Methods for detecting polymerase incorporation of nucleotides

Abstract

Provided is a method comprising: hybridizing test primers to immobilized primers, the immobilized primers comprising a predetermined nucleotide sequence and attached to a substrate via their 5' ends, each test primer being complementary to a portion of each of at least some of the immobilized primers, such that no more than one test primer molecule hybridizes to an immobilized primer molecule; extending at least some of the test primers by only one nucleotide using a polymerase in a template direction, the template comprising the immobilized primer that hybridizes to the test primer, and the nucleotide incorporated into the extended test primer comprising a fluorescent tag; and detecting the amount of fluorescent test primer.

Description

[Technical field]

[0001] (CROSS REFERENCE TO RELATED APPLICATIONS) This application claims the benefit of U.S. Patent Application No. 62 / 890,064, filed Aug. 21, 2019, entitled "Method for Detecting Polymerase Incorporation of Nucleotides," the entire contents of which are incorporated herein by reference.

[0002] (Sequence Listing) This application contains a Sequence Listing that has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy, created on August 7, 2020, is named IP-1854-PCT_SL.txt and is 715 bytes in size. [Background technology]

[0003] Most of the current sequencing platforms use "sequencing by synthesis" (SBS) technology and fluorescence-based methods for detection. In the method, a substrate or surface contains one or more populations of primers directly or indirectly bound to it, the primers having a known nucleotide sequence. A library or sample containing polynucleotides to be sequenced may be added thereto, the polynucleotides of the library containing segments of stretches of nucleotides that are complementary to the primers bound to the substrate and thereby capable of hybridizing to the primers.

[0004] A polymerase enzyme may be added with a free single nucleotide to extend the immobilized primer, which is bound to the surface or substrate, using the hybridized sample polynucleotide as a template. In a series of steps, a copy of the template, the sample polynucleotide, is thereby added to the substrate as a copy extending from the free end of the primer immobilized on the surface or substrate. In subsequent steps, such copying and extension is repeated iteratively to generate a plurality or lawn of copies of the sample template polynucleotide extending from what was originally the immobilized primer. In subsequent steps, a nascent strand can be generated again using a polymerase associated with such sample template nucleotide under conditions in which the addition of a given nucleotide to the nascent strand is visualized to indicate the identity of the nucleotide incorporated, allowing detection of the sequence of the nascent strand and, ultimately, sequencing of the sample polynucleotide, in the presence of a fluorescently labeled nucleotide.

[0005] In some instances, the amount of primer of a given sequence bound to the substrate can be determined prior to the hybridization, polymerization, and sequencing described above, to provide information about the conditions present on the substrate or surface used for sequencing. Such information can be useful in interpreting results and assembling sequences from the raw data generated. Also, methods to detect how well or efficiently a polymerase can polymerize a primer near where it is bound to the substrate, taking into account steric hindrance or other effects that may affect enzyme activity, can be beneficial. However, by extending the end of an immobilized primer in a polymerization reaction with a fluorescent nucleotide and doing so according to the practice of detecting the addition of fluorescence to the immobilized primer, the primer may be modified, altering its subsequent hybridization, polymerization, and sequencing with a test sample polynucleotide whose sequence is being sought. The present disclosure includes providing a method for measuring the on-surface extension by a polymerase of one or more primers immobilized on a surface without the need for covalent modification of the immobilized primer to allow for subsequent use in an SBS method. Summary of the Invention

[0006] In one aspect, a method is provided that includes hybridizing test primers to immobilized primers, the immobilized primers comprising a predetermined nucleotide sequence and attached to a substrate via their 5' ends, each test primer being complementary to a portion of at least some of the immobilized primers, wherein no more than one test primer molecule hybridizes to the immobilized primer molecule; extending at least some of the test primers using one nucleotide with a polymerase according to a template, the template comprising immobilized primers that hybridize to at least some of the test primers, and wherein the nucleotide incorporated into at least some of the test primers by the extension comprises one of a plurality of fluorescent tags; and detecting the amount of fluorescent test primer.

[0007] In an example, the nucleotide sequence of the first plurality of immobilized primers is different from the nucleotide sequence of the second plurality of immobilized primers. In another example, the first plurality of test primers is complementary to a portion of the first plurality of immobilized primers and the second plurality of test primers is complementary to a portion of the second plurality of immobilized primers. In yet another example, a first nucleotide incorporated into the first plurality of test primers comprises a first one of a plurality of fluorescent tags and a second nucleotide incorporated into the second plurality of test primers comprises a second one of a plurality of fluorescent tags, and the fluorescence emitted by the first one of the plurality of fluorescent tags is different from the fluorescence emitted by the second one of the plurality of fluorescent tags.

[0008] In yet another example, the substrate comprises a metal oxide. In a further example, the substrate comprises a metal oxide, the metal oxide being selected from the group consisting of silicon dioxide, fused silica, tantalum pentoxide, titanium dioxide, aluminum oxide, hafnium oxide, and graphene oxide. In a further example, the substrate further comprises a polymer. In a further example, at least some of the immobilized primers are bound to a polymer. In one example, the polymer is a heteropolymer selected from: [ka] (wherein x and y are integers representing the number of monomers, and the ratio of x:y may be from about 15:85 to about 1:99, such as from about 10:90 to about 1:99, for example from about 10:90 to about 5:99), and [ka] (wherein x, y, and z are integers representing the number of monomers, and the ratio of (x:y):z may be from about (85:15) to about (95:5), and each R z are independently H or C 1~4 In some examples, the ratio of x:y:z can be from about 0:15:85 to about 0:5:95. In an example, x:y is 5:95. In another example, the ratio of x:y:z is 5:85:10.

[0009] In another example, the polymerase is selected from Klenow fragment and Phi29 polymerase. In yet another example, the polymerase is bound to a substrate. In yet another example, the polymerase is not bound to a substrate. In an example, the polymerase is selected from Klenow fragment and Phi29 polymerase. In a further example, the polymerase is bound to a substrate. In an even further example, the polymerase is not bound to a substrate.

[0010] In another example, detecting includes measuring fluorescence emitted from the test primer in response to the stimulus. In yet another example, the test primer hybridizes to the immobilized primer during the measurement. A further example includes dehybridizing the test primer from the immobilized primer prior to the measurement.

[0011] In an example, detecting includes measuring fluorescence emitted from the test primer. For example, the test primer may hybridize to the immobilized primer during the measurement. A further example includes dehybridizing the test primer from the immobilized primer prior to the measurement. An even further example includes comparing the detected amount of a first one of the plurality of fluorescent tags to the detected amount of a second one of the plurality of fluorescent tags.

[0012] In an example, the 5' ends of at least some of the test primers do not overhang the 3' end of the immobilized primer. In another example, the 5' ends of at least some of the test primers include a 5' fluorescent tag having a 5' fluorescent tag spectrum, the 5' fluorescent spectrum being different from the fluorescent spectrum of the fluorescent tag of a nucleotide incorporated into the test primer by extension, and detecting includes detecting the amount of the 5' fluorescent tag and the amount of the nucleotide fluorescent tag.

[0013] In yet another example, at least some of the test primers comprise an overhanging test primer complementary to the overhanging immobilized primer, wherein a 5' end of the overhanging test primer overhangs onto the 3' end of the overhanging immobilized primer when hybridized thereto prior to the extension, and further comprising extending the overhanging immobilized primer using one nucleotide, wherein the nucleotide incorporated into the overhanging immobilized primer by the extension comprises a overhanging fluorescent tag having an emission spectrum that is detectably different from the emission spectrum of one of the multiple fluorescent tags incorporated into the overhanging test primer by the extension; detecting the amount of fluorescent immobilized primer; and comparing the amount of fluorescent test primer to the amount of fluorescent immobilized primer.

[0014] In yet another example, at least some of the test primers comprise an overhanging test primer complementary to the overhanging immobilized primer, a 5' end of the overhanging test primer overhangs a 3' end of the overhanging immobilized primer when hybridized thereto prior to the extension and comprises a test primer 5' fluorescent tag, further comprising extending the overhanging immobilized primer using a nucleotide, a nucleotide incorporated into the overhanging immobilized primer by the extension comprises a overhanging fluorescent tag, the test primer 5' fluorescent tag and the overhanging fluorescent tag comprise a fluorescent tag pair when the overhanging test primer hybridizes to the overhanging immobilized primer after extension of the overhanging immobilized primer, and a combined fluorescence emitted by the fluorescent tag pair is different from the fluorescence emitted from the test primer 5' fluorescent tag and the fluorescence emitted from the overhanging fluorescent tag. In yet a further example, detecting the amount of fluorescent test primer comprises detecting the combined fluorescence emitted by the fluorescent tag pair.

[0015] It should be understood that all combinations of the foregoing concepts and additional concepts discussed in more detail below (unless such concepts are mutually inconsistent) are considered to be part of the inventive subject matter disclosed herein and contribute to the advantages and benefits described herein. [Brief description of the drawings]

[0016] These and other features, aspects, and advantages of the present disclosure will become better understood from the following detailed description when taken in conjunction with the accompanying drawings.

