Compositions and methods for in vivo gene editing

Abstract

Provided herein is a method and composition for editing target genome in cell, comprising: contacting cell with (i) a single homology arm construct comprising a replacement sequence and a targeting endonuclease cleavage site; and (ii) a targeting endonuclease, wherein the replacement sequence comprises at least one nucleotide difference compared to the target genome, and the target genome comprises the sequence that is homologous to the targeting endonuclease cleavage site.Direct gene modification in living organisms by in vivo targeting genome editing technology is a powerful tool for many fields of life science, including animal science and developmental biology.

Description

[Technical field]

[0001] cross reference This application claims the benefit of U.S. Provisional Application No. 62 / 890,542, filed August 22, 2019, and U.S. Provisional Application No. 62 / 891,210, filed August 23, 2019, each of which is incorporated by reference herein in its entirety. [Background technology]

[0002] background Direct genetic modification in living organisms by in vivo targeted genome editing technology is a powerful tool for many fields of life science, including animal science and developmental biology. Moreover, this technology can potentially be used to correct genetic diseases by removing disease-causing mutations, providing the possibility of a permanent cure. Summary of the Invention [Means for solving the problem]

[0003] overview In vivo genome editing is a powerful strategy for understanding basic biology and treating genetic diseases. However, it remains difficult to develop universal and efficient genome editing tools for in vivo tissues that consist of diverse cell types in either dividing or non-dividing states. Provided herein is a versatile in vivo gene knock-in methodology that allows targeting a wide range of mutations and cell types by inserting minigenes into the introns of target loci using a single homologous arm donor linearized for intracellular use. As a proof of concept for this strategy, presented herein is the treatment of a mouse model of premature aging caused by a dominant point mutation that is difficult to repair using existing in vivo genome editing tools. Systemic treatment using this method reverses aging-related phenotypes and extends the lifespan of animals, thereby highlighting the potential of this methodology for a wide range of in vivo genome editing applications.

[0004] In one aspect, a method for editing a target genome in a cell is provided.In some embodiments, the method herein comprises contacting a cell with (i) a single homology arm construct comprising a replacement sequence and a targeting endonuclease cleavage site; and (ii) a targeting endonuclease, wherein the replacement sequence comprises at least one nucleotide difference compared to the target genome, and the target genome comprises a sequence homologous to the targeting endonuclease cleavage site.In some embodiments, the single homology arm construct replaces at least a portion of the target genome.In some embodiments, the targeting endonuclease is selected from CRISPR nuclease, TALEN nuclease, DNA-guided nuclease, meganuclease, and zinc finger nuclease. In some embodiments, the CRISPR nuclease is selected from the group consisting of Cas9, Cas12a(Cpf1), Cas12b(c2c1), Cas12c(c2c3), Cas12g, Cas12i, Cas14, Cas10, Cas3, CasX, CasY, Csf1, Cas13a(c2c2), Cas13b(c2c6), Cas13c(c2c7), c2c4, c2c5, c2c8, c2c9, c2c10, Cas10, CAST and Tn6677. In some embodiments, the method further comprises contacting the cell with a guide oligonucleotide. In some embodiments, the guide oligonucleotide is a guide RNA. In some embodiments, the replacement sequence comprises a single nucleotide difference compared to the target genome. In some embodiments, the single base difference is selected from one of a substitution, an insertion, and a deletion. In some embodiments, the replacement sequence comprises a substitution, insertion, inversion, translocation, duplication, or deletion compared to the target genome. In some embodiments, the replacement sequence comprises at least a portion of an intron and at least a portion of an exon. In some embodiments, the replacement sequence comprises all introns and exons of a gene downstream of a mutation in the gene of the target genome.In some embodiments, the cell is selected from one or more of stem cells, neurons, skeletal muscle cells, smooth muscle cells, cardiomyocytes, pancreatic beta cells, lymphocytes, monocytes, neutrophils, T cells, B cells, NK cells, mast cells, plasma cells, eosinophils, basophils, endothelial cells, epithelial cells, hepatocytes, bone cells, platelets, adipocytes, retinal cells, barrier cells, hormone-secreting cells, glial cells, hepatic adipocytes, secretory cells, urinary cells, extracellular matrix cells, nurse cells, stromal cells, spermatocytes, and oocytes. In some embodiments, the single homologous arm construct, guide oligonucleotide, and targeting endonuclease are encoded within the construct. In some embodiments, the construct is a viral construct. In some embodiments, the viral construct is an adeno-associated virus, an adenovirus, a lentivirus, or a retrovirus. In some embodiments, the construct is a non-viral construct. In some embodiments, the non-viral construct is a minicircle or a plasmid. In some embodiments, the cell is contacted in vivo. In some embodiments, the cell is contacted in vitro. In some embodiments, the cell is from a subject. In some embodiments, the subject is a human, a non-human primate, a dog, a cat, a horse, a cow, a sheep, a pig, a rabbit, a rat, or a mouse. In some embodiments, the subject has a mutation in a gene that is homologous to the replacement sequence.

[0005] In another aspect, a method for treating genetic disease in a subject having a mutation in a gene is provided.In some embodiments, the method comprises contacting a cell from the subject with (i) a single homology arm construct comprising a replacement sequence and a targeting endonuclease cleavage site; and (ii) a targeting endonuclease, wherein the replacement sequence comprises the wild-type sequence of the gene, and the gene comprises a sequence homologous to the targeting endonuclease cleavage site.In some embodiments, the single homology arm construct replaces at least a portion of the gene.In some embodiments, the targeting endonuclease is selected from CRISPR nuclease, TALEN nuclease, DNA-guided nuclease, meganuclease, and zinc finger nuclease. In some embodiments, the CRISPR nuclease is selected from the group consisting of Cas9, Cas12a(Cpf1), Cas12b(c2c1), Cas12c(c2c3), Cas12g, Cas12i, Cas14, Cas10, Cas3, CasX, CasY, Csf1, Cas13a(c2c2), Cas13b(c2c6), Cas13c(c2c7), c2c4, c2c5, c2c8, c2c9, c2c10, Cas10, CAST and Tn6677. In some embodiments, the method further comprises contacting the cell with a guide oligonucleotide. In some embodiments, the guide oligonucleotide is a guide RNA. In some embodiments, the mutation comprises a single nucleotide difference compared to the target genome. In some embodiments, the single nucleotide difference is selected from one of a substitution, an insertion, and a deletion. In some embodiments, the mutation comprises an insertion, inversion, translocation, duplication, or deletion compared to the target genome. In some embodiments, the replacement sequence comprises at least a portion of an intron and at least a portion of an exon. In some embodiments, the replacement sequence comprises all introns and exons of the gene downstream of the mutation in the gene of the target genome.In some embodiments, the cell is selected from one or more of stem cells, neurons, skeletal muscle cells, smooth muscle cells, cardiomyocytes, pancreatic beta cells, lymphocytes, monocytes, neutrophils, T cells, B cells, NK cells, mast cells, plasma cells, eosinophils, basophils, endothelial cells, epithelial cells, hepatocytes, bone cells, platelets, adipocytes, retinal cells, barrier cells, hormone-secreting cells, glial cells, hepatic adipocytes, secretory cells, urinary cells, extracellular matrix cells, nurse cells, stromal cells, spermatocytes, and oocytes. In some embodiments, the single homologous arm construct, guide oligonucleotide, and targeting endonuclease are encoded within the construct. In some embodiments, the construct is a viral construct. In some embodiments, the viral construct is an adeno-associated virus, an adenovirus, a lentivirus, or a retrovirus. In some embodiments, the construct is a non-viral construct. In some embodiments, the non-viral construct is a minicircle or a plasmid. In some embodiments, the cells are contacted in vivo. In some embodiments, the cells are contacted in vitro. In some embodiments, the cells are non-dividing cells. In some embodiments, the subject is a human, a non-human primate, a dog, a cat, a horse, a cow, a sheep, a pig, a rabbit, a rat, or a mouse.In some embodiments, the genetic disease is achondroplasia, alpha 1 antitrypsin deficiency, Alzheimer's disease, antiphospholipid syndrome, autism, autosomal dominant polycystic kidney disease, breast cancer, cancer, Charcot-Marie-Tooth, colon cancer, cri-a-cat syndrome, Crohn's disease, cystic fibrosis, Dercum's disease, Down's syndrome, Duane's syndrome, Duchenne muscular dystrophy, factor V Leiden thrombophilia, familial hypercholesterolemia, familial Mediterranean fever, fragile X syndrome, Gaucher's disease, hemochromatosis, hemophilia, holoprosencephaly, Huntington's disease, Klinefelter's syndrome, Leber's congenital amaurosis, Marfan syndrome, myotonic dystrophy, neurofibromatosis, Noonan syndrome, osteogenesis imperfecta, Parkinson's disease, phenylketonuria, Poland anomaly ... anomaly), porphyria, progeria, prostate cancer, retinitis pigmentosa, severe combined immunodeficiency (SCID), sickle cell disease, skin cancer, spinal muscular atrophy, Stargardt disease, Tay-Sachs disease, thalassemia, trimethylaminuria, Turner syndrome, palatocardiofacial syndrome, WAGR syndrome, and Wilson disease.

[0006] In a further aspect, a composition is provided for use in treating genetic disease, comprising: (i) a single homology arm construct comprising a replacement sequence and a targeting endonuclease cleavage site; and (ii) a targeting endonuclease, wherein the replacement sequence comprises at least one nucleotide difference compared to a target genome, and the target genome comprises a sequence that is homologous to the targeting endonuclease cleavage site.In some embodiments, the single homology arm construct replaces at least a portion of a gene.In some embodiments, the targeting endonuclease is selected from CRISPR nuclease, TALEN nuclease, DNA-guided nuclease, meganuclease, and zinc finger nuclease. In some embodiments, the CRISPR nuclease is selected from the group consisting of Cas9, Cas12a(Cpf1), Cas12b(c2c1), Cas12c(c2c3), Cas12g, Cas12i, Cas14, Cas10, Cas3, CasX, CasY, Csf1, Cas13a(c2c2), Cas13b(c2c6), Cas13c(c2c7), c2c4, c2c5, c2c8, c2c9, c2c10, Cas10, CAST and Tn6677. In some embodiments, the composition further comprises a guide oligonucleotide. In some embodiments, the guide oligonucleotide is a guide RNA. In some embodiments, the genetic disease is caused by a mutation comprising a single nucleotide difference compared to the target genome. In some embodiments, the single nucleotide difference is selected from one of a substitution, an insertion, and a deletion. In some embodiments, the genetic disease is caused by a mutation, including a substitution, an insertion, an inversion, a translocation, a duplication, or a deletion. In some embodiments, the replacement sequence includes at least a portion of an intron and at least a portion of an exon. In some embodiments, the replacement sequence includes all introns and exons of the gene downstream of the mutation in the gene of the target genome.In some embodiments, the composition targets cells selected from one or more of stem cells, neurons, skeletal muscle cells, smooth muscle cells, cardiomyocytes, pancreatic beta cells, lymphocytes, monocytes, neutrophils, T cells, B cells, NK cells, mast cells, plasma cells, eosinophils, basophils, endothelial cells, epithelial cells, hepatocytes, bone cells, platelets, adipocytes, retinal cells, barrier cells, hormone-secreting cells, glial cells, hepatic adipocytes, secretory cells, urinary cells, extracellular matrix cells, nurse cells, stromal cells, spermatocytes, and oocytes. In some embodiments, the single homologous arm construct, guide oligonucleotide, and targeting endonuclease are encoded within the construct. In some embodiments, the construct is a viral construct. In some embodiments, the viral construct is an adeno-associated virus, an adenovirus, a lentivirus, or a retrovirus. In some embodiments, the construct is a non-viral construct. In some embodiments, the non-viral construct is a minicircle or a plasmid. In some embodiments, the genetic disease is achondroplasia, alpha 1 antitrypsin deficiency, Alzheimer's disease, antiphospholipid syndrome, autism, autosomal dominant polycystic kidney disease, breast cancer, cancer, Charcot-Marie-Tooth, colon cancer, cri-a-cat syndrome, Crohn's disease, cystic fibrosis, Dercum's disease, Down's syndrome, Duane's syndrome, Duchenne muscular dystrophy, factor V Leiden thrombophilia, familial hypercholesterolemia, familial Mediterranean fever, fragile X syndrome, Gaucher's disease, hemochromatosis, hemophilia, holoprosencephaly, Hanch's syndrome, The disease is selected from Leber's congenital amaurosis, Marfan syndrome, myotonic dystrophy, neurofibromatosis, Noonan syndrome, osteogenesis imperfecta, Parkinson's disease, phenylketonuria, Poland anomaly, porphyria, progeria, prostate cancer, retinitis pigmentosa, severe combined immunodeficiency (SCID), sickle cell disease, skin cancer, spinal muscular atrophy, Stargardt disease, Tay-Sachs, thalassemia, trimethylaminuria, Turner syndrome, palatocardiofacial syndrome, WAGR syndrome, and Wilson's disease.

[0007] In a further aspect, a composition is provided comprising: (i) a single homology arm construct comprising a replacement sequence and a targeting endonuclease cleavage site; and (ii) a targeting endonuclease, wherein the replacement sequence comprises at least one nucleotide difference compared to a target genome, and the target genome comprises a sequence homologous to the targeting endonuclease cleavage site. In some embodiments, the composition comprises a cell. In some embodiments, the single homology arm construct, the guide oligonucleotide, and the targeting endonuclease are encoded within a construct. In some embodiments, the construct is a viral construct. In some embodiments, the viral construct is an adeno-associated virus, an adenovirus, a lentivirus, or a retrovirus. In some embodiments, the construct is a non-viral construct. In some embodiments, the non-viral construct is a minicircle or a plasmid. In some embodiments, the composition further comprises a pharma- ceutically acceptable buffer or excipient. In some embodiments, the targeting endonuclease is selected from CRISPR nuclease, TALEN nuclease, DNA-guided nuclease, meganuclease, and zinc finger nuclease.In some embodiments, the CRISPR nuclease is selected from the group consisting of Cas9, Cas12a(Cpf1), Cas12b(c2c1), Cas12c(c2c3), Cas12g, Cas12i, Cas14, Cas10, Cas3, CasX, CasY, Csf1, Cas13a(c2c2), Cas13b(c2c6), Cas13c(c2c7), c2c4, c2c5, c2c8, c2c9, c2c10, Cas10, CAST, and Tn6677.In some embodiments, the composition further comprises a guide oligonucleotide.

[0008] Further provided herein are kits comprising any of the compositions provided herein and instructions for use.

[0009] In a further aspect, a nucleic acid molecule is provided that comprises a single homology arm construct comprising a replacement sequence and a targeting endonuclease cleavage site, wherein the replacement sequence comprises at least one nucleotide difference compared to the target genome. In some embodiments, the nucleic acid molecule further comprises a sequence encoding a guide oligonucleotide. In some embodiments, the nucleic acid molecule further comprises a sequence encoding a targeting endonuclease. In some embodiments, the nucleic acid molecule is a viral construct. In some embodiments, the viral construct is an adeno-associated virus, an adenovirus, a lentivirus, or a retrovirus. In some embodiments, the nucleic acid molecule is a non-viral construct. In some embodiments, the non-viral construct is a minicircle or a plasmid.

[0010] Further provided herein is a kit comprising any one of the nucleic acid molecules provided herein and instructions for use.

[0011] In another aspect, a method for homologous recombination repair is provided for editing a target genome in a cell, comprising contacting the cell with (i) a single homology arm construct comprising a replacement sequence and a targeting endonuclease cleavage site; and (ii) a targeting endonuclease, wherein the replacement sequence comprises at least one nucleotide difference compared to the target genome, the target genome comprises a sequence homologous to the targeting endonuclease cleavage site, and the replacement sequence is integrated into the target genome using a homology repair protein. In some embodiments, the single homology arm construct replaces at least a portion of the target genome. In some embodiments, the targeting endonuclease is selected from CRISPR nuclease, TALEN nuclease, DNA-guided nuclease, meganuclease, and zinc finger nuclease. In some embodiments, the CRISPR nuclease is selected from the group consisting of Cas9, Cas12a(Cpf1), Cas12b(c2c1), Cas12c(c2c3), Cas12g, Cas12i, Cas14, Cas10, Cas3, CasX, CasY, Csf1, Cas13a(c2c2), Cas13b(c2c6), Cas13c(c2c7), c2c4, c2c5, c2c8, c2c9, c2c10, Cas10, CAST and Tn6677. In some embodiments, the method further comprises contacting the cell with a guide oligonucleotide. In some embodiments, the guide oligonucleotide is a guide RNA. In some embodiments, the replacement sequence comprises a single nucleotide difference compared to the target genome. In some embodiments, the single base difference is selected from one of a substitution, an insertion, and a deletion. In some embodiments, the replacement sequence comprises an insertion, inversion, translocation, duplication, or deletion compared to the target genome. In some embodiments, the replacement sequence comprises at least a portion of an intron and at least a portion of an exon. In some embodiments, the replacement sequence comprises all introns and exons of a gene downstream of a mutation in the gene of the target genome.In some embodiments, the cell is selected from one or more of stem cells, neurons, skeletal muscle cells, smooth muscle cells, cardiomyocytes, pancreatic beta cells, lymphocytes, monocytes, neutrophils, T cells, B cells, NK cells, mast cells, plasma cells, eosinophils, basophils, endothelial cells, epithelial cells, hepatocytes, bone cells, platelets, adipocytes, retinal cells, barrier cells, hormone-secreting cells, glial cells, hepatic adipocytes, secretory cells, urinary cells, extracellular matrix cells, nurse cells, stromal cells, spermatocytes, and oocytes. In some embodiments, the single homologous arm construct, guide oligonucleotide, and targeting endonuclease are encoded within the construct. In some embodiments, the construct is a viral construct. In some embodiments, the viral construct is an adeno-associated virus, an adenovirus, a lentivirus, or a retrovirus. In some embodiments, the construct is a non-viral construct. In some embodiments, the non-viral construct is a minicircle or a plasmid. In some embodiments, the cells are contacted in vivo. In some embodiments, the cells are contacted in vitro. In some embodiments, the cell is from a subject. In some embodiments, the subject is a human, dog, cat, horse, cow, sheep, pig, rabbit, rat, or mouse. In some embodiments, the subject has a mutation in a gene that is homologous to the replacement sequence.

[0012] In a further aspect, a composition is provided for use in treating genetic disease, comprising: (i) a single homology arm construct configured for homology recombination repair, comprising a replacement sequence and a targeting endonuclease cleavage site; and (ii) a targeting endonuclease, wherein the replacement sequence comprises at least one nucleotide difference compared to a target genome, and the target genome comprises a sequence that is homologous to the targeting endonuclease cleavage site.In some embodiments, the single homology arm construct is used to use homology recombination repair to replace at least a portion of a gene.In some embodiments, the targeting endonuclease is selected from CRISPR nuclease, TALEN nuclease, DNA-guided nuclease, meganuclease, and zinc finger nuclease. In some embodiments, the CRISPR nuclease is selected from the group consisting of Cas9, Cas12a(Cpf1), Cas12b(c2c1), Cas12c(c2c3), Cas12g, Cas12i, Cas14, Cas10, Cas3, CasX, CasY, Csf1, Cas13a(c2c2), Cas13b(c2c6), Cas13c(c2c7), c2c4, c2c5, c2c8, c2c9, c2c10, Cas10, CAST and Tn6677. In some embodiments, the composition is further configured to contact the cell with a guide oligonucleotide. In some embodiments, the guide oligonucleotide is a guide RNA. In some embodiments, the genetic disease is caused by a mutation that comprises a single nucleotide difference compared to the target genome. In some embodiments, the single nucleotide difference is selected from one of a substitution, an insertion, and a deletion. In some embodiments, the genetic disease is caused by a mutation, including an insertion, inversion, translocation, duplication, or deletion. In some embodiments, the replacement sequence includes at least a portion of an intron and at least a portion of an exon. In some embodiments, the replacement sequence includes all introns and exons of the gene downstream of the mutation in the gene of the target genome.In some embodiments, the composition targets cells selected from one or more of stem cells, neurons, skeletal muscle cells, smooth muscle cells, cardiomyocytes, pancreatic beta cells, lymphocytes, monocytes, neutrophils, T cells, B cells, NK cells, mast cells, plasma cells, eosinophils, basophils, endothelial cells, epithelial cells, hepatocytes, bone cells, platelets, adipocytes, retinal cells, barrier cells, hormone-secreting cells, glial cells, hepatic adipocytes, secretory cells, urinary cells, extracellular matrix cells, nurse cells, stromal cells, spermatocytes, and oocytes. In some embodiments, the single homologous arm construct, guide oligonucleotide, and targeting endonuclease are encoded within the construct. In some embodiments, the construct is a viral construct. In some embodiments, the viral construct is an adeno-associated virus, an adenovirus, a lentivirus, or a retrovirus. In some embodiments, the construct is a non-viral construct. In some embodiments, the non-viral construct is a minicircle or a plasmid. In some embodiments, the genetic disease is achondroplasia, alpha 1 antitrypsin deficiency, Alzheimer's disease, antiphospholipid syndrome, autism, autosomal dominant polycystic kidney disease, breast cancer, cancer, Charcot-Marie-Tooth, colon cancer, cri-a-cat syndrome, Crohn's disease, cystic fibrosis, Dercum's disease, Down's syndrome, Duane's syndrome, Duchenne muscular dystrophy, factor V Leiden thrombophilia, familial hypercholesterolemia, familial Mediterranean fever, fragile X syndrome, Gaucher's disease, hemochromatosis, hemophilia, holoprosencephaly, Hanch's syndrome, The disease is selected from Leber's congenital amaurosis, Marfan syndrome, myotonic dystrophy, neurofibromatosis, Noonan syndrome, osteogenesis imperfecta, Parkinson's disease, phenylketonuria, Poland anomaly, porphyria, progeria, prostate cancer, retinitis pigmentosa, severe combined immunodeficiency (SCID), sickle cell disease, skin cancer, spinal muscular atrophy, Stargardt disease, Tay-Sachs, thalassemia, trimethylaminuria, Turner syndrome, palatocardiofacial syndrome, WAGR syndrome, and Wilson's disease.

[0013] Incorporation by Reference All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

[0014] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0015] An understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description and accompanying drawings that set forth illustrative embodiments, in which the principles of the invention are utilized. [Brief description of the drawings]

[0016] [Figure 1A] FIG. 1A shows a schematic diagram of targeted GFP knock-in at the Tubb3 locus by a SATI (cell-to-cell linearized single homology arm donor-mediated intron-targeted integration) donor with a single homology arm for targeting in intron 3.

[0017] [Figure 1B] FIG. 1B shows a schematic diagram of targeted GFP knock-in at the Tubb3 locus by a non-homologous HITI donor targeting exon 4.

[0018] [Figure 1C] FIG. 1C shows a schematic diagram of targeted GFP knock-in at the Tubb3 locus by a conventional HDR donor with two homology arms targeting exon 4.

[0019] [Figure 1D] FIG. 1D shows a schematic diagram of targeted GFP knock-in at the Tubb3 locus by a HMEJ donor with two homology arms targeting intron 3.

[0020] [Figure 1E] FIG. 1E shows the experimental scheme of GFP knock-in in cultured primary neurons.

[0021] [Figure 1F] Figure 1F shows representative immunofluorescence images of neurons transfected with Cas9, one-arm SATI donor and int3gRNA-mCherry.

[0022] [Figure 1G] FIG. 1G shows the percentage of knock-in cells (GFP+) per transfected cells (mCherry+) using different combinations of gRNA and donor.

[0023] [Figure 1H] FIG. 1H shows the ratio of HITI-mediated GFP knock-in to oaHDR-mediated GFP knock-in after transfection into primary neurons with one-arm SATI donors.

[0024] [Figure 2A] FIG. 2A shows a schematic diagram of LmnaG609G (c.1827C>T) gene correction using a SATI-mediated gene correction donor.

[0025] [Figure 2B] FIG. 2B shows the ratios of HITI, oaHDR and undetermined (due to large deletions) in the targeted sequence after SATI-mediated gene correction.

[0026] [Figure 2C] FIG. 2C shows the ratios of HITI, oaHDR and undetermined (due to large deletions) with or without indels at the targeted site after gene correction.

[0027] [Figure 2D]FIG. 2D shows the experimental scheme of in vivo gene correction by AAV-progeria-SATI via intravenous (IV) AAV injection into the LmnaG609G / G609G progeria mouse model.

[0028] [Figure 2E] FIG. 2E shows gene correction efficiency at the Lmna c.1827C>T dominant point mutation site from the indicated tissues in progeria mice treated with SATI (Pro+SATI) or donor alone without Cas9 (Pro+donor) at day 100.

[0029] [Figure 2F] Figure 2F shows the indel percentage at Lmna intron 10 gRNA target sites from the indicated tissues in progeria mice treated with SATI (Pro+SATI) or donor alone without Cas9 (Pro+donor) at day 100.

[0030] [Figure 2G] FIG. 2G shows the ratios of HITI, oaHDR and undetermined (due to large deletions) with or without indels at the targeted site after gene correction by systemic AAV-progeria-SATI injection into progeria mice.

[0031] [Figure 3A] FIG. 3A shows survival plots for Lmna+ / + mice (WT), Lmna+ / + mice treated with SATI (WT+SATI), LmnaG609G / G609G mice (Pro), LmnaG609G / G609G mice treated with SATI (Pro+SATI), Lmna+ / G609G heterozygous mice (Het), and Lmna+ / G609G heterozygous mice treated with SATI (Het+SATI).

[0032] [Figure 3B]FIG. 3B shows RT-qPCR analysis (n=3) of the expression ratios of lamin A to lamin C (left) and progerin to lamin A (right) from the indicated tissues.

[0033] [Figure 3C] FIG. 3C shows representative photographs of WT mice, progeria mice (Pro), and progeria+SATI mice (Pro+SATI) at 17 weeks of age.

[0034] [Figure 3D] FIG. 3D shows histological analysis of the skin at 17 weeks of age.

[0035] [Figure 3E] FIG. 3E shows histological analysis of the spleen at 17 weeks of age.

[0036] [Figure 3F] FIG. 3F shows histological analysis of the kidney at 17 weeks of age.

[0037] [Figure 3G] FIG. 3G shows histological analysis of the aorta at 17 weeks of age.

[0038] [Figure 3H] Figure 3H shows electrocardiogram (ECG) analysis in WT, Pro, and Pro+SATI mice from day 92 to day 110. Heart rates are expressed as beats per minute (bpm), n=7. P values ​​are shown on each graph, one-way ANOVA with Tukey's multiple comparison test.

[0039] [Figure 4A] FIG. 4A shows the experimental scheme of in vivo gene repair by AAV-progeria-SATI via intramuscular (IM) AAV injection into the tibialis anterior (TA) muscle of adult LmnaG609G / G609G progeria.

[0040] [Figure 4B]FIG. 4B shows a representative photograph of H&E staining of the TA muscle at 13 weeks of age.

[0041] [Figure 4C] Distribution of myofiber cross-sectional area in the TA muscle of progeria mice at 13 weeks of age.

[0042] [Figure 5A] FIG. 5A shows a schematic diagram of the HDR-mediated gene knock-in method.

[0043] [Figure 5B] FIG. 5B shows a schematic diagram of the HITI-mediated gene knock-in method.

[0044] [Figure 5C] FIG. 5C shows unidirectional gene knock-in by HITI.

[0045] [Figure 6A] FIG. 6A shows a schematic diagram of the HMEJ-mediated intronic gene knock-in method.

[0046] [Figure 6B] FIG. 6B shows a schematic diagram of the new intronic gene knock-in method, SATI.

[0047] [Figure 6C] Figure 6C shows a summary of the suitability differences between the gene editing methods used in this study.

[0048] [Figure 7A] FIG. 7A shows a scheme illustrating the DNA sequence inserted by the conventional HITI system using an exon-targeted HITI donor.

[0049] [Figure 7B] FIG. 7B shows the performance of different gRNA designs in this study.

