Fusion peptide in which the antigen is linked to a small fragment of the invariant chain (CD74)

Abstract

Polynucleotides encoding antigen sequences and invariant chain fragments are provided. [Solution] A polynucleotide encoding a fusion protein containing a polypeptide, wherein the polypeptide consists of an antigen sequence and a fragment of an invariant chain operably linked to the antigen sequence, the invariant chain fragment consisting of 80 residues or less and including a sequence of at least 5 consecutive residues from residues 77-92 of a specific sequence.

Description

[Technical field]

[0001] This document relates to polynucleotides encoding antigen sequences and invariant chain fragments, as well as fusion proteins encoded by said polynucleotides, and viral vectors containing said polynucleotides. [Background technology]

[0002] Infectious diseases remain a major threat to mankind. One way to prevent or treat infectious diseases is to artificially induce an immune response by vaccination, which involves administering antigenic material to an individual to generate an adaptive immune response against the respective antigen. The antigenic material can be a structurally intact but inactivated (i.e. non-infectious) pathogen, or an attenuated (i.e. reduced infectivity) pathogen (e.g. microorganism or virus), or a purified component of a pathogen that has been found to be highly immunogenic. Another approach to induce an immune response against a pathogen is the provision of an expression system comprising one or more vectors that encode the immunogenic proteins of the pathogen. Such vectors may take the form of naked plasmid DNA, but the immunogenic proteins can also be delivered using viral vectors, for example based on modified vaccinia viruses (e.g. Modified Vaccinia Ankara; MVA) or adenovirus vectors. Such expression systems have the advantage of containing well-characterized components that have low sensitivity to environmental conditions.

[0003] A specific goal in developing vector-based expression systems is that application of such expression systems to patients will induce a protective immune response against infection by a particular pathogen. However, some expression systems, although they induce an immunogenic response against a pathogen, are unable to induce a strong immune response (e.g., strong enough to completely prevent infection by the pathogen). Thus, there remains a need for improved expression systems capable of inducing a strong immune response against pathogens.

[0004] Antigens are substances that induce immune responses in the body, in particular antibody production. Antigens are presented on the surface of antigen-presenting cells by MHC molecules. Antigens can be foreign, i.e. of pathogenic origin, or derived from the organism itself, the latter being called self-antigens. There are two classes of MHC molecules, MHC class I (MHC-I) and MHC class II (MHC-II). MHC-I molecules present peptide molecules that are synthesized within the respective cell. MHC-II molecules present peptide fragments that have been ingested by phagocytosis and subsequently digested in endosomes. Typically, MHC-II molecules are expressed only by "professional" antigen-presenting cells, such as macrophages and dendritic cells. Antigens bound to MHC-II molecules are recognized by helper T cells. Binding of the T cell receptor of helper T cells to antigens presented by MHC-II molecules, together with cytokines secreted by antigen-presenting cells, induces maturation of immature helper T cells of Th0 phenotype into various types of effector cells.

[0005] MHC-I molecules bind peptides that arise mainly from the degradation of cytoplasmic proteins by the proteasome. The MHC-I:peptide complex is then inserted into the cell membrane on the outside of the cell via the endoplasmic reticulum. Epitope peptides are bound to the extracellular part of the class I MHC molecule. Thus, the function of class I MHC is to display intracellular proteins to cytotoxic T cells (CTLs). However, class I MHC can also present peptides arising from foreign proteins, in a process known as cross-presentation. Normal cells display peptides arising from the turnover of normal cellular proteins on their class I HMCs, but CTLs are not activated accordingly, thanks to central and peripheral tolerance mechanisms. When cells express foreign proteins, for example after viral infection, some class I MHCs display these peptides on the cell surface. As a result, CTLs specific for that MHC:peptide complex can recognize and kill the presenting cell.

[0006] MHC-II molecules are membrane-bound receptors that are synthesized in the endoplasmic reticulum and exit the endoplasmic reticulum in MHC class II compartments. To prevent endogenous peptides, i.e., self-antigens, from binding to MHC-II molecules, nascent MHC-II molecules bind to another protein, the invariant chain, which blocks the peptide-binding groove of the MHC-II molecule. When the MHC class II compartment fuses with late endosomes containing phagocytosed and digested proteins, the invariant chain is cleaved, leaving only the CLIP region bound to the MHC-II molecule. In a second step, CLIP is released by HLA-DM molecules, which free the MHC-II molecule to bind fragments of foreign antigens. When the MHC class II compartment fuses with the cell membrane, the fragments are presented on the surface of antigen-presenting cells, resulting in presentation of foreign antigens to other cells, primarily helper T cells.

[0007] Immune responses to antigens are increased when adenoviral expression systems encoding the invariant chain and fusions of said antigens are used for vaccination (see WO2007 / 062656, also published as US2011 / 0293704, which is incorporated herein by reference for purposes of revealing the invariant chain sequence), i.e., the invariant chain is known to enhance the immunogenicity of antigens. Furthermore, said adenoviral constructs have been found to be useful in stimulating immune responses in the context of prime-boost vaccination regimens (see WO2014 / 141176, also published as US2016 / 0000904: and WO2010 / 057501, which are also incorporated herein by reference for purposes of revealing the invariant chain sequence and vectors encoding the invariant chain sequence). [Prior art documents] [Patent documents]

[0008] [Patent Document 1] US Patent Application Publication No. 2011 / 0293704 [Patent Document 2] International Publication No. 2007 / 062656 Brochure [Patent Document 3] US Patent Application Publication No. 2016 / 0000904 [Patent Document 4] International Publication No. 2014 / 141176 Brochure [Patent Document 5] International Publication No. 2010 / 057501 Brochure Summary of the Invention

[0009] The inventors have surprisingly found that certain small fragments of the invariant chain also have the ability to enhance the immunogenicity of an antigen. In certain embodiments, it has been found that certain fragments of the invariant chain provide substantially the same immunogenicity enhancement effect as the full-length invariant chain. In yet other specific embodiments, it has been found that certain fragments of the invariant chain provide a higher immunogenicity enhancement effect than the full-length invariant chain.

[0010] While such fragments may provide some immunogenicity, or may maintain about the same or even greater immunogenicity than the full-length invariant chain, they are superior in various ways to the full-length invariant chain. For example, fragments may have a lower risk of unintended immunological consequences, such as potentially anaphylactic shock, or antigen mimicry that may lead to anti-self immune responses. Moreover, many otherwise favorable host vectors may have limited insertion space, and so the fragments of the invention represent smaller invariant chain-derived inserts that provide additional space in the host vector for antigens or other components.

[0011] Embodiments of the present invention are believed to have one or more of the following advantages over related approaches described in the prior art: (i) an increase in immune response (such as CD4 T cell and / or CD8 T cell and / or antibody response); (ii) a broader immune response; (iii) increasing the duration of the immune response; (iv) reducing the risk of harmful and / or unintended immune responses; (v) Increasing the space available for incorporation of additional nucleic acids into the vector.

[0012] In one embodiment of the invention, a fusion protein is provided comprising a polypeptide, the polypeptide consisting of a fragment of the invariant chain operably linked to an antigen sequence, the invariant chain fragment consisting of: (a) a portion of residues 17-97 of SEQ ID NO:1, said portion containing at least five contiguous residues from residues 77-92 of SEQ ID NO:1; (b) contains a sequence of at least 5 consecutive residues, no longer than 80 residues, which sequence shares at least 80% identity with at least 5 consecutive residues derived from residues 77-92 of SEQ ID NO:1; (c) residues 1-97 of SEQ ID NO:1; (d) 91 to 103 residues that share at least 95% identity with residues 1-97 of SEQ ID NO:1; (e) residues 17-97 of SEQ ID NO:1; (f) 76 to 84 residues that share at least 95% identity with residues 17-97 of SEQ ID NO:1; (g) residues 1-92 of SEQ ID NO:1; (h) 88 to 96 residues that share at least 95% identity with residues 1-92 of SEQ ID NO:1; (i) residues 17-92 of SEQ ID NO:1; or (j) 71 to 79 residues that share at least 95% identity with residues 17-92 of SEQ ID NO:1.

[0013] In another embodiment of the invention there is provided a polynucleotide encoding a fusion protein containing a polypeptide, the polypeptide consisting of a fragment of the invariant chain operably linked to an antigen sequence, the invariant chain fragment consisting of: (a) a portion of residues 17-97 of SEQ ID NO:1, said portion containing at least five contiguous residues from residues 77-92 of SEQ ID NO:1; (b) contains a sequence of at least 5 consecutive residues, no longer than 80 residues, which sequence shares at least 80% identity with at least 5 consecutive residues derived from residues 77-92 of SEQ ID NO:1; (c) residues 1-97 of SEQ ID NO:1; (d) 91 to 103 residues that share at least 95% identity with residues 1-97 of SEQ ID NO:1; (e) residues 17-97 of SEQ ID NO:1; (f) 76 to 84 residues that share at least 95% identity with residues 17-97 of SEQ ID NO:1; (g) residues 1-92 of SEQ ID NO:1; (h) 88 to 96 residues that share at least 95% identity with residues 1-92 of SEQ ID NO:1; (i) residues 17-92 of SEQ ID NO:1; or (j) 71 to 79 residues that share at least 95% identity with residues 17-92 of SEQ ID NO:1.

[0014] In another embodiment of the invention, a viral vector is provided that contains a polynucleotide encoding a fusion protein containing a polypeptide, the polypeptide consisting of a fragment of the invariant chain operably linked to an antigenic sequence, the invariant chain fragment consisting of: (a) a portion of residues 17-97 of SEQ ID NO:1, said portion containing at least five contiguous residues from residues 77-92 of SEQ ID NO:1; (b) contains a sequence of at least 5 consecutive residues, no longer than 80 residues, which sequence shares at least 80% identity with at least 5 consecutive residues derived from residues 77-92 of SEQ ID NO:1; (c) residues 1-97 of SEQ ID NO:1; (d) 91 to 103 residues that share at least 95% identity with residues 1-97 of SEQ ID NO:1; (e) residues 17-97 of SEQ ID NO:1; (f) 76 to 84 residues that share at least 95% identity with residues 17-97 of SEQ ID NO:1; (g) residues 1-92 of SEQ ID NO:1; (h) 88 to 96 residues that share at least 95% identity with residues 1-92 of SEQ ID NO:1; (i) residues 17-92 of SEQ ID NO:1; or (j) 71 to 79 residues that share at least 95% identity with residues 17-92 of SEQ ID NO:1. [Brief description of the drawings]

[0015] [Figure 1] Schematic diagram of mouse Ii and human Ii isoforms. [Diagram 2] Schematic diagram of the mouse Ii fragment fused to OVA (ovalbumin) contained in the Ad5 construct. [Diagram 3] Immune response (number of IFN-γ producing T cells per million splenocytes) elicited in mice by mouse Ii fragment fused to OVA contained in an Ad5 construct. [Figure 4] Antigen presentation of ovalbumin peptide SIINFEKL on MHC class I 24 hours after infection of BMDCs with Ad5 vectors encoding the full-length mIi sequence or the short sequences 1-50, 1-75, and 50-215 linked to OVA. Antigen presentation is expressed as the percentage ratio of CD11+ / SIINFEKL+ cells after infection with Ad5-mIi and mIi variants relative to Ad5-Ova control. [Diagram 5] Schematic diagram of mIi(1-75) and mIi(50-75) fused to OVA contained in the Ad5 construct. [Figure 6] Immune responses (IFN-γ producing T cells per million splenocytes) elicited by mouse Ii fragments 1-75 and 50-75 fused to OVA contained in an Ad5 construct. [Figure 7] Antigen presentation of ovalbumin peptide SIINFEKL on MHC class I 24 hours after infection of BMDC with Ad5 vectors encoding short mIi sequences 1-75 and 50-75 linked to OVA. Antigen presentation is expressed as the percentage ratio of CD11+ / SIINFEKL+ cells after infection with Ad5-mIi and mIi variants relative to Ad5-Ova control. [Figure 8]Immune responses (number of IFN-γ-producing T cells per million splenocytes) elicited by PanAd5 constructs containing MAGE A3 alone and the same constructs containing the fusions hIi(full length)-MAGE A3, hIi(1-97)-MAGE A3, and hIi(17-97)-MAGE A3. [Figure 9] Immune responses (number of IFN-γ-producing T cells per million splenocytes) elicited by ChAd3 constructs containing HCV-NS alone and the same constructs containing the fusions hIi(full length)-HCV-NS, hIi(1-97)-HCV-NS, and hIi(17-97)-HCV-NS. [Figure 10A] (FIGS. 10A-10B) Western blot showing targeting of Ii antigen to the proteasome via the ubiquitin signal by mIi sequences 1-75 and 1-50 linked to OVA contained in the Ad5 construct. [Figure 10B] (FIGS. 10A-10B) Western blot showing targeting of Ii antigen to the proteasome via the ubiquitin signal by mIi sequences 1-75 and 1-50 linked to OVA contained in the Ad5 construct. [Figure 11] Western blot showing targeting of Ii antigen to the proteasome via the ubiquitin signal by the mIi full-length sequence or the short sequences 1-75 and 50-75 linked to OVA contained in the Ad5 construct. [Figure 12A] (FIGS. 12A-12J) Alignment of the polypeptide sequences of invariant chains from various organisms. [Figure 12B] (FIGS. 12A-12J) Alignment of the polypeptide sequences of invariant chains from various organisms. [Figure 12C] (FIGS. 12A-12J) Alignment of the polypeptide sequences of invariant chains from various organisms. [Figure 12D] (FIGS. 12A-12J) Alignment of the polypeptide sequences of invariant chains from various organisms. [Figure 12E](FIGS. 12A-12J) Alignment of the polypeptide sequences of invariant chains from various organisms. [Figure 12F] (FIGS. 12A-12J) Alignment of the polypeptide sequences of invariant chains from various organisms. [Figure 12G] (FIGS. 12A-12J) Alignment of the polypeptide sequences of invariant chains from various organisms. [Figure 12H] (FIGS. 12A-12J) Alignment of the polypeptide sequences of invariant chains from various organisms. [Figure 12I] (FIGS. 12A-12J) Alignment of the polypeptide sequences of invariant chains from various organisms. [Figure 12J] (FIGS. 12A-12J) Alignment of the polypeptide sequences of invariant chains from various organisms. [Figure 13] Alignment of fragments of invariant chain from various organisms corresponding to residues 1-97 of the human p35 invariant chain. [Figure 14] Alignment of fragments of invariant chain from various organisms corresponding to residues 67-92 of the human p35 invariant chain. [Figure 15] Schematic diagram of mIi(50-75), mIi(28-75), mIi(55-75) and mIi(60-75) fused to OVA contained in the Ad5 construct. [Figure 16] Immune responses (number of IFN-γ-producing T cells per million splenocytes) elicited by mIi(50-75), mIi(28-75), mIi(55-75) and mIi(60-75) fused to OVA contained in the Ad5 construct. [Figure 17] Immune responses (IFN-γ producing T cells per million splenocytes) elicited by mutant full-length invariant chain and mutant invariant chain fragments fused to OVA contained in Ad5 constructs.

