Compositions and methods for inhibiting the expression of complement factor B (CFB).
dsRNA agents targeting CFB gene expression offer a cost-effective solution for complement-mediated diseases by selectively inhibiting CFB, addressing the limitations of current treatments and enhancing therapeutic outcomes.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- SHANGHAI ARGO BIOPHARMACEUTICAL CO LTD
- Filing Date
- 2024-06-28
- Publication Date
- 2026-07-02
AI Technical Summary
Current treatments for complement-mediated diseases, such as systemic lupus erythematosus and age-related macular degeneration, are limited and costly, necessitating a more effective and affordable therapeutic strategy to inhibit complement factor B (CFB) expression.
Development of double-stranded ribonucleic acid (dsRNA) agents that selectively inhibit CFB gene expression by targeting specific nucleotide sequences, using modified nucleotides and complementary strands to reduce CFB mRNA levels and protein activity.
The dsRNA agents effectively silence CFB gene expression, providing a potential therapeutic option for complement-mediated disorders with reduced costs and improved efficacy compared to existing treatments like eculizumab.
Smart Images

Figure 2026521916000001 
Figure 2026521916000002 
Figure 2026521916000003
Abstract
Description
[Technical Field]
[0001] The present invention partially relates to compositions and methods that can be used to inhibit the expression of the complement factor B (CFB) gene. [Background technology]
[0002] Complement was first discovered in the 1890s, and people at the time found that it assists or "complements" the bacterial killing action of thermostable antibodies present in normal serum. The complement system, or complement pathway, is part of the innate immune system that defends the host against invading pathogens. It consists mainly of more than 30 proteins, which are present in the blood in the form of soluble proteins or in the form of membrane-associated proteins.
[0003] Three main pathways for complement activation have already been identified: the classical pathway, the secondary pathway, and the lectin pathway. Complement activation leads to a cascade of enzymatic reactions called the complement activation pathway, resulting in the formation of potent anaphylatoxins C3a and C5a, which trigger a range of physiological responses from chemoattractions to cellular apoptosis. Initially, complement was thought to play a crucial role in innate immunity, inducing a strong and rapid response to invading pathogens. However, it has recently become increasingly clear that complement also plays a vital role in adaptive immunity involving T cells and B cells, assisting in pathogen elimination, maintaining immunological memory to prevent pathogen re-invasion, and being involved in multiple human pathological conditions.
[0004] Functionally, complement activation occurs at a low level (C3 spontaneously cleaves to produce C3a and C3b), and is further enhanced in the presence of microorganisms by an enzyme cascade that converts the inactive form of the enzyme (zymogen) into its active counterpart. One type of C3 convertase is a complex of C3b and complement factor B (CFB, factor B). Once formed, C3 convertase can convert large amounts of C3 into its cleavage products C3a and C3b in a short time. A specific C3 convertase is a complex of C3b and factor B, and was initially described in the context of an alternative pathway, but can also be formed in the context of the other two pathways. In the alternative pathway, factor B is also a component of C5 convertase, which is a complex that converts C5 (a downstream component of the pathway) into its active form.
[0005] Complement factor B (CFB or "factor B") is involved in the activation of a secondary pathway. Binding of CFB to C3b (e.g., on the cell surface) allows CFB to be readily cleaved by factor D, forming the serine protease C3Bb, which itself is a C3 convertase, thus triggering an amplification loop of C3 activation. CFB is primarily synthesized in the liver, and also at low levels in several external hepatic sites.
[0006] Several diseases are associated with abnormal acquired or genetic activation of the complement pathway and abnormal or overexpression of CFB. Examples include C3 glomerulosis, systemic lupus erythematosus (SLE), lupus nephritis, IgA nephropathy, diabetic nephropathy, polycystic kidney disease, membranous nephropathy, age-related macular degeneration, atypical hemolytic uremic syndrome, thrombotic microangiopathy, myasthenia gravis, ischemia and reperfusion injury, paroxysmal nocturnal hemoglobinuria, rheumatoid arthritis, immune complex-mediated glomerulonephritis (IC-mediated GN), post-infectious glomerulonephritis (PIGN), ischemia / reperfusion injury, antineutrophil cytoplasmic autoantibody-associated vasculitis (ANCA-AV), periodontal disease with microbiota abnormalities, malaria anemia, and hyperlipidemia.
[0007] Currently, there are very few treatment options for complement-mediated diseases, conditions, and syndromes. Eculizumab, a monoclonal humanized antibody, is one such option. Eculizumab has already proven effective in treating paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), and myasthenia gravis. While its use in treating other complement-related disorders is currently being evaluated in clinical trials, eculizumab therapy is very costly, requiring high-dose weekly infusions followed by maintenance infusions every two weeks. Therefore, there is a very high demand for medical treatment for complement-mediated or complement-related disorders. C3 is a key factor in the activation of the complement pathway. Consequently, inhibiting the expression of factors involved in C3 activation (e.g., CFB) offers a promising therapeutic strategy for many complement-mediated disorders. Targeting CFB expression or activity using means such as antisense oligonucleotides, double-stranded siRNAs, or small molecule inhibitors against CFB has already been proposed as a potential therapeutic strategy for treating various complement-mediated diseases.
[0008] Accordingly, the CFB RNAi agents disclosed herein can be used, for example, to treat diseases, conditions, and symptoms associated with complement activation by activating complement factor B activity. [Overview of the Initiative]
[0009] Generally, this disclosure features novel CFB gene-specific RNAi agents, compositions comprising CFB RNAi agents, and methods for inhibiting CFB gene expression in vitro and / or in vivo using CFB RNAi agents and compositions comprising CFB RNAi agents described herein. The CFB RNAi agents described herein can selectively and effectively reduce, inhibit, or silence CFB gene expression in subjects (e.g., human or animal subjects).
[0010] According to one aspect of the present invention, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting CFB expression is provided, wherein the dsRNA agent comprises one sense strand and one antisense strand, wherein the sense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 1, 3, or 5 by 1, 2, or 3 or fewer nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 2, 4, or 6 by 1, 2, or 3 or fewer nucleotides, wherein the sense strand and the antisense strand may be partially complementary, basically complementary, or completely complementary to each other.
[0011] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, of which the antisense strand comprises a region complementary to the CFB RNA transcript, and it comprises at least 15 consecutive nucleotides that differ from any one antisense sequence listed in Tables 1-3 by 1, 2, or 3 or fewer nucleotides.
[0012] In some embodiments, the dsRNA agent comprises one sense strand and one antisense strand, wherein the nucleotides at positions 2-18 of the antisense strand comprise a region complementary to the CFB RNA transcript, the complementary region comprising at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in Tables 1-3, and optionally comprising a target ligand.
[0013] In several embodiments, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting CFB expression is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, the sense strand comprising one of the nucleotides 483-513, 486-516, 491-521, 483-521, 513-543, 987-1017, 989-1019, 1317-1347, 2237-2267, and 2439-2469 in SEQ ID NO: 1. The sense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ from the sequence by 0, 1, 2, or 3 nucleotides, and the antisense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ from the corresponding nucleotide sequence in SEQ ID NO: 2, of which the sense strand and the antisense strand may be partially, basically, or completely complementary to each other.
[0014] In some embodiments, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting CFB expression is provided, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from any one nucleotide sequence of nucleotides 488-508, 491-511, 496-516, 488-516, 518-538, 992-1012, 994-1014, 1322-1342, 2242-2262, or 2444-2464 in SEQ ID NO: 1, and the antisense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from the corresponding nucleotide sequence in SEQ ID NO: 2.
[0015] In some embodiments, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting CFB expression is provided, wherein the sense strand comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from any one nucleotide sequence of nucleotides 490-508, 493-511, 498-516, 490-516, 520-538, 994-1012, 996-1014, 1324-1342, 2244-2262, or 2446-2464 in SEQ ID NO: 1, and the antisense strand comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from the corresponding nucleotide sequence from SEQ ID NO: 2.
[0016] In some embodiments, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting CFB expression is provided, wherein the sense strand comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from any one nucleotide sequence of nucleotides 489-507, 492-510, 497-515, 489-515, 519-537, 993-1011, 995-1013, 1323-1341, 2243-2261, or 2445-2463 in SEQ ID NO: 1, and the antisense strand comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from the corresponding nucleotide sequence from SEQ ID NO: 2.
[0017] In some embodiments, the CFB RNA transcript is Sequence ID No. 1.
[0018] In some embodiments, the antisense strand of the dsRNA agent is at least fundamentally complementary to one of the target regions of SEQ ID NO: 1 and is provided in any one of Tables 1 to 3. In some embodiments, the antisense strand of the dsRNA agent is fully complementary to one of the target regions of SEQ ID NO: 1 and is provided in any one of Tables 1 to 3. In some embodiments, the dsRNA agent comprises a sense strand sequence listed in any one of Tables 1 to 3, of which the sense strand sequence is at least fundamentally complementary to the antisense strand sequence in the dsRNA agent. In some embodiments, the dsRNA agent comprises a sense strand sequence listed in any one of Tables 1 to 3, of which the sense strand sequence is fully complementary to the antisense strand sequence in the dsRNA agent. In some embodiments, the dsRNA agent comprises an antisense strand sequence listed in any one of Tables 1 to 3. In some embodiments, the dsRNA agent comprises a sequence listed as a double-stranded sequence in any one of Tables 1 to 3.
[0019] In some embodiments, the sense strand and antisense strand of the dsRNA agent may be partially, basically, or completely complementary.
[0020] In some embodiments, the dsRNA reagent contains at least one modified nucleotide. In some embodiments, all or essentially all nucleotides of the antisense strand are modified nucleotides. In some embodiments, at least one modified nucleotide includes 2'-O-methylnucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2'-3'-seconucleotide mimetic, locked nucleotide, unlocked nucleic acid nucleotide (UNA), ethylene glycol nucleic acid nucleotide (GNA), 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, debasalized nucleotide, ribitol, reverse nucleotide, reverse debasalized nucleotide, reverse 2'-OMe nucleotide, reverse 2'-deoxynucleotide, isomannitol nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholino nucleotide and 3'-OMe nucleotide, nucleotides containing a 5'-phosphorothioate group, or nucleotides containing a cholesterol derivative or a terminal nucleotide linked to a dodecanoic acid bisdecaneamide group, 2'-amino-modified nucleotide, phosphoramidite, or a non-natural base.
[0021] In some embodiments, the dsRNA agent contains an E-vinylphosphonate nucleotide at the 5' end of the guide strand.
[0022] In some embodiments, the dsRNA agent contains at least one phosphorothioate nucleotide linkage. In some embodiments, the sense strand contains at least one phosphorothioate nucleotide linkage. In some embodiments, the antisense strand contains at least one phosphorothioate nucleotide linkage. In some embodiments, the sense strand contains 1, 2, 3, 4, 5, or 6 phosphorothioate nucleotide linkages. In some embodiments, the antisense strand contains 1, 2, 3, 4, 5, or 6 phosphorothioate nucleotide linkages. In some embodiments, the 5' end of the antisense strand contains 2 phosphorothioate nucleotide linkages. In some embodiments, the 3' end of the antisense strand contains 2 phosphorothioate nucleotide linkages. In some embodiments, the 5' end and the 3' end of the antisense strand independently contain 2 phosphorothioate nucleotide linkages.
[0023] In some embodiments, all or essentially all nucleotides in the sense and antisense strands are modified nucleotides. In some embodiments, the antisense strand contains 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides, 2'-fluoronucleotides, and UNA-modified nucleotides, of which fewer than 6 modified nucleotides are 2'-fluoronucleotides. In some embodiments, the antisense strand contains 3 or 5 2'-fluoronucleotides, preferably 5 2'-fluoronucleotides. In some embodiments, the sense strand contains 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides and 2'-fluoronucleotides, of which fewer than 4 modified nucleotides are 2'-fluoronucleotides. In one embodiment, the sense strand contains 3 2'-fluoronucleotides. In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides and 2'-fluoronucleotides, of which at least 14 modified nucleotides are 2'-O-methylnucleotides, and those located at positions 2, 5, 7, 11, 12, 14, 16 and / or 18, counted from the first matching position at the 5' end of the antisense strand, are independently 2'-fluoronucleotides. In some embodiments, the antisense strand comprises at least one UNA-modified nucleotide and five 2'-fluoronucleotides. In some embodiments, the antisense strand comprises one UNA-modified nucleotide at position 7, five 2'-fluoronucleotides at positions 2, 5, 12, 14 and 16, counted from the first matching position at the 5' end, and the remaining 2'-O-methylnucleotides. In some embodiments, the antisense chain comprises one UNA-modified nucleotide at position 7, five 2'-fluoronucleotides at positions 2, 5, 12, 14 and 18 counted from the first matching position at the 5' end, and the remaining 2'-O-methylnucleotides.In some embodiments, the antisense strand comprises one UNA-modified nucleotide at position 7, five 2'-fluoronucleotides at positions 2, 5, 11, 14, and 16 counted from the first matching position at the 5' end, and the remaining 2'-O-methylnucleotides. In some embodiments, the antisense strand comprises five 2'-fluoronucleotides at positions 2, 7, 12, 14, and 16 counted from the first matching position at the 5' end, and the remaining 2'-O-methylnucleotides. In some embodiments, the antisense strand comprises five 2'-fluoronucleotides at positions 2, 7, 11, 14, and 16 counted from the first matching position at the 5' end, and the remaining 2'-O-methylnucleotides. In some embodiments, the antisense strand comprises five 2'-fluoronucleotides at positions 2, 5, 12, 14, and 16 counted from the first matching position at the 5' end, and the remaining 2'-O-methylnucleotides. In some embodiments, the antisense strand comprises five 2'-fluoronucleotides at positions 2, 5, 12, 14, and 18, counted from the first matching position at the 5' end, and the remaining 2'-O-methylnucleotides. In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides and 2'-fluoronucleotides, preferably at least 18 of which are 2'-O-methylnucleotides, and the nucleotides at positions 9, 11, and / or 13, counted from the first matching position at the 3' end of the sense strand, are 2'-fluoronucleotides. In some embodiments, the sense strand comprises at least 18 modified nucleotides that are 2'-O-methylnucleotides, and the nucleotides at positions 8, 11, and / or 13, counted from the first matching position at the 3' end of the sense strand, are 2'-fluoronucleotides. In some embodiments, the modified sense strand is one of the modified sense strand sequences listed in Tables 2-3. In some embodiments, the modified antisense chain is one of the modified antisense chain sequences listed in Tables 2-3.
[0024] In some embodiments, the dsRNA reagent comprises at least one modified nucleotide and further comprises one or more target groups or binding groups. In some embodiments, one or more target groups or binding groups are conjugated to the sense strand. In some embodiments, the target group or binding group comprises N-acetylgalactosamine (GalNAc).
[0025] In some embodiments, the target group has the following structure: JPEG2026521916000001.jpg5868 n'' is independently selected from 1 or 2.
[0026] In some embodiments, the target group has the following structure. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4]
[0027] In one embodiment, the dsRNA agent includes a target group conjugated to the 5'-terminus of the sense strand. In several embodiments, the dsRNA agent includes a target group conjugated to the 3'-terminus of the sense strand.
[0028] In some embodiments, the antisense chain contains one reverse debase residue at its 3'-terminus.
[0029] In one embodiment, the sense strand contains one or two reverse debasing residues and / or one or two imann residues at its 3' and / or 5' ends. In one embodiment, each end of the sense strand contains one reverse debasing residue. In one embodiment, each end of the sense strand contains one imann residue. In one embodiment, the 5' end of the sense strand contains one reverse debasing residue or imann residue, which is linked via a phosphorothioate bond to an adjacent nucleotide at the 5' end of the sense strand's nucleotide sequence. In one embodiment, the sense strand further contains a target group linked to the reverse debasing residue or imann residue at the 5' end of the sense strand, which is linked via a phosphorothioate bond to an adjacent reverse debasing residue or imann residue, and the target group is selectively N-acetylgalactosamine (GalNAc). In one embodiment, the 5' end of the sense strand contains a reverse debasing residue, which is linked via a phosphorothioate bond to an adjacent nucleotide at the 5' end of the sense strand's nucleotide sequence. In another embodiment, the sense strand further contains a target group linked to the reverse debasing residue at the 5' end of the sense strand, which is linked via a phosphorothioate bond to an adjacent reverse debasing residue, and selectively, the target group is N-acetylgalactosamine (GalNAc), with each strand independently having a length of 21 nucleotides.
[0030] In some embodiments, the dsRNA agent has two blunt ends. In some embodiments, at least one strand contains a 3' overhang of at least one nucleotide. In some embodiments, at least one strand contains a 3' overhang of at least two nucleotides.
[0031] In one embodiment, the dsRNA comprises a duplex selected from AV02373, AV02375, AV02379, AV02388, AV02411, AV02464, AV02554, AV02584, AV06327, AV06328, AV06329, and among them, the duplex optionally comprises a target ligand. In one embodiment, the dsRNA comprises a duplex selected from AD01093, AD01093-1, AD01093-2, AD01094, AD01096, AD01393, AD01393-1, AD01396, AD01399, AD01412, AD01420, AD01420-1.
[0032] According to another aspect of the present invention, there is provided a double-stranded ribonucleic acid (dsRNA) agent for inhibiting CFB expression, wherein the dsRNA agent comprises one sense strand and one antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to a part of the CFB RNA transcript, wherein the length of each strand is about 15 to about 30 nucleotides, and wherein the sense strand comprises a sequence that can be represented by formula (I), 5’-(N’ N2 , F , , , L , N1 ) n’ N’ L N’ L N’ L N’ L N’ F N’ L N’ F N’ L N’ N1 N’ N2 N’ L N’ L N’ L N’ L [[ID=3⑧]]N’ L (N’ L M ) M m’ -3’ (I) Among them, each N’ F represents a 2’-fluoro-modified nucleotide, each N’ N1 and N’ N2 independently represent a modified or unmodified nucleotide, and each N’ LThe symbols independently represent modified or unmodified nucleotides, but do not represent 2'-fluoromodified nucleotides, and m' and n' are each independently integers from 0 to 7.
[0033] In some embodiments, N' N1 and N' N2 It contains only one 2'-fluoromodified nucleotide.
[0034] In some embodiments, N' N1 This independently represents a 2'-fluoromodified nucleotide.
[0035] In some embodiments, N' N2 This independently represents a 2'-fluoromodified nucleotide.
[0036] In some embodiments, m' is 2 and n' is 4, or m' is 2 and n' is 2. In some embodiments, m' is 1 and n' is 4, or m' is 1 and n' is 2. In some embodiments, m' is 0 and n' is 4, or m' is 0 and n' is 2.
[0037] In some embodiments, the dsRNA agent includes a target group conjugated to the 5' end of the sense strand, preferably the target group is one selected from GLO-1 to GLO-16 and GLS-1* to GLS-16*, and more preferably the target group is GLS-15*. In some embodiments, the dsRNA agent includes a target group conjugated to the 3' end of the sense strand. In some embodiments, the antisense strand includes one reverse debase residue at the 3' end. In some embodiments, the sense strand includes one or two reverse debase residues and / or one or two imann residues at the 3' and / or 5' ends. In some embodiments, each 3' and 5' end of the sense strand independently contains a reverse debase residue. In some embodiments, each 3' and 5' end of the sense strand independently contains an imann residue. In one embodiment, the sense strand includes two reverse debase residues at the 3' and 5' ends, and one of the residues at either the 3' or 5' end is further conjugated to a target group, preferably GLS-15*. In another embodiment, the sense strand includes two imann residues at the 3' and 5' ends, and one of the residues at either the 3' or 5' end is further conjugated to a target group, preferably GLS-15*. In another embodiment, each end of the sense strand includes one reverse debase residue or imann residue at the 5' end of the sense strand, of which the reverse debase residue or imann residue is ligated via a phosphorothioate bond to an adjacent nucleotide at the 5' end of the sense strand's nucleotide sequence. In one embodiment, the sense strand further comprises a target group linked to a reverse debasing residue or imann residue at the 5' end of the sense strand, wherein the target group is linked to an adjacent reverse debasing residue or imann residue via a phosphorothioate bond, and selectively, the target group is N-acetylgalactosamine (GalNAc). In one embodiment, the 5' end of the sense strand comprises a single reverse debasing residue, wherein the reverse debasing residue is linked to an adjacent nucleotide at the 5' end of the nucleotide sequence of the sense strand via a phosphorothioate bond.In one embodiment, the sense strand further comprises a target group linked to a reverse debasing residue at the 5' end of the sense strand, wherein the target group is linked to an adjacent reverse debasing residue via a phosphorothioate bond, and selectively, the target group is N-acetylgalactosamine (GalNAc), and each strand independently contains 21 nucleotides. In some embodiments, the antisense strand of the dsRNA agent is at least fundamentally complementary to any one of the target regions of SEQ ID NO: 1, and is provided in any one of Tables 1 to 3.
[0038] According to another aspect of the present invention, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting CFB expression is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand are complementary, the antisense strand comprises a region complementary to the CFB RNA transcript, the length of each strand being approximately 18 to approximately 30 nucleotides, and the antisense strand comprises a sequence that may be represented by formula (II). 3'-(N L ) n N M1 N L N M2 N L N F N L N M3 N M4 N L N L N L N M5 N L N M6 N L N L N F N L -5' (II) Eventually, each N F represents a 2'-fluoromodified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 and N M6 Each N independently represents a modified or unmodified nucleotide. LThe symbols independently represent modified or unmodified nucleotides, but are not 2'-fluoromodified nucleotides, and n is an integer between 0 and 7.
[0039] In some examples, N M1 , N M2 , N M3 , N M4 , N M5 and N M6 It has only three 2'-fluoromodified nucleotides.
[0040] In some embodiments, N M2 , N M3 and N M5 These independently represent 2'-fluoromodified nucleotides.
[0041] In some embodiments, N M2 , N M4 and N M5 These independently represent 2'-fluoromodified nucleotides.
[0042] In some embodiments, N M1 , N M3 and N M6 Each of these independently represents a 2'-fluoromodified nucleotide.
[0043] In some embodiments, N M2 , N M3 and N M6 These independently represent 2'-fluoromodified nucleotides.
[0044] In some embodiments, N M2 , N M4 and N M6 These independently represent 2'-fluoromodified nucleotides.
[0045] In some embodiments, N M1 , N M3 and N M6 Each of these independently represents a 2'-fluoromodified nucleotide, and N M5represents a UNA-modified nucleotide.
[0046] In some embodiments, N M2 , N M3 and N M6 each independently represent a 2'-fluoro-modified nucleotide, and N M5 represents a UNA-modified nucleotide.
[0047] In some embodiments, N M2 , N M4 and N M6 each independently represent a 2'-fluoro-modified nucleotide, and N M5 represents a UNA-modified nucleotide.
[0048] In some embodiments, n is 1, or n is 2, or n is 3, or n is 5. In some embodiments, the antisense strand of the dsRNA agent is at least substantially complementary to any one of the target regions of SEQ ID NO: 1 and is provided in any one of Tables 1 to 3.
[0049] According to another aspect of the present invention, there is provided a double-stranded ribonucleic acid (dsRNA) agent for inhibiting CFB expression, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a dsRNA duplex, wherein the sense strand and the antisense strand are complementary, wherein the antisense strand comprises a region complementary to the CFB RNA transcript, wherein the complementary region comprises at least 15 consecutive nucleotides, and wherein the dsRNA duplex comprises a duplex represented by formula (III). Sense strand: 5'-(N' L ) n’ N' L N' L N' L N' L N' F N' L N' F N' L N' N1 N' N2 N' L N'L N' L N' L N' L (N' L ) m’ -3' Antisense chain: 3'-(N L ) n N M1 N L N M2 N L N F N L N M3 N M4 N L N L N L N M5 N L N M6 N L N L N F N L -5' (III) Eventually, Each chain has a length of approximately 18 to 30 nucleotides. each N F and N' F This independently shows a 2'-fluoromodified nucleotide, and N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N' N1 and N' N2 Each N independently represents a modified or unmodified nucleotide. L and N' L The symbols independently represent modified or unmodified nucleotides, but do not represent 2'-fluoromodified nucleotides, and m', n', and n are each independently integers from 0 to 7.
[0050] In some examples, N M1 , N M2 , N M3 , N M4 , N M5 and N M6 It has only three 2' fluoromodified nucleotides, and N' N1 and N' N2It contains only one 2'-fluoromodified nucleotide.
[0051] In some embodiments, m' is 2 and n' is 4, m' is 2 and n' is 6, or m' is 2 and n' is 2. In some embodiments, m' is 1 and n' is 4, or m' is 1 and n' is 2. In some embodiments, m' is 0 and n' is 4, or m' is 0 and n' is 2. In some embodiments, n is 1, or n is 2, or n is 3, or n is 5.
[0052] In some embodiments, N' N1 This independently represents 2'-fluoromodified nucleotides.
[0053] In some embodiments, N' N2 This independently represents 2'-fluoromodified nucleotides.
[0054] In some embodiments, N M2 , N M3 and N M5 These independently represent 2'-fluoromodified nucleotides.
[0055] In some embodiments, N M2 , N M4 and N M5 These independently represent 2'-fluoromodified nucleotides.
[0056] In some embodiments, N M1 , N M3 and N M6 Each of these independently represents a 2'-fluoromodified nucleotide.
[0057] In some embodiments, N M2 , N M3 and N M6 These independently represent 2'-fluoromodified nucleotides.
[0058] In some embodiments, N M2 , N M4 and N M6 These independently represent 2'-fluoromodified nucleotides.
[0059] In some embodiments, N M1 , N M3 and N M6 Each of these independently represents a 2'-fluoromodified nucleotide, and N M5 This indicates a UNA-modified nucleotide.
[0060] In some embodiments, N M2 , N M3 and N M6 Each of these independently represents a 2'-fluoromodified nucleotide, and N M5 This indicates a UNA-modified nucleotide.
[0061] In some embodiments, N M2 , N M4 and N M6 Each of these independently represents a 2'-fluoromodified nucleotide, and N M5 This indicates a UNA-modified nucleotide.