[0050] [Figure 7C]FIG. 7C shows a schematic representation of gene targeting by HITI using the IRES mCherry-MC donor and different Cas9s in a GFP-corrected HEK293 line.

[0051] [Figure 7D] Figure 7D shows mCherry knock-in HITI efficiency (%) using regular SpCas9 (wtCas9) and NG PAM Cas9 (Cas9-NG and xCas9) in HEK293.

[0052] [Figure 8A] Figure 8A shows representative pictures of untransfected neuronal cultures and neuronal cultures transfected with different donors and gRNAs to recognize the cut patterns induced by one-arm homology and HITI donors.

[0053] [Figure 8B] FIG. 8B shows absolute and relative knock-in efficiencies indicated by the percentage of GFP+ cells among total cells (DAPI+) or transfected cells (mCherry+) in EdU+ or EdU- neurons.

[0054] [Figure 8C] FIG. 8C shows an example of the actual sequence after GFP knock-in at the 3′ end of the Tubb3 coding region with one homology arm donor (MC-Tubb3int3-SATI).

[0055] [Figure 8D] FIG. 8D shows the effect on the efficiency of GFP knock-in in neurons by comparing wild-type Cas9 (Cas9) and Cas9 nickase (Cas9D10A, which introduces a single-stranded break) in SATI donors (MC-Tubb3int3-SATI, MC-Tubb3int3-Scrambled), HITI donors (Tubb3ex4-HITI), and HDR donors (Tubb3ex4-HDR).

[0056] [Figure 9A] FIG. 9A shows a schematic representation of gene targeting by HDR and oaHDR in GFP-corrected HEK293 and hESC lines.

[0057] [Figure 9B] FIG. 9B shows a Surveyor nuclease assay performed by transfection with Cas9, gRNA and tGFP donor DNA.

[0058] [Figure 9C] FIG. 9C shows GFP knock-in efficiency in HEK293 cells.

[0059] [Figure 9D] FIG. 9D shows GFP knock-in efficiency in hES cells.

[0060] [Figure 10A] Figure 10A shows cell cycle analysis by propidium iodide (PI) staining after treatment with or without 20 μM of the cell cycle inhibitor lovastatin in G1 phase for 2 days in a GFP-corrected HeLa line. The efficiency of each phase of the cell cycle is shown on the graph (%).

[0061] [Figure 10B] FIG. 10B shows the percentage of oaHDR- and HDR-mediated gene knock-in in GFP-corrected HeLa lines with treatment with lovastatin.

[0062] [Figure 10C] FIG. 10C shows the structures of wild-type Cas9 (Cas9), G1-phase-specific Cas9 (Cas9-Cdt1), and SM-phase-specific Cas9 (Cas9-Geminin).

[0063] [Figure 10D]FIG. 10D shows the % of oaHDR- and HDR-mediated gene knock-in in GFP-corrected HEK293 lines using different Cas9 treatments.

[0064] [Figure 10E] FIG. 10E shows the % of oaHDR- and HDR-mediated gene knock-in in GFP-corrected HeLa lines using different Cas9 treatments.

[0065] [Figure 11A] Figure 11A shows a schematic diagram of gene targeting by HDR and HITI using mCherry reporter donor in GFP-corrected HEK293 and hESC lines. HDR donor (IRESmCherry-HDR-0c) is inserted by HDR (top). HITI donor (IRESmCherry-MC) is inserted by HITI (bottom).

[0066] [Figure 11B] FIG. 11B shows mCherry knock-in efficiency in HEK293 cells.

[0067] [Figure 11C] FIG. 11C shows mCherry knock-in efficiency in hES cells.

[0068] [Figure 11D] FIG. 11D shows a schematic model of SATI conceptually derived from our findings in different cell types.

[0069] [Figure 12A] FIG. 12A shows a schematic diagram of LmnaG609G (c.1827C>T) gene correction using a plasmid carrying a SATI-mediated gene correction donor (MC-Progeria-SATI) or AAV (AAV-Progeria-SATI).

[0070] [Figure 12B]FIG. 12B shows the experimental scheme for evaluating the corrected gene sequence.

[0071] [Figure 13A] FIG. 13A shows a gene list of shRNAs related to DNA repair used in this study.

[0072] [Figure 13B] FIG. 13B shows the effect of SATI knock-in efficiency in the presence of the indicated shRNAs.

[0073] [Figure 13C] FIG. 13C shows a model of SATI donor-mediated gene knock-in in the oaHDR and NHEJ pathways.

[0074] [Figure 14A] FIG. 14A shows validation of HITI-mediated gene knock-in by PCR using genomic templates from various tissues of AAV-progeria-SATI treated mice at day 100.

[0075] [Figure 14B] FIG. 14B shows sequencing analysis of the 3′ junction sites in liver cells (left) and heart cells (right) upon IV injection of AAV-progeria-SATI at day 100.

[0076] [Figure 15A] Figure 15A shows read counts (reads) and genome editing (indels, HITI, and correction) efficiency (%) by deep sequencing from the indicated organs.

[0077] [Figure 15B] FIG. 15B shows the distribution of indel sizes in the liver.

[0078] [Figure 15C] FIG. 15C shows the distribution of indel sizes in the heart.

[0079] [Figure 15D] FIG. 15D shows the distribution of indel sizes in muscle.

[0080] [Figure 15E] FIG. 15E shows a list of on-target sites (On, Lmna intron 10) and off-target sites (OTS) used to determine the indel frequency of SATI-mediated genome editing.

[0081] [Figure 16A] FIG. 16A shows an intronic SATI-mediated gene targeting strategy to knock-in the "Lmna half-gene" containing the splicing acceptor.

[0082] [Figure 16B] Figure 16B shows a list of trapped exons in liver and heart from mice treated with SATI at day 100. Data are from two mice (#1 and #2).

[0083] [Figure 16C] FIG. 16C shows the chromatin (H3K27Ac and DNaseI HS) and expression (RNAseq) status of the major off-target gene, Alb, in the liver of 8-week-old mice.

[0084] [Figure 16D] FIG. 16D shows the chromatin (H3K27Ac and DNaseI HS) and expression (RNAseq) status of the major off-target gene, Myh6, in 8-week-old mouse hearts.

[0085] [Figure 16E] FIG. 16E shows RT-qPCR analysis of the expression ratios of Albumin to Gapdh (left) and Lamin A to Gapdh (right) in livers from mice treated with SATI at day 100.

[0086] [Figure 17A] FIG. 17A shows cumulative plots of body weight of progeria mice (n=5) and progeria mice treated with SATI (progeria+SATI).

[0087] [Figure 17B] FIG. 17B shows representative photographs of WT, Progeria, and Progeria+SATI treated spleens at 17 weeks of age.

[0088] [Figure 17C] FIG. 17C shows validation of HITI-mediated gene knock-in by PCR using genomic templates from tail tip fibroblasts (TTF) isolated from wild type (WT), progeria (NT), and progeria (T) treated with SATI.

[0089] [Figure 17D] FIG. 17D shows protein levels of lamin A (upper band), progerin (middle band), and lamin C (lower band) detected in wild-type (WT), progerin (NT), and SATI-treated progerin (T) cultured TTFs.

[0090] [Figure 17E] FIG. 17E shows phenotypic rescue of nuclear morphological abnormalities in fibroblasts isolated from progeria mice treated with SATI.

[0091] [Figure 17F] FIG. 17F shows phenotypic rescue of nuclear morphological abnormalities in fibroblasts isolated from progeria mice treated with SATI.

[0092] [Figure 17G] Figure 17G shows hematoxylin and eosin (H&E) staining of the liver of a 17-week-old mouse. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0093] Detailed Description Direct genetic modification can potentially be used to correct genetic diseases by removing disease-causing mutations, offering the possibility of a permanent cure for the disease. In particular, in the presence of an ectopic donor with two stretches of sequence homologous to the target genome, homologous recombination repair (HDR) can replace endogenous genomic sequences with exogenously supplied donor sequences, thereby allowing site-specific integration of transgenes or correction of disease-causing mutations (both recessive and dominant). However, these conventional HDR-based targeted gene knock-in strategies have practical limitations, as HDR is primarily active in dividing cells. Thus, they cannot be utilized for adult tissues composed of non-dividing cells. In vivo tissues consist of many types of cell types that are either dividing or non-dividing and change during development and regeneration. HDR-mediated gene correction strategies have shown promise in curing genetic diseases in mice, but targets are currently limited to tissues that have dividing capacity in vivo (Figure 5A).

[0094] To overcome the limitations of HDR-mediated genome editing, CRISPR / Cas9-based homology-independent targeted integration (HITI) has been developed, which allows targeted knock-in efficiently in both dividing and non-dividing cells in vitro and in vivo (see WO2018 / 013932, the entirety of which is incorporated herein by reference). HITI does not utilize HDR, but instead relies on the non-homologous end joining (NHEJ) pathway, which is another major DNA double-strand break (DSB) repair pathway. In the case of HITI, donor DNA is designed to contain Cas9 cleavage sites that do not have homologous arms and flank the donor sequence (Figure 5B). Cas9-mediated DSBs are simultaneously created in both the genomic target sequence and the exogenously provided donor DNA, which results in blunt ends. The linearized donor DNA can be used for repair by the NHEJ pathway, which allows donor DNA to integrate into the genomic DSB site. Once integrated into the genome, the Cas9 target sequence is disrupted by donor DNA inserted in the desired orientation, preventing further Cas9 cuts. If donor DNA is inserted in an undesired orientation, the Cas9 target sequence remains intact and a second round of Cas9 cuts removes the integrated donor DNA. Thus, in HITI, donor DNA is inserted into the targeted chromosome in a defined orientation (Figure 5C).

[0095] Because NHEJ is active throughout the cell cycle in various adult cell types (including proliferating and postmitotic cells), and its activity far exceeds that of HDR, the HITI strategy has enabled targeted integration of transgene cassettes in many organs, including non-dividing tissues such as the brain. Notably, in a rat model of retinitis pigmentosa, visual function was restored by using HITI to target and insert a functional copy of exon 2 of the Mertk gene to correct the loss of function of the gene caused by a 1.9 kb deletion, whereas conventional HDR could not. These results suggest that HITI-based treatments can be used to reverse various genetic diseases and target tissues. However, HITI has some limitations, for example, it cannot repair genetic point mutations and frameshift mutations due to the fact that although DNA can be inserted at precise locations in the genome, HITI cannot remove existing mutations. Thus, although HITI-mediated gene correction strategies are effective in targeting loss-of-function mutations caused by large deletions, they are not effective for all mutations, such as gain-of-function dominant mutations (Figure 5B). This severely limits the types of diseases that can be treated. Therefore, improved techniques for in vivo manipulation of genomes remain necessary.

[0096] Recent studies have suggested that elements of DNA repair complexes are more promiscuous than previously thought and are not restricted to the NHEJ or HDR pathways, even in postmitotic cells. This gives cells flexibility to overcome DNA damage and provides new opportunities to correct the genome. Previously, attempts were made to combine NHEJ-mediated HITI with standard HDR by constructing a HITI donor with two homologous arms for conventional HDR. This donor structure is similar to the previously reported homology-mediated end joining (HMEJ) strategy (Figure 6A) (Yao, X. et al. Cell Res. 27, 801-814 (2017)). However, the targeted integration efficiency of the HMEJ-like HITI-HDR combination donor in HEK293 cells was lower than that of the HITI donor, suggesting that the addition of two traditional homologous arms does not increase the efficiency of targeted gene knock-in in dividing cells (Suzuki, K. et al. Nature 540, 144-149 (2016)).

[0097] Described herein is a unique NHEJ and HDR-mediated targeted gene knock-in method that requires a DSB-induced site within a single stretch of homologous sequence on the donor (Figure 6B). This design is called "intercellular linearized single homologous arm donor-mediated intron-targeted integration." S Ingle homology A rm donor mediated intron- T targeting IThe system is called "Single-Arm Integration (SATI)". SATI allows DNA knock-in by single homology arm mediated HDR or HITI based on homology independent NHEJ, which allows targeting of a wide range of mutations and cell types. The utility of this system is illustrated herein as a potential therapy by in vivo correction of dominant point mutations that cause premature aging in mice. The data presented in the examples herein show that SATI is a powerful genetic tool for in vivo genome editing due to its target flexibility and versatility.

[0098] SATI is a unique strategy that combines intron-targeted gene knock-in with a specific donor vector with a single homologous arm and a cut site by Cas9. The unique vector structure for SATI has the bipotential capacity to achieve efficient gene knock-in by selecting the predominant DSB repair mechanism in the target cell (i.e., non-canonical HDR or NHEJ mediated by a single homologous arm). SATI differs from HMEJ because the HMEJ donor contains two homologous arms as well as a cut site, allowing the exogenous cassette to be integrated into the target site by either the canonical HDR or NHEJ pathway. Previous attempts have been made to create the same donor structure by constructing a HITI donor with two homologous arms for conventional HDR. However, the targeted integration efficiency of this combination HMEJ-like donor is lower than that of the HITI donor, suggesting that the addition of two conventional homologous arms does not increase the targeted gene knock-in efficiency in dividing cells, and that the canonical HDR and NHEJ pathways compete with each other, as previously described. Furthermore, in vivo HDR application is limited to tissues with dividing capacity. In this study, HMEJ is equally effective as HITI and SATI in primary neuronal cultures. This result suggests that standard HDR and NHEJ do not compete in this cell type, because standard HDR is not active in neurons. Therefore, the efficiency of HMEJ in the target cell type may be affected by standard HDR activity. Since in vivo tissues consist of a mixture of cell types that are either dividing or non-dividing, it remains unclear whether HMEJ can target a wide range of in vivo cell types. In contrast, SATI-mediated knock-in has been achieved in both dividing and non-dividing cells, as with HITI. Further side-by-side comparisons in many different cell types are needed to clarify the details of the differences between HMEJ and SATI. In terms of adaptability, SATI is a versatile in vivo genome editing method that can target a wide range of mutations and cell types (Figure 6C).In addition, the design of the HMEJ donor is less flexible than SATI, since it must include two homologous arms without the possibility of including a splicing acceptor in the left homologous arm to avoid undesired splicing. Moreover, the two homologous arms reduce the size of the inserted cassette that can be packaged into AAV, thus limiting its in vivo application.

[0099] Proof of concept of SATI enabling targeted transgene knock-in into neurons in vitro and in vivo will aid in the advancement of both basic and translational neuroscience research. For example, the system can be used to insert optogenetic activators downstream of relevant gene loci to gain precise cell type-specific control of neuronal activity. SATI-mediated genome editing in adult mouse brain and muscle in vivo offers the possibility of generating knock-in reporters to track cell lineages in non-dividing tissues of other species. This is particularly useful in animal models (e.g., non-human primates) where transgenic tools are limited. Current viral vector-mediated transgene complementation approaches can be used to effectively treat diseases caused by recessive mutations, particularly those where the mutant allele produces no (or very little) functional protein. For genetic disorders such as these, gene therapy has provided notable therapeutic benefits in clinical trials. However, this gene complementation strategy cannot be used to treat gain-of-function gene mutations that result in the production of proteins with increased or abnormal function, such as achondroplasia, Huntington's disease, and progeria syndromes. The SATI system allows for targeted gene knock-in in multiple tissues, thus providing the first in vivo proof-of-concept for in vivo gene correction.

[0100] Although the efficiency of SATI-mediated in vivo gene correction achieved in this study in a mouse model of premature aging caused by a dominant point mutation was modest (2% in the liver), attenuation of the aging phenotype in some tissues and extension of life span were observed. Furthermore, attenuation of the aging phenotype was observed in the skin and spleen, as well as in tail-tip fibroblasts, but SATI-mediated gene knock-in in these tissues could not be detected by PCR and NGS at later stages (approximately 90 days after birth). To increase the SATI efficiency and to clarify the degree of phenotypic improvement and the relationship between corrected cells and non-cell-autonomous effects, it is necessary to develop efficient gene delivery tools and elucidate the detailed mechanism of oaHDR.

[0101] Taken together, our results show that SATI can potentially be used to generate knock-in animals and correct dominant mutations in vivo, even in adult tissues, by targeting multiple tissues through systemic delivery.Importantly, it should be noted that more than 90% of human RefSeq genes have open reading frames of less than 4kb, which is within the capacity of current AAV-based delivery methods.In some embodiments, this advanced gene repair approach is used to develop effective strategies for in vivo targeted gene replacement of a wide range of mutations, including dominant mutations, and to address genetic multi-organ and systemic pathologies.

[0102] Genome editing methods In one aspect, a method for editing a target genome in a cell is provided herein.Some such methods, in some embodiments, comprise contacting a cell with (i) a single homology arm construct comprising a replacement sequence and a targeting endonuclease cleavage site; and (ii) a targeting endonuclease, wherein the replacement sequence comprises at least one nucleotide difference compared to the target genome, and the target genome comprises a sequence that is homologous to the targeting endonuclease cleavage site.In some embodiments, the single homology arm construct replaces at least a portion of the target genome.

[0103] In some embodiments, the genome editing methods herein use a single homology arm construct that includes a replacement sequence and a targeting endonuclease cleavage site. In some embodiments, the single homology arm construct has a nucleic acid sequence that is at least 90% homologous to a nucleic acid sequence in Table 2.

[0104] In some embodiments, the genome editing method herein uses a targeting endonuclease.In some embodiments, the targeting endonuclease is selected from CRISPR nuclease, TALEN nuclease, DNA-guided nuclease, meganuclease, and zinc finger nuclease. In some embodiments, the targeting endonuclease is a CRISPR nuclease selected from the group consisting of Cas9, Cas12a (Cpf1), Cas12b (c2c1), Cas12c (c2c3), Cas12g, Cas12i, Cas14, Cas10, Cas3, CasX, CasY, Csf1, Cas13a (c2c2), Cas13b (c2c6), Cas13c (c2c7), c2c4, c2c5, c2c8, c2c9, c2c10, Cas10, CAST, and Tn6677.

[0105] In some embodiments, the genome editing method herein further comprises contacting the cell with a guide oligonucleotide. In some embodiments, the guide oligonucleotide is a guide RNA. In some embodiments, the guide oligonucleotide or guide RNA has at least 90% sequence identity with the nucleic acid sequence in Table 3.

[0106] In some embodiments, the genome editing method herein uses a replacement sequence that contains a sequence to replace the genome sequence. In some embodiments, the replacement sequence comprises a single nucleotide difference compared to the target genome. In some embodiments, the single nucleotide difference is selected from one of a substitution, an insertion, and a deletion. In some embodiments, the replacement sequence comprises a substitution, an insertion, an inversion, a translocation, a duplication, or a deletion compared to the target genome. In some embodiments, the replacement sequence comprises at least a portion of an intron and at least a portion of an exon. In some embodiments, the replacement sequence comprises all introns and exons of the gene downstream of the mutation in the gene of the target genome.

[0107] In some embodiments, the genome of cells is edited by the genome editing method of the present specification.Any cell is intended for use in the method of the present specification, including, but not limited to, the cell selected from one or more of stem cells, neurons, skeletal muscle cells, smooth muscle cells, cardiomyocytes, pancreatic beta cells, lymphocytes, monocytes, neutrophils, T cells, B cells, NK cells, mast cells, plasma cells, eosinophils, basophils, endothelial cells, epithelial cells, hepatocytes, bone cells, platelets, adipocytes, retinal cells, barrier cells, hormone secreting cells, glial cells, hepatic adipocytes, secretory cells, urinary cells, extracellular matrix cells, nurse cells, interstitial cells, spermatocytes, and oocytes.

[0108] The genome editing method herein uses a construct, such as a DNA construct, that contains the components required for genome editing.For example, in some embodiments, the construct contains a single homology arm construct, a guide oligonucleotide, and a targeting endonuclease that are encoded in the construct.In some embodiments, the construct is a viral construct, including but not limited to adeno-associated virus, adenovirus, lentivirus, or retrovirus.In some embodiments, the construct is a non-viral construct, including but not limited to minicircle or plasmid.

[0109] In some embodiments, the genome editing method herein is carried out by contacting the cell. In some embodiments, the cell is contacted in vivo. In some embodiments, the cell is contacted in vitro. In some embodiments, the cell is from a subject. In some embodiments, the subject is a human, a non-human primate, a dog, a cat, a horse, a cow, a sheep, a pig, a rabbit, a rat, or a mouse. In some embodiments, the subject has a mutation in a gene that is homologous to the replacement sequence.

[0110] Treatment In another aspect, a method for treating a genetic disease in a subject having a mutation in a gene is provided. Some such methods, in some embodiments, comprise contacting a cell from the subject with (i) a single homology arm construct comprising a replacement sequence and a targeting endonuclease cleavage site, and (ii) a targeting endonuclease, where the replacement sequence comprises a wild-type sequence of the gene, and the gene comprises a sequence homologous to the targeting endonuclease cleavage site. In some embodiments, the single homology arm construct replaces at least a portion of the gene.

[0111] In some embodiments, the genome editing methods herein use a single homology arm construct that includes a replacement sequence and a targeting endonuclease cleavage site. In some embodiments, the single homology arm construct has a nucleic acid sequence that is at least 90% homologous to a nucleic acid sequence in Table 2.

[0112] In some embodiments, the method for treating genetic disease herein uses targeting endonuclease.In some embodiments, the targeting endonuclease is selected from CRISPR nuclease, TALEN nuclease, DNA-guided nuclease, meganuclease and zinc finger nuclease. In some embodiments, the targeting endonuclease is a CRISPR nuclease selected from the group consisting of Cas9, Cas12a (Cpf1), Cas12b (c2c1), Cas12c (c2c3), Cas12g, Cas12i, Cas14, Cas10, Cas3, CasX, CasY, Csf1, Cas13a (c2c2), Cas13b (c2c6), Cas13c (c2c7), c2c4, c2c5, c2c8, c2c9, c2c10, Cas10, CAST, and Tn6677.

[0113] In some embodiments, the method of treating genetic disease herein further comprises contacting the cell with a guide oligonucleotide.In some embodiments, the guide oligonucleotide is a guide RNA.In some embodiments, the guide oligonucleotide or the guide RNA has at least 90% identical sequence to the nucleic acid sequence in Table 3.

[0114] In some embodiments, the method of treating genetic disease herein uses a replacement sequence that contains a sequence to replace a genome sequence. In some embodiments, the replacement sequence comprises a single nucleotide difference compared to the target genome. In some embodiments, the single nucleotide difference is selected from one of substitution, insertion, and deletion. In some embodiments, the replacement sequence comprises a substitution, insertion, inversion, translocation, duplication, or deletion compared to the target genome. In some embodiments, the replacement sequence comprises at least a portion of an intron and at least a portion of an exon. In some embodiments, the replacement sequence comprises all introns and exons of the gene downstream of the mutation in the gene of the target genome.

[0115] In some embodiments, the genome of cells is edited by the method of treating genetic disease herein.Any cell is intended for use in the method herein, including but not limited to the cell selected from one or more of stem cells, neurons, skeletal muscle cells, smooth muscle cells, cardiomyocytes, pancreatic beta cells, lymphocytes, monocytes, neutrophils, T cells, B cells, NK cells, mast cells, plasma cells, eosinophils, basophils, endothelial cells, epithelial cells, hepatocytes, bone cells, platelets, adipocytes, retinal cells, barrier cells, hormone secreting cells, glial cells, hepatic adipocytes, secretory cells, urinary cells, extracellular matrix cells, nurse cells, interstitial cells, spermatocytes, and oocytes.

[0116] The method of treating genetic disease herein uses a construct, such as a DNA construct, that contains the components required for genome editing.For example, in some embodiments, the construct comprises a single homology arm construct, a guide oligonucleotide, and a targeting endonuclease that are encoded in the construct.In some embodiments, the construct is a viral construct, including but not limited to adeno-associated virus, adenovirus, lentivirus, or retrovirus.In some embodiments, the construct is a non-viral construct, including but not limited to minicircle or plasmid.

[0117] In some embodiments, the method of treating genetic disease herein is carried out by contacting cells. In some embodiments, the cells are contacted in vivo. In some embodiments, the cells are contacted in vitro. In some embodiments, the cells are from a subject. In some embodiments, the subject is a human, a non-human primate, a dog, a cat, a horse, a cow, a sheep, a pig, a rabbit, a rat, or a mouse. In some embodiments, the subject has a mutation in the gene that is homologous to the replacement sequence.

[0118] Methods of treating a genetic disease include, but are not limited to, treating a genetic disease, wherein the genetic disease is selected from the group consisting of achondroplasia, alpha 1 antitrypsin deficiency, Alzheimer's disease, antiphospholipid syndrome, autism, autosomal dominant polycystic kidney disease, breast cancer, cancer, Charcot-Marie-Tooth, colon cancer, cri-a-cat syndrome, Crohn's disease, cystic fibrosis, Dercum's disease, Down's syndrome, Duane's syndrome, Duchenne muscular dystrophy, factor V Leiden thrombophilia, familial hypercholesterolemia, familial Mediterranean fever, fragile X syndrome, Gaucher's disease, hemoglobinuria, and the like. The genetic disease is selected from matosis, hemophilia, holoprosencephaly, Huntington's disease, Klinefelter's syndrome, Leber's congenital amaurosis, Marfan syndrome, myotonic dystrophy, neurofibromatosis, Noonan syndrome, osteogenesis imperfecta, Parkinson's disease, phenylketonuria, Poland anomaly, porphyria, progeria, prostate cancer, retinitis pigmentosa, severe combined immunodeficiency (SCID), sickle cell disease, skin cancer, spinal muscular atrophy, Stargardt's disease, Tay-Sachs, thalassemia, trimethylaminuria, Turner's syndrome, palatocardiofacial syndrome, WAGR syndrome, and Wilson's disease. In some embodiments, the genetic disease comprises progeria.

[0119] In a further aspect, a composition is provided for use in the treatment of genetic disease.In some embodiments, some such methods include (i) a single homology arm construct comprising a replacement sequence and a targeting endonuclease cleavage site, and (ii) a targeting endonuclease for use in the treatment of genetic disease, wherein the replacement sequence comprises at least one nucleotide difference compared to the target genome, and the target genome comprises a sequence that is homologous to the targeting endonuclease cleavage site.In some embodiments, the single homology arm construct replaces at least a portion of a gene.

[0120] In some embodiments, the compositions for use in treating genetic diseases herein employ a single homology arm construct comprising a replacement sequence and a targeting endonuclease cleavage site. In some embodiments, the single homology arm construct has a nucleic acid sequence that is at least 90% homologous to a nucleic acid sequence in Table 2.

[0121] In some embodiments, the composition for treating genetic disease herein uses targeting endonuclease.In some embodiments, the targeting endonuclease is selected from CRISPR nuclease, TALEN nuclease, DNA-guided nuclease, meganuclease and zinc finger nuclease. In some embodiments, the targeting endonuclease is a CRISPR nuclease selected from the group consisting of Cas9, Cas12a (Cpf1), Cas12b (c2c1), Cas12c (c2c3), Cas12g, Cas12i, Cas14, Cas10, Cas3, CasX, CasY, Csf1, Cas13a (c2c2), Cas13b (c2c6), Cas13c (c2c7), c2c4, c2c5, c2c8, c2c9, c2c10, Cas10, CAST, and Tn6677.

[0122] In some embodiments, the composition for use in treating genetic disease herein further comprises contacting the cell with a guide oligonucleotide.In some embodiments, the guide oligonucleotide is a guide RNA.In some embodiments, the guide oligonucleotide or guide RNA has at least 90% identical sequence to the nucleic acid sequence in Table 3.

[0123] In some embodiments, the composition for use in treating genetic disease herein uses a replacement sequence that contains a sequence to replace the genome sequence. In some embodiments, the replacement sequence comprises a single nucleotide difference compared to the target genome. In some embodiments, the single nucleotide difference is selected from one of substitution, insertion, and deletion. In some embodiments, the replacement sequence comprises a substitution, insertion, inversion, translocation, duplication, or deletion compared to the target genome. In some embodiments, the replacement sequence comprises at least a portion of an intron and at least a portion of an exon. In some embodiments, the replacement sequence comprises all introns and exons of the gene downstream of the mutation in the gene of the target genome.