[0016] A brief description of the sequence identifier SEQ ID NO: 1 Amino acid sequence of human invariant chain isoform p35 SEQ ID NO:2 Nucleotide sequence encoding human invariant chain isoform p35 SEQ ID NO: 3: Amino acid sequence of human invariant chain isoform p33 SEQ ID NO: 4 Nucleotide sequence encoding a MAGE antigen SEQ ID NO: 5 Amino acid sequence of human invariant chain isoform p43 SEQ ID NO:6 Nucleotide sequence encoding human invariant chain isoform p43 SEQ ID NO: 7 Amino acid sequence of human invariant chain isoform p41 SEQ ID NO:8 Nucleotide sequence encoding the OVA antigen SEQ ID NO: 9 Amino acid sequence of human invariant chain isoform c SEQ ID NO: 10 Nucleotide sequence encoding human invariant chain isoform c SEQ ID NO: 11: Amino acid sequence of mouse invariant chain p31 SEQ ID NO: 12 Nucleotide sequence encoding mouse invariant chain p31 SEQ ID NO: 13: Amino acid sequence of mouse invariant chain p41 SEQ ID NO: 14 Nucleotide sequence encoding mouse invariant chain p41 SEQ ID NO: 15 Amino acid sequence of the guinea pig (Cavia porcellus) invariant chain (UniProt accession number H0UZ94) SEQ ID NO: 16: Amino acid sequence of the naked mole rat (Heterocephalus glaber) invariant chain (UniProt accession number G5C391) SEQ ID NO: 17 Amino acid sequence of the Damaraland mole rat (Fukomys damarensis) invariant chain (UniProt accession number A0A091E9W3) SEQ ID NO: 18: Amino acid sequence of Rattus norvegicus second isoform invariant chain (UniProt accession number P10247-2) SEQ ID NO: 19: Amino acid sequence of Rattus norvegicus isoform 1 invariant chain (UniProt accession number P10247) SEQ ID NO: 20 Amino acid sequence of the Myotis lucifugus invariant chain (UniProt accession number G1QEN4) SEQ ID NO: 21: Amino acid sequence of the invariant chain of Myotis davidii (UniProt accession number L5LQM9) SEQ ID NO: 22: Amino acid sequence of the Myotis brandtii invariant chain (UniProt accession number S7N2W2) SEQ ID NO: 23: Amino acid sequence of the invariant chain of the Japanese flying fox (Pteropus alecto) (UniProt accession number L5L1G3) SEQ ID NO: 24: Amino acid sequence of the western chimpanzee (Pan troglodytes verus) invariant chain (UniProt accession number A5A6L4) SEQ ID NO: 25: Amino acid sequence of the Sumatran orangutan (Pongo abelii) invariant chain (UniProt accession number Q5RFJ4) SEQ ID NO: 26: Amino acid sequence of the chimpanzee (Pan troglodytes) invariant chain (UniProt accession number H2QRT2) SEQ ID NO: 27: Amino acid sequence of the western lowland gorilla (Gorilla gorilla gorilla) invariant chain (UniProt accession number G3R7S6) SEQ ID NO: 28: Amino acid sequence of the Nomascus leucogenys invariant chain (UniProt accession number G1RHB8) SEQ ID NO: 29: Amino acid sequence of the invariant chain of Macaca mulatta (UniProt accession number I0FWR3) SEQ ID NO: 30 Amino acid sequence of Macaca fascicularis invariant chain (UniProt accession number G7P8P8) SEQ ID NO: 31 Amino acid sequence of the Macaca mulatta invariant chain (UniProt accession number G7MVM5) SEQ ID NO: 32 Amino acid sequence of the invariant chain of Macaca mulatta (UniProt accession number I0FWR4) SEQ ID NO: 33: Amino acid sequence of the Macaca mulatta invariant chain (UniProt accession number F7E9S4) SEQ ID NO: 34: Amino acid sequence of Papio anubis invariant chain (UniProt accession number A0A096MM48) SEQ ID NO: 35: Amino acid sequence of the green monkey (Chlorocebus sabaeus) invariant chain (UniProt accession number A0A0D9RGK4) SEQ ID NO: 36: Amino acid sequence of the common marmoset (Callithrix jacchus) invariant chain (UniProt accession number F7ENM4) SEQ ID NO: 37: Amino acid sequence of Felis catus invariant chain (UniProt accession number M3VXS2) SEQ ID NO: 38 Amino acid sequence of the ferret (Mustela putorius furo) invariant chain (UniProt accession number M3YQS4) SEQ ID NO: 39: Amino acid sequence of the African elephant (Loxodonta africana) invariant chain (UniProt accession number G3TJE1) SEQ ID NO: 40: Amino acid sequence of the African elephant (Loxodonta africana) invariant chain (UniProt accession number G3U7Y6) SEQ ID NO: 41 Amino acid sequence of the wild boar (Sus scrofa) invariant chain (UniProt accession number Q764N1) SEQ ID NO: 42 Amino acid sequence of the Camelus ferus invariant chain (UniProt accession number S9XLT6) SEQ ID NO: 43 Amino acid sequence of Bos mutus invariant chain (UniProt accession number L8I7V9) SEQ ID NO: 44 Amino acid sequence of the bovine (Bos taurus) invariant chain (UniProt accession number Q7JFY1) SEQ ID NO: 45 Amino acid sequence of the bovine (Bos taurus) invariant chain (UniProt accession number Q29630) SEQ ID NO: 46: Amino acid sequence of the horse (Equus caballus) invariant chain (UniProt accession number F6TGS3) SEQ ID NO: 47: Amino acid sequence of the horse (Equus caballus) invariant chain (UniProt accession number Q9MXD5) SEQ ID NO: 48: Amino acid sequence of the Oryctolagus cuniculus invariant chain (UniProt accession number G1SKK3) SEQ ID NO: 49: Amino acid sequence of the Otolemur garnettii invariant chain (UniProt accession number H0WQB3) SEQ ID NO: 50 Amino acid sequence of the Tupaia chinensis invariant chain (UniProt accession number L9KN01)

[0017] SEQ ID NO: 51: Amino acid sequence of the invariant chain of Ictidomys tridecemlineatus (UniProt accession number I3MCR9) SEQ ID NO: 52: Amino acid sequence of the Tasmanian devil (Sarcophilus harrisii) invariant chain (UniProt accession number G3X0Q6) SEQ ID NO: 53 Amino acid sequence of residues 17-97 of human p35 invariant chain SEQ ID NO: 54: Amino acid sequence of the region of the mouse p31 invariant chain corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 55: Amino acid sequence of the region of the African elephant (Loxodonta africana) invariant chain (UniProt Accession No. G3TJE1) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 56: Amino acid sequence of the region of the Felis catus invariant chain (UniProt accession number M3VXS2) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 57: Amino acid sequence of the region of the horse (Equus caballus) invariant chain (UniProt Accession No. F6TGS3) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 58: Amino acid sequence of the region of the Camelus ferus invariant chain (UniProt Accession No. S9XLT6) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 59: Amino acid sequence of the region of the Sus scrofa invariant chain (UniProt Accession No. Q764N1) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 60: Amino acid sequence of the region of the ferret (Mustela putorius furo) invariant chain (UniProt Accession No. M3YQS4) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 61: Amino acid sequence of the region of the Macaca mulatta invariant chain (UniProt accession number I0FWR3) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 62: Amino acid sequence of the region of the Macaca fascicularis invariant chain (UniProt Accession No. G7P8P8) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 63: Amino acid sequence of the region of the green monkey (Chlorocebus sabaeus) invariant chain (UniProt accession number A0A0D9RGK4) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 64: Amino acid sequence of the region of the Papio anubis invariant chain (UniProt accession number A0A096MM48) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 65: Amino acid sequence of the region of the western chimpanzee (Pan troglodytes verus) invariant chain (UniProt Accession No. A5A6L4) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 66: Amino acid sequence of the region of the Gorilla gorilla gorilla invariant chain (UniProt Accession No. G3R7S6) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 67: Amino acid sequence of the region of the Nomascus leucogenys invariant chain (UniProt Accession No. G1RHB8) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 68: Amino acid sequence of the region of the Sumatran orangutan (Pongo abelii) invariant chain (UniProt accession number Q5RFJ4) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 69: Amino acid sequence of the region of the common marmoset (Callithrix jacchus) invariant chain (UniProt Accession No. F7ENE8) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 70 Amino acid sequence of the region of the Myotis lucifugus invariant chain (UniProt Accession No. G1QEN4) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 71: Amino acid sequence of the region of the Myotis davidii invariant chain (UniProt accession number L5LQM9) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 72 Amino acid sequence of the region of the Bos mutus invariant chain (UniProt Accession No. L8I7V9) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 73: Amino acid sequence of the region of the Bos taurus invariant chain (UniProt Accession No. Q29630) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 74: Amino acid sequence of the region of the Myotis brandtii invariant chain (UniProt Accession No. S7N2W2) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 75: Amino acid sequence of the region of the naked mole rat (Heterocephalus glaber) invariant chain (UniProt accession number G5C391) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 76: Amino acid sequence of the region of the Fukomys damarensis invariant chain (UniProt accession number A0A091E9W3) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 77: Amino acid sequence of the region of the guinea pig (Cavia porcellus) invariant chain (UniProt Accession No. H0UZ94) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 78: Amino acid sequence of the region of the Oryctolagus cuniculus invariant chain (UniProt Accession No. G1SKK3) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 79: Amino acid sequence of the region of the Pteropus alecto invariant chain (UniProt Accession No. L5L1G3) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 80: Amino acid sequence of the region of the Rattus norvegicus second isoform invariant chain (UniProt Accession No. P10247-2) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 81: Amino acid sequence of the region of the Tupaia chinensis invariant chain (UniProt Accession No. L9KN01) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 82: Amino acid sequence of the region of the Ictidomys tridecemlineatus invariant chain (UniProt Accession No. I3MCR9) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 83: Amino acid sequence of the region of the Otolemur garnettii invariant chain (UniProt Accession No. H0WQB3) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 84: Amino acid sequence of the region of the Tasmanian devil (Sarcophilus harrisii) invariant chain (UniProt Accession No. G3X0Q6) corresponding to residues 17-97 of the human p35 invariant chain SEQ ID NO: 85 Amino acid sequence of residues 67-92 of human p35 invariant chain SEQ ID NO: 86: Amino acid sequence of the region of the mouse p31 invariant chain corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO: 87: Amino acid sequence of the region of the ferret (Mustela putorius furo) invariant chain (UniProt Accession No. M3YQS4) corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO: 88: Amino acid sequence of the region of the Myotis brandtii invariant chain (UniProt Accession No. S7N2W2) corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO: 89: Amino acid sequence of the region of the Pteropus alecto invariant chain (UniProt Accession No. L5L1G3) corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO: 90 Amino acid sequence of the region of the Damaraland mole rat (Fukomys damarensis) invariant chain (UniProt accession number A0A091E9W3) corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO: 91: Amino acid sequence of the region of the Ictidomys tridecemlineatus invariant chain (UniProt Accession No. I3MCR9) corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO: 92 Amino acid sequence of the region of the Bos mutus invariant chain (UniProt Accession No. L8I7V9) corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO: 93: Amino acid sequence of the region of the naked mole rat (Heterocephalus glaber) invariant chain (UniProt accession number G5C391) corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO: 94: Amino acid sequence of the region of the Myotis davidii invariant chain (UniProt accession number L5LQM9) corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO: 95: Amino acid sequence of the region of the Tupaia chinensis invariant chain (UniProt Accession No. L9KN01) corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO: 96: Amino acid sequence of the region of the Myotis lucifugus invariant chain (UniProt Accession No. G1QEN4) corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO: 97: Amino acid sequence of the region of the Rattus norvegicus second isoform invariant chain (UniProt Accession No. P10247-2) corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO: 98 Amino acid sequence of the region of the Bos taurus invariant chain (UniProt Accession No. Q29630) corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO: 99: Amino acid sequence of the region of the Otolemur garnettii invariant chain (UniProt Accession No. H0WQB3) corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO: 100: Amino acid sequence of the region of the Cavia porcellus invariant chain (UniProt Accession No. H0UZ94) that corresponds to residues 67-92 of the human p35 invariant chain

