Isoxazoles as FXR receptor agonists

Abstract

The present invention relates to compounds of formula (I), pharmaceutical compositions thereof and their use, especially in the treatment and / or prevention of FXR-mediated diseases. [Selection diagram] None

Description

[Technical field]

[0001] [Cross-reference to related art] This patent application claims priority to Italian Patent Application No. 102018000007265, filed July 17, 2018, the entire disclosure of which is hereby incorporated by reference.

[0002] The present invention relates to isoxazole derivatives and their use, especially in the treatment and / or prevention of FXR mediated diseases. [Background technology]

[0003] The farnesoid X receptor (FXR, also known as BAR, NR1H4) is a ligand-dependent transcription factor and a member of the nuclear hormone receptor superfamily.

[0004] FXR, which is highly expressed in enterohepatic tissues (liver and intestine), regulates bile acid homeostasis, lipoproteins, glucose metabolism, liver regeneration, and cardiovascular disorders (Non-Patent Document 1, Non-Patent Document 2, Non-Patent Document 3, Non-Patent Document 4, Non-Patent Document 5, Non-Patent Document 6, Non-Patent Document 7, Non-Patent Document 8, Non-Patent Document 9). Certain bile acids bind to and activate FXR, the most potent of which is chenodeoxycholic acid (CDCA), an endogenous ligand for FXR, which is the major bile acid found in human bile.

[0005] In recent years, various potent and selective FXR agonists belonging to steroidal and non-steroidal chemical classes, such as 6-ECDCA, GW4064, and Fexaramine, have been reported. However, some side effects associated with dysregulation of serum lipids observed in patients with diabetes and fatty liver result in advanced clinical trials (Non-Patent Document 10).

[0006] In the context of non-steroidal ligands, GW4064 represents a milestone in the field of isoxazole-type FXR agonists.

[0007] Indeed, GW4064 showed limited intestinal absorption (less than 10%) and a short terminal half-life in rats after oral administration. Furthermore, the extensively delocalized π-electron system in the stilbene moiety is responsible for its UV photoinstability, making GW4064 potentially cytotoxic. [Prior art documents] [Non-patent literature]

[0008] [Non-Patent Document 1] Mangelsdorf, DJ et al. Cell 1995, 83; 835 [Non-Patent Document 2] Forman, BM et al. Cell 1995, 81, 687 [Non-Patent Document 3] Makishima, M. et al. Science 1999, 284, 1362 [Non-Patent Document 4] Parks, DJ et al. Science 1999, 284, 1365 [Non-Patent Document 5] Wang, H. et al. Mol. Cell 1999, 3, 543 [Non-Patent Document 6] Kuipers, F. et al. Rev. Endocr. Metab. Disord. 2004, 5,319 [Non-Patent Document 7] Zhang et al. Proc. Natl. Acad. Sci. USA 2006, 103, 1006 [Non-Patent Document 8] Matsubara, T. et al. Mol. Cell. Endocrinol. 2013, 368, 17 [Non-Patent Document 9] Claudel, T. et al. Arterioscler. Thromb. Vasc. Biol. 2005, 25, 2020 [Non-Patent Document 10] Fiorucci S. et al. Expert Opin. Ther. Targets 2014, 18, 1449-59 Summary of the Invention [Problem to be solved by the invention]

[0009] The object of the present invention is to identify novel compounds that act as FXR agonists, which have improved pharmacokinetic properties compared to GW4064. [Means for solving the problem]

[0010] This object is achieved according to the present invention with respect to selective FXR agonists comprising an isoxazole chemical scaffold as defined in claim 1, a pharmaceutical composition as defined in claim 5 and uses as defined in claims 6 and 7. Preferred embodiments are set out in the dependent claims. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0011] The following paragraphs provide definitions of the various chemical moieties of the compounds according to the invention and are intended to apply uniformly throughout the specification and claims, unless a differently stated definition gives a more expansive definition.

[0012] The term "alkyl," as used herein, refers to a saturated aliphatic hydrocarbon group. Such term includes straight (unbranched) or branched chains.

[0013] Non-limiting examples of alkyl groups according to the present invention are, for example, methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, or n-hexyl, and the like.

[0014] The term "alkoxy," as used herein, refers to an alkyl group that is linked to the remainder of the compound by an oxygen atom.

[0015] The term "halogen" as used herein refers to fluorine, chlorine, bromine and iodine.

[0016] Unless otherwise indicated, the term "substituted," as used herein, means that one or more hydrogen atoms of the group described above have been replaced with another non-hydrogen atom or functional group, provided that the normal valences are maintained and that the substitution results in a stable compound.

[0017] The term "pharmaceutically acceptable salts" refers to salts of the compounds of Formula (I) identified below that retain the desired biological activity and that have been approved by regulatory authorities.

[0018] As used herein, the term "salt" refers to any salt of a compound according to the invention prepared from an inorganic or organic base. Typically, such salts have a physiologically acceptable cation.

[0019] Furthermore, the compound of formula (I) may form salts with bases, and these salts are included in the present invention so long as they are pharma-ceutically acceptable salts.

[0020] The compounds of formula (I) containing acidic protons may be converted into their therapeutically active non-toxic base addition salt forms, such as metal salts or amine salts, by treatment with appropriate organic and inorganic bases.

[0021] Physiologically or pharma- ceutical acceptable salts are particularly suitable for medical applications due to their greater aqueous solubility relative to the parent compound.

[0022] Pharmaceutically acceptable salts may also be prepared from other salts, including other pharma- ceutically acceptable salts, of the compounds of formula (I) using conventional methods.

[0023] It will be understood by those skilled in the art of organic chemistry that many organic compounds can form complexes with the solvents in which they are reacted or from which they are precipitated or crystallized. These complexes are known as "solvates". For example, complexes with water are known as "hydrates". Solvates of the compounds of the present invention are within the scope of the present invention. Compounds of formula (I) can be easily isolated in association with the solvent molecules by crystallization or evaporation of the appropriate solvent to obtain the corresponding solvates.

[0024] The compound of formula (I) may exist in crystalline form. In certain embodiments, the crystalline form of the compound of formula (I) is a polymorph.

[0025] The subject invention also encompasses isotopically labeled compounds which are identical to the compounds of formula (I) and listed below, except that one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number normally found in nature. Examples of isotopes which may be incorporated into the compounds of the invention and their pharma- ceutically acceptable salts include isotopes of hydrogen, carbon, nitrogen, oxygen, e.g. 2 H, 3 H, 11 C. 13 C. 14 C. 15 N, 17 O. 18 O is one example.

[0026] Compounds of the present invention and pharma- ceutically acceptable salts of said compounds that contain the aforementioned isotopes and / or other isotopes of other atoms are within the scope of the present invention. Isotopically labeled compounds of the present invention, e.g. 3 H, 14 Those in which radioactive isotopes such as C are incorporated are useful in drug and / or substrate tissue distribution assays. Tritium, i.e. 3 H and carbon-14, i.e. 14 C isotopes are particularly preferred for their ease of preparation and detectability. 11 The C isotope is particularly useful in PET (positron emission tomography). In addition, deuterium, i.e. 2Substitution with heavier isotopes such as H can provide certain therapeutic advantages, e.g., increased half-life in vivo or reduced dosage requirements due to greater metabolic stability, and therefore may be preferred in some circumstances. The isotopically labeled compounds of formula (I) and described below of the invention can generally be made by carrying out the procedures disclosed in the schemes and / or examples below, by substituting readily available isotopically labeled reagents for non-isotopically labeled reagents.

[0027] Certain groups / substituents encompassed by the present invention may exist as isomers. Thus, in certain embodiments, compounds of formula (I) may have axial asymmetry and, correspondingly, compounds of formula (I) may exist in the form of optical isomers such as (R)-form, (S)-form, etc. The present invention encompasses within its scope all such isomers, including racemates, enantiomers and mixtures thereof.

[0028] In particular, all stereoisomers, including enantiomers, diastereomers and mixtures thereof, including racemates, are included within the scope of the present invention and a general reference to a compound of formula (I) includes all stereoisomers, unless otherwise stated.

[0029] In general, the compounds or salts of the present invention should be construed to exclude compounds (if any) that are highly chemically unstable by themselves or in water and clearly unsuitable for pharmaceutical use by any route of administration, whether oral, parenteral, or otherwise. Such compounds are known to the expert chemist.

[0030] According to a first aspect of the present invention, there is provided a compound of formula (I): [ka] or pharma- ceutically acceptable salts and solvates thereof are provided.

[0031] In the compound of formula (I), R1 and R2 are independently selected from the group consisting of H, halogen, and CF3, provided that R1 and R2 are not both H; R3 is selected from the group consisting of C1-C3 alkyl and halo-C1-C3 alkyl; n is an integer selected from 1, 2, and 3; R4 is selected from the group consisting of phenyl unsubstituted or substituted with 1 R5, and biphenyl unsubstituted or substituted with 1 R5; R5 is selected from the group consisting of COOR6, CN, hydroxy-C1-C3 alkyl, SO2CH3, CF3, C1-C3 alkyl-O-phenyl unsubstituted or substituted with one R7, and C1-C3 alkyl-O-biphenyl unsubstituted or substituted with one R7; R6 is selected from the group consisting of H and C1-C3 alkyl; R7 is selected from the group consisting of COOR6, CN, hydroxy-C1-C3 alkyl, SO2CH3 and CF3; However, the compound is not 4-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)benzoic acid.

[0032] According to one embodiment, R4 is [ka] wherein R5 is as defined above.

[0033] According to one embodiment, R5 is COOH, COOCH3, CN, -CH2OH, SO2CH3, [ka] wherein R7 is as defined above.

[0034] According to one embodiment, n is 1.

[0035] According to one embodiment, R1 and R2 are independently selected from the group consisting of H, Cl and CF3, preferably, R1 and R2 are chlorine.

[0036] According to one embodiment, R3 is selected from the group consisting of methyl, ethyl, propyl, isopropyl, and CF3.

[0037] According to one embodiment, R7 is selected from the group consisting of COOH, COOCH3, CN, CH2OH, SO2CH3 and CF3.

[0038] According to one embodiment, the compound of formula (I) is [ka] TIFF0007629846000005.tif172170TIFF0007629846000006.tif126170.

[0039] A second aspect of the present invention relates to a pharmaceutical composition comprising a compound of formula (I) as disclosed above, comprising 4-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)benzoic acid, and at least one pharma- ceutically acceptable excipient.

[0040] Those skilled in the art are aware of such excipient compounds suitable for formulating pharmaceutical compositions.

[0041] The compounds of the present invention, together with conventionally used excipients, may be placed into the form of pharmaceutical compositions and unit dosages thereof, in which form they may be used as solids, such as tablets or filled capsules, or as liquids, such as solutions, suspensions, emulsions, elixirs, or capsules filled therein, all for oral use, or in the form of sterile injectable solutions for parenteral administration, including subcutaneous and intravenous use.

[0042] Such pharmaceutical compositions and their unit dosage forms may comprise the ingredients in conventional proportions, with or without additional active compounds or active ingredients, and such unit dosage forms may contain any suitable effective amount of the active ingredient(s) commensurate with the daily dosage range intended for use.

[0043] The pharmaceutical composition containing the compound of the present invention can be prepared in a manner known in the pharmaceutical art, and contains at least one active compound.Generally, the compound of the present invention is administered in a pharmacologic effective amount.The amount of the compound actually administered is usually determined by a physician in consideration of the relevant circumstances, including the condition to be treated, the route of administration selected, the actual compound to be administered, the age, weight and response of individual patient, the severity of the patient's symptoms, etc.