[0017] [Figure 1] 1 shows a flow diagram of an example method according to an aspect of the present disclosure.

[0018] [Diagram 2] 1 shows a flow diagram of an example method according to an aspect of the present disclosure.

[0019] [Diagram 3]1 is a graphical representation of the amount of each of two different primers (P5 and P7) bound to the surface (y-axis) as assessed by quantifying the amount of fluorescently tagged test primer hybridized thereto as a function of the ratio of P5 to P7 primers included in the surface primer grafting reaction (x-axis) for each of three total concentrations of primers used in the surface primer grafting reaction (left, middle, and right panels).

[0020] [Figure 4] FIG. 1 is a graphical representation of the measured amounts of two different primers (P5 and P7) bound to a surface (y-axis) as assessed by quantifying the ratio of the amount of fluorescently tagged test primer hybridized to the P5 primer compared to the P7 primer as a function of the ratio of P5 to P7 primers included in the surface primer grafting reaction (x-axis) for each of three total concentrations of primers used in the surface primer grafting reaction.

[0021] [Diagram 5] FIG. 1 is a graphical representation of the amount of each of two different polynucleotides complementary to surface-bound primers (P5 and P7) extended by a polymerase (y-axis) as assessed by quantifying the amount of fluorescence incorporated into such test primers according to an embodiment of the present disclosure as a function of the ratio of P5 to P7 primers included in the surface primer grafting reaction (x-axis) for each of three total concentrations of primers used in the surface primer grafting reaction (left, middle, and right panels).

[0022] [Figure 6]FIG. 1 is a graphical representation of the measured amounts (y-axis) of two polynucleotides complementary to the primers (P5 and P7) bound to the surface, as assessed by quantifying the ratio of the amount of fluorescently tagged test primer hybridized to the P5 primer compared to the P7 primer, as a function of the ratio (x-axis) of P5 primer to P7 primer included in the reaction to graft the primer onto the surface, for each of three total concentrations of primers used in the reaction to graft the primer onto the surface.

[0023] [Figure 7] 1 shows the percentage of hybridizable immobilized polynucleotides that have associated polymerase activity, according to an embodiment of the present disclosure.

[0024] [Figure 8A] 1 shows an example of a method according to the present disclosure in which a polymerase adds fluorescent nucleotides to a polynucleotide complementary to a surface-bound primer. [Figure 8B] 1 shows an example of a method according to the present disclosure in which a polymerase adds fluorescent nucleotides to a polynucleotide complementary to a surface-bound primer. [Figure 8C] 1 shows an example of a method according to the present disclosure in which a polymerase adds fluorescent nucleotides to a polynucleotide complementary to a surface-bound primer. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0025] Methods are provided for assessing the availability of surface or substrate bound or immobilized polynucleotide primers for polymerase activity. Current SBS and related techniques use a number of such primers to serve as the initiation of a polymerase reaction to determine the nucleotide sequence of a polynucleotide in a sample applied to the surface. Some of such methods include hybridization of a sample oligonucleotide to a surface immobilized primer. Advantageously, an understanding of the total amount of primer available for hybridization to a sample oligonucleotide can be determined. Such information can be useful for determining parameters for use in such services in SBS or related methods using such surfaces. Such methods can further be useful for assessing whether various characteristics of a surface with immobilized primers, or a given polymerase enzyme, or various primer sequences bound to a surface, or any combination of the foregoing, affect polymerization with such primers, for example, for use in SBS or related methods.

[0026] The SBS method may further include different kinds of primers hybridized to the surface for hybridizing to various portions of the sample polynucleotide applied thereto. In an example, a polynucleotide obtained from a sample, such as a tissue sample or other polynucleotide source, may be modified at its ends to include known sequences for hybridizing to known primer sequences. For example, such a polynucleotide may have a nucleotide sequence appended to one end that may hybridize to a first primer sequence, and a nucleotide sequence appended to the other end that may hybridize to a second primer sequence. Furthermore, a surface for use in SBS or related methods may have two primer populations affixed thereto, including a first primer sequence and a second primer sequence, which sequences are capable of hybridizing to one or the other end of a sample polynucleotide having the aforementioned modifications. Thus, such a sample polynucleotide may hybridize to one or the other immobilized primer, or in some cases, both. In some examples, a surface may have a population of more than two primers immobilized thereon, and a sample of polynucleotides may have more than two complementary nucleotide sequences immobilized at one or another end, for example, for hybridizing to such primers immobilized on the surface. In other examples, individual polynucleotides in a sample may have sequences added to each end that are the same as each other, and thus each hybridize to the same type of primer immobilized on the surface, rather than each having a different sequence from each other. In other examples, a sample may include polynucleotides some of which have different terminal sequences added to each other, other polynucleotides with the same terminal sequences added to each other, polynucleotides with terminal sequences added differently from the terminal sequences added, or several other polynucleotides in the sample, or various combinations of the foregoing.

[0027] For example, for performing SBS or related methods on a surface on which two or more populations of such primers are immobilized, the relative amount of each population with respect to the other immobilized on the surface can be advantageously determined. For example, it may be desirable to create or use a surface on which an equal ratio of first and second primers are immobilized. For example, it may be desirable for a sample polynucleotide modified to include a first and second sequence at the first and second ends to be equally likely to hybridize to the surface immobilized primers by one end or the other. Alternatively, it may be desirable for the polynucleotides in such a sample to hybridize to one primer on the surface to a higher degree than the other, or vice versa. Furthermore, the polynucleotide molecules in the sample may have unequal portions of terminally added nucleotide sequences, which affects the likelihood that a given polynucleotide molecule will hybridize to one or another surface immobilized primer. When hybridization of polynucleotides to surface immobilized primers is used for SBS or similar or other methods for polymerase-catalyzed extension of nucleotide chains, the ability to control and / or determine the total and relative amounts of the various primers immobilized on the surface can be beneficial.

[0028] In some instances, as surprisingly disclosed herein, the total amount of primers, or the total amount of one or more species of primers, or the relative amounts or ratios of primers immobilized on a surface, while useful information, may not be a perfect predictor of the activity of polymerase activity for such primers immobilized on a surface. In some cases, for example, a given primer may be able to function as a more efficient initiation point for polymerase reaction compared to another primer sequence hybridized to the same surface. In another example, the introduction of various mutations to the surface to which the primer is immobilized may disproportionately increase or decrease the polymerase activity in a given primer compared to another primer. In another example, a polymerase molecule may be more efficient or more processive in initiating polymerization from a given surface-immobilized primer compared to a surface-immobilized primer of a different sequence. In another example, the distance from the surface or modified surface from which the primer is immobilized to it extends, or the distance of the portion of the primer with which the polymerase interacts to initiate the polymerization reaction, may affect the likelihood of polymerization being initiated, perhaps disproportionately for one primer sequence as opposed to another primer sequence. For all of the above examples, and others, the effect may be primer sequence specific, i.e., alteration of one variable or another that may affect how, whether, or how efficiently a polymerase initiates a polymerization reaction for a surface-immobilized primer of one sequence may have a different comparable effect for a surface-immobilized primer of a different sequence.

[0029] In such cases, it is advantageous not to simply determine the number or relative ratio of one primer to another that is immobilized on the surface.In some instances, a given ratio of one primer to another may not have a one-to-one correspondence to how much polymerase activity can be initiated at a given primer.If the probability, efficiency, processivity, or other parameters of polymerization initiation differ on a primer sequence-to-primer sequence basis, or in other differences between the types of primers on the surface, such as the estimated distance that the primer extends from the surface, or the distance that the part that polymerase binds to and initiates polymerization extends from the surface, simply specifying the relative amount of primers immobilized on the surface may not accurately reflect the relative polymerization that is initiated at each type of primer.

[0030] Polymerization at surface-immobilized primers can be determined by performing a test polymerization reaction with a polymerase in which one or more nucleotides are attached to the distal end of the primer and oriented away from the end proximal to and attached to the surface. However, such methods involve covalently modifying the surface-immobilized primer, i.e., by covalently attaching a nucleotide to the free end. In some instances, it may be desirable to measure polymerization initiated at a surface-immobilized primer without including the creation of a covalent modification to the surface-immobilized primer, as provided in the present disclosure. For example, it may be desirable to test or confirm the level or relative level of polymerase activity of a species of primer or species of primer immobilized on a surface before using such a surface in an SBS or similar method. Alternatively, sequential assays may be desirable to be performed on a given surface on which primers are immobilized, and it may be desirable to directly compare the outputs of such sequential assays without confounding the covalent modifications made to the primer by one or more sequential assays.