[0018] SEQ ID NO: 101: Amino acid sequence of the region of the common marmoset (Callithrix jacchus) invariant chain (UniProt accession number F7ENE8) corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO: 102: Amino acid sequence of the region of the Nomascus leucogenys invariant chain (UniProt Accession No. G1RHB8) corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO: 103: Amino acid sequence of the region of the Gorilla gorilla gorilla invariant chain (UniProt Accession No. G3R7S6) corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO: 104: Amino acid sequence of the region of the Sumatran orangutan (Pongo abelii) invariant chain (UniProt accession number Q5RFJ4) corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO: 105: Amino acid sequence of the region of the western chimpanzee (Pan troglodytes verus) invariant chain (UniProt Accession No. A5A6L4) corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO: 106: Amino acid sequence of the region of the Macaca mulatta invariant chain (UniProt accession number I0FWR3) corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO: 107: Amino acid sequence of the region of the Macaca fascicularis invariant chain (UniProt Accession No. G7P8P8) corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO: 108: Amino acid sequence of the region of the green monkey (Chlorocebus sabaeus) invariant chain (UniProt accession number A0A0D9RGK4) corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO: 109: Amino acid sequence of the region of the Papio anubis invariant chain (UniProt accession number A0A096MM48) corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO: 110: Amino acid sequence of the region of the African elephant (Loxodonta africana) invariant chain (UniProt Accession No. G3TJE1) corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO:111: Amino acid sequence of the region of the Felis catus invariant chain (UniProt accession number M3VXS2) corresponding to residues 67-92 of the human p35 invariant chain. SEQ ID NO:112: Amino acid sequence of the region of the Equus caballus invariant chain (UniProt accession number F6TGS3) corresponding to residues 67-92 of the human p35 invariant chain. SEQ ID NO: 113: Amino acid sequence of the region of the Sus scrofa invariant chain (UniProt Accession No. Q764N1) corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO: 114: Amino acid sequence of the region of the Oryctolagus cuniculus invariant chain (UniProt Accession No. G1SKK3) corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO: 115: Amino acid sequence of the region of the Tasmanian devil (Sarcophilus harrisii) invariant chain (UniProt Accession No. G3X0Q6) corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO: 116: Amino acid sequence of the region of the Camelus ferus invariant chain (UniProt Accession No. S9XLT6) corresponding to residues 67-92 of the human p35 invariant chain SEQ ID NO: 117 Nucleotide sequence encoding the HCV-NS antigen SEQ ID NO:118 OVA257-264 (SIINFEKL) peptide sequence SEQ ID NO: 119 Amino acid sequence of the res linker SEQ ID NO: 120 Nucleotide sequence encoding the res linker SEQ ID NO: 121: Amino acid sequence of HA tag SEQ ID NO: 122 Nucleotide sequence encoding the HA tag SEQ ID NO: 123 Human Ad5 hexon protein sequence SEQ ID NO: 124 Human Ad5 penton protein sequence SEQ ID NO: 125 Human Ad5 fiber protein sequence SEQ ID NO: 126 Chimpanzee adenovirus ChAd3 hexon protein sequence SEQ ID NO: 127 Chimpanzee adenovirus ChAd3 fiber protein sequence SEQ ID NO: 128 Chimpanzee adenovirus ChAd19 hexon protein sequence SEQ ID NO: 129 Chimpanzee adenovirus ChAd19 fiber protein sequence SEQ ID NO: 130 Chimpanzee adenovirus ChAd63 hexon protein sequence SEQ ID NO: 131 Chimpanzee adenovirus ChAd63 fiber protein sequence SEQ ID NO: 132 Polypeptide sequence of ChAd155 hexon SEQ ID NO: 133 Polypeptide sequence of ChAd155 penton SEQ ID NO:134 Polypeptide sequence of ChAd155 fiber SEQ ID NO: 135 Polypeptide sequence of mIi (full length) LLLmut SEQ ID NO: 136 Polypeptide sequence of mIi (full length)K63R SEQ ID NO: 137 Polypeptide sequence of mIi(1-75)K63R SEQ ID NO: 138 Polypeptide sequence of mIi(D+ER) SEQ ID NO:139 Polypeptide sequence of mIi(D-17) (i.e., residues 18-215 of the N-terminal Met+p31 mIi) SEQ ID NO:140 Polypeptide sequence of mIi(50-215) (i.e., residues 51-215 of the N-terminal Met+p31 mIi) DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0019] Detailed Description of the Invention As described above, the inventors have surprisingly found that certain small fragments of the invariant chain have the ability to enhance the immunogenicity of antigens. The invariant chain fragments described herein specifically lack the KEY, CLIP and trimerization regions of the invariant chain. Furthermore, in some embodiments, the invariant chain fragments described herein also lack the intralysosomal sorting sequence ("ESS").

[0020] The prior art has revealed information on the immunogenicity enhancing effect of the full-length invariant chain, including the KEY, CLIP, trimerization, and ESS regions of the invariant chain (see, for example, Holst et al. 2008). The prior art also discloses information on the immunogenicity enhancing effect of the invariant chain KEY region itself (for example, (a) Holmes et al. 2008 discloses a phase I trial of a fusion of LRMK amino acids of the KEY region with a HER-2 / neu peptide, and (b) Kallinteris et al. 2006 aims to utilize the KEY region specifically for enhancing vaccine efficacy). As for the trimerization region, it is known that this region is important for its role as an MHC-II chaperone and MIF signaling receptor. Finally, as for the ESS region, Waelchli et al. 2014 discloses that the invariant chain mediates its effect via colocalization in the endosomal pathway. Therefore, invariant chain fragments lacking the ESS are predicted to be unable to utilize this pathway because they are unable to localize to endosomes.

[0021] In WO2010057501 (supra), it is disclosed that adenovirus encoding a mouse invariant chain fragment of residues 51-118 fused to lymphocytic choriomeningitis virus glycoprotein (GP) antigen has reduced immunogenicity compared to adenovirus encoding full-length invariant chain fused to GP antigen (see WO2010057501, FIG. 7 and page 81, lines 33-34, which states "Accordingly, when the 51-118 variant (Ad-Ii51-118GP) was examined, a marked reduction in CD8+ T cell stimulatory capacity was observed").

[0022] Thus, in light of the prior art, it is surprising, as shown in the examples described herein, that the mli1-80, mli1-75 and mli50-75 fragments, although lacking the KEY, CLIP and trimerization domains (and in the case of mli50-75, lacking the ESS), are nevertheless able to increase immunogenicity and / or antigen presentation to substantially the same levels as full-length mli or even greater.

[0023] Moreover, as shown in the Examples herein, it is surprising that the mli55-75 and mli60-75 fragments, despite lacking known functional domains, are able to increase immunogenicity and / or antigen presentation to levels substantially equal to or even greater than full-length mli.

[0024] In particular, it is surprising that residues 55-75 and 60-75 of mouse li, contained within the 51-118 fragment described in WO2010057501 above (and in addition, mouse Iino residues 50-75, except for one amino acid, are contained within the 51-118 fragment described in WO2010057501 above), provide substantially the same immunogenicity enhancing effect as the full-length invariant chain.

[0025] It can be predicted that variants of the mli1-80, mli1-75, mli50-75, mli55-75 and mli60-75 fragments will share similar advantageous and surprising properties.

[0026] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. For example, the terms used herein are defined as set forth in A multilingual glossary of biotechnological terms: (IUPAC Recommendations), Leuenberger, HGW, Nagel, B. and Klbl, 1995.

[0027] Throughout the following specification and claims, unless the context requires otherwise, the term "comprise" and variations such as "comprises" and "comprising" should be understood to mean the inclusion of a recited integer or step, or group of integers or steps, but not the exclusion of any other integers or steps, or group of integers or steps. Unless the context requires otherwise, the term "consist of" and variations such as "consisting of" should be understood to mean the inclusion of a recited integer or step, or group of integers or steps, and to the exclusion of other same or different integers or steps, or group of same or different integers or steps, i.e., "consisting only of." Unless the context requires otherwise, the term "consist of at least," and variations such as "consisting of at least," should be understood to mean inclusive of the minimum recited integer or step, and also inclusive of additional instances of the same integer or step, or group of integers or steps, but excluding any other different integer or step, or group of different integers or steps.

[0028] Several documents are cited in the text of this specification. All documents cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.), whether supra or infra, are incorporated herein by reference in their entirety. Nothing herein should be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention. All definitions provided herein with respect to one aspect of the invention also apply to other aspects of the invention.

[0029] Proteins, fusion proteins and polynucleotides The terms "protein," "polypeptide," and "peptide" are used interchangeably herein to refer to any peptide-linked chain of amino acids, regardless of length, co-translational, or post-translational modifications. A fusion protein (or "chimeric protein") is a recombinant protein comprising two or more peptide-linked proteins. Fusion proteins are made by the joining of two or more genes that originally coded for separate proteins. Translation of the fusion genes results in a single fusion protein.

[0030] The terms "polynucleotide" and "nucleic acid" are used interchangeably herein to refer to polymeric macromolecules made from nucleotide monomers. Preferably, the polynucleotides of the invention are recombinant. Recombinant means that the polynucleotide is the product of at least one cloning, restriction or ligation step, or other process that results in a polynucleotide that is different from a naturally occurring polynucleotide.

[0031] A heterologous sequence refers to any sequence that is not isolated from, derived from, or based on a naturally occurring nucleic acid sequence contained in a host organism. "Naturally occurring" refers to a sequence found in nature and not synthetically prepared or modified. A sequence is "derived from" a source if it is isolated from a source but suitably modified (e.g., by deletion, substitution (mutation), insertion, or other modification) so as not to impair the normal function of the source gene.

[0032] The polynucleotides and polypeptides used in the present invention are suitably isolated. An "isolated" polynucleotide (or polypeptide) is one that has been removed from its original environment. For example, a naturally occurring polynucleotide is isolated if it has been separated from some or all of the coexisting materials in the natural system. A polynucleotide is considered to be isolated, for example, if it is cloned into a vector that is not part of its natural environment or if it is contained within a cDNA.

[0033] Polypeptide and polynucleotide sequence comparisons To compare two closely related polypeptide or polynucleotide sequences, one can calculate the "% sequence identity" between the first and second sequences. A polypeptide or polynucleotide sequence is said to be the same as, or identical to, another polypeptide or polynucleotide sequence if it shares 100% sequence identity over its entire length. Residues in a sequence are numbered from left to right, i.e., from N-terminus to C-terminus for polypeptides and 5' to 3' for polynucleotides. The term "identical" or percent "identity" refers to two or more sequences or subsequences that are identical or have a specified percentage of identical amino acid residues (i.e., 70% identity, sometimes 75%, 80%, 85%, 90%, 95%, 98% or 99% identity) when aligned and compared for maximum correspondence over a comparison window or designated region, as assessed using one of the sequence comparison algorithms below or by manual alignment and comparison inspection. This definition also refers to the complement of a test sequence. In some cases, identity exists over a region that is at least 250 amino acids in length, for example 300 or 350 amino acids. Suitably, the comparison is carried out over a window that corresponds to the entire length of the reference sequence (rather than a derived sequence).

[0034] For sequence comparison, one sequence serves as a reference sequence, and test sequence is compared to it.When using sequence comparison algorithm, test sequence and reference sequence are input into computer, subsequence coordinates are designated as necessary, and sequence algorithm parameters are designated.Default program parameters can be used, but other parameters can be designated instead.The sequence comparison algorithm then calculates the percent sequence identity of test sequence to reference sequence based on program parameters.

[0035] "Comparison window" as used herein refers to the area where a sequence can be compared with a reference sequence of the same number of adjacent positions after two sequences are optimally aligned. Methods for aligning sequences for comparison are well known in the art. Optimal sequence alignment for comparison can be performed, for example, by the local homology algorithm of Smith & Waterman 1981, or by the homology alignment algorithm of Needleman & Wunsch 1970, or by the similarity search method of Pearson & Lipman 1988, or by computer processing of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by manual alignment and comparison inspection (see, for example, Current Protocols in Molecular Biology (Ausubel et al. 1995)).

[0036] One example of a useful algorithm is PILEUP. PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pairwise alignments to show the relationships and percent sequence identity. It also plots a tree or dendrogram showing the clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng & Doolittle 1987. The method used is similar to that described by Higgins & Sharp 1989. The program can align up to 300 sequences of a maximum length of 5,000 nucleotides or amino acids each. The multiple alignment method starts with a pairwise alignment of the two most similar sequences and creates a cluster of two aligned sequences. This cluster is then aligned with the next most related sequence or cluster of aligned sequences. The two sequence clusters are aligned by a simple extension of the pairwise alignment of the two individual sequences. The final alignment is achieved by a series of progressive, pairwise alignments. The program is run by specifying the individual sequences and their amino acid coordinates for the regions of sequence comparison and specifying the program parameters. PILEUP is used to compare the reference sequence with other test sequences and determine percent sequence identity relationships using the following parameters: default gap weight (3.00), default gap length weight (0.10), and weighted end gaps. PILEUP can be obtained from the GCG Sequence Analysis Software Package, e.g., version 7.0 (Devereaux et al. 1984).

[0037] Another example of an algorithm suitable for determining percent sequence identity and sequence similarity is the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. 1977 and Altschul et al. 1990, respectively. Software for performing BLAST analysis is publicly available from the National Center for Biotechnology Information (website at www.ncbi.nlm.nih.gov / ). This algorithm requires first identifying high-scoring sequence pairs (HSPs) by identifying short words of length w in the query sequence that match or meet some positive threshold score T when aligned with words of the same length in database sequences. T is called the neighborhood word score threshold (Altschul et al., supra). These initial neighborhood word hits act as seeds to initiate searches to find longer HSPs that contain them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for a pair of mismatching residues; always <0). For amino acid sequences, a scoring matrix is ​​used to calculate the cumulative score. Extension of the word hits in each direction is stopped when the cumulative alignment score has decreased by an amount x from its maximum achieved value; when the cumulative score falls below zero due to the accumulation of one or more negative scoring residue alignments; or when the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, M=5, N=-4, and a comparison of two strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength of 3, and an expectation (E) of 10. 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff 1989) using alignment (B) 50, expectation (E) 10, M=5, N=-4, and a comparison of the two strands.

[0038] The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul 1993). One measure of similarity provided by the BLAST algorithm is the minimum sum probability (P(N)), which provides an indication of the likelihood that a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the minimum sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than 0.001.

