Circular RNA and methods for producing circular RNA

Abstract

The present invention relates to a recombinant nucleic acid molecule that produces circular RNA, comprising, in the 5' to 3' direction, a) an internal guide sequence (IGS), b) a ribozyme, c) a first portion of an extended anticodon arm (eACA) sequence, d) a target gene, and e) a second portion of the eACA sequence. The nucleotides in the second portion of the eACA sequence form fluctuating base pairs with the nucleotides in the IGS. The recombinant nucleic acid molecule, circular RNA, and methods for producing circular RNA and methods for using circular RNA are provided.

Description

[Technical Field]

[0001] This application claims priority to UK Patent Application No. 2308675.4, filed on 9 June 2023, the contents and components thereof, by reference in all purposes, constitute part of this Specification.

[0002] The present invention relates to a recombinant nucleic acid molecule that produces circular RNA, a method for producing circular RNA, and circular RNA that does not contain an exogenous exon sequence. [Background technology]

[0003] Circular RNA (circRNA) is a single-stranded RNA molecule that is closed by covalent bonds. In the past decade, tens of thousands of circRNAs have been identified, ranging from viruses to humans. In human cells, circRNAs are mainly produced through backsplicing. Because circRNAs are ubiquitous, there is growing interest in them. Although the innate functions of circRNAs are not yet fully understood, some hypotheses suggest that they act as sponges for microRNAs and proteins, or as templates for generating peptides or proteins. Simultaneously, due to their high stability, circRNAs are currently forming the basis for next-generation mRNA therapeutics.

[0004] While in vitro circularization of RNA can be achieved by chemical or enzymatic ligation, such strategies are inefficient for generating long circRNAs and are prone to intermolecular ligation (Non-Patent Document 1). An alternative method, the so-called permuted intron-exon method (PIE), is efficient for circularizing long RNAs (Non-Patent Documents 2, 3, and 1). The PIE method leverages the self-splicing properties of group I introns, which are well-studied ribozymes that can splinter adjacent exons through a two-step transesterification reaction that does not involve any protein. In the PIE method, the 5' half of the intron moves to the 3' end of the RNA, thereby connecting adjacent exons, so the splicing product is a circular form of pre-spliced ​​exons.

[0005] While the PIE method is an attractive one-step method for generating circRNA, it comes with several drawbacks. The key to PIE's functionality lies in the formation of a ribozyme core by two intron halves isolated by pre-connected exons. Long pre-connected exons have the ability to interact with adjacent intron halves, potentially hindering the formation of a functional ribozyme core. Furthermore, circRNAs generated by PIE may contain unwanted sequences that have been reported to trigger immune responses (Non-Patent Literature 4). Group I introns can also act as transribozymes targeting a second molecule (Non-Patent Literature 5, Non-Patent Literature 6). Much effort has been expended to manipulate transribozymes to deliver the correct sequence to defective mRNA in vivo (Non-Patent Literature 7, Non-Patent Literature 8, Non-Patent Literature 9, Non-Patent Literature 10), but unfortunately, the efficiency remains low.

[0006] Various attempts have been made to obtain circular RNA that does not contain unwanted sequences, such as spacer sequences introduced by the PIE method or circular RNA that does not contain native exon sequences. One such method is described in Patent Document 2, in which the internal guide sequence (IGS) of the ribozyme is inversely complementary to the target site region in the target gene for self-splicing and circularization. The IGS region and the target site region are located on opposite sides of the ribozyme and the target gene, respectively, and the guanine at the 5' end of the IGS region forms a fluctuation base pair with the uracil at the 3' end of the target site region. However, such methods are limited by the low efficiency of converting the precursor to circular RNA, resulting in high levels of nick formation and low yields.

[0007] Therefore, there is a need in this field for more efficient RNA cyclization methods that can also generate circular RNA without including unwanted sequences. [Prior art documents] [Patent Documents]

[0008] [Patent Document 1] International Publication No. 2023 / 046153 [Patent Document 2] International Publication No. 2022 / 191642 [Non-patent literature]

[0009] [Non-Patent Document 1] Petkovic, S. and Muller, S., RNA circularization strategies in vivo and in vitro. Nucleic Acids Res 43, 2454-2465, (2015) [Non-Patent Document 2] Puttaraju, M. and Been, MD, Group I permuted intron-exon (PIE) sequences self-splice to circular exons. Nucleic Acids Res 20, 5357-5364 (1992) [Non-Patent Document 3] Wesselhoeft, RA, Kowalski, PS, and Anderson, DG, Engineering circular RNA for potent and stable translation in eukaryotic cells. Nat Commun 9, 2629, doi:10.1038 / s41467-018-05096-6 (2018) [Non-Patent Document 4] Liu, CX et al. Mol Cell 82, 420-434 e426 (2022) [Non-Patent Document 5] Inoue T et al., Intermolecular exon ligation of the rRNA precursor of Tetrahymena: Oligonucleotides can function as 5' exons. Cell, vol 43(2) (1985) [Non-Patent Document 6] Been, MD et al., One binding site determines sequence specificity of Tetrahymena pre-rRNA self-splicing trans-splicing and RNA enzyme activity. Cell, vol. 47(2) (1986) [Non-Patent Document 7] Sullenger BA et al., Ribozyme-mediated repair of defective mRNA by targeted trans-splicing Nature, vol. 371(6498) (1994)

Non-Patent Document 8

Non-Patent Document 9

Non-Patent Document 10

Summary of the Invention

[0010] In a first aspect, the present invention provides a recombinant nucleic acid molecule that produces circular RNA, which, in the 5' to 3' direction, a) an internal guide sequence (IGS); b) a ribozyme; c) a first part of an extended anticodon arm (eACA) sequence; d) a gene of interest; e) a second part of the eACA sequence; and wherein the nucleotides in the second part of the eACA sequence form wobble base pairs with the nucleotides in the IGS, and provides a recombinant nucleic acid molecule.

[0011] The gene of interest in the recombinant nucleic acid molecule of the first aspect may contain a coding sequence. The gene of interest may further contain an internal ribosome entry site (IRES) sequence.

[0012] In some embodiments, the recombinant nucleic acid molecule of the first aspect may lack a stop codon in-frame with the coding sequence.

[0013] In a second aspect, the present invention provides the use of the recombinant nucleic acid molecule described herein in a method for producing circular RNA.

[0014] In a third aspect, the present invention is a method for generating circular RNA, comprising: a) preparing the recombinant nucleic acid molecule described herein; and b) circularizing the recombinant nucleic acid molecule.

[0015] In a fourth aspect, the present invention is a method for generating circular RNA, comprising: a) preparing the recombinant nucleic acid molecule described herein; b) transcribing the recombinant nucleic acid molecule to generate an RNA precursor; and c) circularizing the recombinant nucleic acid molecule.

[0016] In a fifth aspect, the present invention is a method for generating circular RNA, comprising: a) identifying a target gene comprising a sequence capable of forming an eACA stem-loop; b) producing a recombinant nucleic acid molecule comprising an internal guide sequence (IGS)-ribozyme-sequence encoding the target gene in the 5' to 3' direction; and c) circularizing the recombinant nucleic acid molecule.

[0017] In a sixth aspect, the present invention is a method for generating circular RNA, comprising: a) preparing the recombinant nucleic acid molecule described herein; and b) transcribing and circularizing the recombinant nucleic acid molecule, wherein circularization occurs cotranscriptionally.

[0018] In a seventh aspect, the present invention provides a circular RNA comprising a sequence encoding a target gene, wherein the circular RNA does not contain an exogenous splicing sequence.

[0019] In an eighth aspect, the present invention provides a circular RNA comprising a sequence encoding a target gene, wherein the circular RNA does not contain RNA derived from a cyclization factor.

[0020] In a ninth aspect, the present invention provides a circular RNA that can be obtained by the method described herein, wherein the circular RNA is less immunogenic than a circular RNA containing an exogenous exon sequence.

[0021] In a tenth embodiment, the present invention provides a circular RNA that can be obtained by the method described herein, wherein the circular RNA does not contain an exogenous exon sequence.

[0022] A circular RNA according to any of the seventh to tenth embodiments may be produced by any of the methods according to the third to sixth embodiments.

[0023] In an eleventh embodiment, the present invention provides the use of the circular RNA described herein in an in vitro method for expressing proteins in cells.

[0024] In a twelfth aspect, the present invention provides a method for expressing a target gene in a cell, comprising the steps of (a) circulating a recombinant nucleic acid molecule described herein to obtain a circular RNA containing the target gene, and (b) administering the circular RNA to a cell.

[0025] In a thirteenth aspect, the present invention provides a method for treating a disease in a subject, comprising the steps of (a) cyclizing a recombinant nucleic acid molecule described herein to obtain circular RNA, and (b) administering the circular RNA to a subject.

[0026] In a fourteenth embodiment, the present invention provides recombinant nucleic acid molecules described herein for use as pharmaceuticals.

[0027] In a fifteenth embodiment, the present invention provides recombinant nucleic acid molecules described herein for use in a method of treating a disease in a subject. [Brief explanation of the drawing]

