Genetically modified mice expressing human APOE4 and mouse Trem2 p.R47H and methods of use thereof

Abstract

Provided is a genetically modified mouse characterized by one or more symptoms or signs related to non-familial late-onset Alzheimer's disease, with the expression of human APOE4p and mouse Trem2p, wherein the mouse genome comprises: 1) a DNA sequence encoding human APOE4 protein (APOE4p) operably linked to a promoter; and 2) a DNA sequence encoding mouse Trem2 protein (Trem2p) with p.R47H mutation operably linked to a promoter, whereby the mouse expresses human APOE4p and mouse Trem2p.Provided is a method for screening compounds for use in treating Alzheimer's disease using such genetically modified mouse.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority from U.S. Provisional Patent Application No. 62 / 474,358, filed March 21, 2017, the entire contents of which are incorporated herein by reference.

[0002] government support This invention was made with Government support under AG054345 awarded by the National Institutes of Health. The Government has certain rights in this invention.

[0003] FIELD OF THEINVENTION The present invention relates generally to genetically modified mice useful as models for human Alzheimer's disease. In particular aspects, the present invention relates to genetically modified mice expressing human APOE4 and mouse Trem2 p.R47H and methods of use thereof. [Background technology]

[0004] 2. Background of the Invention One of the major obstacles to the development of therapies for Alzheimer's disease (AD) is the lack of animal models for use in preclinical trials. One reason for this may be that existing models are based on familial mutations, while the majority of the clinical population has non-familial, late-onset AD.

[0005] Familial or early-onset Alzheimer's disease is caused by mutations or overexpression in the amyloid precursor protein (APP) gene, or mutations in the presenilin genes (PSEN1 or PSEN2). All of these result in increased production of Abeta42 peptide, which is believed to be neurotoxic. Numerous, if not hundreds, of mouse models have been created that mimic aspects of familial Alzheimer's disease. Many treatments have been found to be effective in these familial Alzheimer's disease mouse models, but none have been effective when tested in clinical trials.

[0006] In contrast, late-onset Alzheimer's disease, which accounts for 95-98% of the human Alzheimer's disease patient population, does not have a simple and clear genetic etiology. Late-onset Alzheimer's disease is thought to be a multifactorial syndrome resulting from diverse genetic and environmental factors that interact with the aging process. Due to this complexity, the genetic factors are still not fully understood, and no useful mouse model of late-onset Alzheimer's disease in humans has been reported to date. Summary of the Invention [Means for solving the problem]

[0007] Summary of the Invention According to an embodiment of the present invention, there is provided a genetically modified mouse characterized by one or more symptoms or signs related to non-familial late-onset Alzheimer's disease with expression of human APOE4p and mouse Trem2p, wherein the genome of the mouse comprises 1) a DNA sequence encoding human APOE4 protein (APOE4p) operably linked to a promoter, and 2) a DNA sequence encoding mouse Trem2 protein (Trem2p) with p.R47H mutation operably linked to a promoter, and the mouse expresses human APOE4p and mouse Trem2p. According to an embodiment of the present invention, the mouse is homozygous for the DNA sequence encoding APOE4p and for the DNA sequence encoding Trem2p.

[0008] According to an embodiment of the present invention, there is provided a genetically modified mouse characterized by one or more symptoms or signs related to non-familial late-onset Alzheimer's disease with expression of human APOE4p and mouse Trem2p, wherein the genome of the mouse comprises 1) a DNA sequence encoding human APOE4 protein (APOE4p) operably linked to a promoter, and 2) a DNA sequence encoding mouse Trem2 protein (Trem2p) with p.R47H mutation operably linked to a promoter, the mouse expresses human APOE4p and mouse Trem2p, the APOE4p comprises the amino acid sequence of SEQ ID NO: 1, or the APOE4p is encoded by the complement of the nucleic acid that hybridizes to SEQ ID NO: 2 under highly stringent hybridization conditions. According to an embodiment of the present invention, the mouse is homozygous for the DNA sequence encoding APOE4p and for the DNA sequence encoding Trem2p.

[0009] According to an embodiment of the present invention, there is provided a genetically modified mouse characterized by one or more symptoms or signs related to non-familial late-onset Alzheimer's disease with expression of human APOE4p and mouse Trem2p, wherein the genome of the mouse comprises 1) a DNA sequence encoding human APOE4 protein (APOE4p) operably linked to a promoter, and 2) a DNA sequence encoding mouse Trem2 protein (Trem2p) with p.R47H mutation operably linked to a promoter, the mouse expresses human APOE4p and mouse Trem2p, the mouse Trem2p comprises the amino acid sequence of SEQ ID NO: 3, or the mouse Trem2p is encoded by the complement of the nucleic acid that hybridizes to SEQ ID NO: 4 under highly stringent hybridization conditions. According to an embodiment of the present invention, the mouse is homozygous for the DNA sequence encoding APOE4p and for the DNA sequence encoding Trem2p.

[0010] According to an embodiment of the present invention, there is provided a genetically modified mouse characterized by one or more symptoms or signs associated with non-familial, late-onset Alzheimer's disease with expression of human APOE4p and mouse Trem2p, wherein the genome of the mouse comprises 1) a DNA sequence encoding a human APOE4 protein (APOE4p) operably linked to a promoter, and 2) a DNA sequence encoding a mouse Trem2 protein (Trem2p) having a p.R47H mutation operably linked to a promoter, and the mouse expresses human APOE4p and mouse Trem2p, wherein APOE4p comprises the amino acid sequence of SEQ ID NO:1, or APOE4p is encoded by the complement of a nucleic acid that hybridizes to SEQ ID NO:2 under highly stringent hybridization conditions, and mouse Trem2p comprises the amino acid sequence of SEQ ID NO:3, or mouse Trem2p is encoded by the complement of a nucleic acid that hybridizes to SEQ ID NO:4 under highly stringent hybridization conditions. According to an embodiment of the invention, the mouse is homozygous for a DNA sequence encoding APOE4p and for a DNA sequence encoding Trem2p.

[0011] A genetically modified mouse characterized by one or more symptoms or signs associated with non-familial, late-onset Alzheimer's disease with expression of human APOE4p and mouse Trem2p, wherein the genome of the mouse comprises: 1) a DNA sequence encoding a human APOE4 protein (APOE4p) operably linked to a promoter; and 2) a DNA sequence encoding a mouse Trem2 protein (Trem2p) having a p.R47H mutation operably linked to a promoter. tm1.1(APOE*4)Adiuj Trem2 em1Adiuj According to an embodiment of the invention, a genetically modified mouse is provided, which is a . / J mouse, wherein the mouse is homozygous for a DNA sequence encoding APOE4p and for a DNA sequence encoding Trem2p, and which expresses human APOE4p and mouse Trem2p.

[0012] According to an embodiment of the present invention, a method for screening for treatment for use in the treatment of Alzheimer's disease is provided, the genetically modified mouse is characterized by one or more symptoms or signs related to non-familial late-onset Alzheimer's disease with the expression of human APOE4p and mouse Trem2p, the genome of the mouse comprises 1) a DNA sequence encoding human APOE4 protein (APOE4p) operably linked to a promoter, and 2) a DNA sequence encoding mouse Trem2 protein (Trem2p) with p.R47H mutation operably linked to a promoter, the mouse expresses human APOE4p and mouse Trem2p, the genetically modified mouse is treated, and the mouse is evaluated for the effect of the treatment on one or more symptoms or signs related to non-familial late-onset Alzheimer's disease with the expression of human APOE4p and mouse Trem2p in the mouse.According to an embodiment of the present invention, the mouse is homozygous for the DNA sequence encoding APOE4p and for the DNA sequence encoding Trem2p. According to an embodiment of the present invention, the step of evaluating the treatment effect comprises comparing the treatment effect on the genetically modified mouse with a control. According to an embodiment of the present invention, the control comprises administering the treatment to a mouse that does not express human APOE4p and mouse Trem2p, and evaluating the treatment effect on the mouse that does not express human APOE4p and mouse Trem2p. According to an embodiment of the present invention, the control comprises administering the treatment to a wild-type C57BL / 6J mouse, and evaluating the treatment effect on the wild-type C57BL / 6J mouse. According to an embodiment of the present invention, the control comprises administering the treatment to an APOE3-expressing mouse, and evaluating the treatment effect on the APOE3-expressing mouse.

[0013] A method for screening for treatments for use in the treatment of Alzheimer's disease, comprising the steps of: (a) screening for a treatment for use in the treatment of Alzheimer's disease; (b) screening for a treatment for use in the treatment of Alzheimer's disease; and (c) screening for a treatment for use in the treatment of Alzheimer's disease. The method comprises the steps of: (a) screening for a treatment for use in the treatment of Alzheimer's disease; According to an embodiment of the present invention, a method is provided, comprising administering a treatment to a genetically modified mouse, the mouse expressing human APOE4p and mouse Trem2p, the APOE4p comprising the amino acid sequence of SEQ ID NO: 1 or the APOE4p being encoded by the complement of the nucleic acid that hybridizes with SEQ ID NO: 2 under highly stringent hybridization conditions; and evaluating the effect of the treatment in the mouse on one or more symptoms or signs associated with the expression of human APOE4p and mouse Trem2p that are related to non-familial late-onset Alzheimer's disease. According to an embodiment of the present invention, the mouse is homozygous for the DNA sequence encoding APOE4p and for the DNA sequence encoding Trem2p. According to an embodiment of the present invention, the step of evaluating the effect of the treatment comprises comparing the effect of the treatment on the genetically modified mouse with a control. According to an embodiment of the present invention, the control comprises administering the treatment to a mouse that does not express human APOE4p and mouse Trem2p, and evaluating the effect of the treatment on the mouse that does not express human APOE4p and mouse Trem2p. According to an embodiment of the present invention, the control comprises administering the treatment to a wild-type C57BL / 6J mouse, and evaluating the effect of the treatment on the wild-type C57BL / 6J mouse. According to an embodiment of the present invention, the control comprises administering the treatment to an APOE3-expressing mouse, and evaluating the effect of the treatment on the APOE3-expressing mouse.

[0014] A method for screening for a treatment for use in the treatment of Alzheimer's disease, comprising the steps of: (a) screening for a treatment for use in the treatment of Alzheimer's disease, comprising: (a) screening for a treatment for use in the treatment of Alzheimer's disease, comprising screening for a treatment for use in the treatment of Alzheimer's disease, comprising screening for a treatment for use in the treatment of Alzheimer's disease, comprising screening for a treatment for use in the treatment of Alzheimer's disease, comprising screening for a treatment for use in the treatment of Alzheimer's disease, comprising screening for a treatment for use in the treatment of Alzheimer's disease, According to an embodiment of the present invention, a method is provided, comprising administering a treatment to a genetically modified mouse, the mouse expressing human APOE4p and mouse Trem2p, the mouse Trem2p comprising the amino acid sequence of SEQ ID NO: 3 or the mouse Trem2p being encoded by the complement of the nucleic acid that hybridizes to SEQ ID NO: 4 under highly stringent hybridization conditions, and evaluating the effect of the treatment on one or more symptoms or signs associated with the expression of human APOE4p and mouse Trem2p in the mouse, which are related to non-familial late-onset Alzheimer's disease. According to an embodiment of the present invention, the mouse is homozygous for the DNA sequence encoding APOE4p and for the DNA sequence encoding Trem2p. According to an embodiment of the present invention, the step of evaluating the effect of the treatment comprises comparing the effect of the treatment on the genetically modified mouse with a control. According to an embodiment of the present invention, the control comprises administering a treatment to a mouse that does not express human APOE4p and mouse Trem2p, and evaluating the effect of the treatment on the mouse that does not express human APOE4p and mouse Trem2p. According to an embodiment of the invention, the control comprises administering the treatment to a wild-type C57BL / 6J mouse and evaluating the effect of the treatment on the wild-type C57BL / 6J mouse. According to an embodiment of the invention, the control comprises administering the treatment to an APOE3-expressing mouse and evaluating the effect of the treatment on the APOE3-expressing mouse.

[0015] 2) a DNA sequence encoding a mouse Trem2 protein having a p.R47H mutation, the DNA sequence being operably linked to a promoter; and 3) a DNA sequence encoding a mouse Trem2 protein having a p.R47H mutation, the mouse expressing human APOE4p and mouse Trem2p; and APOE4p comprising the amino acid sequence of SEQ ID NO: 1 or APOE According to an embodiment of the present invention, a method is provided, comprising: administering a treatment to a genetically modified mouse, in which mouse Trem2p is encoded by the complement of the nucleic acid that hybridizes with SEQ ID NO:2 under highly stringent hybridization conditions, mouse Trem2p comprises the amino acid sequence of SEQ ID NO:3, or mouse Trem2p is encoded by the complement of the nucleic acid that hybridizes with SEQ ID NO:4 under highly stringent hybridization conditions; and evaluating the effect of the treatment on one or more symptoms or signs associated with the expression of human APOE4p and mouse Trem2p in the mouse, which are related to non-familial late-onset Alzheimer's disease. According to an embodiment of the present invention, the mouse is homozygous for the DNA sequence that codes for APOE4p and for the DNA sequence that codes for Trem2p. According to an embodiment of the present invention, the step of evaluating the effect of the treatment comprises comparing the effect of the treatment on the genetically modified mouse with a control. According to an embodiment of the present invention, the control comprises administering the treatment to a mouse that does not express human APOE4p and mouse Trem2p, and evaluating the effect of the treatment on the mouse that does not express human APOE4p and mouse Trem2p. According to an embodiment of the present invention, the control comprises administering the treatment to a wild-type C57BL / 6J mouse, and evaluating the effect of the treatment on the wild-type C57BL / 6J mouse. According to an embodiment of the present invention, the control comprises administering the treatment to an APOE3-expressing mouse, and evaluating the effect of the treatment on the APOE3-expressing mouse.