[0039] A "difference" between sequences refers to the insertion, deletion or substitution of a single residue at a position of the second sequence compared to the first sequence. The two sequences can contain one, two, or more than two such differences. An insertion, deletion or substitution results in a decrease in the % sequence identity in a second sequence that is otherwise identical (100% sequence identity) to the first sequence. For example, if the identical sequence is 9 residues long, one substitution in the second sequence results in 88.9% sequence identity. If the identical sequence is 17 amino acid residues long, two substitutions in the second sequence results in 88.2% sequence identity.

[0040] Alternatively, for the purpose of comparing a first reference sequence with a second comparison sequence, the number of additions, substitutions and / or deletions made to the first sequence to generate the second sequence can be ascertained. An addition is the addition of one residue to the first sequence (including an addition at either end of the first sequence). A substitution is the replacement of one residue in the first sequence with one different residue. A deletion is the deletion of one residue from the first sequence (including a deletion at either end of the first sequence).

[0041] Suitably, the substitutions can be conservative. A "conservative" substitution is an amino acid substitution in which an amino acid residue is replaced with another amino acid residue of similar chemical structure and is expected to have little effect on the function, activity, or other biological properties of the polypeptide. Such conservative substitutions are, of course, those in which one amino acid residue in the following groups is replaced by another amino acid residue in the same group: TIFF0007630466000001.tif12860

[0042] Invariant chain and invariant chain fragments The term "invariant chain", also known as "li" or "CD74", refers to a non-polymorphic type II integral membrane protein. This protein has diverse functions in lymphocyte maturation and adaptive immune responses; specifically, li ensures the targeting of newly synthesized MHC II to the endocytic pathway, where the complex can encounter antigenic peptides (Pieters J. 1997). Furthermore, it has been shown that li functions as an MHC class I chaperone (Morris et al. 2004) and that, through its endosomal targeting sequence, it promotes the stimulation of CD4+ T cells, but not CD8+ T cells, against covalently bound antigens (Diebold et al. 2001).

[0043] Four different isoforms of the human invariant chain are known, commonly referred to as p33, p35, p41 and p43 (Strubin et al. 1986). SEQ ID NO: 1 and SEQ ID NO: 2 correspond to the amino acid and nucleic acid sequences of the human invariant chain p35 isoform, respectively. SEQ ID NO: 3 corresponds to the amino acid sequence of the human invariant chain p33 isoform, respectively. SEQ ID NO: 5 and SEQ ID NO: 6 correspond to the amino acid and nucleic acid sequences of the human invariant chain p43 isoform, respectively. SEQ ID NO: 7 corresponds to the amino acid sequence of the human invariant chain p41 isoform. As for human p33 and p41, an alternative translation initiation was selected, so that the human p35 and p43 isoforms contain an additional 16 residues at the N-terminus. Compared to human p33 and p35, the human p41 and p43 isoforms contain an additional domain (alternative splicing of exon 6b) inserted in frame in the C-terminal region of the invariant chain. The sequence of an additional human isoform c, which lacks two exons relative to human p33 and p35, is available in Genbank (accession number bc024272). SEQ ID NO: 9 and SEQ ID NO: 10 correspond to the amino acid and nucleic acid sequences, respectively, of the human invariant chain c isoform. Suitably, the invariant chain fragment is derived from the human p33, p35, p41, p43 or c isoform of the invariant chain.

[0044] [Table 1] An overview of the different isoforms is shown in FIG.

[0045] The invariant chain contains several domains, namely, a cytoplasmic domain, a transmembrane domain (TM, positions 47-72 of human invariant chain SEQ ID NO:1, positions 30-55 of mouse invariant chain SEQ ID NO:11), and an endoplasmic reticulum lumen domain, which in the human invariant chain p35 and p43 variants contains a sorting (targeting) peptide (lysosomal targeting) peptide preceded by an endoplasmic reticulum retention signal (ERR or ER) (positions 1-16 of human invariant chain SEQ ID NO:1). The endoplasmic reticulum luminal domain contains the endoplasmic reticulum luminal domain (also known as the lysosomal sorting sequence or intralysosomal sorting sequence (ESS)) (positions 17-46 of human invariant chain SEQ ID NO: 1; positions 1-29 of mouse invariant chain SEQ ID NO: 11), and the endoplasmic reticulum luminal domain itself contains the KEY region (positions 93-96 of human invariant chain SEQ ID NO: 1; positions 76-79 of mouse invariant chain SEQ ID NO: 11) and the adjacent CLIP region (positions 97-120 of human invariant chain SEQ ID NO: 1; positions 80-103 of mouse invariant chain SEQ ID NO: 11). The CLIP region includes the core CLIP peptide (positions 103-117 of human invariant chain SEQ ID NO:1, positions 86-100 of mouse invariant chain SEQ ID NO:11) and the trimerization domain (positions 134-208 of human invariant chain SEQ ID NO:1, positions 117-191 of mouse invariant chain SEQ ID NO:11) (Mittendorf et al. 2009; Strumptner-Cuvelette and Benaroch 2002). The remainder of the endoplasmic reticulum luminal domain includes two highly flexible regions located between the transmembrane and KEY regions (positions 73-92 of human invariant chain SEQ ID NO:1, positions 56-75 of mouse invariant chain SEQ ID NO:11) or downstream of the trimerization domain (positions 209-232 of human invariant chain SEQ ID NO:1, positions 192-215 of mouse invariant chain SEQ ID NO:11).

[0046] Suitably the fusion protein does not include the full length invariant chain.

[0047] Invariant chain has been characterized in several organisms, including chicken, cow, dog, mouse, rat and human. The polypeptide sequences of invariant chain from various organisms aligned against human p35 invariant chain (SEQ ID NO:1) are shown in FIG. 12. Also included in this figure are human p43 and c isotypes, and mouse p31 and p41 isotypes. Each invariant chain sequence is identified by its corresponding UniProt accession number and SEQ ID NO. The sequence identifiers of these invariant chain sequences are SEQ ID NOs:1, 5, 9, 11, 13, and 15-52. Examples of fragments of invariant chain from various organisms corresponding to residues 17-97 of human p35 invariant chain are shown in FIG. 13, where the sequences are aligned against residues 17-97 of human p35 invariant chain (SEQ ID NO:1). The sequence identifiers of these invariant chain fragment sequences are SEQ ID NOs:53-84. Examples of portions of invariant chain from various organisms corresponding to residues 67-92 of the human p35 invariant chain are shown in Figure 14, with the sequences aligned to residues 67-92 of the human p35 invariant chain. The sequence identification numbers of these invariant chain fragment sequences are SEQ ID NOs:85-116.

[0048] A portion of a fragment of the invariant chain comprising consecutive residues from residues 77-92 of SEQ ID NO:1 In one embodiment, the fragment of the invariant chain consists of a portion of residues 17-97 of SEQ ID NO:1, which portion contains at least 5, more preferably at least 6, more preferably at least 7, more preferably at least 8, more preferably at least 9, more preferably at least 10, more preferably at least 11, more preferably at least 12, more preferably at least 13, more preferably at least 14, more preferably at least 15 contiguous residues from residues 77-92 of SEQ ID NO:1. In yet another embodiment, the portion comprises, or more preferably consists of, residues 77-92 of SEQ ID NO:1.

[0049] In yet other embodiments, the fragment of the invariant chain consists of 80 residues or less and comprises a sequence of at least 5 consecutive residues (5 consecutive residues) that shares at least 80% identity, more preferably at least 90% identity, with at least 5 consecutive residues from residues 77-92 of SEQ ID NO:1, more preferably at least 6, more preferably at least 7, more preferably at least 8, more preferably at least 9, more preferably at least 10, more preferably at least 11, more preferably at least 12, more preferably at least 13, more preferably at least 14, and more preferably at least 15 consecutive residues. More suitably, the fragment of the invariant chain consists of 80 residues or less and comprises a sequence of at least 5 consecutive residues from residues 77-92 of SEQ ID NO:1, but more preferably a sequence of at least 6, more preferably at least 7, more preferably at least 8, more preferably at least 9, more preferably at least 10, more preferably at least 11, more preferably at least 12, more preferably at least 13, more preferably at least 14, and more preferably at least 15 consecutive residues.

[0050] Alternatively, the fragment of the invariant chain consists of 80 residues or less and comprises a sequence of at least 5 consecutive residues which sequence contains no more than 4, more preferably no more than 3, more preferably no more than 2, and more preferably no more than 1 substitution, deletion, or addition of at least 5 consecutive residues from residues 77-92 of SEQ ID NO:1, more preferably at least 6, more preferably at least 7, more preferably at least 8, more preferably at least 9, more preferably at least 10, more preferably at least 11, more preferably at least 12, more preferably at least 13, more preferably at least 14, and more preferably at least 15 consecutive residues.

[0051] Suitably, fragments of the invariant chain comprise or consist of residues 77-81, 78-82, 79-83, 80-84, 81-85, 82-86, 83-87, 84-88, 85-89, 86-90 or 87-91 of SEQ ID NO:1.

[0052] Suitably, the fragment of the invariant chain comprises or consists of residues 77-84, 78-85, 79-86, 80-87, 81-88, 82-89, or 83-90 of SEQ ID NO:1.

[0053] A portion of the invariant chain fragment comprising consecutive residues from residues 72-92 of SEQ ID NO:1. In one embodiment, the fragment of the invariant chain consists of a portion of residues 17-97 of SEQ ID NO:1, which portion contains at least 5 contiguous residues from residues 72-92 of SEQ ID NO:1, more preferably at least 6, more preferably at least 7, more preferably at least 8, more preferably at least 9, more preferably at least 10, more preferably at least 11, more preferably at least 12, more preferably at least 13, more preferably at least 14, more preferably at least 15, more preferably at least 16, more preferably at least 17, more preferably at least 18, more preferably at least 19, and more preferably at least 20 contiguous residues. In yet another embodiment, the portion includes, or more preferably consists of, residues 72-92 of SEQ ID NO:1.

[0054] In yet other embodiments, the fragment of the invariant chain consists of 80 residues or less and comprises a sequence of at least 5 consecutive residues that shares at least 80% identity, more preferably at least 90% identity, with at least 5 consecutive residues from residues 72-92 of SEQ ID NO:1, more preferably at least 6, more preferably at least 7, more preferably at least 8, more preferably at least 9, more preferably at least 10, more preferably at least 11, more preferably at least 12, more preferably at least 13, more preferably at least 14, more preferably at least 15, more preferably at least 16, more preferably at least 17, more preferably at least 18, more preferably at least 19, and more preferably at least 20 consecutive residues.

[0055] More suitably, the fragment of the invariant chain consists of 80 residues or less and comprises a sequence of at least 5 consecutive residues from residues 72-92 of SEQ ID NO:1, but more preferably a sequence of at least 6, more preferably at least 7, more preferably at least 8, more preferably at least 9, more preferably at least 10, more preferably at least 11, more preferably at least 12, more preferably at least 13, more preferably at least 14, more preferably at least 15, more preferably at least 16, more preferably at least 17, more preferably at least 18, more preferably at least 19, and more preferably at least 20 consecutive residues.

[0056] Alternatively, the fragment of the invariant chain consists of 80 residues or less and comprises a sequence of at least 5 consecutive residues, which sequence contains no more than 7, more preferably no more than 6, more preferably no more than 5, more preferably no more than 4, more preferably no more than 3, more preferably no more than 2, and more preferably no more than 1 substitution, deletion, or addition of at least 5 consecutive residues from residues 72-92 of SEQ ID NO:1, more preferably at least 6, more preferably at least 7, more preferably at least 8, more preferably at least 9, more preferably at least 10, more preferably at least 11, more preferably at least 12, more preferably at least 13, more preferably at least 14, more preferably at least 15, more preferably at least 16, more preferably at least 17, more preferably at least 18, more preferably at least 19, and more preferably at least 20 consecutive residues.

[0057] A portion of the invariant chain fragment comprising the continuous sequence from residues 67-92 of SEQ ID NO:1 In one embodiment, the fragment of the invariant chain consists of a portion of residues 17-97 of SEQ ID NO:1, which portion contains at least 10, more preferably at least 15, and more preferably at least 20 contiguous residues from residues 67-92 of SEQ ID NO:1. In yet another embodiment, the portion includes, or more preferably consists of, residues 67-92 of SEQ ID NO:1.

[0058] In yet another embodiment, the fragment of the invariant chain consists of 80 residues or less and comprises a sequence of at least 10 consecutive residues which shares at least 80% identity, more preferably at least 90% identity, with at least 10 consecutive residues from residues 67-92 of SEQ ID NO: 1. More suitably, the fragment of the invariant chain consists of 80 residues or less and comprises a sequence of at least 10 consecutive residues which includes at least 10 consecutive residues from residues 67-92 of SEQ ID NO: 1. Suitably, fragments of the invariant chain comprise or consist of residues 67-76, 68-77, 69-78, 70-79, 71-80, 72-81, 73-82, 74-83, 75-84, 76-85, 77-86, 78-87, 79-88, 80-89, 81-90, 82-91 or 83-92 of SEQ ID NO:1.

[0059] Suitably, a fragment of the invariant chain comprises at least 15 contiguous residues, which at least 15 contiguous residues share at least 80% identity, more suitably at least 90% identity, with at least 15 contiguous residues from residues 67-92 of SEQ ID NO: 1. More suitably, a fragment of the invariant chain comprises at least 15 contiguous residues, which at least 15 contiguous residues include at least 15 contiguous residues from residues 67-92 of SEQ ID NO: 1. Suitably, a fragment of the invariant chain comprises or consists of residues 67-81, 68-82, 69-83, 70-84, 71-85, 72-86, 73-87, 74-88, 75-89, 76-90, 77-91 or 78-92 of SEQ ID NO: 1.