[0031] Polynucleotides have so-called 3' and 5' ends, which refer to the numbered carbons on the sugar ring of the nucleotide at each end of the chain, and are not directly attached to adjacent nucleotides in the sequence via such carbons. Polymerases add nucleotides to the growing chain in a 5'→3' direction. That is, the 5' carbon of the sugar of the free nucleotide is attached to the 3' sugar of the nucleotide at the so-called 3' end of the polynucleotide via an intervening phosphate group by a reaction catalyzed by the polymerase enzyme. In some examples of surfaces on which primers are immobilized for use in performing SBS or other related methods, the primers may be attached or immobilized to a substrate with the 5' end oriented toward and proximal to the surface or substrate, and the 3' end distal and free. In such examples, a sample polynucleotide may hybridize to such a primer. Thus, in the presence of polynucleotides and free nucleotides, the primers may be extended beginning with the addition of nucleotides to the free 3' end using the hybridized sample polynucleotide as a template. Polymerization can continue with the extension of nascent nucleotides extending from the initial free 3' end of the surface-immobilized primer. Conventional SBS and related techniques can use such methods as part of the process to ultimately determine the sample polynucleotide sequence.

[0032] As explained above, in some cases it may be advantageous to quantify how much of a given primer species is present immobilized on a surface or the relative amounts of primers of various species. Traditionally, one way to do so is to perform a first test in which a polynucleotide is added to a surface with surface-immobilized primers, the polynucleotide being complementary to at least a portion or sequence of the primer or some of the primers. Such a polynucleotide may include a marker that allows its detection. Traditionally, for example, a short polynucleotide of a certain length, for example 10-60 nucleotides, complementary to a portion or sequence within the primer immobilized on the surface may be added to the surface to hybridize to the primer. The polynucleotide may be modified, for example, by including a fluorescent probe or molecule. When more than one primer, for example two primers, are immobilized on a surface, two different polynucleotides, one capable of hybridizing to one primer and the other capable of hybridizing to the primer of the other species, may be added to the surface and incubated therewith.

[0033] Each type of polynucleotide may contain a fluorophore, and each fluorophore may fluoresce in a way that allows one fluorophore to be distinguished from the other, such as by having a different emission spectrum from the other. After incubating a surface with such polynucleotides to hybridize to their respective complementary primers, the unhybridized polynucleotides may be washed away, and the fluorophores remaining on the surface reflect the amount of one or the other or both species of polynucleotide present, and thus the complementary primers immobilized on the surface. The hybridized fluorescent polynucleotides may then be dehybridized from the surface-immobilized primers, resulting in a surface that is not covalently modified from its state before hybridization with the fluorescent polynucleotides, but with information regarding the amount and / or relative amounts of primers and / or the various species of primers hybridized thereto, obtained for later reference.

[0034] To determine the polymerase activity potential for surface-immobilized primers and / or primer species, in some examples, different or additional methods may be used according to the embodiments disclosed herein without covalently modifying the surface-immobilized primer. An example is shown in FIG. 1. In this example, the immobilized primer is immobilized on a surface. In this example, the immobilized primer is identified as P5, with its 3' end indicated by an arrowhead distal to the surface and its 5' end proximal to and oriented toward the surface or substrate to which the immobilized primer is immobilized or immobilized. The sequence of the immobilized primer is known or predefined, or at least a portion of it is known or predefined, such that a polynucleotide can be designed to have a complementary nucleotide sequence thereto, such that the polynucleotide can hybridize to the primer or at least a portion of the primer. Thus, further, the sequence of the primer of the nucleotide or portion may be known, such that the polynucleotide may not directly hybridize to the immobilized primer nucleotide to which the complementary nucleotide may hybridize, but the identity nucleotide flanked by one or more nucleotides is known.

[0035] Referring again to FIG. 1, hybridization may be performed, for example, including adding a test primer to a surface in a hybridization solution, where such a test primer may hybridize to a portion of the immobilized primer to which it is complementary. In the example shown in FIG. 1, a polynucleotide complementary to the P5 immobilized primer, designated cP5, is shown hybridized to a portion of the P5 immobilized primer. In this example, the arrowhead on the cP5 polynucleotide indicates the 3' end of the cP5 test primer. The 5' end of the P5 immobilized primer is proximal to the surface, but according to base pairing complementarity, the 3' end of the complementary cP5 polynucleotide is proximal to the surface and the 5' end distal to it when the complementary cP5 primer hybridizes to the immobilized P5 primer. Also, in this example, the 5' end of the complementary cP5 primer does not overhang the 3' end of the P5 immobilized primer. That is, the 3' end of the P5 immobilized primer is complementary to and hybridizes to a nucleotide of a complementary cP5 polynucleotide.

[0036] In this configuration, the polymerase can add a nucleotide to the complementary cP5 polynucleotide, but not to the P5 immobilized primer. That is, the polymerase uses the non-hybridized nucleotide 5' to the 5'-most nucleotide of the template polynucleotide that hybridizes to the polynucleotide being extended by the polymerase as a template for adding the next nucleotide added by extension. In the example shown in FIG. 1, there is no such 5'-most nucleotide of the complementary cP5 polynucleotide. That is, the 5'-most nucleotide of the complementary cP5 polynucleotide hybridizes to a nucleotide of the P5 immobilized primer. Thus, there is no nucleotide of the complementary cP5 polynucleotide that can be used as a template for the polymerase to add another nucleotide to the 3'-end of the immobilized primer. However, the complementary cP5 polynucleotide can be extended by the polymerase. Adjacent 5' to the nucleotide of the P5 immobilized primer that hybridizes to the 3'-most nucleotide of the complementary cP5 primer is a nucleotide of the P5 immobilized primer that does not hybridize to a nucleotide of the complementary cP5 polynucleotide. A polymerase contacted with the hybridized P5 immobilized primer and complementary cP5 polynucleotide can extend the 3' end of the complementary cP5 nucleotide by at least one nucleotide, which is complementary to the nucleotide of the P5 immobilized primer that is one nucleotide 5' to the nucleotide of the P5 primer that hybridizes to the 3' end of the complementary cP5 polynucleotide. In this example, only one complementary cP5 polynucleotide hybridizes to a given P5 immobilized primer.

[0037] Continuing with the case of FIG. 1, after the complementary cP5 nucleotide hybridizes to the P5 immobilized primer, the non-hybridized complementary cP5 polynucleotide may be washed away. The surface may then be contacted with a polymerase enzyme, for example, in a polymerization solution. Similarly, the solution may also include a nucleotide that can be added to the 3' end of the complementary cP5 polynucleotide by the polymerase, as described above. In an example, the only polynucleotide included in the polymerization solution may be complementary to the next non-hybridized nucleotide 5' to the P5 immobilized primer, such that the polymerase can catalyze its addition to the 3' end of the complementary cP5 polynucleotide using the P5 immobilized primer as a template. In some examples, the next 5' nucleotide of the P5 immobilized primer is known to be different from the P5 nucleotide that serves as a template for adding a nucleotide to the 3' end of the complementary cP5 polynucleotide. In such an example, if only one type of nucleotide is included in the polymerization solution that can be bound to a 3' end complementary to a cP5 polynucleotide by a polymerase using the P5 immobilized primer as a template, then accordingly, only one nucleotide will bind to the complementary cP5 polynucleotide.

[0038] In the example shown in Figure 1, the hybridization polymerization processes are shown as being performed separately from one another, however, in other examples, the test polynucleotide complementary to the immobilized primer, the polymerase enzyme, and the nucleotides for incorporation by the polymerase may all be added to the surface in a single solution such that hybridization and polymerization occur in the same solution.

[0039] In another example, the nucleotide in the polymerization reaction may be modified so that only one can be added to the nascent chain in the polymerization reaction without further intervention. For example, a modification at the 3' end of a nucleotide or related molecule can prevent the ability of another nucleotide to be added to it once the nucleotide has been added to the 3' end of the growing chain by a polymerase. For example, a nucleotide can have a chemical modification at its 3' carbon, such as the addition of an azidomethyl or other group that can prevent the chain from further elongation after the nucleotide has been added. In another example, the nucleotide in the polymerization solution can be a dideoxynucleotide, which does not have a hydroxyl group on the 3 carbon and therefore has no binding site for the 5' phosphate-carbon of the next nucleotide. In other examples, only 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 15-20, or more nucleotides may be added to the 3' end of a complementary cP5 polynucleotide. The amount of such added nucleotides may be controlled by controlling which types of nucleotides are included in the polymerization reaction, for example, by including all nucleotides complementary to the available template P5 immobilized primer nucleotides, except for the P5 immobilized primer that is one nucleotide 5' to the last P5 immobilized primer that is intended to serve as a template for extending the 3' end of the cP5 polynucleotide. Alternatively, the last nucleotide for addition to the extended 3' end of the complementary cP5 polynucleotide may be modified to prevent further extension therefrom according to the above or other examples.

[0040] In another example, more than one type of immobilized primer can be attached to a surface or substrate with different sequences. Furthermore, different types of test primers can be incubated with a surface or substrate so that a species of test primer that is complementary to a certain type of immobilized primer can hybridize to the immobilized primer of that species, and a polynucleotide complementary to a second type of text primer can hybridize to the immobilized primer of the second species. In an example, one or each type of test primer can only hybridize to a certain type of immobilized primer, and another or different species of test primers are only complementary to another species of immobilized primer, so that only a certain type of test primer hybridizes to a given species of immobilized primer. In another example, a species of test primer can hybridize to both or all species of immobilized primers immobilized on a substrate or surface.