[0028] [Figure 1] This figure compares conventional techniques with trans-ribozyme-based circularization (TRIC). (A) A schematic diagram showing that a linear molecule containing joined exons is obtained as a result of splicing with a group I intron from the cyanobacterium Anabaena (Ana). (B) A schematic diagram showing the circularization of a target gene by the reordered intron-exon (PIE) method. (C) A schematic diagram showing that the target sequence is edited in splicing with a group I intron acting as a trans-ribozyme. (D) A schematic diagram showing the circularization of a target gene using the TRIC method. [Figure 2] (A) Schematic diagram of the tRNA intron of Ana. (B) Early form of TRIC (V0). The tRNA sequence of Ana is preserved (L15 / R30). Inset: Reaction steps of TRIC-V0. (C) (Right side of the figure) 12% denatured PAGE and 6% denatured PAGE identifying the circular 3× Flag generated by TRIC-V0. (D) RT-PCR of in vitro transcript, band I product, and band II product. (E) Sanger sequencing of RT-PCR products. [Figure 3] (A) Schematic diagram of TRIC-V1 (L15 / R30) with EGS and loop region. (B) Electrophoresis of the in vitro transcription product of the V1 mutant on 6% denatured PAGE. (C) RNase R digestion of the in vitro transcript of TRIC-V1. [Figure 4](A) Relative length of the long target gene. (B) 0.8% native agarose gel on which in vitro transcription and cyclized samples of TRIC-V1 were run. The expected band positions for the cyclized product are indicated by black circles on the gel. [Figure 5] (A) Schematic diagram of the DNA template, RNA precursor, and resulting circular RNA for the PIE-Ana method. The linear precursor sequence is shown on the right. (B) Schematic diagram of the DNA template, RNA precursor, and resulting circular RNA for the TRIC-V1 method. The linear precursor sequence is shown on the right. [Figure 6] (A) Results of in vitro transcription performed with various concentrations of Mg2+. (B) Full-length precursors of TRIC-V1 were subjected to cyclization for 10, 20, and 40 minutes and separated on a 0.8% native agarose gel. (C) Cyclization efficiency of TRIC-V1 for long GOIs. (D) Comparison of the TRIC-V1 method and the PIE-Ana method. The expected band positions for the cyclic product are indicated by black circles on the gel. [Figure 7] (A) Schematic diagram of TRIC-V1 with a short GOI. (B) The top panel and the middle table show sequence information for TRIC-V1. The bottom table shows the composition of the right and left arms of the tRNA sequence in TRIC variants 1.30 to 1.39. [Figure 8] (A) Schematic diagram of TRIC-V2. (B) 6% denatured PAGE showing cyclization using V1.30 to V1.39 mutants, as well as V2.0, V2.1, and V2.2 mutants. The left / right configuration is shown below the gel. (C) Extended anticodon arm (eACA). Circulation sites can be aggregated as long as a stem-loop structure can be found in which the loop contains uracil at the third position and the stem is 5 bp or longer. Therefore, the cyclization site can be placed in either the UTR or CDS. (D) Circulation of RNA by eACA in CDS. The expected band positions for the cyclization product are indicated by black circles on the gel. [Figure 9](A) Comparison of TRIC-V1 and TRIC-V2 on 2% native agarose gels with varying EGS and eACA stem lengths. (B, C) Comparison of PIE and TRIC-V2 for CVB3-EGFP, CVB3-spike-EGFP, and CVB3-Cas9-EGFP. (D) Michaelis-Menten fitting of TRIC-V2 and PIE for RNA circularization. Data expressed as mean + SD (n=3, **p<0.01). (E) Comparison of efficiency, yield, and nick formation between TRIC-V1, TRIC-V2, and PIE. Data expressed as mean + SD (n=3, **p<0.01). [Figure 10] (A) A schematic overview of the TRIC-V2 method. (B) A legend regarding the components of TRIC-V2. [Figure 11](A) Schematic diagram of circular RNA generated by TRIC-V2, including the location of the siRNA targeting site (msiTS). Left: Arrangement of the resulting circGOI: eACA(UTR)-msiTS-IRES-start codon-CDS-stop codon-polyAC-eACA(UTR). eACA is aggregated within the UTR of the circular GOI. Right: Arrangement of the resulting circGOI: eACA(CDS)-stop codon-polyAC-msiTS-IRES-start codon-eACA(CDS). eACA is aggregated within the CDS of the circular GOI. Multiple siRNA targeting sites (msiTS) are introduced to target siRNA and isolate IRES and eACA. (B) Top panel: HPLC profile of the circularized RNA sample. Bottom panel: HPLC fraction separated on a 0.8% native agarose gel. (C)Circular RNA purified in two steps (HPLC and RNase R digestion) on a 6M-1.5% urea agarose gel. (D~F)Expression of IFN-β (D), IL6 (E), and CCL5 (F) by A549 cells. Data are expressed as mean + SD (n=3, *p<0.05, **p<0.01, ***p<0.001). (G)Expression of Nluc in HEK293 cells after transfection with linear or circular constructs. Data are expressed as mean + SD (n≧3, *p<0.05, **p<0.01). (H)Expression of Nluc after siRNA treatment. Data are expressed as mean + SD (n=6, **p<0.01). [Figure 12] This is a schematic diagram illustrating how circular RNA can be provided from a target gene containing an extended anticodon arm sequence. [Figure 13] This is a schematic diagram showing the arrangement of the cyclization site in either the UTR or CDS. (A) Overview of TRIC-V2 showing the resulting cyclic construct. (B) Exemplary sequence having eACA located in the UTR (SEQ ID NO: 61) or exemplary sequence having eACA located in the CDS (SEQ ID NO: 62). [Figure 14] This is a schematic diagram showing various recombinant nucleic acid constructs used in the experiments described herein. [Figure 15](A) A schematic diagram illustrating the process known as rolling circle translation (RCT), in which ribosomes can infinitely translate circRNA containing only CDS and no stop codons to produce polyproteins. (B) A schematic diagram illustrating the conversion of polyproteins to protein monomers when 2A sequences such as T2A or P2A are present. (C) Secondary structure of a 373nt CSFV IRES. Numerous stop codons are present in all possible frames. Specifically, frames 1 to 3 contain 4, 10, and 8 stop codons, respectively. From frame 1, stop codons were removed by three mutations (U52C, A171G, and A191G) and one deletion (d349U) to align with the CDS. (D) Equimolar amounts of circOR4F17-Nluc-RCT (SEQ ID NO: 78), circCSFV-Nluc (SEQ ID NO: 74), circCSFV-Nluc-RCT (SEQ ID NO: 75), V2 circNluc, and N1Ψ-modified linear Nluc were transfected into HEK 293F cells. Nluc expression was monitored after 24 hours. (E) Western blot analysis of Nluc expression from either single translations or RCTs using CSFV IRES. Actin was used as an internal reference. Polyproteins were observed. Data in (D) are mean ± SD for four biological replicates. *p<0.05, **p=0.01, and ***p<0.001, unpaired two-sided t-test. [Figure 16] (A) Schematic diagram showing the original eACA(a-0) containing a 7nt loop and stem structure with U(T) at the third position, as well as new constructs (b-1~m-12) with various loop lengths and U positions. (B) Precursor RNA was diluted to 400 ng / μl, denatured at 95°C for 2 minutes, and left on ice for at least 3 minutes. Then, 1 μl of 10× splicing buffer was added to each tube containing 9 μl of refolded RNA precursor. After 1 or 3 minutes, 2 μl of 100 mM EDTA was added to each tube to stop the reaction. Then, approximately 500 ng of each RNA was loaded onto a 1.5% native agarose gel and electrophoresed at 25W for 30 minutes. [Figure 17](A) Full-length precursors of TRICv2 constructs containing a GU base pair or a CA base pair were cyclized for 1 to 20 minutes and analyzed on a 1.2% native agarose gel. (B) Cyclization of TRICv2(C·A) was confirmed by urea agarose gel. [Figure 18] (A-B) Comparison of V2 using either the group I intron of Ana or the group I intron of Tetrahymena thermophila (Tetra), with the Tetra-STS and Tetra-Rzy constructs. CVB3 (coxackievirus B3)-EGFP was cloned into the best Tetra-STS (AU-rich no. 16) and Tetra-Rzy (CVB3IRES-GFP) constructs. FL was cyclized over specified times and analyzed on native agarose gel (a) or urea agarose gel (b). [Modes for carrying out the invention]

[0029] The inventors have discovered that when the 5' end of an RNA molecule is attached to the 3' end of a trans-splicing ribozyme, the splicing product becomes circular RNA. The method described herein is "trans-ribozyme-based cyclization ( T rans Ri bozyme-based C This method, known as ircularization (TRIC), uses an intact intron ligated upstream of the sequence to be circularized. This technique allows for better folding of the catalytic structural core compared to the PIE method, where the intron is split into two. As a result, the likelihood of interference between the target gene and the intron is reduced, enabling the circularization of longer sequences or the target gene itself.

[0030] A key feature of the present invention is the presence of an extended anticodon arm (eACA) sequence in the recombinant nucleic acid molecule to be circularized. This sequence provides a structure structurally similar to the anticodon arm found in Ana tRNA, including the stem and loop, enabling circularization with higher efficiency compared to existing PIE methods and the method described in Patent Document 2. The advantage of eACA is that it depends on the structure rather than the specific nucleotide sequence, so the eACA sequence (i.e., the sequence capable of forming the stem-loop structure described herein) can be easily identified within the target gene, and thus the target gene can be circularized without the need to add additional sequences or perform large-scale mutations. Therefore, the recombinant nucleic acid molecule described herein can produce circular RNA containing only the target gene without including exogenous splicing sequences or unnecessary spacer sequences, and this can be done with high efficiency by utilizing the tendency of eACA sequences to form a stem-loop structure.

[0031] Abbreviation ACA - Anticodon Arm CDS-Coding Array EGS-Extended Guide Array eIGS - Extended Internal Guide Array eACA-anticodon arm-like structure GOI-Target Gene IGS-Internal Guide Array IVT-in vitro transcription PIE - Permutation Intron-Exon RNA (ribonucleic acid) TRIC-transribozyme-based cyclization tRNA-transfer RNA UTR - Untranslated Area RCT - Rolling Circle Translation.

[0032] This specification provides recombinant nucleic acid molecules that produce circular RNA. Nucleic acid molecules are generally linear before circularization. Generally, a nucleic acid molecule to be circularized comprises a target gene (GOI), which is the gene to be circularized; a ribozyme capable of circularization; and a bipartite extended anticodon arm (eACA) sequence.

[0033] The ribozyme may be any ribozyme capable of acting as a trans-splicing ribozyme. In some cases, the ribozyme is derived from or is a group I intron. Suitable examples of ribozymes are the ribosome intron of Tetrahymena, the thymidylate synthase intron of T4 phage, the pretRNA intron of Anabaena, the BH72 Ile tRNA intron of Azoarcus sp., and the Twort ribonucleotide reductase intron of Staphylococcus phage. The sequences of these ribozymes are shown below, where the internal guide sequence (IGS) is indicated in underlined and shaded text.

[0034] Group I introns of Ana: TIFF2026521490000001.tif22170

[0035] Group I introns of T4 phage: TIFF2026521490000002.tif68170

[0036] Ribosome introns of Tetrahymena: TIFF2026521490000003.tif32170

[0037] BH72 Ile tRNA intron of Azoarcus species: TIFF2026521490000004.tif16170

[0038] Twort ribonucleotide reductase intron of Staphylococcus phage: TIFF2026521490000005.tif32170

[0039] The recombinant nucleic acid molecules described herein generally include internal guide sequences (IGS). IGS may be part of a ribozyme, such as a group I intron. Generally, this allows the use of intact introns in the TRIC method. However, in the TRIC method, it is possible to use a shortened ribozyme sequence in which the native IGS is removed and replaced with an IGS different from the normally present one.

[0040] The function of IGS is to form base pairs with the terminal region of the target gene, bringing them closer together, thus enabling circularization. IGS binds via complementary base pairing to both the first and second portions of the eACA sequence located at both ends of the GOI to be circularized.

[0041] Extended Anticodon Arm (eACA) Sequence Extended anticodon arm (eACA) sequences are sequences capable of forming stem-loop structures (also known as hairpins or hairpin loops). Stem-loop structures are generally formed when two regions of single-stranded RNA, which are complementary to each other (when read in opposite directions), form base pairs. Base pairing results in a double helix structure ending in an unpaired loop. The natural tendency of eACA sequences to form stem-loop structures can be utilized to enable the circularization of target genes, as shown in Figure 12.

[0042] Prior to circularization, the linear recombinant nucleic acid molecule contains the eACA sequence in two separate regions. As shown in Figure 10A (top panel), the first portion of the eACA sequence is located at or near the 5' end of the target gene, and the second portion of the eACA sequence is located at or near the 3' end of the target gene. During circularization, the first and second portions of the eACA sequence are covalently joined by transribozyme splicing to create a circular target gene. In the resulting circular molecule, the first and second portions are joined to form the eACA sequence, which generally allows for the formation of the stem-loop structure shown in Figures 8C, 10A, and 12.

[0043] The first portion of the eACA sequence may include a first eACA stem portion and a first eACA loop portion. The second portion of the eACA sequence may include a second eACA stem portion and a second eACA loop portion. "Stem portion" means a portion of the first (or second) portion of the eACA sequence capable of forming the stem of a stem-loop structure. "Loop portion" means a portion of the first (or second) portion of the eACA sequence capable of forming the loop of a stem-loop structure. Figure 12 shows how the stem-loop forming structure is identified within the target gene and subsequently used for RNA circularization. Thus, the stem and loop portions of the eACA sequence can form stem-loop structures in the recombinant nucleic acid molecules described herein.

[0044] The specific nucleotide sequence of the eACA sequence is not important to TRIC and does not determine whether cyclization occurs. Rather, it is the structure of the eACA, not its sequence, that is important. Therefore, the eACA may be any nucleotide sequence, as long as the last nucleotide in the second eACA loop portion can form a fluctuation base pair with the corresponding nucleotide in the internal guide sequence described herein. The last nucleotide in the second eACA loop portion may be uracil, which forms a fluctuation base pair with the corresponding guanine in the internal guide sequence. Alternatively, the last nucleotide in the second eACA loop portion may be cytosine, which forms a fluctuation base pair with the corresponding adenine in the internal guide sequence.

[0045] The first eACA stem portion and the second eACA stem portion may be complementary to each other, but this is not required.

[0046] The first and second eACA stem regions are generally at least 5 nucleotides long, but they can be as short as 1 nucleotide. The length of the stem regions can be adjusted depending on the target gene being circularized. For example, if a long target gene (over 500 nt) is being circularized, a longer stem length (over 15 nt, for example) may be advantageous.

[0047] Therefore, the first stem portion and the second stem portion may each have a length of at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 10 nucleotides, at least 15 nucleotides, at least 20 nucleotides, at least 25 nucleotides, or at least 30 nucleotides. In particular, the first stem portion and the second stem portion may each have a length of at least 15 nucleotides or at least 25 nucleotides. For example, the first eACA stem portion and the second eACA stem portion may have a length of 1 to 50 nucleotides, for example, 5 to 40 nucleotides.

[0048] The first and second stem portions do not need to be the same length; for example, one stem portion may be one or two nucleotides shorter than the other, as long as a stem-loop structure can still be formed.

[0049] The anticodon arm loop of the Ana tRNA group I intron is naturally 7 nucleotides long. Therefore, in the circular RNA described herein, if the ribozyme used is or derived from the Ana group I intron, the loop of the stem-loop structure may be 7 nucleotides long. If other group I introns are used, the loop of the stem-loop structure may have a different nucleotide length. The loop of the stem-loop structure may be between 3 and 40 nucleotides long, and generally between 3 and 10 nucleotides long. Often, the loop of the stem-loop structure is at least 3 nucleotides long, at least 4 nucleotides long, or at least 5 nucleotides long, especially if the ribozyme is or derived from the Ana group I intron. In some embodiments, the loop of the stem-loop structure is generally between 5 and 11 nucleotides long.