[0016] A method for screening for a treatment for use in the treatment of Alzheimer's disease, comprising the steps of: (a) screening for a treatment for use in the treatment of Alzheimer's disease; (b) screening for a treatment for use in the treatment of Alzheimer's disease; and (c) screening for a treatment for use in the treatment of Alzheimer's disease. The method comprises the steps of: (a) screening for a treatment for use in the treatment of Alzheimer's disease; (b) screening for a treatment for use in the treatment of Alzheimer's disease; tm1.1(APOE*4)Adiuj Trem2 em1Adiuj According to an embodiment of the present invention, a method is provided, comprising administering a treatment to a genetically modified mouse, the genetically modified mouse being a C57BL / 6J mouse, the mouse being homozygous for the DNA sequence encoding APOE4p and for the DNA sequence encoding Trem2p, and expressing human APOE4p and mouse Trem2p, and evaluating the effect of the treatment in the mouse on one or more symptoms or signs associated with the expression of human APOE4p and mouse Trem2p, which are related to non-familial late-onset Alzheimer's disease. According to an embodiment of the present invention, the step of evaluating the effect of the treatment comprises comparing the effect of the treatment on the genetically modified mouse with a control. According to an embodiment of the present invention, the control comprises administering a treatment to a mouse that does not express human APOE4p and mouse Trem2p, and evaluating the effect of the treatment on the mouse that does not express human APOE4p and mouse Trem2p. According to an embodiment of the present invention, the control comprises administering a treatment to a wild-type C57BL / 6J mouse, and evaluating the effect of the treatment on the wild-type C57BL / 6J mouse. According to an aspect of the invention, the control comprises administering a treatment to an APOE3-expressing mouse and evaluating the effect of the treatment on the APOE3-expressing mouse.

[0017] According to an embodiment of the present invention, a genetically modified mouse is provided, characterized by one or more symptoms or signs associated with non-familial late-onset Alzheimer's disease with the expression of human APOE4p and mouse Trem2p, wherein the genome of the mouse comprises 1) a DNA sequence encoding human APOE4 protein (APOE4p) operably linked to a promoter, and 2) a DNA sequence encoding mouse Trem2 protein (Trem2p) with p.R47H mutation operably linked to a promoter, and the mouse expresses human APOE4p and mouse Trem2p, and a method for screening for a compound for use in treating Alzheimer's disease is provided according to an embodiment of the present invention, comprising administering a compound to the genetically modified mouse, and evaluating the effect of the compound on one or more symptoms or signs associated with the expression of human APOE4p and mouse Trem2p in the mouse, which are associated with non-familial late-onset Alzheimer's disease. According to an embodiment of the present invention, the mouse is homozygous for the DNA sequence encoding APOE4p and for the DNA sequence encoding Trem2p. According to an embodiment of the present invention, the step of evaluating the effect of the compound comprises comparing the effect of the compound on the genetically modified mouse with a control. According to an embodiment of the present invention, the control comprises administering the compound to a mouse that does not express human APOE4p and mouse Trem2p, and evaluating the effect of the compound on the mouse that does not express human APOE4p and mouse Trem2p. According to an embodiment of the present invention, the control comprises administering the compound to a wild-type C57BL / 6J mouse, and evaluating the effect of the compound on the wild-type C57BL / 6J mouse. According to an embodiment of the present invention, the control comprises administering the compound to an APOE3-expressing mouse, and evaluating the effect of the compound on the APOE3-expressing mouse.

[0018] A method for screening for compounds for use in the treatment of Alzheimer's disease, comprising the steps of: (a) screening for compounds for use in the treatment of Alzheimer's disease; (b) screening for compounds for use in the treatment of Alzheimer's disease; and (c) screening for compounds for use in the treatment of Alzheimer's disease. The method comprises the steps of: (a) screening for compounds for use in the treatment of Alzheimer's disease; (b) screening for compounds for use in the treatment of Alzheimer's disease; and (c) screening for compounds for use in the treatment of Alzheimer's disease. According to an embodiment of the present invention, a method is provided, comprising administering a compound to a genetically modified mouse, the mouse expressing human APOE4p and mouse Trem2p, the APOE4p comprising the amino acid sequence of SEQ ID NO: 1 or the APOE4p being encoded by the complement of the nucleic acid that hybridizes with SEQ ID NO: 2 under highly stringent hybridization conditions; and evaluating the effect of the compound in the mouse on one or more symptoms or signs associated with the expression of human APOE4p and mouse Trem2p that are related to non-familial late-onset Alzheimer's disease. According to an embodiment of the present invention, the mouse is homozygous for the DNA sequence encoding APOE4p and for the DNA sequence encoding Trem2p. According to an embodiment of the present invention, evaluating the effect of the compound comprises comparing the effect of the compound on the genetically modified mouse with a control. According to an embodiment of the present invention, the control comprises administering a compound to a mouse that does not express human APOE4p and mouse Trem2p, and evaluating the effect of the compound on the mouse that does not express human APOE4p and mouse Trem2p. According to an embodiment of the invention, the control comprises administering the compound to a wild-type C57BL / 6J mouse and evaluating the effect of the compound on the wild-type C57BL / 6J mouse. According to an embodiment of the invention, the control comprises administering the compound to an APOE3-expressing mouse and evaluating the effect of the compound on the APOE3-expressing mouse.

[0019] According to an embodiment of the present invention, there is provided a genetically modified mouse characterized by one or more symptoms or signs associated with non-familial, late-onset Alzheimer's disease with expression of human APOE4p and mouse Trem2p, wherein the genome of the mouse comprises 1) a DNA sequence encoding a human APOE4 protein (APOE4p) operably linked to a promoter, and 2) a DNA sequence encoding a mouse Trem2 protein (Trem2p) having a p.R47H mutation operably linked to a promoter, and the mouse expresses human APOE4p and mouse Trem2p, and expresses mouse Trem2p. According to an embodiment of the present invention, a method for screening for a compound for use in treating Alzheimer's disease is provided, comprising administering a compound to a genetically modified mouse, wherein p comprises the amino acid sequence of SEQ ID NO:3, or mouse Trem2p is encoded by the complement of the nucleic acid that hybridizes to SEQ ID NO:4 under highly stringent hybridization conditions, and evaluating the effect of the compound in the mouse on one or more symptoms or signs associated with the expression of human APOE4p and mouse Trem2p that are related to non-familial late-onset Alzheimer's disease. According to an embodiment of the present invention, the mouse is homozygous for the DNA sequence encoding APOE4p and for the DNA sequence encoding Trem2p. According to an embodiment of the present invention, evaluating the effect of the compound comprises comparing the effect of the compound on the genetically modified mouse with a control. According to an embodiment of the present invention, the control comprises administering a compound to a mouse that does not express human APOE4p and mouse Trem2p, and evaluating the effect of the compound on the mouse that does not express human APOE4p and mouse Trem2p. According to an embodiment of the invention, the control comprises administering the compound to a wild-type C57BL / 6J mouse and evaluating the effect of the compound on the wild-type C57BL / 6J mouse. According to an embodiment of the invention, the control comprises administering the compound to an APOE3-expressing mouse and evaluating the effect of the compound on the APOE3-expressing mouse.

[0020] A method for screening for compounds for use in the treatment of Alzheimer's disease, comprising the steps of: (a) screening for compounds for use in the treatment of Alzheimer's disease; (b) screening for compounds for use in the treatment of Alzheimer's disease; and (c) screening for compounds for use in the treatment of Alzheimer's disease. The method comprises the steps of: (a) screening for compounds for use in the treatment of Alzheimer's disease; (b) screening for compounds for use in the treatment of Alzheimer's disease; and (c) screening for compounds for use in the treatment of Alzheimer's disease. According to an embodiment of the present invention, a method is provided, comprising administering a compound to a genetically modified mouse, wherein APOE4p comprises the amino acid sequence of SEQ ID NO:1, or APOE4p is encoded by the complement of a nucleic acid that hybridizes with SEQ ID NO:2 under highly stringent hybridization conditions, and mouse Trem2p comprises the amino acid sequence of SEQ ID NO:3, or mouse Trem2p is encoded by the complement of a nucleic acid that hybridizes with SEQ ID NO:4 under highly stringent hybridization conditions, and evaluating the effect of the compound in the mouse on one or more symptoms or signs associated with the expression of human APOE4p and mouse Trem2p that are related to non-familial late-onset Alzheimer's disease. According to an embodiment of the present invention, the mouse is homozygous for the DNA sequence encoding APOE4p and for the DNA sequence encoding Trem2p. According to an embodiment of the present invention, evaluating the effect of the compound comprises comparing the effect of the compound on the genetically modified mouse with a control. According to an embodiment of the invention, the control comprises administering the compound to a mouse that does not express human APOE4p and mouse Trem2p and evaluating the effect of the compound on the mouse that does not express human APOE4p and mouse Trem2p. According to an embodiment of the invention, the control comprises administering the compound to a wild-type C57BL / 6J mouse and evaluating the effect of the compound on the wild-type C57BL / 6J mouse.According to an aspect of the invention, the control comprises administering a compound to an APOE3-expressing mouse and evaluating the effect of the compound on the APOE3-expressing mouse.

[0021] A method for screening for compounds for use in the treatment of Alzheimer's disease, comprising the steps of: (a) screening for compounds for use in the treatment of Alzheimer's disease; (b) screening for compounds for use in the treatment of Alzheimer's disease; and (c) screening for compounds for use in the treatment of Alzheimer's disease. The method comprises the steps of: (a) screening for compounds for use in the treatment of Alzheimer's disease; (b) screening for compounds for use in the treatment of Alzheimer's disease; and (c) screening for compounds for use in the treatment of Alzheimer's disease. tm1.1(APOE*4)Adiuj Trem2 em1AdiujAccording to an embodiment of the present invention, a method is provided, comprising administering a compound to a genetically modified mouse, the genetically modified mouse being a 16-18 17-19 18-20 19-21 19-22 19-23 19-24 19-31 19-32 19-33 19-34 19-35 19-40 19-41 19-42 19-43 19-44 19-45 19-56 19-57 19-60 19-61 19-72 19-83 19-94 19-95 19-10 19-11 19-12 19-13 19-14 19-15 19-16 19-17 19-18 19-20 19-21 19-22 19-23 19-34 19-24 19-35 19-45 19-56 19-61 19-19 19-25 19-26 19-27 19-37 19-38 19-39 19-40 19-57 19-61 19-72 19-83 19-94 19-19 19-24 19-25 19-39 19-39 19-45 19-57 19-61 19-72 19-83 19-94 19-19 19-25 19-39 19-39 19-45 19-57 19-61 19-72 19-83 19-94 19- According to an embodiment of the invention, the control comprises administering the compound to a wild-type C57BL / 6J mouse and evaluating the effect of the compound on the wild-type C57BL / 6J mouse. According to an embodiment of the invention, the control comprises administering the compound to an APOE3-expressing mouse and evaluating the effect of the compound on the APOE3-expressing mouse. [Brief description of the drawings]

[0022] [Figure 1] FIG. 1 is a schematic diagram of the humanized ApoE4 expression construct described in detail in the Examples herein.

[0023] [Diagram 2] Figure 2 is an image of a Western blot of brain tissue from B6(SJL)-Apoetm1.1(APOE*4)AdiujTrem2em1Adiuj / J (generic name B6J.APOE4 / Trem2) mice (lanes 4–6) and control (wild-type (WT) C57BL / 6J (abbreviated as B6J)) mice (lanes 1–3) brain tissue.

[0024] [Figure 3A] FIG. 3A is a graph showing the results of an assay for high density lipoprotein (HDL) in blood samples obtained from 12-month-old B6J.APOE4 / Trem2 mice and 12-month-old C57BL / 6J control mice.

[0025] [Figure 3B] FIG. 3B is a graph showing the results of an assay for low-density lipoprotein (LDL) in blood samples obtained from 12-month-old B6J.APOE4 / Trem2 mice and 12-month-old C57BL / 6J control mice.

[0026] [Figure 3C] FIG. 3C is a graph showing the results of an assay for total cholesterol in blood samples obtained from 12-month-old B6J.APOE4 / Trem2 mice and 12-month-old C57BL / 6J control mice.

[0027] [Figure 4] Figure 4 shows representative images of 7-8 month old B6J.APOE4 / Trem2 tissue immunostained to show collagen IV (ColIV) and fibrin(ogen), along with representative images taken from similar sagittal sections of brains from control C57BL / 6J (abbreviated as B6J) mice, similarly immunostained.

[0028] [Diagram 5] FIG. 5 is a gene expression heat map of differentially expressed genes in B6J.APOE4 / Trem2 mice compared to wild-type control B6J mice. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0029] Detailed Description of the Invention The present invention relates generally to a genetically modified mouse model of non-familial, late-onset Alzheimer's disease that encodes two risk factors for non-familial, late-onset AD exogenously introduced into its genome, such that the mouse produces human apolipoprotein E4 (APOE4) and mouse Trem2 p.R47H protein.

[0030] Human apolipoprotein is a polymorphic protein with three isoforms named ApoE2, ApoE3 and ApoE4.These three isoforms differ from each other in terms of the identity of the amino acids at positions 130 and 176 of the amino acid sequence of the protein (corresponding to positions 112 and 158 of the mature APOE protein without the 18 amino acid signal peptide).ApoE2 is characterized by both cysteine ​​at positions 130 and 176, ApoE3 is characterized by cysteine ​​at position 130 and arginine at position 176, and ApoE4 is characterized by both arginine at positions 130 and 176.Individuals with one or more ApoE4 alleles are at higher risk of developing non-familial late-onset AD, and several mechanisms of pathology have been proposed. See, e.g., DiBattista et al., 2016, Exp. Neurol. 280:97-105; Bu et al., Nature Reviews Neuroscience, 2009, 10:333-344; Huang et al., Cell, 2017, 168:1-15; and Tambini et al., EMBO Reports, 2016, 17:27-36.

[0031] Trem2 (triggering receptor expressed on myeloid cells 2) is an immune phagocytosis receptor expressed by brain microglia. Trem2 triggers the phagocytosis of cellular debris and regulates aspects of the inflammatory response. A rare variant in TREM2 p.R47H is significantly associated with Alzheimer's disease in humans.

[0032] In a particular embodiment, the present invention relates to a genetically modified mouse, whose genome comprises a DNA sequence encoding the human APOE4 protein and a DNA sequence encoding the mouse Trem2 protein having the R47H point mutation.

[0033] The human APOE4 DNA sequence (hereinafter APOE4g) that encodes the human APOE4 protein (hereinafter APOE4p or "human APOE4") is set forth herein as SEQ ID NO: 2. The encoded APOE4p is set forth herein as SEQ ID NO: 1.