[0062] In some embodiments, the dsRNA agent includes a target group conjugated to the 5' end of the sense strand, preferably the target group is one selected from GLO-1 to GLO-16 and GLS-1* to GLS-16*, and more preferably the target group is GLS-15*. In some embodiments, the dsRNA agent includes a target group conjugated to the 5' end of the sense strand. In some embodiments, the antisense strand includes one reverse debase residue at the 3' end. In some embodiments, the sense strand includes one or two reverse debase residues and / or one or two imann residues at the 3' and / or 5' ends. In some embodiments, each 3' and 5' end of the sense strand independently contains a reverse debase residue. In some embodiments, each 3' and 5' end of the sense strand independently contains an imann residue. In one embodiment, the sense strand contains two reverse debase residues at the 3' and 5' ends, and one of the residues at the 3' or 5' end is further conjugated to a target group, preferably GLS-15*. In one embodiment, the sense strand contains two imann residues at the 3' and 5' ends, and one of the residues at the 3' or 5' end is further conjugated to a target group, preferably GLS-15*. In one embodiment, the dsRNA agent has two blunt ends. In one embodiment, at least one strand contains a 3' overhang of at least one nucleotide. In one embodiment, at least one strand contains 3' overhangs of at least two nucleotides. In one embodiment, each end of the sense strand contains one reverse debase residue or imann residue at the 5' end of the sense strand, of which the reverse debase residue or imann residue is ligated via a phosphorothioate bond to an adjacent nucleotide at the 5' end of the sense strand's nucleotide sequence. In one embodiment, the sense chain further comprises a target group linked to a reverse debasing residue or imann residue at the 5' end of the sense chain, wherein the target group is linked to an adjacent reverse debasing residue or imann residue via a phosphorothioate bond, and the target group is selectively N-acetylgalactosamine (GalNAc).In one embodiment, the 5' end of the sense strand contains one reverse debasing residue, which is linked via a phosphorothioate bond to an adjacent nucleotide at the 5' end of the sense strand's nucleotide sequence. In another embodiment, the sense strand further contains a target group linked to the reverse debasing residue at the 5' end of the sense strand, which is linked via a phosphorothioate bond to an adjacent reverse debasing residue, and selectively the target group is N-acetylgalactosamine (GalNAc), with each strand independently containing 21 nucleotides. In another embodiment, the antisense strand of the dsRNA agent is at least fundamentally complementary to any one of the target regions of Sequence ID No. 1 and is provided in any one of Tables 1 to 3.
[0063] According to one aspect of the present invention, a composition is provided that comprises any embodiment relating to the above-described embodiment of the dsRNA agent of the present invention. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the composition further comprises one or more other therapeutic agents. In some embodiments, the composition is packaged in a reagent kit, container, packaging, dispenser, pre-filled syringe or vial. In some embodiments, the composition is prepared for use in subcutaneous or intravenous (IV) administration.
[0064] Another aspect of the present invention provides cells comprising any embodiment of the above-described embodiment of the dsRNA agent of the present invention. In some embodiments, the cells are mammalian cells, and optionally human cells.
[0065] Another aspect of the present invention provides a method for inhibiting CFB gene expression in cells, the method comprising (i) producing cells containing an effective amount of any embodiment of the dsRNA agent of the present invention or any embodiment of the composition of the present invention. In some embodiments, the method further comprises (ii) inhibiting CFB gene expression in cells by maintaining the produced cells for a sufficient time to obtain degradation of the mRNA transcript of the CFB gene. In some embodiments, the cells are in the body of a subject and the dsRNA agent is administered subcutaneously to the subject. In some embodiments, the cells are in the body of a subject and the dsRNA agent is administered intravenously to the subject. In one embodiment, the method further includes evaluating CFB gene inhibition after administering a dsRNA agent to a subject, the evaluation method comprising (i) determining one or more physiological features of the subject's CFB-related disease or condition, and (ii) comparing the determined physiological features with baseline pre-treatment physiological features of the CFB-related disease or condition and / or control physiological features of the CFB-related disease or condition, the comparison indicating one or more of the presence or absence of CFB gene expression inhibition in the subject. In some embodiments, the physiological features are one or more of CFB mRNA levels and CFB protein levels. Reduction in CFB expression may also be indirectly evaluated by measuring a reduction in CFB biological activity, such as other pathologies associated with elevated CFB levels (preferably in the blood or kidneys), or excessive activation of the complement pathway, or other therapeutic methods that require inhibition of CFB expression. One or more of the following indicators will decrease: CFB mRNA levels, CFB protein levels, CH50 activity (a measure of total hemolytic complement), AH50 (a measure of hemolytic activity of the complement alternative pathway), lactate dehydrogenase (LDH) (a measure of intravascular hemolysis), hemoglobin levels, and the levels of one or more of the following: C3, C9, C5, C5a, C5b, and soluble C5b-9 complexes.
[0066] Another aspect of the present invention provides a method for inhibiting CFB gene expression in a subject's body, the method comprising administering to the subject an effective amount of an embodiment relating to the dsRNA agent of the present invention or an embodiment relating to the composition of the present invention. In some embodiments, the dsRNA agent is administered subcutaneously to the subject. In some embodiments, the dsRNA agent is administered intravenously to the subject. In some embodiments, the method further comprises evaluating CFB gene inhibition after administration of the dsRNA agent, the evaluation method comprising (i) determining one or more physiological features of CFB-related disease or disorder in the subject's body, and (ii) comparing the determined physiological features with baseline pre-treatment physiological features of CFB-related disease or disorder and / or control physiological features of CFB-related disease or disorder, the comparison indicating one or more types of CFB gene expression inhibition in the subject's body. In some embodiments, CFB gene expression can be evaluated based on the level or change in level of any variable related to CFB gene expression, such as CFB mRNA levels or CFB protein levels. A reduction in CFB expression may be indirectly assessed by measuring a reduction in CFB biological activity, such as other pathologies associated with elevated CFB levels, preferably in the blood or kidneys, or excessive activation of the complement pathway, or other therapeutic methods that require inhibiting CFB expression, CFB mRNA levels, CFB protein levels, CH50 activity (a criterion for measuring total hemolytic complement), AH50 (a criterion for measuring hemolytic activity of the complement alternative pathway), lactate dehydrogenase (LDH) (a criterion for measuring intravascular hemolysis), hemoglobin levels, and levels of one or more of the C3, C9, C5, C5a, C5b, and soluble C5b-9 complexes.
[0067] Another aspect of the present invention provides a method for treating a disease or condition associated with the presence of CFB protein, the method comprising administering to a subject an effective amount of any embodiment of the dsRNA agent of the present invention or any one embodiment of any composition of the present invention in order to inhibit CFB gene expression. In some embodiments, CFB-related diseases, conditions, or conditions include autoimmune diseases, complement system dysfunction including abnormal upregulation of complement components such as CFB, C3 glomerulosis (C3G), systemic lupus erythematosus (SLE), lupus nephritis, Ig-mediated renal lesions such as IgA nephropathy and primary membranous nephropathy, nephropathy, diabetic nephropathy, polycystic kidney disease, membranous nephropathy, age-related macular degeneration (AMD) including dry AMD and geographic atrophy, typical or infectious hemolytic uremic syndrome (tHUS), atypical hemolytic uremic syndrome (aHUS), asthma, psoriasis, thrombotic microangiopathy, ischemia-reperfusion injury, paroxysmal nocturnal hemoglobinuria (PNH), rheumatic diseases, rheumatoid arthritis, multiple sclerosis (MS), neuromyelitis optica (NMO), and immune complex-mediated conditions. The following conditions are selected: 1. Glomerulonephritis (IC-mediated GN), 2. Post-infection glomerulonephritis (PIGN), 3. Antineutrophil cytoplasmic autoantibody-associated vasculitis (ANCA-AV), 3. Antiphospholipid syndrome (APS), 4. Periodontal disease, malaria anemia, dermatomyositis, bullous pemphigoid, Shiga toxin-associated E. coli hemolytic uremic syndrome, 4. Myasthenia gravis (MG), neuromyelitis optica (NMO), dense deposit disease, coronary artery disease, dermatomyositis, Graves' disease, atherosclerosis, Alzheimer's disease, systemic inflammatory response sepsis, septic shock, spinal cord injury, glomerulonephritis, Hashimoto's thyroiditis, type 1 diabetes, psoriasis, pemphigus, autoimmune hemolytic anemia (AIHA), cold agglutinin disease, fluid and vascular graft rejection, graft dysfunction, myocardial infarction, graft allergy, hyperlipidemia, and sepsis.
[0068] In some embodiments, the method further comprises administering an alternative treatment to a subject. In some embodiments, the alternative treatment comprises treatment for a CFB-related disease or condition. In one embodiment, the alternative treatment comprises administering one or more CFB antisense polynucleotides of the present invention to a subject, administering a non-CFB dsRNA therapeutic agent to the subject, and modifying the subject's behavior. In some embodiments, the alternative therapeutic agent is selected from the group consisting of oligonucleotides, small molecules, monoclonal antibodies, polyclonal antibodies, and peptides. Preferably, the alternative therapeutic agent is a C5 inhibitor, for example, an anti-complement component C5 antibody or its antigen-binding fragment (e.g., eculizumab, ravulizumab-cwvz, or pozelimube (REGN3918)) or a C5 peptide inhibitor (e.g., Zircoplan). Eculizumab is a humanized monoclonal IgG2 / 4, kappa light chain antibody that specifically binds to complement component C5 with high affinity and inhibits the formation of terminal complement complex C5b-9 by inhibiting the cleavage of C5 to C5a and C5b. Ravulizumab-cwvz is a humanized IgG2 / 4 monoclonal antibody that specifically binds to complement component C5 with high affinity and inhibits the formation of terminal complement complex C5b-9 by inhibiting the cleavage of C5 to C5a and C5b. Pozelimab (also known as H4H12166P and described in US20170355757) is a fully human IgG4 monoclonal antibody for blocking complement factor C5. Zilucoplan is a synthetic macrocyclic peptide that binds to complement component 5 (C5) with sub-nanomolecular affinity and allosterically inhibits its cleavage to C5a and C5b after activation of classical, alternative, or lectin pathways. Preferably, another therapeutic agent is a C3 peptide inhibitor or an analogue thereof. In one embodiment, the C3 peptide inhibitor is compstatin. Compstatin is a cyclic tridecapeptide having effective and selective C3 inhibitory activity.
[0069] In some embodiments, the dsRNA drug is administered to the subject by subcutaneous injection. In some embodiments, the dsRNA drug is administered to the subject by intravenous injection. In some embodiments, the method further includes determining the efficacy of the administered double-stranded ribonucleic acid (dsRNA) drug to the subject.
[0070] In some embodiments, a method for determining the therapeutic effect of treating a subject includes (i) determining one or more physiological characteristics of the subject's CFB-related disease or condition, and (ii) comparing the determined physiological characteristics with baseline pre-treatment physiological characteristics of the CFB-related disease or condition, the comparison result indicating one or more of the presence, absence, and efficacy levels of administering a double-stranded ribonucleic acid (dsRNA) agent to the subject.
[0071] In some embodiments, CFB gene expression can be evaluated based on the level or change in level of any variable related to CFB gene expression, such as the subject's CFB mRNA level, CFB protein level, or CH50 activity (a criterion for measuring total hemolytic complement), AH50 (a criterion for measuring hemolytic activity of the complement alternative pathway), lactate dehydrogenase (LDH) (a criterion for measuring intravascular hemolysis), hemoglobin level, or the levels of one or more of C3, C9, C5, C5a, C5b, and soluble C5b-9 complexes.
[0072] Another aspect of the present invention provides a method for reducing the level of CFB protein in a subject compared to a baseline pre-treatment level of CFB protein in the subject, the method comprising administering to the subject an effective amount of any embodiment of the dsRNA agent or any embodiment of the composition of the present invention to reduce the level of CFB gene expression. In some embodiments, the dsRNA agent is administered to the subject subcutaneously or intravenously.
[0073] Another aspect of the present invention provides a method for modifying the physiological characteristics of a CFB-related disease or disorder in a subject compared to baseline pre-treatment physiological characteristics of the CFB-related disease or disorder in the subject, the method comprising administering to the subject an effective amount of any embodiment of the dsRNA agent of the present invention or any embodiment of the composition of the present invention to modify the physiological characteristics of the CFB-related disease or disorder in the subject. In some embodiments, the dsRNA agent is administered to the subject subcutaneously or intravenously. In some embodiments, the physiological characteristics and symptoms are one or more levels of CFB mRNA levels, CFB protein levels, or CH50 activity (a criterion for total hemolytic complement), AH50 (a criterion for hemolytic activity of the complement alternative pathway), lactate dehydrogenase (LDH) (a criterion for intravascular hemolysis), hemoglobin levels, or one or more levels of C3, C9, C5, C5a, C5b and soluble C5b-9 complexes in the subject.
[0074] According to another aspect of the present invention, a method of using the above-mentioned dsRNA agent for treating a disease or condition associated with the presence of CFB protein is provided. In some embodiments, the above-mentioned disease or condition is autoimmune disease, complement system dysfunction (including abnormal upregulation of complement components such as CFB), C3 glomerulopathy (C3G), systemic lupus erythematosus (SLE), lupus nephritis, Ig-mediated renal lesions (e.g., IgA nephropathy and primary membranous nephropathy), nephropathy, diabetic nephropathy, polycystic kidney disease, membranous nephropathy, age-related macular degeneration (AMD) including dry AMD and geographic atrophy, typical or infectious hemolytic uremic syndrome (tHUS), atypical hemolytic uremic syndrome (aHUS), asthma, psoriasis, thrombotic microangiopathy, ischemia and reperfusion injury, paroxysmal nocturnal hemoglobinuria (PNH), rheumatoid arthritis, rheumatoid arthritis, multiple sclerosis (MS), neuromyelitis optica (NMO), immune complex-mediated glomerulopathy One or more of the following conditions are present: nephritis (IC-mediated GN), post-infectious glomerulonephritis (PIGN), antineutrophil cytoplasmic autoantibody-associated vasculitis (ANCA-AV), antiphospholipid syndrome (APS), periodontal disease, malaria anemia, bullous dermatomyositis pemphigoid, Shiga toxin-associated E. coli hemolytic uremic syndrome, myasthenia gravis (MG), neuromyelitis optica (NMO), dense deposit disease, coronary artery disease, dermatomyositis, Graves' disease, atherosclerosis, Alzheimer's disease, systemic inflammatory response sepsis, septic shock, spinal cord injury, glomerulonephritis, Hashimoto's thyroiditis, type 1 diabetes, psoriasis, pemphigus, autoimmune hemolytic anemia (AIHA), cold agglutinin disease, fluid and vascular graft rejection, graft dysfunction, myocardial infarction, graft sensitization, hyperlipidemia, and sepsis.
[0075] According to another aspect of the present invention, an antisense polynucleotide agent for inhibiting the expression of CFB protein is provided, the agent comprising 10 to 30 consecutive nucleotides, of which at least one consecutive nucleotide is a modified nucleotide, and the nucleotide sequence of the agent is approximately 80% complementary to the equivalent region of the nucleotide sequence of SEQ ID NO: 1 over its entire length. In some embodiments, the equivalent region is any one of the target regions of SEQ ID NO: 1, and the complementary sequence is a sequence provided in one of Tables 1 to 3. In some embodiments, the antisense polynucleotide agent comprises one of the antisense sequences provided in one of Tables 1 to 3.
[0076] Another aspect of the present invention provides a composition comprising embodiments of any of the above-described antisense polynucleotide agents. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the composition further comprises one or more additional therapeutic agents for treating CFB-related diseases or conditions. In some embodiments, the composition is packaged in a reagent kit, container, packaging, dispenser, pre-filled syringe or vial. In some embodiments, the composition is prepared for use in subcutaneous or intravenous administration.
[0077] According to another aspect of the present invention, cells comprising an embodiment of any one of the above-described antisense polynucleotide agents are provided. In some embodiments, the cells are mammalian cells, and optionally human cells.
[0078] Another aspect of the present invention provides a method for inhibiting CFB gene expression in cells, the method comprising (i) producing cells containing an effective amount of any embodiment of the antisense polynucleotide reagent. In some embodiments, the method further comprises (ii) inhibiting CFB gene expression in cells by maintaining the cells produced in (i) for a sufficient time to obtain degradation of the mRNA transcript of the CFB gene.
[0079] Another aspect of the present invention provides a method for inhibiting CFB gene expression in a subject, the method comprising administering an effective amount of any embodiment of the antisense polynucleotide reagent to the subject.
[0080] According to another aspect of the present invention, a method is provided for treating a disease or condition associated with the presence of CFB protein, the method comprising administering to a subject an effective amount of any of the above-mentioned embodiments of the antisense polynucleotide agent or any of the above-mentioned embodiments of the present invention in order to inhibit CFB gene expression. In one embodiment, the above disease or condition is autoimmune disease, complement system dysfunction (including abnormal upregulation of complement components such as CFB), C3 glomerulosis (C3G), systemic lupus erythematosus (SLE), lupus nephritis, Ig-mediated renal lesions (e.g., IgA nephropathy and primary membranous nephropathy), nephropathy, diabetic nephropathy, polycystic kidney disease, membranous nephropathy, age-related macular degeneration (AMD) including dry AMD and geographic atrophy, typical or infectious hemolytic uremic syndrome (tHUS), atypical hemolytic uremic syndrome (aHUS), asthma, psoriasis, thrombotic microangiopathy, ischemia and reperfusion injury, paroxysmal nocturnal hemoglobinuria (PNH), rheumatoid arthritis, rheumatoid arthritis, multiple sclerosis (MS), neuromyelitis optica (NMO), immune complex-mediated glomerulonephritis. One or more of the following conditions are present: IC-mediated glomerulonephritis (GN), post-infectious glomerulonephritis (PIGN), antineutrophil cytoplasmic autoantibody-associated vasculitis (ANCA-AV), antiphospholipid syndrome (APS), periodontal disease with bacterial flora abnormalities, malaria anemia, bullous dermatomyositis pemphigoid, Shiga toxin Escherichia coli-associated hemolytic uremic syndrome, myasthenia gravis (MG), neuromyelitis optica (NMO), dense deposit disease, coronary artery disease, dermatomyositis, Graves' disease, atherosclerosis, Alzheimer's disease, systemic inflammatory response sepsis, septic shock, spinal cord injury, glomerulonephritis, Hashimoto's thyroiditis, type 1 diabetes, psoriasis, pemphigus, autoimmune hemolytic anemia (AIHA), cold agglutinin disease, fluid and vascular graft rejection, graft dysfunction, myocardial infarction, graft sensitization, hyperlipidemia, and sepsis.
[0081] Another aspect of the present invention provides a method for reducing the level of CFB protein in a subject compared to a baseline pre-treatment level of CFB protein in the subject, the method comprising administering to the subject an effective amount of any embodiment of the antisense polynucleotide reagent or any embodiment of the composition of the present invention to reduce the level of CFB gene expression. In one embodiment, the antisense polynucleotide reagent is administered to the subject subcutaneously or intravenously.
[0082] According to another aspect of the present invention, an antisense polynucleotide reagent for inhibiting CFB gene expression is provided, the reagent comprising 10 to 30 consecutive nucleotides, of which at least one of the consecutive nucleotides is a modified nucleotide, and of which the nucleotide sequence has about 80% or about 85% complementarity with the equivalent region of the nucleotide sequence of SEQ ID NO: 1 over its entire length.
[0083] Another aspect of the present invention provides a method for modifying the physiological characteristics of a subject's CFB-related disease or condition, the method comprising administering to the subject an effective amount of any embodiment of the antisense polynucleotide agent or any embodiment of the composition of the present invention to modify the physiological characteristics of the subject's CFB-related disease or condition compared to baseline pre-treatment physiological characteristics of the subject's CFB-related disease or condition. In some embodiments, the antisense polynucleotide agent is administered to the subject by subcutaneous or intravenous injection. In some embodiments, the physiological characteristics and symptoms are one or more levels of the subject's CFB mRNA level, CFB protein level, or CH50 activity (a criterion for total hemolytic complement), AH50 (a criterion for hemolytic activity of the complement alternative pathway), lactate dehydrogenase (LDH) (a criterion for intravascular hemolysis), hemoglobin level, or one or more levels of C3, C9, C5, C5a, C5b, and soluble C5b-9 complex.
[0084] Array description Sequence IDs 1 and 2 (reverse complementary) are from modern human CFB mRNA [NCBI reference sequence: NM_001710.6].
[0085] Sequence IDs 3 and 4 (reverse complementary) are macaque (rhesus monkey) CFB mRNA [NCBI reference sequence: XM_015136029.2].
[0086] Sequence IDs 5 and 6 (reverse complementary) are mouse (subtype 1) CFB mRNA [NCBI reference sequence: NM_008198.3].
[0087] Sequence numbers 7-468 and 1489-1595 are sense strand sequences, as shown in Table 1.
[0088] Sequence numbers 469-930 and 1596-1702 are antisense strand sequences, as shown in Table 1.
[0089] Sequence numbers 931-1392 and 1703-1810 are sequences with chemical modifications, as shown in Table 2.
[0090] Sequence IDs 1393-1488, 1811-1879, and 1882-1951 are shown in Table 3. The delivery molecule is indicated as "GLX-__" at the 3' or 5' end of each sense chain. [Modes for carrying out the invention]
[0091] The present invention partially comprises an RNAi agent capable of inhibiting CFB gene expression, for example, a double-stranded (ds) RNAi agent. The present invention further partially comprises a composition comprising a CFB RNAi agent and a method of using the composition. The CFB RNAi agents disclosed herein can be attached to a delivery compound so as to be delivered to cells, including hepatocytes. The pharmaceutical composition of the present invention may comprise at least one dsRNA CFB agent and a delivery compound. In some embodiments of the compositions and methods of the present invention, the delivery compound is a delivery compound containing GalNAc. The CFB RNAi agent delivered to cells can reduce the activity of the CFB protein product of the gene in the cells by inhibiting CFB gene expression. The dsRNAi reagents of the present invention can be used to treat CFB-related diseases and conditions.
[0092] In some embodiments of the present invention, CFB expression in cells or subjects is reduced to treat diseases or conditions associated with CFB expression in cells or subjects. Non-limiting examples of diseases and conditions treatable by reduction of CFB activity include the alleviation or improvement of one or more symptoms associated with unwanted or excessive CFB expression, CH50 activity (a criterion for measuring total hemolytic complement), AH50 (a criterion for measuring hemolytic activity of the complement alternative pathway), lactate dehydrogenase (LDH) (a criterion for measuring intravascular hemolysis), hemoglobin levels, and one or more levels of C3, C9, C5, C5a, C5b, and soluble C5b-9 complexes. "Treatment" may mean extending survival time compared to the expected survival time without treatment.
[0093] As used herein, “G,” “C,” “A,” and “U” typically represent nucleotides containing guanine, cytosine, adenine, and uracil as bases, respectively. However, the terms “ribonucleotide” or “nucleotide” should be understood to refer to modified nucleotides (as described in more detail below) or alternative substitutional portions. It will be understood by those skilled in the art that guanine, cytosine, adenine, and uracil may be substituted by other portions without significantly altering the base-pairing properties of oligonucleotides containing such substitutional portions. For example, a nucleotide containing inosine as a base can pair with a nucleotide base containing adenine, cytosine, or uracil, but is not limited to these. Accordingly, in the nucleotide sequences of the present invention, nucleotides containing uracil, guanine, or adenine may be substituted with, for example, a nucleotide containing inosine. Sequences containing such substitutional portions are examples of the present invention.
[0094] As used herein, “complement factor B” is interchangeable with the terms “factor B” or “CFB” and, unless otherwise specified, refers to a naturally occurring gene encoding the complement factor B protein from any vertebrate or mammal, including but not limited to humans, cattle, chickens, rodents, mice, rats, pigs, sheep, primates, monkeys and guinea pigs. The term further refers to fragments and variants of natural CFB that retain the in vivo or in vitro activity of at least one of the natural CFBs. The amino acid and complete coding sequences of the human CFB gene reference sequence can be found, for example, in GenBank Ref Seq Accession No. NM_001710.6 (SEQ ID NO: 1 and 2), Macaca mulatta (rhesus monkey) CFB mRNA GenBank Ref Seq Accession No. XM_015136029.2 (SEQ ID NO: 3 and 4), and Mus musculus (isoform 1) NM_008198.3 (SEQ ID NO: 5 and 6). Other examples of CFB mRNA sequences can be readily obtained using public databases such as GenBank, UniProt, Ensembl, and OMIM.
[0095] The following describes how to prepare and use compositions containing CFB single-stranded (ssRNA) and dsRNA reagents to inhibit CFB gene expression, as well as compositions and methods for treating diseases and conditions caused or regulated by CFB gene expression. The term "RNAi" is also known in this field, and it may also be called "siRNA".
[0096] As used herein, the term “RNAi” includes RNA and reagents that mediate targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. As is known in this art, an RNAi target region refers to a continuous portion of the nucleotide sequence of an mRNA molecule formed during gene transcription, including messenger RNA (mRNA), which is an RNA-processed product as a primary transcript. The target portion of the sequence is at least long enough to function as a substrate for RNAi directed cleavage in or near that portion. The target sequence may be 8–30 nucleotides long (inclusive), 10–30 nucleotides long (inclusive), 12–25 nucleotides long (inclusive), 15–23 nucleotides long (inclusive), 16–23 nucleotides long (inclusive), or 18–23 nucleotides long (inclusive), including all relatively short lengths within each specified range. In some embodiments of the present invention, the length of the target sequence is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides. In some embodiments, the length of the target sequence is between 9 and 26 nucleotides (including both endpoints), encompassing all subranges and integers within that range. For example, but not intended to be limiting, in some embodiments of the present invention, the target sequence is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long, of which the sequence is completely or at least fundamentally complementary to at least a portion of the RNA transcript of the CFB gene. Some aspects of the present invention include a pharmaceutical composition comprising one or more CFB dsRNA agents and a pharmaceutically acceptable carrier. In one embodiment of the present invention, the CFB RNAi described herein inhibits the expression of CFB protein.
[0097] As used herein, “dsRNA agents” refers to compositions containing RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecules that can sequence-specifically degrade or inhibit the translation of messenger RNA (mRNA) transcripts of target mRNA. While not intending to limit ourselves to any particular theory, the dsRNA agents of the present invention may function by RNA interference mechanisms (i.e., by inducing RNA interference through interaction with the RNA interference pathway mechanism (RNA-induced silencing complex or RISC) in mammalian cells) or by any alternative mechanism or pathway. In this field, methods for silencing genes in plant, invertebrate, and vertebrate cells are well known [see, for example, Sharp et al., Genes Dev. 2001, 15:485; Bernstein, et al., (2001) Nature 409:363; Nykanen, et al., (2001) Cell 107:309; and Elbashir, et al., (2001) Genes Dev. 15:188)], of which each disclosure is incorporated herein by reference in whole. Gene silencing procedures known in this field can be used in combination with the disclosures provided herein to inhibit CFB expression.