[0050] Generally, if the loop in a stem-loop structure contains 7 nucleotides, the first eACA loop portion contains 4 nucleotides and the second eACA loop portion contains 3 nucleotides.

[0051] Therefore, the first eACA stem portion and the second eACA stem portion may each be at least 15 nucleotides long, the first eACA loop portion may be 4 nucleotides long, and the second eACA loop portion may be 3 nucleotides long. In the resulting circular RNA molecule, an eACA sequence capable of forming a stem-loop structure is generated, where the stem contains at least 15 base pairs and the loop is 7 nucleotides long.

[0052] In total, the first portion of the eACA sequence may contain only 5 nucleotides (e.g., 1 stem nucleotide and 4 loop nucleotides). The second portion of the eACA sequence may contain only 4 nucleotides (e.g., 1 stem nucleotide and 3 loop nucleotides). Alternatively, the first portion of the eACA sequence may contain, for example, 19 nucleotides (e.g., 15 stem nucleotides and 4 loop nucleotides) or 29 nucleotides (e.g., 25 stem nucleotides and 4 loop nucleotides). The second portion of the eACA sequence may contain, for example, 18 nucleotides (e.g., 15 stem nucleotides and 3 loop nucleotides) or 28 nucleotides (e.g., 25 stem nucleotides and 3 loop nucleotides).

[0053] An exemplary first portion of an eACA sequence, comprising a 1-nucleotide stem and a 4-nucleotide loop, may contain the nucleotide sequence 5'-NNNNN-3' (where N is any nucleotide), and an exemplary second portion of an eACA sequence, comprising a 1-nucleotide stem and a 3-nucleotide loop, may contain the nucleotide sequence 5'-NNNU-3' (where N is any nucleotide). As an example, in the case of nanoluciferase (NLuc), a possible ACA sequence is: This is TIFF2026521490000006.tif10170 (SEQ ID NO: 58). To achieve circularization, the GOI of NLuc is rearranged so that the ACA sequence is located in two parts (a first part on the 5' end and a second part on the 3' end). The first part of the eACA sequence contains the sequence TTAAGGTGATC (SEQ ID NO: 59). The second part of the eACA sequence contains the sequence GATCACCACT (SEQ ID NO: 60). When thymine is added to the DNA precursor molecule, uracil is added to the translated RNA molecule, resulting in circularization.

[0054] The first and second eACA loop regions form base pairs with the internal guide sequence (IGS) to form the P1 and P10 regions, which are important for ribozyme activity. The first eACA loop region, located toward the 5' end of the target gene, forms base pairs with the IGS to form the P10 region. Not all nucleotides in the first eACA loop region need to form the P10 region; in some cases, only two nucleotides in the first eACA loop region may form the P10 region. The second eACA loop region, located toward the 3' end of the target gene, forms base pairs with the IGS to form the P1 region.

[0055] As described above, for cyclization to occur, the last nucleotide of the second eACA loop portion (i.e., the 3' terminal nucleotide of the second eACA loop portion) may form a fluctuation base pair with the corresponding nucleotide in the IGS. Generally, the fluctuation base pair is either a GU fluctuation base pair between G in the IGS and U in the second eACA loop portion, or an AC fluctuation base pair between A in the IGS and C in the second eACA loop portion. The fluctuation base pair results in a cyclization site, and once cyclization occurs, the 3' terminal nucleotide of the second eACA loop portion forms the third nucleotide in the loop of the eACA stem-loop structure. This is shown in Figure 8C.

[0056] The P1 region is also formed by base pairing of the IGS with a region adjacent to the second eACA loop portion in the 3' direction, which is known as the "P1 extension." If present, the P1 extension typically contains between 2 and 4 nucleotides, which base-pair with the IGS. Thus, the P1 region can be formed by the P1 extension and the second eACA loop portion that base-pairs with the IGS, as shown in Figure 10A. Therefore, in some embodiments, the second portion of the eACA sequence and the P1 extension can together form the P1 region. If the P1 extension is absent, the P1 region is formed solely by the second eACA loop portion that base-pairs with the IGS. The P1 extension is described in Olson & Muller (2012) RNA 18:581-589, which is incorporated herein by reference. Generally, when an extended guide sequence (EGS) is used, the P1 extension region will be present.

[0057] A particular advantage of the TRIC method is that eACA sequences already present in the target gene can be utilized. For example, if a stem-loop forming eACA sequence can be found in the target gene, this gene can be efficiently circularized without introducing any additional sequences. This means that the resulting circular RNA is far less likely to be immunogenic. This is illustrated in Figure 12. Figure 12 shows the first step in identifying the eACA sequence (i.e., the stem-loop forming structure) within the target gene. Subsequently, the target gene is rearranged so that the eACA sequence is divided into two parts, one at each end of the target gene. Then, this rearranged gene is cloned into a TRIC construct and circularized. An example of this is the protein-coding circular RNA T2A nanoluciferase. This circular RNA already contains an eACA sequence in its native sequence. This means that the circularization site can be introduced using a naturally occurring eACA sequence without the need for mutation or the introduction of additional sequences.

[0058] If the natural coding sequence (CDS) does not contain an eACA sequence, it is possible to create an eACA sequence by selective mutation. Codon redundancy means that mutations can be added to the nucleotide sequence of a GOI without affecting the resulting peptide sequence. Therefore, an eACA sequence can be established within a GOI without the need to introduce additional sequences. Instead, only selective mutations of the existing sequence are required, according to the rules of codon redundancy. An example of this is the circular RNA of T2A-EGFP and circZNF609 described in Example 5, where mutations are introduced based on codon redundancy to introduce the circularization site.

[0059] If eACA is not present in non-coding RNA, or if the circularization site is located within the untranslated region (UTR) of protein-coding RNA, the circularization site can be created by introducing additional nucleotides. For example, as shown in Figure 8C, five nucleotides (light gray nucleotides) can be introduced to create the stem portion of the eACA sequence, and the remaining portion of the eACA can be provided using the existing sequence of the GOI (black nucleotides).

[0060] Therefore, in the recombinant nucleic acids described herein, the first and / or second portions of the eACA sequence may be naturally present within the target gene. In other words, they may be part of the target gene and therefore exist without the need to mutate an existing sequence or introduce an additional sequence.

[0061] Alternatively, in the recombinant nucleic acids described herein, all or part of the eACA sequence may be derived from human ribosomal RNA (rRNA). Using human rRNA may result in less immunogenic circular RNA.

[0062] The positions of the first and second portions of the eACA sequence within the target gene have little effect on circularization. One portion of the eACA sequence may be identified within the coding sequence or located within the coding sequence, while the other portion may be identified within the untranslated region or located within the untranslated region. For example, neither portion needs to be within the coding sequence, nor does neither portion need to be within the untranslated region.

[0063] Extended Guide Sequence (EGS) The recombinant nucleic acids described herein may further include extended guide sequences (EGS), in particular a first EGS and a second EGS capable of complementary base pairing. The function of the EGS is to extend the length of the complementary base-pairing regions at both ends of the recombinant nucleic acid molecule. In this way, EGS can be included to compensate for shorter IGS, especially when cyclizing longer GOIs (greater than 500 nt).

[0064] The recombinant nucleic acids described herein may include a first EGS located at the 5' end of the IGS. The recombinant nucleic acids described herein may include a second EGS located at the 3' end of the second portion of the eACA sequence. Generally, there are loop sequences located between the first EGS and the IGS, as will be described in more detail below. Similarly, generally, there are loop sequences located between the second EGS and the second portion of the eACA sequence.

[0065] The first EGS and the second EGS may be partially or completely complementary to each other. In general, mismatches are well tolerated and do not significantly affect cyclization. In the recombinant nucleic acids described herein, the first EGS may be at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% complementary to the second EGS.

[0066] If present, the first EGS and the second EGS may each be between 1 and 500 nucleotides in length. For example, the first and second EGS may each be between 10 and 50 nucleotides in length. The first and second EGS may each be between 20, 30, or 40 nucleotides in length.

[0067] An exemplary first EGS sequence is GGUCAAUCGGUUGGCUUCCG (SEQ ID NO: 56). An exemplary second EGS sequence is CGGAAGCCAACCGAUUGACC (SEQ ID NO: 57).

[0068] loop Extending the P1 region where base pairs are formed may have adverse effects on cyclization. To avoid this, the recombinant nucleic acids described herein may further include loop sequences such as a first loop sequence and a second loop sequence.

[0069] The first and second loops may act as spacers between the internal guide sequence (IGS) and the first extended guide sequence (EGS) at the 5' end, and as spacers between the P1 region and the second EGS at the 3' end. Since the loop sequences are preferably not complementary to each other, there is little to no base-pair interaction between the first and second loop sequences. Due to the low complementarity or non-complementarity between the two loop sequences, the P1 region into which base pairs are formed remains fixed in length. The first loop may instead be referred to herein as the “left loop.” The second loop may instead be referred to herein as the “right loop.”

[0070] The first and second loop sequences may each be between 1 and 10 nucleotides in length. The first and second loop sequences do not need to have the same number of nucleotides; in fact, the TRIC method works well even when the first and second loop sequences have different lengths. The first loop sequence may be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. The second loop sequence may be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. A preferred combination is a 6-nucleotide first loop sequence and a 5-nucleotide second loop sequence. Another preferred combination is a 3-nucleotide first loop sequence and a 2-nucleotide second loop sequence.

[0071] The first loop sequence is located on the 3' side of the first EGS and the 5' side of the IGS, i.e., between the first EGS and the IGS. The second loop sequence is located on the 3' side of the second portion of the eACA sequence and the 5' side of the second EGS, i.e., between the second portion of the eACA sequence and the second EGS. If a P1 extension region exists, the second loop sequence is located on the 3' side of the P1 extension region.

[0072] It is not always necessary to have two loop sequences. Recombinant nucleic acids described herein may not include a second loop sequence and may only include a first loop sequence located between the first EGS and IGS. Alternatively, recombinant nucleic acids described herein may only include a loop sequence located between the second portion of the eACA sequence (or the P1 extension, if present) and the second EGS.

[0073] An example sequence for the first loop sequence is AAATAA (sequence number 54). An example sequence for the second loop sequence is ACACC (sequence number 55).

[0074] Target gene (GOI) The target gene (GOI) refers to the sequence to be circularized. The GOI may include a coding sequence that encodes a peptide or protein, or it may be a non-coding sequence. The GOI may include a combination of coding and non-coding sequences. Furthermore, as used herein, the term “target gene” will be understood to include sequences containing additional sequence elements, such as translation initiation elements such as internal ribosome entry sites (IRES) sequences, multiple siRNA target sites (msiTS), spacer sequences such as polyAC sequences, start codons, stop codons, and any other sequence elements known to be useful in the art for the generation of circular RNA. For example, if eACA is located within the coding sequence to be circularized, the GOI may include a coding sequence containing a stop codon, polyAC sequence, multiple siRNA target site (msiTS), IRES, start codon, and eACA, in the 5' to 3' direction. If the eACA is located in the untranslated region of the circularized sequence, the GOI may include, in the 5' to 3' direction, a multiple siRNA target site (msiTS), an IRES, a start codon, a coding sequence, a stop codon, a polyAC sequence, and the eACA. See, for example, Figures 10A and 10B.

[0075] Suitable translation initiation elements include internal ribosome entry site (IRES) sequences. Examples of IRESs used in the present invention include viral IRESs such as those of coxsackievirus B3 (CVB3), cafeteria roenbergensis virus (CroV), or classical swine fever virus (CSFV). Their DNA sequences are shown below.