[0044] The pharmaceutical composition of the present invention can be administered by various routes, including oral, rectal, subcutaneous, intravenous, intramuscular, intranasal and pulmonary routes. Compositions for oral administration can take the form of bulk liquid solutions or suspensions, or bulk powders. More commonly, however, the compositions are provided in unit dosage forms to facilitate accurate dosing. The term "unit dosage form" refers to physically discrete units suitable as single dosages for human subjects and other mammals, each unit containing a predetermined amount of active material calculated to produce the desired therapeutic effect, together with suitable pharmaceutical excipients. Typical unit dosage forms include prefilled and premeasured ampoules or syringes of liquid compositions, or pills, tablets, capsules, and the like, in the case of solid compositions.

[0045] Liquid forms suitable for oral administration may include a suitable aqueous or nonaqueous vehicle with buffers, suspending and dispersing agents, colorants, flavorings, etc. Solid forms may contain, for example, any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth, or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, primogel, or corn starch; a lubricant such as magnesium stearate; a glidant such as colloidal silicon dioxide; a sweetener such as sucrose or saccharin; or a flavoring such as peppermint, methyl salicylate, or orange flavoring.

[0046] Injectable compositions are typically based upon injectable sterile saline or phosphate buffered saline or other injectable carriers known in the art.

[0047] The pharmaceutical compositions may be in the form of tablets, pills, capsules, solutions, suspensions, emulsions, powders, suppositories, and as sustained release formulations.

[0048] If desired, tablets may be coated by standard aqueous or nonaqueous techniques. In certain embodiments, such compositions and preparations may contain at least 0.1 percent of active compound. The percentage of active compound in these compositions may of course vary and may conveniently be from about 1 percent to about 60 percent by weight of the unit. The amount of active compound in such therapeutically useful compositions is such that a therapeutically active dosage is obtained. The active compound may also be administered intranasally, for example, as liquid drops or spray.

[0049] Tablets, pills, capsules, etc. may also contain binders such as gum tragacanth, gum arabic, corn starch, or gelatin; excipients such as calcium phosphate; disintegrating agents such as corn starch, potato starch, alginic acid; lubricants such as magnesium stearate, and sweeteners such as sucrose, lactose, or saccharin. When the dosage unit form is a capsule, in addition to the above types of materials, it may contain a liquid carrier such as fatty oil. Various other materials may be present as coatings or to modify the physical form of the dosage unit. For example, tablets may be coated with shellac, sugar, or both. Syrups or elixirs may contain, in addition to the active ingredient, sucrose as a sweetener, methylparaben and propylparaben as preservatives, dyes, and flavorings such as cherry or orange flavor. To prevent degradation during transit through the upper gastrointestinal tract, the composition may be in an enteric coated formulation.

[0050] Compositions for pulmonary administration include, but are not limited to, dry powder compositions consisting only of a powder of the compound of formula (I) or a salt thereof and a suitable carrier and / or lubricant. Compositions for pulmonary administration may be inhaled from any suitable dry powder inhaler device known to those skilled in the art.

[0051] The administration of the composition is carried out under a protocol and at a dosage sufficient to reduce inflammation and pain in the subject. In some embodiments, in the pharmaceutical composition of the present invention, the active ingredient(s) is generally formulated in a dosage unit. The dosage unit may contain 0.1 mg to 1000 mg of the compound of formula (I) per dosage unit for daily administration.

[0052] In some embodiments, the amount useful in a particular formulation will depend on the severity of the disease, disorder or condition, previous treatment, individual health status and response to the drug, hi some embodiments, dosages range from 0.001% to about 60% by weight of the formulation.

[0053] When used in combination with one or more other active ingredients, the compounds of the present invention and the other active ingredients may be used in lower doses than when each is used singly.

[0054] Methods for administration of drugs and formulations for formulations for any of the various routes of administration are disclosed in Remington's Pharmaceutical Sciences, 17th Edition, Gennaro et al. Eds., Mack Publishing Co., 1985, and Remington's Pharmaceutical Sciences, Gennaro AR ed. 20th Edition, 2000, Williams & Wilkins PA, USA, and Remington: The Science and Practice of Pharmacy, 21st Edition, Lippincott Williams & Wilkins Eds., 2005, and in Loyd V. Allen and Howard C. Ansel, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, 10th Edition, Lippincott Williams & Wilkins Eds., 2014.

[0055] The above components for orally administered or injectable compositions are merely representative.

[0056] The compounds of this invention can also be administered in sustained release forms or from sustained release drug delivery systems.

[0057] A third aspect of the present invention relates to compounds of formula (I) disclosed above, including 4-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)benzoic acid, for use as a medicament.

[0058] The compounds of formula (I) disclosed above comprising 4-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)benzoic acid can be used for the prevention and / or treatment of a disorder selected from the group consisting of gastrointestinal disorders, hepatic disorders, cardiovascular disorders, vascular disorders, pulmonary disorders, metabolic conditions, infectious diseases, cancer, renal disorders, inflammatory disorders including immune-mediated disorders, and neurological disorders.

[0059] In one embodiment, immune-mediated inflammatory disorders include autoimmune disorders such as systemic lupus erythematosus, rheumatoid arthritis, Sjogren's syndrome, scleroderma also known as systemic sclerosis, spondyloarthritis, vasculitis, sarcoidosis, Mediterranean fever, and other inherited autoinflammatory diseases, polymyositis and dermatomyositis, Behcet's syndrome.

[0060] In one embodiment, the infectious disease is selected from the group of acquired immune deficiency syndrome (AIDS) and related disorders, virus B and virus C infections.

[0061] In one embodiment, neurological disorders include Alzheimer's disease and other forms of dementia, Parkinson's disease and other movement disorders, amyotrophic lateral sclerosis and other motor neuron disorders, multiple sclerosis and other demyelinating diseases, ischemic stroke, myasthenia gravis, and muscular dystrophies.

[0062] In one embodiment, liver disorders include primary biliary cirrhosis (PBC), cerebrotendinous xanthomatosis (CTX), primary sclerosing cholangitis (PSC), drug-induced cholestasis, intrahepatic cholestasis of pregnancy, cholestasis associated with parenteral nutrition, cholestasis associated with bacterial overgrowth or sepsis, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), liver transplantation, congenital hepatic fibrosis, granulomatous liver disease, intrahepatic or extrahepatic malignancies, Wilson's disease, hemochromatosis, and alpha 1-antitrypsin deficiency.

[0063] In one embodiment, gastrointestinal disorders include inflammatory bowel disease (IBD) (including Crohn's disease, ulcerative colitis, and indeterminate colitis), irritable bowel syndrome (IBS), bacterial overgrowth, acute and chronic pancreatitis, malabsorption, post-radiation colitis, and microscopic colitis.

[0064] In one embodiment, renal disorders include diabetic nephropathy, hypertensive nephropathy, chronic glomerulonephritis, including chronic transplant glomerulonephritis, chronic tubulointerstitial disease, and vascular disorders of the kidney.

[0065] In one embodiment, cardiovascular diseases include atherosclerosis, arteriosclerosis, dyslipidemia, hypercholesterolemia, hypertriglyceridemia, hypertension also known as arterial hypertension, inflammatory heart disease including myocarditis and endocarditis, ischemic heart disease, cerebrovascular disease including stable angina, unstable angina, myocardial infarction, and ischemic stroke.

[0066] In one embodiment, vascular diseases include pulmonary heart disease, such as pulmonary hypertension, peripheral vascular disease (PVD), peripheral artery disease (PAD), also known as peripheral artery occlusive disease and peripheral obliterative arteriopathy.

[0067] In one embodiment, the pulmonary disorder includes interstitial lung disease, including, but not limited to, asthma, cystic fibrosis, obstructive respiratory disease, primary or secondary pulmonary fibrosis.

[0068] In one embodiment, the metabolic disease is selected from the group of diseases including insulin resistance, metabolic syndrome, diabetes mellitus type I and type II, hypoglycemia, disorders of the adrenal cortex including adrenal insufficiency. Metabolic diseases also include conditions associated with obesity and bariatric surgery.

[0069] In one embodiment, the cancer is selected from the group comprising liver cancer, bile duct cancer, esophageal cancer, pancreatic cancer, gastric cancer, colorectal cancer, breast cancer, ovarian cancer, and conditions associated with chemotherapy resistance.

[0070] The compounds of formula (I) which can be used as medicaments and for the prevention and / or treatment of the disorders listed above, [ka] TIFF0007629846000008.tif172170TIFF0007629846000009.tif124170.

[0071] Further characteristics of the invention will emerge from the following description of some merely illustrative and non-limiting examples.

[0072] In the examples below, the following abbreviations are used:

[0073] Methylene chloride (CH2Cl2), hydroxylamine hydrochloride (NH2OH), methanol (MeOH), potassium carbonate (K2CO3), sodium sulfate (Na2SO4), N,N-diisopropylethylamine (DIPEA), dimethylformamide (DMF), (2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HBTU), lithium bromide (LiBr), sodium bicarbonate (NaHCO3), trifluoroacetic acid (TFA), tetrahydrofuran (THF), lithium hydroxide (LiOH), hydrochloric acid (HCl), ethyl acetate (EtOAc), nitrogen (N2), water (H2O), time (h), room temperature (rt), retention time (t R ).

[0074] Unless otherwise indicated, the analysis was performed on a Varian Inova 400 MHz with CDCl3 as the solvent. 1 H NMR was recorded on a Varian Inova 100 MHz using CDCl as the solvent. 13 C NMR was recorded. EXAMPLES

[0075] Example 1. Preparation of BAR2101 to BAR2105, BAR2110 to BAR2113, BAR2116, BAR2118 to BAR2120 Alcohol 1 was prepared in a multi-step process involving aldehyde oxime formation, chlorination, base-promoted β-ketoester-mediated isoxazole formation, and diisobutylaluminum hydride-mediated ester reduction as previously described (Cipriani, S. et al. Sci. Rep. 2017, 7, 41055). The key intermediate primary alcohol 1 was then utilized in multiple Mitsunobu reactions with various phenols (Scheme 1) to generate BAR2101–BAR2103, BAR2110, BAR2113, BAR2116, and BAR2118 in high chemical yields.

[0076] LiBH4 reduction and basic hydrolysis of the methyl esters BAR2102 and BAR2110 afforded the corresponding alcohols BAR2104 (95% yield) and BAR2112 (quantitative yield), and carboxylic acids BAR2105 (quantitative yield) and BAR2111 (89% yield), respectively.

[0077] Mitsunobu reaction of alcohol 1 with methyl 4'-hydroxy-[1,1'-biphenyl]-3-carboxylate afforded the constrained methyl ester BAR2118 in 68% yield. Reduction and hydrolysis using the same experimental conditions previously described afforded the corresponding alcohol BAR2120 and carboxylic acid BAR2119 (83% and 64% chemical yields, respectively). [ka] a) PPh3, DIAD, THF dry, 0°C; b) LiBH4, MeOH dry, THF dry, 0°C; c) NaOH, MeOH:H2O 1:1 vol / vol.