[0041] In another example, whether one or more test primers incubated with the surface are capable of hybridizing to only one or more surface-immobilized primers, the test primers may be designed such that only one type of nucleotide can be added by the polymerase to the 3' end of a test primer hybridized to one type of test primer, and only another type of nucleotide can be added by the polymerase to the 3' end of another test primer hybridized to another type of immobilized primer. For example, in either or both cases, the next 5' nucleotide of each type of immobilized primer immediately 5' to the 5'-most immobilized primer nucleotide hybridized to the 3' end of the test primer to which it hybridizes may be different from the comparable nucleotide of the other species, or of the other species if there are more than two in total. In such a case, the polymerase may catalyze the addition of one type of complementary nucleotide to the 3' end of one type of test primer hybridized to one type of immobilized primer, and the addition of a different type of complementary nucleotide to the 3' end of another type of test primer hybridized to another type of immobilized primer.

[0042] Thus, different nucleotides may be added to test primers hybridized to different immobilized primers. In an example, different types of nucleotides are identifiable in a manner that allows for differentiation between different nucleotides. For example, different types of nucleotides may carry different markers to which they are covalently attached. In an example, the nucleotides may have fluorescent markers observable by fluorescent imaging. The two types of nucleotides may have two different types of fluorophores, each of which has a different emission spectrum from the other, such as being excitable by a different wavelength of light or other electromagnetic radiation compared to the other and / or emitting a detectably different wavelength from the other upon excitation. A large number of fluorophores are used in related fields to distinguish between different nucleotides, including various examples of SBS and related methods. According to this example, different types of nucleotides are added to test primers complementary to different types of immobilized primers immobilized on a surface, and the polymerase activity associated with, for example, different fluorophores attached to different nucleotides, different types of immobilized primers can be determined. Certain fluorescent or other markers can be detected on the surface where the test primers hybridize to the immobilized primers.

[0043] With test primers and immobilized primers designed such that the type of nucleotide that can be added to a given test primer when hybridized to the immobilized primer in the presence of nucleotides and polymerase in the polymerization solution, and the detection properties of the markers, such as fluorophores, immobilized to different types of nucleotides, are also known, the detection of a given marker can indicate the type of primer whose polymerization reaction is catalyzed by the polymerase. When more than one immobilized primer and / or more than one test primer are used according to the disclosed method for evaluating polymerase activity in primers immobilized on a substrate, two different types of test primers can be simultaneously incubated and hybridized with the immobilized primer immobilized on the surface, and the test primer species are extended simultaneously during the same polymerization reaction with each other. In other examples, one test primer can be incubated at a time, and / or a nucleotide species that can be added to the test primer when hybridized to only one of multiple immobilized primers can be present in a given polymerase reaction. Thereafter, a second incubation process with a test primer of the same or another species may be carried out, and / or another polymerization reaction may be carried out with a species of nucleotide capable of binding to the polynucleotide when hybridized to an immobilized primer of a second species.

[0044] In examples, the species of nucleotide incorporated by one or more polymerization reactions can be detected, while the test primer remains hybridized to the immobilized primer and the test primer extended by the addition of a detectable nucleotide as disclosed herein can be detected. For example, with reference to FIG. 1, the polymerization reaction is illustrated by incubation of the test primer hybridized to the immobilized primer with nucleotides (shown as a star shape) and polymerase (represented as a three-quarter circle shape). In this example, the polymerase is shown as being in solution. However, in other examples, the polymerase may be bound to a substrate. After the polymerization reaction, unbound polymerase, unbound test primer, and / or free nucleotides may be washed away under hybridization conditions that allow continued hybridization of the test primer to the immobilized primer. The surface may then be scanned according to known methods to detect detectable nucleotides on the surface. The location and / or overall amount of each type of nucleotide present after washing the unincorporated nucleotides and unhybridized test primers from the surface indicates the polymerization that has occurred with a given immobilized primer. In some examples, detection, measurement, or quantification of incorporated nucleotides may be performed after the extended test primer during the polymerization reaction has dehybridized from the immobilized primer, such as after incubation in a rehybridization solution. In such examples, rather than or after measuring the amount and / or position of incorporated nucleotides when the extended test primer remains hybridized to the immobilized primer, the amount of incorporated nucleotide may be measured, for example, in a dehybridization solution containing the extended test primer that has dehybridized from the immobilized primer after polymerase-catalyzed nucleotide incorporation.

[0045] The example shown in FIG. 1 is just one non-limiting example. Many modifications or variations of the example illustrated in FIG. 1 are also included in the present disclosure, including those described in the paragraph above. Additionally, only one immobilized primer and only one test primer and only one detectable nucleotide are shown in FIG. 1. Consistent with the above examples, examples may include multiple immobilized primers. Examples may include multiple test primers. Examples may include multiple labeled detectable nucleotides for incorporation into the test primers by a polymerase. As can be further appreciated, the surface of the surface may be 1 mm2 or 2 mm2 or 3 mm2 or 4 mm2 or 5 mm2 or 6 mm2 or 7 mm2 or 8 mm2 or 9 mm2 or 10 mm2 or 11 mm2 or 12 mm2 or 13 mm2 or 14 mm2 or 15 mm2 or 16 mm2 or 17 mm2 or 18 mm2 or 19 mm2 or 20 mm2 or 21 mm2 or 22 mm2 or 23 mm2 or 24 mm2 or 25 mm2 or 26 mm2 or 27 mm2 or 28 mm2 or 30 mm2 or 31 mm2 or 32 mm2 or 35 mm2 or 36 mm2 or 37 mm2 or 38 mm2 or 40 mm2 or 40 mm2 or 50 mm2 or 60 mm2 or 70 mm2 or 80 mm2 or 10 mm2 or 11 mm2 or 25 mm2 or 26 mm2 or 27 mm2 or 28 mm2 or 29 mm2 or 30 mm2 or 31 mm2 or 32 mm2 or 33 mm2 or 34 mm2 or 35 mm2 or 36 mm2 or 37 mm2 or 38 mm2 or 39 mm2 or 40 mm2 or 40 mm2 or 40 mm2 or 50 mm2 or 50 mm2 or 60 mm2 2 Maximum of 1 x 10 11 Many copies of one or more immobilized test primers, including seed primers, can be attached to a surface, on the order of thousands or hundreds of thousands or millions or tens of millions or more. For purposes of illustration, only one molecule of immobilized primer is shown in FIG.

[0046] In an example, one test primer hybridizable to one immobilized primer may correspond to a sequence at or added to a nucleotide end in a sample whose sequence is to be determined in performing SBS using a surface using the methods disclosed herein. Another test primer hybridizable to another immobilized primer may correspond to a sequence at or added to the other end of a nucleotide in a sample whose sequence is to be determined in performing SBS using a surface using the methods disclosed herein. Thus, for example, immobilized primers such as P5 and P7 primers may be primers immobilized on a surface. Furthermore, the test primers used in the methods disclosed herein may have sequences complementary to the P5 and P7 immobilized primers, and the sample polynucleotides whose sequences are to be examined during subsequent SBS using a surface or substrate may have sequences corresponding to such test primers added to one and / or the other end as part of such subsequent SBS or similar process.

[0047] The polymerase activity determined according to the methods disclosed herein in the example where one or more test primer sequences used correspond to the sequence of the polynucleotide added to the end of the sample polynucleotide can provide predictive information regarding the hybridization of such sample polynucleotide to such immobilized primers and / or the polymerase activity expected in terms of such hybridization. More generally, regardless of any subsequent SBS or related methods performed on the substrate on which the methods disclosed herein are used, the information obtained by the methods disclosed herein indicates the polymerase activity at the surface and possibly distinguishable polymerase activity depending on the given immobilized primer. Surprisingly, as disclosed herein, the quantification of immobilized primers to which the test primers can hybridize is only one and does not have a one-to-one correspondence for polymerization at different immobilized primer sites.

[0048] A non-limiting example of a method for quantifying nucleotides incorporated by a polymerase reaction according to the present disclosure is shown in FIG. 2. As disclosed above, in some examples, the amount of incorporated nucleotides detectable, for example, by known fluorescence emission spectra, can be detected, while the test primer incorporated during the polymerization reaction is still hybridized to an immobilized primer bound to a surface, as shown in plate 1 on the left side of FIG. 2. In another example, a marker associated with the incorporated nucleotide can be released from the immobilized primer. For example, a test primer hybridized to an immobilized primer and containing an incorporated nucleotide with a detectable marker, such as a fluorophore, can be dehybridized from the immobilized primer. Alternatively, the detectable marker, such as a fluorophore, can be chemically cleaved from the test primer and thereby released into solution. In any such case, an indication of fluorescence or other associated marker in solution can be detected prior to (or after) detection on the surface, prior to release of the marker from the immobilized primer. Such an example is shown in the center plate 1 panel in FIG. 2.