[0076] CVB3-IRES TTAAAACAGCCTGTGGGTTGATCCCACCCACAGGCCCATTGGGCGCTAGCACTCTGGTATCACGGTACCTTTGTGCGCCTGTTTTATACCCCCTCCCCCAACTGTAACTTAGAAGTAACACACACCGATCAACAGTCAGCGTGGCACACCAGCCACGTTTTGATCAAGCACTTCTGTTACCCCGGACTGAGTATCAATAGACTGCTCACGCGGTTGAAGGAGAAAGCGTTCGTTATCCGGCCAACTACTTCGAAAAACCTAGTAACACCGTGGAAGTTGCAGAGTGTTTCGCTCAGCACTACCCCAGTGTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCGACCGTGGCGGTGGCTGCGTTGGCGGCCTGCCCATGGGGAAACCCATGGGACGCTCTAATACAGACATGGTGCGAAGAGTCTATTGAGCTAGTTGGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCTAACTGCGGAGCACACACCCTCAAGCCAGAGGGCAGTGTGTCGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCATTTTATTCCTATACTGGCTGCTTATGGTGACAATTGAGAGATCGTTACCATATAGCTATTGGATTGGCCATCCGGTGACTAATAGAGCTATTATATATCCCTTTGTTGGGTTTATACCACTTAGCTTGAAAGAGGTTAAAACATTACAATTCATTGTTAAGTTGAATACAGCAAA(SEQ ID NO: 71)

[0077] CroV-IRES: GTATAAGAGACAGGTGTTTGCCTTGTCTTCGGACTGGCATCTTGGGACCAACCCCCCTTTTCCCCAGCCATGGGTTAAATGGCAATAAAGGACGTAACAACTTTGTAACCATTAAGCTTTGTAATTTTGTAACCACTAAGCTTTGTGCACATAATGTAACCATCAAGCTTGTTAGTCCCAGCAGGAGGTTTGCATGCTTGTAGCCGAAATGGGGCTCGACCCCCCATAGTAGGATACTTGATTTTGCATTCCATTGTGGACCTGCAAACTCTACACATAGAGGCTTTGTCTTGCATCTAAACACCTGAGTACAGTGTGTACCTAGACCCTATAGTACGGGAGGACCGTTTGTTTCCTCAATAACCCTACATAATAGGCTAGGTGGGCATGCCCAATTTGCAAGATCCCAGACTGGGGGTCGGTCTGGGCAGGGTTAGATCCCTGTTAGCTACTGCCTGATAGGGTGGTGCTCAACCATGTGTAGTTTAAATTGAGCTGTTCATATACC(SEQ ID NO: 72)

[0078] CSFV-IRES: GTATACGAGGTTAGTTCATTCTCGTATACACGATTGGACAAATCAAAATTATAATTTGGTTCAGGGCCTCCCTCCAGCGACGGCCGAACTGGGCTAGCCATGCCCATAGTAGGACTAGCAAACGGAGGGACTAGCCGTAGTGGCGAGCTCCCTGGGTGGTCTAAGTCCTGAGTACAGGACAGTCGTCAGTAGTTCGACGTGAGCAGAAGCCCACCTCGAGATGCTACGTGGACGAGGGCATGCCCAAGACACACCTTAACCCTAGCGGGGGTCGCTAGGGTGAAATCACACCACGTGATGGGAGTACGACCTGATAGGGCGCTGCAGAGGCCCACTATTAGGCTAGTATAAAAATCTCTGCTGTACATGGCAC(SEQ ID NO: 73) <不明确,原文无具体含义,保留原样>

[0079] In some preferred embodiments, the viral IRES can be modified to remove stop codons within the open reading frame. Suitable modified viral IRESs include modified CSFV IRESs. Modified CSFV IRESs may include, for example, the DNA sequence of SEQ ID NO: 96, nucleotides 324-696 of SEQ ID NO: 75, or nucleotides 596-968 of SEQ ID NO: 77. Modified IRESs may be useful for rolling-circle translation of circular RNAs as described herein.

[0080] The TRIC method is suitable for target genes of any length. TRIC is particularly suitable for long target genes. In this context, "long" is generally considered to mean a sequence of at least 500 nucleotides. Therefore, the target gene may be at least 100 nucleotides, at least 250 nucleotides, at least 500 nucleotides, at least 1000 nucleotides, at least 2000 nucleotides, at least 3000 nucleotides, at least 4000 nucleotides, at least 5000 nucleotides, at least 6000 nucleotides, at least 7000 nucleotides, or at least 8000 nucleotides in length.

[0081] Therefore, the recombinant nucleic acid molecule producing circular RNA described herein has a 5' to 3' direction. a) Internal guide array (IGS), b) Ribozyme and, c) The first part of the extended anticodon arm (eACA) sequence, d) The target gene and, e) The second part of the eACA sequence, This can include, where the nucleotide in the second part of the eACA sequence forms a fluctuating base pair with the nucleotide in the IGS.

[0082] In some embodiments, the recombinant nucleic acids described herein are oriented in the 5' to 3' direction. a) The first EGS and, b) The first loop array, c) Internal guide array (IGS), d) Ribozyme and, e) The first part of the extended anticodon arm (eACA) sequence, f) The target gene and, g) The second part of the eACA sequence, h) P1 extension section, i) The second loop array, j) The second EGS, It can include...

[0083] If the target gene to be circularized is long (more than 500 nt), the first and second eACA stem portions may be 15 base pairs or 25 base pairs, and the loop in the resulting stem-loop structure may be 7 nucleotides.

[0084] Further components Recombinant nucleic acids described herein may further comprise elements that facilitate transcription or cyclization processes. For example, a recombinant nucleic acid described herein may further comprise a T7 high-efficiency sequence, one or more restriction enzyme cleavage sites, and / or a poly(A) tail. If the recombinant nucleic acid is a DNA template, it may further comprise a T7 promoter sequence. The recombinant nucleic acid may further comprise a nucleotide sequence encoding a self-cleaving peptide to ensure the generation of monomeric proteins during rolling-circle amplification. Such additional elements are known in the art.

[0085] In other embodiments, the recombinant nucleic acids described herein may lack stop codons. For example, the recombinant nucleic acids may be manipulated or modified to remove stop codons in the open reading frame. This may facilitate rolling circle amplification.

[0086] Method for generating circular RNA Generally, methods for producing circular RNA include preparing linear recombinant nucleic acid molecules, such as those described herein, and splicing those molecules to produce circular RNA.

[0087] Therefore, the method for generating circular RNA is: a) A step of preparing recombinant nucleic acid molecules as described herein, b) A step of cyclicizing recombinant nucleic acid molecules, It can include...

[0088] It should be understood that the term "recombinant nucleic acid molecule" may refer to either a DNA template molecule or an RNA precursor.

[0089] Protocols suitable for cyclic formation are known in the art, for example, as described in Non-Patent Documents 2 and 3. Their contents are incorporated herein by reference.

[0090] In some cases, recombinant nucleic acid molecules are linear DNA template molecules. In the first part of this method, in vitro transcription is performed using the DNA template molecule to obtain a linear RNA precursor molecule. Subsequently, a circular RNA molecule is produced by cyclization / splicing using the RNA precursor.

[0091] Therefore, the method for generating circular RNA is: a) A step of preparing recombinant nucleic acid molecules as described herein, b) A step of transcribing recombinant nucleic acid molecules to produce an RNA precursor, c) A step of circulating the RNA precursor, It can include...

[0092] In the above method, some splicing (and consequently cyclization) may occur during transcription, which is known as cotransitional splicing. In some cases, it is preferable to suppress splicing during the transcription process so that splicing and cyclization occur only after transcription. Therefore, the method described herein may additionally include suppression of splicing (and cyclization) during step (b) (transcription step).

[0093] Magnesium ions are generally essential for in vitro transcription and splicing, but co-transcriptional splicing / cyclization can be suppressed by performing the transcription process with low concentrations of magnesium ions and excess nucleoside triphosphates (NTPs). NTPs are involved in transcription with Mg 2+ It may have a chelating effect. Therefore, the method described herein involves NTP at a concentration of approximately 24 mM and Mg at a concentration of less than 18 mM, less than 16 mM, less than 14 mM, or less than 12 mM. 2+ The process may include carrying out step (b) in the presence of nucleoside triphosphate (NTP) at a concentration of approximately 24 mM and Mg at a concentration of 16 mM or less. 2+ This is done in the presence of Mg. If the concentration of NTP is higher or lower than 24 mM, 2+ The concentration of [the substance] may also fluctuate.

[0094] Therefore, the method for generating circular RNA is: a) A step of preparing recombinant nucleic acid molecules as described herein, b) A step of transcribing recombinant nucleic acid molecules to produce RNA precursors, c) A step of circulating the RNA precursor, It may contain, where step (b) is Mg at a concentration of 16 mM or less. 2+ This is performed in the presence of NTP at a concentration of approximately 24 mM.

[0095] In other cases, repression of splicing during transcription is not necessary to produce circular RNA. Therefore, a method for producing circular RNA is needed. a) A step of preparing recombinant nucleic acid molecules as described herein, b) A step of transcribing and cyclicizing recombinant nucleic acid molecules, A method is described herein that includes, where the splicing occurs cotranscriptically.

[0096] As described above, the advantage of the TRIC method is that it can be used to circularize target genes that naturally contain sequences capable of forming eACA stem-loops. This makes it possible to create circular RNAs that do not contain exogenous sequence materials (such as exon sequences), which are often immunogenic, thus offering a clear advantage over existing methods such as PIE.

[0097] Therefore, the method for generating circular RNA is: a) A step of identifying a target gene containing a sequence capable of forming an eACA stem-loop, b) A step of producing a recombinant nucleic acid molecule containing an internal guide sequence (IGS)-ribozyme-sequence encoding the target gene in the direction from 5' to 3', c) A step of cyclizing recombinant nucleic acid molecules, It can include...

[0098] Step (b) above may include rearranging the target gene such that a first portion of the sequence capable of forming an eACA stem-loop is located at the 5' end and a second portion of the sequence capable of forming an eACA stem-loop is located at the 3' end.

[0099] Suitable target genes containing sequences capable of forming eACA stem-loops can be identified by those skilled in the art using methods known in the art, including the use of software such as RNAFold (University of Vienna).

[0100] Furthermore, this specification also describes the use of any of the recombinant nucleic acid molecules described herein in a method for generating circular RNA.

[0101] Methods for generating circular RNA may include expressing recombinant nucleic acid molecules within cells and subsequently performing circularization within the cells.

[0102] Circular RNA Circular RNAs can be prepared using the recombinant nucleic acid molecules described herein. The circular RNAs contain sequences encoding the target gene. One advantage of the described circular RNAs is that, in some cases, they do not contain exogenous splicing sequences, unlike circular RNAs obtained using PIE methods, which typically contain exogenous exon sequences.

[0103] "Exogenous" means any sequence information that is not naturally present in the target gene. The circular RNAs described herein may not contain RNA from cyclization factors. For example, the circular RNAs described herein may not contain any RNA from ribozymes, particularly group I introns. In some cases, the circular RNAs described herein may contain only the target gene. As a result, the immunogenicity of the circular RNAs is reduced compared to circular RNAs produced using methods of the art (e.g., PIE). The circular RNAs described herein may be less immunogenic than circular RNAs containing exogenous exon sequences (e.g., those encoding the same GOI). Lower immunogenicity means that transfection with circular RNA results in a less pronounced immune response by the host cell, for example, reduced production of cytokines, chemokines, or other immune signaling molecules. Suitable methods for determining immunogenicity are known in the art. For example, immunogenicity can be determined by measuring the production of immune factors (cytokines, chemokines, etc.) in transfected cells over a period after transfection.

[0104] In the circular RNA described herein, the sequence encoding the target gene may include a sequence capable of forming the eACA stem-loop structure described herein. For example, a sequence capable of forming an eACA stem-loop structure having a stem of at least 5 base pairs and a loop of 7 nucleotides, where the third nucleotide of the loop in the 5' to 3' direction is uracil. The sequence capable of forming the eACA stem-loop structure may be naturally present in the target gene or may be introduced before circularization.

[0105] Furthermore, circular RNAs that can be obtained by the methods disclosed herein are also described herein. For example, a) A step of preparing recombinant nucleic acid molecules as described herein, b) A step of transcribing recombinant nucleic acid molecules to produce an RNA precursor, c) A step of circulating the RNA precursor, Circular RNAs that can be obtained by methods including the above are described herein.

[0106] Use of circular RNA / precursors The recombinant nucleic acids described herein may be useful in therapeutic methods or as pharmaceuticals. Circular RNAs obtained from the recombinant nucleic acids described herein can be used in various ways to exert therapeutic effects. For example, circular RNA can act as a "sponge" for microRNAs (miRNAs), thereby inhibiting or reducing the degradation of target mRNA by miRNAs. Circular RNA may also affect protein transport and intracellular protein localization. The specific therapeutic effect will depend on the target gene, including whether the target gene is a coding or non-coding sequence.

[0107] Furthermore, circular RNA can also be used to induce the expression of a target gene in vivo or in vitro. Accordingly, this specification describes a method for expressing a target gene in cells, comprising preparing a circular RNA containing the target gene by circularizing a recombinant nucleic acid molecule as described herein, and administering this circular RNA to cells.