[0124] In some embodiments, the composition for use in treating genetic disease herein edits the genome of cells.Any cell is intended for use in the method herein, including but not limited to the cell selected from one or more of stem cells, neurons, skeletal muscle cells, smooth muscle cells, cardiomyocytes, pancreatic beta cells, lymphocytes, monocytes, neutrophils, T cells, B cells, NK cells, mast cells, plasma cells, eosinophils, basophils, endothelial cells, epithelial cells, hepatocytes, bone cells, platelets, adipocytes, retinal cells, barrier cells, hormone-secreting cells, glial cells, hepatic adipocytes, secretory cells, urinary cells, extracellular matrix cells, nurse cells, interstitial cells, spermatocytes, and oocytes.

[0125] The composition for use in the treatment of genetic disease herein uses a construct, such as a DNA construct, that contains the components required for genome editing.For example, in some embodiments, the construct comprises a single homology arm construct, a guide oligonucleotide, and a targeting endonuclease that are encoded in the construct.In some embodiments, the construct is a viral construct, including but not limited to adeno-associated virus, adenovirus, lentivirus, or retrovirus.In some embodiments, the construct is a non-viral construct, including but not limited to minicircle or plasmid.

[0126] In some embodiments, the compositions for use in treating genetic disease herein are carried out by contacting cells. In some embodiments, the cells are contacted in vivo. In some embodiments, the cells are contacted in vitro. In some embodiments, the cells are from a subject. In some embodiments, the subject is a human, a non-human primate, a dog, a cat, a horse, a cow, a sheep, a pig, a rabbit, a rat, or a mouse. In some embodiments, the subject has a mutation in a gene that is homologous to the replacement sequence.

[0127] Compositions for use in treating genetic diseases include, but are not limited to, treating genetic diseases, where the genetic disease is selected from the group consisting of achondroplasia, alpha 1 antitrypsin deficiency, Alzheimer's disease, antiphospholipid syndrome, autism, autosomal dominant polycystic kidney disease, breast cancer, cancer, Charcot-Marie-Tooth, colon cancer, cri-a-cat syndrome, Crohn's disease, cystic fibrosis, Dercum's disease, Down's syndrome, Duane's syndrome, Duchenne muscular dystrophy, factor V Leiden thrombophilia, familial hypercholesterolemia, familial Mediterranean fever, fragile X syndrome, Gaucher's disease, The genetic disease is selected from hemochromatosis, hemophilia, holoprosencephaly, Huntington's disease, Klinefelter's syndrome, Leber's congenital amaurosis, Marfan syndrome, myotonic dystrophy, neurofibromatosis, Noonan syndrome, osteogenesis imperfecta, Parkinson's disease, phenylketonuria, Poland anomaly, porphyria, progeria, prostate cancer, retinitis pigmentosa, severe combined immunodeficiency (SCID), sickle cell disease, skin cancer, spinal muscular atrophy, Stargardt's disease, Tay-Sachs, thalassemia, trimethylaminuria, Turner's syndrome, palatocardiofacial syndrome, WAGR syndrome, and Wilson's disease. In some embodiments, the genetic disease comprises progeria.

[0128] In a further aspect, a composition is provided for use in treating a genetic disease, comprising: (i) a single homology arm construct configured for homology directed repair, comprising a replacement sequence and a targeting endonuclease cleavage site; and (ii) a targeting endonuclease, wherein the replacement sequence comprises at least one nucleotide difference compared to a target genome, and the target genome comprises a sequence homologous to the targeting endonuclease cleavage site. In some embodiments, the single homology arm construct has a nucleic acid sequence at least 90% homologous to a nucleic acid sequence in Table 2.

[0129] In some embodiments, the composition for treating genetic disease herein uses targeting endonuclease.In some embodiments, the targeting endonuclease is selected from CRISPR nuclease, TALEN nuclease, DNA-guided nuclease, meganuclease and zinc finger nuclease. In some embodiments, the targeting endonuclease is a CRISPR nuclease selected from the group consisting of Cas9, Cas12a (Cpf1), Cas12b (c2c1), Cas12c (c2c3), Cas12g, Cas12i, Cas14, Cas10, Cas3, CasX, CasY, Csf1, Cas13a (c2c2), Cas13b (c2c6), Cas13c (c2c7), c2c4, c2c5, c2c8, c2c9, c2c10, Cas10, CAST, and Tn6677.

[0130] In some embodiments, the composition for use in treating genetic disease herein further comprises contacting the cell with a guide oligonucleotide.In some embodiments, the guide oligonucleotide is a guide RNA.In some embodiments, the guide oligonucleotide or guide RNA has at least 90% identical sequence to the nucleic acid sequence in Table 3.

[0131] In some embodiments, the composition for use in treating genetic disease herein uses a replacement sequence that contains a sequence to replace the genome sequence. In some embodiments, the replacement sequence comprises a single nucleotide difference compared to the target genome. In some embodiments, the single nucleotide difference is selected from one of substitution, insertion, and deletion. In some embodiments, the replacement sequence comprises a substitution, insertion, inversion, translocation, duplication, or deletion compared to the target genome. In some embodiments, the replacement sequence comprises at least a portion of an intron and at least a portion of an exon. In some embodiments, the replacement sequence comprises all introns and exons of the gene downstream of the mutation in the gene of the target genome.

[0132] In some embodiments, the composition for use in treating genetic disease herein edits the genome of cells.Any cell is intended for use in the method herein, including but not limited to the cell selected from one or more of stem cells, neurons, skeletal muscle cells, smooth muscle cells, cardiomyocytes, pancreatic beta cells, lymphocytes, monocytes, neutrophils, T cells, B cells, NK cells, mast cells, plasma cells, eosinophils, basophils, endothelial cells, epithelial cells, hepatocytes, bone cells, platelets, adipocytes, retinal cells, barrier cells, hormone-secreting cells, glial cells, hepatic adipocytes, secretory cells, urinary cells, extracellular matrix cells, nurse cells, interstitial cells, spermatocytes, and oocytes.

[0133] The composition for use in the treatment of genetic disease herein uses a construct, such as a DNA construct, that contains the components required for genome editing.For example, in some embodiments, the construct comprises a single homology arm construct, a guide oligonucleotide, and a targeting endonuclease that are encoded in the construct.In some embodiments, the construct is a viral construct, including but not limited to adeno-associated virus, adenovirus, lentivirus, or retrovirus.In some embodiments, the construct is a non-viral construct, including but not limited to minicircle or plasmid.

[0134] In some embodiments, the compositions for use in treating genetic disease herein are carried out by contacting cells. In some embodiments, the cells are contacted in vivo. In some embodiments, the cells are contacted in vitro. In some embodiments, the cells are from a subject. In some embodiments, the subject is a human, a non-human primate, a dog, a cat, a horse, a cow, a sheep, a pig, a rabbit, a rat, or a mouse. In some embodiments, the subject has a mutation in a gene that is homologous to the replacement sequence.

[0135] Compositions for use in treating genetic diseases include, but are not limited to, treating genetic diseases, where the genetic disease is selected from the group consisting of achondroplasia, alpha 1 antitrypsin deficiency, Alzheimer's disease, antiphospholipid syndrome, autism, autosomal dominant polycystic kidney disease, breast cancer, cancer, Charcot-Marie-Tooth, colon cancer, cri-a-cat syndrome, Crohn's disease, cystic fibrosis, Dercum's disease, Down's syndrome, Duane's syndrome, Duchenne muscular dystrophy, factor V Leiden thrombophilia, familial hypercholesterolemia, familial Mediterranean fever, fragile X syndrome, Gaucher's disease, The genetic disease is selected from hemochromatosis, hemophilia, holoprosencephaly, Huntington's disease, Klinefelter's syndrome, Leber's congenital amaurosis, Marfan syndrome, myotonic dystrophy, neurofibromatosis, Noonan syndrome, osteogenesis imperfecta, Parkinson's disease, phenylketonuria, Poland anomaly, porphyria, progeria, prostate cancer, retinitis pigmentosa, severe combined immunodeficiency (SCID), sickle cell disease, skin cancer, spinal muscular atrophy, Stargardt's disease, Tay-Sachs, thalassemia, trimethylaminuria, Turner's syndrome, palatocardiofacial syndrome, WAGR syndrome, and Wilson's disease. In some embodiments, the genetic disease comprises progeria.

[0136] Genetic diseases that may be treated by the methods and compositions disclosed herein include, but are not limited to, aceruloplasminemia, type II achondroplasia, achondroplasia, acute intermittent porphyria, adenylosuccinate lyase deficiency, adrenoleukodystrophy, ALA dehydratase deficiency, Alagille syndrome, albinism, Alexander disease, alkaptonuria, alpha 1-antitrypsin deficiency, Alström syndrome, Alzheimer's disease, amelogenesis imperfecta, amyotrophic lateral sclerosis, androgen insensitivity syndrome, anemia, Angelman syndrome, Apert syndrome, ataxia telangiectasia, Beare-Stevenson cutis gyrata syndrome, syndrome, Benjamin syndrome, beta thalassemia, biotinidase deficiency, bladder cancer, Bloom's syndrome, bone disease, breast cancer, Birt-Hogg-Dubé syndrome, CADASIL syndrome, CGD, chronic granulomatous disorder, ankle dysplasia, Canavan disease, cancer, Charcot-Marie-Tooth disease, Charge syndrome, Cockayne syndrome, Coffin-Lowry syndrome, collagenopathy types II and XI, colorectal cancer, connective tissue diseases, Cowden syndrome, cri-a-cat syndrome, Crohn's disease (fibrostenosing), Crouzon syndrome, Crouzondermoskeletal syndrome syndrome), degenerative neurological disorders, developmental disorders, DiGeorge syndrome, distal hereditary motor neuropathy, dwarfism, Ehlers-Danlos syndrome, erythropoietin protoporphyria, Fabry disease, facial injuries and disorders, factor V Leiden thrombophilia, familial adenomatous polyposis, familial dysautonomia, FG syndrome, fragile X syndrome, Friedreich ataxia, G6PD deficiency, galactosemia, Gaucher disease, genetic brain disorders, Harlequin type ichthyosisichthyosis, Head and brain malformations, Hearing impairment and hearing loss, Hearing problems in children, Hemochromatosis, Hemophilia, Hepatic erythropoietic porphyria, Hereditary coproporphyria, Hereditary hemorrhagic telangiectasia (HHT), Hereditary multiple exostoses, Hereditary nonpolyposis colorectal cancer, Homocystinuria, Huntington's disease, Primary hyperoxaluria, Hyperphenylalaninemia, Hypochondrogenesis, Hypochondroplasia, Incontinentia pigmenti, Infantile-onset ascending hereditary spastic paraplegia paralysis), infertility, Jackson-Weiss syndrome, Joubert syndrome, Klinefelter syndrome, Leber congenital amaurosis, Kniest dysplasia, Krabbe disease, Lesch-Nyhan syndrome, leukodystrophy, Li-Fraumeni syndrome, familial lipoprotein lipase deficiency, male genital disorders, Marfan syndrome, McEune-Albright syndrome, McLeod syndrome, MEDNIK, familial Mediterranean fever, Menkes disease, metabolic disorders, beta-globin methemoglobinemia, methylmalonic academia, Micro syndrome, microcephaly, movement disorders, Mowat-Wilson syndrome, mucopolysaccharidosis (MPS I), Muenke syndrome syndrome, muscular dystrophies, Duchenne and Becker muscular dystrophy, myotonic dystrophy, neurofibromatosis type I, neurofibromatosis type II, neurological diseases, neuromuscular disorders, sphingomyelin phosphodiesterase 1 (SMPD1), non-syndromic hearing loss, Noonan syndrome, Ogden syndrome, osteogenesis imperfecta, chondrodysplasia with sensorineural hearing loss, pantothenate kinase-associated neurodegeneration, Pendred syndrome, Peutz-Jeghers syndrome, Pfeiffer syndrome, phenylketonuria, polycystic kidney disease, porphyria, Prader-Willi syndrome, primary ciliary dyskinesia (PCD), primary pulmonary hypertension, progeria, propionic acidemiaacademia, protein C deficiency, protein S deficiency, pseudo-Gaucher disease, pseudoxanthoma elasticum, retinal disorders, retinoblastoma, Rett syndrome, Rubinstein-Taybi syndrome, Schwartz-Jampel syndrome, severe achondroplasia with developmental delay and acanthosis nigricans (SADDAN), sickle cell anemia, Siderius X-linked mental retardation syndrome, skin pigmentation disorder, Smith-Lemli-Opitz syndrome, Smith-Magenis syndrome, speech and communication disorders, spinal-bulbar muscular atrophy, spinal muscular atrophy, Stargardt disease, spinocerebellar ataxia, Strudwick type spondyloepimetaphyseal dysplasia, congenital spondyloepiphyseal dysplasia congenital, Stickler syndrome, Tay-Sachs disease, tetrahydrobiopterin deficiency, tothoracic dysplasia, thyroid disease, Treacher Collins syndrome, Usher syndrome, variegate porphyria, von Hippel-Lindau disease, Waardenburg syndrome, Weisenbacher-Zweimüller syndrome, Williams syndrome, Wilson disease, Wolf-Hirschhorn syndrome, xeroderma pigmentosum, X-linked severe combined immunodeficiency, or X-linked sideroblastic anemia.

[0137] Methods of one-arm homology-directed repair In another aspect, a method of one-arm homology-directed repair for editing a target genome in a cell is provided.Some such methods, in some embodiments, comprise contacting a cell with (i) a single homology arm construct comprising a replacement sequence and a targeting endonuclease cleavage site, and (ii) a targeting endonuclease, wherein the replacement sequence comprises at least one nucleotide difference compared to the target genome, the target genome comprises a sequence homologous to the targeting endonuclease cleavage site, and the replacement sequence is integrated into the target genome using homology-directed repair and an unknown protein.In some embodiments, the single homology arm construct replaces at least a portion of the target genome.

[0138] In some embodiments, the methods of one-arm homology directed repair herein use a single homology arm construct that includes a replacement sequence and a targeted endonuclease cleavage site. In some embodiments, the single homology arm construct has a nucleic acid sequence that is at least 90% homologous to a nucleic acid sequence in Table 2.

[0139] In some embodiments, the one-arm homology directed repair method herein uses targeting endonuclease.In some embodiments, the targeting endonuclease is selected from CRISPR nuclease, TALEN nuclease, DNA-guided nuclease, meganuclease, and zinc finger nuclease. In some embodiments, the targeting endonuclease is a CRISPR nuclease selected from the group consisting of Cas9, Cas12a (Cpf1), Cas12b (c2c1), Cas12c (c2c3), Cas12g, Cas12i, Cas14, Cas10, Cas3, CasX, CasY, Csf1, Cas13a (c2c2), Cas13b (c2c6), Cas13c (c2c7), c2c4, c2c5, c2c8, c2c9, c2c10, Cas10, CAST, and Tn6677.

[0140] In some embodiments, the method of one-arm homology directed repair herein further comprises contacting the cell with a guide oligonucleotide. In some embodiments, the guide oligonucleotide is a guide RNA. In some embodiments, the guide oligonucleotide or guide RNA has at least 90% sequence identity with the nucleic acid sequence in Table 3.

[0141] In some embodiments, the one-arm homology-directed repair method herein uses a replacement sequence that contains a sequence to replace the genome sequence. In some embodiments, the replacement sequence comprises a single nucleotide difference compared to the target genome. In some embodiments, the single nucleotide difference is selected from one of substitution, insertion, and deletion. In some embodiments, the replacement sequence comprises a substitution, insertion, inversion, translocation, duplication, or deletion compared to the target genome. In some embodiments, the replacement sequence comprises at least a portion of an intron and at least a portion of an exon. In some embodiments, the replacement sequence comprises all introns and exons of the gene downstream of the mutation in the gene of the target genome.

[0142] In some embodiments, the genome of cells is edited by the one-arm homology recombination repair method herein.Any cell is intended for use in the method herein, including but not limited to the cell selected from one or more of stem cells, neurons, skeletal muscle cells, smooth muscle cells, cardiomyocytes, pancreatic beta cells, lymphocytes, monocytes, neutrophils, T cells, B cells, NK cells, mast cells, plasma cells, eosinophils, basophils, endothelial cells, epithelial cells, hepatocytes, bone cells, platelets, adipocytes, retinal cells, barrier cells, hormone secreting cells, glial cells, hepatic adipocytes, secretory cells, urinary cells, extracellular matrix cells, nurse cells, interstitial cells, spermatocytes, and oocytes.

[0143] In the present invention, the method of one-arm homology recombination repair uses a construct, such as a DNA construct, that contains the components required for genome editing.For example, in some embodiments, the construct contains a single homology arm construct, a guide oligonucleotide, and a targeting endonuclease that are encoded in the construct.In some embodiments, the construct is a viral construct, including but not limited to adeno-associated virus, adenovirus, lentivirus, or retrovirus.In some embodiments, the construct is a non-viral construct, including but not limited to minicircle or plasmid.

[0144] In some embodiments, the method of one-arm homology directed repair herein is carried out by contacting a cell. In some embodiments, the cell is contacted in vivo. In some embodiments, the cell is contacted in vitro. In some embodiments, the cell is from a subject. In some embodiments, the subject is a human, a non-human primate, a dog, a cat, a horse, a cow, a sheep, a pig, a rabbit, a rat, or a mouse. In some embodiments, the subject has a mutation in a gene that is homologous to the replacement sequence.

[0145] Compositions and Kits In an additional aspect, a composition is provided that comprises: (i) a single homology arm construct comprising a replacement sequence and a targeting endonuclease cleavage site; and (ii) a targeting endonuclease, wherein the replacement sequence comprises at least one nucleotide difference compared to a target genome, and the target genome comprises a sequence homologous to the targeting endonuclease cleavage site. In some embodiments, the single homology arm construct has a nucleic acid sequence at least 90% homologous to a nucleic acid sequence in Table 2.

[0146] In some embodiments, the compositions herein include cells. In some embodiments, the cells are mammalian cells. In some embodiments, the cells are human cells. In some embodiments, the cells are selected from one or more of stem cells, neurons, skeletal muscle cells, smooth muscle cells, cardiomyocytes, pancreatic beta cells, lymphocytes, monocytes, neutrophils, T cells, B cells, NK cells, mast cells, plasma cells, eosinophils, basophils, endothelial cells, epithelial cells, hepatocytes, bone cells, platelets, adipocytes, retinal cells, barrier cells, hormone-secreting cells, glial cells, hepatic adipocytes, secretory cells, urinary cells, extracellular matrix cells, nurse cells, interstitial cells, spermatocytes, and oocytes.

[0147] The compositions herein include constructs, such as DNA constructs, that contain the components required for genome editing.For example, in some embodiments, the constructs include single homology arm constructs, guide oligonucleotides, and targeting endonucleases that are encoded in the constructs.In some embodiments, the constructs are viral constructs, including but not limited to adeno-associated virus, adenovirus, lentivirus, or retrovirus.In some embodiments, the constructs are non-viral constructs, including but not limited to minicircles or plasmids.

[0148] In some embodiments, the compositions herein include a pharma- ceutically acceptable buffer or excipient. In some embodiments, the compositions described herein include, but are not limited to, water, saline, phosphate buffered saline, dextrose, glycerol, ethanol, mannitol, sorbitol, sodium chloride, and combinations thereof.

[0149] In some embodiments, the compositions provided herein comprise a targeting endonuclease.In some embodiments, the targeting endonuclease is selected from CRISPR nuclease, TALEN nuclease, DNA-guided nuclease, meganuclease, and zinc finger nuclease. In some embodiments, the targeting endonuclease is a CRISPR nuclease selected from the group consisting of Cas9, Cas12a (Cpf1), Cas12b (c2c1), Cas12c (c2c3), Cas12g, Cas12i, Cas14, Cas10, Cas3, CasX, CasY, Csf1, Cas13a (c2c2), Cas13b (c2c6), Cas13c (c2c7), c2c4, c2c5, c2c8, c2c9, c2c10, Cas10, CAST, and Tn6677.

[0150] In some embodiments, the compositions provided herein further comprise a guide oligonucleotide. In some embodiments, the guide oligonucleotide is a guide RNA. In some embodiments, the guide oligonucleotide or guide RNA has at least 90% sequence identity with the nucleic acid sequence in Table 3.

[0151] Further provided herein are kits comprising at least one composition described herein and instructions for use in at least one method provided herein.

[0152] Compositions for delivery Any suitable delivery method is intended to be used to deliver the composition of the present disclosure.In some embodiments, the individual components of the SATI system (e.g., nuclease and / or exogenous DNA sequence) are delivered simultaneously or at different times.The choice of the method of genetic modification depends on the cell type to be transformed and / or the situation in which transformation is performed (e.g., in vitro, ex vivo, or in vivo).A general discussion of these methods can be found in Ausubel, et al., Short Protocols in Molecular Biology, 3rd.ed, Wiley & Sons, 1995.

[0153] In some embodiments, the methods disclosed herein involve contacting a target DNA or introducing into a cell (or population of cells) one or more nucleic acids comprising a nucleotide sequence encoding a complementary strand nucleic acid (e.g., a gRNA), a site-directed modifying polypeptide (e.g., a Cas protein), and / or an exogenous DNA sequence. Suitable nucleic acids comprising a nucleotide sequence encoding a complementary strand nucleic acid and / or a site-directed modifying polypeptide include expression vectors, where the expression vector comprising a nucleotide sequence encoding a complementary strand nucleic acid and / or a site-directed modifying polypeptide is a recombinant expression vector.

[0154] Non-limiting examples of delivery methods or transformation include, for example, viral or bacteriophage infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct microinjection, and nanoparticle-mediated nucleic acid delivery (see, e.g., Panyam et., al Adv Drug Deliv Rev. 2012 Sep. 13. pii: 50169-409X (12)00283-9. doi: 10.1016 / j.addr.2012.09.023).

[0155] In some aspects, the disclosure provides a method comprising delivering one or more polynucleotides, such as one or more vectors described herein, one or more transcripts thereof, and / or one or more proteins transcribed therefrom, to a host cell. In some aspects, the disclosure further provides cells produced by such methods, and organisms (e.g., animals, plants, or fungi, etc.) that contain or result from such cells. In some embodiments, the nuclease protein is combined with a complementary sequence and delivered to the cell, optionally as a complex with the complementary sequence. It is contemplated that conventional viral and non-viral based gene transfer methods are used to introduce nucleic acid into mammalian cells or target tissues. Such methods are used to administer nucleic acid encoding components of the SATI system to cells in culture or within a host organism. Non-viral vector delivery systems include DNA plasmids, RNA (e.g., transcripts of vectors described herein), naked nucleic acid, and nucleic acid complexed with a delivery vehicle such as liposomes. Viral vector delivery systems include DNA and RNA viruses, which may be episomal or genomicly integrated after delivery to the cell.For reviews of gene therapy procedures, see Anderson, Science 256: 808-813 (1992);Nabel & Felgner, TIBTECH 11: 211-217 (1993);Mitani & Caskey, TIBTECH 11: 162-166 (1993);Dillon. TIBTECH 11: 167-175 (1993);Miller, Nature 357: 455-460 (1992);Van Brunt, Biotechnology 6 (10): 1149-1154 (1988);Vigne, Restorative Neurology and Neuroscience 8: 35-36 (1995);Kremer & Perricaudet, British Medical Bulletin 51 (1): 31-44 (1995);Haddada et al., in Current Topics in Microbiology and See Immunology Doerfler and Bohm (eds) (1995); and Yu et al., Gene Therapy 1: 13-26 (1994).

[0156] Methods of non-viral delivery of nucleic acid can include lipofection, nucleofection, microinjection, electroporation, biolistic, virosomes, liposomes, immunoliposomes, nanoparticles, polycation or lipid:nucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced DNA uptake.Lipofection is described, for example, in U.S. Pat. Nos. 5,049,386, 4,946,787; and 4,897,355), and lipofection reagents are commercially available (e.g., Transfectam™ and Lipofectin™).Cationic and neutral lipids suitable for efficient receptor-recognition lipofection of polynucleotides include those of Felgner, WO91 / 17424; WO91 / 16024.Delivery is intended to be to cells (e.g., in vitro or ex vivo administration) or to target tissues (e.g., in vivo administration).

[0157] The preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known (see, e.g., Crystal, Science 270: 404-410 (1995); Blaese et al., Cancer Gene Ther. 2: 291-297 (1995): Behr et al., Bioconjugate Chem. 5: 382-389 (1994); Remy et al., Bioconjugate Chem. 5: 647-654 (1994); Gao et al., Gene Therapy 2: 710-722 (1995); Ahmad et al., Cancer Res. 52: 4817-4820). (1992); see U.S. Patent Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, and 4,946,787.

[0158] RNA or DNA virus-based systems are used to target specific cells in the body and transport the viral payload to the nucleus of the cell. Alternatively, viral vectors are administered directly (in vivo) or viral vectors are used to treat cells in vitro and the modified cells are administered as needed (ex vivo). Virus-based systems include, but are not limited to, retroviral, lentiviral, adenoviral, adeno-associated, and herpes simplex virus vectors for gene transfer. In some embodiments, integration into the host genome is achieved using retroviral, lentiviral, and adeno-associated virus gene transfer methods, which in some embodiments results in long-term expression of the inserted transgene. High transduction efficiency is observed in many different cell types and target tissues.

[0159] In certain embodiments, the tropism of the retrovirus is altered by incorporating foreign envelope proteins and increasing the target population of potential target cells. Lentiviral vectors are retroviral vectors that can transduce or infect non-dividing cells and produce high viral titers. The choice of retroviral gene transfer system depends on the target tissue. In some embodiments, the retroviral vector contains cis-acting long terminal repeats capable of packaging up to 6-10 kb of foreign sequence. In some embodiments, the minimal cis-acting LTRs are sufficient for vector replication and packaging, allowing the therapeutic gene to integrate into the target cell resulting in permanent transgene expression. Retroviral vectors include, but are not limited to, those based on murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, e.g., Buchscher et al., J. Virol. 66: 2731-2739 (1992); Johann et al., J. Virol. 66: 1635-1640 (1992); Sommnerfelt et al., Virol. 176: 58-59 (1990); Wilson et al., J. Virol. 63: 2374-2378 (1989); Miller et al., J. Virol. 65: 2220-2224 (1991); PCT / US94 / 05700).

[0160] In some embodiments, an adenovirus-based system is used. In some embodiments, the adenovirus-based system induces the transient expression of transgenes. Adenovirus-based vectors can transduce cells with high efficiency, and in some embodiments, do not require cell division. Adenovirus-based vectors can be used to achieve high titer and level expression. In some embodiments, adeno-associated virus ("AAV") vectors are used to transduce cells with target nucleic acids, e.g., for in vitro production of nucleic acids and peptides, and in vivo and ex vivo gene therapy procedures (see, e.g., West et al., Virology 160: 38-47 (1987); U.S. Pat. No. 4,797,368; WO93 / 24641; Kotin, Human Gene Therapy 5: 793-801 (1994); Muzyczka, J. Clin. Invest. 94: 1351 (1994). Construction of recombinant AAV vectors is described in U.S. Pat. No. 5,173,414; Tratschin et al., Mol. Cell. Biol. 5: 3251-3260 (1985); Tratschin, et al., Mol. Cell. Biol. 4: 2072-2081 (1985). (1984); Hermonat & Muzyczka, PNAS 81: 6466-6470 (1984); and Samulski et al., J. Virol. 63: 03822-3828 (1989).