[0034] The mouse Trem2 mutant DNA sequence (hereinafter Trem2g) encoding the mouse Trem2 protein (hereinafter Trem2p or "mouse Trem2p") having an R47H point mutation is presented herein as SEQ ID NO: 4. The encoded Trem2p is presented herein as SEQ ID NO: 3.

[0035] In genetically modified mice according to embodiments of the methods of the present invention, one or more genetic modifications may be introduced into the mouse genome to encode a variant of APOE4p and / or a variant of Trem2p.

[0036] As used herein, the term "variant" refers to an APOE4p or Trem2p that contains one or more mutations in its amino acid sequence compared to the corresponding protein of SEQ ID NO: 1 or SEQ ID NO: 3. For example, such mutations can be substitutions, additions, and / or deletions of one or more amino acids, so long as the variant of APOE4p or Trem2p retains the functional properties of APOE4p or Trem2p of SEQ ID NO: 1 or SEQ ID NO: 3, respectively.

[0037] In certain embodiments, APOE4p variants according to embodiments of the invention have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity over their entire length to SEQ ID NO:1, have R (arginine) and R (arginine) at amino acid positions 130 and 176 of the APOE4 protein including the 18 amino acid signal peptide, as shown herein as SEQ ID NO:1, and further retain the functional properties of APOE4p of SEQ ID NO:1.

[0038] In certain embodiments, an APOE4p variant according to embodiments of the invention has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity over its entire length to SEQ ID NO:15, has R (arginine) and R (arginine) at amino acid positions 112 and 158 of the APOE4 protein without the 18 amino acid signal peptide, as shown herein as SEQ ID NO:15, and further retains the functional properties of APOE4p of SEQ ID NO:15.

[0039] In certain embodiments, Trem2p variants according to embodiments of the present invention have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity over their entire length to SEQ ID NO:3 and retain the functional properties of Trem2p of SEQ ID NO:3.

[0040] Mutations can be introduced using standard molecular biology techniques, such as CRISPR technology. Alternative techniques include site-directed mutagenesis and PCR-mediated mutagenesis. Those skilled in the art will recognize that one or more amino acid mutations can be introduced without altering the functional properties of APOE4p and mouse Trem2p proteins.

[0041] Assays for assessing the functional properties of APOE4p, Trem2p and variants are known in the art.

[0042] Conservative amino acid substitution can be made in APOE4p and Trem2p protein to generate APOE4p and Trem2p variants.Conservative amino acid substitution is recognized in the art as replacing one amino acid with another amino acid with similar properties.For example, each amino acid can be described as having one or more of the following properties: electropositive, electronegative, aliphatic, aromatic, polar, hydrophobic and hydrophilic.Conservative substitution is replacing one amino acid with a specific structural or functional property with another amino acid with the same property. Acidic amino acids include aspartic acid, glutamic acid, basic amino acids include histidine, lysine, arginine, aliphatic amino acids include isoleucine, leucine and valine, aromatic amino acids include phenylalanine, glycine, tyrosine and tryptophan, polar amino acids include aspartic acid, glutamic acid, histidine, lysine, asparagine, glutamine, arginine, serine, threonine and tyrosine, hydrophobic amino acids include alanine, cysteine, phenylalanine, glycine, isoleucine, leucine, methionine, proline, valine and tryptophan, and conservative substitutions include substitutions between amino acids in each group. Amino acids can also be described in terms of relative size, alanine, cysteine, aspartic acid, glycine, asparagine, proline, threonine, serine, valine, all of which are typically considered to be small molecules.

[0043] APOE4p and Trem2p variants can include synthetic amino acid analogs, amino acid derivatives and / or non-standard amino acids, illustratively including, but not limited to, alpha-aminobutyric acid, citrulline, canavanine, cyanoalanine, diaminobutyric acid, diaminopimelic acid, dihydroxy-phenylalanine, dienkolinic acid, homoarginine, hydroxyproline, norleucine, norvaline, 3-phosphoserine, homoserine, 5-hydroxytryptophan, 1-methylhistidine, 3-methylhistidine, and ornithine.

[0044] It will be understood by those skilled in the art that due to the degenerate nature of the genetic code, nucleic acid sequences other than SEQ ID NO:2 and SEQ ID NO:4 encode APOE4p and Trem2p, respectively, and such selective nucleic acids can be introduced into the mouse genome to generate genetically modified mice of the present disclosure that express APOE4p and Trem2p.

[0045] The singular terms "a," "an," and "the" are not intended to be limiting and include plural referents unless expressly stated otherwise or the context clearly dictates otherwise.

[0046] The terms "expressing" and "express" refer to the transcription of a gene to produce the corresponding mRNA and / or the translation of mRNA to produce the corresponding protein.

[0047] The APOE4p and Trem2p variants are each encoded by a nucleic acid having a high degree of identity to SEQ ID NO: 2 or SEQ ID NO: 4. The complement of a nucleic acid encoding an APOE4p variant specifically hybridizes under high stringency conditions to SEQ ID NO: 2, which encodes APOE4p. The complement of a nucleic acid encoding a Trem2p variant specifically hybridizes under high stringency conditions to SEQ ID NO: 4, which encodes Trem2p.

[0048] The term "nucleic acid" refers to an RNA or DNA molecule having more than one nucleotide in any form, including single-stranded, double-stranded, oligonucleotide or polynucleotide. The term "nucleotide sequence" refers to the ordering of nucleotides in an oligonucleotide or polynucleotide in a single-stranded form of a nucleic acid.

[0049] The terms "hybridization" and "hybridize" refer to the pairing and binding of complementary nucleic acids. Hybridization occurs to various degrees between two nucleic acids, as is well known in the art, depending on factors such as the degree of complementarity of the nucleic acids, the melting temperature Tm of the nucleic acids, and the stringency of the hybridization conditions.

[0050] The term "stringency of hybridization conditions" refers to conditions of temperature, ionic strength, and composition of hybridization medium with respect to certain common additives such as formamide and Denhardt's solution. Determination of specific hybridization conditions for a particular nucleic acid is routine and well known in the art, for example, as described in J. Sambrook and DW Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press; 3rd ed., 2001; and FM Ausubel, ed., Short Protocols in Molecular Biology, Current Protocols; 5th ed., 2002. High stringency hybridization conditions are conditions that allow only hybridization of substantially complementary nucleic acids. Typically, nucleic acids with about 85-100% complementarity are considered to be highly complementary and hybridize under high stringency conditions. Moderate stringency conditions are exemplified by conditions under which nucleic acids having a moderate degree of complementarity, i.e., about 50-84% complementarity, as well as nucleic acids having a high degree of complementarity, hybridize. In contrast, low stringency hybridization conditions are conditions under which nucleic acids having a low degree of complementarity hybridize.

[0051] The terms "specific hybridization" and "specifically hybridize" refer to hybridization of a particular nucleic acid to a target nucleic acid without substantial hybridization to nucleic acids other than the target nucleic acid in a sample.

[0052] The stringency of hybridization and washing conditions depends on several factors, including the Tm of probe and target and the ionic strength of hybridization and washing conditions, as known to those skilled in the art.The conditions of hybridization and achieving desired hybridization stringency are described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 2001; and Ausubel, F. et al. (eds.), Short Protocols in Molecular Biology, Wiley, 2002.

[0053] An example of high stringency hybridization conditions is hybridization of nucleic acids greater than about 100 nucleotides in length in a solution containing 6xSSC, 5xDenhardt's solution, 30% formamide, and 100 micrograms / ml denatured salmon sperm overnight at 37°C, followed by a 15 minute wash in a solution of 0.1xSSC and 0.1% SDS at 60°C. SSC is 0.15M NaCl / 0.015M Na citrate. Denhardt's solution is 0.02% bovine serum albumin / 0.02% Ficoll / 0.02% polyvinylpyrrolidone.

[0054] The term "complementarity" refers to Watson-Crick base pairing between nucleotides, specifically nucleotides that hydrogen bond with each other with thymine or uracil residues linked to adenine residues by two hydrogen bonds, and cytosine and guanine residues linked by three hydrogen bonds. In general, nucleic acids include nucleotide sequences that are described as having a "percent complementarity" to a particular second nucleotide sequence. For example, a nucleotide sequence can have 80%, 90% or 100% complementarity to a particular second nucleotide sequence, indicating that 8 / 10, 9 / 10 or 10 / 10 nucleotides of the sequence are complementary to the particular second nucleotide sequence. For example, the nucleotide sequence 3'-TCGA-5' is 100% complementary to the nucleotide sequence 5'-AGCT-3'. Furthermore, the nucleotide sequence 3'-TCGA- is 100% complementary to the region of the nucleotide sequence 5'-TTAGCTGG-3'.

[0055] To determine the percent identity of two amino acid sequences or two nucleic acid sequences, the sequences are aligned and optimally compared (e.g., gaps can be introduced into the first amino acid or nucleic acid sequence to optimally align with the second amino acid or nucleic acid sequence). The amino acid residues or nucleotides at the corresponding amino acid or nucleotide positions are then compared. If a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, the molecules are identical at that position. The percent identity between two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity = number of identical overlapping positions / total number of positions x 100%). In one embodiment, the two sequences are identical in length or differ in length by no more than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10% of the total length of the reference sequence.

[0056] Determining the percent identity between two sequences can also be accomplished using a mathematical algorithm. A preferred, non-limiting example of a mathematical algorithm utilized for comparing two sequences is the algorithm of Karlin and Altschul, 1990, PNAS 87:2264-2268, modified as in Karlin and Altschul, 1993, PNAS 90:5873-5877. Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et al., 1990, J. Mol. Biol. 215:403. BLAST nucleotide searches are performed, for example, with the NBLAST nucleotide program parameters set to score=100, wordlength=12 to obtain nucleotide sequences homologous to the nucleic acid molecules of the present invention. BLAST protein searches are performed, for example, with the XBLAST program parameters set to score 50, wordlength=3 to obtain amino acid sequences homologous to the protein molecules of the present invention. To obtain and compare gapped alignments, Gapped BLAST is utilized as described by Altschul et al., 1997, Nucleic Acids Res. 25:3389-3402. Alternatively, PSI BLAST is used to perform an iterated search that detects distant relationships between molecules (ibid.). When utilizing BLAST, Gapped BLAST, and PSI Blast programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST parameters) are used (see, e.g., the NCBI website). Another preferred, non-limiting example of a mathematical algorithm utilized for comparing sequences is the algorithm of Myers and Miller, 1988, CABIOS 4:11-17. Such an algorithm is incorporated into the ALIGN program (version 2.0), which is part of the GCG sequence alignment software package. When utilizing the ALIGN program to compare amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 are used.

[0057] The percent identity between two sequences is determined using techniques similar to those described above, with or without gaps. In calculating percent identity, typically only exact matches are counted.

[0058] Nucleic acids encoding APOE4p, Trem2p, or variants of either thereof can be isolated from natural sources, produced recombinantly, or produced by chemical synthesis techniques using well-known methods.

[0059] Genetically engineered mice

[0060] Provided according to embodiments of the invention are genetically modified mice whose genome comprises a nucleic acid encoding APOE4p operably linked to a promoter, whereby the animal expresses the encoded APOE4p, and whose genome comprises a nucleic acid encoding Trem2p operably linked to a promoter, whereby the animal expresses the encoded Trem2p.

[0061] Provided according to embodiments of the invention are genetically modified mice whose genome comprises a nucleic acid encoding APOE4p operably linked to the endogenous mouse Apoe promoter, whereby the animal expresses the encoded APOE4p, and whose genome comprises a nucleic acid encoding Trem2p operably linked to the endogenous mouse Trem2 promoter, whereby the animal expresses the encoded Trem2p.

[0062] Any of a variety of methods can be used to introduce the genetic modifications into the mouse genome to generate genetically modified mice that express APOE4p and Trem2p.

[0063] Genome editing methods for generating genetically modified mice according to embodiments of the present invention, whose genome comprises a nucleic acid encoding APOE4p operably linked to a promoter, where the animal expresses the encoded APOE4p, and whose genome comprises a nucleic acid encoding Trem2p operably linked to a promoter, where the animal expresses the encoded Trem2p, include, but are not limited to, site-directed mutagenesis, recombination-based methods, and nuclease genome editing techniques.

[0064] Genome editing techniques can be used to modify genomic sequences by introducing discrete mutations at defined target sites in the genome.

[0065] For example, one or more nucleotides of a genomic sequence can be replaced with one or more different nucleotides using genome editing techniques, thereby causing the genomic sequence to encode a protein that differs by a single amino acid or by multiple amino acids compared to the unmodified genomic sequence.

[0066] Genome editing techniques can also be used to modify genomic sequences by "knock-in" techniques, which insert coding sequences at predetermined target sites within the genome.

[0067] As used herein, the terms "target site" and "target sequence" refer to a nucleic acid sequence that defines a portion of a chromosomal sequence to be edited, in the general context of gene editing techniques.

[0068] For example, a nucleic acid sequence encoding a protein can be inserted into a predetermined target site in the genome, thereby causing the genome to contain the nucleic acid encoding the protein and express the protein. The nucleic acid sequence can also contain a promoter to drive expression of the encoded protein, or the nucleic acid can be inserted at a location such that, when the nucleic acid is operably linked to the endogenous promoter, expression of the encoded protein can be driven by the endogenous promoter.

[0069] According to a particular embodiment of the present invention, a point mutation is introduced into the genome of a first mouse using genome editing technology, so that the mouse encodes Trem2p, and a nucleic acid encoding human APOE4 is inserted into the Apoe4 gene of the genome of a second mouse by "knock-in" genome editing technology, so that the genome of the second mouse contains a "humanized" APOE4 gene, which includes exon 1 of the mouse Apoe4 gene and exons 2, 3 and 4 of the human APOE4 gene, as shown in Figure 1. The first and second mice are then naturally or artificially bred to obtain a genetically modified mouse whose genome includes a DNA sequence encoding APOE4p and a DNA sequence encoding Trem2p.

[0070] According to a particular embodiment of the present invention, a point mutation is introduced into the genome of a first mouse using CRISPR genome editing technology, so that the mouse encodes Trem2p, and a nucleic acid encoding human APOE4 is introduced into the Apoe4 gene of the genome of a second mouse by "knock-in" CRISPR genome editing technology, so that the genome of the second mouse contains a "humanized" APOE4 gene, which includes exon 1 of the mouse Apoe4 gene and exons 2, 3 and 4 of the human APOE4 gene, as shown in Figure 1. The first and second mice are then naturally or artificially bred to generate a genetically modified mouse whose genome includes the DNA sequence encoding APOE4p and the DNA sequence encoding Trem2p.