[0078] General Procedure Step a). Mitsunobu reaction. To a solution of PPh3 (3.5 equiv.) in dry THF at 0 °C, DIAD (3.5 equiv.) was added dropwise. The suspension was stirred for 10 min, then a solution of compound 1 in dry THF was added. After 10 min, a solution of the corresponding phenol in dry THF was added. After a period of 3 h to overnight, water (10 mL) was added and the reaction mixture was evaporated. The residue was then extracted with EtOAc (3 x 50 mL). The combined organic layers were washed with a solution of KOH 2.5 M and water, dried and evaporated to give a yellow oil. Purification by flash chromatography on silica gel gave BAR2101-BAR2103, BAR2110, BAR2113, BAR2116, BAR2118.

[0079] Step b) LiBH4 reduction. To a solution of ester BAR2102 or BAR2110 or BAR2118 in dry THF (25 mL) was added dry methanol (3.0 equiv.) and LiBH4 (3.0 equiv.) at 0°C. The resulting mixture was stirred at 0°C for 4-8 h and then quenched by the addition of 1M NaOH (2.0 equiv.) and ethyl acetate. The organic phase was washed with water, dried (Na2SO4) and concentrated to give the crude residue, which was purified by HPLC or silica gel column chromatography.

[0080] Step c) Basic hydrolysis. Another portion of BAR2102, or BAR2110 or BAR2118 was hydrolyzed with NaOH (5.0 eq.) in a solution of MeOH:H2O 1:1 vol / vol (30 mL). The mixture was stirred under reflux for 8 h. The resulting solution was then acidified with HCl 6M and extracted with ethyl acetate (3 x 50 mL). The combined organic phases were washed with brine, dried over anhydrous Na2SO4 and evaporated under reduced pressure to give the crude residue of the compound, which was subjected to purification by HPLC or flash chromatography.

[0081] Example 1A. Preparation of 3-(2,6-dichlorophenyl)-5-isopropyl-4-(phenoxymethyl)isoxazole (BAR2101) After step a, purification on silica gel (hexane and 0.5% TEA) gave BAR2101 (40%). An analytical sample (t R = 10 min). BAR2101C 19 H 17 Cl2NO2 1 H NMR (CDCl3, 400 MHz): δ 7.39 (2H, d, J = 7.7 Hz), 7.31 (1H, t, J = 7.7 Hz), 7.22 (2H, t, J = 7.8 Hz), 6.93 (1H, t, J = 7.8 Hz), 6.78 (2H, d, J = 7.8 Hz), 4.72 (2H, s), 3.33 (1H, septet, J = 6.9 Hz), 1.41 (6H, d, J = 6.9 Hz); 13 C NMR (CDCl3, 100 MHz) δ 176.3, 159.1, 158.9, 135.8 (2C), 131.2, 129.4 (2C), 128.0 (3C), 121.2, 114.7 (2C), 109.4, 59.2, 27.0, 20.8 (2C).

[0082] Example 2A. Preparation of methyl 4-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)benzoate (BAR2102) After step a, purification on silica gel (9:1 hexane / AcOEt and 0.5% TEA) gave BAR2102 (82%). An analytical sample (t R = 12 min). BAR2102C 21 H 19 Cl2NO4 1H NMR (CDCl3, 400 MHz): δ 7.91 (2H, d, J = 8.2 Hz), 7.39 (2H, d, J = 7.6 Hz), 7.31 (1H, t, J = 7.6 Hz), 6.78 (2H, d, J = 8.2 Hz), 4.77 (2H, s), 3.86 (3H, s), 3.32 (1H, septet, J = 6.7 Hz), 1.42 (6H, d, J = 6.7 Hz); 13 C NMR (CDCl3, 100 MHz): δ 176.5, 166.7, 161.8, 159.0, 135.7 (2C), 131.5, 131.3 (2C), 128.1 (2C), 127.7, 123.0, 114.1 (2C), 108.8, 59.5, 51.9, 27.1, 20.8 (2C).

[0083] Example 3A. Preparation of 4-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)benzonitrile (BAR2103) After step a, purification on silica gel (9:1 hexane / AcOEt and 0.5% TEA) gave BAR2103 (89%). The analytical sample (t R = 7.4 min). BAR2103C 20 H 16 Cl2N2O2 1 H NMR (CDCl3, 400 MHz): δ 7.52 (2H, d, J = 8.5 Hz), 7.40 (2H, d, J = 7.0 Hz), 7.33 (1H, t, J = 7.0 Hz), 6.81 (2H, d, J = 8.5 Hz), 4.77 (2H, s), 3.31 (1H, septet, J = 6.8 Hz), 1.42 (6H, d, J = 6.8 Hz); 13C NMR (CDCl3, 100 MHz): δ 176.61, 161.3, 158.9, 135.7 (2C), 133.9 (2C), 131.4, 128.1 (2C), 127.5, 118.9, 115.2 (2C), 108.5, 104.5, 59.5, 27.1, 20.8 (2C).

[0084] Example 4A. Preparation of (4-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)phenyl)methanol (BAR2104) After step b, purification on silica gel (100% CH2Cl2) gave BAR2104 (95%). An analytical sample (t R = 13 min). BAR2104C 20 H 19 Cl2NO3 1 H NMR (CDCl3, 400 MHz): δ7.39 (2H, d, J = 7.2 Hz), 7.32 (1H, t, J = 7.2 Hz), 7.22 (2H, d, J = 7.3 Hz), 6.76 (2H, d, J = 7.3 Hz), 4.71 (2H, s), 4.58 (2H, s), 3.32 (1H, septet, J = 6.6 Hz), 1.41 (6H, d, J = 6.6 Hz); 13 C NMR (CDCl3, 100 MHz): δ176.3, 159.1, 157.8, 135.8 (2C), 133.7, 131.2, 128.5 (2C), 128.1 (2C), 127.8, 114.8 (2C), 109.4, 64.9, 59.4, 27.1, 20.7 (2C).

[0085] Example 5A. Preparation of 4-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)benzoic acid (BAR2105) After step c, purification on silica gel (100% CH2Cl2) gave BAR2105 (quantitative yield). An analytical sample (t R = 9.2 min). BAR2105C 20 H 17 Cl2NO4 1 H NMR (CDCl3, 400 MHz): δ7.94 (2H, d, J = 6.5 Hz), 7.37 (2H, d, J = 7.0 Hz), 7.29 (1H, t, J = 7.0 Hz), 6.77 (2H, d, J = 6.5 Hz), 4.77 (2H, s), 3.31 (1H, septet, J = 6.4 Hz), 1.41 (6H, d, J = 6.4 Hz); 13 C NMR (CDCl3, 100 MHz): δ177.4, 162.4, 162.3, 158.9, 135.7 (2C), 132.2 (2C), 131.3, 128.0 (2C), 127.7, 123.0, 114.2 (2C), 108.8, 59.4, 27.1, 20.8 (2C).

[0086] Example 6A. Preparation of 3-(2,6-dichlorophenyl)-5-isopropyl-4-((4-(methylsulfonyl)phenoxy)methyl)isoxazole (BAR2116) After step a, purification on silica gel (100% CH2Cl2) gave BAR2116 (67%). An analytical sample (t R = 13.5 min). BAR2116C 20 H 19 Cl2NO4S 1 H NMR (CDCl3, 400 MHz): δ 7.79 (2H, d, J = 8.5 Hz), 7.40 (2H, d, J = 7.8 Hz), 7.32 (1H, t, J = 7.8 Hz), 6.88 (2H, d, J = 8.5 Hz), 4.80 (2H, s), 3.32 (1H, septet, J = 6.9 Hz), 3.0 (3H, s), 1.43 (6H, d, J = 6.9 Hz); 13 C NMR (CDCl3, 100 MHz): δ 176.6, 162.1, 158.9, 135.7 (2C), 132.8, 131.48, 129.5 (2C), 128.1 (2C), 127.5, 114.9 (2C), 108.5, 59.7, 44.2, 27.1, 20.8 (2C).

[0087] Example 7A. Preparation of methyl 3-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)benzoate (BAR2110) After step a, purification on silica gel (8:2 hexane / AcOEt and 0.5% TEA) gave BAR2110 (57%). An analytical sample (t R = 16.5 min). BAR2110C 21 H 19 Cl2NO4 1H NMR (CDCl3, 400 MHz): δ 7.60 (1H, d, J = 7.8 Hz), 7.43 (1H, s), 7.38 (2H, d, J = 7.7 Hz), 7.32-7.25 (2H, m, ovl), 6.94 (1H, d, J = 8.3 Hz), 4.77 (2H, s), 3.89 (3H, s), 3.33 (1H, septet, J = 6.9 Hz), 1.42 (6H, d, J = 6.9 Hz); 13 C NMR (CDCl3, 100 MHz): δ 176.4, 166.7, 159.1, 158.1, 135.7 (2C), 131.4, 131.2, 129.4, 128.1 (2C), 127.8, 122.5, 120.3, 114.6, 109.1, 59.5, 52.1, 27.1, 20.8 (2C).

[0088] Example 8A. Preparation of 3-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)benzonitrile (BAR2113) After step a, purification on silica gel (9:1 hexane / AcOEt and 0.5% TEA) gave BAR2113 (73%). An analytical sample (t R = 11.4 min). BAR2113C 20 H 16 Cl2N2O2 1H NMR (CDCl3, 400 MHz): δ7.40 (1H, s), 7.39 (2H, d, J = 7.8 Hz), 7.33 (1H, dd, ovl), 7.31 (1H, t, ovl), 7.21 (1H, d, J = 7.7 Hz), 6.99 (1H, d, J = 8.0 Hz), 4.75 (2H, s), 3.31 (1H, septet, J = 6.8 Hz), 1.41 (6H, d, J = 6.8 Hz); 13 C NMR (CDCl3, 100 MHz): δ 176.6, 158.9, 158.1, 135.7 (2C), 131.4, 130.4, 128.1 (2C), 127.6, 125.0, 120.0, 118.4, 117.5, 113.2, 108.6, 59.6, 27.1, 20.8 (2C).

[0089] Example 9A. Preparation of (3-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)phenyl)methanol (BAR2112) After step b, purification by HPLC on Nucleodur 100-5 C18 (5 μm; 4.6 mm i.d. × 250 mm) using MeOH / HO (75:25) as eluent (flow rate 1 mL / min) gave BAR2112 (quantitative yield) (t R = 18 min). BAR2112C 20 H 19 Cl2NO3 1 H NMR (CDCl3, 400 MHz): δ7.39 (2H, d, J = 7.5 Hz), 7.30 (1H, t, J = 7.5 Hz), 7.19 (1H, t, J = 7.8 Hz), 6.90 (1H, d, J = 7.8 Hz), 6.80 (1H, s), 6.70 (1H, d, J = 7.8 Hz), 4.73 (2H, s), 4.61 (2H, d, J = 4.1 Hz), 3.33 (1H, septet, J = 6.9 Hz), 1.41 (6H, d, J = 6.9 Hz); 13 C NMR (CDCl3, 100 MHz): δ176.5, 159.0, 158.5, 142.5, 135.8 (2C), 131.2, 129.5, 128.1 (2C), 127.8, 119.6, 114.1, 112.8, 109.4, 65.0, 59.2, 27.1, 20.8 (2C).

[0090] Example 10A. Preparation of 3-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)benzoic acid (BAR2111) After step c, purification by HPLC on Nucleodur 100-5 C18 (5 μm; 4.6 mm i.d. × 250 mm) using MeOH / HO (75:25) as eluent (flow rate 1 mL / min) gave BAR2111 (89%) (t R = 22.5 min). BAR2111C 20 H 17 Cl2NO4 1 H NMR (CDCl3, 400 MHz): δ7.65 (1H, d, J = 7.0 Hz), 7.47 (1H, s), 7.37 (2H, d, J = 7.5 Hz), 7.31-7.25 (2H, m, ovl), 6.97 (1H, d, J = 7.8 Hz), 4.77 (2H, s), 3.32 (1H, septet, J = 7.1 Hz), 1.41 (6H, d, J = 7.1 Hz); 13 C NMR (CDCl3, 100 MHz): δ176.41, 159.7, 159.1, 158.2, 135.7 (2C), 131.3, 129.5 (2C), 128.0 (2C), 127.6, 123.2, 121.0, 115.2, 109.1, 59.5, 27.1, 20.8 (2C).