[0108] Rolling Circle Translation Using circular RNA obtained from recombinant nucleic acid molecules described herein, the expression of a target gene can be induced through rolling-circle amplification. A suitable circular RNA may lack an in-frame stop codon. For example, the circular RNA may contain a modified viral IRES described herein that lacks an in-frame stop codon. In some embodiments, the circular RNA may be translated multiple times in succession by ribosomes to produce a polyprotein. In other embodiments, the suitable circular RNA may further contain a DNA sequence encoding a self-cleaving peptide. The self-cleaving peptide induces ribosome skipping during ribosome translation of the circular RNA to produce a monomeric protein. Suitable self-cleaving peptides are well known in the art and include 2A peptides such as T2A, P2A, E2A, and F2A.

[0109] Treatment method This specification describes a method for treating a disease in a subject, comprising the steps of (a) preparing circular RNA by circularizing a recombinant nucleic acid molecule described herein, and (b) administering the circular RNA to the subject.

[0110] Furthermore, this specification also describes recombinant nucleic acid molecules used as pharmaceuticals, recombinant nucleic acid molecules used in methods for treating diseases in subjects, circular RNA obtained from recombinant nucleic acid molecules used as pharmaceuticals, and circular RNA obtained from recombinant nucleic acid molecules used in methods for treating diseases in subjects.

[0111] Furthermore, this specification also describes pharmaceutical compositions comprising a cyclic RNA or recombinant nucleic acid molecule described herein and a pharmaceutically acceptable excipient.

[0112] Wherever these terms appear herein, they may be replaced by "consisting of," "consists of," "consisting essentially of," or "consists essentially of," and vice versa.

[0113] It is understood that this application discloses all aspects and all combinations of the embodiments described above, unless the context should be interpreted otherwise. Similarly, this application discloses all combinations of preferred and / or optional features, either individually or with any other aspects, unless the context should be interpreted otherwise.

[0114] Modifications of the above embodiments, further embodiments, and variations thereof will become apparent to those skilled in the art by reading this disclosure, and they themselves fall within the scope of the present invention.

[0115] All documents and sequence database entries referenced herein constitute part of this specification by reference in their entirety for any purpose.

[0116] As used herein, “and / or” shall be understood as a specific disclosure that includes or excludes each of two expressed features or components. For example, “A and / or B” shall be understood as if each of (i) A, (ii) B, and (iii) A and B were described separately herein. [Examples]

[0117] The present invention will now be described with reference to the following, not-limited, embodiments.

[0118] Materials and methods In vitro transcription (IVT) protocol: The DNA template was linearized and clarified by phenol:chloroform:isoamyl alcohol extraction. IVT was performed with 50 ng / μl of DNA template, 14 μg / μl of homemade T7 polymerase, 0.04 U / μl of RNase inhibitor (Promega), 6 mM of each NTP, and 1× IVT buffer. For IVT where cotranscription splicing is acceptable, the 1× IVT buffer contains 80 mM HEPES-K (pH 7.5), 2 mM spermidine, 40 mM DTT, and 24 mM MgCl2. If cotranscription splicing should be suppressed, the concentration of MgCl2 in the 1× IVT buffer is 14 mM. The IVT reaction was incubated at 37°C for 3 to 5 hours, followed by digestion with RNase-free DNase I for 20 minutes. Then, 100 mM EDTA was added to a concentration of 25 mM, and any precipitates were removed. Next, equivolute 7.5 M lithium chloride was added, and the RNA was precipitated at -20°C for 30 minutes to overnight. The precipitate was then centrifuged at 13,000 rpm / min for at least 20 minutes. The RNA pellet was washed with 75% alcohol, air-dried, and dissolved in DEPC-treated H2O.

[0119] Circulation protocol: 3× Flag circular RNA was cyclized during IVT. For co-transcription cyclization of EGFP, Fluci, Spike, Cas9, and factor 8, an additional 2 mM GTP was added to the DNA template digestion type IVT reaction and heated at 55°C for 20 minutes. For full-length precursors, 9 μl of RNA was first denatured at 95°C for 2 minutes, followed by annealing on ice for 3 minutes. Then, 1 μl of 10× cyclization buffer (500 mM Tris-HCl, pH=7.4, 100 mM MgCl2, 10 mM DTT, 20 mM GTP) was added to the annealed RNA and heated at 55°C for the specified time.

[0120] Michaelis-Menten Fitting: The ribozyme concentration was fixed at 1 μM, and the GTP concentration was varied from 1 μM to 2000 μM. The time course of cyclization of TRIC-V2 and PIE was monitored at each GTP concentration. Then, the time required for 50% cyclization to be completed for each sample (t 1 / 2 ) is calculated and used to determine the initial cyclization rate (V) of each construct at each GTP concentration. obs ) was estimated. Next, V obs The dynamic parameters of TRIC-V2 were calculated by plotting the TRIC-V2 concentration against GTP concentration.

[0121] Calculation of cyclic efficiency: To measure efficiency, yield, and nick formation ratio, samples were loaded onto native agarose gels, and the intensities of full-length RNA, circular RNA, and nicked RNA were measured in Image J. Efficiency is equal to the percentage of full-length precursor converted to circular RNA. Yield is calculated by dividing total RNA by circular RNA. The nick formation ratio is equal to the ratio between nicked RNA and circular RNA.

[0122] RNase R digestion: To perform RNase R digestion, IVT of TRIC-V1.0 was precipitated with 7.5 M LiCl and dissolved in DEPC-treated water. Then, 5 μg of RNA was digested with 10 U of RNase R (antibodies-online) at 37°C for 15 minutes. The digested RNA was loaded onto a denatured PAGE.

[0123] RT-PCR: The reverse transcriptase and DNA polymerase used here are SuperScrip IV Reverse Transcriptase (Thermo Fisher) and Q5 High-Fidelity DNA Polymerase (NEB). Reverse transcription and PCR were performed according to the manufacturer's manual. IVT samples, RNA I, and RNA II were used as templates for reverse transcription and PCR using the primers shown in Figure 2B.

[0124] Purification of circular RNA: A two-step strategy was used to purify circular RNA. First, the circular RNA sample was injected into an SRT-2000 SEC column (Sepax) running on an AKTA pure system (Cytiva). The running buffer contained 10 mM Tris-HCl (pH=6.5) and 1 mM EDTA. Next, the fraction containing circular RNA was collected, digested with RNase R (antibodies-online, 0.5 U / μg) at 37°C for 1 hour, and clarified using an RNA clean & concentrate kit (ZYMO RESEARCH).

[0125] Cell transfection, RT-qPCR, Nluc expression, and siRNA knockdown: A549 cells and HEK 293F cells were cultured in DMEM (10% FBS, high glucose GlutaMAX, Life Technologies Ltd) medium and Freestyle (Gibco) medium, respectively.

[0126] To study immunogenicity, 200 ng of each RNA was transfected into 100,000 A549 cells in a 24-well plate using MessengerMax transfection reagent (Invitrogen). After 24 hours, the cells were harvested, and total RNA was extracted using TRIzol (Invitrogen) and an RNA clean & concentrater kit. Subsequently, 300 ng of each total RNA was reverse transcribed using Superscript IV reverse transcriptase (Invitrogen) with 20-mer oligodT (Invitrogen) in addition to a random hexamer. The reverse transcripts were diluted 20-fold and used as templates for qPCR. The primers are listed in Table 1 (ViiA 7, Thermo Fisher).

[0127] To study Nluc expression and siRNA knockdown, 10,000 cells in a 96-well plate were transfected with 50 ng of circular Nluc and equimolar amounts of linear mRNA using MessengerMax transfection reagent. For protein expression, 5 μl of cells were collected and luciferase assays were performed using the Nano-Glo® luciferase assay system (Promega). For siRNA knockdown, siRNA was transfected into cells on day 3 using RNAiMax (Invitrogen). Five hours after siRNA transfection, Nluc expression was measured using the same kit.

[0128] [Table 1]

[0129] statistical analysis For the statistical analysis, a two-sample t-test model assuming unequal variances was used. Further details can be found in the legend of the figure.

[0130] Example 1 - TRIC To conduct initial tests of the TRIC method, the inventors selected the tRNA intron from cyanobacterium Anabaena (Ana). This first construct was named TRIC-V0. Leu Although Ana is short (249 nt), it exhibits high activity. The Ana intron divides the leucine transfer RNA (tRNA) into a 34-nt left half and a 51-nt right half (L34 / R51) at the anticodon arm (ACA) (Figure 2A - the illustration labeled "tRNA"). The inventors aimed to determine whether circularization could be achieved by using a part of the leucine tRNA sequence. The L15 / R30 portion of the Leu tRNA anticodon arm was left intact and ligated and circularized on both sides of the target gene (in this case, the coding sequence of 3×Flag). This construct is shown in Figure 2B (SEQ ID NO: 14).

[0131]

[0132] In vitro transcription was performed, and the samples were loaded onto a 12% denaturing polyacrylamide gel (PAGE) as described in Non-Patent Document 2. The gel results are shown in Figure 2C (the left column labeled IVT).

[0133] ​Consistent with Ana's high activity, splicing occurred cotranscribely, and numerous RNA species were identified on the 12% gel. Full-length precursors (403 nt) and spliced ​​linear introns (257 nt) were identified, but the circular target gene (3× Flag) was not. The linear intron and two other major species (I and II) were electrolytically eluted from the 12% gel and loaded onto 6% PAGE (Figure 2C, right column labeled IVT). Both major species I and II contained fast-moving minor species, and both migrated faster than themselves on 12% PAGE, indicating that they are circular RNAs. Since the minor bands in I and II migrated to the same locations as the linear intron and the nick-forming 3× Flag, respectively, we concluded that species I is a circular intron and species II is a circular 3× Flag (target gene). To further confirm the circular characteristics of 3×Flag, the inventors performed reverse transcription and subsequent PCR (RT-PCR) on IVT samples and species I and II (Figure 2D). As expected, a 109 bp DNA product was generated from IVT and II, but not from I. Next, the inventors cloned this PCR product into a sequencing vector and performed Sanger sequencing. The sequencing results clearly showed that the circularization of the target gene by 3×Flag occurred as expected (Figure 2E). These results demonstrate that TRIC-V0 can very efficiently circularize the target gene during the IVT process (co-transcriptional circularization) even with short IGS.

[0134] Example 2 - TRIC V1 The internal guide sequence (IGS) of Ana's group I intron is short (5 nucleotides), and the inventors hypothesized that a short IGS might make it difficult to circularize a long target gene. To compensate for the short IGS, the inventors introduced an extended guide sequence (EGS) at the 5' end of TRIC. This was able to form a 20-nucleotide base-pairing structure with the corresponding region at the 3' end (Figure 3A). This construct was named TRIC-V1.

[0135] The sequence connecting IGS and EGS forms an internal loop, which the inventors also optimized in TRIC-V1. Three constructs were created, each containing a different loop configuration. In TRIC-V1.0 (SEQ ID NO: 15), the 6nt upstream sequence of Ana IGS was retained in the loop sequence, while in V1.1 (SEQ ID NO: 16) and V1.2 (SEQ ID NO: 17), the loop length was shortened by introducing a base pair interaction between the 3nt at the 3' end of the construct and the 3nt at the 5' end of the loop. As a result, the EGS was effectively extended to a length of 23nt (Figure 3A), and the length of the 5' loop was shortened to 3 nucleotides. In V1.1 and V1.2, the length of the 3' loop was 3 nucleotides, while in V1.0, the length of the 3' loop was 5 nucleotides.

[0136] In vitro transcription was performed on three mutants, V1.0, V1.1, and V1.2, and their products were loaded into 6% PAGE along with purified circular 3×Flag (species II from previous experiments). All three mutants were found to very efficiently circularize the target gene (3×Flag) (Figure 3B). We then performed RNase R digestion of the in vitro transcript from V1.0. As expected, only the circular target gene (3×Flag) was resistant to RNase R digestion, while the linear introns were digested (Figure 3C). Compared to the TRIC-V0 mutant, the efficiency of the three V1.1 mutants (i.e., the ratio of full-length precursor to circular GOI) was similar, as the full-length precursor was largely converted to circular RNA during in vitro transcription. One advantage of the V1 mutants compared to V0 is the reduced amount of circular introns. Since circular introns cannot be removed by RNase R digestion, the reduction of these circular introns is beneficial. Of the three V1 mutants, V1.1 yielded the highest ratio of circular 3×Flags to linear introns, so we proceeded with further investigation of this mutant.