[0071] Genome editing can be performed, for example, by the methods described herein, as well as by other methods described in JP Sundberg and T. Ichiki, eds., Genetically Engineered Mice Handbook, CRC Press, 2006; MH Hofker and J. van Deursen, eds., Transgenic Mouse Methods and Protocols, Humana Press, 2002; AL Joyner, Gene Targeting: A Practical Approach, Oxford University Press, 2000; Manipulating the Mouse Embryo: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, December 15, 2002; ISBN-10:0879695919; Kursad Turksen (ed.), Embryonic stem cells: methods and protocols in Methods Mol Biol. 2002, Vol. 185, Humana Press; Current Protocols in Stem Cell Biology, ISBN:978047015180; Meyer et al., PNAS USA, 2010, 107(34), 15022-15026; and Doudna, J. et al. (eds.) CRISPR-Cas: A Laboratory Manual, 2016, CSHP. A brief description of several genome editing techniques is provided herein.

[0072] Nuclease technology for genetic modification of mice

[0073] Genetic modification methods, including but not limited to nuclease gene editing technology, can be used to introduce desired DNA sequences into a predetermined target site in the genome, such as homing endonucleases, integrases, meganucleases, transposon-based methods, zinc finger nucleases (ZFNs), transcription activator-like (TALs), clustered regularly interspaced short palindromic repeats (CRISPR)-Cas or Drosophila recombination-associated protein (DRAP)-mediated processes. Briefly, the genetic modification methods that can be used include introducing an RNA molecule and at least one oligonucleotide that codes for target TALEN, ZFN, CRISPR or DRAP into ES cells, iPS cells, somatic cells, fertilized oocytes or embryos, and then selecting ES cells, iPS cells, somatic cells, fertilized oocytes or embryos that have desired genetic modifications.

[0074] For example, a desired nucleic acid sequence can be introduced into a predetermined target site in the genome of a mouse by nuclease techniques, including, but not limited to, CRISPR, TAL (transcription activator-like) effector, zinc finger-mediated genome editing, or DRAP, to generate genetically modified mice provided according to embodiments of the present invention, whose genome comprises a nucleic acid encoding APOE4p operably linked to a promoter, where the animal expresses the encoded APOE4p, and whose genome comprises a nucleic acid encoding Trem2p operably linked to a promoter, where the animal expresses the encoded Trem2p.

[0075] As used herein, the terms "target site" and "target sequence," in the context of nuclease gene editing technologies, refer to a nucleic acid sequence that defines the portion of a chromosomal sequence to be edited, as well as a nucleic acid sequence that a nuclease is modified to recognize and bind to, when sufficient conditions for binding are present.

[0076] CRISPR-Cas system

[0077] CRISPR (clustered regularly interspaced short palindromic repeats) are loci containing multiple short tandem repeats found in approximately 40% of sequenced bacterial and 90% of sequenced archaeal genomes and confer resistance to foreign DNA elements. See Horvath, 2010, Science 327:167-170; Barrangou et al., 2007, Science 315:1709-1712; and Makarova et al., 2011, Nature Reviews Microbiology. 9:467-477.

[0078] CRISPR repeats range in size from 24 to 48 base pairs. They usually exhibit approximate dyad symmetry, implying the formation of secondary structures such as hairpins, but are not strictly palindromic. CRISPR repeats are separated by spacers of similar length.

[0079] CRISPR-associated (cas) genes are often associated with CRISPR repeat-spacer arrays. More than 40 different Cas protein families have been described (Haft et al. 2005, PLoS Comput Biol. vol. 1(6):e60). Using specific combinations of cas genes and repeat structures, eight CRISPR subtypes have been defined, some of which are associated with additional gene modules that code for repeat-associated mysterious proteins (RAMPs).

[0080] There are many different CRISPR systems in different organisms, one of the simplest is the type II CRISPR system from Streptococcus pyogenes, where only a single gene encoding Cas9 protein and two RNAs, the mature CRISPR RNA (crRNA) and a partially complementary trans-acting RNA (tracrRNA), are necessary and sufficient for RNA-guided silencing of foreign DNA (Gasiunas et al., 2012, PNAS 109:E2579-E2586; Jinek et al., 2012, Science 337:816-821). Maturation of the crRNA requires tracrRNA and RNaseIII (Deltcheva et al., 2011, Nature 471:602-607). However, this requirement can be circumvented by using engineered short guide RNAs (sgRNAs) that contain designed hairpins that mimic the tracrRNA-crRNA complex (Jinek et al., 2012, Science 337:816-821). Base pairing between the sgRNA and the target DNA generates a double-strand break (DSB) due to the endonuclease activity of Cas9. Binding specificity is determined by both sgRNA-DNA base pairing and a short DNA motif (protospacer adjacent motif [PAM] sequence: NGG) juxtaposed to the DNA complementary region (Marraffini and Sontheimer, 2010, Nature Reviews Genetics 11:181-190). For example, the CRISPR system requires a minimal set of two molecules, Cas9 protein and sgRNA, and therefore can be used as a host-independent gene targeting platform. Cas9 / CRISPR can be utilized for site-selective RNA-guided genome editing, e.g., targeted insertion.See, e.g., Carroll, 2012, Molecular Therapy 20:1658-1660; Chang et al., 2013, Cell Research 23:465-472; Cho et al., 2013, Nature Biotechnol 31:230-232; Cong et al., 2013, Science 339:819-823; Hwang et al., 2013, Nature Biotechnol 31:227-229; Jiang et al., 2013, Nature Biotechnol 31:233-239; Mali et al., 2013, Science 339:823-826; Qi et al., 2013, Cell 152:1173-1183; Shen et al., 2013, Cell Research 23:720-723; and Wang et al., 2013, Cell 153:910-918. In particular, Wang et al., 2013, Cell 153:910-918 describes targeted insertion using the CRISPR / Cas9 system in combination with oligonucleotides.

[0081] TAL (Transcription Activator-Like) Effectors

[0082] Transcription activator-like (TAL) effectors or TALEs (transcription activator-like effectors) are derived from the plant pathogenic fungal genus Xanthomonas, and these proteins mimic plant transcription activators to manipulate plant transcripts. See Kay et al., 2007, Science 318:648-651.

[0083] TAL effectors contain a domain packed with tandem repeats, each containing approximately 34 amino acids that are key to the DNA binding specificity of these proteins. In addition, the TAL effectors contain a nuclear localization sequence and an acidic transcription activation domain. For reviews, see Schornack et al., 2006, J. Plant Physiol. 163(3):256-272; Scholze and Boch, 2011, Curr Opin Microbiol 14:47-53.

[0084] The specificity of TAL effectors depends on the sequence found in the tandem repeat. This repeat sequence contains about 102 bp, and the repeats are typically 91-100% homologous to each other (Bonas et al., 1989, Mol Gen Genet 218:127-136). The polymorphisms in the repeats are usually located at positions 12 and 13, and there is thought to be a one-to-one correspondence in the identity between the two hypervariable residues at positions 12 and 13, as well as the identity of consecutive nucleotides in the TAL effector target sequence. See Moscou and Bogdanove, 2009, Science 326:1501; and Boch et al., 2009, Science 326:1509-1512. The two hypervariable residues, known as repeat variable dimers (RVDs), ensure that one RVD recognizes one nucleotide in a DNA sequence, allowing the DNA-binding domain of each TAL effector to target a wide range of recognition sites (15-30 nt) with high precision. Experimentally, the DNA recognition code of these TAL effectors has been determined such that the HD sequence at positions 12 and 13 results in binding to cytosine (C), NG binds to T, NI binds to A, C, G or T, NN binds to A or G, and IG binds to T. These DNA-binding repeats have been constructed into proteins with new combinations and numbers of repeats to create artificial transcription factors capable of interacting with new sequences and activating the expression of reporter genes in plant cells (Boch et al. 2009, Science 326:1509-1512). These DNA-binding domains have been shown to have general applicability in the field of targeted genome editing or targeted gene regulation in all cell types. See Gaj et al., Trends in Biotechnol, 2013, 31(7):397-405. Additionally, engineered TAL effectors have been shown to function in association with exogenous functional protein effector domains, such as nucleases, that are not naturally found in native Xanthomonas TAL effectors or proteins in mammalian cells.TAL nucleases (TALNs or TALENs) can be constructed by combining TALs with nucleases, such as N- or C-terminal FokI nuclease domains. Kim et al. 1996, PNAS 93:1156-1160; Christian et al. 2010, Genetics 186:757-761; Li et al. 2011, Nucleic Acids Res 39:6315-6325; and Miller et al. 2011, Nat Biotechnol 29:143-148. The functionality of TALENs to cause deletions by NHEJ has been demonstrated in rats, mice, zebrafish, Xenopus, medaka, rats and human cells. Ansai et al., 2013, Genetics 193:739-749; Carlson et al., 2012, PNAS 109:17382-17387; Hockemeyer et al., 2011, Nature Biotechnol. 29:731-734; Lei et al., 2012, PNAS 109:17484-17489; Moore et al., 2012, PLoS ONE 7:e37877; Stroud et al., 2013, J. Biol. Chem. 288:1685-1690; Sung et al., 2013, Nature Biotechnol 31:23-24; Wefers et al., 2013, PNAS 110:3782-3787.

[0085] Methods for producing such TALENs are further described in U.S. Patent Nos. 8,420,782, 8,450,471, 8,450,107, 8,440,432 and 8,440,431, and U.S. Patent Application Publication Nos. 2013 / 0137161 and 2013 / 0137174.

[0086] Other useful endonucleases can include, for example, HhaI, HindIII, NotI, BbvCI, EcoRI, Bg / I, and AlwI. The fact that some endonucleases (e.g., FokI) function only as dimers can be exploited to enhance the target specificity of TAL effectors. For example, in some cases, each FokI monomer can be fused to a TAL effector sequence that recognizes a different DNA target sequence, and only when the two recognition sites are in close proximity will the inactive monomers actually assemble to generate a functional enzyme. By requiring DNA binding to activate the nuclease, highly site-specific restriction enzymes can be generated.

[0087] In some embodiments, TALEN can further comprise a nuclear localization signal or sequence (NLS). NLS is an amino acid sequence that targets TALEN nuclease protein and promotes the introduction of double-stranded breaks at the target sequence of chromosome into the nucleus.

[0088] Nuclear localization signals are known in the art, see, for example, Makkerh et al. 1996, Curr Biol. 6:1025-1027. NLSs include the sequence PKKKRKV (SEQ ID NO: 16) from SV40 large T antigen, Kalderon 1984, Cell 39:499-509; RPAATKKAGQAKKK (SEQ ID NO: 17) from nucleoplasmin, Dingwallet et al. 1988, J Cell Biol. 107:841-9. Further examples are described in McLane and Corbett 2009, IUBMB Life 61:697-70; Dopie et al. 2012, PNAS 109:E544-E552.

[0089] The cleavage domain can be obtained from any endonuclease or exonuclease. Non-limiting examples of endonucleases from which the cleavage domain can be derived include, but are not limited to, restriction endonucleases and homing endonucleases. See, for example, 2002-2003 Catalog, New England Biolabs, Beverly, Mass.; and Belfort et al. (1997) Nucleic Acids Res. vol. 25:3379-3388. Additional enzymes that cleave DNA are known, such as SI nuclease, mung bean nuclease, pancreatic DNase I, micrococcal nuclease, yeast HO endonuclease. See also Linn et al. (eds.) Nucleases, Cold Spring Harbor Laboratory Press, 1993. One or more of these enzymes, or functional fragments thereof, can be used as a source of cleavage domain.

[0090] Zinc finger-mediated genome editing

[0091] The use of zinc finger nuclease (ZFN) for gene editing, for example, for targeted insertion via homology-directed repair process, is well established.See, for example, Carbery et al., 2010, Genetics, 186:451-459; Cui et al., 2011, Nature Biotechnol., 29:64-68; Hauschild et al., 2011, PNAS, 108:12013-12017; Orlando et al., 2010, Nucleic Acids Res., 38:e152-e152; and Porteus and Carroll, 2005, Nature Biotechnology, 23:967-973.

[0092] The components of ZFN-mediated process include zinc finger nucleases with DNA binding domain and cleavage domain.These are described, for example, in Beerli et al. (2002) Nature Biotechnol., 20:135-141; Pabo et al. (2001) Ann. Rev. Biochem., 70:313-340; Isalan et al. (2001) Nature Biotechnol., 19:656-660; Segal et al. (2001) Curr Opin. Biotechnol., 12:632-637; and Choo et al. (2000) Curr Opin. Struct. Biol., 10:411-416; and U.S. Patent No. 6,453,242 and 6,534,261. Methods for designing and selecting zinc finger binding domains for target sequences are known in the art, see, e.g., Sera et al., Biochemistry 2002, vol. 41, pp. 7074-7081; U.S. Patent Nos. 6,607,882, 6,534,261, and 6,453,242.

[0093] In some embodiments, zinc finger nuclease can further comprise nuclear localization signal or sequence (NLS). NLS is an amino acid sequence that promotes zinc finger nuclease protein to target and introduce double-stranded break ends in chromosomal target sequence into nucleus. Nuclear localization signal is known in the art. For example, see Makkerh et al. (1996) Current Biology 6:1025-1027.

[0094] The cleavage domain can be obtained from any endonuclease or exonuclease. Non-limiting examples of endonucleases from which the cleavage domain can be derived include, but are not limited to, restriction endonucleases and homing endonucleases. See, for example, 2002-2003 Catalog, New England Biolabs, Beverly, Mass.; and Belfort et al. (1997) Nucleic Acids Res. vol. 25:3379-3388. Additional enzymes that cleave DNA are known (e.g., SI nuclease, mung bean nuclease, pancreatic DNase I, micrococcal nuclease, yeast HO endonuclease). See also Linn et al. (eds.) Nucleases, Cold Spring Harbor Laboratory Press, 1993. One or more of these enzymes (or functional fragments thereof) can be used as a source of cleavage domain. The cleavage domain can also be derived from an enzyme or portion thereof that requires dimerization to activate cleavage, as described above.