[0049] In yet another example, the solution containing the fluorophore or other marker after release from the immobilized primer may be removed from the solution on the surface and transferred to another detection vessel for measurement in a different marker, detection system, or device, such as fluorescence. Such an example is shown in the right panel of FIG. 2, where a portion of the solution from plate 1 is removed and placed in this example on plate 2. However, the second vessel for measurement does not have to be a plate, but can be any known device or system or method for detection. In an example, gel electrophoresis can be used to separate and then visualize the test primers with marker-bound nucleotides added in a polymerase reaction as described. In another example where gel electrophoresis is used to resolve test primers containing nucleotides incorporated in a polymerase reaction as disclosed, the distinction between the polymerase activity associated with one type of immobilized primer-test primer hybridized pair and another type of immobilized primer-test primer hybridized pair can be based on the difference in the length of the respective test primers after polymerase-catalyzed incorporation of nucleotides. For example, one test primer species may be longer than the other, while adding the same amount of nucleotides to each (such as one), or in either event, adding an amount to each such that the overall length of each after polymerase-catalyzed nucleotide addition may differ enough to allow separation by gel electrophoresis. This may be possible even if the nucleotides incorporated into the various test primers did not contain markers that were detectably distinguishable from one another. In some instances, the incorporated nucleotides, or one of them, may not contain any independently detectable markers, in which case gel electrophoresis or other size-based partitioning methods may be used.

[0050] Surprisingly, as disclosed herein, measurements of hybridization of test primers to immobilized primers cannot indicate whether polymerase activity in different species of immobilized primer-test primer hybridization pairs is comparable or equivalent, or if not, how it differs from one another. Examples of such possible differences in polymerase activity may not necessarily be reflected in Figures 3-6. Figure 3 shows the amount of test primer hybridized to immobilized primers on a surface (Y axis), expressed as the amount of strands per well, where strands shows an extrapolation of the amount of immobilized primer from the amount of fluorescence detected, and well shows the portion of the surface where the measurement was made. Fluorescence is the fluorescence detected from a test primer that contains a fluorophore. In this example, two immobilized primers P5 and P7 were used, and thus two test primers cP5 and cP7 complementary to these used. cP5 and cP7 contained fluorescent markers that could be detected differently from one another. Three panels are shown. Each panel reflects a different total concentration of primers used in the reaction in which the primers bind to a surface or substrate to become immobilized primers, according to known methods. Total concentrations are given in μM (0.5 μM, 1 μM, and 2 μM) from left panel to right panel. On the x-axis is shown the relative ratio of P5 primer to P7 primer included in the reaction in which the primers are bound to a surface or substrate to become immobilized primers according to known methods. Thus, Figure 3 shows the number of immobilized primers that can hybridize to the complementary test primer that it was designed to hybridize to for various total concentrations of primers included in the reaction to immobilize the primers to a surface, and for different relative concentrations of each primer given such total primer concentrations.

[0051] These data are presented in a different format in FIG. 4. In FIG. 4, the x-axis is the relative ratio of P5 primer to P7 primer in the reaction in which the primers are bound to a surface or substrate to become immobilized primers, as in FIG. 3, according to known methods. The amount of fluorescence detected on the surface corresponding to each of the P5 and P7 immobilized primers was determined (see FIG. 3, y-axis), and the ratio of P5-related fluorescence to P7-related fluorescence was calculated for each relative ratio of P5 to P7 in the immobilized primer immobilization reaction used to immobilize the immobilized primer to the substrate. This ratio of P5-related fluorescence to P7-related fluorescence is given on the y-axis of FIG. 4. The three plots represent three different total concentrations of primers (0.5 μM, 1 μM, and 2 μM, as in the three panels shown in FIG. 3) used in the reaction in which the primers are bound to a surface or substrate to become immobilized primers, as in known methods. The 1:1 line is shown as a prediction of the plot, which would be expected for equimolar concentrations of primers used in the reaction in which the primers are immobilized on the surface, resulting in equimolar amounts of fluorescent test primer hybridized to the surface. However, as shown, the actual values ​​are lower than the predicted 1:1 line. In other words, at these total concentrations, increasing the ratio of P5 to P7 in the immobilization reaction did not correspond to an equivalent increase in the amount of P5 available for hybridization by the test primer to the P7 immobilized primer (e.g., a smaller ratio of P5 to P7 grafted to the surface).

[0052] Figures 5 and 6 are comparable to Figures 3 and 4, except that the y-axis shows the amount of fluorescent nucleotide attached to the 3' end of a polynucleotide complementary to P5 or P7 according to the methods disclosed herein (see, e.g., Figure 1), rather than reporting the amount of fluorescent test primer hybridized to the immobilized primer. Other aspects of Figures 3 and 4 are applicable to Figures 5 and 6. The three panels in Figure 5 correspond to the total concentration of primers used in immobilizing the primers to the surface, and the x-axis shows the relative concentration of P5 to P7 in the reaction. In Figure 6, the x-axis is as described in Figure 4. The y-axis is similar to that described in Figure 4, except that the ratio is the ratio of P5-associated polymerase activity to P7-associated polymerase activity, rather than the ratio of P5 hybridization to P7 hybridization. Again, a 1:1 plot is drawn into which results may be drawn when increasing the relative concentration of P5 to P7 in reactions in which the primers are immobilized on a surface results in a commensurate increase in polymerization associated with the P5 immobilized primer compared to polymerization associated with the P7 immobilized primer.

[0053] In this case, surprisingly, increasing the relative concentration of P5 also correspondingly increased the P5-associated polymerase activity. However, as shown in FIG. 4, it should be noted that increasing the relative concentration of P5 did not lead to a corresponding increase in P5 hybridization to the test primer. In other words, in combination, FIGS. 4 and 6 show that the polymerase activity associated with the P5 primer can increase more than the measurement of P5 hybridization availability alone would predict. Rather, unexpectedly and surprisingly, as disclosed herein, increasing the P5:P7 ratio proportionally increased the P5:P7-associated polymerase activity, even though the increase in P5:P7 hybridization availability was less than proportional. These differences are shown in FIG. 6, which shows the percentage of primer accessible to the polymerase relative to the total amount of primer accessible to hybridization (e.g., grafted primer) for three different relative concentrations of P5 primer to P7 used in the reaction to immobilize the primer to the surface. As shown, in this example, a higher proportion of P5 primers makes the polymerase activity accessible to the P7 primer.

[0054] Such information can be useful. It can be used to determine the conditions to be applied to the grafting reaction while the primer is immobilized on the surface to reach a predetermined hybridization accessibility and polymerase activity accessibility. In other examples, comparative polymerase accessibility of different primers of any desired sequence can be assayed. Primers of different lengths can be assayed. Different concentrations of immobilized primers on the surface can be tested. Test primers can be assayed. Different polymerases can be assayed as well as different substrates. In some examples, the surface of the substrate can have different surface modifications. The methods disclosed herein can be used to assay various modifications to the surface and the effect they may have on the availability of different immobilized primer polymerase activities.

[0055] Any of a variety of polymerases, including, for example, protein-based enzymes isolated from biological systems and functional variants thereof, can be used in the methods described herein. Reference to a particular polymerase, such as those exemplified below, will be understood to include its functional variants unless otherwise indicated. A particularly useful function of polymerases is to catalyze the polymerization of nucleic acid chains using existing nucleic acids as templates. Other useful functions are described elsewhere herein. Examples of useful polymerases include DNA and RNA polymerases, functional fragments thereof, and recombinant fusion peptides comprising them. Exemplary DNA polymerases include those classified by structural homology into families identified as A, B, C, D, X, Y, and RT. Family A DNA polymerases include, for example, T7 DNA polymerase, eukaryotic mitochondrial DNA polymerase gamma, E. coli DNA Pol I (including the Klenow fragment), Thermus aquaticus Pol I, and Bacillus stearothermophilus Pol I. Family B DNA polymerases include, for example, eukaryotic DNA polymerases a, 6, and E; DNA polymerase C; T4 DNA polymerase, Phi29 DNA polymerase, Thermococcus sp. 9°N-7 archaeal polymerase (also known as 9°N™) and variants thereof, such as those disclosed in U.S. Patent Application Publication No. 2016 / 0032377(A1), and RB69 bacteriophage DNA polymerase. Family C includes, for example, the E. coli DNA polymerase III alpha subunit. Family D includes, for example, polymerases from the subdomain of the archaeal phylum Lirioarchaea. Family X DNA polymerases include, for example, the eukaryotic polymerases Pol beta, Pol sigma, Pol lambda, and Pol mu, and S. cerevisiae Pol4.Family Y DNA polymerases include, for example, Pol eta, Pol iota, Pol kappa, E. coli Pol IV (DINB), and E. coli Pol V (UmuD'2C). The RT (reverse transcriptase) family of DNA polymerases includes, for example, retroviral reverse transcriptase and eukaryotic telomerase. Exemplary RNA polymerases include, but are not limited to, viral RNA polymerases such as T7 RNA polymerase; eukaryotic RNA polymerases such as RNA polymerase I, RNA polymerase II, RNA polymerase III, RNA polymerase IV, and RNA polymerase V; and archaeal RNA polymerases. Other polymerases, such as those disclosed in U.S. Pat. No. 8,460,910, are also included among polymerases when referred to herein, as are any other functional polymerases, including those having sequences that are modified by comparison with any of the above polymerase enzymes, which are provided merely as a non-limiting list of examples.