[0098] The dsRNA agents disclosed herein consist of one sense strand and one antisense strand and include, but are not limited to, short interfering RNA (siRNA), RNAi agents, microRNA (miRNA), short hairpin RNA (shRNA), and Dicer substrates. The antisense strand of the dsRNA agents described herein is at least partially complementary to the target mRNA. In this art, dsRNA double-stranded structures of different lengths are known to be usable to inhibit target gene expression. For example, dsRNA double-stranded structures having 19, 20, 21, 22, and 23 base pairs are known to be able to effectively induce RNA interference (Elbashir et al., EMBO 2001, 20:6877-6888). It is also known in this art that relatively short or relatively long RNA double-stranded structures can effectively induce RNA interference. In some embodiments, the lengths of the sense strand and antisense strand may be homologous or different. In some embodiments, the length of each strand is 40 nucleotides or less. In some embodiments, the length of each strand is 30 nucleotides or less. In some embodiments, the length of each strand is 25 nucleotides or less. In some embodiments, the length of each strand is 23 nucleotides or less. In some embodiments, the length of each strand is 21 nucleotides or less. In some embodiments, the length of the sense strand and antisense strand of the RNAi agent may be 15 to 49 nucleotides each. In some embodiments, the length of the antisense strand is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the sense strand length is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides. In some embodiments, both the sense strand and the antisense strand length is 21 nucleotides.In some embodiments, the sense strand and antisense strand are complementary or basically complementary, and the length of the complementary region is 15 to 23 nucleotides. In some embodiments, the length of the complementary region is 19 to 21 nucleotides. In some embodiments, the length of the complementary region is 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments of the present invention, the CFB dsRNA may include at least one strand having a length of at least 21 nt, or it may have a relatively short double-stranded body based on one of the sequences listed in any one of Tables 1 to 3, but it may be effective to reduce one, two, three, or four nucleotides at one or both ends compared to the dsRNAs listed in Tables 1 to 3. In some embodiments of the present invention, the CFB dsRNA agent may have a portion of at least 15, 16, 17, 18, 19, 20 or more consecutive nucleotide sequences of one or more sequences in Tables 1-3, and its ability to inhibit CFB gene expression differs from the inhibition level of a dsRNA containing a complete sequence by 5%, 10%, 15%, 20%, 25%, or 30% or less. The sense strand sequences, antisense sequences, and double-stranded bodies disclosed in Tables 1-3 may be referred to herein as “parent” sequences, meaning that the sequences disclosed in Tables 1-3 may be modified, shortened, extended, substituted, etc., as described herein, and the resulting sequences retain the effectiveness of all or at least part of the parent sequence in the methods and compositions of the present invention. The sense strand and antisense strand included in the dsRNA of the present invention are independently selected. As used herein, the term “independently selected” means that each of two or more similar elements can be selected independently of the selection of the other elements. For example, though not intended to be limiting, when producing the dsRNA of the present invention, two strands of "elements" may be selected so as to be contained within a double strand.One selected element, i.e., the sense sequence, may be sequence number 932 (as shown in Table 2), while the other selected element, i.e., the antisense sequence, may be sequence number 1163, or sequence number 1163 that is modified, shortened, extended, and / or contains one, two, or three substitutions compared to its parent sequence, sequence number 1163. It should be understood that the double strands of the present invention do not necessarily have to contain simultaneously the sense strand and antisense sequence shown in pairs in the double strands in Tables 1-3. Each sense and antisense strand sequence in the tables is immediately followed by its sequence number.
[0099] Some embodiments of the compositions and methods of the present invention include single-stranded RNA in the composition and / or administered to a subject. For example, the antisense strands listed in any one of Tables 1 to 3 may be compositions, or compositions administered to a subject to reduce CFB polypeptide activity and / or CFB gene expression in the subject's body. Table 1 shows the core extension nucleotide sequences of the antisense and sense strands of a certain CFB dsRNA agent. A single-stranded antisense molecule included in a certain composition of the present invention and / or administered in a certain method of the present invention is referred herein to as a “single-stranded antisense agent” or “antisense polynucleotide agent.” A single-stranded sense molecule included in a certain composition of the present invention and / or administered in a certain method of the present invention is referred herein to as a “single-stranded sense agent” or “sense polynucleotide agent.” The term “nucleotide sequence” in this specification refers to a polynucleotide sequence that is free from chemical modifications or delivery compounds. For example, the sense strand GACAAUGUGAGUGAUGAGAUA (SEQ ID NO: 22) shown in Table 1 is the nucleotide sequence of SEQ ID NO: 946 in Table 2 and SEQ ID NO: 1393 in Table 3, of which SEQ ID NO: 946 and SEQ ID NO: 1393 represent their chemical modifications and delivery compounds. Sequences disclosed herein may be assigned identifiers. For example, a single-stranded sense sequence may be labeled with "sense strand SS#", a single-stranded antisense sequence may be labeled with "antisense strand AS#", and a double-stranded molecule containing both the sense strand and the antisense strand may be labeled with "double-stranded molecule AD# / AV#".
[0100] Table 1 includes a sense strand and an antisense strand, and provides the label numbers for the double-stranded bodies formed by the sense strand and antisense strand in the same row in Table 1. In one embodiment of the present invention, the antisense sequence includes nucleic acid base u or nucleic acid base a at position 1 of the antisense sequence. In one embodiment of the present invention, the antisense sequence includes nucleic acid base u at position 1 of the antisense sequence. As used herein, the term “matching position” in the sense strand and antisense strand is a position that “pairs” in each strand when the two strands are double-stranded. For example, in a sense strand with 21 nucleic acid bases and an antisense strand with 21 nucleic acid bases, the nucleic acid base at position 1 of the sense strand and the nucleic acid base at position 21 of the antisense strand are in a “matching position”. In another non-limiting example, in a sense strand with 23 nucleic acid bases and an antisense strand with 23 nucleic acid bases, nucleic acid base 2 of the sense strand and position 22 of the antisense strand are in a matching position. In yet another non-limiting example, in a sense strand of 18 nucleic acid bases and an antisense strand of 18 nucleic acid bases, the nucleic acid base at position 1 of the sense strand and the nucleic acid base at position 18 of the antisense strand are in matching positions, and nucleic acid base 4 in the sense strand and nucleic acid base 15 in the antisense strand are in matching positions. Those skilled in the art know how to identify, or become, matching positions in the sense strand and antisense strand of a double helix and paired strands.
[0101] The last column in Table 1 indicates a duplex AV# which is a duplex containing sense and antisense sequences in the same row of the table. For example, Table 1 discloses a duplex designated Duplex AV02358.um which contains sense sequence number 7 and antisense sequence number 469. Thus, each row in Table 1 labels a duplex of the present invention, each duplex containing sense and antisense sequences shown in the same row, the designating identifier of each duplex shown in the last column of that row.
[0102] In some embodiments of the method of the present invention, an RNAi agent containing a polynucleotide sequence shown in any one of Tables 1 to 3 is administered to a subject. In some embodiments of the present invention, the RNAi agent administered to the subject comprises a double-stranded body, which contains at least one nucleotide sequence listed in Table 1 and includes 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 sequence modifications. In some embodiments of the method of the present invention, the RNAi agent containing a polynucleotide sequence shown in any one of Tables 1 to 3 is attached to a delivery molecule, a non-limiting example of which is a delivery compound containing a GalNAc compound or a GLS-15* compound.
[0103] [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9] [Table 2-10] [Table 2-11] [Table 2-12] [Table 2-13] [Table 2-14] [Table 2-15] [Table 2-16] [Table 2-17] [Table 2-18]
[0104] The sense strand sequences of AV02373.um, AV02375.um, AV02379.um, AV02388.um, AV02554.um, and AV02584.um correspond to the nucleotide sequences at positions 488-508, 491-511, 496-516, 518-538, 2242-2262, and 2444-2464 of Sequence ID No. 1, respectively, as shown in Table 1.
[0105] Table 2 lists the sense and antisense strand sequences of a certain chemically modified CFB RNAi agent of the present invention. In some embodiments of the method of the present invention, an RNAi agent having the polynucleotide sequence shown in Table 2 is administered to cells and / or a subject. In some embodiments of the method of the present invention, an RNAi agent having the polynucleotide sequence shown in Table 2 is administered to a subject. In some embodiments of the present invention, the RNAi agent administered to the subject includes a double-stranded molecule labeled in the first row of Table 2 and includes sequence modifications in the sense and antisense strand sequences shown in the third and sixth columns of the same row in Table 2, respectively. In some embodiments of the method of the present invention, the sequences shown in Table 2 may be attached to (also referred to herein as "linked to") a compound that can deliver the RNAi agent to the cells and / or tissues of the subject. Non-limiting examples of deliverable compounds that can be used in some embodiments of the present invention are compounds containing GalNAc or compounds containing GLS-15*. In Table 2, the first column shows the double-stranded molecule AV# of the nucleotide sequence shown in Table 1. Table 2 discloses the double-stranded AV# and further shows the chemical modifications contained in the sense and antisense sequences of the double-stranded AV#. For example, Table 1 shows the single-base sequences SEQ ID NO: 7 (sense) and SEQ ID NO: 469 (antisense), which together constitute a double-stranded AV# and are labeled as AV# AV02358.um, while Table 2 lists the double-stranded AV# AV02358, which indicates that the double-stranded AV# of SEQ ID NO: 931 and SEQ ID NO: 1162 contain the base sequences of SEQ ID NO: 7 and SEQ ID NO: 469, respectively, but have the chemical modifications shown in the sense and antisense sequences shown in the third and sixth columns, respectively. In the second column of Table 2, "Sense Strand SS#" is the identifier assigned to the sense sequence (including modifications) shown in the third column of the same row. In the fifth column of Table 2, "Antisense Strand AS#" is the identifier assigned to the antisense sequence (including modifications) shown in the sixth column.
[0106] [Table 3-1] [Table 3-2] Table 3-3 Table 3-4 Table 3-5 Table 3-6 Table 3-7 Table 3-8 Table 3-9
[0107] Table 3 shows the antisense and sense strand sequences of a certain chemically modified CFB RNAi agent of the present invention. In some embodiments of the method of the present invention, the RNAi agent shown in Table 3 is administered to cells and / or subjects. In some embodiments of the method of the present invention, an RNAi agent having the polynucleotide sequence shown in Table 3 is administered to a subject. In some embodiments of the present invention, the RNAi agent administered to a subject comprises a double-stranded body labeled in the first row of the first column in Table 3, and includes the sequence modification and / or delivery compound shown in the sense strand in the third column and the antisense strand sequence in the sixth column of the same row in Table 3, respectively. These sequences are used in certain in vivo studies described elsewhere in this specification. In some embodiments of the method of the present invention, the sequences shown in Table 3 may be attached to (also referred to herein as "bound to") a compound for delivery, a non-limiting example of which is a GalNAc-containing compound, of which the delivery compound is labeled "GLX-n" in the sense strand in the third column in Table 3. As used herein, "GLX-n" refers to a "GLS-n*" or "GLO-n" delivery compound (where "X" may be "S" or "O"), but GLX-0 may be any "GLS-n*" and "GLO-n" delivery compound that can be attached to the 3' end of an oligonucleotide during the synthesis process. As used herein and as shown in Table 3, "GLX-n" indicates that the GalNAc-containing compound to be attached is one of the following compounds: GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, the structure of each compound is provided elsewhere in this specification.Those skilled in the art can manufacture and use the dsRNA compounds of the present invention, the delivery compound to which the attachment is any one of GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16. The first column of Table 3 provides the double-stranded AD# assigned to the double-stranded sense and antisense sequences in that row. For example, double-stranded AD# AD01093 is the double-stranded form of sense strand sequence number 1393 and antisense strand sequence number 1441. Each row in Table 3 provides one sense strand and one antisense strand and discloses the double-stranded form of the sense and antisense strands shown. The "sense strand SS#" in the second column of Table 3 is the identifier assigned to the sense sequence (including modifications) shown in the third column of the same row. The "antisense strand AS#" in the fifth column of Table 3 is the identifier assigned to the antisense sequence (including modifications) shown in the sixth column. The identifier of a certain linked GalNAc-containing "GLO-n" or "GLS-n" compound is shown as GLS-5*, GLS-15*, or GLX-0, and another "GLO-n" or "GLS-n*" compound may substitute for the compound shown as GLO-0, and the resulting compound should be understood to be included in the examples of the methods and / or compositions of the present invention.
[0108] [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5] [Table 4-6]
[0109] AD01786 contains the nucleotide sequence u*Uf*gAfaUfgAfaAfcGfa*Cf*u*Uf*c*Uf*cGfuUfuCfaUfuCf*a*Af*(L-96)(SEQ ID NO: 1880), and AD01787 contains (GLO-15)(MOE-A*)(MOE-T*)(MOE-m5C*)(MOE-m5C*)(MOE- The nucleotide sequence contains m5C*)(dA*)(m5dC*)(dG*)(m5dC*)(m5dC*)(m5dC*)(m5dC*)(dT*)(dG*)(dT*)(MOE-m5C*)(MOE-m5C*)(MOE-A*)(MOE-G*)(MOE-m5C) (Sequence ID 1881), and L-96 refers to the compound GalNAc3 described in Jayaprakash, et al., (2014) J.Am.Chem.Soc., 136, 16958~16961.
[0110] [Table 5-1] [Table 5-2] [Table 5-3]
[0111] In one embodiment of the present invention, the dsRNA (also referred to herein as the “double-stranded DNA”) is a dsRNA disclosed in one of Tables 1 to 3. Each row in Tables 1 to 3 discloses a double-stranded DNA comprising the sense strand sequence and antisense strand sequence in that row of the table. In addition to the double-stranded DNA disclosed in Tables 1 to 3, in some embodiments, the double-stranded DNA of the present invention may include the sense and antisense sequences shown in Tables 1 to 3, which should be understood to differ from the sequences shown in Tables 1 to 3 by 0, 1, 2, or 3 nucleotides. Thus, as a non-limiting example, in some embodiments, the antisense strand in the double-stranded DNA of the present invention may be SEQ ID NOs: 484, 490, 497, 665, or 667, respectively, which differ from the nucleotides in SEQ ID NOs: 484, 490, 497, 665, or 667 by 0, 1, 2, or 3 nucleotides.
[0112] It should be understood that the sense strand sequence and antisense strand sequence in the double-stranded dsRNA of the present invention can be independently selected. Accordingly, the dsRNA of the present invention may include the double-stranded sense strand and antisense strand disclosed in one row of Tables 1-3. Alternatively, in the dsRNA of the present invention, one or both of the selected sense strand and antisense strand in the dsRNA may include the sequences shown in Tables 1-3, but one or both of the sense strand and antisense strand may contain one, two, three or more nucleic acid base substitutions derived from the parent sequence. In some embodiments, the selected sequence may be longer or shorter than its parent sequence. Accordingly, the dsRNA agents included in the present invention may, but do not need to include, the exact sequences of the sense strand and antisense strand pair disclosed as double-stranded in Tables 1-3.
[0113] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the nucleotides at positions 2-18 of the antisense strand comprise a region complementary to the CFB RNA transcript, the complementary region comprising at least 15 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in Tables 1-3, and optionally comprising a target ligand. In some cases, the region complementary to the CFB RNA transcript comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ by 3 or fewer nucleotides from one of the antisense sequences listed in Tables 1-3. In some embodiments of the dsRNA agent of the present invention, the antisense strand of the dsRNA is essentially complementary to at least one of the target regions of Sequence ID No. 1 and is provided in any one of Tables 1-3. In some embodiments, the antisense strand of the dsRNA agent of the present invention is fully complementary to any one of the target regions of Sequence ID No. 1 and is provided in any one of Tables 1 to 3. In some embodiments, the dsRNA agent comprises a sense strand sequence listed in any one of Tables 1 to 3, and the sense strand sequence is at least fundamentally complementary to the antisense strand sequence in the dsRNA agent. In other embodiments, the dsRNA agent of the present invention comprises a sense strand sequence listed in any one of Tables 1 to 3, and the sense strand sequence is fully complementary to the antisense strand sequence in the dsRNA agent. In some cases, the dsRNA agent of the present invention comprises an antisense strand sequence listed in any one of Tables 1 to 3. Some embodiments of the dsRNA agent of the present invention include a sense strand and an antisense strand disclosed as a double-stranded structure in any one of Tables 1 to 3. As described herein, it should be understood that the sense strand and antisense strand in the double-stranded structure of the present invention can be independently selected.
[0114] Mismatch It is known to those skilled in the art that mispairs in dsRNA, particularly in the terminal region of dsRNA, are acceptable for efficacy. Some mispairs are more acceptable; for example, mispairs of the fluctuating base pairs G:U and A:C are acceptable for efficacy (Du et el., A systematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites. Nucleic Acids Res. 2005 Mar 21;33(5):1671-7. Doi:10.1093 / nar / gki312. Nucleic Acids Res. 2005;33(11):3698). In some embodiments of the methods and compounds of the present invention, the CFB dsRNA agent may contain one or more mispairs with the CFB target sequence. In some embodiments, the CFB dsRNA agent of the present invention does not contain mispairs. In some embodiments, the CFB dsRNA agent of the present invention contains one or fewer mispairs. In some embodiments, the CFB dsRNA agent of the present invention contains two or fewer mispairs. In some embodiments, the CFB dsRNA agent of the present invention contains three or fewer mispairs. In some embodiments of the present invention, the antisense strand of the CFB dsRNA agent contains mispairs with the CFB target sequence, and these mispairs are not located in the center of the complementary region. In some embodiments, the antisense strand of the CFB dsRNA agent contains one, two, three, four or more mispairs located at the last 5, 4, 3, 2, or 1 nucleotide of one or both of the 5' or 3' ends of the complementary region. Methods described herein and / or methods known in the art can be used to determine whether a CFB dsRNA agent containing mispairs with the CFB target sequence effectively inhibits the expression of the CFB gene.
[0115] Complementarity As used herein, unless otherwise specified, the term “complementary” means that an oligonucleotide or polynucleotide containing a first nucleotide sequence (e.g., targeting a CFB dsRNA agent sense strand or CFB mRNA) is used to describe a first nucleotide sequence (e.g., targeting a CFB dsRNA agent sense strand or CFB mRNA) relative to a second nucleotide sequence (e.g., a CFB dsRNA agent antisense strand or a single-stranded antisense polynucleotide), and that the oligonucleotide or polynucleotide containing the second nucleotide sequence is capable of hybridizing with the oligonucleotide or polynucleotide containing the second nucleotide sequence [forming base-pair hydrogen bonds under mammalian physiological conditions (or similar conditions in vitro)] and forming a double-stranded or double-helical structure under certain conditions. Other conditions, e.g., physiologically relevant conditions that may be encountered in vivo, are also applicable. Those skilled in the art can determine the optimal set of conditions for testing the complementarity of the two sequences from the final application of the nucleotides to be hybridized. The complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimeographs, to the extent that they satisfy the above hybridization requirements. Sequence identity or complementarity is not related to modification.
[0116] Complementary sequences, for example in the CFB dsRNA described herein, include base pairings of one or two nucleotide sequences over the full length of an oligonucleotide or polynucleotide containing a first nucleotide sequence and an oligonucleotide or polynucleotide containing a second nucleotide sequence. In this specification, such sequences may be referred to as “fully complementary.” If, in an embodiment, two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, such overhangs should be understood not to be mispaired in the context of complementarity determination as herein. For example, a CFB dsRNA agent comprises an oligonucleotide having a length of 19 nucleotides and another oligonucleotide having a length of 20 nucleotides, of which the relatively longer oligonucleotide contains a 19-nucleotide sequence that is fully complementary to the relatively shorter oligonucleotide, but can still be referred to as “fully complementary” for the purposes described herein. Thus, as used herein, “fully complementary” means that all (100%) of the continuous sequence of the first polynucleotide hybridize with the same number of bases in the continuous sequence of the second polynucleotide. The continuous sequence may include all or part of the first or second nucleotide sequence.
[0117] As used herein, the term “basically complementary” means that in a pair of nucleic acid base sequences to hybridize, at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of, but not all, of the bases in the sequence of the first polynucleotide hybridize with the same number of bases in the sequence of the second polynucleotide. The term "basically complementary" can be used to refer to a first sequence relative to a second sequence, for example, two double-stranded sequences reaching 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or even 30 base pairs (bp) may, after hybridization, contain one or more mispaired base pairs, e.g., at least 1, 2, 3, 4, or 5, while simultaneously retaining hybridization ability under conditions most relevant to their final application, such as inhibiting CFB gene expression via the RISC pathway.
[0118] The term “partially complementary” can be used herein to refer to a pair of nucleic acid base sequences that hybridize, of which at least 75% (but not all) of the bases in the sequence of the first polynucleotide hybridize with the same number of bases in the sequence of the second polynucleotide. In some embodiments, “partially complementary” means that at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the bases in the sequence of the first polynucleotide hybridize with the same number of bases in the sequence of the second polynucleotide.
[0119] As used herein, the terms “complementary,” “fully complementary,” “basically complementary,” and “partially complementary” refer to base matching between the sense and antisense strands of a CFB dsRNA agent, between the antisense strand of a CFB dsRNA agent and the target CFB mRNA sequence, or between a single-stranded antisense oligonucleotide and the target CFB mRNA sequence. The term “antisense strand of a CFB dsRNA agent” should be understood to refer to the same sequence as “CFB antisense polynucleotide agent.”
[0120] As used herein, the terms “basically the same” or “basically identical” as used for nucleic acid sequences mean that they include sequences that have at least about 85%, preferably at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity compared to a reference sequence. The percentage of sequence identity is determined by comparing two optimally aligned sequences in a comparison window. The percentage can be calculated by determining the number of positions in which the same nucleic acid bases appear in the two sequences to generate the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, multiplying the result, and dividing by 100 to obtain the percentage of sequence identity. The inventions disclosed herein cover nucleotide sequences that are basically the same as those disclosed in, for example, Tables 1-3 herein. In some embodiments, the sequences disclosed herein are exactly the same, or at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% are the same as those disclosed in Tables 1-3 herein.
[0121] As used herein, the term “sequence-containing chain” refers to an oligonucleotide containing a nucleotide chain described by a sequence referred to using standard nucleotide nomenclature. As used herein, the term “double-stranded RNA” or “dsRNA” refers to an RNAi containing an RNA molecule or molecular complex having a hybridization double-stranded region, the hybridization double-stranded region comprising two antiparallel and essentially or completely complementary nucleic acid strands, which are said to have “sense” and “antisense” directions with respect to the target CFB RNA. The double-stranded region may be of any length that allows for the specific degradation of the desired target CFB RNA by the RISC pathway, but is typically in the length range of 9 to 30 base pairs, for example, 15 to 30 base pairs. Considering double helix structures between 9 and 30 base pairs, the double helix may be of any length within that range, for example, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, and any sub-range thereof, such as 15-30 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 18-26 base pairs, and 18-23 base pairs. This includes, but is not limited to, base pairs of 1, 18-22, 18-21, 18-20, 19-30, 19-26, 19-23, 19-22, 19-21, 19-20, 20-30, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-26, 21-25, 21-24, 21-23, or 21-22. The length of CFB dsRNA reagents produced in cells by treatment with Dicer and similar enzymes is typically in the range of 19-22 base pairs. One strand of the double-stranded region of the CFB dsDNA agent contains a sequence that is essentially complementary to the region of the target CFB RNA.The two strands forming the double-stranded structure may originate from a single RNA molecule having at least one self-complementary region, or they may be formed from two or more individual RNA molecules. When the double-stranded region is formed from two strands of a single molecule, the molecule may have a double-stranded region separated by a single-stranded nucleotide chain (referred to herein as a “hairpin ring”) between the 3’ end of one strand forming the double-stranded structure and the corresponding 5’ end of the other strand. In some embodiments of the present invention, the hairpin ring contains at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more unpaired nucleotides. When the two essentially complementary strands of a CFB dsRNA agent consist of individual RNA molecules, these molecules do not need to be covalently bonded, but can be. When the two strands are covalently bonded in a manner other than a hairpin ring, the linking structure is called a “linker”. The term "siRNA" is also used herein to refer to the dsRNA agents described herein.
[0122] In some embodiments of the present invention, the CFB dsRNA reagent may contain sense and antisense sequences having unpaired nucleotides or nucleotide analogs at one or two ends of the dsRNA reagent. Ends without unpaired nucleotides are called "blunt ends" and do not have nucleotide overhangs. When both ends of a dsRNA reagent are blunt ends, the dsRNA is called a "blunt-ended" dsRNA. In some embodiments of the present invention, the first end of the dsRNA reagent is blunt, in some embodiments, the second end of the dsRNA reagent is blunt, and in one embodiment of the present invention, both ends of the CFB dsRNA reagent are blunt.
[0123] In some embodiments of the dsRNA reagent of the present invention, the dsRNA does not have one or two blunt ends. In this case, the dsRNA reagent has at least one unpaired nucleotide at the end of each strand. For example, a nucleotide overhang exists if the 3' end of one strand of the dsRNA extends beyond the 5' end of the other strand, or vice versa. The dsRNA may contain at least 1, 2, 3, 4, 5, 6 or more nucleotide overhangs. The nucleotide overhang may contain or consist of nucleotide / nucleoside analogs (including deoxynucleotides / nucleosides). In some embodiments, the nucleotide overhang may be located on the sense strand of the dsRNA reagent, on the antisense strand of the dsRNA reagent, or at both ends of the dsRNA reagent, and the nucleotides of the overhang may be located at the 5' end, 3' end, or both ends of the antisense or sense strand of the dsRNA. In one embodiment of the present invention, one or more nucleotides at the overhanging end are replaced with a nucleoside phosphorothioate.
[0124] As used herein, the terms “antisense strand” or “guide strand” refer to the strand of the CFB dsRNA agent that contains a region that is essentially complementary to the CFB target sequence. As used herein, the terms “sense strand” or “passenger strand” refer to the strand of the CFB dsRNA agent that contains a region that is essentially complementary to the antisense strand region of the CFB dsRNA agent.