[0095] Two zinc finger nucleases may be required for cleavage, as each nuclease contains a monomer of an active enzyme dimer. Alternatively, a single zinc finger nuclease may contain both monomers generating an active enzyme dimer. Restriction endonucleases (restriction enzymes) exist in many species and are capable of sequence-specific binding to DNA (to a recognition site) and cleaving DNA at or near the binding site. Certain restriction enzymes (e.g., type IIS) cleave DNA at a site removed from the recognition site and have separable binding and cleavage domains. For example, the type IIS enzyme FokI catalyzes double-stranded cleavage of DNA at the 9th nucleotide from its recognition site on one strand and the 13th nucleotide from its recognition site on the other strand. See, for example, U.S. Patent Nos. 5,356,802, 5,436,150 and 5,487,994, and Li et al. (1992) PNAS 89:4275-4279; Li et al. (1993) PNAS 90:2764-2768; Kim et al. (1994) PNAS 91:883-887; Kim et al. (1994) J. Biol. Chem. 269:31,978-31,982. Thus, zinc finger nucleases can include at least one cleavage domain from a type IIS restriction enzyme and one or more zinc finger binding domains, which may or may not be modified. Exemplary type IIS restriction enzymes are described, for example, in International Publication WO07 / 014275, the disclosure of which is incorporated herein by reference in its entirety. Additional restriction enzymes also contain separable binding and cleavage domains, which are also contemplated by this disclosure. See, for example, Roberts et al. (2003) Nucleic Acids Res. 31:418-420. An exemplary type IIS restriction enzyme in which the cleavage domain is separable from the binding domain is FokI. This particular enzyme is active as a dimer (Bitinaite et al., 1998, PNAS 95:10, 570-10, 575). Thus, for purposes of this disclosure, the portion of the FokI enzyme used in zinc finger nucleases is considered to be a cleavage monomer.Thus, in target double-stranded cleavage using a FokI cleavage domain, two zinc finger nucleases, each of which contains a FokI cleavage monomer, can be used to reconstitute an active enzyme dimer.Alternatively, a single polypeptide molecule containing a zinc finger binding domain and two FokI cleavage monomers can also be used.In certain embodiments, the cleavage domain can contain one or more modified cleavage monomers that minimize or prevent homodimerization, as described, for example, in U.S. Patent Publication Nos. 2005 / 0064474, 2006 / 0188987, and 2008 / 0131962, each of which is incorporated herein by reference in its entirety. As a non-limiting example, amino acid residues at positions 446, 447, 479, 483, 484, 486, 487, 490, 491, 496, 498, 499, 500, 531, 534, 537, and 538 of FokI are all targets that affect dimerization of the FokI cleavage half-domain. Exemplary engineered cleavage monomers of FokI that form obligate heterodimers include pairs in which a first cleavage monomer contains mutations at amino acid residues 490 and 538 of FokI, and a second cleavage monomer contains mutations at amino acid residues 486 and 499. Thus, in one embodiment, the mutation at amino acid residue position 490 replaces Glu (E) with Lys (K), the mutation at amino acid residue position 538 replaces Ile (I) with Lys (K), the mutation at amino acid residue position 486 replaces Gln (Q) with Glu (E), and the mutation at position 499 replaces Ile (I) with Lys (K). In particular, modified truncation monomers can be prepared by mutating position 490 from E to K and position 538 from I to K in one truncation monomer to create a modified truncation monomer called "E490K:I538K" and by mutating position 486 from Q to E and position 499 from I to L in another truncation monomer to create a modified truncation monomer called "Q486E:I499L". The modified truncation monomers described above are obligate heterodimer mutants in which aberrant cleavage is minimized or eliminated.The modified truncation monomers can be prepared using suitable methods, for example, by site-directed mutagenesis of the wild-type truncation monomer (FokI) as described in US Patent Publication No. 2005 / 0064474.

[0096] The above zinc finger nuclease can be modified to introduce double-stranded breaks into target integration sites. The double-stranded breaks can be at target integration sites or can be up to 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100 or 1000 nucleotides away from integration sites. In some embodiments, the double-stranded breaks can be up to 1, 2, 3, 4, 5, 10, 15 or 20 nucleotides away from integration sites. In other embodiments, the double-stranded breaks can be up to 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides away from integration sites. In still other embodiments, the double-stranded breaks can be up to 50, 100 or 1000 nucleotides away from integration sites.

[0097] DRAP technology is described in US Pat. Nos. 6,534,643, 6,858,716 and 6,830,910 and in Watt et al., 2006.

[0098] Optionally, a nucleic acid sequence encoding a protein can be inserted into a random target site in the genome, thereby allowing the genome to contain the nucleic acid encoding the protein. Typically, in a random insertion, the nucleic acid sequence also contains a promoter to drive expression of the inserted nucleic acid.

[0099] Additionally, if desired, a nucleic acid encoding a desired protein, APOE4p, Trem2p or both APOE4p and Trem2p, is inserted into a predetermined target site in the genome outside the Apoe4 gene or Trem2 gene.

[0100] For example, a nucleic acid encoding a desired protein, APOE4p, Trem2p, or both APOE4p and Trem2p, is inserted into a predetermined target site in the genome known to give rise to reliable expression, such as the Hprt or Rosa26 locus.

[0101] According to an embodiment, in genome editing at a predetermined target site, a targeting construct is produced using recombinant DNA technology and comprises 5' and 3' sequences that are homologous to a target endogenous gene in a cell.The targeting construct further comprises a selectable marker such as neomycin phosphotransferase, hygromycin or puromycin, a nucleic acid encoding a desired protein, APOE4p, Trem2p or both APOE4p and Trem2p, and optionally a polyadenylation signal.To ensure proper transcription and translation of the nucleic acid encoding the desired protein, the nucleic acid encoding the desired protein can be in frame with the endogenous locus or at a splice acceptor site and can comprise an internal ribosome entry site (IRES) sequence.

[0102] Such targeting constructs are transfected into desired cell types, such as, but not limited to, stem cells, and the cells are screened to detect the correct genome editing event using PCR, Southern blot or sequence analysis. Cells with the correct genome editing event can be further analyzed for the expression of the encoded protein by protein analysis, such as ELISA or Western blot analysis. If necessary, the nucleic acid encoding the selectable marker can be removed by treating the stem cells with a recombinase, such as Cre recombinase or flippase (Flp). After recombinase treatment, the cells are analyzed for the presence of the nucleic acid encoding the desired protein.

[0103] Cells with the correct genome editing event are selected and injected into preimplantation embryos as described above. Chimeric males are selected and bred. Offspring can be analyzed for the inheritance of ES cell genome by coat color and genetic analysis such as PCR, Southern blot or sequencing, and can be tested for the expression of desired protein, for example, by protein analysis (Western blot, ELISA) or other functional assay. Offspring expressing the correct protein are intercrossed to generate mice homozygous for the genetic modification(s).

[0104] Production of genetically modified mice expressing APOE4p and Trem2p can include injecting or transfecting appropriate nucleic acids, e.g., one or more nucleic acids encoding a desired protein, and / or one or more expression constructs, e.g., expression constructs encoding proteins or RNAs (e.g., cas9 or guide RNAs for use in CRISPR), into preimplantation embryos or stem cells, e.g., embryonic stem (ES) cells or induced pluripotent stem (iPS) cells.

[0105] The terms "expression construct" and "expression cassette" are used herein to refer to a double-stranded recombinant DNA molecule that contains a desired nucleic acid coding sequence and contains one or more control elements necessary or desired for expression of an operably linked coding sequence.

[0106] The term "control element" as used herein refers to a nucleotide sequence that regulates some aspect of the expression of a nucleic acid sequence. Exemplary control elements include, illustratively, enhancers, internal ribosome entry sites (IRES), introns, replication origins, polyadenylation signals (pA), promoters, transcription termination sequences, and upstream control domains, which contribute to the replication, transcription, and post-transcriptional processing of nucleic acid sequences. Those skilled in the art can select and use these and other control elements in expression constructs with no more than routine experimentation. Expression constructs can be produced recombinantly or synthetically using well-known methods.

[0107] The term "operably linked," as used herein, refers to a nucleic acid that is in a functional relationship with a second nucleic acid.

[0108] The control element is included in the expression cassette, which in certain embodiments is a promoter. The term "promoter" as used herein refers to a DNA sequence operably linked to a nucleic acid sequence to be transcribed, such as a nucleic acid sequence encoding a desired molecule. The promoter is generally located upstream of the nucleic acid sequence to be transcribed, providing a site for more specific binding of RNA polymerase and other transcription factors. In certain embodiments, the promoter is generally located upstream of the nucleic acid sequence to be transcribed to generate the desired molecule, providing a site for more specific binding of RNA polymerase and other transcription factors. The included promoter can be a constitutive promoter, or can provide inducible expression, and can provide ubiquitous, tissue-specific or cell type-specific expression.

[0109] Ubiquitous promoters that can be included in the expression construct include, but are not limited to, the 3-phosphoglycerate kinase (PGK-1) promoter, the beta-actin promoter, the ROSA26 promoter, the heat shock protein 70 (Hsp70) promoter, the EF-1 alpha gene encoding elongation factor 1 alpha (EF1) promoter, the eukaryotic translation initiation factor 4A (eIF-4A1) promoter, the chloramphenicol acetyltransferase (CAT) promoter and the CMV (cytomegalovirus) promoter.

[0110] These and other promoters are known in the art as exemplified by Abboud, SL et al., J. Histochem and Cytochem., 51(7):941-949, 2003; Schorpp et al., Nucl. Acids Res., 24(9):1787-1788, 1996; McBurney, MW et al., Devel. Dynamics, 200:278-293, 1994; and Majumder, M. et al., Blood, 87(8):3203-3211, 1996.

[0111] In addition to a promoter, one or more enhancer sequences can be included, such as, but not limited to, the cytomegalovirus (CMV) early enhancer element and the SV40 enhancer element.

[0112] Further sequences included include intron sequences such as the beta-globin intron or generic intron, transcription termination sequences, and mRNA polyadenylation (pA) sequences, such as, but not limited to, SV40-pA, beta-globin-pA, and SCF-pA.

[0113] Expression constructs can include sequences necessary for amplification in bacterial cells, such as a selectable marker (eg, a kanamycin or ampicillin resistance gene) and a replicon.

[0114] In the method of DNA injection of an expression construct into a preimplantation embryo, the expression construct is injected into a mouse preimplantation embryo, optionally after linearization. Preferably, the expression construct is injected into a fertilized oocyte. Fertilized oocytes are collected from superovulated females the day after mating (0.5 dpc) and injected with the expression construct. Injected oocytes are cultured overnight or directly transferred into the oviducts of 0.5 day pc pseudopregnant females.

[0115] Methods for superovulation, oocyte retrieval, expression construct injection and embryo transfer are known in the art and described in Manipulating the Mouse Embryo: A Laboratory Manual, 3rd Edition, Cold Spring Harbor Laboratory Press, December 15, 2002; ISBN-10:0879695919.

[0116] The offspring can be tested for the presence of the desired mutation or insertion by DNA analysis, such as PCR, Southern blot, or sequencing. Mice carrying the desired mutation or insertion can be tested for protein expression, for example, by ELISA or Western blot analysis.

[0117] Alternatively, the nucleic acid or expression construct can be transfected into stem cells (ES cells or iPS cells) using well-known methods such as electroporation, calcium phosphate precipitation and lipofection. The cells are screened for the presence of the desired mutation or insertion sequence by DNA analysis such as PCR, Southern blot or sequencing. For example, cells with the desired mutation or insertion sequence can be tested for functional expression by protein analysis such as ELISA or Western blot analysis.

[0118] Mouse ES cells are grown in a medium optimized for a particular line. Typically, ES medium contains 15% fetal bovine serum (FBS) or synthetic or semi-synthetic equivalent, 2 mM glutamine, 1 mM Na-pyruvate, 0.1 mM non-essential amino acids, 50 U / ml penicillin and streptomycin, 0.1 mM 2-mercaptoethanol and 1000 U / ml LIF (plus chemical inhibitors of differentiation for some cell lines) in Dulbecco's modified Eagle's medium (DMEM). Detailed descriptions are known in the art (Tremml et al., 2008, Current Protocols in Stem Cell Biology, Chapter 1: Unit 1C.4). For a review of ES cell differentiation inhibitors, see Buehr, M. et al. (2003), Genesis of embryonic stem cells, Philosophical Transactions of the Royal Society B: Biological Sciences, Vol. 358, pp. 1397-1402.

[0119] Selected cells that incorporate the desired mutation or insertion sequence can be injected into preimplantation embryos. For microinjection, ES or iPS cells are made into single cells using a mixture of trypsin and EDTA, which are then resuspended in ES medium. A group of single cells is selected using a precision drawn glass needle (20-25 micrometer inner diameter) and introduced into the blastocyst cavity (blastocoel) through the embryo zona pellucida using an inverted microscope fitted with a micromanipulator.

[0120] As an alternative to blastocyst injection, stem cells can be injected into early embryos (e.g., 2-cell, 4-cell, 8-cell, pre-morula or morula). Injection can be facilitated by opening the zona pellucida perforated with a laser or piezo pulse. Approximately 9-10 selected stem cells (ES or iPS cells) are injected per blastocyst or 8-cell stage embryo, 6-9 stem cells per 4-cell stage embryo, and approximately 6 stem cells per 2-cell stage embryo. After introduction of the stem cells, the embryos are allowed to recover for several hours at 37°C in 5% CO2, 5% O2 in nitrogen or cultured overnight, and then transferred into pseudopregnant recipient females. In a further alternative to stem cell injection, stem cells can be aggregated using morula stage embryos. All these methods are well established and can be used to create stem cell chimeras. For a more detailed description, see Manipulating the Mouse Embryo: A Laboratory Manual, 3rd Edition (A. Nagy, M. Gertsenstein, K. Vintersten, R. Behringer, Cold Spring Harbor Laboratory Press, December 15, 2002; ISBN-10:0879695919; Nagy et al., 1990, Development 110:815-821; US ​​7,576,259: Method for making genetic modifications; US 7659442; US 7,294,754; and Kraus et al., 2010, Genesis 48:394-399.