[0056] The term "surface" or "substrate" refers to a support or substrate to which a test primer can be attached. The surface may be a wafer, a panel, a rectangular sheet, a die, or any other suitable configuration. The surface may be generally rigid and insoluble in aqueous liquids. Examples of suitable surfaces include epoxy siloxanes, glass and modified or functionalized glass, polyhedral oligomeric silsesquioxanes (POSS) and their derivatives, plastics (including acrylics, polystyrene and copolymers of styrene with other materials, polypropylene, polyethylene, polybutylene, polyurethane, polytetrafluoroethylene (such as TEFLON® from Chemours), cyclic olefin / cycloolefin polymers (COP) (such as ZEONOR® from Zeon), polyimides, etc.), nylon, ceramic / ceramic oxides, silica, fused silica or silica-based materials, aluminum silicate, silicon and modified silicon (e.g., boron doped p+ silicon), silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (TaO5) or other tantalum oxides (TaOx), hafnium oxide (HaO2), aluminum oxide, graphene oxide, titanium dioxide, carbon, metals, inorganic glasses, etc. The surface may also be glass, or silicon, or a silicon-based polymer, such as a POSS material, and may optionally have a coating layer of tantalum oxide or another ceramic oxide on the surface. The surface or substrate may include or be silicon or one or more other transition metals.

[0057] The immobilization primer sequence and the test primer sequence may be any suitable sequence according to the above disclosure. In the example, the sequence of the P5 immobilization primer disclosed herein is represented by SEQ ID NO: 1 (CAAGCAGAAGACGGCATACGAGAT), and the sequence of the P7 immobilization primer disclosed herein is represented by SEQ ID NO: 2 (AATGATACGGCGACCACCGAGATCTACAC). The test primer for hybridization may be a sequence complementary to a portion of these sequences.

[0058] Fluorescence can be detected by any suitable method. For example, known optical fluorescence detection methods can be used to detect fluorescence on a surface, where the fluorescence is excited and detected at the surface where the hybridized polynucleotide remains hybridized to the template. In another example, the hybridized test primer can be dehybridized from the immobilized primer and eluted into a solution, and the fluorescence is detected in the eluted solution, not on the surface. Any of a variety of known methods for measuring fluorophores, which are generally attached to nucleotides for use in the disclosed methods, can be used on a surface, in solution, or otherwise.

[0059] Detection can be performed by any suitable method, including fluorescence spectroscopy or other optical means. The fluorescent label can be a fluorophore, which emits radiation at a defined wavelength after absorbing energy. Many suitable fluorescent labels are known. For example, Welch et al. (Chem. Eur: J. 5(3): 951-960, 1999) disclose dansyl-functionalized fluorescent moieties that can be used in the present invention. Zhu et al. (Cytometry 28: 206-211, 1997) describe the use of the fluorescent labels Cy3 and Cy5, which can also be used in accordance with aspects of the present disclosure. Labels suitable for use are also disclosed by Prober et al. (Science 238:336-341, 1987); Connell et al. (BioTechniques 5(4):342-384, 1987), Ansorge et al. (Nucl. Acids Res. 15(11):4593-4602, 1987), and Smith et al. (Nature 321:674, 1986). Other commercially available fluorescent labels include, but are not limited to, fluorescein, rhodamine (such as TMR, Texas Red, and Rox), Alexa, Bodipy, acridine, coumarin, pyrene, benzanthracene, and cyanine. Any suitable modification of any of the foregoing may be adapted and used for use in accordance with the methods disclosed herein. Fluorescent nucleotides may, for example, include such linkages. Commercially available fluorescently tagged nucleotides may be used in accordance with the present disclosure. A non-limiting generalized example of a fluorescent nucleotide can be shown as follows: [ka] Working Example

[0060] As used herein, the term "nucleotide" is intended to include natural nucleotides, their analogs, ribonucleotides, deoxyribonucleotides, dideoxyribonucleotides, and other molecules known as nucleotides. The term may be used to refer to monomeric units present in a polymer, for example, to identify subunits present in a DNA or RNA chain. The term may also be used to refer to molecules that are not necessarily present in a polymer, for example, molecules that can be incorporated into a polynucleotide in a template-dependent manner by a polymerase. The term may also refer to nucleoside units, for example, having 0, 1, 2, 3, or more phosphates on the 5' carbon. For example, tetraphosphate nucleotides, pentaphosphate nucleotides, and hexaphosphate nucleotides may be particularly useful, as they may be nucleotides with more than six phosphates on the 5' carbon, for example, 7, 8, 9, 10, or more phosphates. Exemplary natural nucleotides include, but are not limited to, ATP, UTP, CTP, and GTP (collectively NTPs), and ADP, UDP, CDP, and GDP (collectively NDPs), or AMP, UMP, CMP, or GMP (collectively NMPs), or dATP, dTTP, dCTP, and dGTP (collectively dNTPs), and dADP, dTDP, dCDP, and dGDP (collectively dNDPs), and dAMP, dTMP, dCMP, and dGMP (dNMPs). Exemplary nucleotides can include any NMP, dNMP, NDP, dNDP, NTP, dNTP, and other NXPs and dNXPs (wherein X represents a number between 2 and 10) (collectively NPPs).

[0061] Non-naturally occurring nucleotides, also referred to herein as nucleotide analogs, include those that are not present in a natural biological system or that are not substantially incorporated into a polynucleotide by a polymerase in its natural environment, e.g., a non-recombinant cell expressing the polymerase. Particularly useful non-naturally occurring nucleotides include those that are incorporated into a polynucleotide chain by a polymerase at a rate that is substantially faster or slower than the rate at which another nucleotide, such as a natural nucleotide that base pairs with the same Watson-Crick complementary base, is incorporated into the chain by the polymerase. For example, the non-naturally occurring nucleotide may be incorporated at a rate that is at least 2-fold different, e.g., at least 5-fold different, 10-fold different, 25-fold different, 50-fold different, 100-fold different, 1000-fold different, 10000-fold different, or even more different, compared to the rate of incorporation of the natural nucleotide. The non-naturally occurring nucleotide can be further extended after incorporation into a polynucleotide. Examples include nucleotide analogs with a 3' hydroxyl or nucleotide analogs with a reversible terminator moiety at the 3' position that can be removed to allow the polynucleotide incorporating the nucleotide analog to be further extended. Examples of reversible terminator moieties that can be used are described, for example, in U.S. Patent Nos. 7,427,673, 7,414,116, and 7,057,026, and WO 91 / 06678 and WO 07 / 123744. It will be understood that in some instances, nucleotide analogs with 3' terminator moieties or no 3' hydroxyl (such as dideoxyribonucleotide analogs) can be used under conditions that do not allow further extension of the polynucleotide incorporating the nucleotide analog. In some instances, the nucleotide may not include a reversible terminator moiety, or the nucleotide does not include a non-reversible terminator moiety, or the nucleotide does not include any terminator moiety at all. Nucleotide analogs with modifications at the 5' position are also useful.

[0062] A "primer" is defined as a single-stranded nucleic acid sequence (e.g., single-stranded DNA or single-stranded RNA) that serves as an initiation point for DNA or RNA synthesis or, in the case of immobilized primers, as a template for the extension of the test primer. The 5' end of the primer for immobilization on a surface may be modified to allow a coupling reaction with a functionalized layer or functionalized polymer layer on the surface. The length of the primer may be any number of bases long and may include a variety of non-natural nucleotides. In examples, the primer is a short chain ranging from 20-40 bases or 10-20 bases.

[0063] In some examples, the immobilized primer may be directly attached to the surface or substrate, or to a functionalized surface of the surface or substrate. In other examples, the surface or substrate may be further modified by adding a polymer attached to the surface or substrate, and the immobilized primer attached to the surface or substrate via attachment to such a polymer. Such polymers may be random, block, linear, and / or branched copolymers containing two or more repeating monomer units in any order or configuration, and may be linear, crosslinked, or branched, or combinations thereof. In examples, the polymers used may include examples such as poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide), also known as PAZAM. In examples, the polymer may be a heteropolymer, the heteropolymer being: [ka] or substituted analogs thereof ("substituted" refers to the replacement of one or more hydrogen atoms in a specified group with another atom or group). In some examples, the acrylamide monomer may include an acrylamide monomer such as an azidoacetamidopentylacrylamide monomer. [ka] In some examples, the acrylamide monomer may include N,N-dimethylacrylamide. [ka] (wherein in examples involving xy copolymers, n corresponds to y, and in examples involving xyz copolymers, n corresponds to z).

[0064] In examples, the polymer is a heteropolymer and may further comprise an azide-containing acrylamide monomer. In some embodiments, the heteropolymer comprises: [ka] and optionally [ka] Includes.