[0125] qualification In some embodiments of the present invention, the RNA of the CFB RNAi agent is chemically modified to enhance stability and / or one or more other beneficial properties. The nucleic acid in some embodiments of the present invention can be synthesized and / or modified by methods well established in the art, such as "Current protocols in Nucleic Acid Chemistry," Beaucage, Slet al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference. Modifications that may be present in certain embodiments of the CFB dsRNA agent of the present invention include, for example, terminal modifications such as (a) 5'-end modifications (phosphorylation, conjugate, reverse ligation, etc.) and 3'-end modifications (conjugate, DNA nucleotide, reverse ligation, etc.); (b) base modifications such as substitution of base pairs with stable bases, unstable bases, or bases having an extended repertoire of partners, base removal (debasing nucleotide), or conjugated bases; (c) sugar modifications (e.g., at the 2' or 4' position) or sugar substitutions; and (d) main chain modifications including modification or substitution of phosphodiester bonds. Specific examples of RNA compounds that can be used in certain embodiments of the CFB dsRNA agent, CFB antisense polynucleotide, and CFB sense polynucleotide of the present invention include, but are not limited to, RNA having a modified main chain or RNA that does not have natural nucleoside interbonding. As a non-limiting example, RNA having a modified main chain may not have phosphorus atoms in the main chain. RNA that does not have a phosphorus atom in its internucleoside backbone may be called an oligonucleoside. In one embodiment of the present invention, the modified RNA has a phosphorus atom in its internucleoside backbone.
[0126] The terms “RNA molecule” or “RNA” or “ribonucleic acid molecule” should be understood to encompass not only RNA molecules expressed or discovered in nature, but also RNA analogs and derivatives, including one or more ribonucleotide / ribonucleoside analogs or derivatives described herein or known in this art. The terms “ribonucleoside” and “ribonucleotide” are interchangeable herein. RNA molecules can be modified in their nucleic acid base structure or ribose-phosphate backbone structure, for example, as described below, and molecules containing ribonucleoside analogs or derivatives must retain the ability to form double helixes. As a non-limiting example, an RNA molecule may further include at least one modified ribonucleoside, including, but not limited to, 2'-O-methyl-modified nucleosides, nucleosides containing a 5'-phosphorothioate group, terminal nucleosides linked to a cholesterol derivative or a dodecanoic acid bisdecanamide group, locked nucleosides, debased nucleosides, 2'-deoxy-2'-fluoro-modified nucleosides, 2'-amino-modified nucleosides, 2'-alkyl-modified nucleosides, morpholino nucleosides, phosphoramidates, or nucleosides containing non-natural bases, or any combination thereof. In some embodiments of the present invention, the RNA molecule contains at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or up to the full length of a CFB dsRNA drug molecule ribonucleosides, where these ribonucleosides are modified ribonucleosides. The modifications to each of these multiple modified ribonucleosides in the RNA molecule do not need to be the same.
[0127] In some embodiments, the dsRNA agent, CFB antisense polynucleotide, and / or CFB sense polynucleotide of the present invention may comprise one or more independently selected modified nucleotides and / or one or more independently selected nonphosphodiester bonds. In this specification, the term “independently selected” for the selected elements (e.g., modified nucleotides, nonphosphodiester bonds, etc.) means that two or more selected elements may be, but do not need to be, the same as each other.
[0128] As used herein, “nucleotide base,” “nucleotide,” or “nucleic acid base” are heterocyclic pyrimidines or purine compounds that are standard components of all nucleic acids and include adenine, guanine, cytosine, thymine, and uracil, which form nucleotides. Nucleic acid bases may be further modified to include universal bases, hydrophobic bases, promiscuous bases, size-extended bases, and fluorinated bases, but this is not intended to limit them. The terms “ribonucleotide” or “nucleotide” may be used herein to refer to unmodified nucleotides, modified nucleotides, or substituted portions of substitutes. It will be recognized by those skilled in the art that guanine, cytosine, adenine, and uracil may be substituted by other portions without fundamentally altering the base-pairing properties of oligonucleotides containing nucleotides having such substituted portions.
[0129] In one embodiment, the modified RNA intended for use in the methods and compositions described herein is a peptide nucleic acid (PNA) that has the ability to form a desired double-stranded structure and enables or mediates the specific degradation of the target RNA via the RISC pathway. In one embodiment of the present invention, the CFB RNA interferant comprises a single-stranded RNA that interacts with the target CFB RNA sequence to guide the cleavage of the target CFB RNA.
[0130] The modified RNA backbone may include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotryesters, aminoalkyl phosphotryesters, methylphosphonates, and other alkylphosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-aminophosphoramidates and aminoalkylphosphoramidates, thiophosphoramidates, thioalkylphosphonates, thioalkyl phosphotryesters and borate phosphates having normal 3'-5' linkages, their 2'-5' linkage analogs, and those having reverse polarity in which adjacent nucleoside unit pairs are linked from 3'-5' to 5'-3' or from 2'-5' to 5'-2'. It further includes various salts, mixed salts, and free acid forms. Methods for producing phosphorus-containing ligatures are commonly practiced in this field, and such methods can be used to produce the modified CFB dsRNA reagent, the modified CFB antisense polynucleotide, and / or the modified CFB sense polynucleotide of the present invention.
[0131] The phosphorus atom-free modified RNA backbone has a backbone formed by short-chain alkyl or cycloalkyl nucleotide interlinks, mixed heteroatoms and alkyl or cycloalkyl nucleotide interlinks, or one or more short-chain heteroatoms or heterocyclyl nucleotide interlinks. These include backbones having morpholine links (partially formed from the sugar moiety of nucleosides), siloxane backbones, sulfides, sulfoxides and sulfones, formyl and thioformyl backbones, methyleneformyl and thioformyl backbones, olefin-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonates and sulfonamide backbones, amide backbones, and other backbones having a compositional portion that mixes N, O, S and CH2. Methods for producing phosphorus atom-free modified RNA backbones are common in the art, and such methods can be used to produce certain modified CFB dsRNA agents, certain modified CFB antisense polynucleotides, and / or certain modified CFB sense polynucleotides of the present invention.
[0132] In some embodiments of the present invention, the RNA mimetics include CFB dsRNA, CFB antisense polynucleotides, and / or CFB sense polynucleotides, for example, the sugar and internucleotide bonds of nucleotide units, i.e., the main chain, are replaced with new groups. In such embodiments, the base units are maintained for hybridization with appropriate CFB nucleic acid target compounds. Oligomer compounds that are RNA mimetics and have been shown to have excellent hybridization properties are called peptide nucleic acids (PNAs). In PNA compounds, the sugar main chain of RNA is replaced with an amide-containing main chain, particularly an aminoethylglycine main chain. The nucleic acid bases are retained and are directly or indirectly bound to the aza nitrogen atoms of the main chain amide moiety. Methods for producing RNA mimetics are commonly practiced in the art, and such methods can be used to produce certain modified CFB dsRNA agents of the present invention.
[0133] Some embodiments of the present invention include RNA having a phosphorothioate backbone and oligonucleosides having a heteroatom backbone, and in particular -CH2-NH-CH2-, -CH2-N(CH3)-O-CH2- [referred to as the methylene (methylimino) or MMI backbone], -CH2-ON(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2- and -N(CH3)-CH2- [of which the natural phosphodiester backbone is represented by -OPO-CH2-]. Methods for producing RNA having a phosphorothioate backbone and oligonucleosides having a heteroatom backbone are commonly practiced in the art, and such methods can be used to produce certain modified CFB dsRNA reagents, certain CFB antisense polynucleotides and / or certain CFB sense polynucleotides of the present invention.
[0134] The modified RNA may further contain one or more substituted sugar moieties. The CFB dsRNA, CFB antisense polynucleotide and / or CFB sense polynucleotide of the present invention may contain at the 2' position one of OH, F, O-, S- or N-alkyl group, O-, S- or N-alkenyl group, O-, S- or N-alkynyl group, or O-alkyl-O-alkyl group, of which alkyl group, alkenyl group and alkynyl group may be substituted or unsubstituted C1-C 10 Alkyl alkyl group or C2-C 10 The group may be an alkenyl group or an alkynyl group. An exemplary suitable modification is O[(CH2) n O] m CH3, O(CH2) n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2 and O(CH2) n ON[(CH2) n It contains CH3)2, of which n and m are 1 to about 10. In other embodiments, dsRNA has C1-C at the 2' position. 10It comprises one of the following: lower alkyl groups, substituted lower alkyl groups, alkylaryl groups, arylalkyl groups, O-alkylaryl groups or O-aralkyl groups, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl groups, heterocycloalkylaryl groups, aminoalkylamino groups, polyalkylamino groups, substituted silyl groups, RNA cleavage groups, reporter groups, intercalators, groups for improving the pharmacokinetic properties of CFB dsRNA agents, or groups for improving the pharmacokinetic properties of CFB dsRNA agents, CFB antisense polynucleotides and / or CFB sense polynucleotides and other substituents having similar properties. In some embodiments, the modification includes a 2'-methoxyethoxy group (2'-O-CH2CH2OCH3, also called 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), i.e., an alkoxy-alkoxy group. Another exemplary modification is the 2'-dimethylaminoethoxyethoxy group, also called 2'-DMAOE, i.e., the O(CH2)2ON(CH3)2 group, and the 2'-dimethylaminoethoxyethoxy group (also called the 2'-dimethylaminoethoxyethoxy group) (also called 2'-DMAOE), which in this art is also called the 2'-O-dimethylaminoethoxyethyl group or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH2)2. Methods for producing modified RNA, such as those described, are commonly practiced in this art, and such methods can be used to produce a certain modified CFB dsRNA agent of the present invention.
[0135] Other modifications include 2'-methoxy(2'-OCH3), 2'-aminopropoxy(2'-OCH2CH2CH2NH2), and 2'-fluoro(2'-F). Similar modifications may occur at other positions in the RNA of the CFB dsRNA reagent, CFB antisense polynucleotide, and / or CFB sense polynucleotide of the present invention, particularly at the 3' position of the sugar in the 3' terminal nucleotide, or at the 5' position of the CFB dsRNA, CFB antisense polynucleotide, or CFB sense polynucleotide linked from 2' to 5', and the 5' position of the 5' terminal nucleotide. The CFB dsRNA reagent, CFB antisense polynucleotide, and / or CFB sense polynucleotide may have a cyclobutyl group moiety that replaces a sugar mimetic, such as pentofuranose. Methods for producing the modified RNA, e.g., those described, are commonly practiced in the art, and such methods can be used to produce certain modified CFB dsRNA reagents, CFB antisense polynucleotides, and / or CFB sense polynucleotides of the present invention.
[0136] In some embodiments, the CFB dsRNA agent, CFB antisense polynucleotide and / or CFB sense polynucleotide may include modifications or substitutions of nucleic acid bases (usually abbreviated as “bases” in this art). As used herein, “unmodified” or “natural” nucleic acid bases include the purine bases adenine and guanine, and the pyrimidine bases thymine, cytosine and uracil. Modified nucleic acid bases include other synthetic and natural nucleic acid bases, such as 5-methylcytosine (5-Me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, the 6-methyl group and other alkyl derivatives of adenine and guanine, the 2-propyl group and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine This includes 5-uracil (pseudouracil), 4-thiouracil, 8-halogens, 8-amino groups, 8-thiols, 8-thioalkyl groups, 8-hydroxyaldehydes, other 8-substituted adenines and guanines, 5-halogens, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils, cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-azaadenine, and 3-deazaguanine and 3-deazaadenine.Other nucleic acid bases that may be included in certain embodiments of the CFB dsRNA agent of the present invention are known in the art, see, for example, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. Ed. Wiley-VCH, 2008; The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859; Kroschwitz, JL, Ed. John Wiley & Sons, 1990, English et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302; Crooke, STand Lebleu, B., Ed., CRC Press, 1993. Methods for producing dsRNA, CFB antisense strand polynucleotides, and / or CFB sense strand polynucleotides, including nucleic acid base modifications and / or substitutions (e.g., those described herein), are commonly practiced in the art, and such methods can be used to produce certain modified CFB dsRNA reagents, CFB sense polynucleotides, and / or CFB antisense polynucleotides of the present invention.
[0137] One embodiment of the CFB dsRNA agent, CFB antisense polynucleotide, and / or CFB sense polynucleotide of the present invention comprises RNA modified to include one or more locked nucleic acids (LNAs). The locked nucleic acid is a nucleotide having a modified ribose moiety, the modified ribose moiety including an additional crosslink linking the 2' and 4' carbon atoms. The structure effectively "locks" the ribose in the 3'-internal structural conformation. By adding locked nucleic acids to the CFB dsRNA agent, CFB antisense polynucleotide, and / or CFB sense polynucleotide of the present invention, serum stability can be increased and off-target effects can be reduced (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447, Mook, O. R. et al., (2007) Mol Canc Ther 6(3):833-843, Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Methods for producing dsRNA agents containing locked nucleic acids, CFB antisense polynucleotides, and / or CFB sense polynucleotides are commonly practiced in this art, and such methods can be used to produce certain modified CFB dsRNA agents of the present invention.
[0138] A certain embodiment of the CFB dsRNA compound, sense polynucleotide and / or antisense polynucleotide of the present invention comprises at least one modified nucleotide, of which the at least one modified nucleotide is 2'-O-methylnucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2'-3'-seconucleotide mimetic, locked nucleotide, 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholinonucleotide and 3'-OMe nucleotide, nucleotide containing a 5'-phosphorothioate group, nucleotide containing a vinyl phosphonate, adenosine-ethyl The CFB dsRNA compound includes nucleotides containing lenglycol nucleic acid (GNA), nucleotides containing thymidine-ethylene glycol nucleic acid (GNA) S-isomers, nucleotides containing 2'-deoxythymidine-3' phosphate, nucleotides containing 2'-deoxyguanosine-3'-phosphate, nucleotides containing 2'-deoxyadenosine-3'-phosphate, nucleotides containing 2'-deoxycytidine-3'-phosphate, nucleotides containing 2'-deoxyuridine-3'-phosphate, or nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino-modified nucleotides, phosphoramidates, or nucleotides containing non-natural bases. In some embodiments, the CFB dsRNA compound includes an E-vinylphosphonate nucleotide at the 5' end of the antisense strand (also referred to herein as the guide strand).
[0139] In some embodiments of the CFB dsRNA compound of the present invention, the 3' and 5' ends of the sense polynucleotide and / or the 3' end of the antisense polynucleotide include at least one modified nucleotide, of which the at least one modified nucleotide includes a debased nucleotide, a ribitol, an inverted nucleotide, an inverted debased nucleotide, an inverted 2'-OMe nucleotide, and an inverted 2'-deoxynucleotide. It is known to those skilled in the art that stability can be enhanced by including a debased or inverted debased nucleotide at the oligonucleotide terminus (Czauderna et al. Structural variations and stabilizing modifications of synthetic siRNAs in mammalian cells. Nucleic Acids Res. 2003;31(11):2705-2716. doi:10.1093 / nar / gkg393). In some embodiments, the CFB dsRNA compound includes one or more inverted debased residues (invab) at the 3' end or 5' end, or at both the 3' and 5' ends. Exemplary invab residues include, but are not limited to, the following: JPEG2026521916000042.jpg4496 Certain embodiments of the CFB dsRNA compound of the present invention, including the 3' and 5'-terminal sense polynucleotides and / or the 3'-terminal antisense polynucleotide, comprise at least one modified nucleotide, of which the at least one modified nucleotide comprises an isomannitol residue or a stereoisomer of the isomannitol residue. Specific examples of the isomannitol residue or the stereoisomer of the isomannitol residue are: JPEG2026521916000043.jpg200146 This includes, but is not limited to, the terms "Olig" each independently refer to a polynucleotide portion. An example is the isomannose residue (imann), JPEG2026521916000044.jpg3456 This includes, but is not limited to, the following:
[0140] In one embodiment, the isomannoside nucleotide may be further conjugated with one or more target groups or delivery molecules, such as the GalNAc moiety.
[0141] One embodiment of the CFB dsRNA compound, an antisense polynucleotide of the present invention, comprises at least one modified nucleotide, of which at least one modified nucleotide comprises unlocked nucleic acid nucleotide (UNA) and / or ethylene glycol nucleic acid nucleotide (GNA). UNA and GNA are thermally unstable chemical modifications and are known to those skilled in the art to significantly improve the off-target profile of siRNA compounds (Janas et al., Selection of GalNAc-conjugate siRNAs with limit off-target-drivenrat. Nat Commun. 2018, 9(1):723. doi:10.1038 / s41467-018-02989-4; Laurens et al., Enhancement of in vitro and in vivo performance of siRNA using unlocked nucleic acid (UNA). Mol BioSyst. 2010, 6:862-70).
[0142] Another modification that may be included in the RNA of one embodiment of the CFB dsRNA agent, CFB antisense polynucleotide, and / or CFB sense polynucleotide of the present invention includes chemically linking one or more ligands, moieties, or conjugates to the RNA, the ligands, moieties, or conjugates each enhancing one or more characteristics of the CFB dsRNA agent, CFB antisense polynucleotide, and / or CFB sense polynucleotide. Non-limiting examples of characteristics that can be enhanced are the activity, cell distribution, delivery of the CFB dsRNA agent, the pharmacokinetic properties of the CFB dsRNA agent, and the cell uptake of the CFB dsRNA agent. In some embodiments of the present invention, the CFB dsRNA agent includes one or more target groups or binding groups conjugated to the sense strand in one embodiment of the CFB dsRNA agent of the present invention. Non-limiting examples of target groups are compounds containing N-acetyl-galactosamine (GalNAc). The terms “target group,” “targeting agent,” “conjugate,” “target compound,” “delivery molecule,” “delivery compound,” and “target ligand” are interchangeable herein. In some embodiments of the present invention, the CFB dsRNA agent comprises a target compound conjugated to the 5'-terminus of the sense strand. In some embodiments of the present invention, the CFB dsRNA agent comprises a target compound conjugated to the 3'-terminus of the sense strand. In some embodiments of the present invention, the CFB dsRNA agent comprises a target group containing GalNAc. In some embodiments of the present invention, the CFB dsRNA agent does not contain a target compound conjugated to either or both of the 3'-terminus and 5'-terminus of the sense strand. In some embodiments of the present invention, the CFB dsRNA agent does not contain a target compound containing GalNAc conjugated to either or both of the 5'-terminus and 3'-terminus of the sense strand.
[0143] Other targeting agents and binders are well known in this field, and for example, targeting agents and binders usable in certain embodiments of the present invention include lipid moieties such as cholesterol moiety (Letsinger et al., Proc. Natl. Acid. USA, 1989, 86:6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), thioethers such as beryl-S-trityl mercaptan (Manoharan et al., Ann. NYAcad. Sci., 1992, 660:306-309, Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), and a type of thiocholesterol (Oberhauser et al., Nucl. Acids Fatty acids such as Res., 1992, 20:533-538, dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118, Kabanov et al., FEBS Lett., 1990, 259:327-330, Svinarchuk et al., Biochimie, 1993, 75:49-54), dihexadecyl-racemi-glycerol or triethylammonium 1,2-di-O-hexadecyl-racemi-glycerol-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654, Shea et al., Nucl. Acids Phospholipids such as Res., 1990, 18:3777-3783, polyamines or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), palmityl moieties (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or octadecylamine or hexylamino-carbonyloxycholesterol moieties (Crooke et al., J. Pharmacol. Exp.This includes, but is not limited to, those listed in Ther., 1996, 277:923-937.
[0144] Some embodiments of compositions comprising a CFB dsRNA agent, a CFB antisense polynucleotide, and / or a CFB sense polynucleotide may include ligands that alter the distribution, targeting, etc., of the CFB dsRNA agent. In some embodiments of the CFB dsRNA agent compositions of the present invention, the ligands increase affinity to selected targets (e.g., molecules, cells or cell types, compartments, e.g., cell or organ compartments, tissues, organs or body regions) compared to species without such ligands. Ligands usable in the compositions and / or methods of the present invention may be naturally occurring substances such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin), carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid), or lipids. Ligands may be recombinant or synthetic molecules, such as synthetic polymers such as synthetic polyamino acids or polyamines. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-coglycolic acid) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphatidine. Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptide mimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or α-helix peptides.
[0145] Ligands included in the compositions and / or methods of the present invention may include target groups, non-limiting examples of which are cell or tissue targeting agents, such as lectins, glycoproteins, lipids or proteins, such as antibodies that bind to specific cell types (e.g., kidney cells or hepatocytes). Target groups may include thyroid-stimulating hormone, melanocyte-stimulating hormone, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, polyhydric lactose, polyhydric galactose, N-acetylgalactosamine, N-acetyl-glucosamine polyhydric mannose, polyhydric fucose, glycosylated polyamino acids, polyhydric galactose, transferrin, bisphosphonates, polyglutamic acid, polyaspartic acid, lipids, cholesterol, steroids, bile acids, folic acid, vitamin B12, vitamin A, biotin, or RGD peptides or RGD peptide mimics.
[0146] Other examples of ligands include dyes, intercalators (e.g., acridine), crosslinking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texafrin, saffrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic molecules (e.g., cholesterol, cholic acid, adamantane acetate, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propylene glycol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-( The compound contains oleoyl cholenic acid, dimethoxytrityl chloride group or phenoxazine and peptide conjugate (e.g., Antenna peptide, Tat peptide), alkylating agent, phosphate, amino group, mercapto group, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino group, alkyl group, substituted alkyl group, radiolabeled substance, enzyme, hapten (e.g., biotin), transport / absorption enhancer (e.g., aspirin, vitamin E, folic acid), synthetic ribonuclease (e.g., imidazole, bisimidazole, histamine, imidazole cluster, acridine-imidazole conjugate, Eu3+ complex of tetraazamacrocycle), dinitrophenyl group, HRP, or AP.
[0147] The ligands included in the compositions and / or methods of the present invention may be proteins such as glycoproteins, peptides such as molecules having a specific affinity for coligands, or antibodies such as antibodies that bind to specific cell types (e.g., cancer cells, endothelial cells, cardiac cells, or osteocytes). Ligands useful in the embodiments of the compositions and / or methods of the present invention may be hormones or hormone receptors. Ligands useful in the embodiments of the compositions and / or methods of the present invention may be lipids, lectins, carbohydrates, vitamins, cofactors, polyvalent lactose, polyvalent galactose, N-acetylgalactosamine, N-acetyl-glucosamine, polyvalent mannose, or polyvalent fucose. Ligands useful in embodiments of the compositions and / or methods of the present invention may be substances that can increase the entry of CFB dsRNA agents into cells, for example, by disrupting the cytoskeleton of cells, for example, by disrupting microtubules, microfilaments, and / or intermediate filaments of cells. Non-exclusive examples of this type of drug include taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, and myoservin.
[0148] In some embodiments, ligands linked to the CFB dsRNA agent of the present invention are used as pharmacokinetic (PK) modifiers. Examples of PK modifiers usable in the compositions and methods of the present invention include, but are not limited to, lipophilic substances, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEG, vitamins, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, and aptamers that bind to serum proteins. Furthermore, since oligonucleotides containing many phosphorothioate bonds are known to be able to bind to serum proteins, short oligonucleotides containing multiple phosphorothioate bonds in their backbone (e.g., oligonucleotides with about 5 bases, 10 bases, 15 bases, or 20 bases) can also be used as ligands in the compositions and / or methods of the present invention.
[0149] CFB dsRNA formulation In some embodiments of the present invention, the CFB dsRNA agent is present in the composition. The composition of the present invention may include one or more CFB dsRNA agents and one or more selective pharmaceutically acceptable carriers, delivery agents, targeting agents, detectable labels, etc. According to some embodiments of the methods of the present invention, non-limiting examples of targeting agents that may be useful are agents for introducing the CFB dsRNA agent of the present invention into and / or into cells to be treated. The selection of a targeting agent depends on factors such as the nature of the CFB-related disease or pathology and the cell type to be targeted. In non-limiting examples, in some embodiments of the present invention, it may be desirable to introduce the CFB dsRNA agent into and / or into hepatocytes. In some embodiments of the methods of the present invention, the therapeutic agent should be understood to include a CFB dsRNA agent having only a delivery agent without any additional adhesion elements, for example, a delivery agent containing N-acetylgalactosamine (GalNAc). For example, in some embodiments of the present invention, the CFB dsRNA agent can be administered to cells or subjects in a composition containing a delivery compound comprising GalNAc and a pharmaceutically acceptable carrier, without being linked to any detectable label or targeting agent of the CFB dsRNA agent.
[0150] When the CFB dsRNA agent of the present invention is administered together with one or more delivery agents, targeting agents, labeling agents, etc., and / or attached to one or more delivery agents, targeting agents, labeling agents, etc., those skilled in the art will understand and be able to select and use agents suitable for the methods of the present invention. Labeling agents can be used in certain methods of the present invention to locate the CFB dsRNA agent in cells and tissues, and can be used to locate the cells, tissues, or organs of a therapeutic composition containing the CFB dsRNA agent administered in the methods of the present invention. Procedures for linking and using labeling agents (e.g., enzyme labels, dyes, radiolabels, etc.) are well known in the art. In some embodiments of the compositions and methods of the present invention, it should be understood that the labeling agent is attached to one or both of the sense polynucleotides and antisense polynucleotides contained in the CFB dsRNA agent.
[0151] Delivery of CFB dsRNA reagent and CFB antisense polynucleotide reagent One embodiment of the method of the present invention involves delivering a CFB dsRNA agent to cells. As used herein, the term “delivery” means promoting or influencing cellular uptake or absorption. The absorption or uptake of the CFB dsRNA agent may occur by independent diffusion or activation of cellular processes, or by the use of a delivery agent, targeting agent, etc., that can be associated with the CFB dsRNA agent of the present invention. The delivery methods applicable to the method of the present invention include, but are not limited to, intracellular delivery in which the CFB dsRNA agent is administered by injection to a tissue site or systemically. In some embodiments of the present invention, the CFB dsRNA agent is ligated to a delivery agent.
[0152] Non-limiting examples of methods usable for delivering CFB dsRNA agents to cells, tissues and / or subjects include CFB dsRNA-GalNAc conjugates, SAMiRNA technology, LNP-based delivery methods, and naked RNA delivery. These and other delivery methods have already been successfully used in this field for the delivery of therapeutic RNAi agents to treat various diseases and conditions, such as, but are not limited to, liver diseases, acute intermittent porphyria (AIP), hemophilia, and pulmonary fibrosis. Detailed information on various delivery methods can be found in the publications Nikam, RR & KRGore (2018) Nucleic Acid Ther, 28 (4), 209-224 Aug 2018, Springer AD & SFDowdy (2018) Nucleic Acid Ther. Jun 1;28(3):109-118, Lee, K. et al., (2018) Arch Pharm Res, 41(9), 867-874, and Nair, J. K. et al., (2014) J. Am. Chem. Soc. 136:16958-16961, the contents of which are incorporated herein by reference.