[0091] Example 11A. Preparation of methyl 4'-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)-[1,1'-biphenyl]-3-carboxylate (BAR2118) After step a, purification on silica gel (100% CH2Cl2) gave BAR2118 (68%). An analytical sample (t R = 9.9 min). BAR2118C 27 H 23 Cl2NO4 1 H NMR (CDCl3, 400 MHz): δ8.20 (1H, s), 7.98 (1H, d, J = 7.7 Hz), 7.71 (1H, d, J = 7.7 Hz), 7.49 (2H, d, J = 8.5 Hz), 7.48 (1H, t, J = 7.7 Hz), 7.42 (2H, d, J = 8.0 Hz), 7.33 (1H, dd, J = 7.1, 8.0 Hz), 6.87 (2H, d, J = 8.5 Hz), 4.78 (2H, s), 3.95 (3H, s), 3.36 (1H, septet, J = 7.1 Hz), 1.44 (6H, d, J = 7.1 Hz); 13 C NMR (CDCl3, 100 MHz): δ176.4, 167.1, 159.1, 158.1, 140.8, 135.8 (2C), 133.2, 131.2, 131.0, 130.6, 128.8, 127.8, 127.7, 128.1 (4C), 126.8, 115.1 (2C), 109.3, 59.4, 52.1, 27.1, 20.8 (2C).

[0092] Example 12A. Preparation of (4'-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)-[1,1'-biphenyl]-3-yl)methanol (BAR2120) After step b, purification on silica gel (9:1 hexane / AcOEt and 0.5% TEA) gave BAR2120 (83%). An analytical sample (t R = 8.5 min). BAR2120C 26 H 23 Cl2NO3 1 H NMR (CD3OD, 400 MHz): δ7.53 (1H, s), 7.52 (2H, d, J = 7.5 Hz), 7.47 (1H, t ovl), 7.46 (2H, d, J = 8.8 Hz), 7.43 (1H, d, J = 7.8 Hz), 7.36 (1H, t, J = 7.8 Hz), 7.27 (1H, d, J = 7.8 Hz), 6.84 (2H, d, J = 8.8 Hz), 4.84 (2H, s), 4.64 (2H, s), 3.43 (1H, septet, J = 6.7 Hz), 1.42 (6H, d, J = 6.7 Hz); 13 C NMR (CDCl3, 100 MHz): δ176.4, 157.8, 154.1, 141.4, 137.4, 135.8 (2C), 134.0, 131.2, 129.0, 128.1 (4C), 126.0, 125.4, 125.3, 122.8, 115.1 (2C), 109.3, 65.4, 59.4, 27.0, 20.8 (2C).

[0093] Example 13A. Preparation of 4'-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)-[1,1'-biphenyl]-3-carboxylic acid (BAR2119) After step c, purification on silica gel (99:1 CH2Cl2 / MeOH) gave BAR2119 (64%). An analytical sample (t R = 12.5 min). BAR2119C 26 H 21 Cl2NO4 1 H NMR (CDCl3, 400 MHz): δ8.27 (1H, s), 8.04 (1H, d, J = 8.0 Hz), 7.76 (1H, d, J = 7.7 Hz), 7.51 (2H, d, J = 8.2 Hz), 7.50 (1H, t, J = 8.0 Hz), 7.42 (2H, d, J = 7.6 Hz), 7.33 (1H, t, J = 7.6 Hz), 6.87 (2H, d, J = 8.2 Hz), 4.78 (2H, s), 3.36 (1H, septet, J = 7.1 Hz), 1.44 (6H, d, J = 7.1 Hz); 13 C NMR (CDCl3, 100 MHz): δ176.4, 164.9, 160.6, 158.1, 140.8, 135.8 (2C), 133.1, 132.1, 131.5, 131.2, 128.8, 128.3, 128.1 (4C), 127.8, 127.7, 115.1 (2C), 109.3, 59.4, 27.1, 20.8 (2C).

[0094] Example 2. Preparation of BAR2106 to BAR2109, BAR2121 to BAR2124, BAR2139, BAR2140, and BAR2147 BAR2104, prepared according to Scheme 1, was alkylated with six different phenols via Mitsunobu reaction to give BAR2106, BAR2107, BAR2121, BAR2122, BAR2138, and BAR2144. LiBH4 reduction and alkaline hydrolysis of the methyl esters BAR2106, BAR2122, BAR2138, and BAR2144 afforded the corresponding alcohols BAR2108, BAR2124, BAR2140, BAR2146, and acids BAR2109, BAR2123, BAR2139, and BAR2147, respectively (Scheme 2). [ka] a) PPh3, DIAD, THF dry, 0°C; b) LiBH4, MeOH dry, THF dry, 0°C; c) NaOH, MeOH:H2O 1:1 vol / vol.

[0095] Example 2A. Preparation of methyl 4-((4-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)benzyl)oxy)benzoate (BAR2106) After step a, purification on silica gel (100% CH2Cl2) gave BAR2106 (63%). An analytical sample of BAR2106 (t R = 10.4 min). BAR2106C 28 H 25 Cl2NO5 1H NMR (CDCl3, 400 MHz): δ 7.98 (2H, d, J = 8.0 Hz), 7.40 (2H, d, J = 7.7 Hz), 7.33-7.26 (3H, m, ovl), 6.96 (2H, d, J = 8.0 Hz), 6.79 (2H, d, J = 7.7 Hz), 5.00 (2H, s), 4.72 (2H, s), 3.88 (3H, s), 3.32 (1H, septet, J = 6.9 Hz), 1.41 (6H, d, J = 6.9 Hz); 13 C NMR (CDCl3, 100 MHz): δ 176.4, 166.8, 162.4, 159.1, 158.2, 135.7 (2C), 131.5, 131.2 (2C), 129.2 (2C), 128.8, 128.1 (2C), 127.3, 122.7, 114.9 (2C), 114.4 (2C), 109.3, 69.7, 59.4, 51.8, 27.1, 20.7 (2C).

[0096] Example 2B. Preparation of 4-((4-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)benzyl)oxy)benzonitrile (BAR2107) After step a, purification on silica gel (7:3 hexane / AcOEt and 0.5% TEA) gave BAR2107 (quantitative yield). An analytical sample (t R = 8 min). BAR2107C 27 H 22 Cl2N2O3 1H NMR (CDCl3, 400 MHz): δ7.58 (2H, d, J = 8.5 Hz), 7.40 (2H, d, J = 8.0 Hz), 7.32 (1H, t, J = 8.4 Hz), 7.27 (2H, d, J = 8.4 Hz), 6.98 (2H, d, J = 8.5 Hz), 6.80 (2H, d, J = 8.0 Hz), 5.00 (2H, s), 4.73 (2H, s), 3.32 (1H, septet, J = 6.9 Hz), 1.42 (6H, d, J = 6.9 Hz); 13 C NMR (CDCl3, 100 MHz): δ176.1, 161.7, 158.8, 158.1, 135.5 (2C), 133.7 (2C), 131.1, 129.0 (2C), 128.1, 127.8 (2C), 127.5, 118.9, 115.3 (2C), 114.7 (2C), 109.1, 103.8, 69.7, 59.2, 26.8, 20.5 (2C).

[0097] Example 2C. Preparation of (4-((4-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)benzyl)oxy)phenyl)methanol (BAR2108) After step b, purification by HPLC on a Phenomenex C18 (5 μm, 4.6 mm i.d. × 250 mm) using MeOH / HO (75:25) as eluent (flow rate 1 mL / min) afforded BAR2108 (quantitative yield) (t R = 24 min). BAR2108C 27 H 25 Cl2NO4 1H NMR (CDCl3, 400 MHz): δ7.39 (2H, d, J = 7.9 Hz), 7.31 (1H, ovl), 7.28 (4H, d, ovl), 6.94 (2H, d, J = 8.3 Hz), 6.80 (2H, d, J = 8.3 Hz), 4.96 (2H, s), 4.72 (2H, s), 4.62 (2H, d, J = 5.1 Hz), 3.33 (1H, septet, J = 6.9 Hz), 1.41 (6H, d, J = 6.9 Hz); 13 C NMR (CDCl3, 100 MHz): δ176.5, 159.3, 158.4, 158.2, 135.7 (2C), 133.7, 131.4, 129.8 (2C), 129.2 (2C), 128.8, 128.2 (2C), 128.0, 115.0 (4C), 109.5, 69.8, 64.9, 59.6, 27.3, 20.9 (2C).

[0098] Example 2D. Preparation of 4-((4-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)benzyl)oxy)benzoic acid (BAR2109) After step c, purification on silica gel (7:3 hexane:AcOEt) gave BAR2109 (93%). An analytical sample (t R = 15 min). BAR2109C 27 H 23 Cl2NO5 1H NMR (CDCl3, 400 MHz): δ8.05 (2H, d, J = 8.6 Hz), 7.40 (2H, d, J = 7.89 Hz), 7.33-7.29 (3H, m, ovl), 6.99 (2H, d, J = 8.6 Hz), 6.81 (2H, d, J = 8.4 Hz), 5.03 (2H, s), 4.73 (2H, s), 3.32 (1H, septet, J = 6.9 Hz), 1.42 (6H, d, J = 6.9 Hz); 13 C NMR (CDCl3, 100 MHz): δ176.4, 163.2, 162.4, 158.9, 158.3, 135.8 (2C), 132.3, 131.2 (2C), 129.2 (2C), 128.7, 128.1 (2C), 127.8, 121.7, 114.9 (2C), 114.5 (2C), 109.3, 69.8, 59.4, 27.1, 20.8 (2C).

[0099] Example 2E. Preparation of methyl 3-((4-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)benzyl)oxy)benzoate (BAR2122) After step a, purification on silica gel (100% CH2Cl2) gave BAR2122 (61%). An analytical sample (t R = 18 min). BAR2122C 28 H 25 Cl2NO5 1H NMR (CDCl3, 400 MHz): δ7.63 (2H, d, J = 7.6 Hz), 7.40 (2H, d, J = 8.1 Hz), 7.33 (1H, t, J = 8.1 Hz), 7.30-7.29 (3H, m, ovl), 7.13 (1H, d, J = 7.9 Hz), 6.79 (2H, d, J = 8.3 Hz), 5.00 (2H, s), 4.72 (2H, s), 3.91 (3H, s), 3.32 (1H, septet, J = 6.9 Hz), 1.41 (6H, d, J = 6.9 Hz); 13 C NMR (CDCl3, 100 MHz): δ176.4, 171.1, 169.3, 157.0, 152.9, 135.8 (2C), 131.2, 129.4, 129.2 (4C), 128.1 (2C), 122.2, 120.8, 120.2, 115.0, 114.8 (2C), 109.3, 69.8, 59.4, 52.2, 27.1, 20.7 (2C).