[0065] In some embodiments, the heteropolymer has the following structure: [ka] (In the formula, each R z are independently H or C 1~4 where x is an alkyl group, and this structure may be referred to herein as an "xy copolymer." In some examples, the ratio of x:y may be from about 15:85 to about 1:99, such as from about 10:90 to about 1:99, such as from about 10:90 to about 5:99, or may be about 5:95. In other embodiments, the heteropolymer may include the following structure: [ka] (In the formula, each R z are independently H or C 1~4In some examples, the ratio of (x:y):z may be about 85:15 to about 95:5, or about 90:10 (the ratio of x:(y:z) may be about 1:(99) to about 10:(90), or about 5:(95), respectively). In some examples, the ratio of x:y:z may be about 0:15:85 to about 0:5:95. In an example, x:y is 5:95. In another example, the ratio of x:y:z is 5:85:10. In these examples, "about" means that the relative amounts of something may vary by up to 5% from the amounts stated in the recited ratio.

[0066] A "heteropolymer" is a large molecule of at least two different repeating subunits (monomers). An "acrylamide monomer" has the structure [ka] or a substituted analog thereof (e.g., methacrylamide or N,N-dimethylacrylamide). An example of a monomer containing an acrylamide group and an azide group is azidoacetamidopentylacrylamide, shown above. "Alkyl" refers to a straight or branched hydrocarbon chain that is fully saturated (i.e., contains no double or triple bonds). Exemplary alkyl groups include methyl, ethyl, dimethylacrylamide, propyl, isopropyl, butyl, isobutyl, and tertiary butyl. As an example, the notation "C 1~4 "Alkyl" indicates that there are 1 to 4 carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from the group consisting of methyl, ethyl, dimethyl, propyl, isopropyl, n-butyl, isobutyl, sec-butyl, and t-butyl.

[0067] In some instances, it may be desirable to measure both the amount of hybridizable immobilized primers on a substrate and also the immobilized primers accessible to a polymerase in the methods disclosed herein. An example of such a method is shown simply in FIG. 8A. Here, an immobilized primer is shown with its 3' end extending distally from the surface to which it is covalently attached. Also shown is a complementary test primer that hybridizes to it. In this example, one fluorophore, shown as a dark star, is shown at the 5-prome end of the test primer, and another fluorophore is shown as a lighter star at the 3-prome end of the test primer. In this example, the test primer possessed a 5' fluorophore when added to the surface during incubation and hybridization. In that respect, this method is similar to conventional methods for measuring hybridization-accessible immobilized primers. Hybridization-accessible immobilized primers can be determined by measuring the fluorescence emitted from the surface after incubation with such a test primer that already has a fluorophore attached to its 5' end.

[0068] However, in this example, the test primer-immobilized primer pair is further incubated with a polymerase and nucleotides having an attached fluorophore, and the fluorescently tagged nucleotide can be attached to the 3' end of the test primer by the polymerase, using the immobilized primer as a template, as described above. The result is the test primer-immobilized primer pair shown in FIG. 8A, which shows a test primer with a 5' fluorophore attached first, as well as a 3' fluorophore attached to it by the polymerase. By measuring the amount of the first fluorophore, the amount of hybridization-accessible immobilized primer present on the surface can be determined. However, by measuring the amount of fluorophore attached to the 3'-most nucleotide present (following the example above), the amount of immobilized primer accessible to the polymerase can be determined. By combining both measurements in an assay according to this example, more information can be obtained more efficiently. In this example, the 5' fluorophore and the 3' fluorophore added by the polymerase are detectably different from each other.

[0069] The above examples include examples of methods in which the immobilized primer is not covalently modified. Such examples may be for certain uses, for example, where the substrate with the immobilized primer is intended to be used after the assay according to the methods disclosed herein is completed, and no covalent modification to the immobilized primer is desired. However, in other examples, the methods disclosed herein may include covalent modification of the immobilized primer. Three such examples are shown in Figures 8B and 8C. In Figure 8B, a test primer with a 5' overhang is shown, which can serve as a template for extension of the 3' end of the immobilized primer distal to the surface, as well as the test primer at the 3' end according to the disclosure above. In such examples, the test primer and the immobilized primer may be designed such that detectably different nucleotides can be incorporated at their respective 3' ends.

[0070] In another example, such as that shown in FIG. 8C, the 5' end of the test primer may include a fluorescently labeled nucleotide. Such a fluorescently labeled nucleotide may overhang the immobilized primer, thereby serving as a template for its extension. In this example, the fluorophore attached to the 5' end of the test primer and the fluorophore attached to the nucleotide added to the 3' end of the immobilized primer using the 5' overhang of the test primer as a template are detectably different from each other. In some examples, the proximity of these two fluorophores to each other may affect the fluorescence output. For example, according to fluorescence quenching, the fluorophores may be selected such that when the fluorophores are in such close proximity to each other, as may occur when adding a labeled nucleotide to the 3' end of the immobilized primer using the test primer as a template, the emission from either or both of the pair is blunted by quenching.

[0071] In such a situation, for example, if a fluorescent nucleotide added to the 3' side quenches the fluorescence emission from a fluorophore attached to the 5' side of the test primer, a decrease in fluorescence emitted from the 5' test primer fluorophore may be interpreted as an indication that a nucleotide has been added to the 3' end of the immobilized primer, such as by a polymerase. Alternatively, measurement of an increase in fluorescence emission from the immobilized primer upon dehybridization of the test primer may indicate that a polymerase has catalyzed the addition of a fluorescent nucleotide to the 3' end of the immobilized primer. Alternatively, the fluorophores in this example may be selected to undergo fluorescence resonance energy transfer, such that one acts as a donor to the other to stimulate fluorescence by the other when in such close proximity to each other, as may occur when a polymerase catalyzes the addition of a fluorescently tagged nucleotide to the 3' end of the immobilized primer. Detection of the emission characteristic of the occurrence of fluorescence resonance energy transfer between the fluorophores may then indicate that a nucleotide has been added to the 3' end of the immobilized primer by a polymerase. Alternatively, a decrease in such emission upon dehybridization of the test primer may indicate the addition of a nucleotide to the immobilized primer by the polymerase. Examples of detection of the amount of fluorescent test primer that involve detecting the combined fluorescence emitted by a pair of fluorescent nucleotides include such examples where detection involves detection of quenching or fluorescence resonance energy transfer.

[0072] Other variations, combinations, or modifications of the above-mentioned embodiments are also within the scope of the present disclosure. The above-mentioned embodiments are intended to illustrate examples of the present disclosure, but are not intended to limit the scope thereof in any way. Although the examples have been shown and described in detail herein, it will be apparent to those skilled in the art that various modifications, additions, substitutions, and the like can be made without departing from the spirit of the present disclosure, and thus are considered to be within the scope of the present disclosure. The present disclosure relates, for example, to the following: [1] 1. A method comprising: hybridizing test primers to immobilized primers, the immobilized primers comprising a predetermined nucleotide sequence and attached to a substrate via their 5' ends, each test primer being complementary to a portion of at least some of the immobilized primers, such that no more than one test primer molecule hybridizes to an immobilized primer molecule; extending at least some of the test primers with a polymerase according to a template using a nucleotide, wherein the template comprises an immobilized primer that hybridizes to at least some of the test primers, and wherein the nucleotide incorporated into at least some of the test primers by the extension comprises one of a plurality of fluorescent tags; detecting the amount of the fluorescent test primer. [2] 2. The method of claim 1, wherein the nucleotide sequence of a first plurality of said immobilized primers is different from the nucleotide sequence of a second plurality of said immobilized primers. [3] 3. The method of claim 2, wherein a first plurality of the test primers are complementary to a portion of the first plurality of immobilized primers and a second plurality of the test primers are complementary to a portion of the second plurality of immobilized primers. [4] 4. The method of claim 3, wherein a first nucleotide incorporated into the first plurality of test primers comprises a first of a plurality of fluorescent tags, a second nucleotide incorporated into the second plurality of test primers comprises a second of the plurality of fluorescent tags, and wherein the fluorescence emitted by the first of the plurality of fluorescent tags is different from the fluorescence emitted by the second of the plurality of fluorescent tags. [5] The method according to claim 1 , wherein the substrate comprises a metal oxide. [6] 5. The method according to claim 1, wherein the substrate comprises a metal oxide, and the metal oxide is selected from the group consisting of silicon dioxide, quartz glass, tantalum pentoxide, titanium dioxide, aluminum oxide, hafnium oxide, and graphene oxide. [7] The method of claim 1 , wherein the substrate further comprises a polymer. [8] The method of claim 7, wherein at least some of the immobilized primers are bound to the polymer. [9] The polymer is

change

change

[10] The heteropolymer is

change

[11] The heteropolymer is

change

[12] The method according to any one of claims 1 to 10, wherein the polymerase is selected from the Klenow fragment and Phi29 polymerase.

[13] The method according to any one of claims 1 to 12, wherein the polymerase is bound to the substrate.

[14] The method according to any one of claims 1 to 12, wherein the polymerase is not bound to the substrate.

[15] The method according to any one of claims 7 to 11, wherein the polymerase is selected from the Klenow fragment and Phi29 polymerase.

[16] The method of claim 15, wherein the polymerase binds to the polymer.

[17] The method of claim 15, wherein the polymerase does not bind to the polymer.