[0161] In some embodiments, packaging cells are used to form viral particles that can infect host cells. Such cells include, but are not limited to, 293 cells (e.g., for packaging adenovirus), and psi.2 or PA317 cells (e.g., for packaging retrovirus). Viral vectors are generated by producing cell lines that package nucleic acid vectors into viral particles. In some cases, the vector contains minimal viral sequences required for packaging and subsequent integration into the host. In some cases, the vector contains other viral sequences that are replaced by the polynucleotide(s) expressed by the expression cassette. In some embodiments, missing viral functions are supplied in trans by the packaging cell line. For example, in some embodiments, the AAV vector contains ITR sequences from the AAV genome that are required for packaging and integration into the host genome. The viral DNA is packaged into a cell line that contains a helper plasmid that encodes other AAV genes, namely rep and cap, but lacks the ITR sequences. Alternatively, the cell line is infected with adenovirus as a helper. The helper virus promotes the replication of the AAV vector and the expression of AAV genes from the helper plasmid. Adenovirus contamination is reduced, for example, by heat treatment, to which adenovirus is more sensitive than AAV.

[0162] Alternatively, the host cell is transiently or non-transiently transfected with one or more vectors described herein. In some embodiments, the cell is transfected so that the cell is naturally present in the subject. In some embodiments, the cell is obtained from the subject or the cell is derived from the subject and transfected. In some embodiments, the cell is derived from the cell obtained from the subject, such as a cell line. In some embodiments, the cell transfected with one or more vectors described herein is used to establish a new cell line that contains one or more vector-derived sequences. In some embodiments, the cell that is transiently transfected with the components of the CRISPR system described herein (e.g., by transient transfection of one or more vectors or transfection with RNA) and modified by the activity of the CRISPR complex is used to establish a new cell line that contains the cells that contain the modification but do not have any other exogenous sequences.

[0163] Any suitable vector compatible with the host cell is contemplated for use in the methods of the present invention. Non-limiting examples of vectors for eukaryotic host cells include pXT1, pSG5, pSVK3, pBPV, pMSG, and pSVLSV40.

[0164] In some embodiments, the nucleotide sequence encoding the complementary strand nucleic acid and / or the site-specific modified polypeptide is operably linked to a control element, e.g., a transcription control element such as a promoter. In some embodiments, the transcription control element is functional in either a eukaryotic cell, e.g., a mammalian cell, or a prokaryotic cell (e.g., a bacterial or archaeal cell). In some embodiments, the nucleotide sequence encoding the complementary strand nucleic acid and / or the site-specific modified polypeptide is operably linked to multiple control elements that allow expression of the nucleotide sequence encoding the complementary strand nucleic acid and / or the site-specific modified polypeptide in a prokaryotic cell and / or a eukaryotic cell.

[0165] Depending on the host / vector system utilized, any of a number of suitable transcriptional and translational control elements can be used in the expression vector, including constitutive and inducible promoters, transcriptional enhancer elements, transcriptional terminators, and the like (e.g., the U6 promoter, the H1 promoter, and the like; see above) (see, e.g., Bitter et al. (1987) Methods in Enzymology, 153: 516-544).

[0166] In some embodiments, the complementary strand nucleic acid and / or the site-directed modified polypeptide are provided as RNA. In such cases, the RNA encoding the complementary strand nucleic acid and / or the site-directed modified polypeptide can be produced by direct chemical synthesis or transcribed from the DNA encoding the complementary strand nucleic acid in vitro. The RNA encoding the complementary strand nucleic acid and / or the site-directed modified polypeptide is synthesized in vitro using RNA polymerase enzyme (e.g., T7 polymerase, T3 polymerase, SP6 polymerase, etc.). Once synthesized, the RNA is directly contacted with the target DNA or introduced into the cell using any suitable technique for introducing nucleic acid into the cell (e.g., microinjection, electroporation, transfection, etc.).

[0167] The nucleic acid coding for the complementary strand nucleic acid (introduced as either DNA or RNA) and / or the site-specific modified polypeptide (introduced as DNA or RNA) and / or the exogenous DNA sequence is provided to the cell using a suitable transfection technique; see, for example, Angel and Yanik (2010) PLoS ONE 5 (7): e11756, and the commercially available TransMessenger® reagent from Qiagen, Stemfect® RNA Transfection Kit from Stemgent, and TransIT®-mRNA Transfection Kit from Mirus Bio LLC. The nucleic acid coding for the complementary strand nucleic acid and / or the site-specific modified polypeptide and / or the chimeric site-specific modified polypeptide and / or the exogenous DNA sequence can be provided in a DNA vector. Many vectors are available that are useful for transferring nucleic acid into target cells, such as plasmids, cosmids, minicircles, phages, viruses, etc. In some embodiments, the vector containing the nucleic acid(s) is maintained episomally, e.g., a plasmid, minicircle DNA, virus such as cytomegalovirus, adenovirus, or is integrated into the target cell genome by homologous recombination or random integration, e.g., vectors derived from retroviruses such as MMLV, HIV-1, and ALV.

[0168] nucleic acid molecule In a further aspect, a nucleic acid molecule is provided that comprises a single homology arm construct comprising a replacement sequence and a targeting endonuclease cleavage site. In some embodiments, the replacement sequence comprises at least one nucleotide difference compared to the target genome. In some embodiments, the single homology arm construct has a nucleic acid sequence that is at least 90% homologous to a nucleic acid sequence in Table 2.

[0169] In some embodiments, the compositions provided herein further comprise a guide oligonucleotide. In some embodiments, the guide oligonucleotide is a guide RNA. In some embodiments, the guide oligonucleotide or guide RNA has at least 90% sequence identity with the nucleic acid sequence in Table 3.

[0170] In some embodiments, the nucleic acid provided herein further comprises a sequence encoding a targeting endonuclease.In some embodiments, the targeting endonuclease is selected from CRISPR nuclease, TALEN nuclease, DNA-guided nuclease, meganuclease, and zinc finger nuclease. In some embodiments, the targeting endonuclease is a CRISPR nuclease selected from the group consisting of Cas9, Cas12a (Cpf1), Cas12b (c2c1), Cas12c (c2c3), Cas12g, Cas12i, Cas14, Cas10, Cas3, CasX, CasY, Csf1, Cas13a (c2c2), Cas13b (c2c6), Cas13c (c2c7), c2c4, c2c5, c2c8, c2c9, c2c10, Cas10, CAST, and Tn6677.

[0171] In some embodiments, the nucleic acid provided herein comprises a construct, such as a DNA construct, that comprises the components required for genome editing.For example, in some embodiments, the construct comprises a single homology arm construct, a guide oligonucleotide, and a targeting endonuclease that are encoded in the construct.In some embodiments, the construct is a viral construct, including but not limited to adeno-associated virus, adenovirus, lentivirus, or retrovirus.In some embodiments, the construct is a non-viral construct, including but not limited to minicircle or plasmid.

[0172] In additional embodiments, kits are provided that include at least one nucleic acid provided herein and instructions for use in accordance with at least one method provided herein.

Table 1-1

Table 1-2

Table 1-3

Table 1-4

Table 1-5

Table 1-6

Table 1-7

Table 1-8

Table 1-9

Table 1-10

Table 1-11

Table 1-12

Table 1-13

Table 1-14

Table 1-15

Table 1-16

Table 1-17

[0173] Nucleases In some embodiments, nuclease is used in the method and composition herein.The nuclease that recognizes targeting sequence is known to those skilled in the art, and includes but is not limited to zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), clustered regularly interspaced short palindromic repeats (CRISPR) nuclease and meganuclease.The nuclease that can be found in the composition and is useful in the method disclosed herein is described in more detail below.

[0174] Zinc finger nucleases (ZFNs) A "zinc finger nuclease" or "ZFN" is a fusion of the cleavage domain of FokI with a DNA recognition domain containing three or more zinc finger motifs. Heterodimerization of two individual ZFNs at specific locations in DNA with precise orientation and spacing leads to double-stranded breaks in the DNA. In some cases, ZFNs are fused to the C-terminus of each zinc finger domain with a cleavage domain. To allow the two cleavage domains to dimerize and cleave the DNA, the two individual ZFNs bind to opposing strands of DNA at their C-termini at a specific distance. In some cases, the linker sequence between the zinc finger domain and the cleavage domain requires that the 5' ends of each binding site are separated by about 5-7 bp. Exemplary ZFNs that are useful in the present invention include, but are not limited to, those described in Urnov et al., Nature Reviews Genetics, 2010, 11: 636-646; Gaj et al., Nat Methods, 2012, 9 (8): 805-7; U.S. Patent Nos. 6,534,261; 6,607,882; 6,746,838; 6,794,136; 6,824,978; 6,866,997; 6,933,113; 6,979,539; 7,013,219; 7,030,215; 220,719; 7,241,573; 7,241,574; 7,585,849; 7,595,376; 6,903,185; 6,479,626; and those described in U.S. Patent Application Publication Nos. 2003 / 0232410 and 2009 / 0203140.

[0175] In some embodiments, ZFN generates double-strand breaks in target DNA, resulting in DNA break repair that allows introduction of genetic modification.In some embodiments, DNA break repair occurs by non-homologous end joining (NHEJ) or homology-directed repair (HDR).In some embodiments, ZFN is a zinc finger nickase, which in some embodiments is an engineered ZFN that induces site-specific single-strand DNA breaks or nicks.A description of zinc finger nickase can be found, for example, in Ramirez et al., Nucl Acids Res, 2012, 40 (12): 5560-8;Kim et al., Genome Res, 2012, 22 (7): 1327-33.

[0176] TALEN "TALENs" or "TAL-effector nucleases" are engineered transcription activator-like effector nucleases that contain a central domain of DNA-binding tandem repeats, a nuclear localization signal, and a C-terminal transcription activation domain. In some cases, the DNA-binding tandem repeats contain 33-35 amino acids in length and contain two hypervariable amino acid residues at positions 12 and 13 that recognize one or more specific DNA base pairs. TALENs are generated by fusing a TAL effector DNA-binding domain with a DNA cleavage domain. For example, a TALE protein can be fused to a nuclease such as wild-type or mutated FokI endonuclease or the catalytic domain of FokI. Several mutations to FokI for use in TALENs have been created, e.g., those that improve cleavage specificity or activity. Such TALENs are engineered to bind to any desired DNA sequence.

[0177] TALENs are often used to create double-stranded breaks in target DNA sequences, which in turn undergo NHEJ or HDR to produce genetic modifications. In some cases, they provide a single-stranded donor DNA repair template to facilitate HDR.

[0178] Detailed descriptions of TALENs and their use for gene editing can be found, for example, in U.S. Pat. Nos. 8,440,431; 8,440,432; 8,450,471; 8,586,363; and 8,697,853; Scharenberg et al., Curr Gene Ther, 2013, 13 (4): 291-303; Gaj et al., Nat Methods, 2012, 9 (8): 805-7; Beurdeley et al., Nat Commun, 2013, 4: 1762; and Joung and Sander, Nat Rev Mol Cell Biol, 2013, 14 (1): 49-55.

[0179] DNA-guided nucleases A "DNA-guided nuclease" is a nuclease that uses a single-stranded DNA complementary nucleotide to hybridize with another nucleic acid, for example, a target nucleic acid in the genome of a cell, thereby directing the nuclease to a precise location in the genome. In some embodiments, the DNA-guided nuclease comprises an Argonaute nuclease. In some embodiments, the DNA-guided nuclease is selected from TtAgo, PfAgo, and NgAgo. In some embodiments, the DNA-guided nuclease is NgAgo.

[0180] Meganuclease "Meganuclease" is a rare-cutting or homing endonuclease that is highly specific in certain embodiments and recognizes DNA target sites that are at least 12 base pairs long, for example, 12 to 40 base pairs long, or 12 to 60 base pairs long. In some embodiments, the meganuclease is a modular DNA-binding nuclease, such as any fusion protein that includes at least one catalytic domain of an endonuclease and at least one DNA-binding domain or protein that specifies a nucleic acid target sequence. In some embodiments, the DNA-binding domain contains at least one motif that recognizes single-stranded or double-stranded DNA. Alternatively, the meganuclease is a monomer or dimer.

[0181] In some cases, meganucleases are naturally occurring (found in nature) or wild-type, while in other cases, meganucleases are non-naturally occurring, artificial, engineered, synthetic, rationally designed, or man-made. In certain embodiments, meganucleases of the invention include I-CreI meganuclease, I-CeuI meganuclease, I-MsoI meganuclease, I-SceI meganuclease, variants thereof, mutants thereof, and derivatives thereof.

[0182] Although not limited to just these, any meganuclease including, but not limited to, I-Scel, I-Scell, I-SceIII, I-SceIV, I-SceV, I-SceVI, I-SceVII, I-Ceul, I-CeuAIIP, I-Crel, I-CrepsbIP, I-CrepsbllP, I-CrepsbIIIP, I-CrepsbIVP, I-Tlil, I-Ppol, PI-PspI, F-Scel, F-Scell, F-Suvl, F-TevI, F-TevII, I-Amal, I-Anil, I-Chul, I-Cmoel, I-Cpal, I-CpaII, I-Csml, I-Cvul, I-CvuAIP, I-Ddil, I-DdiII, I-Dirl, I-Dmol, I-Hmul, I-HmuII, I-HsNIP, I-Llal, I-Msol, I-Naal, I-Nanl, I-NcIIP, I-NgrIP, I-Nitl, I-Njal, I-Nsp236IP, I-Pakl, I-PboIP, I-PcuIP, I-PcuAI, I-PcuVI, I-PgrlP, 1-PobIP, I-Porl, I-PorIIP, I-PbpIP, I-SpBetaIP, I-Scal, I-SexIP, 1-SneIP, I-Spoml, I-SpomCP, I-SpomIP, I-SpomIIP, I-SquIP, I-Ssp6803I, I-SthPhiJP, I-SthPhiST3P, I-SthPhiSTe3bP, I-TdeIP, I-Tevl, I-TevII, I-TevIII, I-UarAP, I-UarHGPAIP, I-UarHGPA13P, I-VinIP, 1-ZbiIP, PI-MtuI, PI-MtuHIP PI-MtuHIIP, PI-PfuI, PI-PfuII, PI-PkoI, Pl-PkoII, PI-Rma43812IP, PI-SpBetaIP, PI-SceI, PI-TfuI, PI-TfuII, PI-Thyl, PI-Tlil, PI-TliII, or any active variant or fragment thereof is intended to be used herein.

[0183] CRISPR The CRISPR (clustered regularly interspaced short palindromic repeats) / Cas (CRISPR-associated proteins) nuclease system is an engineered nuclease system based on a bacterial system used for genome manipulation. The CRISPR / Cas nuclease system is based in part on the adaptive immune response of many bacteria and archaea. When a virus or plasmid invades a bacterium, the "immune" response converts a segment of the invader's DNA into CRISPR RNA (crRNA). The crRNA then associates with another type of RNA, called tracrRNA, through a region of partial complementarity, to guide the Cas (e.g., Cas9) nuclease to a region of homology to the crRNA in the target DNA, called the "protospacer." The Cas (e.g., Cas9) nuclease cleaves the DNA, generating blunt ends at the double-stranded break at a site specified by a 20-nucleotide complementary strand sequence contained in the crRNA transcript. In some embodiments, Cas (e.g., Cas9) nucleases require both crRNA and tracrRNA for site-specific DNA recognition and cleavage. This system is currently being engineered, and thus in certain embodiments, the crRNA and tracrRNA are combined into one molecule ("single guide RNA" or "sgRNA"), and the crRNA equivalent portion of the single guide RNA is engineered to guide the Cas (e.g., Cas9) nuclease to target any desired sequence (see, e.g., Jinek et al. (2012) Science 337: 816-821; Jinek et al. (2013) eLife 2:e 00471; Segal (2013) eLife 2: e00563). Thus, CRISPR / Cas systems can be engineered to create double-stranded breaks at desired targets within a cell's genome and harness the cell's endogenous machinery to repair the induced break by homology directed repair (HDR) or non-homologous end joining (NHEJ).

[0184] In some embodiments, Cas nuclease has DNA cleavage activity.In some embodiments, Cas nuclease directs the cleavage of one or both strands at a location in the target DNA sequence.For example, in some embodiments, Cas nuclease is a nickase that has one or more inactivation catalytic domains that cleaves one strand of the target DNA sequence.

[0185] Non-limiting examples of Cas nucleases include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Cpf1, C2c3, C2c2, and C2c1, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm 2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Cpf1, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CasX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, homologs, variants, mutants, and derivatives thereof. There are three major types of Cas nucleases (types I, II, and III) and ten subtypes, including five type I, three type II, and two type III proteins (see, e.g., Hochstrasser and Doudna, Trends Biochem Sci, 2015: 40 (1): 58-66). Type II Cas nucleases include, but are not limited to, Cas1, Cas2, Csn2, and Cas9. These Cas nucleases are known to those skilled in the art. For example, the amino acid sequence of Streptococcus pyogenes wild-type Cas9 polypeptide is described, for example, in NBCI reference sequence number NP_269215, and the amino acid sequence of Streptococcus thermophilus wild-type Cas9 polypeptide is described, for example, in NBCI reference sequence number WP_011681470.

[0186] In some embodiments, the Cas nuclease, e.g., Cas9 polypeptide, is selected from, but is not limited to, Veillonella atypical, Fusobacterium nucleatum, Filifactor alocis, Solobacterium moorei, Coprococcus catus, Treponema denticola, Peptoniphilus duerdenii, Catenibacterium mitsuokai, Streptococcus mutans, Listeria innocua, Staphylococcus pseudintermedius, Acidaminococcus intestine, Olsenella uli, Oenococcus kitaharae, Bifidobacterium bifidum, Lactobacillus rhamnosus, Lactobacillus gasseri, Finegoldia magna, Mycoplasma mobile, Mycoplasma gallisepticum, Mycoplasma ovipneumoniae, Mycoplasma canis, Mycoplasma synoviae, Eubacterium rectale, Streptococcus thermophilus, Eubacterium dolichum, Lactobacillus coryniformis subsp. Torquens, Ilyobacter polytropus, Ruminococcus albus, Akkermansia muciniphila, Acidothermus cellulolyticus, Bifidobacterium longum, Bifidobacterium dentium, Corynebacterium diphtheria, Elusimicrobium minutum, Nitratifractor salsuginis, Sphaerochaeta globus, Fibrobacter succinogenes subsp.Succinogenes, Bacteroides fragilis, Capnocytophaga ochracea, Rhodopseudomonas palustris, Prevotella micans, Prevotella ruminicola, Flavobacterium columnare, Aminomonas paucivorans, Rhodospirillum rubrum, Candidatus Puniceispirillum marinum, Verminephrobacter eiseniae, Ralstonia syzygii, Dinoroseobacter shibae, Azospirillum, Nitrobacter hamburgensis, Bradyrhizobium, Wolinella succinogenes, Campylobacter jejuni subsp.Jejuni, Helicobacter mustelae, Bacillus cereus, Acidovorax ebreus, Clostridium perfringens, Parvibaculum lavamentivorans, Roseburia intestinalis, Neisseria meningitidis, Pasteurella multocida subsp.Multocida, Sutterella wadsworthensis, Proteobacterium, Legionella pneumophila, Parasutterella excrementihominis, Wolinella succinogenes, and Francisella novicida.

[0187] "Cas9" refers to an RNA-guided double-stranded DNA-binding nuclease or nickase protein. Wild-type Cas9 nuclease has two functional domains, e.g., RuvC and HNH, that cut different DNA strands. Cas9 can induce double-stranded breaks in genomic DNA (target DNA) when both functional domains are active. In some embodiments, the Cas9 enzyme comprises one or more catalytic domains of Cas9 protein from bacteria belonging to the group consisting of Corynebacter, Sutterella, Legionella, Treponema, Filifactor, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flavobacterium, Sphaerochaeta, Azospirillum, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, and Campylobacter. In some embodiments, Cas9 is a fusion protein, e.g., the two catalytic domains are derived from different bacterial species.

[0188] A useful variant of Cas9 nuclease is RuvC. - or HNH -Examples of the Cas9 nuclease include a single inactive catalytic domain such as an enzyme or nickase. Cas9 nickase has only one active functional domain, and in some embodiments, it cuts only one strand of the target DNA, thereby creating a single-strand break or nick. In some embodiments, the mutant Cas9 nuclease with at least D10A mutation is Cas9 nickase. In other embodiments, the mutant Cas9 nuclease with at least H840A mutation is Cas9 nickase. Other examples of mutations present in Cas9 nickase include, but are not limited to, N854A and N863A. When using at least two DNA-targeting RNAs that target opposite DNA strands, Cas9 nickase is used to introduce double-strand breaks. The double-nicking induced double-strand breaks are repaired by NHEJ or HDR. In this gene editing strategy, HDR is advantageous and reduces the frequency of indel mutations at off-target DNA sites. In some embodiments, Cas9 nuclease or nickase is codon-optimized for the target cell or organism.

[0189] In some embodiments, the Cas nuclease is a Cas9 polypeptide that contains two silencing mutations (D10A and H840A) in the RuvC1 and HNH nuclease domains, and is referred to as dCas9. In one embodiment, the dCas9 polypeptide from Streptococcus pyogenes contains at least one mutation at positions D10, G12, G17, E762, H840, N854, N863, H982, H983, A984, D986, A987, or any combination thereof. Descriptions of such dCas9 polypeptides and variants thereof are provided, for example, in International Patent Publication No. WO2013 / 176772. In some embodiments, the dCas9 enzyme contains a mutation at D10, E762, H983, or D986, as well as a mutation at H840 or N863. In some cases, the dCas9 enzyme contains D10A or D10N mutation. Alternatively, the dCas9 enzyme contains H840A, H840Y, or H840N mutation. In some embodiments, the dCas9 enzyme of the present invention contains D10A and H840A; D10A and H840Y; D10A and H840N; D10N and H840A; D10N and H840Y; or D10N and H840N substitutions. Alternatively, the substitution is a conservative or non-conservative substitution that renders the Cas9 polypeptide catalytically inactive and capable of binding to target DNA.

[0190] With respect to genome editing methods, in some embodiments, the Cas nuclease comprises a Cas9 fusion protein, such as a polypeptide comprising the catalytic domain of the type IIS restriction enzyme FokI linked to dCas9. The FokI-dCas9 fusion protein (fCas9) can bind to a single strand of target DNA using two guide RNAs to generate a double-stranded break.

[0191] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Furthermore, any methods or materials similar or equivalent to those described herein can be used in the practice of the present invention. For purposes of the present invention, the following terms are defined:

[0192] The terms "a," "an," or "the," as used herein, not only include embodiments with one member, but also include embodiments with more than one member. For example, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a cell" includes a plurality of such cells, reference to "the agent" includes reference to one or more agents known to those of skill in the art, and so forth.

[0193] The term "nucleic acid", "nucleotide", or "polynucleotide" refers to deoxyribonucleic acid (DNA), ribonucleic acid (RNA) and polymers thereof in either single-stranded, double-stranded or multi-stranded form. The term encompasses, but is not limited to, single-stranded, double-stranded or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and / or pyrimidine bases or other natural, chemically modified, biochemically modified, non-natural, synthetic, or derivatized nucleotide bases. In some embodiments, nucleic acids may include mixtures of DNA, RNA, and analogs thereof. Unless otherwise limited, the term encompasses nucleic acids that contain known analogs of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specified, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, single nucleotide polymorphisms (SNPs), and complementary sequences as well as sequences explicitly indicated. In particular, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues. The term nucleic acid is used interchangeably with gene, cDNA encoded by a gene, and mRNA.

[0194] The term "gene" or "nucleotide sequence encoding a polypeptide" refers to a segment of DNA involved in producing a polypeptide chain. The DNA segment can include regions preceding and following the coding region (leader and trailer) involved in the transcription / translation of the gene product and regulation of transcription / translation, as well as intervening sequences (introns) between individual coding segments (exons).

[0195] The terms "subject," "patient," and "individual" are used interchangeably herein and include a human or an animal. For example, an animal subject can be a mammal, a primate (e.g., monkey), a livestock animal (e.g., horse, cow, sheep, pig, or goat), a companion animal (e.g., dog, cat), a laboratory animal (e.g., mouse, rat, guinea pig, bird), an animal of veterinary significance, or an animal of economic significance.

[0196] As used herein, the term "administering" includes oral administration, topical contact, administration as a suppository, intravenous administration, intraperitoneal administration, intramuscular administration, intralesional administration, intrathecal administration, intranasal administration, or subcutaneous administration to a subject. Administration is by any route, including parenteral and transmucosal (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or transdermal). Parenteral administration includes, for example, intravenous, intramuscular, intra-arteriole, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial. Other modes of delivery include, but are not limited to, the use of liposomal formulations, intravenous infusion, transdermal patches, and the like.

[0197] The term "treating" refers to an approach to obtain beneficial or desired results, including, but not limited to, therapeutic benefit and / or prophylactic benefit. Therapeutic benefit refers to any therapeutically relevant improvement or effect on one or more diseases, conditions, or symptoms under treatment. With regard to prophylactic benefit, the composition can be administered to a subject at risk of developing a particular disease, condition, or symptom, or to a subject who has reported one or more physiological symptoms of the disease, although the disease, condition, or symptom may not yet be manifested.

[0198] The term "effective amount" or "sufficient amount" refers to an amount of an agent (such as, for example, a DNA nuclease) sufficient to produce a beneficial or desired result. The therapeutically effective amount may vary depending on one or more of the subject and disease state being treated, the weight and age of the subject, the severity of the disease state, the mode of administration, etc., which can be easily determined by one of ordinary skill in the art. The specific amount may vary depending on one or more of the specific agent selected, the target cell type, the location of the target cell within the subject, the dosing regimen followed, whether it is administered in combination with other compounds, the timing of administration, and the physical delivery system carried.

[0199] The term "pharmaceutically acceptable carrier" refers to a substance that aids in the administration of an agent (such as, for example, a DNA nuclease) to a cell, organism, or subject. "Pharmaceutically acceptable carrier" refers to a carrier or excipient that can be included in a composition or formulation and does not cause significant adverse toxicological effects to the patient. Non-limiting examples of pharmaceutically acceptable carriers include water, NaCl, normal saline, lactated Ringer's, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavorings, and colorings. Those skilled in the art will appreciate that other pharmaceutical carriers are also useful in the present invention.

[0200] The term "about," when in reference to a reference numerical value, can include a range of values ​​of plus or minus 10% of that value. For example, the amount "about 10" includes the amounts from 9 to 11, inclusive, including the reference numbers 9, 10, and 11. The term "about," when in reference to a reference numerical value, can also include a range of values ​​of plus or minus 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of that value.

[0201] 1A-1H show single homologous arm donor-mediated gene knock-in in non-dividing primary neurons.

[0202] Figure 1A shows a schematic diagram of targeted GFP knock-in at the Tubb3 locus by a SATI (cell-to-cell linearized single homology arm donor-mediated intron-targeted integration) donor with a single homology arm for targeting in intron 3. The light pink pentagon is the intron 3 gRNA target sequence. The yellow scissors or black line within the gRNA target sequence is the Cas9 cleavage site. The light blue trapezoid is the target and donor homology sequence.

[0203] Figure IB shows a schematic of targeted GFP knock-in at the Tubb3 locus with a non-homologous HITI donor targeting exon 4. The light blue pentagon is the exon 4 gRNA target sequence. The black line within the pentagon is the Cas9 cleavage site.

[0204] Figure 1C shows a schematic diagram of targeted GFP knock-in at the Tubb3 locus with a conventional HDR donor with two homology arms targeting exon 4. The light blue pentagon is the exon 4 gRNA target sequence. The light blue parallelogram is the target and donor homology sequences.

[0205] Figure ID shows a schematic diagram of targeted GFP knock-in at the Tubb3 locus by a HMEJ donor with two homology arms targeting intron 3. To avoid undesired recombination, the red bar (splice acceptor and downstream sequence from rat Tubb3 gene) and the inserted cassette (i.e., exon 4, GFP and 3'UTR) do not have any homologous sequences. The light pink pentagon is the intron 3 gRNA target sequence. The light blue parallelogram is the homologous sequence of the target and donor.

[0206] FIG. 1E shows the experimental scheme of GFP knock-in in cultured primary neurons.

