forced swimming test, tail suspension test, and sucrose preference test. Mouse depression caused by chronic and unpredictable mild stress stimuli is classified as depression caused by physical (environmental) factors. Short-fermenting Lactobacillus 1 cultured in MRS medium was centrifuged at 3000 rpm for 10 minutes, resuspended in 1×PBS to OD1.0 (600 nm), and then 200 μL of the short-fermenting Lactobacillus ibiome003 suspension (10 7 CFU) was administered to the mice in the short-fermenting Lactobacillus 1 group by gavage, and 200 μL of saline was administered to the mice in the saline group once every two days for 2 consecutive weeks. Then, the forced swimming test and tail suspension test were performed to compare the immobility time of the mice in each group. The specific experimental methods are as follows. In the forced swimming test, the experimental apparatus was a transparent 20x30 cm circular barrel filled with pure water, with a diameter of 20 cm and a water depth of 15 cm. The temperature of the pure water was 23-25 °C. A video camera was installed in the front, at the same level as the water surface. The mice were placed in the water, and their behavior for 6 minutes was recorded, and the immobility time in the last 4 minutes was analyzed. The immobile behavior was defined as the state where the mouse floated and only moved occasionally without struggling, maintaining the floating state. The longer the immobility time, the more severe the depressive symptoms, which reflects giving up escaping (behavioral despair). In the tail suspension test, the mouse's tail was suspended with adhesive tape and secured in a position where it could not be grasped by surrounding surfaces. Its behavior was recorded from the front for 6 minutes. The remaining 4 minutes were analyzed. This test utilizes the fact that animals exhibit a state of stillness due to short-term unavoidable stress, and that the more severe the depressive symptoms, the shorter the escape attempt time. The tail suspension test induces despair behavior (inability to escape from a bad environment) due to the inability to escape from an abnormal body position. The sugar water preference test evaluates the degree of anhedonia (anorgasmia) in mice. The experiment was conducted twice in total, and the baseline preference rate of all mice was measured before model creation to confirm the uniformity of the experimental group. The formal test consisted of adaptive training and the main test. In the training, mice were given two bottles of 1% (w / v) sucrose solution per cage for the first 24 hours, and immediately afterward, one of the bottles was replaced with pure water for 24 hours. After adaptation was complete, the mice underwent a 24-hour fast and water abstinence, at which point the measurement of sugar water preference rate began. In the main test, mice could only choose from two pre-weighed bottles: one containing 1% (w / v) sucrose solution and the other containing pure water. After 24 hours of fasting, the two bottles were removed and weighed, and the total liquid consumption, sugar water consumption, and pure water consumption of the mice were recorded. Sugar water preference rate (%) was calculated as: Sugar water consumption / (Sucrose water consumption + Pure water consumption) × 100%. Anorexia nervosa refers to a state in which pleasure cannot be experienced from rewards or enjoyable activities, or a loss of interest in reward stimuli (a manifestation of mood disorder / depression). The results are shown in Figure 4. In the forced swimming and tail suspension tests (Figures 4A and 4B), the resting time of CUMS mice + short-fermentation agent Lactobacillus 1 was significantly shorter than that of CUMS mice + saline solution (P<0.01) and was comparable to that of the normal mouse group, indicating that the short-fermentation agent Lactobacillus 1 significantly alleviates CUMS-induced depression-like behavior. In the sugar water preference test (Figure 4C), the preference rate of CUMS mice + short-fermentation agent Lactobacillus 1 was significantly higher than that of CUMS mice + saline solution (P<0.01) and was comparable to that of the normal mouse group, indicating that the short-fermentation agent Lactobacillus 1 significantly restores CUMS-induced pleasure loss.