[0137] The 3×Flag sequence (SEQ ID NO: 18) is 141 nucleotides long. The inventors also confirmed that TRIC-V1 can circularize long target genes. Five new constructs were created with the aim of generating circular CVB3-EGFP (EGFP, 1638nt) (SEQ ID NO: 19), CVB3-firefly luciferase (Fluc, 2601nt) (SEQ ID NO: 20), CVB3-SARS-CoV 2 spike protein-EGFP (Spike, 5469nt) (SEQ ID NO: 21), CVB3-spCas9-EGFP (Cas9, 5757nt) (SEQ ID NO: 22), and CVB3-factor VIII-EGFP (factor VIII, 8706nt) (SEQ ID NO: 23) (Figure 4A). In the TRIC V1.0 construct, a circular RNA identical to that obtained using the PIE Ana construct was generated by using a longer tRNA sequence (L15 / R51), an internal homology arm (iHR), and a spacer sequence (polyAC) (Figures 5A and 5B). The sequences of each GOI are shown below.

[0138] 3×Flag: AAAATCCGTTGACCTTAAACGGTCGTGTGGTACACTCGATCTGGACTAAAGCTGCTCATGGATTACAAAGATCACGATGGTGATTATAAAGATCACGACATCGATTACAAGGATGATGATGATAAGAGACGCTACGGACTT (SEQ ID NO: 18)

[0139] EGFP:

[0140] Firefly luciferase (Fluc):

[0141] SARS-CoV 2 spike protein - EGFP

[0142] spCas9-EGFP

[0143] Factor 8 - EGFP

[0144] After in vitro transfer, some samples underwent an additional 20-minute post-transfer cyclization protocol. Each reaction mixture was supplied with additional GTP at a final concentration of 2 mM. The reaction mixture was heated at 55°C for 20 minutes to initiate cyclization as previously described (Non-Patent Literature 3). All samples were loaded onto 0.8% agarose gels and electrophoresed for 1 hour and 45 minutes. The results are shown in Figure 4B. Here, the expected band positions for the cyclic product are indicated by black circles.

[0145] TRIC V1 can cotranscribe long target genes without the use of a post-transcriptional cyclization protocol, as indicated by the numerous RNA species observed for each construct in Figure 4B. During in vitro transcription, TRIC-V1 produced more splicing products for all target genes than the PIE method, suggesting that TRIC-V1 has a higher cotranscriptional cyclization efficiency than PIE. However, the cotranscribed circular RNAs were significantly nicked. This is because over 50% of the circular RNAs for EGFP and Fluci were nicked, and the circular RNAs for spike, Cas9, and factor VIII were difficult to detect. An additional 20 minutes of post-transcriptional cyclization did indeed increase the amount of splicing product, but this was mainly due to an increase in the amount of nicking. While cotranscribed nicking occurs for 3× Flag short GOIs, this is significant for the long GOIs used in this experiment. Therefore, we attempted to identify a protocol that can be used to generate long circular GOIs.

[0146] Example 3 - Post-transfer cyclization Mg 2+ This is thought to be the main cause of nick formation in circular RNA (Non-Patent Literature 3). Mg 2+ Since it is essential for both in vitro transcription and cyclization, the inventors hypothesized that a rational way to reduce nick formation of circular RNA would be to suppress co-transcriptional cyclization and increase the rate of post-transcriptional cyclization.

[0147] The inventors of this invention use excess nucleoside triphosphate (NTP) during transcription to enable Mg 2+ We tested whether chelation could suppress cotranscription splicing. The concentration of NTP was fixed at 24 mM, and Mg 2+ The concentration of was varied from 6 mM to 24 mM. As shown in Figure 6A, Mg 2+ When the concentration was lower than 16 mM, the in vitro transcript was mainly a full-length precursor, suggesting that co-transcriptional cyclization was actually suppressed. Therefore, in subsequent studies, 24 mM NTP and 14 mM Mg 2+ In vitro transcription was performed using [the specified method]. After transcription, the full-length precursor was subjected to cyclization for 0 minutes, 10 minutes, 20 minutes, or 40 minutes, and the reaction product was analyzed on a 0.8% agarose gel.

[0148] As shown in Figure 6B, using a post-transcriptional cyclization protocol, circular RNAs were obtained for spike, Cas9, and factor 8 (as well as for EGFP and Fluci), with much lower complexity of spliced ​​products. While longer cyclization times did indeed increase the conversion from full-length precursors to cyclized / nicked GOIs, the amount of circular RNA did not necessarily increase, especially for cyclization beyond 20 minutes. Therefore, a 20-minute cyclization protocol was selected to measure the efficiency of the TRIC-V1 construct. As shown in Figure 6C, the efficiency of TRIC-V1 was higher than 80% for long GOIs, demonstrating that TRIC-V1 can efficiently cyclize GOIs longer than 8000 nt. Furthermore, the efficiency of TRIC-V1 was at least as high as that observed for the PIE Ana method (Figure 6D).

[0149] Example 4 - TRIC-V2 Both TRIC-V1 and PIE operate in reliance on the native exon sequence, i.e., the tRNA sequence in the case of Ana. While these native exon sequences are inevitably part of the resulting circular GOI (shown in Figures 5A and 5B), their inclusion comes with certain disadvantages. Firstly, native exon sequences are immunogenic (Non-Patent Literature 4), which hinders the biomedical use of circular RNAs produced by group I intron-based methods such as PIE. Secondly, including native exon sequences means that the circularization site must be located in the untranslated region (UTR) of the protein encoding the circular RNA. Since the UTR is usually a highly structured internal ribosome entry site (IRES), additional unnecessary spacer sequences are required to ensure that the group I intron and the remaining exons are isolated from the IRES. Finally, while there are tens of thousands of naturally occurring circular RNAs whose functions await elucidation, group I intron-based methods are undesirable in this field due to the unnecessary spacers and native exon sequences. To overcome these limitations, the inventors attempted to obtain an improved version of TRIC.

[0150] To reduce the dependence of cyclization on the tRNA sequence, the lengths of the left and right arms of the Ana tRNA of TRIC-V1.0 were systematically tested (Figure 7). We first shortened the TRIC tRNA sequence to just 5 nucleotides (3 nucleotides in the left arm and 2 nucleotides (L3 / R2) in the right arm). This construct was named TRIC-V1.30 (SEQ ID NO: 29) (see Figure 7B for an overview of the left / right configuration of the construct used in this experiment). The sole purpose of shortening the tRNA sequence to such a short length was to enable the formation of P1 and P10 structures. After in vitro transcription, the reaction product was loaded onto a 6% denatured PAGE. Strong intron bands were detected, but the circular 3× Flag band was very weak, indicating that cyclization was not the primary reaction (Figure 8B). Since the function of the native tRNA exon sequence is to bring the RNA sequence closer to the circularization site, we attempted to induce an interaction between the 3' end sequence of P10 and EGS (V1.31, SEQ ID NO: 30). In V1.31, a circular 3× Flag band was clearly detected, but the circularization efficiency was not comparable to that of TRIC V1.0 (Figure 8B).

[0151] To improve the circularization efficiency, the inventors restored either the left arm (L15 / R2-V1.32 (SEQ ID NO: 31)) or the right arm (L3 / R30-V1.33 (SEQ ID NO: 32)) of the tRNA sequence. Restoring the right arm (V1.33) restored most of the circularization efficiency. Starting from this L3 / R30 configuration in V1.33, the length of the right arm was gradually shortened in constructs V1.34 (L3 / R25) (SEQ ID NO: 33), V1.35 (L3 / R16) (SEQ ID NO: 34), and V1.36 (L3 / R9) (SEQ ID NO: 35). The minimum length for the right arm was identified as 9 nucleotides (V1.36, L3 / R9). Subsequently, with the right arm fixed at 9 nucleotides, an 8nt left arm was tested (V1.39, L8 / R9 (SEQ ID NO: 38)). In the L8 / R9 construct, the cyclization efficiency was fully restored to the V1.0 level. Therefore, the tRNA sequence requirement in V1.39 was shortened to a 17-nucleotide structure that mimicked the anticodon arm (ACA) found in Ana tRNA.

[0152] The inventors attempted to determine whether the activity of group I introns can be replicated based on structure rather than specific nucleotide sequences. To this end, the inventors reversed the sequence of the ACA stem while keeping the sequence of the ACA loop the same (construct named V2.0 (SEQ ID NO: 39)), and found that the cyclization efficiency was at least as high as that of V1.0 and V1.39. In V2.0, the requirement for the tRNA sequence is shortened to 5nt (L-CTT / R-AA). Since the 5nt sequence cannot be specific to any species, TRIC-V2 is independent of the original bacterial tRNA sequence.

[0153] The inventors also confirmed that the stem length can be extended up to 15 base pairs (V2.1 (SEQ ID NO: 40)) without impairing the cyclization efficiency. In this construct, the only tRNA sequence present was the L-CTT / R-AA sequence, and the remaining base pairs did not originate from tRNA sequences. A longer stem is advantageous because it allows for better cyclization of longer GOIs.

[0154] The inventors then reversed the sequences of the P1 and P10 regions (from L-CTT / R-AA to L-GAT / R-TT) except for the uracil that forms the internal guide sequence and fluctuation base pair (construction named V2.2 (SEQ ID NO: 41)). Here again, it was found that the cyclization efficiency was not affected. Thus, the inventors have demonstrated that IGS requires only GU fluctuation base pairs for cyclization, and that the rest of the sequence is independent.

[0155] Based on the above, the inventors have found that if an anticodon arm-like structure (eACA) consisting of a 7nt loop with uracil as the third nucleotide and a stem of 5 base pairs or more can be found within the target gene, the target gene can be efficiently circularized without introducing any unnecessary sequences (Figure 8). When the circularization site is located within the coding sequence, the selected site can be extended for codon redundancy. Potentially, this means that only a few nt mutations are required without affecting the peptide sequence. When the circularization site is located in the UTR of non-coding RNA or protein-coding circular RNA, the circularization site can be assembled by introducing just 5 additional nucleotides to create the eACA.

[0156] Example 5 - TRIC-V2 and Long GOI Next, the TRIC-V2 construct was tested with respect to three protein-coding circular RNAs: circular T2A-EGFP, T2A-nanoluciferase, and circular Znf609. The circularization sites were placed in CDS. For all the circular RNAs tested, numerous circularization sites were found within the CDS. Full-length precursors of these three RNAs were generated and circulated for 20 minutes as previously described and shown in Figure 12. The sequences of the full-length precursors for T2A-EGFP, T2A-nanoluciferase, and Znf609 are shown as SEQ ID NOs. 42, 43, and 44, respectively. As shown in Figure 8D (urea agarose gel), all of these long circular RNAs were efficiently generated by TRIC-V2.

[0157] The results of this experiment suggested that a longer eACA stem leads to better cyclization efficiency. To further investigate this, CVB3-EGFP was cloned into the TRIC-V2 construct, and two stem lengths, 15 nt (SEQ ID NO: 45) and 25 nt (SEQ ID NO: 46), were tested. Separately, the effect of extending the length of the extended guide sequence (EGS) was found by adding a 40 nt EGS (SEQ ID NO: 47) to the TRIC-V1 construct (i.e., the construct with L15 / R51 of the tRNA sequence). Full-length precursors of all these constructs were generated, and cyclization was performed for 4 minutes.

[0158] As shown in Figure 9A, a 4-minute cyclization process converts approximately 50% of the full-length precursor into circular RNA with TRIC-V1.0. Extending the EGS from 20 to 40 did not substantially increase the cyclization efficiency.

[0159] On the other hand, extending the stem length to 15nt or 25nt in TRIC-V2 increased the annularization efficiency. However, extending the EGS of TRIC-V2 from 20nt to 40nt did not substantially increase the annularization efficiency.

[0160] Next, TRIC-V2 was compared to the PIE method for 1-minute and 3-minute cyclization of long GOI EGFP, spikes, and Cas9. In 1-minute cyclization, PIE converted a small number of EGFP precursors to circular RNA, while TRIC-V2 converted a larger number of EGFP precursors to circular RNA. For example, when the eACA stem was equal to 25 nt, more than 50% of the TRIC-V2 precursor was converted to circular RNA within 1 minute (Figure 9B, 2% native agarose gel). In 3-minute cyclization, PIE converted less than 50% of the full-length EGFP precursor to circular RNA, while TRIC-V2 converted almost all of the full-length precursor to circular RNA. Furthermore, PIE produced a noticeable number of concatemerizations, which were hardly observed with TRIC-V2 (Figure 9B). These differences between PIE and TRIC-V2 are also observed in the case of spikes and Cas9, suggesting that TRIC-V2 is much faster and clearer than the PIE method for cyclization of long GOIs (Figure 9C, 0.8% native agarose gel).