[0207] Figure 1F shows representative immunofluorescence images of neurons transfected with Cas9, 1-arm SATI donor and int3gRNA-mCherry, detected by anti-β-III tubulin antibody (magenta), bmCherry signal (red), anti-GFP antibody (green), DAPI signal (blue) and EdU signal (white). Scale bar: 10 µm.

[0208] Figure 1G shows the percentage of knock-in cells (GFP+) per transfected cells (mCherry+) using different combinations of gRNA and donor. Each value indicates the percentage of GFP-positive cells among the transfected cells. Data are presented as boxes with whiskers, with all input data points as green dots and the mean as a line within the box. Analysis was performed using one-way ANOVA with Bonferroni's multiple comparison test, **** P<0.0001.

[0209] Figure 1H shows the ratio of HITI-mediated GFP knock-in to oaHDR-mediated GFP knock-in after transfection of one-arm SATI donors into primary neurons. The following donor and gRNA combinations were transfected (donor cut: MC-Tubb3int3-scrambled and mScramblegRNA-mCherry; chromosome cut: MC-Tubb3int3-scrambled and int3gRNA-mCherry; donor + chromosome cut (SATI): MC-Tubb3int3-SATI and int3gRNA-mCherry). The number of analyses is indicated at the top.

[0210] 2A-2G show oaHDR or HITI-mediated gene knock-in profiles after SATI-mediated gene correction in progeria mice in vitro and in vivo.

[0211] Figure 2A shows the expression of Lmna using a SATI-mediated gene correction donor. G609GA schematic diagram of (c.1827C>T) gene correction is shown. The red box indicates exon 11 with a single point mutation. After gene correction mediated by NHEJ-mediated HITI, the targeting sequence containing the corrected mutation is inserted intron 10, just before the mutated exon 11 (left side). After gene correction mediated by oaHDR, the mutation is corrected without any other genomic sequence changes, except for the point mutation (right side). The expression level of Lamin C transcribed from exons 1-10 is not affected by the Lmna c.1827C>T mutation. After gene correction, Lamin A protein is expressed instead of progerin expression. The light pink pentagon is the Lmna intron 10 gRNA target sequence. The yellow scissors or black line within the gRNA target sequence is the Cas9 cleavage site (see also Figure 12A).

[0212] Figure 2B shows the ratios of HITI, oaHDR and undetermined (due to large deletions) in targeted sequences after SATI-mediated gene correction from progeria MEFs (upper panel, n=48), primary neurons (middle panel, n=47), and brain (lower panel, n=19). Actual knock-in ratios (%) are shown on the graph.

[0213] Figure 2C shows the ratios of HITI, oaHDR and undetermined (due to large deletions) with or without indels at the targeted site after gene correction by Cas9 / Lmna-gRNA-mCherry / MC-Progeria-SATI transfection and shRNA gene knockdown in progeria MEFs. Actual targeting ratios are shown on the graph (%). Each target of shRNA knockdown is shown at the bottom. Scrambled control, n=48; Ku80, n=19; Lig3, n=32; Rad51, n=17.

[0214] Figure 2D shows Lmna G609G / G609G Figure 1 shows the experimental scheme of in vivo gene correction by AAV-Progeria-SATI via intravenous (IV) AAV injection into a progeria mouse model. AAV-Progeria-SATI is injected together with AAV-Cas9 into neonatal (postnatal day 1, P1) mice. Phenotypes are analyzed on the indicated days of each experiment.

[0215] FIG. 2E shows gene correction efficiency at the Lmna c.1827C>T dominant point mutation site from the indicated tissues in progeria mice treated with SATI (Pro+SATI) or donor alone without Cas9 (Pro+donor) at day 100.

[0216] Figure 2F shows the indel percentage at Lmna intron 10 gRNA target sites from the indicated tissues in progeria mice treated with SATI (Pro+SATI) or donor alone without Cas9 (Pro+donor) at day 100.

[0217] Figure 2G shows the ratios of HITI, oaHDR and undetermined (due to large deletions) with or without indels at the targeted site after gene correction by systemic AAV-Progeria-SATI injection into progeria mice. Deep sequencing was performed using DNA extracted from the liver (top) and heart (bottom), respectively. The actual knock-in ratios are shown in the graph (%).

[0218] 3A-3H show prevention and molecular analysis of the aging phenotype in progeria mice treated with SATI.

[0219] Figure 3A shows Lmna + / + Mice (WT), Lmna treated with SATI + / + Mouse (WT+SATI), Lmna G609G / G609G Mice (Pro), Lmna treated with SATI G609G / G609G Mouse (Pro+SATI), Lmna + / G609G Heterozygous mice (Het), Lmna treated with SATI + / G609G Survival plots of heterozygous mice (Het+SATI). WT, n=72; WT+SATI, n=8; Het, n=33; Het+SATI, n=11; Progeria, n=25; Progeria+SATI, n=15. P<0.0001 according to the log-rank (Mantel-Cox) test. Median survival and maximum survival days for each group are shown at the bottom.

[0220] FIG. 3B shows RT-qPCR analysis (n=3) of the expression ratios of Lamin A to Lamin C (left) and Progerin to Lamin A (right) from the indicated tissues. The expression level of each gene was first normalized by Gapdh, and then the ratios were calculated. Relative values ​​after treatment with SATI are shown. Data are presented as mean±sem. Each P value is shown according to an unpaired Student's t test. NS, not significant. Relative ratios are shown at the top of each graph.

[0221] FIG. 3C shows representative photographs of WT mice, progeria mice (Pro), and progeria+SATI mice (Pro+SATI) at 17 weeks of age.

[0222] Figures 3D-3G show histological analysis of skin (Figure 3D), spleen (Figure 3E), kidney (Figure 3F) and aorta (Figure 3G) at 17 weeks of age. Left: representative pictures of hematoxylin and eosin (H&E) staining. Middle and right: quantitative analysis (Figures 3D-3G) expressed as mean ± sem. Skin, n=39; spleen, n=20; kidney glomerulus, n=20; kidney tubule, n=50; aorta, n=9. Scale bars: 100 μm for skin, kidney and aorta, 250 μm for spleen. Black arrowheads indicate decreased epidermal thickness and increased keratinization (Figure 3D), as well as lymphoid nodules in the white pulp of the spleen (Figure 3E). Epidermal thickness was significantly decreased in untreated mice and restored in mice treated with SATI (Figure 3D). Germinal center area was significantly decreased in untreated mice and restored in SATI-treated mice (Figure 3E). Glomerular area (middle panel) and tubule diameter (right panel) were significantly decreased in untreated mice and restored in SATI-treated mice (Figure 3F). Aortic nucleus density was significantly decreased in untreated mice and restored in SATI-treated mice (Figure 3G). P values ​​are shown on each graph, one-way ANOVA with Tukey's multiple comparison test (Figure 3D-3G).

[0223] Figure 3H shows electrocardiogram (ECG) analysis in WT, Pro, and Pro+SATI mice from day 92 to day 110. Heart rates are expressed as beats per minute (bpm), n=7. P values ​​are shown on each graph, one-way ANOVA with Tukey's multiple comparison test.

[0224] 4A-4C show intramuscular treatment with SATI into the tibialis anterior muscle of an adult with progeria.

[0225] Figure 4A shows an adult Lmna G609G / G609G Figure 1 shows the experimental scheme of in vivo gene repair by AAV-Progeria-SATI via intramuscular (IM) AAV injection into the tibialis anterior (TA) muscle of progeria mice. The TA muscle of 10-week-old progeria mice was injected with AAV(s) and analyzed 3 weeks later.

[0226] Figure 4B shows representative photographs of H&E staining of TA muscles at 13 weeks of age. Top: wild type injected with PBS as a control (WT+PBS), middle: treatment with AAV-Progeria-SATI only without AAV-Cas9 (Pro-Cas9), bottom: treatment with AAV-Progeria-SATI and AAV-Cas9 (Pro+Cas9). Scale bar: 100 μm.

[0227] FIG. 4C: Myofiber cross-sectional area distribution of TA muscle in progeria mice at 13 weeks of age. Each color of bar indicates a representative muscle from an independent mouse. WT+PBS, n=6; Pro-Cas9, n=6; Pro+Cas9, n=8. The average % fibers is shown in the upper right corner. Respective trend lines are shown as dashed lines. Data are presented as mean ± sem. Respective P values ​​are shown according to unpaired Student's t-test.

[0228] 5A-5C show schematic diagrams of HDR- and HITI-mediated knock-in methods.

[0229] Figure 5A shows the schematic diagram of HDR-mediated gene knock-in method. Donor DNA contains two homologous arms that are identical to the target genome. HDR can replace existing mutations, but is not active in non-dividing cells. In vivo application is limited to tissues that have the ability to divide.

[0230] Figure 5B shows the schematic diagram of HITI-mediated gene knock-in method.Donor DNA contains Cas9-mediated DSB-inducing site and does not contain homology with target genome. Simultaneously create DSB in both genome target sequence and donor DNA, thereby allowing donor genome to integrate into DSB site.HITI cannot replace existing mutation, but is also active in non-dividing cells.

[0231] FIG. 5C shows unidirectional gene knock-in by HITI. The complex of SpCas9 and sgRNA introduces a double-strand break (DSB) three base pairs upstream of the PAM sequence in the chromosomal DNA, resulting in two blunt ends. The same sgRNA target sequence is loaded in the opposite direction onto the donor DNA. In the cell, both the targeted chromosomal DNA and the donor DNA are cut by the SpCas9 / sgRNA complex. The blunt ends of the targeted chromosomal DNA and the linearized donor DNA are ligated by the cellular non-homologous end joining (NHEJ) repair mechanism, and the donor DNA is integrated into the target site. When the donor DNA is integrated in the correct orientation (left), the junction sequence is protected from further cleavage by SpCas9. When the donor DNA is integrated in the reverse orientation (right), the integrated donor DNA is deleted by SpCas9 due to the presence of an intact sgRNA target site. This integration system is called homology-independent targeted integration (HITI). The blue pentagon is the sgRNA target sequence. The black line within the blue pentagon is the SpCas9 cleavage site. GOI is the gene of interest.

[0232] 6A-6C show schematic diagrams of HMEJ and intron-targeted SATI methods.

[0233] Figure 6A shows a schematic diagram of HMEJ-mediated intronic gene knock-in method. The donor DNA contains the cassette to be inserted, two DSB-inducing sites, and two homologous arms that are identical to the target genome. To avoid undesired recombination, it is important that the cassette to be inserted (i.e., splice acceptor, exon(s), GOI and 3'UTR) does not have any homologous sequence. Furthermore, to avoid undesired splicing when the insert is integrated by NHEJ, the left homologous arm should not contain a splice acceptor. HMEJ allows DNA knock-in by conventional HDR or NHEJ. Even under the above-mentioned limitations on donor design, HMEJ-mediated gene knock-in can also target a wide range of mutations and cell types, but is less efficient in dividing cells due to competition with conventional HDR. In addition, it is necessary to have two homologous arms, which may exceed the capacity of AAV and limit its application in vivo.

[0234] Figure 6B shows a schematic diagram of SATI, a new intron gene knock-in method. The donor DNA contains one homology arm that is identical to the DSB-induced site and the target genome. SATI allows DNA knock-in by single homology arm mediated HDR (oaHDR) or HITI based on homology-independent NHEJ, which allows targeting a wide range of mutations and cell types.

[0235] Figure 6C shows an overview of the applicability differences between the gene editing methods used in this study. A red circle means "fully applicable", a red triangle means "partially applicable", and a red cross means "difficult to apply". The weaknesses of each gene editing method are indicated in the annotations (right).

[0236] 7A-7D show schematic diagrams of HITI and intron-targeted SATI strategies.

[0237] Figure 7A shows a scheme showing the DNA sequence inserted by the conventional HITI system using an exon-targeted HITI donor. The red pentagon and the yellow and light blue highlights are the 3' end of the exon 4 gRNA target sequence. The black line and the red dashed arrow in the red pentagon are the Cas9 cleavage site. If the donor sequence can be inserted by HITI without indels, the sequences of the junctions at both ends are as shown at the bottom left, and there is no frame shift, so GFP can be expressed normally (left side). If the original HITI targets an exon, the donor DNA is often integrated with a small indel at the junction site, resulting in an out-of-frame mutation and unable to express GFP signal at the end (right side).

[0238] FIG. 7B shows the performance of different gRNA designs in this study.

[0239] Figure 7C shows a schematic diagram of gene targeting by HITI using an IRES mCherry-MC donor and different Cas9 in a GFP-corrected HEK293 line. If the IRES mCherry donor can be successfully integrated into the target region by HITI, the mCherry signal is detected.

[0240] Figure 7D shows mCherry knock-in HITI efficiency (%) using normal SpCas9 (wtCas9) and NG PAM Cas9 (Cas9-NG and xCas9) in HEK293. Data are presented as mean ± sem. Analysis was by one-way ANOVA with Bonferroni's multiple comparison test, *** P<0.001.

[0241] 8A-8D show the development of a novel targeted gene knock-in method in primary neurons.

[0242] Figure 8A shows representative pictures of untransfected and transfected neuronal cultures with different donors and gRNAs for recognizing cut patterns induced by one arm homology and HITI donors. Images were acquired using a confocal microscope with a 20x objective. Scale bar: 100 μm.

[0243] FIG. 8B shows absolute and relative knock-in efficiency, expressed as the percentage of GFP+ cells among total cells (DAPI+) or transfected cells (mCherry+) in EdU+ or EdU- neurons. n=7. Values ​​indicate the percentage of GFP-positive cells among total cells (black) or among transfected cells (light grey). Data are presented as mean ± sem.

[0244] Figure 8C shows an example of the actual sequence after GFP knock-in at the 3' end of the Tubb3 coding region with one homology arm donor (MC-Tubb3int3-SATI). The dashed arrow indicates the cut site by Cas9. The underlined sequence corresponds to the PAM sequence. The yellow highlight indicates the gRNA sequence. The sequence shown in green is the insert sequence from the donor vector. The sequence shown in blue is the targeted genomic sequence.

[0245] Figure 8D shows the effect on the efficiency of GFP knock-in in neurons by comparing wild-type Cas9 (Cas9) and Cas9 nickase (Cas9D10A, which introduces a single-strand break) in SATI donors (MC-Tubb3int3-SATI, MC-Tubb3int3-Scrambled), HITI donors (Tubb3ex4-HITI) and HDR donors (Tubb3ex4-HDR). Data are represented as boxes with whiskers, with all input data points included as green dots and the mean in the center of the box.

[0246] 9A-9D show HDR-, HITI- and oaHDR-mediated gene knock-in efficiencies in dividing cells.

[0247] Figure 9A shows a schematic diagram of gene targeting by HDR and by oaHDR in GFP-corrected HEK293 and hESC lines. Each cell line stably expresses a chromosomal reporter construct. When the truncated GFP (tGFP) donor is correctly integrated into the target sequence, GFP is expressed and can be detected. When the donor sequence is inserted by HITI, no GFP expression is detected.

[0248] Figure 9B shows the surveyor nuclease assay performed by transfecting with Cas9, gRNA and tGFP donor DNA. Different gRNAs (gRNA1, gRNA2 and gRNA3) are transfected into GFP-corrected HEK293 strains, respectively. The gRNA cut efficiency was calculated from the intensity of the bands and is shown at the bottom (%).

[0249] Figures 9C and 9D show GFP knock-in efficiency in HEK293 cells (Figure 9C) and hES cells (Figure 9D). gRNA for HDR: gRNA1. gRNA with genomic cut only: gRNA2. gRNA with donor cut only: gRNA3. gRNA with both genomic and donor cut: gRNA2+3. Data from three independent experiments. * P < 0.05 and ** Unpaired Student's t test yielded P<0.01 (FIGS. 9C, 9D). Data are presented as mean±sem.

[0250] 10A-10E show measurements of cell cycle-dependent oaHDR activity in dividing cells.

[0251] Figure 10A shows cell cycle analysis by propidium iodide (PI) staining after treatment with or without 20 μM of the cell cycle inhibitor lovastatin in G1 phase for 2 days in a GFP-corrected HeLa line. The efficiency of each phase of the cell cycle is shown in the graph (%).

[0252] FIG. 10B shows the percentage of oaHDR- and HDR-mediated gene knock-in in GFP-corrected HeLa lines with treatment with lovastatin. * *P<0.05. Data from three independent experiments, unpaired Student's t test. Data are presented as mean ± sem.

[0253] FIG. 10C shows the structures of wild-type Cas9 (Cas9), G1-phase-specific Cas9 (Cas9-Cdt1), and SM-phase-specific Cas9 (Cas9-Geminin).

[0254] Figures 10D and 10E show the % of oaHDR- and HDR-mediated gene knock-in in GFP-corrected HEK293 (Figure 10D) and HeLa (Figure 10E) lines using different Cas9 treatments. Actual efficiencies (%) are shown above. Data are presented as mean ± sem. NS is not significant by unpaired Student's t-test.

[0255] 11A-11D show HDR-, HITI- and oaHDR-mediated gene knock-in in different cell types.

[0256] Figure 11A shows a schematic diagram of gene targeting by HDR and HITI using mCherry reporter donor in GFP-corrected HEK293 and hESC lines. HDR donor (IRESmCherry-HDR-0c) is inserted by HDR (top). HITI donor (IRESmCherry-MC) is inserted by HITI (bottom).

[0257] Figures 11B and 11C show mCherry knock-in efficiency in HEK293 cells (Figure 11B) and hES cells (Figure 11C). *** *P<0.001. Data from three independent experiments with unpaired Student's t-test. Data are presented as mean ± sem.

[0258] FIG. 11D shows a schematic model of SATI conceptually derived from our findings in different cell types.

[0259] 12A and 12B show the experimental design for oaHDR or HITI-mediated gene knock-in profiles after SATI-mediated gene correction in progeria mice in vitro and in vivo.

[0260] FIG. 12A shows a schematic diagram of LmnaG609G (c.1827C>T) gene correction using a plasmid (MC-Progeria-SATI) or AAV (AAV-Progeria-SATI) with a SATI-mediated gene correction donor. After gene correction mediated by NHEJ-mediated HITI, a targeting sequence containing the corrected mutation is inserted intron 10, just before the mutated exon 11 (left side). After gene correction mediated by oaHDR, the mutation is corrected without any other genomic sequence changes except for the point mutation (right side). The blue pentagon is the Lmna intron 10 gRNA target sequence. The black line in the blue pentagon is the Cas9 cleavage site. The blue half arrow is a PCR primer for detecting only HITI. The black half arrow is a PCR primer for detecting the junction site of gene correction.

[0261] Figure 12B shows the experimental scheme for evaluating the corrected gene sequence. Genomic DNA is extracted from progeria MEF, primary neurons, and brain tissue, respectively. In order to enrich the corrected sequence, BstXI enzyme digestion, which can only recognize uncorrected mutations, is carried out between the first and second PCR. The final PCR product is cloned into TOPO cloning vector and sequenced to determine the ratio of HITI to oaHDR.

[0262] Figures 13A-13C show that oaHDR is a non-canonical HDR pathway mediated by multiple elements of DSB repair.

[0263] FIG. 13A shows a gene list of shRNAs related to DNA repair used in this study.

[0264] FIG. 13B shows the effect of SATI knock-in efficiency in the presence of the indicated shRNAs. n≧4. alt-NHEJ, alternative NHEJ. Data are presented as mean±sem. Input data points are indicated with green dots. t-test for analysis comparing each condition to a control transfected with pLKO-shRNA-scrambled plasmid. **** P<0.0001, *** P<0.001, ** P < 0.01 and * P<0.05.

[0265] Figure 13C shows a model of SATI donor-mediated gene knock-in in the oaHDR and NHEJ pathways. Once the DSB is induced by Cas9, the break is ligated by Ku70 / 80 heterodimer. In some cases, end resection occurs by an unknown mechanism, exposing the genome and / or double-stranded donor as a single strand. Single-strand annealing (SSA) or microhomology and Lig3-mediated alternative NHEJ (AltNHEJ) occurs, and the GOI (gene of interest) is inserted as an oaHDR mechanism (left side). Rad51 deficiency can cause large deletions, since exposed single-stranded DNA is stabilized by Rad51.

[0266] 14A and 14B show knock-in analysis of progeria mice with gene correction using SATI treatment.

[0267] Figure 14A shows the validation of HITI-mediated gene knock-in by PCR using genomic templates from various tissues of AAV-Progeria-SATI treated mice at day 100. The blue half arrows in Figure 12A are PCR primers designed to detect HITI. The Fanca gene is shown as an internal control.

[0268] FIG. 14B shows sequencing analysis of the 3' junction sites in liver cells (left) and heart cells (right) following IV injection of AAV-Progeria-SATI at day 100. The dashed arrows indicate the cut sites by Cas9. The yellow highlights indicate the gRNA sequences. The sequences shown in green are the insert sequences derived from the donor vector. The sequences shown in blue are the targeted genomic sequences. The sequences shown in red are the inserts.

[0269] 15A-15E show NGS analysis in mice treated with SATI.

[0270] FIG. 15A shows read counting (reads) and genome editing (indels, HITI and correction) efficiency (%) by deep sequencing from the indicated organs.

[0271] Figures 15B, 15C, and 15D show the distribution of indel sizes in liver (Figure 15B), heart (Figure 15C), and muscle (Figure 15D). Indel sizes (bp) are shown at the bottom.

[0272] Figure 15E shows a list of on-target sites (On, Lmna intron 10) and off-target sites (OTS) used to determine the indel frequency of SATI-mediated genome editing using genomic DNA isolated from the liver of progeria mice at day 100. Nucleotide letters shown in red are individual mismatches of predicted off-target sites.

[0273] 16A-16E show genome-wide off-target analysis of liver and heart of SATI-treated progeria mice at day 100.

[0274] Figure 16A shows an intronic SATI-mediated gene targeting strategy to knock-in the "Lmna half-gene" containing the splicing acceptor. Off-target integration of the donor results in the integration site transcript being captured and expressed as a fusion gene. The captured exons, including the on-target Lmna exon 10, and unknown off-target genes were determined using 5'RACE and sequencing. The blue half arrows are PCR primers for 5'RACE.

[0275] Figure 16B shows a list of trapped exons in liver and heart from mice treated with SATI at day 100. Data are from two mice (#1 and #2).

[0276] FIG. 16C shows the chromatin (H3K27Ac and DNaseI HS) and expression (RNAseq) status of the major off-target gene, Alb, in the liver of 8-week-old mice.

[0277] FIG. 16D shows the chromatin (H3K27Ac and DNaseI HS) and expression (RNAseq) status of the major off-target gene, Myh6, in 8-week-old mouse hearts.

[0278] Figure 16E shows RT-qPCR analysis of the expression ratios of Albumin to Gapdh (left) and Lamin A to Gapdh (right) in livers from mice treated with SATI at day 100 (n=3). Data are presented as mean ± sem.

[0279] 17A-17G show the phenotyping and analysis of WT, progeria, and SATI-treated progeria mice.

[0280] Figure 17A shows cumulative plots of body weight of progeria mice (n=5) and progeria mice treated with SATI (progeria+SATI) (n=5). Data are presented as mean±sem.

[0281] Figure 17B shows representative photographs of WT, progeria, and progeria+SATI-treated spleens at 17 weeks of age. Partial rescue of splenic involution is observed with SATI treatment in progeria mice.

[0282] Figure 17C shows validation of HITI-mediated gene knock-in by PCR using genomic templates from tail tip fibroblasts (TTFs) isolated from wild type (WT), progeria (NT), and progeria treated with SATI (T). TTFs are established 70 days after IV injection at P1. Genomic DNA recovered from the liver of SATI-treated mice at day 100 was used as a knock-in control. The blue half arrows in Figure 12A are PCR primers designed to detect HITI. The Fanca gene is shown as an internal control.

[0283] Figure 17D shows the protein levels of lamin A (upper band), progerin (middle band), and lamin C (lower band) detected in wild-type (WT), progerin (NT), and SATI-treated progerin (T) cultured TTFs. Each band was normalized by actin density, and then the progerin / lamin A levels were calculated and normalized to NT, which are shown at the bottom.

[0284] Figures 17E and 17F show phenotypic rescue of nuclear morphological abnormalities in fibroblasts isolated from SATI-treated progeria mice. Nuclear morphological abnormalities in TTFs isolated from wild-type mice (WT), progeria mice (Pro), and SATI-treated progeria mice (Pro+SATI) at day 70. Immunostaining for lamin A / C (left, Figure 17E), DAPI (middle, Figure 17E), and quantification of morphological abnormalities (n=6, Figure 17F). Arrowheads indicate abnormal nuclear morphology. Scale bar, 20 μm (Figure 17E). Data are presented as mean ± sem. Each P value is shown according to one-way ANOVA with Tukey's multiple comparison test (Figure 17F).

[0285] Figure 17G shows hematoxylin and eosin (H&E) staining of the liver of a 17-week-old mouse. The lower panels are enlarged views of the boxed areas in the upper panels, respectively. Histopathological analysis showed no obvious inflammatory features around the central and portal vein areas of the liver 17 weeks after systemic AAV injection (progeria + SATI). Scale bars, (black) 200 μm, (blue) 100 μm. EXAMPLES

[0286] The following examples are presented for the purpose of illustrating various embodiments of the present invention and are not intended to limit the present invention in any way. The examples, together with the methods described herein, are presently representative of preferred embodiments and are exemplary, not limiting the scope of the present invention. Variations of the examples and other uses that are encompassed within the spirit of the invention as defined by the claims will occur to those skilled in the art.

[0287] Example 1: Development of a single homologous arm donor-mediated gene knock-in method in postmitotic neurons The HITI system takes advantage of the endogenous cellular NHEJ pathway, a relatively mutagenic form of DNA repair compared to HDR. With NHEJ, small insertions / deletions (indels) are often created at the junction of the DNA to be inserted and the targeted genomic locus. This can lead to out-of-frame mutations when targeting exons, thereby leading to gene inactivation (Figure 7A). To overcome this limitation, we targeted intronic sequences upstream of the relevant exon (or mutation) and included splice acceptors, relevant downstream exon(s), 3'UTR, and genetic elements such as GFP within the donor DNA. In theory, this would result in transcription of the donor exon(s) rather than the endogenous exon(s) downstream of the insertion site, thereby allowing for the generation of normal transcripts (i.e., correction of the mutation) or fusion transcripts (i.e., knock-in of genetic elements such as GFP) (Figure 6B). Importantly, small indels introduced into introns have a lower probability of affecting target gene function.

[0288] To evaluate the efficacy of this new technique, the tubulin beta 3 chain, Tubb3 gene, was targeted in non-dividing cultured mouse primary neurons using a series of donor DNA, gRNA, and Streptococcus pyogenes-derived Cas9 (SpCas9) (Figure 1A-D). Protospacer adjacent motif (PAM) sequences (5'-NGG-3'), which are generally recognized by wild-type SpCas9 and are abundant throughout the mammalian genome, are not always found at the precise locations required to target all genes using HITI. Recently, several novel Cas9s that can target flexible PAM sequences (5'-NG-3') have been developed by protein engineering (Hu, JH et al. Nature 556, 57-63 (2018); Nishimasu, H. et al. Science 361, 1259-1262 (2018)). Using these newly developed Cas9s, the target region can be expanded due to their flexibility (Figure 7B). However, the activity of these novel Cas9s was not higher than that seen with the original SpCas9, and because they target introns (providing greater flexibility in gRNA design), wild-type SpCas9 (hereafter Cas9) was used for further experiments (Figure 7B-7D). For neuronal experiments, the majority of donor DNA was in the form of minicircles (MCs). MCs are double-stranded DNAs that lack a bacterial backbone that enhances the stability of integrated transgenes. Intron 3 of the Tubb3 gene was targeted using donor DNA, Tubb3int3-SATI. This donor contained sequences identical to the target genome, including exon 4, GFP, and Tubb3 3'UTR, and thus had one homology arm to the target site. Additionally, Cas9 cleavage sites were included flanking the donor sequence to confer the ability of HITI-mediated targeted integration. Thus, the intracellularly linearized donor DNA plasmid can then be used for repair by the NHEJ pathway, allowing HITI-mediated unidirectional integration into the genomic DSB site (Figure 1A; Figure 6B).A series of donors including previously developed exon-targeted HITI, conventional HDR, and HMEJ, which are combination vectors with two homologous arms and a cut site, (Tubb3ex4-HITI, Tubb3ex4-HDR, and Tubb3int3-HMEJ, respectively) were also constructed for comparison (Figures 1B-D; Figures 5A, 5B, and 6A).