[0024] Example 5: Effects of the short-fermentation agent Lactobacillus 1 (ibiome003) on mice The weight changes of mice in Example 4 were recorded over time, and weight data of the mice was recorded daily from the start of gastric administration of the short-fermentation agent Lactobacillus 1, and a weight curve was created. The results are shown in Figure 5. There were no significant differences in weight changes among the four groups, indicating that the short-fermentation agent Lactobacillus 1 did not affect weight gain and was highly safe. The condition of the mice in the short-fermentation agent Lactobacillus 1 group was good, with no adverse reactions during the observation period, and no difference was observed compared to the normal group. Autopsy revealed that the internal organs of the short-fermentation Lactobacillus group 1 mice were healthy and plump, with no lesions or adhesions. HE staining of liver and intestinal tissue (Figures 6 and 7) showed no differences in cell morphology. Simultaneously, ALT and AST levels in mouse serum were evaluated, and no adverse effects were observed.

[0025] Example 6: Alleviation of amino acid diet (AAD) induced depression-like phenotype in mice by colonization with the short-fermentation agent Lactobacillus 1 (ibiome003). Twenty 6-8 week old SPF-grade C57 / B6j male mice (purchased from "Jicui Yaokang") were randomly divided into four groups: a normal mouse + saline group (5 mice), a normal mouse + short-fermentation Lactobacillus group (5 mice), an AAD mouse + saline group (5 mice), and an AAD mouse + short-fermentation Lactobacillus group (5 mice). After environmental adaptation, the normal mouse group was fed a normal diet from day 0, while the AAD mouse group was fed an amino acid diet (trophic acid diet) for four consecutive weeks. The success of the depression model was confirmed by forced swimming tests, tail suspension tests, and sugar water preference tests. AAD-induced depression is classified as a food-factor-induced depression. Similarly, administering the short-fermenting agent Lactobacillus 1 (10) via gastric administration for two weeks. 9CFU was administered to the mice, and forced swimming and tail suspension tests were conducted. The time the mice in each group remained still during forced swimming and tail suspension experiments was compared. The results are shown in Figures 8A and 8B. The resting time of the AAD mice + short-fermentation agent Lactobacillus 1 group was significantly shorter than that of the AAD mice + saline group, and was similar to that of the normal mouse group, indicating that the short-fermentation agent Lactobacillus 1 significantly alleviates AAD-induced depression-like behavior. In the sugar water preference test (Figure 8C), the preference rate of the AAD mice + short-fermentation agent Lactobacillus 1 group was significantly higher than that of the AAD mice + saline group (P<0.01), and was similar to that of the normal mouse group, indicating that the short-fermentation agent Lactobacillus 1 significantly restores AAD-induced pleasure loss.

[0026] Example 7: Measurement of serotonin, acetylcholine, and dopamine content In Example 6, AAD-induced depressed mice were administered either physiological saline or the short-fermentation agent Lactobacillus 1 (ibiome003) via gastric administration, and brain serotonin, acetylcholine, and dopamine levels were measured. The results are shown in Figure 9. No significant changes in brain serotonin, acetylcholine, and dopamine levels were observed in depressed mice administered with the short-fermentation agent Lactobacillus 1 compared to the group administered with physiological saline.

[0027] Example 8: Alleviation of corticosterone (Cort)-induced depression-like phenotype in mice by colonization with the short-fermentation agent Lactobacillus 1 (ibiome003). Twenty 6-8 week old SPF-grade C57 / B6j male mice (purchased from "Jicui Yaokang") were randomly divided into four groups: a normal mouse + saline group (5 mice), a normal mouse + short-fermentation agent Lactobacillus group (5 mice), a Cort mouse + saline group (5 mice), and a Cort mouse + short-fermentation agent Lactobacillus group (5 mice). After environmental adaptation, from day 0, the drinking water for the Cort mouse group was a corticosterone solution (MCE, HY-B1618) with a final concentration of 25 μg / mL (pH 7.0-7.4), while the normal mouse group was given ordinary water. The water was changed every two days, and the model was maintained for 21 consecutive days. The success of the model was confirmed by forced swimming tests, tail suspension tests, and sugar water preference tests. Cort-induced depression is classified as a type of depression caused by chemical factors. Similarly, when administered via gastric injection, the short-fermentation agent Lactobacillus 1 (10) was observed in the mouse intestines for two weeks. 12 CFU was administered to the mice, and forced swimming and tail suspension tests were conducted. The time the mice in each group remained still during forced swimming and tail suspension experiments was compared. The results are shown in Figures 10A and 10B. The resting time of the Cort mice + short-fermentation agent Lactobacillus 1 group was significantly shorter than that of the Cort mice + saline group, and was similar to that of the normal mouse group, indicating that the short-fermentation agent Lactobacillus 1 significantly alleviates Cort-induced depression-like behavior. In the sugar water preference test (Figure 10C), the preference rate of the Cort mice + short-fermentation agent Lactobacillus 1 group was significantly higher than that of the Cort mice + saline group (P<0.01), and was similar to that of the normal mouse group, indicating that the short-fermentation agent Lactobacillus 1 significantly restores Cort-induced pleasure loss.