[0161] Next, the kinetics of ribozymes were measured using the Michaelis-Menten model. TRIC-V2 with a 25nt stem was 3.7 times faster than PIE in the generation of CVB3-EGFP circular RNA (Figure 9D). Then, using CVB3-EGFP as an example, the cyclization efficiency, circular RNA yield (ratio between circular RNA and total RNA), and nick formation rate were calculated. As shown in Figure 9E, for TRIC-V1, cyclization for 20 minutes yielded an efficiency of 95.6%, with yield and nick formation rates of 58.2% and 26.7%, respectively. For TRIC-V2, cyclization for 3 minutes yielded an efficiency of 89.4%, with yield and nick formation rates of 70.6% and 4.6%, respectively. Further cyclization of TRIC-V2 up to 8 minutes yielded higher efficiency and yield (97.8% and 74.8%), but also increased nick formation (7.7%). Notably, the 74.8% yield is 90.3% of the critical yield (MW ratio between circular RNA and its precursor). In the case of PIE, 8 minutes of circularization yielded an efficiency of 86.7%, where the yield and nick formation rates were 65.5% and 9.3%, respectively. Therefore, TRIC-V2 yields higher efficiency, higher yield, and lower nick formation compared to PIE, and in all cases, there are no issues with the native exon sequence in the resulting circular RNA.

[0162] Overall, the post-transcription cyclization protocol and the highly efficient TRIC-V2 enable the generation of clear and highly efficient circular RNA, resulting in a high final yield.

[0163] Example 6 - Immunogenicity of TRIC-V2 It has been shown that bacterial sequences introduced into circular GOIs by the PIE method are immunogenic (Non-Patent Literature 4). As described above, TRIC-V2 can generate circular target genes without any bacterial sequences. The inventors investigated whether the circular RNA generated by TRIC-V2 is less immunogenic than that generated by PIE.

[0164] Constructs were created to produce circular EGFP and circular nanoluciferase (Nluc) using PIE (sequences 48 and 49, respectively) or TRIC-V2 (sequences 50 and 51, respectively). The circular RNA was purified by gel filtration (using an SRT-2000 SEC column (Sepax)) and RNase R digestion.

[0165] As shown in Figure 11B, circular RNA can be separated from spliced ​​group I introns, but not from nicked RNA and full-length precursors. To further remove nicked RNA and full-length precursors, circular RNA was digested with the exonuclease RNase R at 37°C for 1 hour. The circular RNA was then clarified using the RNA Clean & Concentrator kit (ZYMO RESEARCH). The purified circular RNA was confirmed by 6M-1.5% urea agarose gel. As shown in Figure 11C, no introns or full-length precursors were observed in the purified circular RNA. However, some nicked products, likely generated during the gel electrophoresis process, were still present.

[0166] Next, A549 cells were transfected with circular RNA, and the expression levels of immune factors (IL6, CCL5, and INFβ) were monitored by RT-qPCR. The experiment included various controls, such as mocks (Mock and Lipo), a positive control (poly I:C), unmodified linear mRNAs (lin.EGFP and lin.Nluc), and modified linear mRNAs (lin.EGFP-modi and lin.Nluc-modi). GAPDH was used as an internal reference. The results are shown in Figures 11D to 11F. These results revealed that poly I:C and unmodified linear mRNA induced strong expression of immune factors, while the negative controls (mock and lipo) did not induce significant expression. Furthermore, as expected, unmodified linear mRNA did not induce a strong immune response. Regarding circular RNAs, it was observed that they generally showed lower immunogenicity compared to unmodified linear mRNA. Specifically, in the case of circular Nluc, PIE-circ.Nluc induced significantly stronger immunogenicity expression compared to TRIC-circ.Nluc. In particular, TRIC-circ.Nluc exhibited similar behavior to the non-immunogenic mock, suggesting low immunogenicity. Regarding circular EGFP, both methods induced a similar number of immune responses from the circular RNAs produced. These findings demonstrate that the immunogenicity of circular RNAs produced by TRIC-V2 is lower than that of PIE, especially in the case of circular Nluc. Furthermore, unmodified TRIC circular RNA may exhibit similar levels of immunogenicity to the non-immunogenic mock.

[0167] Next, we tested Nluc expression from circular and linear RNA in HEK293 cells over a 7-day period (Figure 11G). Circular Nluc showed increased and more sustained protein expression compared to linear mRNA. In some cases, it may be necessary to interrupt expression from circular RNA. One way to achieve this is by using siRNA. Multiple siRNA target sites (msiTS) were introduced to the 5' end of the IRES sequence in circular RNA generated by TRIC-V2 (construct shown in Figure 11A). msiTS-circ.Nluc was transfected into HEK293 cells, and siRNA was applied to the cells 3 days after transfection. As shown in Figure 11H, Nluc expression was reduced after 5 hours, demonstrating that circular RNA generated by TRIC-V2 can be effectively targeted using siRNA.

[0168] Example 7 - Rolling Circle Type Replication Circular RNA (circRNA) is more stable than mRNA, making it a promising alternative to mRNA for therapeutic use. Natural circRNAs act as a sponge for microRNAs and proteins, but also as translation templates. If an internal ribosome entry site (IRES) is present for initiation, circRNA can be efficiently translated. In circRNAs lacking an in-frame stop codon, ribosomes can repeatedly and completely translate the vicinity of the circRNA, resulting in polyproteins; this process is known as rolling circle translation (RCT) (Figure 15a). Since polyproteins can, in principle, be cleaved by proteases or self-cleaving sequences, it is possible to produce multiple copies of GOIs in a single initiation. In principle, RCT can be 100 times more efficient than single-step translation. However, RCT faces two challenges: low initiation efficiency and accessory sequences introduced by currently used in vitro circulation methods.

[0169] Unlike single-step translation, RCTs primarily generate polyproteins, which can be converted into protein monomers with 2A skipping sequences (Figure 15b). Instead of using circRNAs with only CDSs, which are inefficient for translation initiation, we selected a robust short IRES (OR4F17) for the RCT construct. As expected, a considerable number of proteins were generated in the circOR4F17-Nluc-RCT. However, translation was still N 1 The efficiency was orders of magnitude lower compared to Ψ-modified mRNA.

[0170] Next, the inventors investigated whether a potent viral IRES could be used in an RCT. However, viral IRESs are typically long and highly structured, which can interfere with an RCT either by in-frame stop codons or by causing ribosome arrest. Nevertheless, the inventors tested a 373nt CSFV IRES. As expected, numerous stop codons were identified in each frame. Therefore, the inventors manipulated frame 1 to eliminate the stop codons and placed it alongside the CDS (Figure 15c). In particular, an RCT using the CSFV IRES showed a more than 10-fold increase in Nluc expression compared to its single translation, and was more than 7000-fold more efficient than an RCT using the OR4F17 IRES (Figures 15d, 15e).

[0171] Example 8 - Loop Optimization As shown, the eACA structure is essential for the circularization to occur. This eACA is a stem-loop structure containing a stem of 1 bp or more and a 7 nt loop with U at the third position (a-0 in Figure 16A). This minimal structure makes it possible to circularize GOIs with almost no restrictions without introducing unwanted sequences.

[0172] To further relax the limitations of eACA, the inventors tested numerous loop types in the circularization of EGFP (b1-m12 in Figure 16A: SEQ ID NOs. 79-90). In these loops, the loop length varied from 3nt to 11nt, and U was placed in the 1st to 5th positions. Circularization of EGFP was ineffective in the cases of L5_U2 and L3_U1, but worked efficiently in all other tested cases, including L5_U3 (Figure 16B). This suggests that the loop must be longer than 4nt, and U cannot be in the 1st or 2nd position.

[0173] Example 9 - Fluctuation Base Pairs The fluctuation base pair between G and U between the IGS (internal guide sequence) and GOI is known to be important for ribozyme function. To investigate whether other base pairs are functional, the inventors mutated G in the IGS to U or A, and U in the GOI to either A or C. Thus, both new Watson-Crick base pairs (UA) and fluctuation base pairs (AC) are included.

[0174] The inventors generated full-length precursors and performed cyclization for 3 minutes and 30 minutes. In the presence of TRICv2(GU), EGFP was efficiently cyclized (Figure 17a). On the other hand, it has been clearly shown that both TRICv2(CA) (SEQ ID NO: 92) and TRICv2(AU) (SEQ ID NO: 91) can convert full-length RNA to circular RNA. The circular RNAs from TRICv2(CA) and TRICv2(AU) were further confirmed by urea agarose gel (Figure 17b).

[0175] Example 10 - Comparison of TRIC-V2 Recent studies have described constructs derived from group I introns of Tetrahymena thermophylla (Tetra), Tetra-STS (RZ construct, Patent Document 2), and Tetra-Rzy for circRNA synthesis. The present inventors compared these to V2 by cloning CVB3-EGFP into Tetra-STS (AU-rich no. 16) and Tetra-Rzy (CVB3IRES-GFP) constructs (SEQ ID NOs. 94 and 95). V2 was superior to both constructs (Figure 18). Furthermore, Tetra-V2 (SEQ ID NO. 93) also efficiently produced circCVB3-EGFP, demonstrating that optimization from Ana introns can be effectively applied to other group I introns.

[0176] array The nucleotide sequences referred to in this specification are shown in the table below.

[0177] [Table 2] TIFF2026521490000009.tif254170TIFF2026521490000010.tif254170TIFF2026521490000011.tif254170TIFF2026521490000012.tif254170TIFF2026521490000013.tif254170TIFF2026521490000014.tif254170TIFF2026521490000015.tif254170TIFF2026521490000016.tif254170TIFF2026521490000017.tif254170TIFF2026521490000018.tif254170TIFF2026521490000019.tif254170TIFF2026521490000020.tif254170TIFF2026521490000021.tif254170TIFF2026521490000022.tif254170TIFF2026521490000023.tif254170TIFF2026521490000024.tif254170TIFF2026521490000025.tif254170TIFF2026521490000026.tif254170TIFF2026521490000027.tif254170TIFF2026521490000028.tif254170TIFF2026521490000029.tif254170TIFF2026521490000030.tif254170TIFF2026521490000031.tif254170TIFF2026521490000032.tif254170TIFF2026521490000033.tif254170TIFF2026521490000034.tif254170TIFF2026521490000035.tif254170TIFF2026521490000036.tif254170TIFF2026521490000037.tif254170TIFF2026521490000038.tif254170TIFF2026521490000039.tif254170TIFF2026521490000040.tif254170TIFF2026521490000041.tif254170TIFF2026521490000042.tif254170TIFF2026521490000043.tif254170TIFF2026521490000044.tif254170TIFF2026521490000045.tif254170TIFF2026521490000046.tif254170TIFF2026521490000047.tif254170TIFF2026521490000048.tif254170TIFF2026521490000049.tif254170TIFF2026521490000050.tif254170TIFF2026521490000051.tif254170TIFF2026521490000052.tif254170TIFF2026521490000053.tif254170TIFF2026521490000054.tif254170TIFF2026521490000055.tif254170TIFF2026521490000056.tif254170TIFF2026521490000057.tif131170.

Claims

1. A recombinant nucleic acid molecule that produces circular RNA, wherein in the 5' to 3' direction, a) Internal guide array (IGS), b) Ribozyme and, c) The first part of the extended anticodon arm (eACA) sequence, d) The target gene and, e) The second portion of the eACA sequence, A recombinant nucleic acid molecule comprising, where the nucleotide in the second portion of the eACA sequence forms a fluctuating base pair with the nucleotide in the IGS.

2. The recombinant nucleic acid molecule according to claim 1, wherein the first portion of the eACA sequence includes a first eACA stem portion and a first eACA loop portion.

3. The recombinant nucleic acid molecule according to claim 1 or 2, wherein the second portion of the eACA sequence includes a second eACA stem portion and a second eACA loop portion.

4. The recombinant nucleic acid molecule according to any one of claims 1 to 3, wherein the first eACA stem portion and the second eACA stem portion are each at least 5 nucleotides in length.