[0289] A set of donor DNA, gRNA with mCherry expression vector (gRNA-mCherry), and Cas9 were co-transfected into mouse primary neurons. To ensure that gene editing occurred in postmitotic neurons, cells were incubated in EdU, allowing verification of when neurons in culture became postmitotic and which cell populations were transfected. Five days after transfection, precise gene knock-in was confirmed by immunocytochemistry (Figure 1E, Figure 1F; Figure 8A). Using a donor targeting intron 3 (Tubb3int3-SATI), Tubb3-GFP fusion protein was detected in the cytoplasm, as expected. Tubb3-GFP colocalized with β-III-tubulin / Tuj1, the product of the Tubb3 gene. Furthermore, GFP-positive (GFP+) cells were negative for EdU (EdU-), thereby demonstrating that the intronic gene knock-in approach worked in non-dividing neurons (Figure 1F; Figure 8B).

[0290] GFP knock-in efficiency and donor sequence at the integration site were compared for different donor and gRNA combinations. Similar to previous studies, GFP knock-in efficiency using a conventional HDR donor (Tubb3ex4-HDR) with two homologous arms to the genomic cut site was very low (approximately 0.07% of transfected cells) (Figure 1C, Figure 1G). With a non-homologous HITI donor (Tubb3ex4-HITI), efficient NHEJ-mediated GFP knock-in was achieved by HITI (36.25% of transfected cells) in agreement with previous data (Figure 1B, Figure 1G). With Tubb3int3-SATI, knock-in events were observed either when only the target was cut in intron 3 in the genome or when only the Tubb3int3-SATI donor was cut, but GFP knock-in efficiency was low (6.3% and 2.7% per transfected cells) (Figure 1A, Figure 1G). Surprisingly, the junction site of the donor and inserted GFP at the targeted locus remained intact as well as the targeted genomic sequence, i.e., the sequence of the junction site of the gRNA targeting sequence did not show the HITI feature (Figure 1H; Figure 8C). Therefore, it was speculated that the donor DNA was inserted by an unknown non-canonical HDR pathway when a single homologous arm was used. The utilization of this non-canonical HDR is termed one-arm HDR (oaHDR) and is distinct from conventional HDR, which utilizes two homologous arms for the chromosomal cut site (Figure 1A, Figure 1C). By simultaneously cutting the genome and one homologous arm donor DNA (Tubb3int3-SATI), efficient GFP knock-in was observed (approximately 37% of transfected cells) (Figure 1G). The efficiency was equivalent to that of an exon-targeting non-homologous HITI donor (Tubb3ex4-HITI, ∼36%) and to that seen with an HMEJ donor (Tubb3int3-HMEJ, ∼40%) (Figure 1G). Furthermore, when Cas9 was replaced with a Cas9 nickase (Cas9D10A) that introduces a single-strand break (SSB), the GFP knock-in efficiency was very low, suggesting that HITI and oaHDR require DSBs but not SSBs (Figure S8D).During analysis of gene editing events following GFP integration using donor Tubb3int3-SATI and double digestion of the chromosomal target, approximately 95% of gRNA target sites were characterized by oaHDR, indicating no differences in genomic sequence apart from GFP insertion (Figure 1H; Figure S8C). Only 5% of GFP knock-in events were mediated by HITI, suggesting that donor DNA was inserted primarily by oaHDR, which is expected to require the participation of elements of both NHEJ- and HDR-associated pathways.

[0291] Taken together, these results suggest that non-canonical HDR occurs in neurons when the single homologous arm donor cuts at least either the donor or the chromosomal target sequence. The knock-in efficiency increases significantly when both the donor and the chromosomal target are cut (Figure 1G). In summary, a genome targeting system called "cell-to-cell linearized single homologous arm donor-mediated intron-targeted integration (SATI)" that induces DSBs in both the donor and the chromosomal target and utilizes features of both HITI and oaHDR has been successfully developed. Using this system to target introns provides flexibility in designing gRNAs specific to a wider range of genomic sequences and minimizes the impact of indels created by NHEJ (Figures 6B, 6C and 7A, 7B).

[0292] Example 2: Measurement of oaHDR- and HITI-based knock-in efficiency in dividing cells DNA repair by standard HDR can only occur efficiently during the S-G2 phase of the cell cycle, making standard HDR unavailable to non-dividing cells. To test the scope of potential applications of SATI, we determined whether oaHDR occurs in dividing cells in vitro. We used genetically modified human HEK293 cells and human embryonic stem (hES) cell lines carrying a mutated GFP transgene expressed under the EF1α promoter. We compared knock-in efficiency by HDR-mediated targeted integration or oaHDR-mediated targeted integration using three functional gRNAs: gRNA1, gRNA2, and gRNA3 (Figure 9A, Figure 9B). Conventional two homologous arm donor-mediated HDR is active in these cells, consistent with previous reports. Interestingly, very few knock-in events were observed when both genomic and donor DNA were cut simultaneously, suggesting that only a small amount of oaHDR-mediated integration occurred in dividing HEK293 and hES cells (Figure 9C, Figure 9D). To potentially increase oaHDR efficiency in dividing cells, knock-ins were performed during different phases of the cell cycle. Non-dividing cells such as neurons show high levels of oaHDR and are arrested in G0 / G1 phase. Therefore, it was speculated that oaHDR-mediated integration could be boosted by arresting proliferative cells in G0 / G1. To investigate this possibility, cells were arrested in G1 (using lovastatin or by expressing a G1-phase specific Cas9, Cas9-Cdt1), and no increase in oaHDR activity was observed in G1-specific genome editing, suggesting that oaHDR-mediated integration is not boosted by G1 arrest (Figure 10A-10E).

[0293] In contrast, in actively dividing cells, the activity of HITI was an order of magnitude greater than conventional HDR, as demonstrated by knock-in of the mCherry reporter into HEK293 and hES cells (18.2% vs. 1.4% in HEK293 cells; hESC10 6Thus, with the SATI construct, integration can proceed predominantly by non-canonical one-arm HDR (non-dividing cells) or by HITI (actively dividing cells), with higher efficiency compared to HDR (Figure 11D).

[0294] Example 3: Genetic correction of dominant mutations using SATI To demonstrate the versatility of the SATI strategy for targeting, we used a mouse model of progeria to correct a dominant mutation (c.1827C>T;p.Gly609Gly) in exon 11 of the lamin A / C, Lmna gene, using SATI. This mutation results in the production of an abnormal form of the lamin A protein, termed progerin. Accumulation of progerin leads to pathological changes in multiple tissues. 19~21 To correct this dominant mutation, AAV and minicircle vectors containing SATI-mediated gene correction donors (AAV-Progeria-SATI and MC-Progeria-SATI, respectively) were constructed (Figure 2A; Figure 12A). These Progeria-SATI donors contained one 1.9 kb homology arm (including wild-type exon 11, exon 12, and 3'UTR of the Lmna gene) flanked by intron 10 gRNA target sequences, and AAV-Progeria-SATI contained an intron 10 gRNA expression cassette. It was hypothesized that both HITI- and oaHDR-mediated targeted gene knock-in would result in the production of wild-type Lmna gene transcripts (Figure 2A).

[0295] To determine whether gene correction of the c.1827C>T mutation was successful and to determine the ratio of oaHDR-mediated knock-in to HITI-mediated knock-in, mouse embryonic fibroblasts (MEFs) and primary neurons were isolated from progeria mice (Figure 12B). Notably, MEFs exhibit low HDR activity despite being highly proliferative. The progeria-SATI donor was delivered to these cells by transfection or infection. AAV-progeria-SATI was also injected into the adult brains of progeria mice along with AAV-Cas9. Genomic DNA was extracted from the edited progeria cells or brain tissues. Because the DNA delivery efficiency to these cells and tissues is low, the corrected sequences were first enriched by cutting with BstXI enzyme, which specifically recognizes the uncorrected allele, and then analyzed by Sanger sequencing. Gene correction events were observed, with both oaHDR (80-90%) and HITI (10-20%) evident in gene-corrected cells, suggesting that SATI-mediated gene correction of the dominant point mutation causing progeria was achieved and that oaHDR-mediated integration was predominant with respect to the SATI donor in these cell types (Figure 2B).

[0296] To determine the pathways responsible for oaHDR- and HITI-mediated gene knock-in, wild-type primary neurons transfected with Tubb3-GFP knock-in SATI system (Tubb3int3-SATI donor, Cas9, double-cut gRNA) were tested together with shRNAs against genes involved in DSB repair pathways (Figure 13A, Figure 13B). GFP knock-in efficiency of SATI donor was influenced by shRNAs targeting genes related to DSB repair, including canonical NHEJ (cNHEJ) pathway (Ku70, and Ku80), alternative NHEJ pathway (altNHEJ) (Lig3 and Xrcc1) and HDR pathway (Rad50 and Rad51). The change in the ratio of oaHDR to HITI was investigated in progeria MEFs (Figure 2C). Ku80 knockdown eliminated HITI-mediated knock-in. This is consistent with our previous results that demonstrated that HITI is the canonical NHEJ-mediated knock-in mechanism. In contrast, Lig3 knockdown moderately increased HITI (from 12.6% in the control to 21.9%), suggesting that alternative end joining (altNHEJ) is involved in oaHDR-mediated gene knock-in. Interestingly, Rad51 knockdown resulted in large deletions, suggesting that Rad51 may stabilize the genome structure during SATI-mediated gene modification. These results indicate that gene knock-in by the SATI system is mediated by multiple DSB repair pathways (Figure 13C).

[0297] Example 4: SATI-mediated systemic genetic correction of dominant mutations in vivo To test the ability of SATI to correct dominant mutations in vivo, AAV-progeria-SATI was co-transfected with AAV expressing Cas9 into postnatal day 1 (P1) neonatal Lmna pups. G609G / G609GThe SATI donor was delivered systemically by intravenous (IV) injection into progeria mice (Figure 2D). Based on the ability of serotype 9 AAV to infect a wide range of tissues, the SATI donor was packaged in serotype 9 AAV. Genomic PCR and Sanger sequence analysis at day 100 revealed that SATI-mediated targeted gene knock-in had occurred in several tissues, including liver, heart, muscle, kidney, and aorta, although the efficiency varied (Figures 14A-14B). At day 100, the frequency and sequence of indels at the gRNA target site within intron 10 in several organs, as well as the efficiency of SATI-mediated gene correction (2.06% in liver and 0.34% in heart) were determined using next-generation sequencing (NGS) (Figure 15A). Of note, to exclude the possibility that the observed events were due to PCR artifacts, control progeria mice injected with donor-only AAV (denoted "Pro+ donor") were included in the NGS experiment. It is noteworthy that the gRNA target site was within intron 10 of the Lmna gene and that the size of the indel was small and was not predicted to affect splicing of the Lmna transcript (Figures 15B-15D).

[0298] To test the off-target effect of SATI in vivo, we investigated the mutation rates associated with the 10 highest ranking off-target sites for Lmna intron 10 gRNA. SATI-treated liver tissue was analyzed by NGS, which revealed only minimal indels at computationally predicted off-target sites (Figure 15E). We then tested the potential off-target integration of donor DNA in other regions of the genome by 5'RACE and sequencing to identify the upstream sequence of exon 11 of Lmna mRNA transcribed from integrated donor DNA in liver and heart (Figure 16A). We detected on-target integration at the Lmna locus in liver and heart of treated progeria mice (Figure 16B). However, some exons of Alb and Myh6 genes were captured in liver and heart, respectively, suggesting that donor DNA may be trapped in open chromatin regions (Figure 16C, Figure 16D). Importantly, expression levels of the Alb gene in the liver were >10,000-fold higher than those of the Lmna gene, suggesting that trapped donor-derived fusion transcripts were significantly reduced compared with wild-type endogenous Alb gene transcripts and that this minimal off-target integration should not affect tissues unless the fusion protein initiates tumor formation (Figure S16E).

[0299] To evaluate the efficiency of SATI-mediated oaHDR and HITI in vivo at day 100, we amplified approximately 600 bp including the gRNA target site and the c.1827C>T mutation site and determined the efficiency by paired-end sequencing. The percentage of gene correction was estimated to be 2.07% in the liver and 0.14% in the heart, similar to the NGS results above (Figure 2E, 2F; Figure 15A). Furthermore, oaHDR events were observed in the liver and heart analyzed by paired-end sequencing after whole-body SATI treatment in vivo (Figure 2G). Although this number may seem low, it is important to note that gene-corrected cells were still present in several organs even after 100 days of treatment, and that the correction efficiency was sufficient to elicit SATI-mediated phenotypic rescue in several tissues and organs (see below).

[0300] Example 5: Phenotypic rescue of progeria syndromes by SATI Progeria mice generally exhibit progressive weight loss and shortened life span. These phenotypes were delayed by treatment with SATI (Figure 3A; Figure 17A), slowing the progressive weight loss and significantly increasing the median survival time by 1.45-fold (untreated and SATI-treated animals survived for median days of 105 and 152 days, respectively). The Lmna gene encodes both lamin A and lamin C proteins, and Lmna G609G / G609G The mutation results in aberrant splicing of only the lamin A transcript (Fig. 2a).Quantitative RT-PCR analysis of SATI-treated progeria mice revealed an increase in wild-type lamin A transcripts relative to total lamin C transcripts (~3.5-fold) and a decrease in progerin transcripts relative to total lamin A transcripts (~5.4-fold) in the liver, heart, and aorta at day 100 (Fig. 3b).

[0301] Age-related pathological changes are typically observed in multiple organs, including skin, spleen, and kidney, in 3-month-old progeria mice. These aging phenotypes were attenuated in 17-week-old progeria mice treated with SATI (Figures 3C-3F; Figure 17B). SATI-treated mice showed increased epidermal thickness, rescue of germinal centers in the spleen, and reduced tubular atrophy in the kidney. Established tail tip fibroblasts (TTFs) from 70-day SATI-treated mice were used to test knock-in events and protein levels in these cells, but no knock-ins could be detected by PCR (Figure 17C). Instead, SATI treatment slightly reduced progerin / lamin A protein levels and partially rescued the nuclear envelope abnormalities typically observed in progeria (Figures 17D-17F). Progeria mice carry a mutant allele (c.1827C>T;p.Gly609Gly mutation), which is equivalent to the Hutchinson-Gilford Progeria Syndrome (HGPS) c.1824C>T;p.Gly608Gly mutation in the human LMNA gene. Complications related to atherosclerosis, including cardiovascular problems or stroke, are the ultimate cause of death in the majority of patients with HGPS (or progeria). Progeria mice display histological and transcriptional alterations characteristic of progeria symptoms, reminiscent of the major clinical manifestations of human HGPS, including shortened life span and cardiovascular abnormalities. Therefore, the aorta and heart rate of progeria mice were analyzed. Treatment with SATI increased the number of nuclei in the smooth muscle layer of the aortic arch compared to untreated controls (Figure 3G). Electrocardiogram (ECG) recordings revealed that treatment with SATI prevented the progressive development of bradycardia normally observed in progeria mice (Figure 3H).

[0302] Because almost all patients with HGPS are heterozygous for the same dominant c.1824C>T mutation, heterozygous progeria mice (Lmna + / G609G) were also treated with SATI. The median survival of these heterozygous mice was also improved after treatment with SATI (untreated and SATI-treated animals survived for a median survival of 323 and 403 days, respectively) (Figure 3A). Importantly, no morphological / histological alterations were observed in wild-type mice treated with SATI for over 500 days (Figure 17G), suggesting that the adverse effects of the observed off-target integration are largely inconsequential. Collectively, these data demonstrate that SATI can be used to correct dominant mutations in vivo to prevent the development of pathological phenotypes.

[0303] Example 6: In vivo correction in adult tissues using SATI Patients with HGPS are diagnosed at a median age of 19 months (range 3.5 months to 4.0 years). Similarly, many other diseases caused by dominant mutations are diagnosed well beyond the neonatal period. We determined whether delivering SATI at a later stage could provide therapeutic benefit. The SATI line was delivered by localized intramuscular (IM) injection into 10-week-old progeria mice. Skeletal muscle is one of the affected tissues in progeria mice (Figure 4A). Three weeks after injection, fiber size distribution of the injected tibialis anterior muscle was improved in progeria mice treated with SATI (Figure 4B, Figure 4C). Together with successful gene knock-in by SATI in adult postmitotic mouse brain (Figure 2B), these results suggest that localized gene repair in specific tissues at early or adult ages could provide a complementary treatment option for patients with dominant mutations.

[0304] Example 7: Materials and Methods Plasmids and minicircle DNA To construct gRNA expression vectors, each 20 bp target sequence was subcloned into pCAGmCherry-gRNA (Addgene 87110) or gRNA_Cloning Vector (Addgene 41824). The CRISPR-Cas9 target sequences (20 bp target and 3 bp PAM sequence) used in this study are as follows: gRNA targeting Tubb3 intron 3 (int3gRNA-mCherry:GAAGGCTGACCTATTTATCCAGG), gRNA2 (GGTCGCCACCATGGTGAGCAAGG), gRNA3 (CAGCTCGACCAGGATGGGCACGG), and gRNA targeting Lmna intron 10 (Lmna-gRNA-mCherry:CCCATAAGTGTCTAAGATTCAGG). The scrambled-gRNA (mScramblegRNA-mCherry; GCTTAGTTACGCGTGGACGAAGG), gRNA1 (CAGGGTAATCTCGAGAGCTTAGG), and gRNA targeting Tubb3 exon 4 (ex4gRNA-mCherry; GCTTAGTTACGCGTGGACGAAGG) expression plasmids were used previously. hCas9 (Addgene 41815) and tGFP (Addgene 26864) were purchased from Addgene. Enhanced versions of Cas9 (pCAG-1BPNLS-Cas9-1BPNLS (Addgene 87108) and pCAG-1BPNLS-Cas9-1BPNLS-2AGFP (Addgene 87109), IRESmCherry-HDR-0c, IRESmCherry-MC and Tubb3ex4-HDR, Tubb3ex4-HITI (pTubb3-MC: Addgene 87112). Minicircles (MCs) are double-stranded DNA that lack the bacterial backbone and have been shown to enhance the stability of integrated transgenes.To construct the SATI donor for mouse Tubb3 (pMC-Tubb3int3-SATI and pMC-Tubb3int3-Scrambled), the one-sided homology arm containing the gRNA target sequence and GFP was amplified from pTubb3-HR and then subcloned into the ApaI site (NEB#R0114S) and SmaI site (NEB#R0141S) of the minicircle-producing circulator plasmid (pMC.BESPX, System Biosciences#MN100B-1) using the In-Fusion HD Cloning kit (Clontech#639650). To construct the HMEJ donor for mouse Tubb3 (pTubb3int3-HMEJ), unnecessary homologous sequences were removed from the cassette to be inserted by inserting codon-optimized exon 4 and non-translated sequences derived from the rat genome. Codon optimization and synthesis of mouse Tubb3 exon 4 was performed at IDT. A portion of intron 3, including the splice acceptor site, 3'UTR and downstream, was amplified from rat genome isolated from Brown Norway rats. Two homologous arms (left arm: 1.0 kb, right arm: 1.2 kb) were amplified from mouse genomic DNA and then assembled with the cassette to be inserted. The assembled fragment was sandwiched between two gRNA target sequences and subcloned into pCAG-floxSTOP plasmid according to the strategy described above. To construct a SATI donor for progeria gene correction (pMC-progeria-SATI), the gRNA target sequence, and a one-sided homologous arm containing c.1827C were amplified from wild-type C57BL / 6 mouse genomic DNA and then subcloned into pMC.BESPX according to the strategy described above. These parental pre-minicircle DNAs were removed from the backbone DNA and generated as minicircle DNA vectors as described in our previous paper.To construct NG PAM xCas9 (pCAG-1BPNLS-xCas9-1BPNLS), xCas9 3.7 (Addgene 108379) (Addgene Plasmid #108379; http: / / n2t.net / addgene:108379; RRID:Addgene_108379) was amplified by PCR and then inserted into pCAG-1BPNLS-Cas9-1BPNLS using the In-Fusion HD Cloning kit. To construct NG PAM SpCas9-NG (pCAG-1BPNLS-SpCas9NG-1BPNLS), SpCas9-NG was synthesized at IDT and then inserted into pCAG-1BPNLS-Cas9-1BPNLS using the In-Fusion HD Cloning kit. To construct cell cycle-specific Cas9, Cdt1 and Geminin were synthesized at IDT and then inserted into pCAG-1BPNLS-Cas9-1BPNLS (Addgene 87108) using the In-Fusion HD Cloning kit. The generated pCAG-1BPNLS-Cas9-Cdt1 and pCAG-1BPNLS-Cas9-Geminin were G1-phase-specific Cas9 expression plasmids or S / G2 / M-phase-specific Cas9 expression plasmids, respectively. To construct nickase Cas9 (pCAG-1BPNLS-Cas9D10A-1BPNLS), the D10A point mutation was inserted into pCAG-1BPNLS-Cas9-1BPNLS (Addgene 87108) using the In-Fusion HD Cloning kit. The shRNA expression vector (pLKO-shRNA) was purchased from Sigma (Figure 13A). As a control, pLKO-shRNA-scrambled was used.To construct a donor / gRNA AAV for SATI-mediated progeria gene correction, a one-sided homology arm containing c.1827C was amplified from wild-type C57BL / 6 mouse genomic DNA, and then the homology arm was flanked by Cas9 / gRNA target sequences, and a Lmna intron 10 gRNA expression cassette and a mCherryKASH expression cassette were subcloned between the ITRs of PX552 purchased from Addgene (Addgene 60958), generating pAAV-progeria-SATI.pAAV-nEFCas9 (Addgene 87115).

[0305] AAV production AAVs (AAV-Progeria-SATI and AAV-nEFCas9) were all packaged with serotype 9 and produced using standard protocols.

[0306] animal ICR and C57BL / 6 were purchased from the Jackson laboratory. A mouse model of Hutchinson-Gilford Progeria Syndrome (HGPS) carrying the Lmna G609G (c.1827C>T) mutation (progeria) was generated by Carlos Lopez-Otin, University of Oviedo, Spain. All mice used in this study were mixed-sex and mixed-strain, and aged between E12.5 and 17 months or older.

[0307] Primary culture of mouse neurons Mouse neurons were obtained from the cortex of E14.5 ICR mouse brains or P0.5 progeria mouse brains. Brain dissections were performed in cold 2% glucose solution in PBS. The tissue was then dissociated using Accutase (Innovative Cell Technologies #AT104) and the suspension was passed through a 40 μm cell strainer to obtain a single cell suspension. Cells were seeded at a ratio of 200,000 cells per 12 mm poly-D-lysine coverslip (Neuvitro #H-12-1.5-PDL) with Neurobasal media (Gibco #21103-049) supplemented with 5 mM taurine (Sigma #T8691-25G), 2% B27 (Gibco #17504-044) and 1× GlutaMAX (Gibco #35050-061). Cultures were maintained under standard conditions (37°C in humidified 5% CO2 / 95% air). Half the volume of culture medium was replaced every 2 days. The disappearance of proliferative neuronal precursors present in primary cultures was followed by a 10μM EdU-pulse (using EdU from Invitrogen#C10640 kit) every day after seeding. After 5 days of culture, the percentage of EdU+ cells was reduced to basal levels, and such postmitotic cell populations were then used for further experiments.

[0308] Transfection and AAV infection of primary neurons cultured in vitro For transfection of minicircles or plasmids, CombiMag (OZBiosciences#CM20200) reagent was used in combination with Lipofectamine 2000 (Invitrogen#P-N52758) to transfect mouse primary neurons according to the manufacturer's instructions. After 5 days of culture, Cas9, gRNA, and shRNA plasmids were transfected at a ratio of 1 μg each per mL, while donors were transfected at a ratio of 2 μg per mL of culture medium. The following donor and gRNA combinations were transfected into primary neurons (single homologous arm / chromosome cut: MC-Tubb3int3-scrambled and int3gRNA-mCherry; single homologous arm / donor cut: MC-Tubb3int3-scrambled and mScramblegRNA-mCherry; single homologous arm / donor-chromosome double cut (SATI): MC-Tubb3int3-SATI and int3gRNA-mCherry; HITI targeting exon 4: Tubb3ex4-HITI and ex4gRNA-mCherry; HDR targeting exon 4: Tubb3ex4-HDR and ex4gRNA-mCherry); and HMEJ targeting intron 3: Tubb3int3-HMEJ. For AAV infection, an AAV mixture (AAV9-nEFCas9 [2 × 10 11 genome copies (GC)] and AAV9-Progeria-SATI [2 × 10 11 GC]) was used to infect primary cultures at a 6-well scale after 5 days of culture. Five days after transfection or infection, cells were analyzed by the following methods.

[0309] Immunocytochemistry of primary neurons Fixation was performed in 4% paraformaldehyde solution for 15 min. Blocking and permeabilization were performed with 5% bovine serum albumin (BSA, Sigma #A1470-100) and 0.1% Triton-X100 (EMD #TX1568-1) in PBS for 1 h at room temperature. Primary antibodies were diluted in PBS and incubated overnight at 4°C in a humidified chamber with the following concentrations: [1:1,000] anti-GFP (Aves #GFP-1020) or [1:250] anti-βIII-tubulin (Sigma #T2200-200UL). The next day, cells were incubated with secondary antibodies: [1:1,000] Alexa-Fluor 488 or 647 (Thermo Fisher, #A11039 and #A21244). Five washing steps with 0.2% Tween 20 in PBS (Fisher#BP337-500) were performed after each incubation of primary and secondary antibodies to remove excess primary and secondary antibodies. Cells were then mounted using DAPI-Vector Shield mounting medium (Vector#H-1200). To determine the proliferation status, EdU was detected by Click-iT EdU kit according to the manufacturer's instructions (Invitrogen#C10640).

[0310] Acquisition and processing of images of primary neurons Immunocytochemistry samples of neuronal primary cultures were visualized by confocal microscopy using a Zeiss LSM 710 Laser Scanning Confocal Microscope (Zeiss) for detection and quantification of GFP knock-in efficiency. For quantification, the percentage of GFP+ cells was calculated by direct counting with respect to the total number of mCherry+ transfected cells per coverslip. Representative pictures were acquired using an Airyscan LSM880 (Zeiss). At least five pictures were obtained from each sample for imaging. Our cultures were derived from at least 30 different litters, and the exact n value is listed in each figure. Images were processed according to experimental requirements by ZEN2 Black edition software (Zeiss), ICY software for bio-imaging version 1.9.5.1 (http: / / icy.bioimageanalysis.org / ), and NIH ImageJ (FIJI) software.

[0311] Genotyping of cultured primary neurons To determine GFP knock-in in cultured primary neurons and distinguish between one-arm HDR (oaHDR) and HITI events, genomic DNA was extracted using the Pico Pure DNA Extraction Kit (Thermo Fisher Scientific #KIT0103) or Blood&Tissue kit (QIAGEN #69506) according to the manufacturer's instructions. First, the GFP knock-in sequence containing the gRNA target site was amplified using PrimeSTAR GXL DNA polymerase (Takara #R050A) with the following primers: mTubb3GFP-F1: 5'-GCAGAACTCCCAGCACCACAATTTTCAACCATGNNNNNNNNACAGCCCTCATCTGACATCACAGTCTCAGC-3' and mTubb3GFP-R1: 5'-GTTGCTTCTTTAACTTATGTGACTCCAGACAGTTGTTTCCTATGAAGGCTCCGTTTACGTCGCCGTCCAGCTCGACCAG-3'. The PCR products were then nested using the following primers and the first PCR product as a template: mTubb3GFP-F2: 5'-GCAGAACTCCCAGCACCACAATTTTCAACCATG-3' and mTubb3GFP-R2: 5'-GTTGCTTCTTTAACTTATGTGACTCCAGACAGTTGTTTCCTATGAAGGCT-3'. The PCR products were cloned into pCR-Blunt II-TOPO vector using Zero Blunt TOPO cloning kit (Invitrogen #450245). Amplicons were sequenced using an ABI 3730xl sequencer (Applied Biosystems) to determine the ratio of oaHDR to HITI from the gRNA target sequence. It should be noted that NNNNNNNN in the mTubb3GFP-F1 primer is a barcode sequence to distinguish each origin. To avoid inaccuracies due to PCR bias, PCR products containing the same barcode sequence were counted as one.