[0028] Example 9: Not all short-fermentation Lactobacillus agents alleviate depressive symptoms. Several short-fermentation Lactobacillus strains derived from healthy human intestinal tracts were evaluated, with Lactobacillus 2 used as a control. Six-to-eight-week-old SPF-grade C57 / B6j male mice (purchased from "Jicui Yaokang") were randomly divided into three groups: a depression + saline group (5 mice), a depression + short-fermentation Lactobacillus 1 group (5 mice), and a depression + control short-fermentation Lactobacillus 2 group (5 mice). After environmental adaptation, from day 0, the mouse groups received chronic, unpredictable, and mild stimuli for 21 days, mimicking the chronic, low-intensity stress experienced in daily human life. One stimulus was selected each day from the daytime and nighttime, administered to the mice in a random order and not repeated consecutively, so that the mice could not predict the appearance of the stimuli. After 21 consecutive days of modeling, the success of the depression model was confirmed through forced swimming, tail suspension, and sugar water preference experiments. Similarly, the short-fermentation agent Lactobacillus was administered intragastricly to mice for a period of two weeks. The mice were then subjected to forced swimming and tail suspension experiments, and the resting time in each group of mice was compared. The results are shown in Figure 11. Regarding forced swimming and resting time in tail suspension, the short-ferment Lactobacillus 2 mouse group showed no significant difference compared to the control group of depressed mice, indicating that the degree of depression was not alleviated. This suggests that not all short-ferment Lactobacillus strains possess the function of alleviating depressive symptoms.

[0029] Example 10: Evaluation of the acid and bile salt tolerance of the short-fermentation agent Lactobacillus 1 (ibiome003) (1) Experimental group Acid resistance test: A. Buffer control group, B. pH 3.0 simulated gastric juice group Bile salt tolerance test: A. Buffer control group, B. 0.3% bile salt simulated intestinal fluid group (2) Reagent preparation pH 3.0 simulated gastric juice: 0.25 g of pepsin was added to 20 mL of water to adjust the pH to 3.0, and then water was added to bring the total volume to 25 mL. Buffer solution: 6.8 g of potassium dihydrogen phosphate was weighed out, dissolved in 500 mL of pure water, and then the pH was adjusted to 6.8 with a 0.1 mol / L sodium hydroxide solution. Bile salt simulated intestinal fluid: Bile salt solids were weighed out and adjusted proportionally to a concentration of 0.3% to prepare 20 mL of simulated intestinal fluid. (3) Operating Procedure Two grams of powder containing the short-fermenting agent Lactobacillus 1 were taken and vortex-mixed in 18 mL of sterile physiological saline until completely dissolved to prepare the test solution. One mL of the test solution was taken and added to 9 mL of either buffer solution or pH 3.0 simulated gastric juice, and mixed uniformly. After standing, samples were taken at predetermined times (0h, 0.5h, 1h, 2h). 100 μL of the sample was diluted with a 10-fold gradient, and after selecting an appropriate dilution gradient, 100 μL was taken and spread on the surface of MRS medium. Four dilution gradients were selected according to the passage of time, and after spreading, the cultures were incubated at 30°C, and the growth of colonies was observed and recorded. Two mL of the test solution was taken and added to either 18 mL of buffer or 18 mL of 0.3% bile salt simulated intestinal solution, and mixed uniformly. After standing, samples were taken at predetermined times (0h, 1.5h, 3h, 4.5h, 6h). 100 μL of the sample was diluted 10-fold, and an appropriate dilution gradient was selected. 100 μL of each sample was then taken and spread onto the surface of MRS medium. Four dilution gradients were selected according to the passage of time. After spreading, the samples were cultured at 30°C, and the growth of the colonies was observed and recorded. (4) Statistics of the results [Table 2] JPEG2026519936000017.jpg55170[Table 3] The results showed that the short-fermentation agent Lactobacillus 1 exhibited relatively good resistance in a simulated gastric juice solution at pH 3.0, and the decrease in viable cell count was relatively gradual. The decrease was also not significant in a simulated intestinal juice solution containing 0.3% bile salt, demonstrating that the short-fermentation agent Lactobacillus 1 possesses good acid and bile salt tolerance. [Industrial applicability]