5. The recombinant nucleic acid molecule according to any one of claims 1 to 4, wherein the first eACA stem portion and the second eACA stem portion are each at least 10 nucleotides in length.

6. The recombinant nucleic acid molecule according to any one of claims 1 to 5, wherein the first eACA stem portion and the second eACA stem portion each have a length of at least 15 nucleotides.

7. The recombinant nucleic acid molecule according to any one of claims 1 to 6, wherein the first eACA stem portion and the second eACA stem portion each have a length of at least 20 nucleotides.

8. The recombinant nucleic acid molecule according to any one of claims 1 to 7, wherein the first eACA stem portion and the second eACA stem portion each have a length of at least 25 nucleotides.

9. The recombinant nucleic acid molecule according to any one of claims 1 to 8, wherein the first eACA stem portion and the second eACA stem portion have a length between 1 nucleotide and 50 nucleotides.

10. The recombinant nucleic acid molecule according to any one of claims 1 to 9, wherein the first eACA loop portion has a length of 1 to 20 nucleotides.

11. The recombinant nucleic acid molecule according to any one of claims 1 to 10, wherein the second eACA loop portion has a length of 1 to 20 nucleotides.

12. The recombinant nucleic acid molecule according to any one of claims 1 to 11, wherein the first eACA loop portion is 4 nucleotides long, and the second eACA loop portion is 3 nucleotides long.

13. The recombinant nucleic acid molecule according to any one of claims 1 to 12, further comprising a P1 extension on the 3' side of the second portion of the eACA sequence.

14. The recombinant nucleic acid molecule according to claim 13, wherein the P1 extension is two nucleotides long.

15. The recombinant nucleic acid molecule according to claim 13 or 14, wherein the second portion of the eACA sequence and the P1 extension portion can come together to form a P1 region.

16. The recombinant nucleic acid molecule according to claim 15, wherein the P1 region is complementary to the IGS.

17. The recombinant nucleic acid molecule according to any one of claims 1 to 16, wherein the 5' portion of the first portion of the eACA sequence is capable of forming a P10 region.

18. The recombinant nucleic acid molecule according to claim 17, wherein the 5' portion of the first portion of the eACA sequence forming the P10 region is complementary to the IGS.

19. The recombinant nucleic acid molecule according to claim 17 or 18, wherein the 5' portion of the first portion of the eACA sequence forming the P10 region is 2 nucleotides long.

20. The recombinant nucleic acid molecule according to any one of claims 1 to 19, wherein the nucleotide in the second portion of the eACA sequence that forms a fluctuating base pair is uracil or cytosine.

21. The recombinant nucleic acid molecule according to any one of claims 1 to 20, wherein the nucleotide in the second portion of the eACA sequence that forms a fluctuating base pair is the last nucleotide in the second portion of the eACA sequence.

22. The recombinant nucleic acid molecule according to any one of claims 1 to 21, wherein the second eACA loop portion contains uracil or cytosine as a nucleotide other than the first or second nucleotide in the 5' to 3' direction.

23. The recombinant nucleic acid molecule according to any one of claims 1 to 22, wherein the second eACA loop portion comprises uracil or cytosine as the third nucleotide in the 5' to 3' direction.

24. The recombinant nucleic acid molecule according to any one of claims 1 to 23, wherein the first portion of the eACA sequence and the second portion of the eACA sequence can come together to form a stem-loop structure.

25. The recombinant nucleic acid molecule according to claim 24, wherein the loop of the stem-loop structure has a length of 3 to 40 nucleotides.

26. The recombinant nucleic acid molecule according to claim 24 or 25, wherein the loop of the stem-loop structure is longer than 4 nucleotides.

27. The recombinant nucleic acid molecule according to any one of claims 1 to 26, wherein the ribozyme is a group I intron.

28. The recombinant nucleic acid molecule according to any one of claims 1 to 27, wherein the fluctuation base pair includes a GU fluctuation base pair or an AC fluctuation base pair.

29. The recombinant nucleic acid molecule according to any one of claims 1 to 28, wherein the second portion of the eACA sequence is complementary to the IGS except for the fluctuating base pair.

30. A recombinant nucleic acid molecule according to any one of claims 1 to 29, further comprising a first extended guide sequence (EGS) on the 5' side of the IGS, and further comprising a second EGS on the 3' side of the second portion of the eACA sequence.

31. The recombinant nucleic acid molecule according to claim 30, wherein the first EGS is at least 50% complementary to the second EGS.

32. The recombinant nucleic acid molecule according to claim 31, wherein the first EGS is 100% complementary to the second EGS.

33. The recombinant nucleic acid molecule according to any one of claims 30 to 32, wherein the first EGS and the second EGS each have a length between 1 nucleotide and 500 nucleotides.

34. The recombinant nucleic acid molecule according to any one of claims 1 to 33, wherein the first portion of the eACA sequence and the second portion of the eACA sequence are naturally present in the target gene.

35. The recombinant nucleic acid molecule according to any one of claims 1 to 34, wherein the first portion of the eACA sequence and the second portion of the eACA sequence are derived from human ribosomal RNA (rRNA).

36. The recombinant nucleic acid molecule according to any one of claims 1 to 33 or 35, wherein the nucleotide sequence of the target gene is modified to include a first portion of the eACA sequence and a second portion of the eACA sequence.

37. A recombinant nucleic acid molecule according to any one of claims 15 to 36, further comprising a first loop sequence on the 5' side of the IGS and a second loop sequence on the 3' side of the P1 extension.

38. The recombinant nucleic acid molecule according to claim 37, wherein the first loop sequence and the second loop sequence each have a length between 1 and 10 nucleotides.

39. The recombinant nucleic acid molecule according to claim 37 or 38, wherein the first loop sequence is 6 nucleotides long.

40. The recombinant nucleic acid molecule according to any one of claims 37 to 39, wherein the second loop sequence is 5 nucleotides long.

41. The recombinant nucleic acid molecule according to any one of claims 37 to 40, wherein the first loop sequence is 6 nucleotides long and the second loop sequence is 5 nucleotides long.

42. The recombinant nucleic acid molecule according to any one of claims 37 to 41, wherein the first loop sequence is non-complementary to the second loop sequence.

43. The recombinant nucleic acid molecule according to any one of claims 1 to 42, wherein the target gene has a length of at least 500 nucleotides.

44. The recombinant nucleic acid molecule according to any one of claims 1 to 43, wherein the target gene has a length of at least 2,000 nucleotides.

45. The recombinant nucleic acid molecule according to any one of claims 1 to 44, wherein the target gene has a length of at least 4,000 nucleotides.

46. The recombinant nucleic acid molecule according to any one of claims 1 to 45, wherein the target gene has a length of at least 6,000 nucleotides.

47. The recombinant nucleic acid molecule according to any one of claims 1 to 46, wherein the target gene has a length of at least 8,000 nucleotides.

48. From 5' to 3', a) The first EGS and, b) The first loop array and, c) Internal guide array (IGS), d) Ribozyme and, e) The first part of the extended anticodon arm (eACA) sequence, f) The target gene and g) The second portion of the eACA sequence, h) P1 extension section, i) The second loop array, j) The second EGS, A recombinant nucleic acid molecule according to any one of claims 1 to 47, comprising:

49. A recombinant nucleic acid molecule according to any one of claims 1 to 48, further comprising a T7 high-efficiency sequence.

50. A recombinant nucleic acid molecule according to any one of claims 1 to 49, further comprising at least one restriction enzyme cleavage site.

51. A recombinant nucleic acid molecule according to any one of claims 1 to 50, further comprising a poly(A)tail.

52. The recombinant nucleic acid molecule is a DNA template molecule, according to any one of claims 1 to 51.

53. The recombinant nucleic acid molecule according to claim 52, further comprising a T7 promoter sequence.

54. The recombinant nucleic acid molecule according to any one of claims 1 to 53, wherein the target gene is a non-coding RNA.

55. The target gene is a recombinant nucleic acid molecule according to any one of claims 1 to 53, which encodes a polypeptide.

56. The recombinant nucleic acid molecule according to any one of claims 1 to 55, wherein the recombinant nucleic acid molecule lacks an in-frame stop codon.

57. The target gene is a recombinant nucleic acid molecule according to any one of claims 1 to 56, comprising a translation initiation element.

58. The recombinant nucleic acid molecule according to claim 57, wherein the translation initiation element is a modified viral IRES lacking an in-frame stop codon.

59. Use of a recombinant nucleic acid molecule according to any one of claims 1 to 58 in a method for producing circular RNA.

60. A method for generating circular RNA, a) A step of preparing a recombinant nucleic acid molecule according to any one of claims 1 to 58, b) A step of cyclicizing the recombinant nucleic acid molecule, Methods that include...

61. A method for generating circular RNA, a) A step of preparing a recombinant nucleic acid molecule according to any one of claims 1 to 58, b) A step of transcribing the recombinant nucleic acid molecule to produce an RNA precursor, c) A step of circulating the RNA precursor, Methods that include...

62. The method according to claim 61, wherein splicing is suppressed during step (b).

63. Step (b) involves adding nucleoside triphosphate (NTP) at a concentration of approximately 24 mM and Mg at a concentration of 16 mM or less. ２＋ The method according to claim 61 or 62, carried out in the presence of .

64. A method for generating circular RNA, a) A step of identifying a target gene containing a sequence capable of forming an eACA stem-loop, b) A step of producing a recombinant nucleic acid molecule containing an internal guide sequence (IGS) - ribozyme - sequence encoding a target gene in the direction from 5' to 3', c) A step of cyclicizing the recombinant nucleic acid molecule, Methods that include...

65. A method for generating circular RNA, a) A step of preparing a recombinant nucleic acid molecule according to any one of claims 1 to 58, b) A step of transcribing and cyclicizing the recombinant nucleic acid molecule, This includes a method in which cyclization occurs cotranscribeally.

66. A circular RNA containing a sequence encoding a target gene, wherein the circular RNA does not contain an exogenous splicing sequence.

67. A circular RNA containing a sequence encoding a target gene, wherein the circular RNA does not contain RNA derived from a cyclization factor.

68. The cyclic RNA according to claim 66 or 67, wherein the cyclic factor is a ribozyme.

69. The circular RNA according to any one of claims 66 to 68, wherein the cyclization factor is a group I intron.

70. The circular RNA according to any one of claims 66 to 69, wherein the sequence encoding the target gene includes a sequence capable of forming an eACA stem-loop structure.

71. The circular RNA according to any one of claims 66 to 70, wherein the eACA stem-loop structure comprises at least five base pairs of stem.

72. The circular RNA according to any one of claims 66 to 71, wherein the eACA stem-loop structure includes a loop of at least 7 nucleotides in length.

73. The circular RNA according to any one of claims 66 to 72, wherein the circular RNA has reduced immunogenicity compared to a circular RNA containing an exogenous splicing sequence.

74. The circular RNA according to any one of claims 66 to 73, wherein the circular RNA has reduced immunogenicity compared to circular RNA produced using the reordered intron-exon (PIE) method.

75. The circular RNA according to any one of claims 66 to 74, wherein the sequence encoding the target gene is at least 2,000 nucleotides, at least 3,000 nucleotides, at least 4,000 nucleotides, at least 5,000 nucleotides, or at least 6,000 nucleotides in length.

76. A circular RNA obtained or obtainable by the method of any one of claims 60 to 65, wherein the circular RNA is less immunogenic than a circular RNA containing an exogenous exon sequence.

77. A circular RNA obtained or obtainable by the method described in any one of claims 60 to 65, wherein the circular RNA does not contain an exogenous exon sequence.

78. Use of circular RNA according to any one of claims 66 to 77 in an in vitro method for expressing proteins within cells.

79. A method for expressing a target gene in a cell, comprising: (a) circulating a recombinant nucleic acid molecule according to any one of claims 1 to 58 to obtain a circular RNA containing the target gene; and (b) administering the circular RNA to the cell.

80. A method for treating a disease in a subject, comprising: (a) circulating a recombinant nucleic acid molecule according to any one of claims 1 to 58 to obtain a circular RNA; and (b) administering the circular RNA to the subject.

81. A recombinant nucleic acid molecule according to any one of claims 1 to 58, for use as a pharmaceutical.

82. A recombinant nucleic acid molecule according to any one of claims 1 to 58, used in a method for treating a disease in a subject.

83. A circular RNA that can be obtained by the method described in any one of claims 60 to 65.

84. A circular RNA comprising a sequence encoding a target gene, wherein the circular RNA comprises an eACA sequence.

Images