[0100] Example 2F. Preparation of 3-((4-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)benzyl)oxy)benzonitrile (BAR2121) After step a, purification on silica gel (100% CH2Cl2) gave BAR2121 (93%). An analytical sample (t R = 16 min). BAR2121C 27 H 22 Cl2N2O3 1H NMR (CDCl3, 400 MHz): δ7.40 (2H, d, J = 7.8 Hz), 7.33 (1H, t, J = 7.8 Hz), 7.29-7.23 (4H, m, ovl), 7.16 (2H, ovl), 6.79 (2H, d, J = 8.5 Hz), 4.97 (2H, s), 4.72 (2H, s), 3.32 (1H, septet, J = 7.0 Hz), 1.41 (6H, d, J = 7.0 Hz); 13 C NMR (CDCl3, 100 MHz): δ176.4, 163.2, 159.1, 158.3, 135.7 (2C), 131.2, 130.4, 129.7, 129.1 (2C), 128.1 (2C), 124.7, 123.9, 120.5, 118.9, 118.7, 114.9, 114.8, 114.6, 109.3, 69.9, 59.4, 27.1, 20.8 (2C).

[0101] Example 2G. Preparation of (3-((4-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)benzyl)oxy)phenyl)methanol (BAR2124) After step b, purification by HPLC on a Phenomenex C18 5 μm (4.6 mm i.d. × 250 mm) using MeOH / HO (80:20) as eluent (flow rate 1 mL / min) gave BAR2124 (84%) (t R = 10 min). BAR2124C 27 H 25 Cl2NO4 1H NMR (CDCl3, 400 MHz): δ7.40 (2H, d, J = 7.70 Hz), 7.33 (1H, t, J = 7.70 Hz), 7.28 (2H, d, J = 8.4 Hz), 7.27 (1H, dd, ovl), 6.98 (1H, s), 6.94 (1H, d, J = 7.5 Hz), 6.87 (1H, d, J = 8.0 Hz), 6.78 (2H, d, J = 8.4 Hz), 4.96 (2H, s), 4.72 (2H, s), 4.66 (2H, br s), 3.32 (1H, septet, J = 6.9 Hz), 1.41 (6H, d, J = 6.9 Hz); 13 C NMR (CDCl3, 100 MHz): δ176.3, 159.1, 158.9, 158.1, 142.5, 135.7 (2C), 131.2, 129.6, 129.0 (3C), 128.0 (2C), 123.2, 119.3, 114.8 (2C), 114.1, 113.2, 109.3, 69.6, 65.2, 59.3, 27.1, 20.8 (2C).

[0102] Example 2H. Preparation of 3-((4-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)benzyl)oxy)benzoic acid (BAR2123) After step c, purification on silica gel (8:2 hexane / AcOEt) gave BAR2123 (72%). An analytical sample (t R = 12 min). BAR2123C 27 H 23 Cl2NO5 1H NMR (CD3OD, 400 MHz): δ7.58 (1H, s), 7.57 (1H, d, J = 8.0 Hz), 7.49 (2H, d, J = 7.7 Hz), 7.43 (1H, dd, J = 8.0, 8.4 Hz), 7.30 (1H, t, J = 7.7 Hz), 7.28 (2H, d, J = 8.6 Hz), 7.10 (1H, d, J = 8.4 Hz), 6.77 (2H, d, J = 8.6 Hz), 5.00 (2H, s), 4.81 (2H, s), 3.41 (1H, septet, J = 7.1 Hz), 1.40 (6H, d, J = 7.1 Hz); 13 C NMR (CDCl3, 100 MHz): δ176.3, 169.7, 159.1, 158.6, 158.1, 135.7 (2C), 132.0 (2C), 131.2, 129.5, 129.2, 128.4, 128.0 (2C), 122.7, 120.8, 116.1, 115.3, 114.8 (2C), 109.3, 69.7, 59.3, 27.1, 20.7 (2C).

[0103] Example 2I. Preparation of 4'-((4-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)benzyl)oxy)-[1,1'-biphenyl]-3-carboxylic acid (BAR2139) BAR2139 (t) was purified by HPLC on a Nucleodur Sphinx C18 5 μm (4.6 mm i.d. × 250 mm) column using MeOH / HO (95:5) and 0.1% TFA as eluents (flow rate 1 mL / min). R = 5 min). BAR2139C 33 H 27 Cl2NO5 1H NMR (CDCl3, 400 MHz): δ8.27 (1H, br s) 8.02 (1H, d, J = 7.7 Hz), 7.78 (1H, d, J = 7.7 Hz), 7.56 (2H, d, J = 8.2 Hz), 7.52 (1H, t, J = 7.7 Hz), 7.40 (2H, d, J = 7.9 Hz), 7.32 (2H, d, J = 8.2 Hz), 7.30 (1H, t, J = 7.9 Hz), 6.81 (2H, d, J = 8.2 Hz), 5.01 (2H, s), 4.73 (2H, s), 3.33 (1H, septet, J = 7.0 Hz), 1.42 (6H, d, J = 7.0 Hz); 13 C NMR (CDCl3, 100 MHz): δ 176.3, 165.3, 159.1, 158.7, 158.2, 141.1, 135.8 (2C), 132.6, 131.8, 131.3, 129.5 (2C), 129.2 (2C), 128.9, 128.4 (2C), 128.2 (2C), 128.1, 127.8, 115.3 (2C), 114.9 (2C), 109.3, 69.6, 59.6, 27.0, 20.7 (2C).

[0104] Example 2J. (4'-((4-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)benzyl)oxy)-[1,1'-biphenyl]-3-yl)methanol (BAR2140). BAR2140 (t R = 12 min). BAR2140C 33 H 29 Cl2NO4 1H NMR (CDCl3, 400 MHz): δ 7.54-7.39 (9H, ovl), 7.27 (2H, d, J = 7.8 Hz), 7.01, (2H, d, J = 7.9 Hz), 6.76 (2H, d, J = 8.0 Hz), 4.98 (2H, s), 4.79 (2H, s), 4.64 (2H, s), 3.39 (1H, septet, J = 7.0 Hz), 1.38 (6H, d, J = 7.0 Hz); 13 C NMR (CDCl3, 100 MHz): δ 176.4, 159.1, 158.4, 158.2, 141.3, 141.2, 135.8 (2C), 133.7, 131.2, 129.6, 129.2, 129.0, 128.2 (2C), 128.1 (2C), 127.8 (2C), 126.1, 125.4, 125.3, 115.1 (2C), 114.8 (2C), 109.4, 69.6, 65.3, 59.3, 27.0, 20.8 (2C).

[0105] Example 2K. 4'-((4-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)benzyl)oxy)-[1,1'-biphenyl]-4-carboxylic acid (BAR2147). Purification by HPLC on a Nucleodur Sphinx C18 5 μm (4.6 mm i.d. × 250 mm) column was performed using MeOH / HO (90:10) as the eluent (flow rate 1 mL / min). R =8 minutes). BAR2147C 33 H 27 Cl2NO5 1H NMR (CDCl3, 400 MHz): δ 7.8 (2H, d, J = 8.6 Hz), 7.6 (2H, d, J = 8.6 Hz), 7.53 (2H, d, J = 8.5 Hz), 7.40 (2H, d, J = 7.9 Hz), 7.32 (3H, ovl), 7.05 (2H, d, J = 8.5 Hz), 6.81 (2H, d, J = 8.2 Hz), 5.01 (2H, s), 4.73 (2H, s), 3.33 (1H, septet, J = 7.0 Hz), 1.42 (6H, d, J = 7.0 Hz); 13 C NMR (CDCl3, 100 MHz): δ 176.3, 169.3, 159.4, 159.1, 158.2, 145.1, 135.8 (2C), 132.6 (2C), 131.7, 131.3, 129.3, 129.1 (2C), 128.4 (2C), 128.2 (2C), 127.8, 127.1 (2C), 115.4 (2C), 114.8 (2C), 109.3, 69.8, 59.4, 27.1, 20.8 (2C).

[0106] Example 3. Preparation of BAR2151, BAR2159, BAR2175, BAR2183 Starting with the alcohol BAR2112, alkylation with four different phenols via Mitsunobu reaction and hydrolysis gave the carboxylic acids BAR2151, BAR2159, BAR2175, and BAR2183, following the procedure previously described in Example 2 (Scheme 2). [ka] a) PPh3, DIAD, phenol-COOCH3, THF dry, 0°C; c) NaOH, MeOH:H2O 1:1 vol / vol.

[0107] Example 3A. Preparation of 4'-((3-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)benzyl)oxy)-[1,1'-biphenyl]-3-carboxylic acid (BAR2151) BAR2151 (t R = 11 min). BAR2151C 33 H 27 Cl2NO5 1 H NMR (CD3OD, 400 MHz): δ 8.27 (1H, br s) 8.02 (1H, d, J = 7.8 Hz), 7.75 (1H, d, J = 7.8 Hz), 7.56 (2H, d, J = 8.2 Hz), 7.52 (1H, t, J = 7.8 Hz), 7.40 (2H, d, J = 8.0 Hz), 7.32 (1H, t, J = 8.0 Hz), 7.30 (1H, t, J = 7.5 Hz), 7.04 (2H, d, J = 8.2 Hz), 7.00 (1H, d, J = 7.5 Hz), 6.85 (1H, s), 6.80 (1H, d, J = 7.5 Hz), 5.06 (2H, s), 4.78 (2H, s), 3.33 (1H, septet, J = 7.3 Hz), 1.42 (6H, d, J = 7.3 Hz); 13 C NMR (CDCl3, 100 MHz): δ 176.4, 165.5, 159.1, 158.7, 158.5, 141.0, 137.7, 135.6 (2C), 132.3, 131.8, 131.6, 131.4, 129.8, 129.5, 129.1, 128.9, 128.4 (2C), 128.2 (2C), 127.6, 120.4, 115.1 (2C), 114.5, 113.7, 109.3, 69.8, 59.3, 27.0, 20.7 (2C).

[0108] Example 3B. Preparation of 4'-((3-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)benzyl)oxy)-[1,1'-biphenyl]-4-carboxylic acid (BAR2159) BAR2159 (t R = 8 min). BAR2159C 33 H 27 Cl2NO5 1 H NMR (CDCl3, 400 MHz): δ 7.90 (2H, d, J = 7.7 Hz), 7.70 (2H, d, J = 7.7 Hz), 7.56 (2H, d, J = 8.2 Hz), 7.53 (1H, t, J = 8.0 Hz), 7.40 (2H, d, J = 7.9 Hz), 7.30 (1H, t, J = 7.9 Hz), 7.05 (2H, d, J = 8.2 Hz), 7.02 (1H, d, J = 8.0 Hz), 6.88 (1H, s), 6.76 (1H, d, J = 8.0 Hz), 5.03 (2H, s), 4.73 (2H, s), 3.33 (1H, septet, J = 7.0 Hz), 1.42 (6H, d, J = 7.0 Hz); 13 C NMR (CDCl3, 100 MHz): δ 176.3, 165.3, 159.3, 159.1, 158.2, 141.1, 137.7, 135.8 (2C), 132.6, 131.5, 131.2, 129.5, 129.2 (2C), 129.1, 128.1 (2C), 128.0 (2C), 123.8 (2C), 115.4 (2C), 120.0, 114.5, 113.7, 109.3, 69.8, 59.4, 27.0, 20.7 (2C).