[0030] This invention discloses a method for preparing and using Lactobacillus, a short-fermentation agent, to alleviate depressive symptoms in mice. This Lactobacillus is isolated from the intestinal tract of healthy humans, is safe and easy to manage, readily cultured in vitro, has high colonization efficiency in the intestines, and significantly improves depressive-like behaviors across various depression models. Therefore, it can be used in the production of antidepressant foods, health foods, and pharmaceuticals. This provides a new solution for the intervention and management of depression-related mental disorders in clinical settings and has a promising and broad application outlook. Simultaneously, Lactobacillus is widely present in fermented foods and the human intestinal tract, and this invention also demonstrates that the strain exhibits high safety, with no side effects on body weight, internal organs, liver, or intestinal tissue. Furthermore, it shows good tolerance to simulated gastric juice at pH 3.0 and simulated intestinal juice containing 0.3% bile salt, demonstrating excellent acid and bile salt tolerance, which is advantageous for efficacy after pharmaceutical development and provides industrial practicality.

Claims

1. The short-fermentation agent is Lactobacillus brevis ibiome003, The short-fermentation agent Lactobacillus strain is characterized in that it is deposited with the China Center for the Preservation of Typical Cultures (address: Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province), the deposit date is March 21, 2023, and the deposit number is CCTCC NO: M2023387.

2. It is a drug, A drug characterized by comprising the short-fermentation agent Lactobacillus brevis ibiome003 described in claim 1, and pharmaceutically acceptable excipients, carriers, auxiliary materials, and pharmacokinetics.

3. The drug according to claim 2, characterized in that the drug is a powder, suspension, granule, capsule, tablet, pill, oral solution, injection, or powder injection.

4. A pharmaceutical composition, A pharmaceutical composition characterized by comprising the short-fermentation agent Lactobacillus brevis ibiome003 described in claim 1 and a co-administered drug, wherein the co-administered drug is another drug that exhibits a synergistic effect with the short-fermentation agent Lactobacillus brevis.

5. A fermentation agent, a functional microbial agent, or a nutritional composition characterized by containing the short-fermentation agent Lactobacillus brevis ibiome003 described in claim 1.

6. The fermentation agent, functional microbial agent, or nutritional composition according to claim 5, characterized in that the nutritional composition is a food, nutritional supplement, probiotic, or synbiotic.

7. The aforementioned foods include general foods and foods for special dietary uses. Preferably, the fermentation agent, functional microbial agent, or nutritional composition according to claim 6, characterized in that the special-use food includes health functional foods, special medical use foods, and formulas for infants and young children.

8. Use of the short-fermentation agent Lactobacillus (Leviractobacillus brevis) ibiome003 according to claim 1, or the drug according to any one of claims 2 to 3, or the pharmaceutical composition according to claim 4, in the manufacture of a drug for the treatment, relief, or prevention of depression and / or anxiety.

9. The use according to claim 8, characterized in that the symptoms of depression include (but are not limited to) the following. a) Abandonment of the desire to escape b) Desperate actions c) Inability to escape from a harsh environment d) Lack of pleasure e) Loss of interest in reward stimuli.

10. The use according to claim 8, characterized in that the depression is caused by physical (environmental) factors, chemical factors, and / or certain foods.