[0153] Some embodiments of the present invention involve delivering the CFB dsRNA agent of the present invention to cells, tissues and / or subjects using lipid nanoparticles (LNPs). LNPs are typically used for the intracellular delivery of CFB dsRNA agents, including therapeutic CFB dsRNA agents. One advantage of using LNPs or other delivery agents is that the stability of the CFB RNA agent is increased when it is delivered to a subject using LNPs or other delivery agents. In some embodiments of the present invention, the LNPs include cationic LNPs on which one or more CFB RNAi molecules of the present invention are supported. LNPs containing CFB RNAi molecules are administered to a subject, and the LNPs and the CFB RNAi molecules attached to them are absorbed by cells by endocytosis, and their presence mediates RNAi by resulting in the release of RNAi trigger molecules.
[0154] In embodiments of the present invention, another non-limiting example of a delivery agent usable for delivering the CFB dsRNA agent of the present invention to cells, tissues and / or subjects is a reagent containing GalNAc, wherein the GalNAc is attached to the CFB dsRNA agent of the present invention and delivers the CFB dsRNA reagent to cells, tissues and / or subjects. Another example of a GalNAc-containing delivery agent usable in certain embodiments of the methods and compositions of the present invention is disclosed in PCT application:WO2020191183A1 (the entire contents thereof are incorporated herein). A non-limiting example of a GalNAc target ligand usable in the compositions and methods of the present invention for delivering the CFB dsRNA agent to cells is a target ligand cluster. Examples of target ligand clusters proposed herein are referred to as phosphodiester-linked (GLO) GalNAc ligands and phosphorothioate-linked (GLS) GalNAc ligands. In this specification, the term "GLX-n" refers to the linked GalNAc-containing compound, which is GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GL This can be used to indicate that the compound is one of the following compounds: O-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16. The structures of each of these compounds are as follows, and the linkage position between the GalNAc target ligand and the RNAi agent of the present invention is the rightmost position in each of these compounds. [ka] Any RNAi and dsRNA molecules of the present invention should be understood to be able to attach to GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-1'4, GLO-15 and GLO-16. The structures of GLO-1 to GLO-16 and GLS-1* to GLS-16* are as follows.
[0155] [[ID=…]]
Table 6-1
Table 6-2
Table 6-3
Table 6-4
[0156] In certain embodiments, the above isomannoside nucleotides may be further conjugated to one or more GalNAc target ligands. Specific examples of isomannose nucleotides conjugated to GalNAc target ligands are [[ID=…]] JPEG2026521916000050.jpg53120 including, but not limited to, wherein the phrase "olig" independently indicates a polynucleotide moiety in each case.
[0157] Note: Some of the IDs in the original text are numbered with ellipsis in the translation because the original numbering seems to be incomplete or incorrect in the provided text. If there are specific rules or corrections for these IDs, the translation should be adjusted accordingly. Also, the "JPEG2026521916000050.jpg53120" seems to be an image-related identifier which is kept as it is without further translation as it might not be a text that requires translation in a traditional sense.In some embodiments of the present invention, intracellular delivery may be carried out by a β-dextran delivery system, such as that described in U.S. Patent No. 5,100,000. U.S. Patents No. 5,032,401 and No. 5,607,677 and U.S. Disclosure No. 2005 / 0281781 are incorporated herein by reference in their entirety. Alternatively, CFB RNAi agents may be introduced extracellularly into cells by methods known in the art, such as electroporation and lipofection. In some embodiments of the methods of the present invention, CFB dsRNA is delivered without a targeting agent. These RNAs can be delivered as "naked" RNA molecules. In non-limiting examples, the CFB dsRNA of the present invention may be administered to a subject in the form of a pharmaceutical composition containing an RNAi agent but without a targeting agent (e.g., a GalNAc target compound) to treat a CFB-related disease or condition in the subject, such as cardiovascular disease. The targeting agent is, for example, a GalNAc target compound.
[0158] In addition to certain delivery methods described herein, RNAi delivery methods, including but not limited to those described herein and those used in the art, can be used in combination with embodiments of CFB RNAi agents and therapeutic methods described herein.
[0159] The CFB dsRNA reagents of the present invention can be administered to a subject in an amount and manner that effectively reduces the level and activity of CFB polypeptides in cells and / or the subject. In some embodiments of the methods of the present invention, one or more CFB dsRNA reagents are administered to cells and / or the subject to treat a disease or condition related to CFB expression and activity. In some embodiments, the methods of the present invention include reducing a disease or condition related to CFB expression in the subject's body by administering one or more CFB dsRNA reagents to a subject requiring such treatment. The CFB dsRNA reagents or CFB antisense polynucleotide reagents of the present invention can be administered to reduce CFB expression and / or activity in one or more of the following: in vitro, ex vivo, and in vivo cells.
[0160] In some embodiments of the present invention, CFB dsRNA agents or CFB antisense polynucleotide agents are delivered (e.g., introduced) to cells to reduce the level of CFB polypeptides in the cells and thereby reduce their activity. Targeting agents and methods can be used to help deliver CFB dsRNA agents or CFB antisense polynucleotide agents to specific cell types, cell subtypes, organs, spatial regions and / or intracellular subcellular regions in a subject. CFB dsRNA agents can be administered alone in some methods of the present invention or in combination with one or more other CFB dsRNA agents. In some embodiments, two, three, four or more independently selected CFB dsRNA agents are administered to the subject.
[0161] In one embodiment of the present invention, a CFB dsRNA agent is administered to a subject in combination with one or more other therapeutic schemes for treating a CFB-related disease or condition. Non-limiting examples of other therapeutic schemes include administration of one or more CFB antisense polynucleotides of the present invention, administration of non-CFB dsRNA therapeutic agents, and behavioral modification. Additional therapeutic schemes may be administered at one or more time points before, during, and after administration of the CFB dsRNA agent of the present invention. As used herein, “time zero” should be understood to be the time when the CFB dsRNA agent of the present invention is administered to the subject, such as within 5 minutes of time zero, within 10 minutes of time zero, within 30 minutes of time zero, within 45 minutes of time zero, and within 60 minutes of time zero. Non-CFB dsRNA therapeutic agents include non-limiting examples such as C5 inhibitors, e.g., anti-complement component C5 antibodies or their antigen-binding fragments (e.g., eculizumab, ravulizumab-cwvz, or pozelimusb (REGN3918)), or C5 inhibitor peptide inhibitors (e.g., zilucoplan). Eculizumab is a humanized monoclonal IgG2 / 4, kappa light chain antibody that specifically binds to complement component C5 with high affinity and inhibits the formation of terminal complement complex C5b-9 by inhibiting the cleavage of C5 to C5a and C5b. Ravulizumab-cwvz is a humanized IgG2 / 4 monoclonal antibody that specifically binds to complement component C5 with high affinity and inhibits the formation of terminal complement complex C5b-9 by inhibiting the cleavage of C5 to C5a and C5b. Pozelimab (also known as H4H12166P and described in US20170355757) is a fully human IgG4 monoclonal antibody for blocking complement factor C5. Zilucoplan is a synthetic macrocyclic peptide that binds to complement component 5 (C5) with sub-nanomolecular affinity and allosterically inhibits its cleavage to C5a and C5b after activation of the classical, alternative, or lectin pathway. Preferably, another therapeutic agent is a C3 peptide inhibitor or an analogue thereof. In one embodiment, the C3 peptide inhibitor is compstatin. Compstatin is a cyclic tridecapeptide with effective and selective C3 inhibitory activity.These and other therapeutic agents and behavioral modalities are known in the art and have been used to treat CFB-related diseases or conditions in subjects, and can be administered to subjects in combination with the administration of one or more CFB dsRNA agents of the present invention to treat CFB-related diseases or conditions. The CFB dsRNA agents of the present invention, administered to cells or subjects to treat CFB-related diseases or conditions, can function synergistically with one or more other therapeutic agents or activities, and can increase the efficacy of the said one or more therapeutic agents or activities, and / or increase the efficacy of treating CFB-related diseases or conditions with the CFB dsRNA agents.
[0162] The therapeutic method of the present invention comprises the administration of a CFB dsRNA agent and can be used before the onset of a CFB-related disease or disorder and / or during the presence of a CFB-related disease or disorder, including the early, middle, and late stages of the disease or disorder, and all time before and after these stages. The method of the present invention can also be used to treat subjects who have already been treated for a CFB-related disease or disorder with one or more other therapeutic agents and / or therapeutic activities, in which the treatment of the subject's CFB-related disease or disorder has been unsuccessful, had a very low success rate and / or ceased to be successful.
[0163] dsRNA encoded by a vector In one embodiment of the present invention, a CFB dsRNA agent can be delivered to cells using a vector. The transcription units of the CFB dsRNA reagent may be contained in a DNA or RNA vector. The manufacture and use of such vectors encoding transgenes for delivering sequences to cells and / or subjects is well known in the art. The vector can be used in the method of the present invention, which induces transient expression of CFB dsRNA for, for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 hours or longer, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 weeks or longer. The length of transient expression can be determined by a conventional method based on elements, which are, for example, a selected specific vector construct and target cells and / or tissues, but are not limited to these. Such transgenes can be introduced as a linear construct, a circular plasmid or a viral vector, and may be integrated or unintegrated vectors. Transgenes can also be constructed to be inherited as extrachromosomal plasmids (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).
[0164] One or more strands of a CFB dsRNA agent can be transcribed from a promoter on an expression vector. For example, if two individual strands are to be expressed to produce dsRNA, two individual expression vectors can be co-introduced into cells using methods such as transfection or infection. In one embodiment, each individual strand of the CFB dsRNA agent of the present invention can be transcribed by a promoter contained in the same expression vector. In one embodiment of the present invention, the CFB dsRNA agent is expressed as a reverse repeat polynucleotide linked by a linker polynucleotide sequence such that the CFB dsRNA agent has a stem and loop structure.
[0165] Non-limiting examples of RNA expression vectors include DNA plasmids or viral vectors. Expression vectors useful in the embodiments of the present invention may also be compatible with eukaryotic cells. Eukaryotic cell expression vectors are commonly used in this field and are available from many commercial sources. Delivery of the CFB dsRNA expression vector may be systemic, for example, by intravenous or intramuscular administration to target cells extruded from the subject and then introduced into the subject's body, or by any other method that enables introduction into the desired target cells.
[0166] The viral vector systems included in embodiments of the method include, but are not limited to, (a) adenovirus vectors, (b) retroviral vectors including, but not limited to, lentivirus vectors, Moloney's mouse leukemia virus, (c) adeno-associated virus vectors, (d) herpes simplex virus vectors, (e) SV 40 vectors, (f) polyomavirus vectors, (g) papillomavirus vectors, (h) picornavirus vectors, (i) poxvirus vectors, such as orthopoxvirus vectors, or avianpox virus vectors such as canarypox virus vectors and fowlpox virus vectors, and (j) helper-dependent or enteric-free adenovirus vectors. Constructs for recombinant expression of CFB dsRNA agents may include regulatory elements, such as promoters and enhancers, which can be selected to provide constitutive or regulated / induced expression. The use of viral vector systems, promoters and enhancers, etc., is common in the art and can be used in combination with the methods and compositions described herein.
[0167] One embodiment of the present invention involves delivering a CFB dsRNA reagent to cells using a viral vector. Many adenovirus-based delivery systems are commonly used in this field for delivery to, for example, the lungs, liver, central nervous system, endothelial cells, and muscles. Non-limiting examples of viral vectors that can be used in the methods of the present invention include AAV vectors, poxviruses such as vaccinia virus, modified Ankara virus (MVA), NYVAC, and avianpox such as fowlpox and canarypox.
[0168] One embodiment of the present invention includes a method for delivering a CFB dsRNA reagent to cells using a vector, wherein such a vector may be located on a pharmaceutically acceptable carrier, which may, but does not, include a sustained-release matrix in which a gene delivery vector is embedded. In some embodiments, the vector for delivering CFB dsRNA can be produced by recombinant cells, and the pharmaceutical composition of the present invention may include one or more types of cells that produce a CFB dsRNA delivery system.
[0169] Pharmaceutical composition containing CFB dsRNA or ssRNA agent One embodiment of the present invention involves the use of a pharmaceutical composition containing a CFB dsRNA agent or a CFB antisense polynucleotide agent and a pharmaceutically acceptable carrier. The pharmaceutical composition containing the CFB dsRNA agent or CFB antisense polynucleotide agent can be used in the method of the present invention to reduce CFB gene expression and CFB activity in cells, and can be used to treat CFB-related diseases or conditions. Such pharmaceutical compositions can be prepared by a delivery method. Non-limiting examples of formulations for delivery methods include compositions prepared for subcutaneous delivery, compositions prepared for systemic delivery by parenteral delivery, compositions prepared for intravenous (IV) delivery, compositions prepared for intrathecal delivery, and compositions prepared for direct delivery into the brain. The pharmaceutical composition of the present invention can be administered to deliver a CFB dsRNA agent or a CFB antisense polynucleotide agent to cells in one or more ways, for example, by topical administration (e.g., by a transdermal patch), intrapulmonary administration including by inhalation or blowing of a powder or aerosol, including by a sprayer, intra-airway, intranasal, epidermal and transdermal, oral or parenteral administration. Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal or intramuscular injection or infusion, subcutaneous administration including by an implantation device, or intracranial administration including intracerebral, intrathecal or intraventricular administration. The CFB dsRNA agent or CFB antisense polynucleotide agent can also be delivered directly to target tissues, such as by direct delivery to the liver or direct delivery to the kidneys. The terms "delivering CFB dsRNA agents" or "delivering CFB antisense polynucleotide agents" to cells should be understood to include, respectively, the direct delivery of CFB dsRNA agents or CFB antisense polynucleotide agents, and the expression of CFB dsRNA agents in cells from a coding vector delivered to the cells, or the presence of CFB dsRNA or CFB antisense polynucleotide agents in cells in any appropriate manner. The manufacture and use of formulations, as well as the methods for delivering inhibitory RNA, are well known and commonly used in this field.
[0170] As used herein, a "pharmaceutical composition" comprises a pharmacologically effective amount of a CFB dsRNA agent or a CFB antisense polynucleotide agent of the present invention and a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable carrier" refers to a carrier for administering a therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, glucose, water, glycerol, ethanol, and combinations thereof. The term specifically excludes cell culture media. In the case of a drug administered orally, the pharmaceutically acceptable carrier includes, but is not limited to, pharmaceutically acceptable excipients such as inert diluents, disintegrants, binders, lubricants, sweeteners, flavoring agents, coloring agents, and preservatives. Suitable inert diluents include sodium carbonate and calcium carbonate, sodium phosphate and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrants. Binders may include starch and gelatin, while lubricants (if present) are typically magnesium stearate, stearic acid, or talc. If desired, tablets can be coated with materials such as glyceryl monostearate or glyceryl distearate to delay absorption in the gastrointestinal tract. The agents contained in the pharmaceutical preparation are further described below.
[0171] Terms such as "pharmacologically effective amount", "therapeutically effective amount", and "effective amount" as used herein refer to the amount of a CFB dsRNA agent or a CFB antisense polynucleotide agent of the present invention that produces a desired pharmacological, therapeutic, or prophylactic result. For example, if a measurable parameter associated with a disease or medical condition is reduced by at least 10% and a given clinical treatment is considered effective, the therapeutically effective amount of a drug for treating the disease or medical condition is the amount necessary to reduce the parameter by at least 10%. For example, a therapeutically effective amount of a CFB dsRNA agent or a CFB antisense polynucleotide agent can reduce the CFB polypeptide level by at least 10%.
[0172] Effective amount In one embodiment, the method of the present invention involves contacting cells with an effective amount of a CFB dsRNA agent or a CFB antisense polynucleotide agent to reduce CFB gene expression in the cells to be contacted. One embodiment of the method of the present invention involves administering an effective amount of a CFB dsRNA agent or a CFB antisense polynucleotide agent to a subject in order to reduce CFB gene expression and to treat a CFB-related disease or condition in the subject. The “effective amount” for reducing CFB expression and / or treating a CFB-related disease or condition is the amount necessary or sufficient to achieve the desired biological effect. For example, the effective amount of a CFB dsRNA agent or a CFB antisense polynucleotide agent to treat a CFB-related disease or condition may be the amount necessary to (i) alleviate or halt the progression of the disease or condition, or (ii) reverse, reduce or eliminate one or more symptoms of the disease or condition. In some embodiments of the present invention, the effective dose is the amount of the CFB dsRNA agent or CFB antisense polynucleotide agent administered to a subject requiring treatment for a CFB-related disease or condition that produces a therapeutic response preventing and / or treating the disease or condition. According to some aspects of the present invention, the effective dose is the amount of the CFB dsRNA agent or CFB antisense polynucleotide agent of the present invention administered to a subject in combination with or co-administered with another treatment method for a CFB-related disease or condition that produces a therapeutic response preventing and / or treating the disease or condition. In some embodiments of the present invention, the biological effect of treating a subject with the CFB dsRNA agent or CFB antisense polynucleotide agent of the present invention may be improvement and / or complete elimination of symptoms caused by a CFB-related disease or condition. In some embodiments of the present invention, the biological effect is the complete elimination of a CFB-related disease or condition, for example, by a diagnostic test showing that the subject is free from a CFB-related disease or condition. Non-limiting examples of detectable physiological symptoms include a reduction in CFB levels in the liver of a subject after administration of the agent of the present invention. The effects of the agents and / or methods of the present invention on CFB-related diseases or conditions can be determined by other methods known in the art for evaluating the state of CFB-related diseases or conditions.
[0173] Typically, in clinical trials, the effective dose of a CFB dsRNA agent or CFB antisense polynucleotide agent that reduces CFB polypeptide activity to a level that treats CFB-related diseases or conditions is determined, and in blinded studies, the effective dose of the test population relative to the control population is established. In some embodiments, the effective dose is the amount that produces the desired response, for example, the amount that reduces CFB-related diseases or conditions in cells, tissues, and / or subjects suffering from the disease or condition. Therefore, the effective dose of a CFB dsRNA agent or CFB antisense polynucleotide agent that treats CFB-related diseases or conditions treatable by reducing CFB polypeptide activity may be the amount that, when administered, reduces the amount of CFB polypeptide activity in the subject to less than the amount present in cells, tissues, and / or the subject when the CFB dsRNA agent or CFB antisense polynucleotide agent is not administered. In one embodiment of the present invention, the level of CFB polypeptide activity and / or CFB gene expression present in cells, tissues, and / or subjects that have not been exposed to or administered the CFB dsRNA agent or CFB antisense polynucleotide agent of the present invention is referred to as the “control” level. In some embodiments of the method of the present invention, the control level of the subject is the pre-treatment level of the subject, in other words, the level in the subject before administration of the CFB agent may be the control level of the subject and is compared with the level of CFB polypeptide activity and / or CFB gene expression in the subject after administration of the siRNA to the subject. When treating CFB-related diseases or conditions, the desired response may be a reduction or elimination of one or more symptoms of the disease or condition in the cells, tissues, and / or subjects. The reduction or elimination may be temporary or permanent. It should be understood that the state of CFB-related diseases or conditions can be monitored using methods such as determining CFB polypeptide activity, CFB gene expression, symptom assessment, and clinical trials. In some embodiments of the present invention, the desired response to treatment is the "delay" of CFB-related disease or condition, or even the prevention of the onset of said disease or condition.
[0174] Furthermore, by evaluating the physiological effects on cells or subjects upon administration of CFB dsRNA agents or CFB antisense polynucleotide agents (e.g., reduction in CFB-related diseases or symptoms after administration), the effective amount of a compound that reduces CFB polypeptide activity can be determined. The efficacy of the CFB dsRNA agent or CFB antisense polynucleotide agent of the present invention (which may be administered in the form of the drug compound of the present invention) can be determined by measuring and / or monitoring the symptoms of the subject, and the presence or absence of a response to the treatment can be determined. Non-limiting examples include one or more tests known in the art for CH50 activity (a criterion for measuring total hemolytic complement), AH50 (a criterion for measuring complement alternative pathway hemolytic activity), lactate dehydrogenase (LDH) (a criterion for measuring intravascular hemolysis), hemoglobin levels, and one or more levels of C3, C9, C5, C5a, C5b, and soluble C5b-9 complexes. As another non-limiting example, the state of CFB-related lipid imbalance in a subject can be determined by one or more liver function tests known in the art before and after treatment with the CFB dsRNA agent of the present invention.
[0175] Some embodiments of the present invention include a method for determining the efficacy of a dsRNA agent or CFB antisense polynucleotide agent of the present invention administered to a subject, the method for treating a CFB-related disease or disorder by evaluating and / or monitoring one or more "physiological features" of the subject's CFB-related disease or disorder. Non-limiting examples of physiological features of a CFB-related disease or disorder include CFB mRNA levels, CFB protein levels or CH50 activity (a criterion for total hemolytic complement), AH50 (a criterion for hemolytic activity of the complement alternative pathway), lactate dehydrogenase (LDH) (a criterion for intravascular hemolysis), hemoglobin levels, and levels of one or more C3, C9, C5, C5a, C5b and soluble C5b-9 complexes. Standard methods for determining such physiological features are known in the art and include, but are not limited to, blood tests, imaging studies, and health checkups.
[0176] It should be understood that the amount of CFB dsRNA or CFB antisense polynucleotide administered to a subject can be modified, at least in part, based on the determination of the subject's disease and / or condition and / or physiological characteristics. The therapeutic dose can be modified, for example, by increasing or decreasing the amount of CFB-dsRNA or CFB antisense polynucleotide, by changing the composition in which the CFB dsRNA or CFB antisense polynucleotide is administered, by changing the route of administration, or by changing the timing of administration. The effective dose of CFB dsRNA or CFB antisense polynucleotide is modified by the specific disease being treated, the age and physical condition of the subject being treated, the severity of the disease, the duration of treatment, the nature of concurrent treatment (if any), the specific route of administration, and other factors within the knowledge and expertise of the healthcare professional. For example, the effective dose may depend on the level of CFB polypeptide activity and / or CFB gene expression required to effectively treat CFB-related diseases or conditions. Those skilled in the art can empirically determine the effective amount of a particular CFB dsRNA agent or CFB antisense polynucleotide agent used in the method of the present invention without performing excessive experiments. In accordance with the teachings provided herein, an effective preventive or therapeutic scheme can be planned to effectively treat a specific subject by selecting from the various CFB dsRNA agents or CFB antisense polynucleotide agents of the present invention and making trade-offs of factors such as potency, relative bioavailability, patient weight, severity of adverse side effects, and preferred administration method. As used in the examples of the present invention, the effective amount of the CFB dsRNA agent or CFB antisense polynucleotide agent of the present invention may be the amount that, upon contact with the cell, produces the desired biological effect on the cell.
[0177] It should be recognized that CFB gene silencing can be determined constitutively or by genomic engineering and by any appropriate measurement in any cell expressing CFB. In some embodiments of the present invention, administration of the CFB dsRNA agent of the present invention reduces CFB gene expression by at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%. In some embodiments of the present invention, administration of the CFB dsRNA agent of the present invention reduces CFB gene expression between 5% and 10%, 5% and 25%, 10% and 50%, 10% and 75%, 25% and 75%, 25% and 100%, or between 50% and 100%.
[0178] dose CFB dsRNA agents and CFB antisense polynucleotide agents are delivered in a pharmaceutical composition at a dose sufficient to inhibit CFB gene expression. In one embodiment of the present invention, the dose of the CFB dsRNA agent or CFB antisense polynucleotide agent is in the range of 0.01 to 200.0 mg per kg of body weight of the recipient per day, and is typically in the range of 1 to 50 mg / kg body weight, 5 to 40 mg / kg body weight, 10 to 30 mg / kg body weight, 1 to 20 mg / kg body weight, 1 to 10 mg / kg body weight, and 4 to 15 mg / kg body weight per day (including the extreme values). For example, the above CFB dsRNA agents or CFB antisense polynucleotide agents can be administered in the following single doses / body weight amounts: approximately 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1.7 mg mg / kg, 1.8mg / kg, 1.9mg / kg, 2mg / kg, 2.1mg / kg, 2.2mg / kg, 2.3mg / kg, 2.4mg / kg, 2.5mg / kg, 2.6mg / kg, 2.7mg / kg, 2.8mg / kg, 2.9mg / kg, 3.0mg / kg, 3.1mg / kg, 3.2mg / kg, 3.3mg / kg, 3.4mg / kg, 3.5mg / kg, 3.6mg / kg, 3.7mg / k g, 3.8mg / kg, 3.9mg / kg, 4mg / kg, 4.1mg / kg, 4.2mg / kg, 4.3mg / kg, 4.4mg / kg, 4.5mg / kg, 4.6mg / kg, 4.7mg / kg, 4 .8mg / kg, 4.9mg / kg, 5mg / kg, 5.1mg / kg, 5.2mg / kg, 5.3mg / kg, 5.4mg / kg, 5.5mg / kg, 5.6mg / kg, 5.7mg / kg, 5.8m g / kg, 5.9mg / kg, 6mg / kg, 6.1mg / kg, 6.2mg / kg, 6.3mg / kg, 6.4mg / kg, 6.5mg / kg, 6.6mg / kg, 6.7mg / kg, 6.8mg / k g, 6.9mg / kg, 7mg / kg, 7.1mg / kg, 7.2mg / kg, 7.3mg / kg, 7.4mg / kg, 7.5mg / kg, 7.6mg / kg, 7.7mg / kg, 7.8mg / kg, 7.9mg / kg, 8mg / kg, 8.1mg / kg, 8.2mg / kg, 8.3mg / kg, 8.4mg / kg, 8.5mg / kg, 8.6mg / kg, 8.7mg / kg, 8.8mg / kg, 8.9mg / kg, 9mg / kg, 9.1mg / kg, 9.2mg / kg, 9.3mg / k g, 9.4mg / kg, 9.5mg / kg, 9.6mg / kg, 9.7mg / kg, 9.8mg / kg, 9.9mg / kg, 10mg / kg, 11mg / kg, 12mg / kg, 13mg / kg, 14mg / kg, 15mg / kg, 16mg / kg, 17mg / kg, 18mg / kg, 19mg / kg, 20mg / kg, 21mg / kg, 22mg / kg, 23mg / kg, 24mg / kg, 25mg / kg, 26mg / kg, 27mg / kg, 28mg / kg, 29mg / kg, 30mg / kg, 31mg / kg, 32mg / kg, 33mg / kg, 34mg / kg, 35mg / kg, 36mg / kg, 37mg / kg, 38mg / kg, 39mg / kg, 40mg / kg, 41mg / kg, 42mg / kg, 43mg / kg, 44mg / kg, 45mg / kg, 46mg / kg, 47mg / kg, 48mg / kg, 49mg / kg~50mg / kg. .