[0121] Pseudopregnant embryo recipients are prepared using methods known in the art. Briefly, fertile female mice aged 6-8 weeks are mated with vasectomized or sterile males to induce a hormonal state conducive to the maintenance of the surgically introduced embryos. At 2.5 days post-coitum (dpc), up to 15 stem cell containing blastocysts are introduced into the uterine horn very close to the junction of the uterus and the oviduct. For early embryos and morulae, such embryos are either cultured in vitro to blastocysts or transferred into the oviducts of pseudopregnant females at 0.5 dpc or 1.5 dpc depending on the stage of embryogenesis. Chimeric pups derived from the transferred embryos are born 16-20 days after transfer depending on the foetal age at the time of transfer. Chimeric males are selected and bred. The pups can be analyzed for coat color and inheritance of the ES cell genome by genetic analysis such as PCR, Southern blot or sequencing. Furthermore, the expression of the encoded protein(s) can be analyzed by protein analysis (Western blot, ELISA) or other functional assays.

[0122] The genetically modified mice of the present invention can be heterozygous or homozygous for the genetic modification.

[0123] According to aspects of the invention, the genetically modified mice of the invention may be heterozygous or homozygous for a "knock-in" humanized APOE4 modification, whereby the mice express APOE4p, and may be heterozygous or homozygous for a mutant genomic sequence encoding Trem2p, whereby the mice express Trem2p.

[0124] Homozygous genetically modified mice expressing APOE4p can be crossed with homozygous genetically modified mice expressing Trem2p to generate congenic strains homozygous for both the modification and expression of both APOE4p and Trem2p according to embodiments.

[0125] The genetically modified mice of the present invention can be of any of a variety of strains.

[0126] Genetic modifications can be introduced into the genome of isolated mouse embryonic stem (ES) cells, mouse induced pluripotent stem (iPS) cells, mouse somatic cells, fertilized mouse oocytes (zygotes) or mouse embryos by knock-in techniques to generate the genetically modified mice of the invention.

[0127] Embodiments of the present invention provide genetically modified mice that contain a desired genetic modification in all, or substantially all, of their cells, as well as genetically modified mice that contain a desired genetic modification in some, but not all, of their cells.

[0128] Genetically modified mice according to embodiments of the invention can contain one or more additional genetic variants that are associated with an increased risk of late-onset Alzheimer's disease in humans.

[0129] Treatment and compound identification

[0130] Provided according to an embodiment of the invention is a method for screening for a putative treatment for human Alzheimer's disease, the method comprising administering a putative treatment for Alzheimer's disease to a genetically modified mouse of the invention, the mouse's genome comprising 1) a DNA sequence encoding a human APOE4 protein (APOE4p) operably linked to a promoter, and 2) a DNA sequence encoding a mouse Trem2 protein (Trem2p) having a p.R47H mutation operably linked to a promoter, the mouse expressing APOE4p and Trem2p, and the mouse being characterized by one or more symptoms or signs associated with expression of APOE4p and Trem2p associated with non-familial, late-onset Alzheimer's disease, and evaluating the effect of the putative treatment on the mouse.

[0131] 1. A method for screening for putative treatments for human Alzheimer's disease, comprising: detecting a mouse genome comprising: 1) a DNA sequence encoding a human APOE4 protein (APOE4p) operably linked to a promoter; and 2) a DNA sequence encoding a mouse Trem2 protein (Trem2p) having a p.R47H mutation operably linked to a promoter; tm1.1(APOE*4)Adiuj Trem2 em1Adiuj In accordance with an embodiment of the invention, a method is provided comprising administering a putative treatment for Alzheimer's disease to a . / J mouse, the mouse being homozygous for a DNA sequence encoding APOE4p and for a DNA sequence encoding Trem2p, and expressing human APOE4p and mouse Trem2p, and evaluating the effect of the putative treatment on the mouse.

[0132] According to an embodiment of the present invention, a method for screening for compounds for use in treating Alzheimer's disease is provided, comprising administering a compound to the genetically modified mouse of the present invention, and evaluating the effect of the compound in treating one or more symptoms or signs associated with the expression of human APOE4p and mouse Trem2p, which are related to non-familial late-onset Alzheimer's disease.Evaluating the effect of the compound in treating one or more symptoms or signs associated with the expression of human APOE4p and mouse Trem2p, which are related to non-familial late-onset Alzheimer's disease, preferably comprises comparing the result of evaluation with the effect of the compound for a suitable control, such as, but not limited to, APOE3-expressing mouse or wild-type mouse (e.g., mouse carrying Apoe gene).

[0133] Such signs and symptoms include: 1) the presence of significantly more microglia in the brain of a genetically modified mouse of the present invention compared to a control, such as an APOE3-expressing mouse or a wild-type control mouse; 2) the presence of significantly more amyloid plaques in the brain of a genetically modified mouse of the present invention compared to a control, such as an APOE3-expressing mouse or a wild-type control mouse; 3) the presence of significantly more tau aggregates in the brain of a genetically modified mouse of the present invention compared to a control, such as an APOE3-expressing mouse or a wild-type control mouse; 4) the presence of significantly more inflammation in the brain of a genetically modified mouse of the present invention compared to a control, such as an APOE3-expressing mouse or a wild-type control mouse; 5) the presence of significantly more synaptic and / or neuronal losses in the brain of a genetically modified mouse of the present invention compared to a control, such as an APOE3-expressing mouse or a wild-type control mouse; 6) the presence of significantly more cognitive impairment in the brain of a genetically modified mouse of the present invention compared to a control, such as an APOE3-expressing mouse or a wild-type control mouse; and 7) the presence of significantly more tau aggregates in the brain of a genetically modified mouse of the present invention compared to a control, such as an APOE3-expressing mouse or a wild-type control mouse. These include, but are not limited to, any one or more of the following: the presence of significantly more signs of frailty in aged genetically modified mice of the present invention compared to controls such as wild-type control mice; 8) the presence of significantly more impaired blood flow in the brains of genetically modified mice of the present invention compared to controls such as APOE3-expressing mice or wild-type control mice; 9) a significant difference in the presence, level, and / or function of one or more biomarkers of non-familial late-onset Alzheimer's disease in the blood, serum, or tissues of genetically modified mice of the present invention compared to controls such as APOE3-expressing mice or wild-type control mice; 10) cerebral extravasation in genetically modified mice of the present invention compared to controls such as APOE3-expressing mice or wild-type control mice; and 11) levels of one or more blood lipoproteins, such as high density lipoprotein, low density lipoprotein, and / or cholesterol, in genetically modified mice of the present invention compared to controls such as APOE3-expressing mice or wild-type control mice.

[0134] According to an aspect of the invention, a method is provided for screening for a putative treatment for human Alzheimer's disease, wherein the step of evaluating the effect of the compound comprises comparing the effect of the compound on a genetically modified mouse of the invention with a control, wherein the genome of the mouse comprises 1) a DNA sequence encoding a human APOE4 protein (APOE4p) operably linked to a promoter, and 2) a DNA sequence encoding a mouse Trem2 protein (Trem2p) having a p.R47H mutation, operably linked to a promoter, and the mouse expresses APOE4p and Trem2p, and is characterized by one or more symptoms or signs associated with expression of APOE4p and Trem2p associated with non-familial, late-onset Alzheimer's disease.

[0135] According to an aspect of the invention, the step of evaluating the effect of the compound is tm1.1(APOE*4)Adiuj Trem2 em1Adiuj Methods are provided for screening for putative treatments for human Alzheimer's disease that involve comparing the effects of compounds on . / J mice with controls.

[0136] Suitable controls include, for example, administering the compound to a mouse that does not express human APOE4p and mouse Trem2p, and evaluating the effect of the compound on the mouse. Suitable controls include, for example, administering the compound to an APOE3-expressing mouse or a wild-type control mouse. The wild-type control mouse can be any mouse that does not express human APOE4p and mouse Trem2p. Suitable controls include, for example, administering the compound to a wild-type C57BL / 6J mouse, and evaluating the effect of the compound on the wild-type C57BL / 6J mouse.

[0137] Symptoms or signs associated with expression of human APOE4p and mouse Trem2p related to non-familial late-onset Alzheimer's disease can be assessed by methods well known in the art, including, but not limited to, immunoassays, nucleic acid assays, histochemical staining, cognitive assays, in vivo imaging techniques, physical evaluation of animals, evaluation of cerebral extravasation, and morphological evaluation of tissues and / or cells.

[0138] Immunoassays that may be used are well known in the art and include, but are not limited to, enzyme-linked immunosorbent assays (ELISAs), such as, but not limited to, antigen capture ELISAs, indirect ELISAs, fixed cell ELISAs; immunochromatography; antigen capture; flow cytometry; immunoblots; immunoprecipitation; immunodiffusion; competitive immunoassays; immunocytochemistry; radioimmunoassays; and any combination thereof.Generalized details of immunoassays are e.g. found in Wild, D., The Immunoassay Handbook, 3rd ed., Elsevier Science, 2005; Gosling, JP, Immunoassays: A Practical Approach, Practical Approach Series, Oxford University Press, 2005; E. Harlow and D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1988; F. Breitling and S. Dubel, Recombinant Antibodies, John Wiley & Sons, New York, 1999; H. Zola, Monoclonal Antibodies: Preparation and Use of Monoclonal Antibodies and Engineered Antibody Derivatives, Basics: From Background to Bench, BIOS Scientific Publishers, 2000; BKC Lo, Antibody Engineering: Methods and Protocols, Methods in Molecular Biology, Humana Press, 2003; FM Standard references include Ausubel et al., eds., Short Protocols in Molecular Biology, Current Protocols, Wiley, 2002; Ormerod, MG, Flow Cytometry: a practical approach, Oxford University Press, 2000; and Givan, AL, Flow Cytometry: first principles, Wiley, New York, 2001.

[0139] According to aspects of the present invention, nucleic acid assays for detecting nucleic acid analytes related to non-familial late-onset Alzheimer's disease in genetically modified mice of the present invention compared to wild-type mice include, but are not limited to, nucleic acid amplification techniques, such as, but not limited to, PCR, RT-PCR, PCR by ligation and phi-29 PCR; nucleic acid hybridization techniques, such as, but not limited to, Northern blot, Southern blot, RNase protection assay, dot blot, transcriptome analysis, and in situ hybridization. Nucleic acid assays for both qualitative and quantitative assay of nucleic acids in a sample are described in detail in standard references including, by way of example, J. Sambrook and DW Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press; 3rd ed., 2001; FM Ausubel et al., eds., Short Protocols in Molecular Biology, Current Protocols, Wiley, 2002; CW Dieffenbach et al., PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 2003; and V. Demidov et al., DNA Amplification: Current Technologies and Applications, Taylor & Francis, 2004.

[0140] Biomarker assays that may be used are well known in the art and include, but are not limited to, assays of Aβ and tau species, neurofilaments, neurogranin, interleukins, TNFα, GM-CSF, and soluble Trem2 in cerebrospinal fluid (CSF), blood, serum, or tissue.

[0141] Cognitive assays that may be used are well known in the art and include, but are not limited to, assays of spatial memory, short-term memory, long-term memory, assays of executive function, attentional tasks such as 3- and 5-choice serial reaction time tests, processing speed tests, set-shifting tests, reversal learning tasks, object memory assays, pattern recognition assays, passive avoidance memory assays, habituation assays, and novel object recognition assays, water maze tests, fear conditioning tests, radial arm water maze tests, Y-maze tests, T-maze tests, and open field habituation tests.

[0142] Methods for physical assessment of animals that may be used are well known in the art and include, but are not limited to, evaluation of indicators of frailty in genetically modified mice of the present invention compared to controls, such as APOE3-expressing or wild-type mice, as a control for normal aging.

[0143] The in vivo imaging diagnostic method that can be used is well known in the art, and includes but is not limited to magnetic resonance imaging (MRI), computed tomography (CT) imaging, X-ray, optical imaging, and ultrasound imaging.Such imaging diagnostic techniques can be used to evaluate one or more symptoms or signs associated with the expression of human APOE4p and mouse Trem2p that are related to non-familial late-onset Alzheimer's disease, including but not limited to amyloid or tau aggregates, blood flow abnormality, pathological neuronal loss, and glucose metabolism abnormality.

[0144] Assessment of changes in one or more of the transcriptomic, proteomic, and metabolic profiles of the genetically modified mice of the present invention compared to wild-type mice and / or compared to clinical samples can be performed using methods well known in the art.

[0145] Assessment of inflammation can be performed by assaying one or more inflammatory biomarkers, including, but not limited to, IL-8, IL-11, TNF-alpha, granulocyte-macrophage colony-stimulating factor (GM-CSF), TGF-beta, VEGF, monocyte chemoattractant-1, macrophage migration inhibitory factor, s100B, fibrinogen, and interferon gamma-inducible protein 10. Such assays can be performed on samples obtained from the genetically modified and wild-type mice of the invention, such as samples of brain, spinal cord, blood, plasma, serum, cerebrospinal fluid, or other relevant tissues or fluids.

[0146] Morphological evaluation of tissues and / or cells can include physical examination of gross anatomy and / or microscopic examination of tissues and / or cells, with or without histochemical or cytochemical staining of the tissues and / or cells. Morphological evaluation of tissues and / or cells can include evaluation of synaptic and neuronal losses.

[0147] According to an aspect of the present invention, a method for screening for a compound for use in treating Alzheimer's disease is provided in an individual human subject having or suspected of having Alzheimer's disease, comprising administering the compound to a genetically modified mouse of the present invention, and evaluating the effect of the compound on amyloid and / or tau in the mouse, which is associated with the expression of human APOE4p and mouse Trem2p, which is related to non-familial late-onset Alzheimer's disease.According to certain embodiments, evaluating the effect of the compound on amyloid and / or tau comprises evaluating the level and / or localization of amyloid and / or tau.According to certain embodiments, evaluating the effect of the compound on amyloid and / or tau comprises evaluating the amyloid and / or tau aggregates in the genetically modified mouse of the present invention, for example evaluating the size, number, location, or any two or more combinations of aggregates.

[0148] Cerebral extravasation is a key aspect of non-familial, late-onset Alzheimer's disease, and it is a surprising and unexpected finding of the present invention that expression of human APOE4p and mouse Trem2p results in cerebral extravasation.