[0109] Example 3C. Preparation of 4-((3-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)benzyl)oxy)benzoic acid (BAR2175) BAR2175 (t R = 13 min). BAR2175C 27 H 23 Cl2NO5 1 H NMR (CDCl3, 400 MHz): δ 8.05 (2H, d, J = 8.7 Hz), 7.40 (2H, d, J = 7.9 Hz), 7.32 (1H, t, J = 7.9 Hz), 7.29 (1H, d, J = 8.0 Hz), 7.25 (1H, t ovl), 7.0 (2H, d, J = 8.7 Hz), 6.85 (1H, s), 6.76 (1H, d, J = 8.0 Hz), 5.07 (2H, s), 4.74 (2H, s), 3.33 (1H, septet, J = 7.0 Hz), 1.44 (6H, d, J = 7.0 Hz); 13 C NMR (CDCl3, 100 MHz): δ 176.4, 163.9, 159.3, 159.0, 158.5, 137.8, 135.8 (2C), 132.3 (2C), 131.5, 131.3, 129.7, 129.5, 128.0 (2C), 120.2, 114.6, 114.4 (2C), 113.6, 109.2, 69.9, 59.3, 27.0, 20.7 (2C).

[0110] Example 3D. Preparation of 3-((3-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)benzyl)oxy)benzoic acid (BAR2183) BAR2183 (t R = 15 min). BAR2183C 27 H 23 Cl2NO5 1 H NMR (CDCl3, 400 MHz): δ 7.72 (1H, d, J = 7.5 Hz), 7.67 (1H, br s), 7.41 (1H, ovl), 7.40 (2H, d, ovl), 7.31 (1H, t, ovl), 7.30 (1H, tovl), 7.24 (1H, d, J = 8.0 Hz), 7.20 (1H, d, J = 8.2 Hz), 6.87 (1H, br s), 6.76 (1H, d, J = 8.3 Hz), 5.04 (2H, s), 4.75 (2H, s), 3.34 (1H, septet, J = 6.9 Hz), 1.42 (6H, d, J = 6.9 Hz); 13 C NMR (CDCl3, 100 MHz): δ 176.7, 165.3, 159.0, 158.9, 158.5, 137.7, 135.7 (2C), 131.3, 129.6, 129.3, 128.9, 128.4, 128.2 (2C), 120.9, 120.5, 116.1, 115.3, 114.7, 113.8, 110.1, 69.6, 59.3, 27.0, 20.5 (2C).

[0111] Example 4. Preparation of BAR2163, BAR2171, BAR2199, BAR2207 Starting with the alcohol BAR2120, alkylation with two different phenols and alkaline hydrolysis following the procedures previously described in Examples 2 and 3 (Scheme 2 or Scheme 3) afforded the carboxylic acids BAR2163, BAR2171, BAR2199, and BAR2207 (Scheme 4). [ka] a) PPh3, DIAD, phenol-COOCH3THF dry, 0°C; c) NaOH, MeOH:H2O 1:1 vol / vol.

[0112] Example 4A. Preparation of 4-((4'-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)-[1,1'-biphenyl]-3-yl)methoxy)benzoic acid (BAR2163) BAR2163 (t R = 13 min). BAR2163C 33 H 27 Cl2NO5 1 H NMR (CDCl3, 400 MHz): δ 7.60 (2H, d, J = 8.8 Hz), 7.55, (1H, br s), 7.51 (1H, d, J = 7.9 Hz), 7.46 (2H, d, J = 8.5 Hz), 7.42 (2H, d, J = 7.9 Hz), 7.40 (1H, t, ovl), 7.35 (1H, d, J = 7.5 Hz), 7.33 (1H, t, J = 7.9 Hz), 7.04 (2H, d, J = 8.8 Hz), 6.87 (2H, d, J = 8.5 Hz), 5.16 (2H, s), 4.77 (2H, s), 3.36 (1H, septet, J = 7.0 Hz), 1.44 (6H, d, J = 7.2 Hz); 13C NMR (CDCl3, 100 MHz): δ 176.4, 165.3, 160.0, 159.1, 157.9, 141.3, 136.2, 135.8 (2C), 134.0, 133.7, 131.1 (3C), 129.2, 128.2 (2C), 128.1 (2C), 127.8, 126.7, 125.8 (2C), 115.6 (2C), 115.0 (2C), 109.3, 70.3, 59.3, 27.1, 20.7 (2C).

[0113] Example 4B. Preparation of 3-((4'-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)-[1,1'-biphenyl]-3-yl)methoxy)benzoic acid (BAR2171) BAR2171 (t R = 20 min). BAR2171C 33 H 27 Cl2NO5 1 H NMR (CDCl3, 400 MHz): δ 7.51 (1H, br s), 7.51-7.22 (12H, ovl) 6.87 (2H, d, J = 8.4 Hz), 5.10 (2H, s), 4.78 (2H, s), 3.36 (1H, septet, J = 7.3 Hz), 1.44 (6H, d, J = 7.3 Hz); 13C NMR (CDCl3, 100 MHz): δ 176.5, 165.3, 159.1, 158.7, 157.9, 141.2, 136.3, 135.8 (2C), 133.8, 131.2, 130.4, 129.2, 128.2 (2C), 128.1 (2C), 126.7, 125.8 (2C), 124.8, 120.5, 118.7, 117.8, 115.1 (2C), 113.3, 109.4, 70.4, 59.5, 27.0, 20.7 (2C).

[0114] Example 4C. Preparation of 3-((4'-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)-[1,1'-biphenyl]-4-yl)methoxy)benzoic acid (BAR2199) BAR2199 (t R = 23 min). BAR2199C 33 H 27 Cl2NO5 1 H NMR (CDCl3, 400 MHz): δ 7.57 (1H, br s), 7.22-7.51 (12H, ovl), 6.87 (2H, d, J = 8.1 Hz), 5.16 (2H, s), 5.00 (2H, s), 3.33 (1H, septet, J = 7.0 Hz), 1.44 (6H, d, J = 7.0 Hz); 13C NMR (CDCl3, 100 MHz): δ 176.5, 169.3, 160.1, 159.3, 158.1, 141.0, 135.8 (2C), 135.6, 133.0, 131.2 (2C), 130.5 (2C), 130.1 (2C), 129.6, 128.7, 128.2 (2C), 128.1 (2C), 122.6, 119.5, 114.9 (2C), 114.4, 109.3, 70.6, 59.8, 27.0, 20.7 (2C).

[0115] Example 4D. Preparation of 4-((4'-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)-[1,1'-biphenyl]-4-yl)methoxy)benzoic acid (BAR2207) BAR2207 (t R = 15 min). BAR2207C 33 H 27 Cl2NO5 1 H NMR (CDCl3, 400 MHz): δ 8.02 (2H, d, J = 8.2 Hz), 7.61 (2H, d, J = 8.0 Hz), 7.47 (2H, d, J = 7.7 Hz), 7.40 (2H, d, J = 7.9 Hz), 7.39 (2H, d, J = 7.7 Hz), 7.32 (1H, t, J = 7.9 Hz), 7.03 (2H, d, J = 8.0 Hz), 6.90 (2H, d, J = 8.2 Hz), 5.20 (2H, s), 5.05 (2H, s), 3.33 (1H, septet, J = 7.0 Hz), 1.45 (6H, d, J = 7.0 Hz); 13C NMR (CDCl3, 100 MHz): δ 176.3, 165.5, 159.1, 158.7, 158.5, 141.1, 135.8 (2C), 133.0, 132.6, 131.7, 131.3 (2C), 131.2, 129.2 (2C), 129.1 (2C), 128.9, 128.2 (2C), 128.0 (2C), 115.4 (2C), 114.9 (2C), 109.3, 70.5, 59.3, 27.0, 20.7 (2C).

[0116] Example 5. Preparation of BAR2222 to BAR2226, BAR2227, and BAR2228 Following the same procedure as previously described for the synthesis of carboxylic acid BAR2119 (Scheme 1 and Example 12A), but instead changing the starting material (different aldehydes) or different β-ketoesters for isoxazole formation, BAR2222-BAR2226, BAR2227, and BAR2228, respectively, were synthesized.

[0117] Example 5A. Preparation of 4'-((3-(2-chlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)-[1,1'-biphenyl]-3-carboxylic acid (BAR2222) Pure BAR2222 (t R = 13.1 min). BAR2222C 26 H 22 ClNO4 1H NMR (CDCl3, 400 MHz): δ 8.27 (1H, br s) 8.04 (1H, d, J = 7.32 Hz), 7.75 (1H, d, J = 7.32 Hz), 7.48-7.51 (5H, m, ovl), 7.42 (1H, t, J = 7.41 Hz), 7.35 (1H, t, J = 7.41 Hz), 6.86 (2H, d, J = 8.05 Hz), 4.84 (2H, s), 3.35 (1H, septet, J = 6.93 Hz), 1.44 (6H, d, J = 6.93 Hz). 13 C NMR (CDCl3, 100 MHz): δ 176.5 (2C), 161.1, 157.6, 140.0, 133.3, 133.1, 131.7, 131.6, 130.9, 130.8, 129.7, 129.6, 128.2, 128.1(2C), 127.9, 127.8, 126.8, 114.8 (2C), 109.2, 59.4, 26.9, 20.6 (2C).

[0118] Example 5B. Preparation of 4'-((3-(2-bromophenyl)-5-isopropylisoxazol-4-yl)methoxy)-[1,1'-biphenyl]-3-carboxylic acid (BAR2223) Pure BAR2223 (t R = 12.6 min). BAR2223C 26 H 22 BrNO4 1H NMR (CDCl3, 400 MHz): δ 8.26 (1H, br s) 8.04 (1H, d, J = 7.85 Hz), 7.77 (1H, d, J = 7.85 Hz), 7.64 (1H, d, J=8.20 Hz), 7.53 (1H, t, J = 7.85 Hz), 7.51 (1H, t, ovl), 7.51 (2H, d, J = 8.61 Hz), 7.18 (1H, t, J = 8.20 Hz), 6.88 (2H, d, J = 8.61 Hz), 4.79 (2H, s), 3.37 (1H, septet, J = 7.07 Hz), 1.45 (6H, d, J = 7.07 Hz). 13 C NMR (CDCl3, 100 MHz): δ 176.6, 171.4, 162.6, 157.8,140.4, 133.6, 132.9, 131.8, 131.1, 130.4, 130.3, 128.5, 128.2, 128.13(2C), 128.1, 127.4, 126.2, 123.0, 115.1 (2C), 109.2, 59.6, 27.0, 20.7 (2C).

[0119] Example 5C. Preparation of 4'-((5-isopropyl-3-(2-trifluoromethyl)phenyl)isoxazol-4-yl)methoxy)-[1,1'-biphenyl]-3-carboxylic acid (BAR2224) Pure BAR2224 (t R = 10.8 min). BAR2224C 27 H 22 F3NO4 1H NMR (CDCl3, 400 MHz): δ 8.25 (1H, br s) 8.03 (1H, d, J = 7.90 Hz), 7.81 (1H, d, J = 7.66 Hz), 7.76 (1H, d, J = 7.66 Hz), 7.61 (1H, m, ovl), 7.60 (1H, m, ovl), 7.52-7.51 (4H, ovl), 6.88 (2H, d, J = 8.72 Hz), 4.72 (2H, s), 3.33 (1H, septet, J = 7.03 Hz), 1.44 (6H, d, J = 7.03 Hz). 13 C NMR (CDCl3, 100 MHz): δ 176.4, 171.0, 161.3, 158.1, 140.9, 133.1, 132.0, 131.8, 131.5, 129.9, 129.8, 129.7, 128.9, 128.4, 128.3, 128.2 (2C), 126.5, 126.4, 122.2, 115.1 (2C), 109.4, 59.1, 27.0, 20.8 (2C).