[0179] When determining the dose and administration time of the CFB dsRNA agent of the present invention, various factors can be considered. The absolute amount of the CFB dsRNA agent or CFB antisense polynucleotide agent administered depends on various factors, including concurrent treatment, number of doses, and parameters of the individual subject, including age, physical condition, body type, and weight. These factors are well known to those skilled in the art and can be resolved by conventional experiments alone. In some embodiments, the maximum dose, i.e., the safest dose based on reasonable medical judgment, can be used.
[0180] In some embodiments, the method of the present invention may involve administering to a subject one, two, three, four, five, six, seven, eight, nine, ten or more doses of a CFB dsRNA agent or a CFB antisense polynucleotide agent. In some cases, the drug compound (e.g., including a CFB dsRNA agent or a CFB antisense polynucleotide agent) may be administered to the subject at least daily, every other day, weekly, bi-weekly, monthly, etc. The dose may be administered once or multiple times a day, for example, two, three, four, five or more times within a single 24-hour period. The pharmaceutical composition of the present invention may be administered once daily, or the CFB dsRNA agent or CFB antisense polynucleotide agent may be administered in two, three or more subdoses at appropriate intervals throughout the day, or further administered by continuous infusion or sustained-release formulation delivery. In some embodiments of the method of the present invention, the pharmaceutical composition of the present invention is administered to a subject once or more times a day, once or more times a week, once or more times a month, or once or more times a year.
[0181] In some embodiments, the methods of the present invention include the administration of a drug compound alone, in combination with one or more other CFB dsRNA agents or CFB antisense polynucleotide agents, and / or in combination with other drug therapies or therapeutic activities or schemes administered to subjects suffering from CFB-related diseases or conditions. The drug compound may be administered in the form of a pharmaceutical composition. The pharmaceutical composition used in the methods of the present invention may be sterile and contain a certain amount of the CFB dsRNA agent or CFB antisense polynucleotide agent, the amount of which is sufficient to reduce the activity of the CFB polypeptide to a level sufficient to produce a desired response in a weight or volume unit suitable for administration to a subject. The dose of the pharmaceutical composition containing the CFB dsRNA agent or CFB antisense polynucleotide agent administered to a subject to reduce CFB protein activity can be selected according to different parameters, in particular, the method of administration used and the condition of the subject. Other factors include the desired duration of treatment. If the subject's response to the initial dose is insufficient, a higher dose can be employed within the patient's tolerance range (or the dose can be effectively increased by a different, more localized delivery route).
[0182] treatment As used herein, “CFB-related diseases,” “CFB-related diseases and conditions,” and “diseases and conditions caused and / or regulated by CFB” are intended to include any disease related to the CFB gene or protein. These diseases may be caused by excessive production of the CFB protein, mutations in the CFB gene, abnormal cleavage of the CFB protein, or abnormal interactions between CFB and other proteins or other endogenous or exogenous substances. Exemplary CFB-related diseases include autoimmune diseases, complement system dysfunction (including abnormal upregulation of complement components such as CFB), C3 glomerulopathy (C3G), systemic lupus erythematosus (SLE), lupus nephritis, Ig-mediated renal lesions (e.g., IgA nephropathy and primary membranous nephropathy), nephropathy, diabetic nephropathy, polycystic kidney disease, membranous nephropathy, age-related macular degeneration (AMD) including dry AMD and geographic atrophy, typical or infectious hemolytic uremic syndrome (tHUS), atypical hemolytic uremic syndrome (aHUS), asthma, psoriasis, thrombotic microangiopathy, ischemia and reperfusion injury, paroxysmal nocturnal hemoglobinuria (PNH), rheumatoid arthritis, rheumatoid arthritis, multiple sclerosis (MS), neuromyelitis optica (NMO), immune complex-mediated glomerulonephritis (IC-mediated GN), and infectious This includes, but is not limited to, post-staining glomerulonephritis (PIGN), antineutrophil cytoplasmic autoantibody-associated vasculitis (ANCA-AV), antiphospholipid syndrome (APS), periodontal disease with bacterial flora abnormalities, malaria anemia, bullous dermatomyositis pemphigoid, Shiga toxin Escherichia coli-associated hemolytic uremic syndrome, myasthenia gravis (MG), neuromyelitis optica (NMO), dense deposit disease, coronary artery disease, dermatomyositis, Graves' disease, atherosclerosis, Alzheimer's disease, systemic inflammatory response sepsis, septic shock, spinal cord injury, glomerulonephritis, Hashimoto's thyroiditis, type 1 diabetes, psoriasis, pemphigus, autoimmune hemolytic anemia (AIHA), cold agglutinin disease, fluid and vascular graft rejection, graft dysfunction, myocardial infarction, graft sensitization, hyperlipidemia, sepsis, or CFB-associated lipid imbalance.
[0183] In one embodiment of the present invention, a subject may be administered the CFB dsRNA agent or CFB antisense polynucleotide agent of the present invention at one or more time points before or after the diagnosis of a CFB-related disease or condition. In some embodiments of the present invention, a subject has or is at risk of developing a CFB-related disease or condition. A subject at risk of developing a CFB-related disease or condition is a subject whose likelihood of developing a CFB-related disease or condition is increased compared to a control risk of developing a CFB-related disease or condition. In some embodiments of the present invention, the risk level may be statistically significant compared to the control level of risk. Subjects at risk may include, for example, subjects with pre-existing diseases and / or genetic abnormalities who are more susceptible to CFB-related diseases or conditions than a control subject without pre-existing diseases or genetic abnormalities, subjects with a family history and / or personal history of CFB-related diseases or conditions, and subjects who have previously received or will receive treatment for a CFB-related disease or condition. It should be understood that pre-existing diseases and / or genetic abnormalities that make a subject more sensitive to CFB-related diseases or conditions may be diseases or genetic abnormalities that have been previously identified as being associated with a higher likelihood of having CFB-related diseases or conditions when they are present.
[0184] It should be understood that a subject may be administered a CFB dsRNA agent or a CFB antisense polynucleotide agent based on the medical condition of the individual subject. For example, the healthcare provider to the subject can evaluate the CFB level measured from a sample obtained from the subject and determine the subject's CFB level to be reduced by administering the CFB dsRNA agent or CFB antisense polynucleotide agent of the present invention. In this example, even if the subject is not diagnosed with a CFB-related disease (e.g., a disease disclosed herein), the CFB level can be considered a physiological characteristic of a CFB-related disease. The healthcare provider can monitor changes in the subject's CFB level as a criterion for measuring the effectiveness of the CFB dsRNA agent or CFB antisense polynucleotide agent of the present invention. In non-limiting examples, a biological sample (e.g., blood or serum sample) can be obtained from the subject, and the subject's CFB level can be determined in the sample. A CFB dsRNA agent or a CFB antisense polynucleotide agent is administered to the subject, and a blood sample is taken from the subject after administration. The CFB level is determined using this sample, and the result is compared to the result determined from a sample taken before administration to the subject. A reduction in the CFB level in the subject's later sample compared to the pre-administration level indicates that the administered CFB dsRNA agent or CFB antisense polynucleotide agent is effective in reducing the subject's lipid levels.
[0185] One embodiment of the method of the present invention includes a modulated treatment, which involves administering the subject a dsRNA agent or CFB antisense polynucleotide agent of the present invention, at least in part on an evaluation of changes in one or more physiological characteristics of a CFB-related disease or condition in the subject as a result of the treatment. For example, in some embodiments of the present invention, it can be used to determine the effect of the administered dsRNA agent or CFB antisense polynucleotide agent of the present invention and to assist in adjusting the amount of the dsRNA agent or CFB antisense polynucleotide agent of the present invention administered to the subject thereafter. In a non-limiting example, the subject is administered a dsRNA agent or CFB antisense polynucleotide agent of the present invention, the subject's CFB level is measured after administration, and at least in part on the measured level, it is determined that a relatively high amount of the dsRNA agent or CFB antisense polynucleotide agent is desirable to improve the physiological effect of the administered reagent, for example, to reduce or further reduce the subject's CFB level. In further, non-limiting examples, it is desirable that a subject be administered the dsRNA agent or CFB antisense polynucleotide agent of the present invention, the subject's CFB level be measured after administration, and that a relatively low amount of the dsRNA agent or CFB antisense polynucleotide reagent be administered to the subject, at least in part based on the measured level.
[0186] Accordingly, some embodiments of the present invention include evaluating changes in one or more physiological characteristics caused by the subject's prior treatment in order to adjust the amount of the dsRNA agent or CFB antisense polynucleotide agent of the present invention administered to the subject. Some embodiments of the method of the present invention include measuring physiological characteristics of a CFB-related disease or condition one, two, three, four, five, six or more times in order to evaluate and / or monitor the efficacy of the administered CFB dsRNA agent or CFB antisense polynucleotide reagent of the present invention, and using the measurements selectively to adjust one or more of the dose, administration scheme and / or administration frequency of the dsRNA reagent or CFB antisense polynucleotide reagent of the present invention in order to treat the CFB-related disease or condition in the subject. In some embodiments of the method of the present invention, the desired outcome of administering an effective amount of the dsRNA agent or CFB antisense polynucleotide agent of the present invention to a subject is a reduction in the subject's CFB mRNA level, a reduction in the subject's CFB protein level, or the levels of any one or more of the following: CH50 activity (a criterion for measuring total hemolytic complement), AH50 (a criterion for measuring hemolytic activity of the complement alternative pathway), lactate dehydrogenase (LDH) (a criterion for measuring intravascular hemolysis), hemoglobin level, C3, C9, C5, C5a, C5b, and soluble C5b-9 complex.
[0187] As used herein, the terms “treatment,” “treatment,” or “in treatment” may, when used with respect to CFB-related disease or condition, refer to prophylactic treatment that reduces the likelihood of a subject developing CFB-related disease or condition, or to treatment after a subject has developed CFB-related disease or condition, thereby eliminating or reducing the level of CFB-related disease or condition, preventing further progression (e.g., becoming more severe) of CFB-related disease or condition, and / or mitigating the progression of CFB-related disease or condition in the subject, compared to a subject without treatment that reduces polypeptide activity in the subject.
[0188] Certain embodiments of the agents, compositions, and methods of the present invention can be used to inhibit CFB gene expression. In this specification, the terms “inhibition,” “silencing,” “reduction,” “downregulation,” and “knockdown” with respect to CFB gene expression refer to a reduction in CFB gene expression compared to a control level of RNA transcribed from the CFB gene, an activity level of expressed CFB, or a CFB level translated from mRNA, when a cell, cell population, tissue, organ, or subject comes into contact with (e.g., is treated with) the CFB dsRNA agent or CFB antisense polynucleotide agent of the present invention, respectively. This reduction is achieved, for example, by measuring one or more of the levels of RNA transcribed from the gene, the activity level of expressed CFB, and the levels of CFB polypeptides, proteins, or protein subunits translated from mRNA in a cell, cell population, tissue, organ, or subject to which the CFB gene has been transcribed. In some embodiments, the control level is the level in a cell, tissue, organ, or subject that has not come into contact with (e.g., been treated with) the CFB dsRNA agent or CFB antisense polynucleotide agent.
[0189] Method of administration Multiple routes of administration of CFB dsRNA agents or CFB antisense polynucleotide agents can be used in the methods of the present invention. The specific mode of delivery selected depends at least in part on the specific disease being treated and the dose required for therapeutic efficacy. Generally, the methods of the present invention can be carried out in any medically acceptable mode of administration, meaning any mode that produces an effective therapeutic level for CFB-related disease or condition without causing clinically unacceptable side effects. In some embodiments of the present invention, CFB dsRNA agents or CFB antisense polynucleotide agents can be administered orally, intraintestinal, mucosal, subcutaneous, and / or parenteral routes. The term "parenteral" includes subcutaneous, intravenous, intrathecal, intramuscular, intraperitoneal, and intrasternal injection or infusion techniques. Other routes include, but are not limited to, transnasal (e.g., via a nasogastric tube), transdermal, transvaginal, transrectal, sublingual, and inhalation. The routes of delivery of the present invention may include intrathecal, ventricular, or intracranial. In some embodiments of the present invention, a CFB dsRNA agent or a CFB antisense polynucleotide agent can be administered by placing it in a sustained-release matrix and placing the matrix in the body of a subject. In some embodiments of the present invention, a CFB dsRNA agent or a CFB antisense polynucleotide agent can be delivered to subject cells using nanoparticles coated with a delivery agent that targets specific cells or organelles. Various delivery methods, procedures, and reagents are known in the art. Further examples of non-limiting delivery methods and delivery agents are provided elsewhere in this specification. In some embodiments of the present invention, the term “delivery” with respect to CFB dsRNA agents or CFB antisense polynucleotide agents means administering one or more “naked” CFB dsRNA agent or CFB antisense polynucleotide agent sequences to cells or subjects, and in some embodiments of the present invention, “delivery” means delivering cells containing the CFB dsRNA agent or CFB antisense polynucleotide agent to a subject by transfection, thereby delivering a vector encoding the CFB dsRNA agent or CFB antisense polynucleotide agent into the subject’s body.The delivery of CFB dsRNA agents or CFB antisense polynucleotide agents using transfection means may include administering the vector to cells and / or subjects.
[0190] In some methods of the present invention, one or more CFB dsRNA agents or CFB antisense polynucleotide agents can be administered in a formulation, which can be administered in a pharmaceutically acceptable solution, which may typically contain pharmaceutically acceptable concentrations of salts, buffers, preservatives, compatible carriers, adjuvants, and optional other therapeutic components. In some embodiments of the present invention, the CFB dsRNA agent or CFB antisense polynucleotide agent can be prepared with another therapeutic agent and used for co-administration. According to the methods of the present invention, the CFB dsRNA agent or CFB antisense polynucleotide agent can be administered in a pharmaceutical composition. Generally, the pharmaceutical composition comprises the CFB dsRNA agent or CFB antisense polynucleotide agent and an optional pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are well known to those skilled in the art. As used herein, a pharmaceutically acceptable carrier refers to a non-toxic material that does not interfere with the efficacy of the biological activity of the active ingredient, for example, the ability of the CFB dsRNA agent or CFB antisense polynucleotide agent to inhibit CFB gene expression in cells or subjects. Several methods for administering and delivering CFB dsRNA agents or CFB antisense polynucleotide agents for therapeutic purposes are known in the art and can be used in the methods of the present invention.
[0191] Pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials well known in the art. An exemplary pharmaceutically acceptable carrier is described in U.S. Patent No. 5,211,657, and other carriers are known to those skilled in the art. Such formulations may typically contain salts, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. When used in drugs, salts are pharmaceutically acceptable salts; however, pharmaceutically unacceptable salts can be suitably used in the production of such pharmaceutically acceptable salts and are not excluded from the scope of this invention. Such pharmacophysical and pharmaceutically acceptable salts include, but are not limited to, salts produced from acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, malonic acid, and succinic acid. Furthermore, pharmaceutically acceptable salts can be produced as alkali metal salts or alkaline earth metal salts, such as sodium salts, potassium salts, and calcium salts.
[0192] Some embodiments of the methods of the present invention involve directly administering one or more CFB dsRNA reagents or CFB antisense polynucleotide reagents to a tissue. In some embodiments, the tissue to which the compounds are administered is a tissue in which CFB-related disease or pathology is present or may manifest, a non-limiting example being the heart. Direct administration to tissue can be achieved by direct injection or by other means. Many orally delivered compounds naturally proceed to cross the liver and kidneys, and some embodiments of the therapeutic methods of the present invention involve orally administering one or more CFB dsRNA agents to a subject. CFB dsRNA agents or CFB antisense polynucleotide agents can be administered once, alone, or in combination with other therapeutic agents, or alternatively, they can be administered multiple times. In the case of multiple administrations, CFB dsRNA agents or CFB antisense polynucleotide agents can be administered via different routes. For example, without intent to limit, the first (or first few) doses may be administered subcutaneously, and one or more other doses may be administered orally and / or systemically.
[0193] For embodiments of the present invention requiring systemic administration of a CFB dsRNA agent or CFB antisense polynucleotide agent, the CFB dsRNA agent or CFB antisense polynucleotide agent may be prepared for parenteral administration by injection, for example, by bolus injection or continuous infusion. The injectable formulation may be available in unit dose forms such as ampoules or multi-dose containers with or without preservatives. The CFB dsRNA agent formulation (also called a pharmaceutical composition) may take the form of a suspension, solution or emulsion on an oily or aqueous carrier and may contain preparations such as suspending agents, stabilizers and / or dispersants.
[0194] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents include propylene glycol, polyethylene glycol, vegetable oils (e.g., olive oil), and injectable organic esters (e.g., ethyl oleate). Aqueous carriers include water, alcohol / aqueous solutions, emulsions, or suspensions, and include saline and buffering media. Parenteral carriers include sodium chloride solution, ringer's dextrose, glucose and sodium chloride, Ringer's lactate solution, or non-volatile oils. Intravenous carriers include liquids and nutritional supplements, electrolyte supplements (e.g., supplements based on ringer's dextrose), etc. Preservatives and other additives, such as antimicrobial agents, antioxidants, chelating agents, and inert gases, may be present. Doses for other forms of administration (e.g., intravenous administration) are relatively low. If the subject's response to the initial dose is insufficient, a higher dose may be used within the patient's tolerance range (or the dose may be substantially increased by a different, more localized delivery route). If necessary, multiple doses can be used daily to achieve appropriate systemic or local levels of one or more CFB dsRNA agents or CFB antisense polynucleotide agents, and to achieve appropriate reduction of CFB protein activity.
[0195] In other embodiments, the method of the present invention includes the use of a delivery carrier such as biocompatible microparticles, nanoparticles, or implants suitable for implantation into the body of a recipient (e.g., a subject). Exemplary biodegradable implants that can be used by the method are described in PCT disclosure number WO 95 / 24929 (incorporated herein by reference), which describes a biocompatible, biodegradable polymer matrix containing a biopolymer.
[0196] Non-biodegradable and biodegradable polymer matrices can both be used in the methods of the present invention to deliver one or more CFB dsRNA reagents or CFB antisense polynucleotide reagents to a subject. In some examples, the matrix may be biodegradable. The matrix polymer may be natural or synthetic. The polymer can be selected depending on the period for which release is required, typically on the order of a few hours to one year or more. Releases over periods of several hours to 3 to 12 months are usually available. The polymer may optionally take the form of a hydrogel capable of absorbing up to about 90% of its weight in water, and may further optionally be crosslinked with polyvalent ions or other polymers.
[0197] In general, in some embodiments of the present invention, CFB dsRNA agents or CFB antisense polynucleotide agents can be delivered by diffusion using biodegradable implants or by degradation of a polymer matrix. Exemplary synthetic polymers for such use are well known in the art. Biodegradable and non-biodegradable polymers can be used to deliver CFB dsRNA agents or CFB antisense polynucleotide agents by methods known in the art. Bioadhesive polymers such as biodegradable hydrogels (see HSSawhney, CPPathak and JAHubell in Macromolecules, 1993, 26, 581-587, the teachings of which are incorporated herein by reference) can also be used to deliver CFB dsRNA agents or CFB antisense polynucleotide agents for the treatment of CFB-related diseases or conditions. Other suitable delivery systems may include timed-release, delayed-release, or sustained-release delivery systems. Such systems can avoid repeated administration of CFB dsRNA agents or CFB antisense polynucleotide agents, thereby improving convenience for subjects and healthcare workers. Many types of discharge delivery systems are available and known to those skilled in the art. (See, for example, U.S. Patent Nos. 5,075,109, 4,452,775, 4,675,189, 5,736,152, 3,854,480, 5,133,974, and 5,407,686 (the teachings of each patent are incorporated herein by reference)). Pump-based hardware delivery systems can also be used, some of which are applicable to implantation.
[0198] The use of long-term sustained-release implants is suitable for prophylactic treatment of subjects and may also be suitable for subjects at risk of recurrent CFB-related disease or condition. As used herein, long-term release means that the structure and placement of the implant allow for the delivery of therapeutic levels of CFB dsRNA or CFB antisense polynucleotide over a period of at least 10, 20, 30, 60, 90 days, 6 months, 1 year, or longer. Long-term sustained-release implants are well known to those skilled in the art and include some of the release systems described above.
[0199] CFB dsRNA agents or CFB antisense polynucleotide therapeutic formulations can be prepared for storage by mixing molecules or compounds of desired purity with a selectively pharmaceutically acceptable carrier, excipient, or stabilizer, in the form of lyophilized formulations or aqueous solutions [Remington's Pharmaceutical Sciences 21]. st [edition, (2006)]. Acceptable carriers, excipients, or stabilizers are nontoxic to the recipient at the dose and concentration used, and include buffers such as phosphates, citrates, and other organic acids, antioxidants including ascorbic acid and methionine, preservatives (e.g., benzyldimethylstearylammonium chloride, hexamethonium chloride, benzalkonium chloride, benzethonium chloride, phenol, butanol, or benzyl alcohol, alkyl p-hydroxybenzoates such as methyl p-hydroxybenzoic acid or propyl p-hydroxybenzoic acid, catechol, resorcinol, cyclohexanol, 3-penta (Nol and m-cresol), low molecular weight (less than about 10 residues) polypeptides, proteins such as serum albumin, gelatin or immunoglobulin, hydrophilic polymers such as polyvinylpyrrolidone, amino acids such as glycine, glutamine, asparagine, histidine, arginine or lysine, monosaccharides, disaccharides, and other carbohydrates including glucose, mannose or dextrin, chelating agents such as EDTA, sugars such as sucrose, mannitol, trehalose or sorbitol, salt-forming counterions such as sodium, metal complexes (e.g., Zn-protein complexes), and / or TWEEN(R) PLURONICS (R) Alternatively, it may contain a nonionic surfactant such as polyethylene glycol (PEG).
[0200] Cells, subjects, and controls The methods of the present invention can be used in combination with cells, tissues, organs and / or subjects. In some embodiments of the present invention, the subjects are humans or vertebrate mammals, including but not limited to dogs, cats, horses, cattle, goats, mice, rats and monkeys. Accordingly, the present invention can be used for the treatment of CFB-related diseases or conditions in human and non-human subjects. In some embodiments of the present invention, the subjects may be farm animals, zoo animals, livestock or non-livestock animals, and the methods of the present invention can be used in veterinary preventive and therapeutic schemes. In some embodiments of the present invention, the subjects are humans, and the methods of the present invention can be used in preventive and therapeutic schemes for humans.
[0201] Non-limiting examples of subjects to whom the present invention can be applied are subjects who have been diagnosed with, are suspected of having, or are at risk of having, a disease or condition associated with higher-than-desired CFB expression and / or activity, also known as "elevated CFB expression levels." Non-limiting examples of diseases and conditions associated with higher-than-desired CFB expression and / or activity are described elsewhere in this specification. The method of the present invention can be applied to subjects diagnosed with a disease or condition associated with higher-than-desired CFB expression and / or activity at the time of treatment, or subjects who are considered to be at risk of having or progressing a disease or condition associated with higher-than-expected CFB expression and / or activity. In some embodiments of the present invention, the disease or condition associated with higher-than-desired CFB expression and / or activity is an acute disease or condition, while in some embodiments of the present invention, the disease or condition associated with higher-than-desired CFB expression and / or activity is a chronic disease or condition.
[0202] In non-limiting examples, the CFB dsRNA agent of the present invention is administered to subjects diagnosed with, suspected of having, or at risk of having, statin-resistant hypercholesterolemia, a disease in which reduction of CFB expression is required. The method of the present invention can be applied to subjects already diagnosed with the disease or condition at the time of treatment, or to subjects who are considered to have or are at risk of developing the disease or condition.
[0203] In yet another non-limiting example, the CFB dsRNA agent of the present invention is administered to a subject diagnosed with, suspected of having, or at risk of developing, hyperlipidemia, a disease in which reduction of CFB expression is required. The method of the present invention can be applied to subjects diagnosed with the disease or condition at the time of treatment, or subjects considered to have or be at risk of developing the disease or condition.
[0204] Cells to which the methods of the present invention can be applied include in vitro, intracellular, and ex vivo cells. Cells may exist in subjects, in cultures, and / or in suspensions, or in any other suitable state or condition. Cells to which the methods of the present invention can be applied may also be hepatocytes, liver cells, cardiomyocytes, pancreatic cells, cardiovascular cells, renal cells, or other types of vertebrate cells, including human and non-human mammalian cells. In some embodiments of the present invention, cells to which the methods of the present invention can be applied are healthy and normal cells that are not known to be disease cells. In some embodiments of the present invention, the cells to which the methods and compositions of the present invention can be applied are hepatocytes, liver cells, cardiomyocytes, pancreatic cells, cardiovascular cells, and / or renal cells. In some embodiments of the present invention, control cells are normal cells, but it should be understood that in certain cases, cells suffering from disease or illness may function as control cells, for example, by comparing the treated results of cells suffering from disease or illness with the untreated results of cells suffering from disease or illness.
[0205] The method of the present invention allows for the determination of CFB polypeptide activity levels and comparison with control levels of CFB polypeptide activity. The control may be a predetermined value, which may take multiple forms. It may be a single cutoff value, such as a median or mean. It can be established based on comparison groups, such as a group having normal levels of CFB polypeptide and / or CFB polypeptide activity, and a group having improved levels of CFB polypeptide and / or CFB polypeptide activity. Further, non-limiting examples of comparison groups may be a group having one or more symptoms of a CFB-related disease or condition, or diagnosed with a CFB-related disease or condition; a group not having one or more symptoms of such a disease or condition, or not diagnosed with such a disease or condition; a group of subjects administered the siRNA treatment of the present invention; or a group of subjects not administered the siRNA treatment of the present invention. Typically, the control can be based on clearly healthy normal individuals or clearly healthy cells in an appropriate age group. It should be understood that, in addition to predetermined values, the control according to the present invention may also be a sample of material being tested in parallel with the experimental material. Examples include samples from a control group, or manufactured control samples to be tested in parallel with experimental samples. In some embodiments of the present invention, the control may include cells or subjects that have not been contacted or treated with the CFB dsRNA agent of the present invention, in which case the control level of CFB polypeptide and / or CFB polypeptide activity can be compared to the level of CFB polypeptide and / or CFB polypeptide activity in cells or subjects that have been contacted with the CFB dsRNA agent or CFB antisense polynucleotide agent of the present invention.