[0149] According to an embodiment of the present invention, there is provided a method for screening compounds for use in treating non-familial late-onset Alzheimer's disease in individual human subjects who have or are suspected of having non-familial late-onset Alzheimer's disease, comprising administering the compound to a genetically modified mouse of the present invention and evaluating the effect of the compound on cerebral blood vessel leakage associated with the expression of human APOE4p and mouse Trem2p, which is related to non-familial late-onset Alzheimer's disease, in the mouse.The step of evaluating the effect of the compound on cerebral blood vessel leakage includes, but is not limited to, the evaluation of cerebral blood vessel permeability.The term "cerebral blood vessel permeability" refers to the ability of blood vessel walls to act as a barrier to the movement of large molecules and substances such as fibrinogen or albumin, while allowing small molecules or substances such as water, ions, certain drugs and nutrients to move normally across the blood vessel walls. The term "cerebral extravasation" refers to blood vessel abnormality that causes large molecules and substances such as fibrinogen and albumin to leak from the vessel wall. Assays for evaluating cerebral extravasation are well known in the art, and include in vitro assays using cells or tissues isolated from the genetically modified mice of the present invention, and in vivo assays. A non-limiting example of an in vivo assay for cerebral extravasation includes intravenous injection of labeled protein (e.g., Evans Blue-labeled albumin) and evaluation of the appearance of dye-labeled protein in brain tissue, see, for example, Radu et al., An in vivo Assay to Test Blood Vessel Permeability., J. Vis. Exp. 2013, (73):50062.

[0150] The putative treatment can be any method of treatment, such as, but not limited to, administration of a compound. The term "compound" as used herein includes, but is not limited to, small molecule chemicals and biological agents, such as peptides, proteins, glycoproteins, and the like, including antibodies.

[0151] Embodiments of the compositions and methods of the present invention are described in the following examples, which are provided for illustrative purposes and are not to be construed as limitations on the scope of the compositions and methods of the present invention. EXAMPLES

[0152] Working Example

[0153] Generation of genetically modified mice carrying a DNA sequence encoding APOE4p in their genome

[0154] The mouse Apoe4 gene is located at 19,696,109-19,699,166 on chromosome 7. An APOE4 gene targeting construct was generated that contains 4980 bp of mouse sequence (SEQ ID NO: 9) defining the mouse 5' homology arm including exon 1 of mouse ApoE, 4292 bp of human APOE4 sequence (SEQ ID NO: 10) including the human protein encoding exons 2-4 of the human gene, as well as 1.5 kb of additional flanking human sequence following the 3' UTR to include any potential regulatory sequences.

[0155] Figure 1 shows a schematic diagram of the humanized ApoE4 construct (see "m / hAPOE targeting vector E4"). In Figure 1, (CC) on exon 4' indicates the nt present in exon 4 that encodes arginine at p.R310 and R176 of isoform E4, respectively. Isoform E2 with (TT) encodes cysteine ​​at both C130 and C176, whereas E3 (TC) encodes cysteine ​​at C130R and arginine at R176.

[0156] Human APOE4 exon 4 contains the sequence encoding the ApoE4 isoform of this gene and encodes nucleotide sequences encoding arginines at R130 and R176. APOE4 contains an 18 amino acid signal peptide at the N-terminus of the protein, making APOE4, including the signal peptide, 317 amino acids, with variant amino acids that differ between APOE2, APOE3 and APOE4 at positions 130 and 176. In the mature APOE protein (299 amino acids), variant amino acids that differ between APOE2, APOE3 and APOE4 are at positions 112 and 158.

[0157] The Frt neo Frt selection cassette (FNF cassette, SEQ ID NO: 11) was inserted after the human sequence, followed by an Nde1 restriction site (to facilitate Southern screening). The FNF cassette is followed by a 3' homology arm, which is a 5166 bp mouse sequence (SEQ ID NO: 12). The resulting 14,438 bp synthetic construct was cloned into the pBlight vector using recombineering technology to generate a construct for gene targeting in embryonic stem cells, called mApoE_hAPOE4_PGKneo_mAPOE.

[0158] The ApoE4 gene targeting construct was introduced by electroporation into cultured embryonic stem (ES) cells of the C57Bl6 mouse strain. Homologous recombination created a locus that retained all normal mouse regulatory sequences (plus non-coding exon sequences) along with the human APOE4 protein-coding exons 2-4. To confirm correct targeting, transfected ES cells were screened by Southern blot. Three correctly targeted clones were identified. ES cells containing the correctly targeted locus were introduced into C57BL / 6J embryos, and the resulting chimeric mice were bred with C57BL / 6J mice. Offspring carrying the modified locus in the germline were inbred to generate homozygous gene-modified genomes. All F1 matings produced normal litter sizes with Mendelian locus distribution.

[0159] Generation of genetically modified mice carrying a DNA sequence encoding Trem2p in their genome

[0160] A Trem2 R47H KI allele with a 183 nt donor oligo (40 ng) containing a nucleotide G>A point mutation (underlined capital "A" at nt 89 in SEQ ID NO:8) to change the amino acid sequence at R47H, as well as two silent mutations within the gene (to prevent re-cutting of the donor sequence during homology-directed repair) (lysine AAG>AAA (underlined lowercase "a" at nt 93 in SEQ ID NO:8) and alanine GCC>GCA (underlined lowercase "a" at nt 96 in SEQ ID NO:8)) by pronuclear injection of Cas9 RNA (100 ng) and a single guide sequence (50 ng) GAAGCACTGGGGGAGACGCA (SEQ ID NO:7). [ka] was generated at the Jackson Laboratory. A specific R47H knock-in was generated using CRISPR technology, with a silent mutation in the Trem2 gene of the founder mice.

[0161] Offspring carrying the modified allele in the germline were inbred to generate homozygous gene-modified genomes. All F1 matings produced normal litter sizes with Mendelian distribution of loci. The resulting inbred mouse strain was C57BL / 6J-Trem2. em1Adpmc / J (generic name Trem2 R47H KI(JAX)) and expresses Trem2p.

[0162] Generation of genetically modified mice having a DNA sequence encoding APOE4p and a DNA sequence encoding Trem2p in their genomes

[0163] In this example, B6(SJL)-Apoe, an inbred mouse strain expressing human APOE4p, was used. tm1.1(APOE*4)Adpmc / J (generic name APOE*4 KI(JAX)) was transfected with C57BL / 6J-Trem2, an inbred mouse strain expressing mouse Trem2p. em1Adpmc We generated genetically modified mice by crossing B6(SJL)-Apoe / J (generic name Trem2 R47H KI(JAX)) with B6(SJL)-Apoe tm1.1(APOE*4)Adiuj Trem2 em1Adiuj / J (formerly B6(SJL)-Apoe tm1.1(APOE*4)Adpmc Trem2 em1Adpmc / J, abbreviated as APOE4 x Trem2 R47H (JAX) mice), generically designated B6J.APOE4 / Trem2, express both human APOE4 and mouse Trem2p.

[0164] Validation of a genetically engineered mouse model of non-familial late-onset Alzheimer's disease

[0165] Tissue harvest, protein isolation and sectioning

[0166] Mice were administered a lethal dose of ketamine / xylazine via intraperitoneal injection and perfused transcardially with 1x PBS (phosphate-buffered saline). Brains were dissected and the right hemisphere was snap frozen for protein isolation, whereas the left hemisphere was fixed in 4% paraformaldehyde overnight at 4°C. Fixed hemispheres were rinsed in 1x PBS and cryoprotected in 10% sucrose, then in 30% sucrose at 4°C, and finally embedded in OCT (optimal cutting temperature compound). Frozen brains were sectioned at 25 μm and stored at -80°C until required. Proteins were extracted with Trizol reagent (Life Technologies, Cat#15596-018) according to the manufacturer's guidelines. Protein pellets were resuspended in a 1:1 solution of 8M urea and 1% SDS.

[0167] Immunofluorescence, Thioflavin S staining, and image acquisition

[0168] Frozen sections were rinsed in PBT (1x PBS with 1% Triton X-100) for 5 min and then incubated with 500 μL of Liberate Antibody Binding Solution (LAB-Polysciences Inc.) solution for 20 min at room temperature (RT) for antigen retrieval. Slides were then incubated overnight at 4°C in the following primary antibodies: rabbit polyclonal anti-GFAP (1:200, Dako), rabbit polyclonal anti-IBA1 (1:250, Wako), rabbit polyclonal anti-NeuN (1:100, Cell Signaling Inc), mouse monoclonal anti-non-phosphorylated neurofilament (1:200, Covance) and sheep polyclonal anti-TREM2 (1:200, RD Systems). The sheep polyclonal anti-TREM2 antibody was previously validated using Trem2-deficient mice. All antibodies were diluted in PBTB (1x PBS, 1% Triton X-100 and 1% BSA) containing 10% normal goat or donkey serum. After primary incubation, sections were washed three times in PBT and incubated with the appropriate secondary antibodies (goat anti-rabbit Alexa Fluor488 / 594 / 633, goat anti-mouse Alexa Fluor488, donkey anti-sheep Alexa Fluor594, 1:1000 dilution, Life Technologies) for 2 h at RT.

[0169] All sections were then counterstained with DAPI and mounted using AquaPolyMount (Polysciences). For thioflavin S staining, sections stained with IBA1 and GFAP were further counterstained with 1% thioflavin S (diluted 1:1 in water:ethanol). Slides were incubated in 1% thioflavin S for 8 min at RT, washed with 80% ethanol, then 95% ethanol, and finally dH2O, and mounted. Images were acquired using a LeicaSP5 confocal microscope or a Zeiss Axio Imager.Z2. For each antibody, all images were captured using identical parameters for accurate quantification.

[0170] Initial observations were made in sections from both males and females. Because there was no obvious difference between the sexes, quantification of cell numbers was performed on brain sections from at least 4–6 male mice. For plaque counting, the number of plaques present in the entorhinal cortex of each mouse was quantified. For IBA1+ cells, 5 equally spaced images of the entorhinal or hippocampal cortex from the central brain section of each mouse were captured (using a 20× optical lens). For NeuN+ cells, 5 equally spaced images were captured (using a 20× optical lens). For IBA1+ cells associated with plaques, 8+ plaque images were imaged per brain (using a 20× optical lens).

[0171] Images were processed and all cells were counted in 20x images using the cell counter plugin for ImageJ / FIJI. Single cells were determined as DAPI stained nuclei associated with cell specific antibody staining (e.g., IBA1 or NEUN). Cell counts of five images from each mouse were tallied and then averaged across mice. For all cell counting assays, mouse numbers and diets were masked to the investigator.

[0172] Western blot analysis revealed that B6(SJL)-Apoe tm1.1(APOE*4)Adiuj Trem2 em1Adiuj Demonstration of human APOE4 expression in / J (generic name B6J.APOE4 / Trem2) mice

[0173] Brain extracts (approximately 25 micrograms of protein) were diluted in 2× Laemmli sample buffer (Bio-Rad 1610737), run on a 4-20% gradient (BioRad Mini Protean TGX456-1096), and transferred to a nitrocellulose membrane (InVitrogen IB301001).

[0174] Blots were blocked with 5% nonfat dry milk and probed with human APOE4 specific antibody (Novus Biologicals NBP1-49529) diluted 1:100 overnight at +4°C. Blots were then probed with secondary antibody (Millipore goat anti-mouse HRP AP191P) diluted 1:30,000 for 2 hours at room temperature. Blots were detected on Amersham Hyperfilm ECL (GE Healthcare 28906838) using ECL chemiluminescence reagent (GE Healthcare RPN2109).

[0175] An antibody specific for the human APOE4 variant (Novus Biologicals NBP1-49529 at a 1:100 dilution) was used to probe a Western blot of approximately 25 micrograms of protein from brain tissue from C57BL / 6J (abbreviated as B6J) or B6J.APOE4 / Trem2 mice. Figure 2 is an image of a Western blot of brain tissue from B6J.APOE4 / Trem2 (lanes 4-6) and control (WT (B6J), lanes 1-3) brain tissue. As shown in Figure 2, human APOE4 protein expression was only detected in protein from B6J.APOE4 / Trem2 mice.

[0176] Blood chemistry studies indicate metabolic changes in B6J.APOE4 / Trem2 mice

[0177] APOE variants have been shown to differentially regulate lipoprotein and cholesterol metabolism. The mechanism by which APOE4 variants increase risk for Alzheimer's disease is unknown, but their effects on metabolic alterations are thought to play a role. Blood samples from 12-month-old B6J.APOE4 / Trem2 (abbreviated as APOE4 / Trem2 in Figures 3A, 3B, and 3C) mice and 12-month-old C57BL / 6J control mice were tested for high-density lipoprotein (HDL), low-density lipoprotein (LDL), and total cholesterol according to standard blood chemistry procedures.

[0178] At the time of collection, blood was stored on ice in EDTA-coated vials and further centrifuged at 5000 RPM for 15 minutes. Plasma was collected and aliquoted for long-term storage at -80°C. Plasma aliquots were profiled for the following: total cholesterol (mg / dL), LDL (mg / dL), and HDL (mg / dL). High density lipoprotein (HDL) cholesterol was tested using the Wako L-type HDL-C kit (Wako99100101) according to the manufacturer's instructions. LDL was tested using the Beckman Coulter LDL cholesterol kit (Beckman Coulter OSR6196) according to the manufacturer's instructions. Total cholesterol was tested using the Beckman Coulter cholesterol kit (BeckmanCoulter OSR6116).

[0179] The results are shown in Figures 3A, 3B, and 3C, respectively. These data indicate that B6J.APOE4 / Trem2 mice have APOE4-dependent alterations in cholesterol metabolism, including reduced total cholesterol and reduced levels of both LDL and HDL.

[0180] Immunohistochemistry shows cerebral extravasation and inflammation in B6J.APOE4 / Trem2 mice

[0181] All mice were bred and housed with a 12 / 12 hour light / dark cycle. Eight-month-old mice were lethally injected intraperitoneally with ketamine / xylazine according to IACUC-approved procedures. Mice were perfused with 1×PBS (phosphate-buffered saline) and whole brains were removed. One hemisphere was fixed overnight in 4% paraformaldehyde at +4°C. After fixation, tissues were rinsed with 1×PBS and incubated overnight in 10% sucrose at +4°C, then incubated overnight in 30% sucrose at 4°C. Brains were then frozen in optimal cutting temperature (OCT) compound and stored at -80°C until sectioning. Frozen brains were sectioned at 25 microns, mounted on glass slides, and stored at -80°C until required for immunofluorescence staining.