[0120] Example 5D. Preparation of 4'-((3-(2-bromo-6-chlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)-[1,1'-biphenyl]-3-carboxylic acid (BAR2225) Pure BAR2225 (t R = 36.7 min). BAR2225C 26 H 21 BrClNO4 1H NMR (CDCl3, 400 MHz): δ 8.23 ​​(1H, br s) 8.00 (1H, d, J = 7.77 Hz), 7.71 (1H, d, J = 7.77 Hz), 7.58 (1H, d, J = 7.77 Hz), 7.44-7.46 (4H, m, ovl), 7.23 (1H, t, J = 8.55 Hz), 6.85 (2H, d, J = 8.73 Hz), 4.76 (2H, br s), 3.35 (1H, septet, J = 7.03 Hz), 1.43 (6H, d, J = 7.03 Hz). 13 C NMR (CDCl3, 100 MHz): δ 176.4, 171.7, 160.6, 158.2, 140.9, 135.7, 133.0, 131.8, 131.6, 131.2, 129.7, 128.9, 128.6, 128.4, 128.3 (2C), 128.1 (2C), 125.0, 115.2 (2C), 109.1, 59.4, 27.0, 20.7 (2C).

[0121] Example 5E. Preparation of 4'-((3-(2,6-dibromophenyl)-5-isopropylisoxazol-4-yl)methoxy)-[1,1'-biphenyl]-3-carboxylic acid (BAR2226) Pure BAR2226 (t R = 13.3 min). 1H NMR (CDCl3, 400 MHz): δ 8.26 (1H, br s) 8.04 (1H, d, J = 7.77 Hz), 7.77 (1H, d, J = 7.77 Hz), 7.64 (2H, d, J = 8.08 Hz), 7.53 (1H, t, J = 7.77 Hz), 7.51 (2H, d, J = 8.78 Hz), 7.18 (1H, t, J = 8.08 Hz), 6.90 (2H, d, J = 8.78 Hz), 4.79 (2H, s), 3.37 (1H, septet, J = 7.03 Hz), 1.45 (6H, d, J = 7.03 Hz). 13 C NMR (CDCl3, 100 MHz): δ 176.5, 171.4, 161.9, 158.1, 140.7, 132.8, 131.9, 131.8, 130.8, 129.7, 128.7, 128.3, 128.2, 128.2 (2C), 124.9, 124.1, 123.9, 115.0 (2C), 108.9, 59.4, 27.1, 20.8 (2C).

[0122] Example 5F. Preparation of 4'-((3-(2,6-dichlorophenyl)-5-methylisoxazol-4-yl)methoxy)-[1,1'-biphenyl]-3-carboxylic acid (BAR2227) After step c, purification on silica gel gave BAR2227 (98%). The analytical sample (t) was purified by HPLC on a Luna C18 (5 μm; 4.6 mm i.d. × 250 mm) using a linear gradient of Buffer B from 40% to 95% in 13 min (Buffer A = 95% H2O:5 CH3CN:0.1 TFA; Buffer B = 95% CH3CN:5 H2O:0.1 TFA) as eluent (flow rate 1.5 mL / min). R = 13.3 min). BAR2227C 24 H 17 Cl2NO4 1H NMR (CDCl3, 400 MHz): δ 8.27 (1H, s), 8.04 (1H, d, J = 7.7 Hz), 7.77 (1H, d, J = 7.7 Hz), 7.51 (2H, d, J = 8.2 Hz), 7.53 (1H, t, J = 7.7 Hz), 7.43 (2H, d, J = 8.0 Hz), 7.34 (1H, t, J = 8.0 Hz), 6.89 (2H, d, J = 8.2 Hz), 4.80 (2H, s), 2.59 (3H, s); 13 C NMR (CDCl3, 100 MHz): δ 168.6, 165.4, 159.0, 158.1, 141.0, 135.8 (2C), 133.1, 131.8 (2C), 131.3, 129.0, 128.5, 128.4, 128.2 (2C), 128.1 (2C), 127.8, 115.1 (2C), 111.2, 59.7, 11.6.

[0123] Example 5G. Preparation of 4'-((3-(2,6-dichlorophenyl)-5-propylisoxazol-4-yl)methoxy)-[1,1'-biphenyl]-3-carboxylic acid (BAR2228) After step c, purification on silica gel gave BAR2228 (quantitative yield). The analytical sample (t) was purified by HPLC on a Luna C18 (5 μm; 4.6 mm i.d. × 250 mm) using a linear gradient of Buffer B from 40% to 95% in 13 min (Buffer A = 95 HO:5 CHCN:0.1 TFA; Buffer B = 95 CHCN:5 HO:0.1 TFA) as eluent (flow rate 1.5 mL / min). R = 14.7 min). BAR2228C 26 H 21 Cl2NO4 1H NMR (CDCl3, 400 MHz): δ8.26 (1H, s), 8.04 (1H, d, J = 7.8 Hz), 7.76 (1H, d, J = 7.8 Hz), 7.50 (2H, d, J = 8.5 Hz), 7.52 (1H, t, J = 7.8 Hz), 7.42 (2H, d, J = 8.0 Hz), 7.34 (1H, t, J = 8.0 Hz), 6.88 (2H, d, J = 8.5 Hz), 4.78 (2H, s), 2.91 (2H, t, J = 7.3 Hz), 1.86 (2H, sextet, J = 7.3 Hz), 1.04 (3H, t, J = 7.3Hz); 13 C NMR (CDCl3, 100 MHz): δ172.2, 165.2, 159.0, 158.1, 141.0, 135.8 (2C), 133.0, 131.9, 131.3 (2C), 129.0, 128.5, 128.4, 128.2 (2C), 128.1 (2C), 127.9, 115.1 (2C), 111.0, 59.5, 27.9, 21.1, 13.6.

[0124] Example 6. Biological activity The biological activity of selected compounds (Table 1 ) against the receptor FXR was tested in vitro using a reporter gene-transfected cell model in comparison with the control agonist chenodeoxycholic acid (CDCA), the major bile acid that serves as the endogenous ligand for the receptor.

[0125] HepG2 cells were cultured at 37°C in E-MEM medium (Earle's salts minimum essential medium) supplemented with 10% fetal bovine serum (FBS), 1% L-glutamine, and 1% penicillin / streptomycin. Transfection experiments were performed using the reagent Fugene HD (Promega) according to the manufacturer's instructions. Cells were cultured at 5 × 10 4 Cells / well were plated in 24-well plates.

[0126] HepG2 cells were transfected with 100 ng of vector pSG5-FXR, 100 ng of vector pSG5-RXR, 100 ng of vector pGL4.70 Renilla, a plasmid encoding the human Renilla gene, and 200 ng of the reporter vector p(hsp27)-TK-LUC, which contains the FXR response element IR1 cloned from the promoter of heat shock protein 27 (hsp27).

[0127] 24 hours after transfection, cells were stimulated with compounds and CDCA as a positive control. EC 50 To assess the effect of , dose-response curves were performed on HepG2 cells transfected as described and treated with increasing concentrations of compounds (0.1 μM, 0.5 μM, 1 μM, 2.5 μM, 5 μM, 7.5 μM, 10 μM, 12.5 μM, 25 μM, and 50 μM) (Table 1). After treatment, cells were lysed in 100 μL of lysis buffer (25 mM Tris-phosphate, pH 7.8; 2 mM DTT; 10% glycerol; 1% Triton X-100) and 10 μL of cell lysate from each sample was assayed for luciferase activity using the Dual Luciferase Reporter Assay System (Promega Italia Srl, Milan, Italy) according to the manufacturer's instructions. Luminescence was measured using a Glomax 20 / 20 luminometer (Promega Italia Srl, Milan, Italy). Luciferase activity (luciferase recording units, RLU) was normalized using Renilla activity (Renilla recording units, RRU).

[0128] FXR activation was also measured in a cell-free assay by Alpha Screen Technology in a Coactivator Recruitment Assay. GST-fused FXR-LBD was captured using anti-GST-coated acceptor beads, while biotinylated SRC-1 peptide was captured by streptavidin donor beads. Upon irradiation at 680 nm, chemical energy was transferred from the donor to the acceptor beads via the complex streptavidin-donor / SRC-1-biotin / GSTFXR-LBD / anti-GST-acceptor, generating a signal. The assay was performed in white low volume 384-well Optiplates (PerkinElmer) using a final volume of 25 μL containing purified GST-tagged FXR-LBD protein at a final concentration of 10 nM, 30 nM biotinylated SRC-1 peptide, 20 mg / mL anti-GST acceptor beads, and 10 mg / mL streptavidin donor beads (PerkinElmer). The assay buffer contained 50 mM Tris (pH 7.4), 50 mM KCl, and 1 mM DTT. The stimulation time with 1 μL of test compound (final concentration 5 μM each) was fixed at 30 min at room temperature. The concentration of DMSO in each well was maintained at a final concentration of 2%. After adding the detection mix (acceptor beads and donor beads), the plate was incubated in the dark at room temperature for 3 h and then read on an Envision microplate analyzer (PerkinElmer).

[0129] Table 1 reports the efficacy of selected compounds included in formula (I) in recruiting SRC-1 coactivators as a percentage of the maximum efficacy of the compound compared to CDCA, which is set as 100%. Results are expressed as the mean ± standard error of three independent measurements. Each ligand was tested at a concentration of 5 μM.

[0130] Table 1 shows the potency of selected compounds within formula (I) as calculated EC 50Values ​​are reported as μM. Results are expressed as mean ± standard error.

[0131] To examine the specificity of the compounds for PPARγ, HepG2 cells were transiently transfected with 200 ng of the reporter vector p(UAS)5XTKLuc, 100 ng of pGL4.70, and a vector containing the ligand-binding domain of the nuclear receptor PPARγ cloned upstream of the GAL4-DNA binding domain (pSG5-PPARγLBD-GAL4DBD).

[0132] To examine the specificity of compounds for GPBAR1, HEK-293T cells were transiently transfected with Fugene HD reagent (Promega) using the following vectors: pCMVSPORT6-humanGPBAR1, pGL4.29 (Promega), a reporter vector containing a cAMP response element (CRE) cloned upstream of the luciferase reporter gene luc2P, and pGL4.70.

[0133] To examine the specificity of compounds for LXRα- and LXRβ-mediated transactivation, HepG2 cells were transfected with 200 ng of the reporter vector p(UAS)5XTKLuc, 100 ng of a vector containing the ligand-binding domain of LXRα or LXRβ cloned upstream of the GAL4-DNA binding domain (i.e., pSG5-LXRαLBD-GAL4DBD or pSG5-LXRβLBD-GAL4DBD), and 100 ng of pGL4.70 (Promega), a vector encoding the human Renilla gene.

[0134] 24 hours after transfection, cells were stimulated with specific receptor agonists GW3965 (10 μM), rosiglitazone (500 nM), and TLCA (10 μM), respectively, or stimulated with compounds (10 μM).

[0135] After 18 hours of stimulation, cell lysates were assayed for luciferase and Renilla activity using the Dual Luciferase Reporter Assay System (E1980, Promega). Luminescence was measured using a Glomax 20 / 20 luminometer (Promega). Luciferase activity was normalized to Renilla activity.

[0136] None of the compounds belonging to formula (I) exhibited agonist / antagonist activity against LXR, PPARγ and GPBAR1.