[0060] Suitably, a fragment of the invariant chain comprises at least 20 contiguous residues, which at least 20 contiguous residues share at least 80% identity, more suitably at least 90% identity, with at least 20 contiguous residues from residues 67-92 of SEQ ID NO: 1. Suitably, a fragment of the invariant chain comprises at least 20 contiguous residues, which at least 20 contiguous residues include at least 20 contiguous residues from residues 67-92 of SEQ ID NO: 1. Suitably, a fragment of the invariant chain comprises or consists of residues 67-86, 68-87, 69-88, 70-89, 71-90, 72-91 or 73-92 of SEQ ID NO: 1.

[0061] Suitably, a fragment of the invariant chain comprises at least 25 contiguous residues, which at least 25 contiguous residues share at least 80% identity, more suitably at least 90% identity, with at least 25 contiguous residues from residues 67-92 of SEQ ID NO: 1. Suitably, a fragment of the invariant chain comprises at least 25 contiguous residues, which at least 25 contiguous residues include at least 25 contiguous residues from residues 67-92 of SEQ ID NO: 1. Suitably, a fragment of the invariant chain comprises or consists of residues 67-91, or 68-92 of SEQ ID NO: 1.

[0062] Suitably, the fragment of the invariant chain comprises, and more preferably consists of, residues 70-92, 72-92, 73-92, 77-92, 79-92 or 85-92 of SEQ ID NO: 1. Alternatively, the fragment of the invariant chain comprises, and more preferably consists of, residues 67-90, 67-87 or 67-82 of SEQ ID NO: 1. Even more suitably, the fragment of the invariant chain comprises, and more preferably consists of residues 72-92 or 77-92 of SEQ ID NO: 1.

[0063] Suitably the invariant chain fragment comprises, more preferably consists of, a sequence selected from SEQ ID NO: 85-116.

[0064] Suitably the fusion protein does not contain a fragment of the invariant chain operably linked to an antigen sequence, and the fragment of the invariant chain contains more than residues 67-92 of SEQ ID NO:1, or more consecutive residues of SEQ ID NO:1.

[0065] A fragment of the human p35 invariant chain consisting of residues 1-97 and related sequences In one embodiment, the invariant chain fragment consists of residues 1-97 of SEQ ID NO:1. In another embodiment, the invariant chain fragment consists of 91-103, more preferably 93-101, more preferably 95-99, more preferably 97 residues and / or shares at least 95% identity, more preferably 97% identity with residues 1-97 of SEQ ID NO:1. Suitably, the invariant chain fragment consists of residues 1-97 of SEQ ID NO:1 or residues of SEQ ID NOs:5, 9, 11, 13, and 15-52, which correspond to residues 1-97 of SEQ ID NO:1. More suitably, the invariant chain fragment consists of residues 1-97 of SEQ ID NO:1.

[0066] Suitably the fusion protein does not contain a fragment of the invariant chain operably linked to an antigen sequence, and the fragment of the invariant chain contains more consecutive residues of SEQ ID NO:1 than residues 1-97 of SEQ ID NO:1.

[0067] A fragment of the human p35 invariant chain consisting of residues 17-97 and related sequences In one embodiment the invariant chain fragment consists of residues 17-97 of SEQ ID NO: 1. In other embodiments the invariant chain fragment consists of 76-84, more preferably 78-82, more preferably 80-82, more preferably 81 residues and / or shares at least 95% identity, more preferably 97% identity with residues 17-97 of SEQ ID NO: 1. Suitably the invariant chain fragment consists of any one of more of SEQ ID NOs: 53-84. More preferably the invariant chain fragment consists of SEQ ID NO: 53.

[0068] Suitably the fusion protein does not contain a fragment of the invariant chain operably linked to an antigen sequence, and the fragment of the invariant chain contains more than residues 17-97 of SEQ ID NO:1, in consecutive residues.

[0069] A fragment of the human p35 invariant chain consisting of residues 1-92 and related sequences In one embodiment, the invariant chain fragment consists of residues 1-92 of SEQ ID NO:1. In another embodiment, the invariant chain fragment consists of 88-96, more preferably 90-95, more preferably 91-93, more preferably 92 residues and / or shares at least 95% identity, more preferably 97% identity with residues 1-92 of SEQ ID NO:1. Suitably, the invariant chain fragment consists of residues 1-92 of SEQ ID NO:1 or residues of SEQ ID NOs:5, 9, 11, 13, and 15-52, which correspond to residues 1-92 of SEQ ID NO:1. More suitably, the invariant chain fragment consists of residues 1-92 of SEQ ID NO:1.

[0070] Suitably the fusion protein does not contain a fragment of the invariant chain operably linked to an antigen sequence, and the fragment of the invariant chain contains more consecutive residues of SEQ ID NO:1 than residues 1-92 of SEQ ID NO:1.

[0071] A fragment of the human p35 invariant chain consisting of residues 17-92 and related sequences In one embodiment, the invariant chain fragment consists of residues 17-92 of SEQ ID NO: 1. In other embodiments, the invariant chain fragment consists of 71-79, more preferably 74-78, more preferably 75-77, more preferably 76 residues and / or shares at least 95% identity, more preferably 97% identity with residues 1-97 of SEQ ID NO: 1, or residues 5, 9, 11, 13, and 15-52, which correspond to residues 17-92 of SEQ ID NO: 1. More suitably, the invariant chain fragment consists of residues 17-92 of SEQ ID NO: 1.

[0072] Suitably the fusion protein does not contain a fragment of the invariant chain operably linked to an antigen sequence, and the fragment of the invariant chain contains more consecutive residues of SEQ ID NO:1 than residues 17-92 of SEQ ID NO:1.

[0073] Fragment size, fragment location, and fragment number Suitably, an invariant chain fragment consists of fewer than 30 residues, more preferably fewer than 25, more preferably fewer than 20, more preferably fewer than 15, more preferably fewer than 10, more preferably fewer than 7 residues. Suitably, an invariant chain fragment consists of at least 25 residues, more preferably at least 35, more preferably at least 45, more preferably at least 55, more preferably at least 75 residues.

[0074] Suitably, the invariant chain fragment is linked to the antigen sequence by the N-terminus or C-terminus of the invariant chain fragment, more preferably by the C-terminus of the invariant chain fragment.

[0075] Suitably the fragment of the invariant chain is at the N-terminus or C-terminus of the fusion protein, most preferably the fragment of the invariant chain is at the N-terminus of the fusion protein.

[0076] Suitably the fusion protein comprises more than one invariant chain fragment, for example 2, 3, 4 or 5 or more invariant chain fragments. Suitably the invariant chain fragments are encoded within the antigen.

[0077] A fusion protein of the invention contains a polypeptide that consists of an invariant chain fragment operably linked to an antigen sequence, where the invariant chain fragment consists of a particular sequence. By "consisting of" we mean that although there may be additional residues at either end of the invariant chain fragment, additional other residues at either end of the invariant chain do not result in the invariant chain fragment being a larger, as defined invariant chain fragment (and do not result in the invariant chain fragment being a full-length invariant chain).

[0078] It will be appreciated that the fusion proteins of the present invention are not the fusion proteins described in WO2010057501 (which is incorporated herein by reference with the intent to disclaim any claims to the fusions specifically described therein).

[0079] Invariant chains from different species Suitably, the fragment of the invariant chain refers to a truncated form of the invariant chain derived from an animal, such as a vertebrate, for example a fish, a bird, or a mammal. More suitably, the fragment of the invariant chain refers to a truncated form of the invariant chain derived from a mammal. More suitably, the fragment of the invariant chain refers to a truncated form of the invariant chain derived from a mammal selected from the list consisting of chicken, cow, dog, mouse, rat, non-human primate or human. More suitably, the fragment of the invariant chain refers to a truncated form of the invariant chain derived from a human or mouse. More suitably, the fragment of the invariant chain refers to a truncated form of the invariant chain derived from a human.

[0080] The various invariant chains from various species are given in SEQ ID NOs: 1, 5, 9, 1, 13, and 15-52.

[0081] Invariant chains from different species: Mouse invariant chain For the mouse invariant chain, only two isoforms are known, p31 and p41, which correspond to the human invariant chain isoforms p33 and p41, respectively. SEQ ID NO: 11 and SEQ ID NO: 12 correspond to the amino acid and nucleic acid sequences, respectively, of the mouse invariant chain p31 isoform. SEQ ID NO: 13 and SEQ ID NO: 14 correspond to the amino acid and nucleic acid sequences, respectively, of the mouse invariant chain p41 isoform. Fragments of the invariant chain are derived from the mouse invariant chain p31 or p41 isoforms.

[0082] The invention can be practiced with fragments of the mouse invariant chain. Thus, the following aspects are provided:

[0083] 1. A fusion protein comprising a polypeptide, the polypeptide consisting of an invariant chain fragment operably linked to an antigen sequence, the invariant chain fragment consisting of: (a) a portion of residues 1-80 of SEQ ID NO:11, which portion includes at least 5 contiguous residues from residues 60-75 of SEQ ID NO:1; (b) comprising a sequence of at least 5 contiguous residues, no longer than 80 residues, which sequence shares at least 80% identity with at least 5 contiguous residues from residues 60-75 of SEQ ID NO:11; (c) residues 1-80 of SEQ ID NO:11; (d) 91 to 103 residues that share at least 95% identity with residues 1-80 of SEQ ID NO:11; or (e) residues 1-75 of SEQ ID NO:11; (f) 88 to 96 residues that share at least 95% identity with residues 1-75 of SEQ ID NO:11.

[0084] 1. A polynucleotide encoding a fusion protein comprising a polypeptide, the polypeptide consisting of an invariant chain fragment operably linked to an antigen sequence, the invariant chain fragment consisting of: (a) a portion of residues 1-80 of SEQ ID NO:11, which portion includes at least 5 contiguous residues from residues 60-75 of SEQ ID NO:1; (b) comprising a sequence of at least 5 contiguous residues, no longer than 80 residues, which sequence shares at least 80% identity with at least 5 contiguous residues from residues 60-75 of SEQ ID NO:11; (c) residues 1-80 of SEQ ID NO:11; (d) 91 to 103 residues that share at least 95% identity with residues 1-80 of SEQ ID NO:11; or (e) residues 1-75 of SEQ ID NO:11; (f) 88 to 96 residues that share at least 95% identity with residues 1-75 of SEQ ID NO:11.

[0085] 1. A viral vector containing a polynucleotide encoding a fusion protein comprising a polypeptide, the polypeptide consisting of an invariant chain fragment operably linked to an antigen sequence, the invariant chain fragment consisting of: (a) a portion of residues 1-80 of SEQ ID NO:11, which portion includes at least 5 contiguous residues from residues 60-75 of SEQ ID NO:1; (b) comprising a sequence of at least 5 contiguous residues, no longer than 80 residues, which sequence shares at least 80% identity with at least 5 contiguous residues from residues 60-75 of SEQ ID NO:11; (c) residues 1-80 of SEQ ID NO:11; (d) 91 to 103 residues that share at least 95% identity with residues 1-80 of SEQ ID NO:11; or (e) residues 1-75 of SEQ ID NO:11; (f) 88 to 96 residues that share at least 95% identity with residues 1-75 of SEQ ID NO:11.

[0086] 1. A fusion protein comprising a polypeptide, the polypeptide consisting of an invariant chain fragment operably linked to an antigen sequence, the invariant chain fragment consisting of: (a) a portion of residues 1-80 of SEQ ID NO:11, which portion includes at least 10 contiguous residues from residues 50-75 of SEQ ID NO:1; (b) comprising a sequence of at least 10 contiguous residues, no longer than 80 residues, which sequence shares at least 80% identity with at least 10 contiguous residues from residues 50-75 of SEQ ID NO:11; (c) residues 1-80 of SEQ ID NO:11; (d) 91 to 103 residues that share at least 95% identity with residues 1-80 of SEQ ID NO:11; or (e) residues 1-75 of SEQ ID NO:11; (f) 88 to 96 residues that share at least 95% identity with residues 1-75 of SEQ ID NO:11.

[0087] 1. A polynucleotide encoding a fusion protein comprising a polypeptide, the polypeptide consisting of an invariant chain fragment operably linked to an antigen sequence, the invariant chain fragment consisting of: (a) a portion of residues 1-80 of SEQ ID NO:11, which portion includes at least 10 contiguous residues from residues 50-75 of SEQ ID NO:1; (b) comprising a sequence of at least 10 contiguous residues, no longer than 80 residues, which sequence shares at least 80% identity with at least 10 contiguous residues from residues 50-75 of SEQ ID NO:11; (c) residues 1-80 of SEQ ID NO:11; (d) 91 to 103 residues that share at least 95% identity with residues 1-80 of SEQ ID NO:11; or (e) residues 1-75 of SEQ ID NO:11; (f) 88 to 96 residues that share at least 95% identity with residues 1-75 of SEQ ID NO:11.

[0088] 1. A viral vector containing a polynucleotide encoding a fusion protein comprising a polypeptide, the polypeptide consisting of an invariant chain fragment operably linked to an antigen sequence, the invariant chain fragment consisting of: (a) a portion of residues 1-80 of SEQ ID NO:11, which portion includes at least 10 contiguous residues from residues 50-75 of SEQ ID NO:1; (b) comprising a sequence of at least 10 contiguous residues, no longer than 80 residues, which sequence shares at least 80% identity with at least 10 contiguous residues from residues 50-75 of SEQ ID NO:11; (c) residues 1-80 of SEQ ID NO:11; (d) 91 to 103 residues that share at least 95% identity with residues 1-80 of SEQ ID NO:11; or (e) residues 1-75 of SEQ ID NO:11; (f) 88 to 96 residues that share at least 95% identity with residues 1-75 of SEQ ID NO:11.

[0089] More particularly, said portion may comprise, or more preferably consist of, residues 53-75, 55-75, 56-75, 60-75, 62-75, or 68-75 of SEQ ID NO: 11. Alternatively, said portion may comprise, or more preferably consist of, residues 50-73, 50-70, or 50-65 of SEQ ID NO: 11. Even more preferably, said portion may comprise, or more preferably consist of, residues 55-75 or 60-75 of SEQ ID NO: 11.