[18] 18. The method of claim 1, wherein the detecting comprises measuring fluorescence emitted from the test primers.

[19] 20. The method of claim 18, wherein the test primer hybridizes to the immobilized primer during said measuring.

[20] 20. The method of claim 18, further comprising dehybridizing the test primer from the immobilized primer prior to said measuring.

[21] 5. The method of claim 4, wherein the detecting comprises measuring fluorescence emitted from the test primers in response to a stimulus.

[22] 22. The method of claim 21, wherein the test primer hybridizes to the immobilized primer during said measuring.

[23] 22. The method of claim 21, further comprising dehybridizing the test primer from the immobilized primer prior to said measuring.

[24] 24. The method of claim 21, further comprising comparing the detected amount of the first one of the plurality of fluorescent tags to the detected amount of the second one of the plurality of fluorescent tags.

[25] 25. The method of claim 1, wherein the 5' ends of at least some of the test primers do not overhang the 3' end of the immobilized primer.

[26] 25. The method of claim 1, wherein the 5' ends of at least some of the test primers comprise a 5' fluorescent tag having a 5' fluorescent tag spectrum, the 5' fluorescent spectrum being different from the fluorescent spectrum of the fluorescent tag of the nucleotide incorporated into the test primer by the extension, and wherein detecting comprises detecting the amount of 5' fluorescent tag and the amount of nucleotide fluorescent tag.

[27] 25. The method of claim 1, wherein at least some of the test primers comprise an overhanging test primer that is complementary to an overhanging immobilized primer, the 5' end of the overhanging test primer overhanging the 3' end of the overhanging immobilized primer when hybridized thereto prior to said extension, and further comprising: extending the overhanging immobilized primer with a nucleotide, wherein the nucleotide incorporated into the overhanging immobilized primer by said extension comprises a overhanging fluorescent tag having an emission spectrum that is detectably different from the emission spectrum of said one of a plurality of fluorescent tags incorporated into the overhanging test primer by said extension; detecting the amount of fluorescent immobilized primer; and comparing the amount of the fluorescent test primer with the amount of the fluorescent immobilized primer.

[28] 25. The method of claim 1, wherein at least some of the test primers comprise an overhanging test primer that is complementary to an overhanging immobilized primer, the 5' end of the overhanging test primer overhanging the 3' end of the overhanging immobilized primer when hybridized thereto prior to said extension, and comprises a test primer 5' fluorescent tag; 16. A method comprising: extending a protruding immobilized primer using one nucleotide, wherein the nucleotide incorporated into the protruding immobilized primer by the extension comprises a protruding fluorescent tag, wherein the test primer 5' fluorescent tag and the protruding fluorescent tag comprise a fluorescent tag pair when the protruding test primer hybridizes to the protruding immobilized primer after the extension of the protruding immobilized primer, and wherein a composite fluorescence emitted by the fluorescent tag pair is different from the fluorescence emitted from the test primer 5' fluorescent tag and the fluorescence emitted from the protruding fluorescent tag.

[29] 30. The method of claim 28, wherein detecting the amount of fluorescent test primer comprises detecting the composite fluorescence emitted by the fluorescent tag pair.

Claims

1. 1. A method comprising: hybridizing test primers to immobilized primers, wherein the immobilized primers comprise a predetermined nucleotide sequence and are attached to a substrate via their 5' ends, each test primer being complementary to a portion of at least some of the immobilized primers, and wherein no more than one test primer molecule hybridizes to an immobilized primer molecule; extending at least some of the test primers with a polymerase according to a template using a nucleotide, wherein the template comprises an immobilized primer that hybridizes to at least some of the test primers, and wherein the nucleotide incorporated into at least some of the test primers by the extension comprises one of a plurality of fluorescent tags; measuring fluorescence emitted from the test primers; and dehybridizing the test primer hybridized to the immobilized primer.

2. 2. The method of claim 1, wherein the nucleotide sequence of a first plurality of said immobilized primers is different from the nucleotide sequence of a second plurality of said immobilized primers.

3. 3. The method of claim 2, wherein a first plurality of said test primers are complementary to a portion of said first plurality of immobilized primers and a second plurality of said test primers are complementary to a portion of said second plurality of immobilized primers.

4. 4. The method of claim 3, wherein a first nucleotide incorporated into the first plurality of test primers comprises a first of a plurality of fluorescent tags, a second nucleotide incorporated into the second plurality of test primers comprises a second of the plurality of fluorescent tags, and wherein the fluorescence emitted by the first of the plurality of fluorescent tags is different from the fluorescence emitted by the second of the plurality of fluorescent tags.

5. The method of any one of claims 1 to 4, wherein the substrate comprises a metal oxide.

6. 5. The method of claim 1, wherein the substrate comprises a metal oxide, the metal oxide being selected from the group consisting of silicon dioxide, quartz glass, tantalum pentoxide, titanium dioxide, aluminum oxide, hafnium oxide, and graphene oxide.

7. The method of any one of claims 1 to 6, wherein the substrate further comprises a polymer.

8. The method of claim 7 , wherein at least some of the immobilized primers are bound to the polymer.

9. The polymer is 【Chemistry 1】 where x and y are integers representing the number of monomers, and the ratio of x:y may be from about 5:85 to about 1:99; and 【Chemistry 2】 where x, y, and z are integers representing the number of monomers, and the ratio of (x:y):z may be from about (85):15 to about (95):5, and each R ｚ are independently H or C １～４ is alkyl) The method of claim 8, wherein the heteropolymer is selected from the group consisting of

10. The heteropolymer is 【Chemistry 3】 where the ratio of x:y is about 10:

90.

10. The method of claim 9, comprising:

11. The heteropolymer is 【Chemistry 4】 where the ratio of x:y:z is about 5:85:

10.

10. The method of claim 9, comprising:

12. The method of any one of claims 1 to 10, wherein the polymerase is selected from the Klenow fragment and Phi29 polymerase.

13. The method of any one of claims 1 to 12, wherein the polymerase is bound to the substrate.

14. The method of any one of claims 1 to 12, wherein the polymerase is not bound to the substrate.

15. The method according to any one of claims 7 to 11, wherein the polymerase is selected from the Klenow fragment and Phi29 polymerase.

16. The method of claim 15 , wherein the polymerase binds to the polymer.

17. The method of claim 15 , wherein the polymerase does not bind to the polymer.

18. The method of any one of claims 1 to 17, wherein the test primer hybridizes to the immobilized primer during said measurement.

19. A method according to any one of claims 1 to 17, wherein the test primer is dehybridised from the immobilised primer prior to said measuring.

20. The method of any one of claims 1 to 17, wherein fluorescence emitted from the test primers in response to a stimulus is measured.

21. The method of claim 4 , further comprising comparing the detected amount of the first one of the plurality of fluorescent tags to the detected amount of the second one of the plurality of fluorescent tags.

22. The method of any one of claims 1 to 21, wherein the 5' ends of at least some of the test primers do not overhang the 3' end of the immobilized primer.

23. 22. The method of any one of claims 1 to 21, wherein the 5' ends of at least some of the test primers comprise a 5' fluorescent tag having a 5' fluorescent tag spectrum that differs from the fluorescent spectrum of the fluorescent tag of the nucleotide incorporated into the test primer by the extension, and wherein detecting comprises detecting the amount of 5' fluorescent tag and the amount of nucleotide fluorescent tag.

24. 22. The method of any one of claims 1 to 21, wherein at least some of the test primers comprise an overhanging test primer complementary to an overhanging immobilized primer, the 5' end of the overhanging test primer overhanging the 3' end of the overhanging immobilized primer when hybridized thereto prior to said extension, and further comprising: extending the overhanging immobilized primer using a single nucleotide, wherein the nucleotide incorporated into the overhanging immobilized primer by said extension comprises a overhanging fluorescent tag having an emission spectrum that is detectably different from the emission spectrum of said one of the multiple fluorescent tags incorporated into said overhanging test primer by said extension. detecting the amount of fluorescent immobilized primer; and comparing the amount of fluorescent test primer to the amount of fluorescent immobilized primer.

25. 22. The method of any one of claims 1 to 21, wherein at least some of the test primers comprise an overhanging test primer complementary to an overhanging immobilized primer, the 5' end of the overhanging test primer overhanging the 3' end of the overhanging immobilized primer when hybridized thereto prior to said extension, and comprising a test primer 5' fluorescent tag; 16. A method comprising: extending a protruding immobilized primer using one nucleotide, wherein the nucleotide incorporated into the protruding immobilized primer by the extension comprises a protruding fluorescent tag, wherein the test primer 5' fluorescent tag and the protruding fluorescent tag comprise a fluorescent tag pair when the protruding test primer hybridizes to the protruding immobilized primer after the extension of the protruding immobilized primer, and wherein the combined fluorescence emitted by the fluorescent tag pair is different from the fluorescence emitted from the test primer 5' fluorescent tag and the fluorescence emitted from the protruding fluorescent tag.

26. 26. The method of claim 25, wherein detecting the amount of fluorescent test primer comprises detecting the composite fluorescence emitted by the fluorescent tag pair.

Images