[0137] RNA isolation and RT-PCR. HepG2 cells were cultured at 1 × 10 in a T25 flask. 6 Cells were plated at a density of 100 cells / flask. After overnight incubation, cells were starved and then stimulated with 10 μM GW3965 or compounds (0.1 μM, 1 μM, and 5 μM) for 18 hours.

[0138] Total RNA was isolated from HepG2 cells or liver tissues using TRIzol reagent according to the manufacturer's specifications. One microgram of purified RNA was treated with DNase-I and reverse transcribed with QuantiTect Reverse Transcription Kit (Qiagen). For real-time PCR, 10 ng of template was dissolved in 25 μL containing 200 nmol / L of each primer and 12.5 μL of 2×SYBR FAST Universal ready mix (Invitrogen). All reactions were performed in triplicate, and the thermal cycling conditions were as follows: 95°C for 2 min, followed by 40 cycles of 95°C for 20 s and 60°C for 30 s in a StepOnePlus (Applied Biosystems). Relative mRNA expression was calculated according to the Ct method. The sequences of the forward and reverse primers were as follows: human GAPDH: gaaggtgaaggtcggagt (SEQ ID NO: 1) and catgggtggaatcatattggaa (SEQ ID NO: 2); human SHP: gctgtctggagtccttctgg (SEQ ID NO: 3) and ccaatgatagggcgaaagaag (SEQ ID NO: 4); mouse GAPDH, ctgagtatgtcgtggagtctac (SEQ ID NO: 5) and gttggtggtgcaggatgcattg (SEQ ID NO: 6); mouse SHP acgatcctcttcaacccaga (SEQ ID NO: 7) and agggctccaagacttcacac (SEQ ID NO: 8); mouse FXR: agcttccagggtttcagaca (SEQ ID NO: 9) and cttccaacaggtctgcatga (SEQ ID NO: 10); mouse BSEP: gatgcttcccaagttcaagg (SEQ ID NO: 11) and taaagaggaaggcgatgagc (SEQ ID NO: 12).

[0139] Animals and protocols. C57BL / 6N male mice were from The Jackson's Laboratory. Mice were housed under controlled temperature (22°C) and photoperiod (12:12 h light / dark cycle), had unlimited access to standard mouse chow and tap water, and were acclimated to these conditions for at least 5 days before inclusion in the experiments. The experimental protocol was approved by the Animal Care Committee of the University of Perugia, as well as by the Italian Minister of Health and the Italian National Institute of Health (Italy), and agreed with the European guidelines for the use of laboratory animals (permit number 214 / 2017-PR). The general health of the animals was monitored daily by a veterinarian at the animal facility. To evaluate the success of in vivo intestinal absorption and hepatic transport, mice were administered 10 mg / kg BAR2109 dissolved in methylcellulose by oral gavage (OS) or intraperitoneal (IP) daily for 3 days. At the end of the treatment, the animals were sacrificed and blood and liver were collected for further analysis.

[0140] Microsomal stability. Male mouse (CD-1) liver microsomes (Sigma-Aldrich) were used. All incubations were performed in duplicate in a shaking water bath at 37 °C. The incubation mixture contained 1% DMSO used as vehicle, mouse liver microsomes (0.3 mg microsomal protein per mL), 5 mM MgCl2, 1 mM NADP, 5 mM glucose 6-phosphate, 0.4 U mL -1The mixture contained 1 μM of compound along with glucose 6-phosphate dehydrogenase and 50 mM potassium phosphate buffer (pH 7.4). Aliquots were removed at 0, 5, 10, 20, 30, and 40 min after microsome addition and the reaction was stopped by adding 200 μL of ice-cold acetonitrile. After 2 h, samples were centrifuged at 10,000 rpm for 10 min and the supernatant was transferred to a matrix tube for LC-MS / MS analysis. Propranolol, a drug known to have high hepatic clearance in rodents, was used as a quality control compound for the microsome incubation. The slope of the linear regression of the resulting curve (reporting the natural logarithm of the compound area versus incubation time (-k)) was calculated as t 1 / 2 =-ln(2) / k in vitro t 1 / 2 The in vitro intrinsic clearance (CL int (expressed as μL / min / mg) was calculated according to the following formula: Clint = reaction volume (μL) / t 1 / 2 (min) / mg liver microsomal protein. The percentage of unmodified compound is calculated assuming the area of ​​the compound peak at time 0 min is 100%.

[0141] [Table 1]

[0142] A preferred example of the general formula is BAR2119(Cl int 53μL / min / mg, t 1 / 2 (min)44), BAR2109(Cl int 32μL / min / mg, t 1 / 2 (min) 72) and BAR2123 (Cl int 35μL / min / mg, t 1 / 2 (min) 66), and the reference compound GW4064 (Cl int 56μL / min / mg, t 1 / 2 (min) 41), showing increased in vitro metabolic stability.

[0143] Preferred examples encompassed by the general formula are BAR2109 and BAR2123, which induce SHP mRNA expression 6.8-fold and 6.2-fold, respectively, at a concentration of 5 μM (reference compound GW4064 tested at a concentration of 10 μM; SHP mRNA expression induction=4.2-fold).

[0144] A preferred example encompassed by the general formula is BAR2109, which induces expression of hepatic SHP mRNA and BSEP mRNA when administered orally.

Claims

1. A compound of formula (I) or a pharma- ceutically acceptable salt thereof: 【Chemistry 1】 (In the formula, R １ and R ２ is H, halogen, and CF ３ Independently selected from the group consisting of: １ and R ２ At the same time, it is not H, R ３ is C １ ~C ３ Alkyl and halo-C １ ~C ３ alkyl, n is an integer selected from 1, 2, and 3; R ４ is unsubstituted phenyl, and unsubstituted or one R ５ biphenyl substituted with R ５ is COOR ６ , CN, hydroxy-C １ ~C ３ Alkyl, SO ２ CH ３ , C.F. ３ and unsubstituted or one R ７ -C substituted with １ ~C ３ alkyl-O-biphenyl; R ６ is H and C １ ~C ３ is selected from the group consisting of alkyl, R ７ is COOR ６ , CN, hydroxy-C １ ~C ３ Alkyl, SO ２ CH ３ and C.F. ３ is selected from the group consisting of However, the compound is not 4-((3-(2,6-dichlorophenyl)-5-isopropylisoxazol-4-yl)methoxy)benzoic acid.

2. R ４ but, 【Chemistry 2】 2. The compound of claim 1 selected from the group consisting of:

3. R ５ But COOH, COOCH ３ , CN, -CH ２ OH, SO ２ CH ３ , 【Chemistry 3】 3. The compound according to claim 1 or 2, selected from the group consisting of:

4. The following: 【Chemistry 4】 【change】 A compound selected from the group consisting of:

5. Compounds of formula (I): 【Chemistry 5】 (In the formula, R １ and R ２ is H, halogen, and CF ３ Independently selected from the group consisting of: １ and R ２ At the same time, it is not H, R ３ is C １ ~C ３ Alkyl and halo-C １ ~C ３ alkyl, n is an integer selected from 1, 2, and 3; R ４ is unsubstituted phenyl, and unsubstituted or one R ５ biphenyl substituted with R ５ is COOR ６ , CN, hydroxy-C １ ~C ３ Alkyl, SO ２ CH ３ , C.F. ３ and unsubstituted or one R ７ -C substituted with １ ~C ３ alkyl-O-biphenyl; R ６ is H and C １ ~C ３ is selected from the group consisting of alkyl, R ７ is COOR ６ , CN, hydroxy-C １ ~C ３ Alkyl, SO ２ CH ３ , and C.F. ３ 5. A pharmaceutical composition comprising a compound selected from the group consisting of:

6. A pharmaceutical comprising a compound of formula (I): 【Chemistry 6】 (In the formula, R １ and R ２ is H, halogen, and CF ３ Independently selected from the group consisting of: １ and R ２ At the same time, it is not H, R ３ is C １ ~C ３ Alkyl and halo-C １ ~C ３ alkyl, n is an integer selected from 1, 2, and 3; R ４ is unsubstituted phenyl, and unsubstituted or one R ５ biphenyl substituted with R ５ is COOR ６ , CN, hydroxy-C １～ C ３ Alkyl, SO ２ CH ３ , C.F. ３ and unsubstituted or one R ７ C substituted with １ ~C ３ alkyl-O-biphenyl; R ６ is H and C １ ~C ３ is selected from the group consisting of alkyl, R ７ is COOR ６ , CN, hydroxy-C １ ~C ３ Alkyl, SO ２ CH ３ , and C.F. ３ or pharma- ceutically acceptable salts and solvates thereof.

7. The following: 【Chemistry 7】 【change】 A pharmaceutical comprising a compound selected from the group consisting of:

8. The pharmaceutical composition according to claim 6 or 7, which is for the prevention and / or treatment of a disorder selected from the group consisting of gastrointestinal disorders, liver disorders, cardiovascular disorders, vascular disorders, pulmonary disorders, metabolic conditions, infectious diseases, cancer, renal disorders, inflammatory disorders including immune-mediated disorders, and neurological disorders.

9. The disorders include systemic lupus erythematosus, rheumatoid arthritis, Sjogren's syndrome, scleroderma, spondyloarthritis, vasculitis, sarcoidosis, Mediterranean fever, polymyositis and dermatomyositis, Behcet's syndrome, acquired immune deficiency and related disorders, viral B and viral C infections, Alzheimer's disease and other dementias, Parkinson's disease and other movement disorders, amyotrophic lateral sclerosis and other motor neuron disorders, multiple sclerosis and other demyelinating diseases, myasthenia and muscular dystrophies, primary biliary cirrhosis, cerebrotendinous xanthomas, and cerebrotendinous xanthomas. cholangitis, primary sclerosing cholangitis, drug-induced cholestasis, intrahepatic cholestasis of pregnancy, cholestasis associated with parenteral nutrition, cholestasis associated with bacterial proliferation or sepsis, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, nonalcoholic fatty liver disease, nonalcoholic steatohepatitis, liver transplantation, congenital hepatic fibrosis, hepatic granulomatous disease, intrahepatic or extrahepatic malignancies, Wilson's disease, hemochromatosis, alpha 1-antitrypsin deficiency, inflammatory bowel disease, Crohn's disease, ulcerative colitis, indeterminate colitis , irritable bowel syndrome, bacterial overgrowth, acute and chronic pancreatitis, malabsorption, post-irradiation colitis, microscopic colitis, diabetic nephropathy, hypertensive nephropathy, chronic glomerulonephritis, chronic graft glomerulonephritis, chronic tubulointerstitial disease, renal vascular disease, atherosclerosis, arteriosclerosis, dyslipidemia, hypercholesterolemia, hypertriglyceridemia, arterial hypertension, cardiac inflammatory disorders, myocarditis, endocarditis, cardiac ischemia, stable angina, unstable angina, myocardial infarction, cerebrovascular disease, ischemic stroke, pulmonary hypertension, peripheral arterial disease 9. The pharmaceutical composition according to claim 8, characterized in that the therapeutic agent is selected from the group consisting of peripheral arterial occlusive disease, obstructive peripheral arteriopathy, asthma, cystic fibrosis, respiratory obstructive disease, interstitial lung disease, primary or secondary pulmonary fibrosis, insulin resistance, metabolic syndrome, type I and type II diabetes mellitus, hypoglycemia, disorders of the adrenal cortex, adrenal insufficiency, obesity, conditions associated with bariatric surgery, liver cancer, cancer of the bile duct, esophageal cancer, pancreatic cancer, gastric cancer, colorectal cancer, breast cancer, ovarian cancer, and conditions associated with resistance to chemotherapy.

Images