[0090] Functional connectivity (functionally effective connections) According to the invention, the invariant chain fragment is operably linked to the antigen sequence. Functional linkage refers to a direct linkage of amino acid residues or nucleotides or a sequence thereof that links the invariant chain fragment to the antigen sequence, or the encoded invariant chain fragment to the antigen sequence, such that, upon administration of the fusion protein, the invariant chain fragment enhances the immune response to the antigen sequence to about the same extent as an invariant chain fragment directly linked to the antigen sequence. A direct linkage is when the 3' end of the first polynucleotide is directly adjacent to the 5' end of the second sequence, without an intervening nucleic acid. Alternatively, the ORFs may be indirectly linked such that an intervening nucleic acid is present. For example, the intervening nucleic acid may be untranslated or may code for an amino acid sequence, such as a peptide linker. Operably linked nucleic acids may encode directly linked polypeptides, i.e., the carboxy terminus (C-terminus) of one encoded polypeptide is immediately adjacent to the amino terminus (N-terminus) of a second encoded polypeptide. Alternatively, operably linked nucleic acids may encode indirectly linked polypeptides, such that there are intervening amino acids between the encoded polypeptides. Such intervening amino acids are referred to herein as peptide sequences or linkers.

[0091] In one embodiment, the invariant chain fragment is directly linked to the antigen sequence. In another embodiment, the invariant chain fragment is indirectly linked to the antigen sequence. Suitably, the invariant chain fragment is indirectly linked to the antigen sequence by a peptide sequence. Suitably, the peptide sequence comprises glycine and serine, but more suitably consists of the sequence GlySer. Alternatively, the peptide sequence comprises or consists of an AscI linker having the polypeptide sequence ArgArgAla and encoded by the polynucleotide sequence AGGCGCGCC. Alternatively, the peptide sequence comprises or more suitably consists of a res linker having the polypeptide sequence SerAspArgTyrLeuAsnArgArgAla (SEQ ID NO: 119) and encoded by the polynucleotide sequence AGCGATCGCTATTTAAATAGGCGCGCC (SEQ ID NO: 120). Alternatively, the peptide sequence comprises, or more preferably consists of, the human influenza hemagglutinin (HA) tag (polypeptide SEQ ID NO: 121, polynucleotide SEQ ID NO: 122).

[0092] Suitably the peptide sequence does not include the contiguous sequence of residues 98-100 of SEQ ID NO:1, but more suitably does not include the contiguous sequence of residues 98-105, more suitably residues 98-110, more suitably residues 98-125, more suitably residues 98-150. Suitably the peptide sequence does not include the contiguous sequence of more than 11 contiguous residues from residues 98-232 of SEQ ID NO:1, but more suitably does not include the contiguous sequence of more than 8 contiguous residues, more suitably more than 6 contiguous residues, more suitably more than 4 contiguous residues.

[0093] Suitably the peptide sequence does not include the consecutive sequence of residues 93-100 of SEQ ID NO:1, but more preferably does not include the consecutive sequence of residues 93-105, more preferably residues 93-110, more preferably residues 93-125, more preferably residues 93-150.

[0094] Suitably the peptide sequence does not include a contiguous sequence of more than 11 contiguous residues from residues 93-232 of SEQ ID NO:1, but more preferably does not include a contiguous sequence of more than 8 contiguous residues, more preferably more than 6 contiguous residues, more preferably more than 4 contiguous residues.

[0095] Throughout this specification, the phrase "does not include the contiguous sequence of" means that the sequence does not include the entire contiguous sequence referenced.

[0096] Suitably the peptide sequence consists of 50 residues or less, more preferably 30 or less, more preferably 10 or less, more preferably 5 or less.

[0097] Antigen sequence An antigenic sequence is a polypeptide that contains at least one epitope capable of eliciting an immune response. The terms antigenic sequence, antigenic protein, antigenic fragment, antigen and immunogen are used interchangeably herein. An epitope (also known as an antigenic determinant) is that portion of an antigenic sequence that is recognized by the immune system. Suitably, this recognition is achieved by the binding of an antibody, B cell or T cell to said epitope. An epitope bound by an antibody or B cell is referred to as a B cell epitope, and an epitope bound by a T cell is referred to as a T cell epitope. Of course, binding refers to a binding constant between an antibody or T cell receptor (TCR) and the respective epitope of 1 x 10 5 M -1 Greater than or equal to 1 x 10 6 M -1 , 1 x 10 7 M -1 , 1 x 10 8 M -1The term "epitope" refers to conformational epitopes as well as non-conformational epitopes. Conformational and non-conformational epitopes are distinguished in that the binding to the former is lost in the presence of denaturing solvents, whereas the binding to the latter is not lost. T-cell epitopes are non-conformational, i.e., they are linear, whereas B-cell epitopes may be conformational or non-conformational. Linear B-cell epitopes typically vary in length from 5 to 20 amino acids.

[0098] Suitably, the fusion protein comprises a plurality of antigenic sequences. Suitably, the antigenic sequences are derived from a pathogen. Suitably, the antigenic sequences are derived from a pathogen selected from the group consisting of a virus, a bacterium, a protozoan, and a multicellular parasite. In another embodiment, the antigenic sequences are derived from a cancer cell.

[0099] The antigenic sequence induces a B cell response, or a T cell response, or a B cell response and a T cell response. Thus, the antigenic protein or antigenic fragment comprises at least one T cell epitope and / or at least one B cell epitope.

[0100] Suitably, the polynucleotide sequence encoding the antigen sequence comprises a sequence selected from the list consisting of SEQ ID NO:4, SEQ ID NO:8 or SEQ ID NO:117.

[0101] The following examples of mouse invariant chain fragments demonstrate their effect on ovalbumin (OVA) antigen immunogenicity and presentation when placed in an adenovirus type 5 (Ad5) vector. OVA is a glycoprotein of sufficient size and complexity to be weakly immunogenic. For this reason, OVA is a well-known model antigen that is often used in vaccination experiments, and findings regarding it are expected to apply equally to other antigens.

[0102] vector In certain embodiments, a polynucleotide of the invention is comprised within a vector.

[0103] Suitably, the vector is selected from one or several of the list consisting of viral vectors, bacterial vectors (such as Salmonella or Listeria) and lipid nanoparticles (LNPs) (e.g. SAM® - synthetic self-amplifying mRNA delivered by LNPs).

[0104] A viral vector is a virus containing a heterologous nucleic acid that has the ability to introduce the heterologous nucleic acid into the cells of an organism. In the context of the present invention, the antigens and invariant chain fragments encoded by the heterologous nucleic acid are considered to be expressed in the cells once introduced by the viral vector.

[0105] A recombinant viral vector is a viral vector that contains a recombinant polynucleotide and also contains a copy of the original recombinant viral vector. Preferably, the viral vector is selected from the group consisting of adenovirus vectors (also referred to herein as "adenoviral vectors" or simply "adenovirus"), adeno-associated virus (AAV) vectors (e.g., AAV types 5 and 2), alphaviruses (e.g., Venezuelan equine encephalitis virus (VEE), Sindbis virus (SIN), Semliki Forest virus (SFV), and VEE-SIN chimeras), herpesvirus vectors (e.g., vectors derived from cytomegaloviruses such as Rhesus cytomegalovirus (RhCMV)), arenavirus vectors (e.g., lymphocytic choriomeningitis virus (LCMV) vectors), measles virus vectors, poxvirus vectors, paramyxovirus vectors, baculovirus vectors, vesicular stomatitis virus vectors, retroviruses, lentiviruses, and virus-like particles (VLPs).

[0106] In a particular embodiment, the viral vector is an adenovirus vector. Adenovirus has been widely used for gene transfer applications due to its ability to achieve high efficiency gene transfer in various target tissues and its ability to accommodate large transgenes. The adenovirus vector used in the present invention can be derived from various mammalian hosts. More than 100 different serotypes of adenovirus have been isolated, which infect various mammalian species. These adenovirus serotypes have been classified into six subgenera (AF:B is further divided into B1 and B2) according to sequence homology and based on hemagglutination ability (Tatsis and Ertl 2004).

[0107] The adenovirus vector used in the present invention is suitable to be derived from human adenovirus. Examples of human-derived adenoviruses include Ad1, Ad2, Ad4, Ad5, Ad6, Ad11, Ad19, Ad24, Ad34, and Ad35. Ad5-based vectors have been widely used in many gene therapy trials, but the use of Ad5 and other human group C adenovirus vectors may be limited due to the presence of pre-existing immunity in the general population due to natural infection. Ad5 and other human group C members tend to be among the most seroprevalent serotypes. In addition, existing immunity to vectors may develop as a result of exposure to vectors during treatment. Such pre-existing and developed immunity to seroprevalent vectors may limit the effectiveness of gene therapy or vaccination efforts. Therefore, alternative adenovirus serotypes are very important targets to achieve a gene transfer system that can circumvent host immune responses.

[0108] It will be appreciated that the adenovirus comprises hexon, penton and / or fiber proteins, one or more of which share at least 95% identity, or more preferably at least 98% identity, with, or more preferably are identical to, SEQ ID NO: 123, SEQ ID NO: 124, or SEQ ID NO: 125. These sequences are the Ad5 hexon, penton and fiber protein sequences.

[0109] Alternatively, the adenoviral vectors used in the present invention are derived from non-human simian adenoviruses. Numerous adenoviruses have been isolated from non-human simians, such as chimpanzees, bonobos, rhesus monkeys and gorillas, and vectors derived from these adenoviruses induce strong immune responses against the transgenes they encode (Colloca et al. 2012; Roy et al. 2004; Roy et al. 2010). A definite advantage of vectors based on non-human simian adenoviruses is the relative lack of cross-neutralizing antibodies against these adenoviruses in the target population. For example, cross-reactivity of certain chimpanzee adenoviruses due to pre-existing neutralizing antibody responses exists in only 2% of the target population, compared to 35% for some human adenoviral vector candidates.

[0110] Suitably, the adenoviral vector is derived from a non-human simian adenovirus, for example a chimpanzee adenovirus such as ChAd3, ChAd63, ChAd83, ChAd155, Pan 5, Pan 6, Pan 7 (also referred to as C7) or Pan 9. Examples of such strains are described in WO03 / 000283, WO2005 / 071093, WO2010 / 086189 and GB1510357.5 and can be obtained from the American Type Culture Collection, 10801 University Boulevard, Manassas, Virginia 20110-2209, and other sources. Alternatively, the adenoviral vector may be derived from a non-human simian adenovirus, PanAd1, PanAd2 or PanAd3, isolated from a bonobo. Examples of such vectors described herein can be found, for example, in WO2005 / 071093 and WO2010 / 086189. The adenoviral vector may be derived from an adenovirus isolated from a gorilla as described in WO2013 / 52799, WO2013 / 52811 and WO2013 / 52832.

[0111] Suitably the adenovirus contains a hexon and / or fiber protein, one or more of which hexon and fiber proteins share at least 95% identity, or more suitably at least 98% identity, with, or more suitably are identical to, SEQ ID NO: 126 or SEQ ID NO: 127, respectively, which are the hexon and fiber protein sequences of ChAd3.

[0112] Suitably the adenovirus contains a hexon and / or fiber protein, one or more of which hexon and fiber proteins share at least 95% identity, or more suitably at least 98% identity, with, or more suitably are identical to, SEQ ID NO: 128 or SEQ ID NO: 129, respectively. These are the hexon and fiber protein sequences of ChAd19.

[0113] Suitably the adenovirus contains a hexon and / or fiber protein, one or more of which hexon and fiber proteins share at least 95% identity, or more suitably at least 98% identity, with, or more suitably are identical to, SEQ ID NO: 130 or SEQ ID NO: 131, respectively, which are the hexon and fiber protein sequences of ChAd63.

[0114] Suitably the adenovirus contains hexon, penton and / or fiber proteins, one or more of which share at least 95% identity, or more suitably at least 98% identity, with, or more suitably are identical to, SEQ ID NO: 132, SEQ ID NO: 133 or SEQ ID NO: 134, respectively, which are the hexon, penton and fiber protein sequences of ChAd155.

[0115] Adenoviruses have a characteristic morphology with an icosahedral capsid containing three major proteins, the hexon (II), the penton base (III) and the knob-like fiber (IV), along with several other minor proteins VI, VIII, IX, IIIa and IVa2. The viral genome is a linear, double-stranded DNA. The viral DNA is intimately associated with the highly basic protein VII and a small peptide pX (formerly called mu). Another protein, V, is packaged with this DNA-protein complex and provides a structural link to the capsid via protein VI. The virus also contains a virally encoded protease, which is required for the processing of some of the structural proteins to generate mature, infectious virus.

[0116] The adenovirus genome has been well characterized. There is a general conservation in the overall organization of the adenovirus genome with regard to the location of certain similarly positioned open reading frames, for example, the E1A, E1, E2A, E2B, E3, E4, L1, L2, L3, L4 and L5 genes of each virus. Each end of the adenovirus genome contains a sequence known as an inverted terminal repeat (ITR), which is necessary for viral replication. The virus also contains a virally encoded protease, which is necessary for the processing of some structural proteins required to produce infectious virions. The structure of the adenovirus genome is described based on the order in which the viral genes are expressed after being introduced into a host cell. More specifically, the viral genes are referred to as early (E) or late (L) genes, depending on whether transcription occurs before or after the initiation of DNA replication. During the early stages of transduction, the adenoviral E1A, E1B, E2A, E2B, E3 and E4 genes are expressed, preparing the host cell for viral replication. Later in infection, expression of the late genes L1-L5 is activated, which code for structural components of the viral particle.

[0117] Replication-competent adenovirus is an adenovirus that can replicate in host cells without any recombinant helper protein contained in the cell.Suitably, replication-competent adenovirus comprises the following intact, i.e. functional, essential early genes: E1A, E1B, E2A, E2B, E3 and E4.Wild-type adenovirus isolated from a particular animal can replicate in that animal.