[0312] Generation and culture of GFP-corrected HEK293, HeLa and hES cell lines A reporter system based on the mutated GFP gene to evaluate knock-in efficiency in dividing cells and optimize the SATI method in HEK293 cells and hES cells was previously established. A reporter system based on the mutated GFP gene in HeLa cells was established according to a previously used protocol. hES cells were cultured as previously described. HEK293 cells and HeLa cells were cultured using HEK293 medium containing DMEM (Gibco#11995-040), 10% heat-inactivated fetal bovine serum (FBS, Gibco#16000-044), 1x GlutaMAX, 1x MEM non-essential amino acids (Gibco#11140-050) and 1x penicillin streptomycin (Gibco#15140-122).

[0313] Measuring targeted gene knock-in efficiency in GFP-corrected HEK293, HeLa, and hES cell lines To measure the targeted gene knock-in efficiency of HDR, oaHDR and HITI in GFP-corrected HEK293, hES and HeLa cell lines, Lipofectamine 3000 (Invitrogen#L3000008) and FuGENE HD (Promega#E2311) were used for transfection into HEK293 / HeLa-derived cell lines and human ES-derived cell lines, respectively. Transfection complexes were prepared according to the manufacturer's instructions. Cas9 expression plasmid (hCas9 [HEK293 and HeLa cells] or pCAG-1BPNLS-Cas9-1BPNLS [hESC]), gRNA (gRNA1, gRNA2, and / or gRNA3) and donor DNA (tGFP) were used for transfection. HDR efficiency was measured using gRNA1. oaHDR efficiency was measured using co-transfection of gRNA2 and gRNA3. Single transfection of gRNA2 or gRNA3 was used as a control for cutting only genomic DNA and only DNA donor, respectively. For GFP-corrected HEK293 cell lines, Cas9, gRNA and donor plasmids were transfected at a ratio of 1 μg each per reaction at 12-well scale. For GFP-corrected hES cell lines, 0.5 μg Cas9 expression vector, 0.5 μg each gRNA expression plasmid vector and 1 μg donor vector were co-transfected at 6-well scale. For GFP-corrected HeLa cell lines, Cas9, gRNA and donor plasmids were transfected at a ratio of 0.5 μg each per reaction at 12-well scale. To compare HDR and HITI efficiencies in HEK293 and hESC cells, pCAG-1BPNLS-Cas9-1BPNLS, gRNA1 and donor DNA (IRESmCherry-HDR-0c or IRESmCherry-MC) were co-transfected. Promoterless IRESmCherry minicircle DNA (IRESmCherry-MC) was used to measure HITI efficiency. Promoterless IRESmCherry with two homology arm plasmid (IRESmCherry-HDR-0c) was used to measure HDR efficiency.The efficiency of targeted gene knock-in via HDR, oaHDR and HITI was determined by the number of GFP+ or mCherry+ cells by FACS LSR Fortessa (BD) or CytoFLEX S (Beckman coulter) 6 days after transfection. To arrest the G1 phase, 20μM Lovastatin (Sigma#1370600) treatment was performed in HeLa by following previous studies. To investigate the effect of cell cycle specific genome editing, pCAG-1BPNLS-Cas9-1BPNLS, pCAG-1BPNLS-xCas9-1BPNLS, pCAG-1BPNLS-SpCas9NG-1BPNLS, pCAG-1BPNLS-Cas9-Cdt1 and pCAG-1BPNLS-Cas9-Geminin were also transfected into HEK293 or HeLa cells instead of hCas9. The cell cycle was determined by propidium iodide (PI) (Sigma#P4170) staining and FACS analysis according to previous studies.

[0314] Surveyor Assay To investigate the efficacy of the generated gRNA1, gRNA2 and gRNA3, a surveyor assay was performed in HEK293 cells as previously described.

[0315] Establishment and maintenance of progeria mouse embryonic fibroblasts (MEFs) Mouse embryonic fibroblasts (MEFs) were cultured at E12.5 to generate progeroid (Lmna) G609G / G609G) embryos and maintained in standard conditions (37 °C in humidified 5% CO2 / 95% air) in DMEM, 10% heat-inactivated FBS, 1x GlutaMAX, 1x MEM non-essential amino acids, and 1x penicillin-streptomycin. Progeria MEFs (passage 5) were transfected with pCAG-1BPNLS-Cas9-1BPNLS-2AGFP, pCAGmCherry-Lmna-gRNA, MC-Progeria-SATI, and pLKO-shRNA using the Nucleofection P4 Kit (Lonza #V4XP-4024). After 2 days, transfected cells were treated with puromycin (1 μg / mL final, Gibco #A11138-03) to select for cells transfected with shRNA, and after 2 days, MEFs were harvested for genomic DNA extraction using the PicoPure DNA Extraction Kit.

[0316] Stereotaxic AAV injection into the adult brain 8-week-old progeria (Lmna G609G / G609G ) mice, AAV9-nEFCas9 (5.33 × 10 13 genome copies (GC) / mL) and AAV9-Progeria-SATI (2.26 × 10 13AAV injections were performed using a 1:1 mixture of 100 mg / kg ketamine (Putney) and 10 mg / kg xylazine (AnaSed Injection) cocktail via intraperitoneal injection and mounted in a stereotaxic instrument (David Kopf Instruments Model 940 series) for surgery and stereotaxic injection. Virus was injected into the center of V1 using the following coordinates: 3.4 mm rostral, 2.6 mm lateral to bregma and 0.5–0.7 mm ventral from the pia mater. 3 μL of AAV was injected using a 33 Gauge neuros syringe (Hamilton #65460-06). To prevent viral reflux, the injected needle was left in the brain for 5–10 min after completion of the injection. After injection, the skull and skin were closed and the mice were allowed to recover on a 37°C warming pad. Mice were housed for 2 weeks to allow gene knock-in. After 3 weeks, the injection sites were harvested for subsequent experiments and / or genomic DNA was extracted using a Blood & Tissue kit.

[0317] Evaluation of oaHDR / HITI events in progeria mice by Sanger sequencing Genomic DNA was extracted from progeria MEFs, primary neurons, and brain tissues, respectively. To enrich for corrected sequences, the junction of the gene knock-in sequence containing the gRNA target site was first amplified using PrimeSTAR GXL DNA polymerase with the following primers: LMNAex11NGS1-F: 5'-TGCATGCTTCTCCTCAGATTTCCCTGCAACAA-3' and LMNAex11NGS1-R: 5'-GATGAGGGTAAAGCCAAGGCAGCAGGACAAA-3'. The PCR products were then nested using the following primers and the first PCR product as a template: mLMNAex11-F4: 5'-TCCTCAGATTTCCCTGCAACAATGTTCTCTTTCCTTCCTGT-3' and mLMNAex11-R4: 5'-TGTGACACTGGAGGCAGAAGAGCCAGAGGAGA-3'. This PCR product was used to perform digestion with BstXI enzyme (NEB#R0113S), which can only recognize uncorrected mutations, at 37°C. The BstXI digestion product was used to amplify the junction site of the sequence where only the gene containing the gRNA target site was knocked in using the following primers: LMNAenrich2-F: 5'-AACAATGTTCTCTTTCCTTCCTGTCCCC-3' and LMNAenrich2-R: 5'-CAGAAGAGCCAGAGGAGATGGAT-3'. The final PCR product was cloned into pCR-Blunt II-TOPO vector using the Zero Blunt TOPO cloning kit. Amplicons were sequenced using an ABI 3730xl sequencer (Applied Biosystems).

[0318] Intravenous (IV) AAV injection for gene delivery of targeted vectors Newborn (P1)Lmna G609G / G609G (progeria), Lmna + / G609G (Heterozygous Progeria) and Lmna + / + (WT) mice were used for IV AAV9 injection according to previous reports. Briefly, P1 mice were anesthetized and injected with a total of 30 μL of the AAV mixture (AAV9-nEFCas9 (2 × 1011 Genome copies (GC)) and AAV9-Progeria-SATI (2 × 10 11 GC) was injected via the temporal vein using a 30 gauge insulin syringe (Simple Diagnostics #SY139319). After injection, bleeding was stopped by applying pressure using a cotton swab and the mice were allowed to recover on a 37°C warming pad.

[0319] Genotyping of SATI correction in progeria tissue To investigate the SATI-mediated knock-in events by Sanger sequencing, genomic DNA was extracted using the Blood&Tissue kit according to the manufacturer's instructions. The HITI-mediated gene knock-in locus was amplified with PrimeSTAR GXL DNA polymerase using the following HITI-specific primers: mLmnaHITI-F1: 5'-CTGCCTTACCTTCTTCCTGCCCTTCCCTAGCCT-3' and mLmnaHITI-R1: 5'-ATGATGGGGGAAATAGCCAGGAAGCCTTCGAAA-3'. As an internal control, the Fanca gene was amplified with the following primers: mFA-3F: 5'-CGGCCTTCCACCATTGCAGAC-3' and mFA-3R: 5'-CCATGATCTCGCTGACAAGGACTG-3'. To determine the efficiency of indels and gene correction of mutations at the target site, the Lmna intron 10 gRNA target site was amplified using PrimeSTAR GXL DNA polymerase with the following primers: mLmna-F1: 5'-TGCATGCTTCTCCTCAGATTTCCCTGCAACAA-3' and mLmna-R1: 5'-GATGAGGGTAAAGCCAAGGCAGCAGGACAAA-3'. PCR products were cloned into pCR-Blunt II-TOPO vector using the Zero Blunt TOPO cloning kit. Amplicons were sequenced using an ABI 3730xl sequencer (Applied Biosystems). Measuring gene correction frequencies by targeted deep sequencing

[0320] To determine gene correction efficiency, indel efficiency and large deletions, relatively large fragments (1.4 kb) containing the cut site and mutation site on the gRNA from the indicated organs of AAV-infected mice (Progeria (Pro)+ donor, AAV-Progeria-SATI only; Pro+SATI, AAV-Cas9 and AAV-Progeria-SATI) 100 days after injection were amplified using PrimeSTAR GXL DNA polymerase with the following primers: LMNAex11NGS1-F: 5'-TGCATGCTTCTCCTCAGATTTCCCTGCAACAA-3' and LMNAex11NGS1-R: 5'-GATGAGGGTAAAGCCAAGGCAGCAGGACAAA-3'. For library construction, 2 μg of PCR product was treated with dsDNA fragmentase (NEB#M0348) for 18 min, purified by AxyPrep Mag FragmentSelect Kits (Axygen#14-223-160), and then prepared according to the instructions for BGISeq Whole Genome Sequencing library preparation. Sequencing was performed on a BGISeq-500 platform using a paired-end 100 (PE100) strategy. Raw data were filtered by SOAPnuke v1.5.6 using the following criteria: N rate threshold 0.05, low quality threshold 20, low quality rate 0.2. Ten million clear reads of each sample were mapped to accommodate the mouse reference sequence (GRCm38.p6) using BWA v 0.7.15 with standard settings. For editing status, alignment results were counted for base composition of the target site c.1827C>T within exon 11. All insertions and deletions around the gRNA cut site were counted. Sequencing data was also analyzed by split-read method to detect large deletions. Briefly, reads were split into pairwise ends (split-reads) of minimum length 30 bp per base, and these pairwise ends were aligned to the reference using Bowtie2 v2.2.5 with parameter -k 100. When pairwise ends from the same read are individually mapped back to the PCR region sequence, the distance of the two mapped regions is calculated and called a deletion.Pairwise end analysis was performed on all samples, but no large deletions (>42 bp) were found.

[0321] Measurement of off-target mutations by targeted deep sequencing and the ratio of oaHDR to HITI In AAV-infected mice (Pro+ donor, AAV-Progeria-SATI only; Pro+SATI, AAV-Cas9 and AAV-Progeria-SATI), 100 days after injection, on-target sites from the indicated organs were amplified using PrimeSTAR GXL DNA polymerase. To determine off-target effects, the top 10 predicted off-target sites were also amplified using PrimeSTAR GXL DNA polymerase. PCR amplicons were then purified using Agencourt AMPure XP (Beckman coulter #A63380) and second-round PCR to attach Illumina P5 adapters and sample-specific barcodes. Purified PCR products were pooled in equal ratios for single- and / or paired-end sequencing using Illumina MiSeq at the Zhang laboratory (UCSD). High-quality reads (score >23) were analyzed for insertion and deletion (indel) events, and maximum likelihood estimates (MLEs) were calculated similar to methods previously described. Briefly, for off-target site analysis, raw reads with an average Phred quality score of 23 were locally aligned to their respective on-target or off-target sites. All reads were required to match 85% of the genomic reference region and span the entire 20 base pair target region along with 5 base pair flanking regions in both directions. Such 30 base pair regions were then analyzed for indels and the final indel rate was calculated using a maximum likelihood estimate method similar to the previously described method to correct for background errors. A similar approach was used to analyze on-target sites. High quality reads were analyzed for insertions and deletions within the gRNA target ±5 base pairs by matching the 10 base pair flanking region around the predicted insertions and deletions. Correction efficiency was determined using a similar exact matching approach to determine the identity of SNPs in reads containing indel events within the predicted target region. The above CRISPR-Cas9 targeting efficiency and activity are underestimated because next generation sequencing analysis of indels cannot detect large size deletion and insertion events.To distinguish between oaHDR and HITI events, the sequence of the gRNA target and the mutation site were examined in the same reads, and the reads were separated into six categories based on the sequence features of the gRNA target and the linkage of the gRNA target and the mutation site (i.e., no mutation, indels, oaHDR correction with indels, oaHDR correction without indels, HITI correction with indels, HITI correction without indels, and correction due to undetermined events).

[0322] Data availability for targeted deep sequencing Raw Illumina sequencing reads for this study have been deposited in the National Center for Biotechnology Information Short Read Archive and are available through SRA accession number SRP126448. BGISeq-500 sequencing reads for this study have been deposited in the CNGB Nucleotide Sequence Archive at CNGBdb (https: / / db.cngb.org / cnsa / ) under accession code CNP0000221.

[0323] Genome-wide off-target analysis based on 5'-rapid amplification of cDNA ends (RACE) SMARTer RACE 5' / 3' Kit (Takara Bio USA, Inc. #634858) was used according to the manufacturer's instructions to perform 5'-rapid amplification of cDNA ends (RACE). 1 μg of total RNA was used for this reaction. The Lmna exon 11 specific primers used in this experiment were 5'-GATTACGCCAAGCTTCCCACACTGCGGAAGCTTCGAGT-3' for the first PCR and 5'-GATTACGCCAAGCTTACACTGGAGGCAGAAGAGCCAGAGGAGATGGA-3' for the nested PCR. PCR products were cloned into In-Fusion HD Cloning Kit. RACE fragments were sequenced using an ABI 3730xl sequencer (Eton Bioscience, Inc.). The captured exons located upstream of Lmna exon 11 were mapped to the UCSC Mouse Genome Browser (NCBI37 / mm9) (https: / / genome.ucsc.edu / cgi-bin / hgGateway?db=mm9). The chromatin and expression status of the mapped Alb and Myh6 loci were analyzed using H3K27ac ChIPSeq and RNASeq from Encode / LICR and DNase I hypersensitive sites (DHS) from Encode / University of Washington. These data were obtained from liver or heart tissues of adult 8-week-old mice.

[0324] RNA analysis Total RNA was extracted using the RNeasy Protect Mini Kit (QIAGEN#74124) or RNeasy Fibrous Tissue Mini Kit (QIAGEN#74704) according to the manufacturer's instructions, followed by cDNA synthesis using Maxima H Minus cDNA Synthesis Master Mix (Thermo Fisher Scientific#M1681). TaqMan or SYBR green gene expression assays were performed using a CFX384 Real-Time System C1000 Touch Thermal Cycler (Bio-Rad). The TaqMan probes (Thermo Fisher Scientific) used in this experiment were Gapdh [Mm99999915_g1], lamin A [forward primer: 5'-GTGGCAGCTTCGGGGACAAC-3', reverse primer: 5'-AGCAGACAGGAGGTGGCATGTG-3' and probe: 5'-CCCAGGAGGTAGGAGCGGGTGACT-3'], lamin C [forward primer: 5'-GCCTTCGCACCGCTCTCATCAAC-3', reverse primer: 5'-ATGGAGGTGGGAGAGCTGCCCTAG-3' and probe: 5'-CACCAGCTTGCGCATGGCCACTTCT-3'] and progerin [forward primer: 5'-TGAGTACAACCTGCGCTCAC-3', reverse primer: 5'-TGGCAGGTCCCAGATTACAT-3' and probe: 5'-CGGGAGCCCAGAGCTCCCAGAA-3']. For Alb gene expression analysis, we used SsoAdvanced SYBR Green Super mix (Bio-Rad #1725274) with the following primers [forward primer: 5'-CTGTCTGCAATCCTGAACCGTGTG-3' and reverse primer: 5'-AAGCATGGCCGCCTTTCC-3']. The RT-qPCR dataset was first normalized by the housekeeping gene GAPDH, and then the ratios of Lamin A / Lamin C and Progerin / Lamin A were obtained.The same Lmna gene transcripts were compared because the endogenous expression level of the Lmna gene itself is affected by physiological aging. With SATI treatment, the normalized Lamin A / Lamin C ratio should be higher after the mutant exon is replaced by the wild-type exon without affecting the endogenous short form Lamin C transcript. Similarly, the normalized Progerin / Lamin A ratio should be lower after the mutant exon is replaced by the wild-type exon.

[0325] Histological analysis of mouse tissues For hematoxylin and eosin (H&E) staining, mice were harvested after transcardial perfusion with phosphate-buffered saline (PBS(-)) followed by 4% paraformaldehyde (PFA, Sigma#P6148). Then, each organ was dissected, post-fixed with 4% PFA at 4°C, and embedded in paraffin. Paraffin sections were used for H&E staining with standard protocols.

[0326] Heart Rate Analysis To analyze heart rate, mice were anesthetized with 2.5% isoflurane (HENRY SCHEIN #NDC11695-6776-1) and heart rate was monitored using a Power Lab data acquisition instrument with Chat5 for Windows (AD Instruments). Data were processed and analyzed using LabChart 8 (AD Instruments).

[0327] Intramuscular (IM) AAV injection 10-week-old progeria (Lmna G609G / G609G ) Mice were anesthetized using an intraperitoneal injection of ketamine (100 mg / kg) and xylazine (10 mg / kg). A small portion of the anterior quadriceps muscle of the hind limb was surgically exposed. AAV mixture (Pro-Cas9, AAV-Progeria-SATI (1.5 × 10 10 GC) only; Pro+Cas9, AAV-Cas9 (1.5 × 10 10 GC) and AAV-progeria-SATI (1.5 × 10 10GC) was injected into the tibialis anterior (TA) muscle using a 29-gauge insulin syringe. As a control, the same volume of PBS was injected into wild-type B6 TA muscles. After injection, the skin was closed and the mice were allowed to recover on a 37°C warming pad. After 3 weeks, the injection sites were harvested for histological analysis.

[0328] muscle fiber analysis Three weeks after TA muscle injection, mice were euthanized and TA muscles were dissected and processed for histological analysis. Myofiber area was manually analyzed using NIH ImageJ (FIJI) software and processed by Microsoft Excel. 300 myofibers were measured for each muscle.

[0329] Establishment and maintenance of tail tip fibroblasts (TTFs) TTF Lmna + / + (WT), Lmna G609G / G609G (Progeria), and Lmna treated with AAV-Progeria-SATI G609G / G609G TTFs were isolated from (progeria+SATI) mice at day 70 and established as previously described. TTFs were maintained at 37°C in DMEM, 10% heat-inactivated FBS, 1x GlutaMAX, 1x MEM non-essential amino acids, and 1x penicillin-streptomycin.

[0330] Western blot analysis of TTFs Western blotting was performed as previously described. Briefly, protein samples were harvested from confluent TTFs using RIPA buffer. Protein concentration was measured by Bradford Reagent (Sigma#B6916-500ML). A total of 10 μg of protein was loaded onto a 4%-12% Bis-Tris Gel (Invitrogen#NP0321BOX). The transferred PVDF membrane (EMD Millipore#IPVH00010) was blocked with 3% nonfat milk (RPI#M17200) and incubated overnight at 4°C with the primary antibody anti-lamin A / C [1:1,000] (E-1, Santa Cruz#sc-376248). HRP-anti-mouse IgG antibody [1:4,000] (Cell signaling#7076S) was used as the secondary antibody. Blots were incubated at room temperature for 1 hour and developed with ECL (GE healthcare #RPN2232). Anti-actin antibody [1:4000] (Santa Cruz #sc-47778) and HRP-anti-mouse IgG secondary antibody [1:4,000] (Cell signaling #7076S) were used as internal controls.

[0331] Immunocytochemistry of TTFs TTF (passage 5) 1 x 10 4The cells were seeded on cover slips (Fisherbrand #12-545-82 12CIR-1D) in 12-well plates. After 2 days of incubation, the cover slips were washed twice with PBS(-), fixed with 4% paraformaldehyde (PFA) for 30 min at room temperature, then treated with blocking buffer (0.2% TritonX-100 in PBS(-), pH 7.4) for 1 h at room temperature, and then incubated with primary antibody diluted in PBS(-) at 4°C overnight. The primary antibody used in this study was [1:150] anti-lamin A / C (E-1, Santa Cruz #sc-376248). Sections were washed three times in PBS(-) and treated with secondary antibodies conjugated with [1:500] Alexa Fluor 488 goat anti-mouse (Life technologies#11001) and [1:2,000] Hoechst 33342 (Thermo Fisher#H3570) for 30 min at room temperature. After three sequential washes with PBS(-), sections were mounted with ProLong Diamond Antifade Mountant (Invitrogen#P36970).

[0332] Acquisition and processing of TTF and tissue images Representative photographs of H&E staining of each tissue were acquired with an Olympus IX51. Representative photographs of immunocytochemistry samples of TTF were acquired with a confocal microscope using a Zeiss LSM 710 Laser Scanning Confocal Microscope. At least five photographs were obtained from each sample. For quantification, the exact n value is noted in each figure. Images were processed by ZEN2 Black edition software (Zeiss), and NIH ImageJ (FIJI) software according to the experimental requirements. Western blotting bands were analyzed by NIH ImageJ (FIJI) software.

[0333] statistical analysis Statistical significance based on mean (average), standard deviation (sd), standard error of the mean (sem) and unpaired Student's t-test on absolute values ​​using Microsoft Excel or GraphPad Prism version 7.03 for Windows (GraphPad Software, www.graphpad.com). One-way ANOVA followed by Bonferroni's multiple comparison test, Tukey's multiple comparison test and log-rank (Mantel-Cox) test were performed using GraphPad Prism version 7.03 for Windows.