[0206] In some embodiments of the present invention, the CFB polypeptide level determined for a subject may be a control level relative to CFB polypeptide levels determined for the same subject at different times. In one non-limiting example, the level of CFB is determined in a biological sample obtained from a subject that has not been administered the CFB treatment of the present invention. In some embodiments, the biological sample is a serum sample. The level of CFB polypeptide determined from a sample obtained from a subject can be used as a baseline or control value for the subject. In the treatment method of the present invention, after administering a CFB dsRNA agent to a subject once or more times, one or more other serum samples can be obtained from the subject, and the level of CFB polypeptide in one or more subsequent samples can be compared to the subject's control / baseline level. Such comparisons can be used to evaluate the onset, progression, or regression of CFB-related disease or condition in the subject. For example, if the level of CFB polypeptide in a baseline sample obtained from a subject is higher than the level obtained from the same subject after administration of the CFB dsRNA agent or CFB antisense polynucleotide agent of the present invention to the subject, it indicates regression of CFB-related disease or condition and demonstrates the efficacy of the administered CFB dsRNA agent of the present invention in treating CFB-related disease or condition.
[0207] In some embodiments of the present invention, one or more values of the levels of CFB polypeptide and / or CFB polypeptide activity measured in a subject can then serve as a control value for comparison with the levels of CFB polypeptide and / or CFB activity in the subject over the same period, thereby enabling the evaluation of changes in CFB polypeptide activity relative to the "baseline" in the subject. Accordingly, the initial CFB polypeptide level and / or initial CFB polypeptide activity level may be present and / or established in the subject, and the methods and compounds of the present invention may be used to reduce the CFB polypeptide level and / or CFB polypeptide activity in the subject, of which the initial level serves as the control level for the subject.
[0208] The CFB dsRNA agent and / or CFB antisense polynucleotide agent of the present invention can be administered to a subject using the method of the present invention. The effectiveness of the administration and treatment of the present invention can be evaluated if the level of CFB polypeptide in the serum sample obtained from the subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to the pre-administration level of CFB polypeptide in a serum sample obtained from the subject at a previous point in time, or compared to an uncontacted control level (e.g., the level of CFB polypeptide in a control serum sample). It should be understood that both the level of CFB polypeptide and the level of CFB polypeptide activity are related to the level of CFB gene expression. One embodiment of the method of the present invention involves administering the CFB dsRNA and / or CFB antisense agent of the present invention to a subject in an amount effective in inhibiting CFB gene expression and thereby reducing the level of CFB polypeptide and the level of CFB polypeptide activity in the subject.
[0209] Some embodiments of the present invention involve measuring the presence, absence, and / or amount (also referred to herein as level) of CFB polypeptide in one or more biological samples obtained from one or more subjects. Such measurements can be used to evaluate the effectiveness of the therapeutic methods of the present invention. For example, the methods and compositions of the present invention can be used to determine the level of CFB polypeptide in biological samples obtained from subjects previously treated with the CFB dsRNA agent and / or CFB antisense agent of the present invention. A CFB peptide level measured from a serum sample obtained from a treated subject that is at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or lower compared to the measured pre-treatment CFB peptide level of the subject, or compared to the level of a non-contact control biological sample, indicates a level of therapeutic effectiveness for the subject.
[0210] In some embodiments of the present invention, physiological characteristics of a CFB-related disease or condition measured in a subject may be control measurements to physiological characteristics measured at different time points in the same subject for comparison. In non-limiting examples, physiological characteristics, such as CFB mRNA levels, CFB protein levels, or CH50 activity, AH50, lactate dehydrogenase (LDH), hemoglobin levels, or levels of one or more of C3, C9, C5, C5a, C5b, and soluble C5b-9 complexes in a subject, are measured in a biological sample (e.g., a serum sample) obtained from a subject (who has not been treated with the CFB agent of the present invention). CFB mRNA levels (and / or other physiological characteristics of a CFB disease or condition) measured in a sample obtained from a subject can serve as a baseline or control value for the subject. After administering a CFB dsRNA agent to a subject once or multiple times using the therapeutic method of the present invention, one or more separate serum samples can be obtained from the subject, and the CFB mRNA levels and / or CFB protein levels in one or more subsequent samples can be measured and compared, respectively, to the subject's control / baseline levels and / or ratios. Such comparisons can be used to assess the onset, progression, or regression of CFB-related disease or condition in the subject. For example, if the CFB mRNA level in a baseline sample obtained from a subject is higher than the CFB mRNA level measured in a sample obtained from the same subject after administration of the CFB dsRNA agent or CFB antisense polynucleotide agent of the present invention to the subject, it indicates regression of the CFB-related disease or condition and demonstrates the efficacy of the administered CFB dsRNA agent of the present invention in treating CFB-related disease or condition.
[0211] In one embodiment of the present invention, one or more physiological feature values of a CFB-related disease or condition established in a subject can subsequently be used as a control value to compare the physiological features of the same subject, thereby enabling the evaluation of changes in the subject's physiological features relative to the "baseline." Thus, a subject may have and / or be established initial physiological features, and the methods and compounds of the present invention can be used to reduce the levels of CFB polypeptide and / or CFB polypeptide activity in the subject, of which the measured values of the initial physiological features can be used as a control for the subject.
[0212] Using the method of the present invention, CFB-related diseases or conditions can be treated by administering an effective amount of the CFB dsRNA agent and / or CFB antisense polynucleotide agent of the present invention to a subject. The efficacy of the administration and treatment of the present invention can be evaluated by determining changes in one or more physiological characteristics of the CFB-related disease or condition. In non-limiting examples, the CFB mRNA level in a serum sample obtained from a subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to pre-administration lipids in a serum sample obtained from the subject at a previous point in time, or compared to uncontacted control levels (e.g., CFB mRNA levels in a control serum sample). The CFB mRNA level, CFB protein level, or lipid levels, triglycerides, cholesterol levels, and free fatty acid levels in a subject's plasma or tissue sample should all be understood to be related to the level of CFB gene expression. One embodiment of the method of the present invention involves administering the CFB dsRNA agent and / or CFB antisense agent of the present invention to a subject in an amount effective in inhibiting CFB gene expression, thereby reducing the subject's CFB mRNA level, CFB protein level, or otherwise positively influencing the physiological characteristics of the subject's CFB-related disease or condition.
[0213] Some embodiments of the present invention include determining the presence, absence, and / or alteration of physiological features of CFB-related diseases or conditions using the following methods, which include, for example, (1) evaluating the physiological features of one or more biological samples obtained from one or more subjects, (2) imaging the subjects (e.g., obtaining liver images), and (3) performing a health examination of the subjects. The measurements can be used to evaluate the effectiveness of the therapeutic methods of the present invention.
[0214] kit A reagent kit comprising a CFB dsRNA reagent and / or a CFB antisense polynucleotide reagent, and instructions for use in the method of the present invention, is also within the scope of the present invention. The reagent kit of the present invention may contain one or more of the CFB dsRNA agent, CFB sense polynucleotide, and CFB antisense polynucleotide agent that can be used for the treatment of CFB-related diseases or conditions. A reagent kit containing one or more of the CFB dsRNA reagent, CFB sense polynucleotide, and CFB antisense polynucleotide reagent can be manufactured and used in the therapeutic method of the present invention. The components of the reagent kit of the present invention may be packaged in an aqueous medium or in a lyophilized form. The reagent kit of the present invention may include a carrier, which is partitioned to tightly contain one or more container devices or a series of container devices, such as test tubes, vials, flasks, bottles, syringes, etc. The first container device or series of container devices may contain one or more compounds, such as the CFB dsRNA reagent and / or the CFB sense or antisense polynucleotide reagent. The second container device or series of container devices may contain a targeting agent, a labeling agent, a delivery agent, etc., and in one embodiment of the therapeutic method of the present invention, it may be included as part of the CFB dsRNA agent and / or CFB antisense polynucleotide to be administered.
[0215] The reagent kit of the present invention may further include instructions for use. The instructions for use are typically in written form and are used to guide how to administer the treatments included in the reagent kit and to make decisions based on such treatments.
[0216] The following examples are used to illustrate specific examples of the implementation of the present invention and are not intended to limit the scope of the invention. It will be apparent to those skilled in the art that the present invention can be applied to various compositions and methods. [Examples]
[0217] Specific examples Example 1. Phosphoramidite Compound 2 JPEG2026521916000051.jpg36149
[0218] A pyridine solution (400 mL) of DMTrCl (232 g, 684 mmol, 1.0 eq) was added to a pyridine solution (600 mL) of isomannitol compound A (100 g, 684 mmol, 1.0 eq), and the mixture was stirred at 25°C for 12 hours. LC-MS showed that compound A was completely consumed, and a main peak with one desired mass was detected. The resulting reaction mixture was diluted with water (500 mL), extracted with DCM (500 mL x 2), washed with saline solution (500 mL), dried over Na2SO4, and concentrated under vacuum to obtain the residue. The residue was purified by column chromatography (DCM / MeOH = 100 / 1 to 50 / 1, 0.1% Et3N) to obtain compound B (150 g, yield 48.9%) as a yellow solid.
[0219] 1H NMR: EC4783-404-P1B1_C (400 MHz, DMSO-d6) δ ppm 7.46 (br d, J=7.63 Hz, 2 H) 7.28 - 7.37 (m, 6 H) 7.19 - 7.25 (m, 1 H) 6.90 (br d, J=7.88 Hz, 4 H) 4.70 (d, J=6.50 Hz, 1 H) 3.99 - 4.09 (m, 6 H) 3.88 - 3.96 (m, 2 H) 3.83 (br dd, J=7.82, 6.94 Hz, 1 H) 3.74 (s, 6 H) 3.41 (br t, J=8.13 Hz, 1H) 3.05 (t, J=8.44 Hz, 1 H) 2.85 (br t, J=7.50 Hz, 1 H).
[0220] At 25°C in an N2 atmosphere, 2H-tetrazole (0.45M, 436mL, 1.1eq) was added dropwise to a solution of compound B (80.0g, 178 mmol, 1.0eq) in DCM (800mL), followed by the addition of a solution of compound C (80.6g, 267 mmol, 85.0mL, 1.5eq) in DCM (200mL) dropwise to the mixture. The reaction mixture was stirred at 25°C for 1.0 hour. LC-MS showed that compound B was completely consumed, and a main peak with a single desired mass was detected. The resulting reaction mixture was cooled to -20°C and poured into ice-cold saturated NaHCO3 (500 mL). Extraction was performed with DCM (500 mL x 3). The combined organic layer was washed with saturated NaHCO3 / saline solution = 1:1 (300 mL / 300 mL), dried over Na2SO4, and concentrated under vacuum (35°C) to obtain a residue (100 mL). The residue was purified by column chromatography (Al2O3, DCM / MeOH = 100 / 1 to 50 / 1, 0.1% Et3N) to obtain compound 2 (77 g, 119 mmol, yield 66.5%), which was a white solid.
[0221] 1H NMR: EC4783-423-P1B1_C (400 MHz, DMSO-d6) δ ppm 7.22 (br d, J=7.50 Hz, 2 H) 7.05 - 7.14 (m, 6 H) 6.96 - 7.02 (m, 1 H) 6.67 (br dd, J=8.82, 1.81 Hz, 4 H) 3.95 - 4.07 (m, 2 H) 3.73 - 3.83 (m, 1 H) 3.62 - 3.72 (m, 2 H) 3.48 - 3.53 (m, 6 H) 3.27 - 3.37 (m, 3 H) 3.11 (s, 6 H) 2.82 (td, J=8.54, 2.31 Hz, 1 H) 2.47 - 2.63 (m, 3 H) 2.28 (br d, J=1.63 Hz, 3 H) 0.82 - 1.00 (m, 13 H).
[0222] Phosphoramidite compound 1 JPEG2026521916000052.jpg40141
[0223] Under an N2 atmosphere at 0-5°C, compound D (607 mg, 3.34 mmol, 3.0 eq) and DIEA (432 mg, 3.34 mmol, 582 μL, 3.0 eq) were added to a solution of compound B (500 mg, 1.11 mmol, 1.0 eq) in DCM (5.0 mL), and the mixture was stirred at 25°C for 1.0 hour. LC-MS showed that compound B was completely consumed, several new peaks were observed, and approximately 70.9% of the desired compound was detected. The resulting reaction mixture was cooled to -20°C and poured into an ice-cold (0-5°C) saturated NaHCO3 (5.0 mL) solution. Extraction was performed using DCM (5.0 mL x 2). The combined organic layer was washed with ice-cold (0-5°C) saturated NaHCO3 / saline solution = 1:1 (5.0 mL / 5.0 mL), dried over Na2SO4, and concentrated under vacuum to obtain a residue (~5 mL). The residue was purified by column chromatography (basic Al2O3, petroleum ether / ethyl acetate = 10 / 1~5 / 1, 0.1% Et3N) to obtain a white solid compound 1 (280 mg, 471 μmol, yield 42.3%).
[0224] 1 H NMR: EC10615-49-P1N (400 MHz, DMSO-d6) δ ppm 7.44 (br d, J=7.63 Hz, 2 H), 7.31 (br t, J=7.94 Hz, 6 H), 7.18 - 7.26 (m, 1 H), 6.89 (brd, J=8.00 Hz, 4 H), 4.08 - 4.13 (m, 1 H), 3.95 - 4.03 (m, 1 H), 3.84 - 3.93 (m, 1 H), 3.77 - 3.83 (m, 1 H), 3.74 (s, 6 H), 3.43 - 3.53 (m, 3 H), 3.38 (br d, J=6.75 Hz, 1 H), 2.94 - 3.04 (m, 1 H), 2.70 - 2.85 (m, 1 H), 1.09 - 1.15 (m, 12 H), 1.07 (br s, 3 H).
[0225] Other phosphoramidites can be produced by the processes described herein and / or by prior art, for example, US426, 220 and WO02 / 36743, and / or thereafter.
[0226] Example 2. Production of a solid support containing the phosphoramidite monomer of the present invention JPEG2026521916000053.jpg22141
[0227] JPEG2026521916000054.jpg1126 This indicates the highly porous aminomethyl polyethylene resin support portion. Under nitrogen gas protection, 19.50 kg of dichloromethane was added to a 50 L glass reaction vessel, stirring was started, and the temperature was controlled to 20-30°C. 1.47 kg of DMTrimann, 1.50 kg of triethylamine, 0.164 kg of 4-dimethylaminopyridine, and 1.34 kg of succinic anhydride were added to the glass reaction vessel, and the mixture was kept warm at 20-30°C for 18 hours. A sample was taken, and the reaction was stopped. 22.50 kg of saturated sodium bicarbonate solution was added to the reaction system, and the mixture was stirred for 10-20 minutes to separate the layers. The organic phase was separated, the aqueous phase was extracted twice with dichloromethane, the organic phases were combined, dried with anhydrous sodium sulfate, filtered, and concentrated under vacuum to obtain 1.83 kg of a gray to grayish-white solid.
[0228] N,N-dimethylformamide (23.50 kg) was added to a 100 L glass vessel and stirred. The temperature was controlled to 20-30°C. Under nitrogen gas protection, the products from the previous step, O-benzotriazoletetramethyluronium hexafluorophosphate (0.33 kg) and N,N-diisopropylethylamine (0.13 kg), were added to the 100 L glass vessel using a solid input funnel, stirred for 10-30 minutes, and then discharged into a 50 L zinc bucket for use. Large-porous aminomethyl resin (3.25 kg) (purchased from Tianjin Nankai Hecheng Technology Co., Ltd., lot number HA2X1209, load amount 0.48 mmol / g) was added to the above 100 L solid-phase synthesis reactor using a solid-feed funnel. The temperature was controlled to 20-30°C, and N,N-dimethylformamide (21.00 kg + 21.00 kg) and the reaction solution from the zinc bucket in the previous step were added to the solid-phase synthesis reactor. The system underwent an adiabatic reaction, and the solid load amount was tracked until it reached ≥250 μmol / g. UV light was used to detect the load amount. The mixture was filtered under pressure with nitrogen gas, and the filtered cake was washed three times with N,N-dimethylformamide (26.00 kg + 26.10 kg + 26.00 kg), leaving the filtered cake in the vessel. CAP.A (50% acetonitrile and 50% acetic anhydride, 4.40 kg + 4.42 kg + 4.30 kg) and CAP.B (20% pyridine, 30% N-methylimidazole and 50% acetonitrile, 4.40 kg + 4.40 kg + 4.47 kg) were placed in an 80 L glass vessel and stirred for 3-8 minutes before use. This procedure was repeated three times, capping was performed, and acetonitrile (18.00 kg + 18.00 kg + 18.00 kg + 17.50 kg + 17.50 kg) was added to the solid-phase synthesis vessel. Nitrogen gas was bubbling for 10-30 minutes, followed by pressure filtration. This procedure was repeated four times, the filtration cake was purged with nitrogen gas in the solid-phase synthesis vessel for 2-4 hours, and then transferred to a 50 L pressure filtration tank. The temperature was controlled to 15-30°C, and drying was continued. After drying, a yellow to white solid product was obtained with a weight of 3.516 kg.
[0229] Isomannitol residues were added to the 5'-terminus or 3'-terminus of an oligonucleotide chain by a method well known to those skilled in the art, such as invab, and further added to the target group.
[0230] Example 3. Synthesis of CFB RNAi agent.
[0231] The double-stranded CFB RNAi agents shown in Tables 2-3 above were synthesized according to the following general procedure: siRNA sense and antisense chain sequences were synthesized in an oligonucleotide synthesizer using a mature solid-phase synthesis method based on phosphoramidite chemistry. Oligonucleotide chain extension was achieved by a four-step cycle consisting of deprotection, condensation, capping, and oxidation or sulfidation steps for adding each nucleotide. Synthesis was performed on a solid support made from pore-controlled glass (CPG, 1000A). Monomer phosphoramidites may be purchased from commercial sources or may be the phosphoramidite compounds in Example 1. The phosphoramidite compounds herein can be ligated to the 3' end as monomer phosphoramidites and further ligated to the CPG solid support. When ligated to the 5' end, the phosphoramidite compounds can be used in the final coupling reaction and may be further conjugated to a target ligand as needed.
[0232] Phosphoramidites having GalNAc ligand clusters (including, in non-limiting examples, GLS-5* or GLS-15* phosphoramidites) are disclosed in WO2023 / 045995A1 (the entire contents of which are incorporated herein by reference). siRNAs used for in vitro screening (Table 2) were synthesized on a scale of 2 μmol, and siRNAs used for in vivo testing (Table 3) were synthesized on a scale of 5 μmol or more. When the GalNAc ligand (including, in non-limiting examples, GLO-n phosphoramidites, disclosed in WO2023 / 045995A1 (the entire contents of which are incorporated herein by reference)) was conjugated to the 3'-terminus of the sense strand, a CPG solid support to which the GalNAc ligand was attached was used. When a GalNAc ligand (a non-limiting example being GLS-5* or GLS-15*, which is linked to the 5' end of the sense chain, a GLS-5* or GLS-15* phosphoramidite having a GalNAc ligand cluster is found in WO2023 / 045995A1 (all of which are incorporated herein)) was linked to the 5' end of the sense chain, the GalNAc phosphoramidite was used in the final coupling reaction. A 3% dichloromethane solution of trichloroacetic acid (TCA) was used to deprotect the 4,4'-dimethoxytrityl protecting group (DMT). 5-ethylthio-1H-tetrazole was used as an activator. I2 in THF / Py / H2O and phenylacetyl disulfide (PADS) in pyridine / MeCN were used in the oxidation and sulfidation reactions, respectively. After the final solid-phase synthesis step, the oligomers bound to the solid support were cleaved and protecting groups removed by treatment with a 1:1 volume of 40 wt% aqueous methylamine solution and a 28% ammonium hydroxide solution. The crude mixture was concentrated to synthesize siRNA for in vitro screening. The remaining solid was dissolved in 1.0 M NaOAc and the single-stranded product was precipitated as a sodium salt by adding ice-cold EtOH, which could be used for annealing without further purification. The crude single-stranded product was further purified by ion-pair reverse-phase HPLC (IP-RP-HPLC) to synthesize siRNA for in vivo testing.The purified single-stranded oligonucleotide product obtained from IP-RP-HPLC was dissolved in 1.0 M NaOAc, and precipitated by adding ice-cold EtOH to convert it to a sodium salt. The sense and antisense oligonucleotides were annealed equimolarly and complementary in water to form a double-stranded siRNA product, which was then freeze-dried to provide a fluffy white solid.
[0233] In one study, a method for attaching a target group containing GalNAc (also referred to herein as a GalNAc delivery compound) to the 5' end of a sense strand involved using a GalNAc phosphoramidite (GLS-5* or GLS-15* phosphoramidite) in the final coupling step of solid-phase synthesis, using the same process used when extending an oligonucleotide chain to add a nucleotide to the 5' end of a sense strand.
[0234] In some studies, the method for attaching a GalNAc-containing target group to the 3' end of a sense chain involves using a solid-state vector (CPG) containing GLO-n. In some studies, the method for attaching a GalNAc-containing target group to the 3' end of a sense chain involves attaching the GalNAc target group to a CPG solid vector via an ester bond, and then using the resulting CPG with the attached GalNAc target group when synthesizing the sense chain to obtain the GalNAc target group attached to the 3' end of the sense chain.
[0235] imann residues can be added to the 5' or 3' end of an oligonucleotide chain and / or further added to a target group targeting GalNAc by methods well known to those skilled in the art, such as the inverse debasing (invab) method.
[0236] Example 4. In vitro screening of CFB siRNA double-stranded bodies Huh7 cells were digested with trypsin to the appropriate density, mixed with a complex of psiCHECK™-2 vector plasmid and Lipofectamine 2000 (Invitrogen-11668-019), and inoculated into 96-well plates. Following the manufacturer's recommendations, cells were transfected with test siRNA or control siRNA using Lipofectamine RNAiMax (Invitrogen-13778-150) immediately after inoculation. The siRNA was tested three times at two concentrations (1 nM and 10 nM).
[0237] Day 1: psiCHECK(TM)-2 vector transfection (1 plate) (1) 2.5 μg of psiCHECK(TM)-2 vector plasmid was transferred to an Eppendorf tube without RNASE (solution mixture #1). (2) Trypsin was added to one flask to dissociate the Huh7 cells, and the cells were counted using a Vi-Cell counter to adjust the cell density to 1*10^5 / ml. (3) 7.5 μL of Lipofectamine 2000 (Invitrogen-11668-019) was transferred to solution mix #1 tube and mixed uniformly.
[0238] (4) Add the solution from step 3 to the cell suspension, mix uniformly, and dispense the suspension into 96-well plates (100 μL / well).
[0239] Day 2, siRNA transfection (1) The Lipofectamine(R) RNAiMAX reagent was diluted in Opti-MEM(R) medium.
[0240] (2) Dilute the siRNA with water that does not contain RNA to prepare a 12× stock solution.
[0241] (3) Equivolute diluted RNAiMax and siRNA were mixed and incubated at room temperature for 15 minutes to form a complex.
[0242] (4) 45 μL / well of the compound Lipofectamine(R) RNAiMAX (Opti-MEM) was mixed with 225 μL / well of fresh DMEM medium and added to the detection plate. The supernatant was discarded, and 120 μL / well of the compound was mixed and added to a 96-well plate.
[0243] (5) The control wells without compounds were defined as cells transfected with the psiCHECK(TM)-2 vector and not treated with siRNA, while the blank control wells were cell-only wells.
[0244] Day 3: Dual-Glo(R) luciferase measurement
[0245] (1) The reagent was added to the measurement plate and left for 10 minutes to allow cell cleavage to occur.
[0246] (2) After transferring 100 μL of cell cutting solution to a plate, the firefly bioluminescence was measured.
[0247] (3) 50 μL of Dual-Glo(R) Stop & Glo(R) Reagent was added to the measurement plate and mixed, and after waiting for 10 minutes, the lenira emission was measured.
[0248] (4) The relative expression formula was calculated. Data Analysis Sample well ratio = (Lenira bioluminescent sample - background blank) / (Firefly bioluminescent sample - background blank) Ratio of control well without compound = (Control Renira luminescence - background blank) / (Control sample firefly luminescence - background blank) Inhibition rate = 100 - (Ratio of sample wells / Average ratio of control without compound) × 100% The double-stranded sequences used correspond to the sequences shown in Tables 5-7.
[0249] [Table 7-1] [Table 7-2]
[0250] [Table 8-1] [Table 8-2] [Table 8-3]
[0251] [Table 9-1] [Table 9-2] [Table 9-3]
[0252] Example 5. In vivo study of CFB siRNA double-stranded bodies On day 1, female C57BL / 6J mice (4 mice per group) were infected by intravenous injection of an adeno-associated virus 8 (AAV8) vector solution encoding human CFB and luciferase genes. On day 8, mice were given a single subcutaneous dose of 2 mg / kg or 3 mg / kg of CFB siRNA or PBS. Blood samples were collected on day 8, before siRNA administration, day 15, day 22, and day 29. Plasma samples were isolated, and luciferase activity in the plasma samples was measured according to the manufacturer's recommended procedure. Since human CFB expression levels are related to luciferase expression levels, the percentage of residual CFB was calculated by comparing pre- and post-treatment luciferase activity in the siRNA treatment group samples and standardized by the change in luciferase activity over the same period in the control treatment group samples. The results are summarized in Tables 8 and 9.
[0253] [Table 10]
[0254] [Table 11]
[0255] Example 6. In vivo study of CFB siRNA double-stranded bodies On day 1, female C57BL / 6J mice (4 mice per group) were infected by intravenous injection of an adeno-associated virus 8 (AAV8) vector solution encoding human CFB and luciferase genes. On day 8, mice were given a single subcutaneous injection of 2 mg / kg of CFB siRNA or PBS. Blood samples were collected on day 8, before siRNA administration, and on days 18, 25, and 32. Plasma samples were separated to collect serum samples, and protein levels were quantified by ELISA according to the manufacturer's recommended procedure. Since human CFB expression levels are related to luciferase expression levels, the percentage of residual CFB was calculated by comparing pre- and post-treatment samples from the siRNA treatment group and standardized by the ELISA changes over the same period in the control treatment group samples. The results are summarized in Table 10.
[0256] [Table 12]
[0257] Blood samples were collected on day 8, before siRNA administration, and on days 15, 22, and 29. The results are summarized in Tables 11 and 12.