[0118] A replication-incompetent or replication-defective adenovirus refers to an adenovirus that lacks any of the following genes: E1A, E1B, E2A, E2B, E3, and E4 (e.g., E3 ORF1, E3 ORF2, E3 ORF3, E3 ORF4, E3 ORF5, E3 ORF6, E3 ORF7, E3 ORF8, E3 ORF9, E4 ORF7, E4 ORF6, E4 ORF5, E4 ORF4, E4 ORF3, E4 ORF2, and / or E4 ORF4). An adenovirus that is replication-incompetent because it has been engineered to contain at least a functional deletion (i.e., a "loss-of-function" mutation) or complete removal of a gene encoding a gene product essential for viral replication, such as one or more of the adenoviral genes selected from the group consisting of adenoviral genes selected from the group consisting of the adenoviral genes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 112, 113, 120, 121, 132, When using the ChAd3 vector, suitably the E1, E3 and E4 genes are deleted by insertion of the Ad5 E4 ORF6.

[0119] With regard to the construction of adenoviral vectors for gene transfer into mammalian (e.g., human) cells, various modified adenoviral nucleic acid sequences can be used in the vector. For example, all or part of the adenoviral delayed early gene E3 can be removed from the adenoviral sequences that are part of the recombinant virus. The function of E3 is believed to be independent of the function and production of recombinant viral particles. Adenoviral vectors can also be constructed to have a deletion of at least the ORF6 region of the E4 gene, although deletion of the entire E4 region is more desirable due to the redundancy of the functions of this region. Yet another vector of the invention contains a deletion in the delayed early gene E2A. The deletion may be made in any of the late genes L1-L5 of the adenoviral genome. Similarly, deletion of intermediate genes IX and IVa2 may be useful for some purposes. Other deletions can be made in other structural or nonstructural adenoviral genes. The above deletions may be used individually, i.e., the adenoviral sequences used as described herein may contain deletions in only one region. Alternatively, any combination of deletions of the entire gene or portions thereof effective to impair biological activity may be used.

[0120] Adenovirus lacking one or more essential adenoviral sequences (e.g., E1A, E1B, E2A, E2B, E4 ORF6, L1, L2, L3, L4 and L5) can be cultured in the presence of the defective adenoviral gene products necessary for viral infectivity and propagation of the adenoviral particle. These helper functions can be provided by culturing the adenovirus in the presence of one or more helper constructs (e.g., plasmid viruses) or packaging host cells.

[0121] Suitably, the viral vector is a poxvirus vector. The family Poxviridae is characterized by a genome consisting of double-stranded DNA. Advantageously, the poxvirus vector belongs to the subfamily Chordopoxviridae, more preferably to a genus within said subfamily selected from the group consisting of Orthopoxvirus, Parapoxvirus, Yatapoxvirus, Avipoxvirus (preferably Canarypox virus (ALVAC) or Fowlpox virus (FPV)) and Morsipoxvirus. More preferably, the poxvirus vector belongs to the genus Orthopoxvirus and is selected from the group consisting of Vaccinia virus, NYVAC (derived from the Copenhagen strain of vaccinia), Modified Vaccinia Ankara (MVA), Cowpox virus and Monkeypox virus. Most preferably, the poxvirus vector is MVA.

[0122] A description of MVA can be found in Mayr A, Stickl H, Mueller HK, Danner K, Singer H. 1978, and Mayr, A., Hochstein-Mintzel, V. & Stickl, H. 1975.

[0123] MVA is a highly attenuated vaccinia virus strain that has undergone multiple, fully characterized deletions over more than 570 passages in chicken embryo fibroblasts. These included host range genes and genes encoding cytokine receptors. The virus cannot replicate efficiently in human and most other mammalian cells, but the replication defects occur at a late stage of virion assembly, leaving viral and recombinant gene expression intact, making MVA an efficient single-round expression vector incapable of causing infection in mammals. In one embodiment, MVA is derived from virus seed batch 460 MG, obtained from the 571st passage of vaccinia virus passaging in CEF cells. In another embodiment, MVA is derived from virus seed batch MVA 476 MG / 14 / 78. In yet another embodiment, MVA is derived or manufactured before December 31, 1978, and is free of prion contamination.

[0124] In addition to a polynucleotide encoding a fusion protein, a vector can also contain conventional regulatory elements operably linked to the encoding polynucleotide so as to enable its transcription, translation and / or expression in a cell transfected with the vector.

[0125] Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (polyA) signals, including rabbit beta globin polyA, sequences that stabilize cytoplasmic mRNA, sequences that enhance translation efficiency (Kozak consensus sequences), sequences that enhance protein stability, and, if necessary, sequences that enhance secretion of the encoded product. Chimeric introns, among other sequences, can be used.

[0126] A promoter is a nucleotide sequence that allows the binding of RNA polymerase and directs the transcription of a gene. Typically, promoters are located in the 5' non-coding region of a gene, close to the transcription initiation site of the gene. Sequence elements within a promoter that function in transcription initiation are often characterized by consensus nucleotide sequences. Examples of promoters include, but are not limited to, promoters from bacteria, yeast, plants, viruses and mammals (including humans). Numerous expression control sequences are known and available in the art, including promoters that are internal promoters, natural promoters, constitutive promoters, inducible promoters and tissue-specific promoters.

[0127] Examples of constitutive promoters include the TBG promoter, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally including the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally including the CMV enhancer, see e.g. Boshart et al. 1985), the CASI promoter, the SV40 promoter, the dihydrofolate reductase promoter, the beta-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EF1a promoter (Invitrogen). Suitably, the promoter is an HCV promoter or a variant thereof, more suitably, a human CMV (HCMV) promoter or a variant thereof.

[0128] The following examples of mouse invariant chain fragments demonstrate the effect of such fragments on OVA antigen immunogenicity and OVA antigen presentation when placed in adenovirus type 5 (Ad5) vectors. Ad5 has proven to be an effective vaccine vector (see, for example, Tatsis and Hildegund 2004). The findings on Ad5 vectors given in the examples herein are expected to be equally applicable to other vectors, such as bacterial vectors and synthetic lipid nanoparticles. In the case of bacterial vectors, the invariant chain fragments described herein are expected to have a particularly favorable effect on the CD8+ T cell response elicited by such vectors.

[0129] Pharmaceutical Compositions and Adjuvants The fusion protein, polynucleotide or vector of the present invention may be included in a pharmaceutical composition. Suitably, the pharmaceutical composition includes a pharma- ceutically acceptable carrier. A vaccine is a pharmaceutical composition that provides adaptive immunity against a particular disease. The present invention provides a vaccine comprising the fusion protein, polynucleotide or vector of the present invention.

[0130] The vectors can be prepared for administration by suspending or dissolving them in a pharma- ceutical or physiologically acceptable carrier, such as isotonic saline or other isotonic salt solutions. Suitable carriers will be apparent to those skilled in the art and will depend in large part on the route of administration. The compositions described herein can be administered as sustained release formulations, preferably using biodegradable, biocompatible polymers, or by in situ delivery using micelles, gels, and liposomes.

[0131] The term "carrier" as used herein refers to, but is not limited to, a pharmacologically inert substance, such as a vehicle, additive, or base, with which a therapeutically active ingredient is administered. Such pharmaceutical carriers can be liquid or solid. Liquid carriers include, but are not limited to, sterile liquids, such as saline and oils, such as those of petroleum, animal, vegetable, or synthetic origin, for example, peanut oil, soybean oil, mineral oil, sesame oil, etc. Saline and aqueous dextrose and glycerol solutions can also be used as liquid carriers, particularly for injectable solutions. Saline is one of the preferred carriers when the pharmaceutical composition is administered intravenously or intranasally by nebulizer.

[0132] Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glyceryl monostearate, talc, sodium chloride, dried skim milk, glycerin, propylene, glycol, water, ethanol, etc. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by EW Martin.

[0133] The term "adjuvant" refers to an agent (medicine) that enhances, stimulates, activates, strengthens, or modulates the immune response to the active ingredient of the composition, either at the cellular or humoral immune level, for example, an immunological adjuvant stimulates the immune system's response to the actual antigen, but does not have an immunological effect itself. Suitably, the pharmaceutical composition of the present invention includes an adjuvant.

[0134] Examples of such adjuvants include inorganic adjuvants (e.g., inorganic metal salts such as aluminum phosphate or aluminum hydroxide), organic adjuvants (e.g., saponins such as QS21, or squalene), oil-based adjuvants (e.g., Freund's complete and incomplete adjuvants), cytokines (e.g., IL-1β, IL-2, IL-7, IL-12, IL-18, GM-CFS, and IFN-γ), particulate adjuvants (e.g., immune stimulating complexes (ISCOMS), liposomes, or biodegradable microspheres), virosomes, bacterial adjuvants (e.g., 3-de-O-acylated monophosphoryl lipid A, These include, but are not limited to, monophosphoryl lipid A such as 3D-MPL, or muramyl peptides), synthetic adjuvants (e.g., non-ionic block copolymers, muramine peptide analogs, or synthetic lipid A), synthetic polynucleotide adjuvants (e.g., polyarginine or polylysine), and immunostimulatory oligonucleotides containing unmethylated CpG dinucleotides (CpG).

[0135] A suitable adjuvant is monophosphoryl lipid A (MPL), in particular 3-de-O-acylated monophosphoryl lipid A (3D-MPL). Chemically, it is often supplied as a mixture of 3-de-O-acylated monophosphoryl lipid A with either 4, 5 or 6 acylated chains. It can be purified and prepared by the methods described in GB 2122204B, which also discloses the preparation of diphosphoryl lipid A and its 3-O-deacylated variant. Other purified and synthetic lipopolysaccharides have been described (US Pat. No. 6,005,099 and EP 0 729 473 B1; Hilgers et al. 1986; Hilgers et al. 1987; and EP 0 549 074 B1).

[0136] Saponins are also suitable adjuvants (see Lacaille-Dubois, M and Wagner, H 1996). For example, the saponin Quil A (derived from the bark of the South American tree Quillaja Saponaria Molina) and fractions thereof are described in US Pat. No. 5,057,540 and Kensil 1996; and EP 0 362 279 B1. Purified fractions of Quil A are also known as immunostimulants, such as QS21 and QS17; their preparation methods are described in US Pat. No. 5,057,540 and EP 0 362 279 B1. Also described in the above documents is QS7 (a non-haemolytic fraction of Quil A). The use of QS21 is further described in Kensil et al 1991. Combinations of QS21 with polysorbates or cyclodextrins are also known (WO 99 / 10008). Particulate adjuvant systems comprising fractions of Quil A such as QS21 and QS7 are described in WO 96 / 33739 and WO 96 / 11711.

[0137] Another adjuvant is an immunostimulatory oligonucleotide that contains unmethylated CpG dinucleotides (CpG) (Krieg 1995). CpG is an abbreviation for the cytosine-guanosine dinucleotide motif present in DNA. CpG is known to be an adjuvant when administered by both systemic and mucosal routes (WO 96 / 02555, EP 468520, Davis et al 1998; McCluskie and Davis 1998). When formulated into a vaccine, CpG may be administered in free solution with free antigen (WO 96 / 02555), or may be covalently bound to the antigen (WO 98 / 16247), or may be formulated with a carrier such as aluminum hydroxide (Brazolot-Millan et al. 1998).

[0138] Such adjuvants can be formulated with carriers such as liposomes, oil-in-water emulsions, and / or metal salts (including aluminum salts such as aluminum hydroxide). For example, 3D-MPL can be formulated with aluminum hydroxide (EP 0 689 454) or oil-in-water emulsions (WO 95 / 17210); QS21 can be formulated with cholesterol-containing liposomes (WO 96 / 33739), oil-in-water emulsions (WO 95 / 17210), or alum (WO 98 / 15287); CpG can be formulated with alum (Brazolot-Millan, supra) or other cationic carriers.

[0139] Combinations of adjuvants can be utilized in the present invention, particularly combinations of monophosphoryl lipid A and saponin derivatives (see, for example, WO 94 / 00153; WO 95 / 17210; WO 96 / 33739; WO 98 / 56414; WO 99 / 12565; WO 99 / 11241), more particularly combinations of QS21 and 3D-MPL as described in WO 94 / 00153, or compositions in which QS21 is quenched in cholesterol-containing liposomes (DQ) as described in WO 96 / 33739. Alternatively, combinations of CpG and saponins such as QS21 are suitable adjuvants for use in the present invention. A potent adjuvant formulation comprising QS21, 3D-MPL and tocopherol in an oil-in-water emulsion is described in WO 95 / 17210 and is another formulation for the present invention. Saponin adjuvants can be formulated in liposomes and combined with immunostimulatory oligonucleotides. Thus, suitable adjuvant systems include, for example, monophosphoryl lipid A, preferably 3D-MPL, in combination with an aluminum salt (for example, as described in WO00 / 23105). Other exemplary adjuvants contain QS21 and / or MPL and / or CpG. QS21 may be quenched in cholesterol-containing liposomes as described in WO 96 / 33739.

[0140] Other suitable adjuvants include alkyl glucosaminide phosphates (AGPs), as described in WO 9850399 or US Pat. No. 6,303,347 (which also discloses methods for preparing AGPs), or pharma- ceutically acceptable salts of AGPs, as described in US Pat. No. 6,764,840. Some AGPs are TLR4 agonists, while others are TLR4 antagonists. Both are believed to be useful as adjuvants.

[0141] In one embodiment, the present invention provides a fusion protein, a polynucleotide, a viral vector, or a pharmaceutical composition for use as a medicament. Suitably, the fusion protein, the polynucleotide, the viral vector, or the pharmaceutical composition is for treating or preventing Hepatitis B virus infection or Hepatitis C virus infection. There is also provided a use of the fusion protein, the polynucleotide, the viral vector, or the pharmaceutical composition of the present invention for the manufacture of a medicament (medicine) for preventing or treating Hepatitis B virus infection or Hepatitis C virus infection. There is also provided a method of treating or preventing Hepatitis B virus infection or Hepatitis C virus infection, which comprises administering to a person in need thereof an effective amount of the fusion protein, the polynucleotide, the viral vector, or the pharmaceutical composition of the present invention.