[0334] While preferred embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments described herein can be used. It is intended that the following claims define the scope of the invention, and that methods and structures within the scope of these claims and their equivalents are covered thereby. In certain embodiments, for example, the following items are provided: (Item 1) 1. A method for editing a target genome in a cell, comprising contacting the cell with: (i) a single homology arm construct comprising a replacement sequence and a targeting endonuclease cleavage site; and (ii) a targeting endonuclease, wherein the replacement sequence comprises at least one nucleotide difference compared to the target genome, and the target genome comprises a sequence homologous to the targeting endonuclease cleavage site. (Item 2) 2. The method of claim 1, wherein the single homology arm construct replaces at least a portion of the target genome. (Item 3) The method of claim 1 or 2, wherein the targeting endonuclease is selected from a CRISPR nuclease, a TALEN nuclease, a DNA-guided nuclease, a meganuclease, and a zinc finger nuclease. (Item 4) 4. The method of claim 3, wherein the CRISPR nuclease is selected from the group consisting of Cas9, Cas12a (Cpf1), Cas12b (c2c1), Cas12c (c2c3), Cas12g, Cas12i, Cas14, Cas10, Cas3, CasX, CasY, Csf1, Cas13a (c2c2), Cas13b (c2c6), Cas13c (c2c7), c2c4, c2c5, c2c8, c2c9, c2c10, Cas10, CAST, and Tn6677. (Item 5) The method of claim 3 or claim 4, further comprising contacting the cell with a guide oligonucleotide. (Item 6) 6. The method of claim 5, wherein the guide oligonucleotide is a guide RNA. (Item 7) 7. The method of any one of items 1 to 6, wherein the replacement sequence comprises a single nucleotide difference compared to the target genome. (Item 8) 8. The method of claim 7, wherein the single base difference is selected from one of a substitution, an insertion, and a deletion. (Item 9) 9. The method of any one of items 1 to 8, wherein the replacement sequence comprises a substitution, insertion, inversion, translocation, duplication, or deletion compared to the target genome. (Item 10) 10. The method of any one of items 1 to 9, wherein the replacement sequence comprises at least a portion of an intron and at least a portion of an exon. (Item 11) 11. The method of any one of items 1 to 10, wherein the replacement sequence comprises all introns and exons of the gene downstream of the mutation in the gene of the target genome. (Item 12) 12. The method of any one of items 1 to 11, wherein the cell is selected from one or more of stem cells, neurons, skeletal muscle cells, smooth muscle cells, cardiomyocytes, pancreatic beta cells, lymphocytes, monocytes, neutrophils, T cells, B cells, NK cells, mast cells, plasma cells, eosinophils, basophils, endothelial cells, epithelial cells, hepatocytes, bone cells, platelets, adipocytes, retinal cells, barrier cells, hormone secreting cells, glial cells, hepatic adipocytes, secretory cells, urinary cells, extracellular matrix cells, nurse cells, stromal cells, spermatocytes, and oocytes. (Item 13) 13. The method of any one of items 1 to 12, wherein the single homology arm construct, the guide oligonucleotide, and the targeting endonuclease are encoded within a construct. (Item 14) 14. The method of claim 13, wherein the construct is a viral construct. (Item 15) 15. The method of claim 14, wherein the viral construct is an adeno-associated virus, an adenovirus, a lentivirus, or a retrovirus. (Item 16) 14. The method of claim 13, wherein the construct is a non-viral construct. (Item 17) 17. The method of claim 16, wherein the non-viral construct is a minicircle or a plasmid. (Item 18) 18. The method of any one of items 1 to 17, wherein the cell is contacted in vivo. (Item 19) 18. The method of any one of items 1 to 17, wherein the cell is contacted in vitro. (Item 20) 20. The method of any one of items 1 to 19, wherein the cell is derived from a subject. (Item 21) 21. The method of claim 20, wherein the subject is a human, a non-human primate, a dog, a cat, a horse, a cow, a sheep, a pig, a rabbit, a rat, or a mouse. (Item 22) 22. The method of claim 20 or 21, wherein the subject has a mutation in a gene that is homologous to the replacement sequence. (Item 23) 1. A method for treating a genetic disease in a subject having a mutation in a gene, comprising contacting a cell from the subject with: (i) a single homology arm construct comprising a replacement sequence and a targeting endonuclease cleavage site; and (ii) a targeting endonuclease, wherein the replacement sequence comprises a wild-type sequence of the gene, and the gene comprises a sequence homologous to the targeting endonuclease cleavage site. (Item 24) 24. The method of claim 23, wherein the single homology arm construct replaces at least a portion of the gene. (Item 25) 25. The method of claim 23 or 24, wherein the targeting endonuclease is selected from a CRISPR nuclease, a TALEN nuclease, a DNA-guided nuclease, a meganuclease, and a zinc finger nuclease. (Item 26) 26. The method of claim 25, wherein the CRISPR nuclease is selected from the group consisting of Cas9, Cas12a (Cpf1), Cas12b (c2c1), Cas12c (c2c3), Cas12g, Cas12i, Cas14, Cas10, Cas3, CasX, CasY, Csf1, Cas13a (c2c2), Cas13b (c2c6), Cas13c (c2c7), c2c4, c2c5, c2c8, c2c9, c2c10, Cas10, CAST, and Tn6677. (Item 27) 27. The method of claim 25 or 26, further comprising contacting the cell with a guide oligonucleotide. (Item 28) 28. The method of claim 27, wherein the guide oligonucleotide is a guide RNA. (Item 29) 29. The method of any one of items 23 to 28, wherein the mutation comprises a single nucleotide difference compared to the target genome. (Item 30) 30. The method of claim 29, wherein the single nucleotide difference is selected from one of a substitution, an insertion, and a deletion. (Item 31) 31. The method of any one of items 23 to 30, wherein the mutation comprises a substitution, insertion, inversion, translocation, duplication, or deletion compared to the target genome. (Item 32) 32. The method of any one of items 23 to 31, wherein the replacement sequence comprises at least a portion of an intron and at least a portion of an exon. (Item 33) 33. The method of any one of items 23 to 32, wherein the replacement sequence comprises all introns and exons of the gene downstream of the mutation in the gene of the target genome. (Item 34) 34. The method of any one of items 23 to 33, wherein the cell is selected from one or more of stem cells, neurons, skeletal muscle cells, smooth muscle cells, cardiomyocytes, pancreatic beta cells, lymphocytes, monocytes, neutrophils, T cells, B cells, NK cells, mast cells, plasma cells, eosinophils, basophils, endothelial cells, epithelial cells, hepatocytes, bone cells, platelets, adipocytes, retinal cells, barrier cells, hormone secreting cells, glial cells, hepatic adipocytes, secretory cells, urinary cells, extracellular matrix cells, nurse cells, interstitial cells, spermatocytes, and oocytes. (Item 35) 35. The method of any one of items 23 to 34, wherein the single homology arm construct, the guide oligonucleotide, and the targeting endonuclease are encoded within a construct. (Item 36) 36. The method of claim 35, wherein the construct is a viral construct. (Item 37) 37. The method of claim 36, wherein the viral construct is an adeno-associated virus, an adenovirus, a lentivirus, or a retrovirus. (Item 38) 36. The method of claim 35, wherein the construct is a non-viral construct. (Item 39) 39. The method of claim 38, wherein the non-viral construct is a minicircle or a plasmid. (Item 40) 40. The method of any one of items 23 to 39, wherein the cell is contacted in vivo. (Item 41) 41. The method of any one of items 23 to 40, wherein the cell is contacted in vitro. (Item 42) 42. The method of any one of items 23 to 41, wherein the cell is a non-dividing cell. (Item 43) 43. The method of claim 42, wherein the subject is a human, a non-human primate, a dog, a cat, a horse, a cow, a sheep, a pig, a rabbit, a rat, or a mouse. (Item 44) The genetic disease is achondroplasia, alpha 1 antitrypsin deficiency, Alzheimer's disease, antiphospholipid syndrome, autism, autosomal dominant polycystic kidney disease, breast cancer, cancer, Charcot-Marie-Tooth, colon cancer, cri-a-cat syndrome, Crohn's disease, cystic fibrosis, Dercum's disease, Down's syndrome, Duane's syndrome, Duchenne muscular dystrophy, factor V Leiden thrombophilia, familial hypercholesterolemia, familial Mediterranean fever, fragile X syndrome, Gaucher's disease, hemochromatosis, hemophilia, holoprosencephaly, Huntington's disease, Klinefelter's syndrome, 44. The method of any one of items 23 to 43, wherein the disease is selected from the group consisting of rheumatoid arthritis, ... (Item 45) 1. A composition for use in treating a genetic disease, comprising: (i) a single homology arm construct comprising a replacement sequence and a targeting endonuclease cleavage site; and (ii) a targeting endonuclease, wherein the replacement sequence comprises at least one nucleotide difference compared to a target genome, and the target genome comprises a sequence homologous to the targeting endonuclease cleavage site. (Item 46) 46. ​​The composition of claim 45, wherein the single homology arm construct replaces at least a portion of the gene. (Item 47) 47. The composition of claim 45 or 46, wherein the targeting endonuclease is selected from a CRISPR nuclease, a TALEN nuclease, a DNA-guided nuclease, a meganuclease, and a zinc finger nuclease. (Item 48) 48. The composition of claim 47, wherein the CRISPR nuclease is selected from the group consisting of Cas9, Cas12a (Cpf1), Cas12b (c2c1), Cas12c (c2c3), Cas12g, Cas12i, Cas14, Cas10, Cas3, CasX, CasY, Csf1, Cas13a (c2c2), Cas13b (c2c6), Cas13c (c2c7), c2c4, c2c5, c2c8, c2c9, c2c10, Cas10, CAST, and Tn6677. (Item 49) 49. The composition of claim 47 or 48, further comprising contacting the cell with a guide oligonucleotide. (Item 50) 50. The composition of claim 49, wherein the guide oligonucleotide is a guide RNA. (Item 51) 51. The composition of any one of items 45 to 50, wherein the genetic disease is caused by a mutation comprising a single nucleotide difference compared to the target genome. (Item 52) 52. The composition of claim 51, wherein the single nucleotide difference is selected from one of a substitution, an insertion, and a deletion. (Item 53) 53. The composition of any one of items 45 to 52, wherein the genetic disease is caused by a mutation including a substitution, insertion, inversion, translocation, duplication, or deletion. (Item 54) 54. The composition of any one of items 45 to 53, wherein the replacement sequence comprises at least a portion of an intron and at least a portion of an exon. (Item 55) 55. The composition of any one of items 45 to 54, wherein the replacement sequence comprises all introns and exons of the gene downstream of the mutation in the gene of the target genome. (Item 56) 56. The composition of any one of items 45 to 55, which targets cells selected from one or more of stem cells, neurons, skeletal muscle cells, smooth muscle cells, cardiomyocytes, pancreatic beta cells, lymphocytes, monocytes, neutrophils, T cells, B cells, NK cells, mast cells, plasma cells, eosinophils, basophils, endothelial cells, epithelial cells, hepatocytes, bone cells, platelets, adipocytes, retinal cells, barrier cells, hormone secreting cells, glial cells, hepatic adipocytes, secretory cells, urinary cells, extracellular matrix cells, nurse cells, stromal cells, spermatocytes, and oocytes. (Item 57) 57. The composition of any one of items 45 to 56, wherein the single homology arm construct, the guide oligonucleotide, and the targeting endonuclease are encoded within a construct. (Item 58) 58. The composition of claim 57, wherein the construct is a viral construct. (Item 59) 59. The composition of claim 58, wherein the viral construct is an adeno-associated virus, an adenovirus, a lentivirus, or a retrovirus. (Item 60) 58. The composition of claim 57, wherein the construct is a non-viral construct. (Item 61) 61. The composition of item 60, wherein the non-viral construct is a minicircle or a plasmid. (Item 62) The genetic disease is achondroplasia, alpha 1 antitrypsin deficiency, Alzheimer's disease, antiphospholipid syndrome, autism, autosomal dominant polycystic kidney disease, breast cancer, cancer, Charcot-Marie-Tooth, colon cancer, cri-a-cat syndrome, Crohn's disease, cystic fibrosis, Dercum's disease, Down's syndrome, Duane's syndrome, Duchenne muscular dystrophy, factor V Leiden thrombophilia, familial hypercholesterolemia, familial Mediterranean fever, fragile X syndrome, Gaucher's disease, hemochromatosis, hemophilia, holoprosencephaly, Huntington's disease, Klinefelter's syndrome 62. The composition of any one of items 45 to 61, wherein the disease is selected from: Leber congenital amaurosis, Marfan syndrome, myotonic dystrophy, neurofibromatosis, Noonan syndrome, osteogenesis imperfecta, Parkinson's disease, phenylketonuria, Poland anomaly, porphyria, progeria, prostate cancer, retinitis pigmentosa, severe combined immunodeficiency (SCID), sickle cell disease, skin cancer, spinal muscular atrophy, Stargardt disease, Tay-Sachs, thalassemia, trimethylaminuria, Turner syndrome, palatocardiofacial syndrome, WAGR syndrome, and Wilson's disease. (Item 63) A composition comprising: (i) a single homology arm construct comprising a replacement sequence and a targeting endonuclease cleavage site; and (ii) a targeting endonuclease, wherein the replacement sequence comprises at least one nucleotide difference compared to a target genome, and the target genome comprises a sequence homologous to the targeting endonuclease cleavage site. (Item 64) 64. The composition of claim 63, comprising cells. (Item 65) 65. The composition of claim 63 or 64, wherein the single homology arm construct, guide oligonucleotide, and targeting endonuclease are encoded within a construct. (Item 66) 66. The composition of claim 65, wherein the construct is a viral construct. (Item 67) 67. The composition of claim 66, wherein the viral construct is an adeno-associated virus, an adenovirus, a lentivirus, or a retrovirus. (Item 68) 66. The composition of claim 65, wherein the construct is a non-viral construct. (Item 69) 70. The composition of claim 68, wherein the non-viral construct is a minicircle or a plasmid. (Item 70) 70. The composition of any one of items 63 to 69, further comprising a pharma- ceutically acceptable buffer or excipient. (Item 71) 71. The composition of any one of items 63 to 70, wherein the targeting endonuclease is selected from a CRISPR nuclease, a TALEN nuclease, a DNA-guided nuclease, a meganuclease, and a zinc finger nuclease. (Item 72) 72. The composition of claim 71, wherein the CRISPR nuclease is selected from the group consisting of Cas9, Cas12a (Cpf1), Cas12b (c2c1), Cas12c (c2c3), Cas12g, Cas12i, Cas14, Cas10, Cas3, CasX, CasY, Csf1, Cas13a (c2c2), Cas13b (c2c6), Cas13c (c2c7), c2c4, c2c5, c2c8, c2c9, c2c10, Cas10, CAST, and Tn6677. (Item 73) 73. The composition of claim 72, further comprising a guide oligonucleotide. (Item 74) A kit comprising the composition according to any one of items 63 to 73 and instructions for use. (Item 75) A nucleic acid molecule comprising a single homology arm construct comprising a replacement sequence and a targeting endonuclease cleavage site, wherein the replacement sequence comprises at least one nucleotide difference compared to a target genome. (Item 76) 76. The nucleic acid molecule of item 75, further comprising a sequence encoding a guide oligonucleotide. (Item 77) 77. The nucleic acid molecule of claim 75 or 76, further comprising a sequence encoding a targeting endonuclease. (Item 78) 80. The nucleic acid molecule of any one of items 75 to 77, which is a viral construct. (Item 79) 79. The nucleic acid molecule of claim 78, wherein the viral construct is an adeno-associated virus, an adenovirus, a lentivirus, or a retrovirus. (Item 80) 80. The nucleic acid molecule of any one of items 74 to 77, which is a non-viral construct. (Item 81) 81. The nucleic acid molecule of item 80, wherein the non-viral construct is a minicircle or a plasmid. (Item 82) A kit comprising the nucleic acid molecule of any one of items 75 to 81 and instructions for use. (Item 83) 1. A homology-directed repair method for editing a target genome in a cell, comprising contacting the cell with (i) a single homology arm construct comprising a replacement sequence and a targeting endonuclease cleavage site; and (ii) a targeting endonuclease, wherein the replacement sequence comprises at least one nucleotide difference compared to the target genome, and the target genome comprises a sequence homologous to the targeting endonuclease cleavage site, and wherein the replacement sequence is integrated into the target genome using a homology-directed repair protein. (Item 84) 84. The method of claim 83, wherein the single homology arm construct replaces at least a portion of the target genome. (Item 85) 85. The method of claim 83 or 84, wherein the targeting endonuclease is selected from a CRISPR nuclease, a TALEN nuclease, a DNA-guided nuclease, a meganuclease, and a zinc finger nuclease. (Item 86) 86. The method of claim 85, wherein the CRISPR nuclease is selected from the group consisting of Cas9, Cas12a (Cpf1), Cas12b (c2c1), Cas12c (c2c3), Cas12g, Cas12i, Cas14, Cas10, Cas3, CasX, CasY, Csf1, Cas13a (c2c2), Cas13b (c2c6), Cas13c (c2c7), c2c4, c2c5, c2c8, c2c9, c2c10, Cas10, CAST, and Tn6677. (Item 87) 87. The method of claim 85 or 86, further comprising contacting the cell with a guide oligonucleotide. (Item 88) 88. The method of claim 87, wherein the guide oligonucleotide is a guide RNA. (Item 89) 89. The method of any one of items 83 to 88, wherein the replacement sequence contains a single nucleotide difference compared to the target genome. (Item 90) 90. The method of claim 89, wherein the single base difference is selected from one of a substitution, an insertion, and a deletion. (Item 91) 91. The method of any one of items 83 to 90, wherein the replacement sequence comprises an insertion, inversion, translocation, duplication, or deletion compared to the target genome. (Item 92) 92. The method of any one of items 83 to 91, wherein the replacement sequence comprises at least a portion of an intron and at least a portion of an exon. (Item 93) 93. The method of any one of items 83 to 92, wherein the replacement sequence comprises all introns and exons of the gene downstream of the mutation in the gene of the target genome. (Item 94) 94. The method of any one of items 83 to 93, wherein the cell is selected from one or more of a stem cell, a neuron, a skeletal muscle cell, a smooth muscle cell, a cardiomyocyte, a pancreatic beta cell, a lymphocyte, a monocyte, a neutrophil, a T cell, a B cell, a NK cell, a mast cell, a plasma cell, an eosinophil, a basophil, an endothelial cell, an epithelial cell, a hepatocyte, a bone cell, a platelet, an adipocyte, a retinal cell, a barrier cell, a hormone secreting cell, a glial cell, a hepatic adipocyte, a secretory cell, a urinary cell, an extracellular matrix cell, a nurse cell, an interstitial cell, a spermatocyte, and an oocyte. (Item 95) 95. The method of any one of items 83 to 94, wherein the single homology arm construct, the guide oligonucleotide, and the targeting endonuclease are encoded within a construct. (Item 96) 96. The method of claim 95, wherein the construct is a viral construct. (Item 97) 97. The method of claim 96, wherein the viral construct is an adeno-associated virus, an adenovirus, a lentivirus, or a retrovirus. (Item 98) 96. The method of claim 95, wherein the construct is a non-viral construct. (Item 99) 99. The method of claim 98, wherein the non-viral construct is a minicircle or a plasmid. (Item 100) 99. The method of any one of items 83 to 99, wherein the cell is contacted in vivo. (Item 101) 101. The method of any one of items 83 to 100, wherein the cell is contacted in vitro. (Item 102) 102. The method of any one of items 83 to 101, wherein the cell is derived from a subject. (Item 103) 103. The method of claim 102, wherein the subject is a human, dog, cat, horse, cow, sheep, pig, rabbit, rat, or mouse. (Item 104) The method of claim 102 or 103, wherein the subject has a mutation in a gene homologous to the replacement sequence. (Item 105) 1. A composition for use in treating a genetic disease, comprising: (i) a single homology arm construct configured for homology directed repair, the single homology arm construct comprising a replacement sequence and a targeted endonuclease cleavage site; and (ii) a targeting endonuclease, wherein the replacement sequence comprises at least one nucleotide difference compared to a target genome, and the target genome comprises a sequence homologous to the targeted endonuclease cleavage site. (Item 106) 46. ​​The composition of claim 45, wherein the single homology arm construct uses homology directed repair to replace at least a portion of the gene. (Item 107) 47. The composition of claim 45 or 46, wherein the targeting endonuclease is selected from a CRISPR nuclease, a TALEN nuclease, a DNA-guided nuclease, a meganuclease, and a zinc finger nuclease. (Item 108) 48. The composition of claim 47, wherein the CRISPR nuclease is selected from the group consisting of Cas9, Cas12a (Cpf1), Cas12b (c2c1), Cas12c (c2c3), Cas12g, Cas12i, Cas14, Cas10, Cas3, CasX, CasY, Csf1, Cas13a (c2c2), Cas13b (c2c6), Cas13c (c2c7), c2c4, c2c5, c2c8, c2c9, c2c10, Cas10, CAST, and Tn6677. (Item 109) 49. The composition of claim 47 or 48, further comprising contacting the cell with a guide oligonucleotide. (Item 110) 50. The composition of claim 49, wherein the guide oligonucleotide is a guide RNA. (Item 111) 51. The composition of any one of items 45 to 50, wherein the genetic disease is caused by a mutation comprising a single nucleotide difference compared to the target genome. (Item 112) 52. The composition of claim 51, wherein the single nucleotide difference is selected from one of a substitution, an insertion, and a deletion. (Item 113) 53. The composition of any one of items 45 to 52, wherein the genetic disease is caused by a mutation including an insertion, inversion, translocation, duplication, or deletion. (Item 114) 54. The composition of any one of items 45 to 53, wherein the replacement sequence comprises at least a portion of an intron and at least a portion of an exon. (Item 115) 55. The composition of any one of items 45 to 54, wherein the replacement sequence comprises all introns and exons of the gene downstream of the mutation in the gene of the target genome. (Item 116) 56. The composition of any one of items 45 to 55, which targets cells selected from one or more of stem cells, neurons, skeletal muscle cells, smooth muscle cells, cardiomyocytes, pancreatic beta cells, lymphocytes, monocytes, neutrophils, T cells, B cells, NK cells, mast cells, plasma cells, eosinophils, basophils, endothelial cells, epithelial cells, hepatocytes, bone cells, platelets, adipocytes, retinal cells, barrier cells, hormone secreting cells, glial cells, hepatic adipocytes, secretory cells, urinary cells, extracellular matrix cells, nurse cells, stromal cells, spermatocytes, and oocytes. (Item 117) 57. The composition of any one of items 45 to 56, wherein the single homology arm construct, the guide oligonucleotide, and the targeting endonuclease are encoded within a construct. (Item 118) 58. The composition of claim 57, wherein the construct is a viral construct. (Item 119) 59. The composition of claim 58, wherein the viral construct is an adeno-associated virus, an adenovirus, a lentivirus, or a retrovirus. (Item 120) 58. The composition of claim 57, wherein the construct is a non-viral construct. (Item 121) 61. The composition of item 60, wherein the non-viral construct is a minicircle or a plasmid. (Item 122) The genetic disease is achondroplasia, alpha 1 antitrypsin deficiency, Alzheimer's disease, antiphospholipid syndrome, autism, autosomal dominant polycystic kidney disease, breast cancer, cancer, Charcot-Marie-Tooth, colon cancer, cri-a-cat syndrome, Crohn's disease, cystic fibrosis, Dercum's disease, Down's syndrome, Duane's syndrome, Duchenne muscular dystrophy, factor V Leiden thrombophilia, familial hypercholesterolemia, familial Mediterranean fever, fragile X syndrome, Gaucher's disease, hemochromatosis, hemophilia, holoprosencephaly, Huntington's disease, Klinefelter's syndrome 62. The composition of any one of items 45 to 61, wherein the disease is selected from: Leber congenital amaurosis, Marfan syndrome, myotonic dystrophy, neurofibromatosis, Noonan syndrome, osteogenesis imperfecta, Parkinson's disease, phenylketonuria, Poland anomaly, porphyria, progeria, prostate cancer, retinitis pigmentosa, severe combined immunodeficiency (SCID), sickle cell disease, skin cancer, spinal muscular atrophy, Stargardt disease, Tay-Sachs, thalassemia, trimethylaminuria, Turner syndrome, palatocardiofacial syndrome, WAGR syndrome, and Wilson's disease. (Item 123) 1. A method for editing a Lamin A gene in a cell, comprising contacting the cell with (i) a single homology arm construct comprising a Lamin A replacement sequence and a targeting endonuclease cleavage site; and (ii) a targeting endonuclease, wherein the replacement sequence comprises a nucleic acid sequence that is at least 90% homologous to a sequence provided in Table 2. (Item 124) 1. A method of treating progeria in a subject having a mutation in the Lamin A gene, comprising contacting a cell from the subject with (i) a single homology arm construct comprising a replacement sequence and a targeting endonuclease cleavage site; and (ii) a targeting endonuclease, wherein the replacement sequence comprises a nucleic acid sequence that is at least 90% homologous to a sequence presented in Table 2. (Item 125) 1. A composition for use in treating a genetic disease, comprising: (i) a single homology arm construct comprising a replacement sequence and a targeting endonuclease cleavage site; and (ii) a targeting endonuclease, wherein the replacement sequence comprises a nucleic acid sequence that is at least 90% homologous to a sequence presented in Table 2. (Item 126) A composition comprising: (i) a single homology arm construct comprising a replacement sequence and a targeting endonuclease cleavage site; and (ii) a targeting endonuclease, wherein the replacement sequence comprises a nucleic acid sequence that is at least 90% homologous to a sequence presented in Table 2. (Item 127) A kit comprising the composition of item 126 and instructions for use. (Item 128) A nucleic acid molecule comprising a single homology arm construct comprising a replacement sequence and a targeting endonuclease cleavage site, wherein the replacement sequence comprises a nucleic acid sequence that is at least 90% homologous to a sequence provided in Table 2. (Item 129) A kit comprising the nucleic acid molecule of item 128 and instructions for use.

Claims

1. A composition for use in a method for editing a target genome in a dividing cell, the method comprising contacting the dividing cell with the composition, The composition comprises: (i) a single homology arm construct comprising a replacement sequence and a targeting endonuclease cleavage site; and (ii) a targeting endonuclease; the replacement sequence comprises at least one nucleotide difference compared to the target genome, the replacement sequence comprises a splicing acceptor, the target genome comprises a sequence homologous to the targeting endonuclease cleavage site, and the targeting endonuclease cleavage site contained in the single homology arm construct is in the opposite orientation to the targeting endonuclease cleavage site contained in the target genome; A composition wherein the targeting endonuclease is capable of cleaving DNA, wherein the cleavage site of the sequence homologous to the targeting endonuclease cleavage site excludes 100 base pairs each from any of the exons in the target genome, and wherein the replacement sequence is integrated into the target genome using a non-homologous end joining protein.

2. 2. The composition for use of claim 1, wherein the targeting endonuclease is a CRISPR nuclease, a TALEN nuclease, a DNA-guided nuclease, a meganuclease, or a zinc finger nuclease.

3. 3. The composition for use of claim 2, wherein the CRISPR nuclease is Cas9, Cas12a (Cpf1), Cas12b (c2c1), Cas12c (c2c3), Cas12g, Cas12i, Cas14, Cas10, Cas3, CasX, CasY, Csf1, c2c4, c2c5, c2c8, c2c9, c2c10, or Cas10.

4. The composition for use according to claim 3, wherein the CRISPR nuclease is Cas9.

5. The composition for use according to any one of claims 1 to 4, wherein the targeting endonuclease is capable of generating blunt double-stranded DNA ends.

6. The composition for use according to any one of claims 1 to 5, wherein the replacement sequence comprises a mutation, including a substitution, insertion, inversion, translocation, duplication or deletion, compared to the target genome.

7. The composition for use according to any one of claims 1 to 6, wherein the replacement sequence comprises at least a portion of an intron and at least a portion of an exon in a gene of the target genome.

8. The composition for use according to any one of claims 1 to 7, wherein the replacement sequence comprises all introns and exons of the gene downstream of the mutation in the target genome.

9. A composition for use according to any one of claims 1 to 8, wherein the replacement sequence comprises a single homologous arm of the single homologous arm construct.

10. The composition for use according to any one of claims 1 to 9, further comprising a guide oligonucleotide.

11. the single homology arm construct, the guide oligonucleotide, and the targeting endonuclease are encoded within a viral or non-viral construct; The viral construct comprises an adeno-associated viral construct, an adenoviral construct, a lentiviral construct, or a retroviral construct; or The composition for use according to claim 10, wherein the non-viral construct is a minicircle or a plasmid.

12. the single homology arm construct and the guide oligonucleotide are encoded in a targeting construct, the targeting endonuclease is encoded in a nuclease construct, and the targeting construct and the nuclease construct are viral or non-viral constructs; The viral construct comprises an adeno-associated viral construct, an adenoviral construct, a lentiviral construct, or a retroviral construct; or The composition for use according to claim 10, wherein the non-viral construct comprises a minicircle or a plasmid.

13. The composition for use according to claim 12 , wherein the viral construct comprises an adenoviral construct.

14. The composition for use according to any one of claims 1 to 13, further comprising cells and / or further comprising a pharma- ceutically acceptable buffer or excipient.

15. A composition for use in a method for editing a target genome in a dividing cell, the method comprising contacting the dividing cell with the composition, 13. A composition comprising a nucleic acid molecule encoding the single homology arm construct of claim 1, wherein the composition is for use with a targeting endonuclease, and the targeting endonuclease is capable of cleaving DNA.

16. further encoding a guide oligonucleotide or said targeting endonuclease, said nucleic acid molecule being a viral or non-viral construct; The viral construct comprises an adeno-associated viral construct, an adenoviral construct, a lentiviral construct, or a retroviral construct; or The nucleic acid molecule of claim 15, wherein the non-viral construct is a minicircle or a plasmid.

17. The composition for use according to claim 1 , wherein the replacement sequence replaces at least a portion of the target genome.

18. 18. The composition for use according to any one of claims 1 to 17, wherein the cell comprises a stem cell, a neuron, a skeletal muscle cell, a smooth muscle cell, a cardiac muscle cell, a pancreatic beta cell, a lymphocyte, a monocyte, a neutrophil, a T cell, a B cell, a NK cell, a mast cell, a plasma cell, an eosinophil, a basophil, an endothelial cell, an epithelial cell, a hepatocyte, a bone cell, a platelet, an adipocyte, a retinal cell, a barrier cell, a hormone secreting cell, a glial cell, a hepatic adipocyte, a secretory cell, a urinary cell, an extracellular matrix cell, a nurse cell, a stromal cell, a spermatocyte, or an oocyte.

19. The composition for use according to any one of claims 1 to 18, wherein the cell is derived from a subject, the subject being a human, a non-human primate, a dog, a cat, a horse, a cow, a sheep, a pig, a rabbit, a rat, or a mouse, and the subject having a mutation in a gene that is homologous to the replacement sequence.

20. 2. The composition of claim 1 for use in a method of treating a genetic disease in a subject having a mutation in a gene, the method comprising contacting cells from the subject with the composition.

21. 21. The composition for use according to claim 20, wherein the replacement sequence comprises the wild-type sequence of the gene.

22. The genetic disease is achondroplasia, alpha 1 antitrypsin deficiency, Alzheimer's disease, antiphospholipid syndrome, autism, autosomal dominant polycystic kidney disease, breast cancer, cancer, Charcot-Marie-Tooth, colon cancer, cri-cat syndrome, Crohn's disease, cystic fibrosis, Dercum's disease, Down's syndrome, Duane's syndrome, Duchenne muscular dystrophy, factor V Leiden thrombophilia, familial hypercholesterolemia, familial Mediterranean fever, fragile X syndrome, Gaucher's disease, hemochromatosis, hemophilia, holoprosencephaly, Huntington's disease, Klinefelter's syndrome 22. The composition for use according to claim 20 or 21, wherein the disease is selected from the group consisting of Leber's congenital amaurosis, Marfan syndrome, myotonic dystrophy, neurofibromatosis, Noonan syndrome, osteogenesis imperfecta, Parkinson's disease, phenylketonuria, Poland anomaly, porphyria, progeria, prostate cancer, retinitis pigmentosa, severe combined immunodeficiency (SCID), sickle cell disease, skin cancer, spinal muscular atrophy, Stargardt's disease, Tay-Sachs, thalassemia, trimethylaminuria, Turner syndrome, palatocardiofacial syndrome, WAGR syndrome, and Wilson's disease.

Images