[0182] Slides were dried and post-fixed in 4% PFA. Sections were then immersed in diH2O for 3 min at 37°C and then transferred to 0.5 mg / mL pepsin in 0.2 N HCl for 15 min incubation at 37°C. Sections were further washed in diH2O for 3 min, transferred to a humidified chamber and washed in 1x PBS. Sections were incubated overnight at +4°C in rabbit anti-fibrin (1:200) and goat anti-ColIV (anti-collagen IV) (1:40) in 1x PBT. Slides were washed in 1x PBT and incubated in the appropriate secondary antibodies (donkey anti-rabbit IgG594, donkey anti-goat 488) at a concentration of 1:1000 for 2 h at room temperature. Tissues were counterstained with DAPI and mounted using Aqua-Poly mount (Polyscience Inc). Staining was imaged on a Zeiss AxioImager at 20x magnification.

[0183] Sagittal sections of brains from B6J.APOE4 / Trem2 mice were immunostained for fibrinogen (fibrin) to detect cerebral extravasation. Representative images of tissue from 7-8 month old B6J.APOE4 / Trem2 mice are shown in Figure 4 along with representative images obtained from similar sagittal sections of brains from control C57BL / 6J (abbreviated as B6J) mice. Arrows indicate cerebral extravasation as indicated by fibrin immunostaining outside the blood vessels. Blood vessels are indicated by immunostaining for collagen IV (Col IV).

[0184] Vascular damage may be a key aspect of late-onset Alzheimer's pathology. Although several existing mouse models of familial Alzheimer's disease demonstrate cerebral amyloid angiopathy (CAA), the B6J.APOE4 / Trem2 mouse is the first model to exhibit vascular damage without overexpressing a familial Alzheimer's disease mutation.

[0185] Transcriptional analysis demonstrates AD-associated changes in gene expression in the B6J.APOE4 / Trem2 model

[0186] Gene expression analysis was performed using the NanoString Neuropathology Gene Panel. This assay measures the expression of 770 neuropathology-related genes. Female mice approximately 8 months old were tested on the B6J.APOE4 / Trem2 and C57BL / 6J (abbreviated as B6J) strains, with three biological replicates for each strain.

[0187] Total RNA was extracted from brain homogenates. Tissues were lysed and homogenized in TRIzol Reagent (Ambion), and RNA was then isolated using the miRNeasy Mini kit (Qiagen) according to the manufacturer's protocol, including a DNase digestion step where necessary. Sample concentration and quality were tested using a Nanodrop 2000 spectrophotometer (Thermo Scientific) and an RNA 6000 Nano LabChip assay (Agilent Technologies).

[0188] RNA was hybridized and multiplexed with NanoString probes according to the manufacturer's instructions. Target gene counts were normalized to housekeeping genes to account for variability in RNA content. Data were analyzed using Nanostring nSolver Analysis Software.

[0189] Expression of each gene in the B6J.APOE4 / Trem2 strain was compared to the control C57BL / 6J strain, and genes with significant (p<0.05) expression were identified by linear regression modeling, as shown in Figure 5. Figure 5 is a gene expression heatmap of differentially expressed genes in B6J.APOE4 / Trem2 compared to C57BL / 6J. Expression values ​​are the Log2 fold change compared to the C57BL / 6J mean for each gene.

[0190] The probes used in this panel detect mouse Apoe but not human APOE, in which Apoe expression is not detected due to its replacement by the human APOE4 variant, which represents the most strongly downregulated transcript.

[0191] The list of differentially expressed genes includes multiple genes related to brain function and neurodegeneration. Gene Ontology Biological Process and Panther Pathway annotation databases were searched to identify the processes and pathways represented by these genes. The related processes include, but are not limited to, the results in Table I showing the pathways and processes represented by differentially expressed genes in B6J.APOE4 / Trem2 lineage. Notably, these interrelated processes and pathways include many highly related to neurodegeneration. [Table 1]

[0192] Scientific and technical terms used herein are intended to have meanings that are commonly understood by those of ordinary skill in the art. Such terms are illustratively used in J. Sambrook and DW Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 3rd ed., 2001; FM Ausubel, ed., Short Protocols in Molecular Biology, Current Protocols, 5th ed., 2002; B. Alberts et al., Molecular Biology of the Cell, 4th ed., Garland, 2002; DL Nelson and MM Cox, Lehninger Principles of Biochemistry, 4th ed., WH Freeman & Company, 2004; Herdewijn, P. (ed.), Oligonucleotide Synthesis: Methods and Applications, Methods in Molecular Biology, Humana Press, 2004; A. Nagy, M. Gertsenstein, K. Vintersten, R. Behringer (eds.) 2002, Manipulating the Mouse Embryo: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, ISBN-10:0879695919; and K. Turksen (ed.) Embryonic stem cells: methods and protocols in Methods in Molecular Biology, 2002, p. 185, Humana Press; Current Protocols in Stem Cell Biology, ISBN:9780470151808.

[0193] array The amino acid sequence of APOE4p is shown, along with an exemplary nucleic acid sequence encoding APOE4p.

[0194] SEQ ID NO:1: APOE4p (317 amino acids) [ka]

[0195] SEQ ID NO:2: Exons 2, 3 and 4 of the human APOE4 genomic DNA sequence encoding human APOE4p including an 18 amino acid signal peptide [ka] [ka]

[0196] SEQ ID NO: 3: Trem2p (249 amino acids, R47H mutation) [ka]

[0197] SEQ ID NO: 4: Mutant mouse genomic DNA sequence encoding Trem2p (1056 nucleotides) [ka]

[0198] SEQ ID NO: 5: Trem2p (249 amino acids, mouse wild type protein, no R47H mutation) [ka]

[0199] SEQ ID NO: 6: Mouse wild-type genomic DNA sequence encoding Trem2 mouse wild-type protein (1056 nucleotides) [ka]

[0200] SEQ ID NO:7: Trem2 CRISPR guide GAAGCACTGGGGGAGACGCA

[0201] SEQ ID NO:8: Trem2 repair oligo (183 nucleotides) containing a nucleotide G>A point mutation (at nucleotide 89 in this oligo sequence) to change the amino acid sequence at R47H, as well as two silent mutations (lysine AAG>AAA (at nucleotide 93 in this oligo sequence) and alanine GCC>GCA (at nucleotide 96 in this oligo sequence)) within the gene to prevent re-cleavage of the donor sequence in homology-directed repair. [ka] [ka]

[0202] SEQ ID NO: 9: 5' homology arm (4980 nucleotides: mouse Apoe4 exon 1 and 757 nucleotides of mouse Apoe4 intron 2 sequence) included in the "humanized" mouse ApoE construct inserted into the mouse genome. [ka] [ka] [ka]

[0203] Sequence number 10: DNA sequence (4292 nucleotides) contained in the "humanized" mouse ApoE construct to be inserted into the mouse genome, comprising exons 2, 3 and 4 of the human APOE4 gene, and the 1500 nucleotide 3'UTR of the human APOE4 gene after exon 4. [ka] [ka]

[0204] SEQ ID NO:11: Frt PGKneo Frt cassette followed by an Nde1 restriction enzyme site (CATATG) (1834 nucleotides) inserted between nucleotides 9272 and 9273 of the "humanized" mouse ApoE construct to allow selection prior to removal of this cassette by recombinase. [ka] [ka]

[0205] SEQ ID NO: 12: 3' homology arm (5166 nucleotides) included in the "humanized" mouse ApoE construct to be inserted into the mouse genome. [ka] [ka] [ka]

[0206] SEQ ID NO: 13: Wild-type amino acid sequence - Mouse Apoe [ka]

[0207] SEQ ID NO: 14: Amino acid sequence - human APOE3 [ka] [ka]

[0208] SEQ ID NO: 15: APOE4p (299 amino acids) [ka]

[0209] Any patents or publications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.

[0210] The genetically modified mice and methods of use described herein are presently representative of exemplary preferred embodiments and are not intended to limit the scope of the invention. Variations and other uses within the scope are expected to occur to those of skill in the art. Such variations and other uses can be made without departing from the scope of the invention as set forth in the claims. In certain embodiments, for example, the following items are provided: (Item 1) A genetically modified mouse characterized by one or more symptoms or signs associated with non-familial, late-onset Alzheimer's disease accompanied by expression of human APOE4p and mouse Trem2p, wherein the genome of the mouse comprises 1) a DNA sequence encoding a human APOE4 protein (APOE4p) operably linked to a promoter, and 2) a DNA sequence encoding a mouse Trem2 protein (Trem2p) having a p.R47H mutation operably linked to a promoter, and the mouse expresses human APOE4p and mouse Trem2p. (Item 2) 2. The genetically modified mouse of item 1, wherein the APOE4p comprises the amino acid sequence of SEQ ID NO:1 or is encoded by the complement of a nucleic acid that hybridizes to SEQ ID NO:2 under highly stringent hybridization conditions. (Item 3) 2. The genetically modified mouse of item 1, wherein the mouse Trem2p comprises the amino acid sequence of SEQ ID NO: 3, or the mouse Trem2p is encoded by the complement of a nucleic acid that hybridizes to SEQ ID NO: 4 under highly stringent hybridization conditions. (Item 4) The genome of the mouse comprises: 1) a DNA sequence encoding a human APOE4 protein (APOE4p) operably linked to a promoter; and 2) a DNA sequence encoding a mouse Trem2 protein (Trem2p) having a p.R47H mutation operably linked to a promoter. tm1.1(APOE*4)Adiuj Trem2 em1Adiuj 2. The genetically modified mouse of item 1, wherein the mouse is homozygous for a DNA sequence encoding APOE4p and for a DNA sequence encoding Trem2p, and expresses human APOE4p and mouse Trem2p. (Item 5) 1. A method for screening for a compound for use in treating Alzheimer's disease, comprising: Administering a compound to the genetically modified mouse according to any one of items 1 to 4; evaluating the effect of said compound in a mouse for treating one or more symptoms or indications associated with expression of human APOE4p and mouse Trem2p associated with non-familial late-onset Alzheimer's disease; A method comprising: (Item 6) Item 6. The method for screening for a compound for use in treating Alzheimer's disease according to Item 5, wherein the step of evaluating the effect of the compound comprises comparing the effect of the compound on the genetically modified mouse according to any one of Items 1 to 4 with a control. (Item 7) The control is administering the compound to a mouse that does not express human APOE4p and mouse Trem2p; evaluating the effect of said compound in said mouse. 7. A method for screening for a compound for use in treating Alzheimer's disease according to item 6, comprising: (Item 8) The control is administering the compound to wild-type C57BL / 6J mice; evaluating the effect of said compound in said wild-type C57BL / 6J mice. 8. A method for screening for a compound for use in the treatment of Alzheimer's disease according to item 6 or 7, comprising: (Item 9) The control is administering the compound to an APOE3-expressing mouse; evaluating the effect of the compound in the APOE3-expressing mouse. 8. A method for screening for a compound for use in the treatment of Alzheimer's disease according to item 6 or 7, comprising: (Item 10) A genetically modified mouse characterized by one or more symptoms or signs associated with non-familial, late-onset Alzheimer's disease substantially as described herein, comprising expression of human APOE4p and mouse Trem2p. (Item 11) 20. A method for screening for compounds for use in the treatment of Alzheimer's disease substantially as described herein.

Claims

1. 1. A genetically modified mouse model of non-familial, late-onset Alzheimer's disease, comprising a mouse whose genome comprises a deoxyribonucleic acid (DNA) sequence encoding a human APOE4 protein (APOE4p) and a DNA sequence encoding a mouse Trem2 protein (Trem2p) having a R47H point mutation, wherein the human APOE4p and the mouse Trem2p are expressed in the mouse, and the mouse exhibits one or more symptoms or signs associated with non-familial, late-onset Alzheimer's disease, wherein the one or more symptoms or signs associated with non-familial, late-onset Alzheimer's disease are cerebral extravasation compared to an APOE3-expressing mouse or a wild-type control mouse.

2. The mouse model of claim 1 , wherein the APOE4p comprises the amino acid sequence of SEQ ID NO:

1.

3. The mouse model of claim 1 , wherein the mouse Trem2p comprises the amino acid sequence of SEQ ID NO:

3.

4. The mouse model of claim 1 , wherein the APOE4p comprises the amino acid sequence of SEQ ID NO:1 and the mouse Trem2p comprises the amino acid sequence of SEQ ID NO:

3.

5. The one or more symptoms or signs associated with non-familial, late-onset Alzheimer's disease include: (a) the presence of significantly more microglia in the brain of the mouse compared to a control; (b) the presence of significantly more amyloid plaques in the brains of the mice compared to controls; (c) the presence of significantly more tau aggregates in the brains of the mice compared to controls; (d) the presence of significantly more inflammation in the brains of the mice compared to controls; (e) the presence of significantly more synaptic and / or neuronal losses in the brain of said mice compared to controls; (f) the presence of significantly more cognitive impairment in the brain of said mouse compared to a control; (g) the presence of significantly more frailty and signs of aging in the mice compared to controls; (h) the presence of significantly more impaired blood flow in the brain of the mouse compared to a control; and (i) a significantly different presence, level, and / or function of one or more biomarkers of non-familial, late-onset Alzheimer's disease in the blood, serum, or tissues of said mouse compared to a control. The mouse model of claim 1, wherein the control is an APOE3-expressing mouse or a wild-type mouse.

6. 1. A method for screening for putative treatments for human Alzheimer's disease, comprising: Administering the putative treatment to a mouse in the mouse model according to any one of claims 1 to 5; assessing the mouse for changes in one or more symptoms or signs associated with non-familial, late-onset Alzheimer's disease; A method comprising:

7. A method for producing a mouse model according to any one of claims 1 to 5, comprising: Introducing a genetic modification into the genome of said mouse. A method comprising:

8. A method for producing a mouse model according to any one of claims 1 to 5, comprising: Crossing a first mouse, the genome of which contains a deoxyribonucleic acid (DNA) sequence encoding the human APOE4 protein (APOE4p), with a second mouse, the genome of which contains a DNA sequence encoding the mouse Trem2 protein (Trem2p) having a R47H point mutation, to generate said mouse model. A method comprising:

Images