[0258] [Table 13]
[0259] [Table 14]
[0260] Example 7. In vivo testing of CFB siRNA double-stranded bodies in an NHP PD model. This study recruited cynomolgus monkeys aged 6 years and weighing 3-6 kg, with 3 monkeys in each group. Each monkey received a single dose of 6 mg / kg of CFB siRNA reagent or PBS subcutaneously on day 1 (before siRNA administration). After an overnight fast, serum was extracted on days -14 (before administration), -7 (before administration), day 1 (before administration), day 8, day 15, day 22, day 29, day 36, day 43, day 50, day 57, day 64, and day 71. CFB protein residue was measured by Western blotting, and the results are shown in Table 13.
[0261] [Table 15]
[0262] Example 8: In vivo testing of CFB siRNA double-stranded bodies in an NHP PD model. This study recruited cynomolgus monkeys (6 years old, weighing 3-6 kg, 3 monkeys per group). Each monkey received a single subcutaneous injection of 6 mg / kg of CFB siRNA reagent or PBS on day 1 (before siRNA administration). After an overnight fast, serum was extracted on day -14 (before administration), day -7 (before administration), and day 1 (before administration). Samples were collected from all groups on day -14, day -7, day 1, day 8, day 15, day 22, day 29, day 36, day 43, day 50, day 57, day 71, and day 85. Western blotting (WB) was used to detect residual CFB protein, and the WISLAB reagent kit was used to detect Alternative (C5b-9) and Classical (C5b-9). The results are shown in Tables 14-16.
[0263] [Table 16]
[0264] [Table 17]
[0265] [Table 18]
[0266] Example 9. In vivo study of CFB siRNA double-stranded bodies in an NHP PD model. This study recruited cynomolgus monkeys (6 years old, weighing 3-6 kg, 3 monkeys per group). After fasting each monkey overnight, serum was extracted on day -14 (before administration), day -7 (before administration), and day 1 (before administration). On day 1 (before siRNA administration), a single subcutaneous injection of 3 mg / kg of CFB siRNA or PBS was administered. Sample collection times for each group were day -14, day -7, day 1, day 8, day 15, day 22, day 29, day 36, day 43, day 50, and day 57. Western blotting (WB) was used to detect residual CFB protein, and the results are shown in Table 17.
[0267] [Table 19]
[0268] Example 10. In vivo screening of CFB siRNA double-stranded bodies. Huh7 cells were digested with trypsin, adjusted to the appropriate density, and inoculated into 96-well plates. On day 2 after inoculation, cells were transfected with psiCHECK(TM)-2 vector plasmid, blank vector pCNDNA3.0, siRNAs, or control siRNA complexes using Lipofectamine2000 (Invitrogen-11668-019), following the manufacturer's recommended procedure. The siRNA test was repeated three times at different concentrations (10 nM and 1 nM).
[0269] On day 1, Huh7 cells were added to a trypsin-dissociated culture flask, the cells were counted using a Vi-Cell counter, the cell density was adjusted to 1 × 10^5 / mL, and the cells were cultured in DMEM medium.
[0270] On the second day, transfection was performed using a mixture of psiCHECK(TM)-2 vector, blank vector pCDNA3.0, siRNAs, and Lipofectamine 2000.
[0271] (1) Appropriate Lipofectamine 2000 (Invitrogen-11668-019) was mixed with Opti-MEM(R) medium (solution mixture #1). Finally, 0.3 μL of Lipofectamine 2000 and 4.7 μL of Opti-MEM(R) medium were added to each well.
[0272] (2) Appropriate psiCHECK(TM)-2 vectors, blank pCNDNA3.0 vectors, and siRNAs were mixed with Opti-MEM(R) medium (solution mixture #2).
[0273] (3) Equal volumes of solution mixture #1 and mixture #2 were mixed (mixture #3), resulting in 10 μL in each well. The mixture was incubated at room temperature for 15 minutes to form a complex.
[0274] (4) Remove the DMEM medium and add 10 μL of homogeneously mixed solution mixture #3 and 90 μL of fresh DMEM medium.
[0275] (5) The control wells without compounds were defined as cells transfected with the psiCHECK(TM)-2 vector and the blank vector pCNDNA3.0, and not treated with siRNA, while the blank controls were wells containing only cells. Day 3: Dual-Glo(R) luciferase detected. (1) Add the reagent to the detection plate and wait for 10 minutes to allow the cells to cleave.
[0276] (2) After transferring 100 μL of cell sections to a plate, the firefly bioluminescence was measured.
[0277] (3) 50 μL of Dual-Glo(R) Stop & Glo(R) reagent was added to the detection plate and mixed, waited for 10 minutes, and then Renilla luminescence was measured.
[0278] (4) Relative expression was calculated. Data Analysis Sample well ratio = (Sample Renilla luminescence - background blank) / (Sample Firefly luminescence - background blank) Ratio of control well without compound = (Renilla luminescence control sample - background blank) / (Firefly luminescence control sample - background blank) Inhibition rate = 100 - (Ratio of sample wells / Average ratio of control without compound) × 100%
[0279] [Table 20-1] [Table 20-2]
[0280] equivalent While several embodiments of the present invention have been described herein, various other means and / or structures are readily conceivable to those skilled in the art to perform the function and / or to obtain the results and / or one or more advantages described herein, and each of these variations and / or modifications is considered to be within the scope of the present invention. More generally, those skilled in the art will readily understand that all parameters, sizes, materials and arrangements described herein are illustrative, and that actual parameters, sizes, materials and / or arrangements depend on the specific application taught by the present invention. Those skilled in the art will recognize many equivalents of the specific embodiments of the present invention described herein, or can determine them simply by using ordinary experiments. Accordingly, it should be understood that the above embodiments are shown merely illustratively, and within the scope of the appended claims and their equivalents, the present invention can be carried out in ways different from those specifically described and claimed. The present invention relates to each individual feature, system, article, material and / or method described herein. Furthermore, any combination of two or more such features, systems, articles, materials, and / or methods is included within the scope of the present invention, provided that such features, systems, articles, materials, and / or methods are not contradictory to each other.
[0281] All definitions defined and used herein should be understood to govern dictionary definitions, definitions incorporated by reference in documents, and / or the ordinary meanings of the terms defined.
[0282] As used herein and in the claims, the indefinite articles "a" and "an" should be understood to mean "at least one" unless otherwise specified.
[0283] The phrase "and / or" as used in the specification and claims should be understood as "either one or both" of the elements being combined, that is, the elements may exist together in some cases and separately in others. Unless otherwise specified, in addition to the elements explicitly marked in the "and / or" clause, other elements may exist selectively, whether or not they are related to the elements explicitly marked.
[0284] All references, patents and patent applications, and publications cited or referred to herein are incorporated herein by reference in their entirety.
Claims
1. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting CFB expression, wherein the dsRNA agent comprises a sense strand and an antisense strand, the sense strand comprising at least 15 consecutive nucleotides having a difference of 3 or fewer nucleotides from the nucleotide sequence of SEQ ID NO: 1, and the antisense strand comprising at least 15 consecutive nucleotides having a difference of 3 or fewer nucleotides from the nucleotide sequence of SEQ ID NO: 2, wherein the sense strand and the antisense strand may be partially, basically, or completely complementary to each other. Double-stranded ribonucleic acid (dsRNA) agent.
2. The dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from any one of the nucleotide sequences 483-513, 486-516, 491-521, 483-521, 513-543, 987-1017, 989-1019, 1317-1347, 2237-2267, and 2439-2469 from SEQ ID NO: 1, and the antisense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from the corresponding nucleotide sequence from SEQ ID NO: 2, wherein the sense strand and antisense strand may be partially, basically, or completely complementary to each other. The dsRNA agent according to claim 1.
3. The sense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from any one of the nucleotide sequences 488-508, 491-511, 496-516, 488-516, 518-538, 992-1012, 994-1014, 1322-1342, 2242-2262, and 2444-2464 from SEQ ID NO: 1, and the antisense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from the corresponding nucleotide sequence of SEQ ID NO:
2. The dsRNA agent according to claim 1 or 2.
4. The antisense strand includes a region complementary to the CFB RNA transcript, and the complementary region includes at least 15 consecutive nucleotides that differ by 1, 2, or 3 or fewer nucleotides from any one of the antisense sequences listed in any one of Tables 1 to 3. The dsRNA agent according to claim 1.
5. The antisense strand includes a region complementary to the CFB RNA transcript, and the region includes at least 15 consecutive nucleotides from any one of the antisense sequences listed in Tables 1 to 3. The dsRNA agent according to claim 1.
6. The double-stranded ribonucleic acid (dsRNA) agent is for inhibiting CFB expression, and the dsRNA agent comprises a sense strand and an antisense strand, wherein the nucleotides at positions 2 to 18 of the antisense strand comprise a region complementary to the CFB RNA transcript, and the complementary region comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in Tables 1 to 3, and optionally comprises a target ligand. The dsRNA agent according to claim 1.
7. The region complementary to the CFB RNA transcript contains at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ by three or fewer nucleotides from one of the antisense sequences listed in Tables 1-3. The dsRNA agent according to claim 6.
8. The antisense strand of the dsRNA is basically or completely complementary to any one of the target regions of SEQ ID NO: 1, and preferably the dsRNA agent contains an antisense strand sequence listed in any one of Tables 1 to 3. A dsRNA agent according to any one of claims 1 to 7.
9. The sense strand sequence and antisense strand sequence in the dsRNA agent are at least fundamentally complementary or completely complementary, and preferably, the dsRNA agent includes a sense strand sequence listed in any one of Tables 1 to 3. A dsRNA agent according to any one of claims 1 to 8.
10. The dsRNA agent contains a sequence listed as a double-stranded sequence in any one of Tables 1 to 3. A dsRNA agent according to any one of claims 1 to 9.
11. The dsRNA agent comprises at least one modified nucleotide. A dsRNA agent according to any one of claims 1 to 10.
12. All or essentially all nucleotides in the sense strand and / or antisense strand are modified nucleotides. A dsRNA agent according to any one of claims 1 to 11.
13. The double-stranded ribonucleic acid (dsRNA) agent is for inhibiting CFB expression, and the dsRNA agent comprises a sense strand and an antisense strand, the sense strand and the antisense strand are complementary, the antisense strand contains a region complementary to a part of the CFB RNA transcript, each strand has a length of approximately 15 to approximately 30 nucleotides, and the sense strand contains a sequence that can be represented by formula (I). 5’-(N’ L ) n’ N’ L N’ L N’ L N’ L N’ F N’ L N’ F N’ L N’ N1 N’ N2 N’ L N’ L N’ L N’ L N’ L (N’ L ) m’ -3’ (I) Eventually, Each N' F represents a 2'-fluoromodified nucleotide, and each N' N1 and N' N2 The symbols independently indicate modified or unmodified nucleotides, and each N' L The symbols independently represent modified or unmodified nucleotides, but do not represent 2'-fluoromodified nucleotides, and m' and n' are each independently integers from 0 to 7. A dsRNA agent according to any one of claims 1 to 12.
14. The double-stranded ribonucleic acid (dsRNA) agent is for inhibiting CFB expression, and the dsRNA agent comprises a sense strand and an antisense strand, the sense strand and the antisense strand are complementary, the antisense strand contains a region complementary to a part of the CFB RNA transcript, the length of each strand is approximately 18 to approximately 30 nucleotides, and the antisense strand contains a sequence that can be represented by formula (II). 3'- (N L ) n N M1 N L N M2 N L N F N L N M3 N M4 N L N L N L N M5 N L N M6 N L N L N F N L -5' (A) Eventually, Each N F represents a 2'-fluoromodified nucleotide, and each N M1 , N M2 , N M3 , N M4 , N M5 and N M6 Each N independently represents a modified or unmodified nucleotide. L The terms indicate modified or unmodified nucleotides independently, but are not 2'-fluoromodified nucleotides, and n is an integer between 0 and 7. A dsRNA agent according to any one of claims 1 to 12.
15. The double-stranded ribonucleic acid (dsRNA) agent is for inhibiting CFB expression, and the dsRNA agent comprises a sense strand and an antisense strand, the sense strand and antisense strand form a dsRNA double-stranded body, the sense strand and antisense strand are complementary, the antisense strand includes a region complementary to the CFB RNA transcript, the complementary region includes at least 15 consecutive nucleotides, and the dsRNA comprises a double-stranded body represented by formula (III). Sense strand: 5'-(N' L ) n’ N' L N' L N' L N' L N' F N' L N' F N' L N' N1 N' N2 N' L N' L N' L N' L N' L (N' L ) m’ -3' Antisense strand: 3'-(N L ) n N M1 N L N M2 N L N F N L N M3 N M4 N L N L N L N M5 N L N M6 N L N L N F N L -5' (III) Eventually, Each chain has a length of approximately 18 to 30 nucleotides. Each N F and N' F independently represent 2'-fluoro-modified nucleotides, and N M1 N M2 N M3 N M4 N M5 N' N1 and N' N2 independently represent modified or unmodified nucleotides respectively, and N' N1 and N' N2 contain only one 2'-fluoro-modified nucleotide, and N M1 N M2 N M3 N M4 N M5 and N M6 have only three 2'-fluoro-modified nucleotides, and each N L and N' L A dsRNA agent according to any one of claims 1 to 12.
16. The one or more modified nucleotides are independently selected from 2'-O-methylnucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2'3'-seconucleotide mimetic, locked nucleotide, unlocked nucleic acid nucleotide (UNA), ethylene glycol nucleic acid nucleotide (GNA), 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, debasalized nucleotide, ribitol, reversed nucleotide, reversed debasalized nucleotide, isomannoside nucleotide, reversed 2'-OMe nucleotide, reversed 2'-deoxynucleotide, 2'-amino modified nucleotide, 2'-alkyl modified nucleotide, morpholino nucleotide, 3'-OMe nucleotide, nucleotide containing a 5'-phosphorothioate group, cholesterol derivative or terminal nucleotide linked to a dodecanoic acid bisdecanamide group, 2'-amino modified nucleotide, phosphoramidate, or nucleotide containing a non-natural base. A dsRNA agent according to any one of claims 11 to 15.
17. The guide chain contains an E-vinylphosphonate nucleotide at its 5' end. A dsRNA agent according to any one of claims 1 to 16.
18. The dsRNA agent contains at least one phosphorothioate nucleotide interbond, A dsRNA agent according to any one of claims 1 to 17.
19. The sense strand includes at least one phosphorothioate nucleotide interbonding, A dsRNA agent according to any one of claims 1 to 17.
20. The antisense chain includes at least one phosphorothioate nucleotide interbond, A dsRNA agent according to any one of claims 1 to 17.
21. The sense strand comprises 1, 2, 3, 4, 5, or 6 phosphorothioate nucleotide interlinks. A dsRNA agent according to any one of claims 1 to 17.
22. The antisense chain contains 1, 2, 3, 4, 5, or 6 phosphorothioate nucleotide interlinks. A dsRNA agent according to any one of claims 1 to 17.
23. The modified sense strand is one of the modified sense strand sequences shown in Tables 2 to 3. A dsRNA agent according to any one of claims 1 to 22.
24. The modified antisense chain is one of the modified antisense chain sequences shown in Tables 2-3. A dsRNA agent according to any one of claims 1 to 22.
25. The sense strand and the antisense strand are complementary or basically complementary, and the length of the complementary region is between 16 and 23 nucleotides. A dsRNA agent according to any one of claims 1 to 24.
26. The length of the complementary region is 19 to 21 nucleotides. A dsRNA agent according to any one of claims 1 to 25.
27. Each chain has a length of 30 nucleotides or less. A dsRNA agent according to any one of claims 1 to 26.
28. Each chain has a length of 25 nucleotides or less. A dsRNA agent according to any one of claims 1 to 26.
29. Each chain has a length of 23 or fewer nucleotides. A dsRNA agent according to any one of claims 1 to 26.
30. The dsRNA agent comprises at least one modified nucleotide and further comprises one or more target groups or binding groups. A dsRNA agent according to any one of claims 1 to 29.
31. One or more target groups or binding groups are conjugated to the sense chain. The dsRNA agent according to claim 30.
32. The aforementioned target group or binding group includes N-acetylgalactosamine (GalNAc). The dsRNA agent according to claim 30 or 31.
33. The target group has the following structure: n'' is independently either 1 or 2. A dsRNA agent according to any one of claims 30 to 32.
34. The target group has the following structure: Table 1-1 Table 1-2 Table 1-3 Table 1-4 A dsRNA agent according to any one of claims 30 to 33.
35. The dsRNA agent comprises a target group conjugated to the 5'-terminus of the sense strand. A dsRNA agent according to any one of claims 1 to 34.
36. The dsRNA agent comprises a target group conjugated to the 3' end of the sense strand. A dsRNA agent according to any one of claims 1 to 34.
37. The antisense chain contains one reverse debase residue at its 3' end. A dsRNA agent according to any one of claims 1 to 34.
38. The sense strand contains one or two reverse debase residues or imann residues at its 3' or / and 5' end. A dsRNA agent according to any one of claims 1 to 34.
39. The dsRNA agent has two blunt ends, A dsRNA agent according to any one of claims 1 to 38.
40. At least one strand contains the 3' overhang of at least one nucleotide. A dsRNA agent according to any one of claims 1 to 38.
41. At least one strand contains the 3' overhanging ends of at least two nucleotides. A dsRNA agent according to any one of claims 1 to 38.
42. The CFB RNA transcript is sequence number 1. A dsRNA agent according to any one of claims 1 to 41.
43. A dsRNA agent according to any one of claims 1 to 42, composition.
44. Further comprising a pharmaceutically acceptable carrier, The composition according to claim 43.
45. Further comprising one or more other therapeutic agents, The composition according to claim 44.
46. The composition is packaged in a reagent kit, container, packaging, dispenser, pre-filled syringe, or vial. The composition according to claim 45.
47. The composition is prepared for use in subcutaneous or intravenous (IV) administration. The composition according to any one of claims 43 to 46.
48. A cell comprising a dsRNA agent according to any one of claims 1 to 42, wherein the cell is optionally a mammalian cell and optionally a human cell. cell.
49. A method for inhibiting CFB gene expression in cells, wherein the method is (i) Producing cells containing an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 42 or a composition according to any one of claims 43 to 47, method.
50. (ii) Further comprising inhibiting the expression of the CFB gene in the cells by maintaining the cells produced according to claim 49(i) for a time sufficient to obtain degradation of the mRNA transcript of the CFB gene, The method according to claim 49.
51. The cells are located within the body of the subject, and the dsRNA agent is administered subcutaneously to the subject. The method according to any one of claims 49 to 50.
52. The cells are located within the body of the subject, and the dsRNA agent is administered to the subject by IV administration. The method according to any one of claims 49 to 50.
53. The method further includes evaluating the inhibition of the CFB gene after administering a dsRNA agent to the subject, the means for which the evaluation is performed, (i) To determine one or more physiological characteristics of the subject's CFB-related disease or condition, (ii) Comparing the established physiological characteristics with the baseline pre-treatment physiological characteristics of CFB-related disease or condition and / or control physiological characteristics of CFB-related disease or condition, Of these, the comparison indicates one or more of the presence or absence of inhibition of CFB gene expression in the subject. The method according to claim 51 or 52.
54. The confirmed physiological characteristics are one or more of the following levels in the subject: CFB mRNA level, CFB protein level, or CH50 activity, AH50, lactate dehydrogenase (LDH), hemoglobin level, C3, C9, C5, C5a, C5b, and soluble C5b-9 complex. The method according to claim 53.
55. A reduction in one or more of the following in the subject: CFB mRNA level, CFB protein level in the subject, and / or a reduction in one or more of the following in the subject: CH50 activity, AH50, lactate dehydrogenase (LDH), hemoglobin level, C3 / C9 / C5 / C5a / C5b / soluble C5b-9 complex level, and lipid level in blood or serum, indicates a reduction in CFB gene expression in the subject. The method according to claim 54.
56. A method for inhibiting CFB gene expression in a subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 42 or a composition according to any one of claims 43 to 47. method.
57. The dsRNA agent is administered subcutaneously to the subject. The method according to claim 56.
58. The dsRNA agent is administered to the subject via IV administration. The method according to claim 56.
59. The method further includes evaluating the inhibition of the CFB gene after administering the dsRNA agent, wherein the means for evaluation are: (i) To determine one or more physiological characteristics of the subject's CFB-related disease or condition, (ii) Comparing the established physiological characteristics with the baseline pre-treatment physiological characteristics of CFB-related disease or condition and / or control physiological characteristics of CFB-related disease or condition, Of these, the comparison indicates one or more of the presence or absence of inhibition of CFB gene expression in the subject. The method according to any one of claims 56 to 58.
60. The established physiological characteristics are one or more of the following in the subject: CFB mRNA level, CFB protein level, or CH50 activity, AH50, lactate dehydrogenase (LDH), hemoglobin level, C3, C9, C5, C5a, C5b, soluble C5b-9 complex level, and lipid levels in blood or serum. The method according to claim 59.
61. A reduction in one or more of the following in the subject's CFB mRNA level, a reduction in one or more of the in the subject's CFB protein level, and / or a reduction in one or more of the following in the subject's CH50 activity, AH50, lactate dehydrogenase (LDH), hemoglobin level, C3, C9, C5, C5a, C5b, soluble C5b-9 complex level, and one or more of the lipid levels in blood or serum indicates a reduction in the subject's CFB gene expression. The method according to claim 60.
62. A method for treating a disease or condition associated with the presence of CFB protein, the method comprising administering to a subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 42 or a composition according to any one of claims 43 to 47 in order to inhibit CFB gene expression. method.
63. The aforementioned diseases or conditions include autoimmune diseases, complement system dysfunction including abnormal upregulation of complement components such as CFB, C3 glomerulosis (C3G), systemic lupus erythematosus (SLE), lupus nephritis, Ig-mediated renal lesions such as IgA nephropathy and primary membranous nephropathy, nephropathy, diabetic nephropathy, polycystic kidney disease, membranous nephropathy, age-related macular degeneration (AMD) including dry AMD and geographic atrophy, typical or infectious hemolytic uremic syndrome (tHUS), atypical hemolytic uremic syndrome (aHUS), asthma, psoriasis, thrombotic microangiopathy, ischemia-reperfusion injury, paroxysmal nocturnal hemoglobinuria (PNH), rheumatic diseases, rheumatoid arthritis, multiple sclerosis (MS), neuromyelitis optica (NMO), and immune complex-mediated glomerulonephritis (IC-mediated GN). Post-infectious glomerulonephritis (PIGN), antineutrophil cytoplasmic autoantibody-associated vasculitis (ANCA-AV), antiphospholipid syndrome (APS), periodontal disease with bacterial flora abnormalities, malaria anemia, bullous pemphigoid dermatomyositis, Shiga toxin E-coli-associated hemolytic uremic syndrome, myasthenia gravis (MG), neuromyelitis optica (NMO), dense deposit disease, coronary artery disease, dermatomyositis, Graves' disease, atherosclerosis, Alzheimer's disease, systemic inflammatory response sepsis, septic shock, spinal cord injury, glomerulonephritis, Hashimoto's thyroiditis, type 1 diabetes, psoriasis, pemphigus, autoimmune hemolytic anemia (AIHA), cold agglutinin disease, fluid and vascular graft rejection, graft dysfunction, myocardial infarction, graft allergy, hyperlipidemia, and sepsis (one or more of these). The method according to claim 62.
64. The further comprising administering another treatment plan to the subject, The method according to claim 63.
65. The aforementioned alternative treatment regimen includes administering one or more CFB antisense polynucleotides of the present invention to the subject, administering a non-CFB dsRNA therapeutic agent to the subject, and modifying the subject's behavior. The method according to claim 64.
66. The non-CFB dsRNA therapeutic agent is one or more of the following: C5 inhibitors, for example, anti-complement component C5 antibodies or their antigen-binding fragments (e.g., eculizumab, ravulizumab-cwvz, or pozelimab (REGN3918)), C5 peptide inhibitors (e.g., zilucoplan), or C3 peptide inhibitors (e.g., compstatin). The method according to claim 65.
67. The dsRNA agent is administered subcutaneously to the subject. The method according to any one of claims 62 to 66.
68. The dsRNA agent is administered to the subject via IV administration. The method according to any one of claims 62 to 66.
69. Further including determining the efficacy of administered double-stranded ribonucleic acid (dsRNA) drugs in subjects, The method according to any one of claims 62 to 69.
70. The method for determining the effectiveness of treatment in a subject is: (i) To determine one or more physiological characteristics of the subject's CFB-related disease or condition, (ii) Comparing the established physiological characteristics with the baseline pre-treatment physiological characteristics of CFB-related disease or condition, Of these, the comparison indicates one or more of the presence, absence, and effectiveness levels of administering double-stranded ribonucleic acid (dsRNA) agents to the subject. The method according to claim 69.
71. The established physiological characteristics include the subject's CFB mRNA level, CFB protein level, or CH50 activity, AH50, lactate dehydrogenase (LDH), hemoglobin level, one or more levels of C3, C9, C5, C5a, C5b, and soluble C5b-9 complex, and lipid levels in blood or serum. The method according to claim 70.
72. A reduction in one or more of the following in the subject: CFB mRNA levels, CFB protein levels, and / or a reduction in one or more of the following: CH50 activity, AH50, lactate dehydrogenase (LDH), hemoglobin levels, C3, C9, C5, C5a, C5b, soluble C5b-9 complex levels, and blood or serum lipid levels, indicates that administration of a double-stranded ribonucleic acid (dsRNA) drug to the subject is effective. The method according to claim 70.
73. A method for reducing the level of CFB protein in a subject compared to a baseline pre-treatment level of CFB protein in the subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 42 or a composition according to any one of claims 43 to 47 in order to reduce the level of CFB gene expression. method.
74. The dsRNA agent is administered to the subject subcutaneously or intravenously. The method according to claim 73.
75. A method for altering the physiological characteristics of a CFB-related disease or condition in a subject compared to the baseline pre-treatment physiological characteristics of the CFB-related disease or condition in the subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 42 or a composition according to any one of claims 43 to 47 in order to alter the physiological characteristics of the CFB-related disease or condition in the subject. method.
76. The dsRNA agent is administered to the subject subcutaneously or intravenously. The method according to claim 75.
77. The aforementioned physiological characteristics are one or more of the following in the subject: CFB mRNA level, CFB protein level, CH50 activity, AH50, lactate dehydrogenase (LDH), hemoglobin level, levels of one or more of C3, C9, C5, C5a, C5b, soluble C5b-9 complex, and lipid levels in blood or serum. The method according to any one of claims 75 to 76.