[0142] Administration In certain embodiments, the vector is administered intranasally, intramuscularly, subcutaneously, intradermally, intragastricly, orally, rectally or topically.

[0143] Intranasal administration is the administration of the vector to any mucous membrane of the respiratory tract, including the lungs. More specifically, the composition is administered to the mucous membrane of the nose. In some embodiments, intranasal administration is accomplished by spraying or aerosol. In other embodiments, the administration does not involve piercing the mucous membrane with a mechanical means such as a needle. Intramuscular administration refers to the injection of the vector into any muscle of an individual. Typical intramuscular injections are administered in the area of ​​the deltoid, vastus lateralis, or ventral and dorsal gluteal muscles. Subcutaneous administration refers to the injection of the vector into subcutaneous tissue. Intradermal administration refers to the injection of the vector into the dermis between the skin layers. Intragastric administration refers to the administration of the vector directly into the stomach. Oral administration refers to the administration of the vector into stomach tissue via the mouth. Topical administration refers to the administration of the vector to any part of the skin or mucous membrane without piercing the skin with a needle or equivalent device. The vector can be administered locally to the mucous membrane of the oral cavity, nose, genital area, and / or rectum. Topical administration includes means of administration such as sublingual and / or buccal administration. Sublingual administration is administration of the vector under the tongue (e.g., via an oral film (OTF)). Buccal administration is administration of the vector across the buccal mucosa of the cheek.

[0144] The fusion protein, polynucleotide or vector of the present invention can be used to prime an immune response. The term "priming an immune response" refers to the first encounter of the immune system with an antigen sequence and the induction of an antigen-specific immune response within a certain period of time thereafter. In some embodiments, the encounter of an individual's immune system with an antigen sequence that does not induce an antigen-specific immune response is not considered to "prime an immune response". For example, the encounter of an individual's immune system with an antigen sequence that does not induce immunity is not considered to "prime an immune response" according to the present invention. In other embodiments, the induction of immunity is brought about by the generation of memory B cells and / or memory T cells. For example, in the case of cancer, cancer cells can express a particular antigen without inducing an immune response. The mere presence of this antigen does not "prime an immune response" against said antigen. In some embodiments, the individual was not intentionally immunized with an antigen sequence or a vector containing a polynucleotide encoding such a sequence for the purpose of treating or preventing a disease within a given period of time previously.

[0145] The individual to be immunized with the polynucleotide of the invention may be, for example, a mammal or bird, more particularly a primate, mouse, rat, sheep, goat, cow, pig, horse, goose, chicken, duck or turkey, but most particularly a human. Suitably, the fusion protein, polynucleotide, viral vector or pharmaceutical composition is for administration to a mammal, more preferably for administration to a human.

[0146] The polynucleotides of the present invention can be used in a prime-boost vaccination regimen. In many cases, a single dose of a vaccine is not sufficient to generate the number of long-lasting immune cells required for effective protection against future infections with the pathogen, prevent disease, or treat disease. As a result, repeated challenges with a specific pathogen or disease-specific biological agent may be required to establish long-lasting protective immunity against the pathogen or to cure the disease. A regimen that includes repeated administration of a vaccine against the same pathogen or disease is called a "prime-boost vaccination regimen." In one embodiment, a prime-boost vaccination regimen requires at least two doses of a vaccine against a particular pathogen, group of pathogens, or group of diseases. The first administration of a vaccine is called "priming," and any subsequent administration of the same vaccine or a vaccine against the same pathogen as the first vaccine is called "boosting." Thus, in yet another embodiment of the present invention, a prime-boost vaccination regimen requires a single dose of a vaccine to prime the immune response, and at least one subsequent dose to boost the immune response. Of course, two, three, four or even five administrations are also considered to enhance immune response. The period between priming and boosting is 1 week, 2 weeks, 4 weeks, 6 weeks or 8 weeks as required. More specifically, it is 4 weeks or 8 weeks. When two or more boosts are performed, the later boost is administered 1 week, 2 weeks, 4 weeks, 6 weeks or 8 weeks after the preceding boost. For example, the interval between any two boosts is 4 weeks or 8 weeks.

[0147] Prime-boost vaccination methods can be homologous or heterologous. In homologous prime-boost methods, priming and at least one boosting are both performed using the same administration means of antigen protein or antigen fragment thereof, i.e., priming and boosting are performed using one polypeptide, or priming and boosting are performed using one polynucleotide contained in the same vector. In the context of the present invention, homologous prime-boost vaccination methods will include the use of the vector of the present invention for both priming and boosting immune response. Heterologous prime-boost methods will include the use of different means for priming and boosting immune response. Heterologous prime-boost methods will include the vector of the present invention for priming immune response, and different vectors or peptide vaccines for boosting immune response.

[0148] Alternatively, a heterologous prime-boost vaccination regimen may include a different vector or peptide vaccine for priming the immune response and a vector of the present invention for boosting the immune response. In one embodiment of the present invention, the prime-boost vaccination regimen is homologous. In another embodiment of the present invention, the prime-boost vaccination regimen is heterologous. In one heterologous prime-boost vaccination regimen, a vector is used for boosting the immune response and a different vector or peptide vaccine is used for priming the immune response. In another embodiment of a heterologous prime-boost vaccination regimen, a vector is used for priming the immune response and a different vector or peptide vaccine is used for boosting the immune response. Suitably, the antigen sequence used for boosting the immune response is immunologically identical to the antigen sequence used for priming the immune response. Two or more antigen sequences are "immunologically identical" if they are recognized by the same antibody, T cell, or B cell. Recognition of two or more immunogenic sequences by the same antibody, T cell, or B cell is also known as "cross-reactivity" of said antibody, T cell, or B cell. In one embodiment, the recognition of two or more immunologically identical sequences by the same antibody, T cell or B cell is due to the presence of the same or similar epitopes in all sequences. Similar epitopes share sufficient structural and / or charge characteristics to be bound by the Fab region of the same antibody or B cell receptor, or by the V region of the same T cell receptor. The binding characteristics of an antibody, T cell receptor or B cell receptor are defined, for example, by the binding affinity of the receptor for the epitope. Suitably, two immunogenic polypeptides are immunologically identical if the affinity constant of the polypeptide with the lower affinity constant is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% of the affinity constant of the polypeptide with the higher affinity constant. Suitably, two or more immunologically identical polypeptides contain at least one identical epitope.The strongest vaccination effect can usually be obtained when immunogenic polypeptides contain the same epitope or have the same amino acid sequence. In some embodiments, the use of vectors for priming or boosting immune response will establish protective immunity against pathogens or diseases or eradicate diseases. In some embodiments, the use of vectors for priming or boosting immune response will increase antigen-specific CD8+ T cell response compared to the same method without invariant chain fragment. In some embodiments, the use of vectors for priming or boosting immune response will increase antigen-specific CD4+ T cell response compared to the same method without invariant chain fragment.

[0149] In one embodiment of the present invention, the vaccine is used in a prime-boost vaccination regimen. In a first embodiment of this prime-boost vaccination regimen, the vector is used for priming the immune response. In another embodiment of the prime-boost vaccination regimen, the vector is used for boosting the immune response.

[0150] In certain embodiments of the invention, the immune response is primed by intranasal administration and the immune response is boosted by at least one intramuscular administration; the immune response is primed by intranasal administration and the immune response is boosted by at least one subcutaneous administration; the immune response is primed by intranasal administration and the immune response is boosted by at least one intradermal administration; the immune response is primed by intranasal administration and the immune response is boosted by at least one intragastric administration; the immune response is primed by intranasal administration and the immune response is boosted by at least one oral administration; the immune response is primed by intranasal administration and the immune response is boosted by at least one topical administration; the immune response is primed by intranasal administration and the immune response is boosted by at least one intranasal administration; the immune response is primed by intramuscular administration and the immune response is boosted by at least one intramuscular administration; the immune response is primed by intramuscular administration. the immune response is primed by intramuscular administration and the immune response is boosted by at least one subcutaneous administration;the immune response is primed by intramuscular administration and the immune response is boosted by at least one intradermal administration;the immune response is primed by intramuscular administration and the immune response is boosted by at least one intragastric administration;the immune response is primed by intramuscular administration and the immune response is boosted by at least one oral administration;the immune response is primed by intramuscular administration and the immune response is boosted by at least one topical administration;the immune response is primed by intramuscular administration and the immune response is boosted by at least one intranasal administration;the immune response is primed by subcutaneous administration and the immune response is boosted by at least one intramuscular administration;the immune response is primed by subcutaneous administration and the immune response is boosted by at least one subcutaneous administration;the immune response is primed by subcutaneous administration and the immune response is boosted by at least one intradermal administration;The immune response is primed by subcutaneous administration and the immune response is boosted by at least one intragastric administration;The immune response is primed by subcutaneous administration and the immune response is boosted by at least one oral administration;The immune response is primed by subcutaneous administration and the immune response is boosted by at least one topical administration;The immune response is primed by subcutaneous administration and the immune response is boosted by at least one intranasal administration;The immune response is primed by intradermal administration and the immune response is boosted by at least one intramuscular administration;The immune response is primed by intradermal administration and the immune response is boosted by at least one subcutaneous administration;The immune response is primed by intradermal administration and the immune response is boosted by at least one intradermal administration;The immune response is primed by intradermal administration and the immune response is boosted by at least one intragastric administration;The immune response is primed by intradermal administration and the immune response is boosted by at least one oral administration;The immune the response is primed by intradermal administration and the immune response is boosted by at least one topical administration;the immune response is primed by intradermal administration and the immune response is boosted by at least one intranasal administration;the immune response is primed by intragastric administration and the immune response is boosted by at least one intramuscular administration;the immune response is primed by intragastric administration and the immune response is boosted by at least one subcutaneous administration;the immune response is primed by intragastric administration and the immune response is boosted by at least one intradermal administration;the immune response is primed by intragastric administration and the immune response is boosted by at least one intragastric administration;the immune response is primed by intragastric administration and the immune response is boosted by at least one oral administration;the immune response is primed by intragastric administration and the immune response is boosted by at least one topical administration;the immune response is primed by intragastric administration and the immune response is boosted by at least one intranasal administration;The immune response is primed by oral administration and the immune response is boosted by at least one intramuscular administration; the immune response is primed by oral administration and the immune response is boosted by at least one subcutaneous administration; the immune response is primed by oral administration and the immune response is boosted by at least one intradermal administration; the immune response is primed by oral administration and the immune response is boosted by at least one intragastric administration; the immune response is primed by oral administration and the immune response is boosted by at least one oral administration; the immune response is primed by oral administration and the immune response is boosted by at least one topical administration; the immune response is primed by oral administration and the immune response is boosted by at least one intranasal administration; the immune response is , the immune response is primed by local administration and the immune response is boosted by at least one intramuscular administration; the immune response is primed by local administration and the immune response is boosted by at least one subcutaneous administration; the immune response is primed by local administration and the immune response is boosted by at least one intradermal administration; the immune response is primed by local administration and the immune response is boosted by at least one intragastric administration; the immune response is primed by local administration and the immune response is boosted by at least one oral administration; the immune response is primed by local administration and the immune response is boosted by at least one local administration; the immune response is primed by local administration and the immune response is boosted by at least one intranasal administration. In one embodiment, the immune response is primed by intranasal administration and the immune response is boosted by at least one intramuscular administration. In yet another embodiment, the immune response is primed by intranasal administration and the immune response is boosted by at least one intranasal administration. In yet another embodiment, the immune response is primed by intramuscular administration and the immune response is boosted by at least one intramuscular administration.

[0151] When a vector of the invention is administered in a dosing regimen that includes co-administration with other components, each formulated in a different composition, the vectors of the invention are preferably administered at or near the same site, in a common location. For example, the components can be administered (e.g., via a route of administration selected from intramuscular, transdermal, intradermal, subcutaneous) on the same side or arm ("ipsilateral" administration), or on the opposite side or arm ("contralateral" administration).

[0152] Dosage The dosage of the vector will vary from patient to patient, depending primarily on factors such as the condition being treated, the age, weight, and health of the patient. For example, a therapeutically effective adult human or animal dosage of a viral vector is generally about 1x10 5 ~ 1x10 15 Viral particles, e.g., 1x10 8 ~1x10 12 (For example, 1x10 8 , 5x10 8 , 1x10 9 , 5x10 9 , 1x10 10 , 2.5x10 10 , 5x10 10 , 1x10 11 , 5x10 11 or 1x10 12 Alternatively, the viral vector typically contains 1x10 5 ~1x10 10 Plaque forming units (PFU), e.g. 1x10 5 PFU, 5x10 5 PFU, 1x10 6 PFU, 5x10 6 PFU, 1x10 7 PFU, 5x10 7 PFU, 1x10 8 PFU, 5x10 8 PFU, 1x10 9 PFU, 5x10 9 PFU, or 1x10 10The dose can be administered in doses of 1 x 10 PFU. The dose will vary depending on the size of the animal and the route of administration. For example, a suitable human or animal dose (for an animal weighing approximately 80 kg) for intramuscular injection is approximately 1 x 10 PFU for a single site. 9 ~Approx. 5 x 10 12 Optionally, multiple administration sites may be used. In another example, a suitable human or animal dose is about 1 x 10 11 ~Approx. 1 x 10 15 It can be within the range of particles.

[0153] An immunologically effective amount of a nucleic acid can suitably be between 1 ng and 100 mg. For example, a suitable amount can be between 1 μg and 100 mg. The appropriate amount of a particular nucleic acid can be readily determined by one of skill in the art. A typical effective amount of a nucleic acid component can be between 1 ng and 100 μg, such as between 1 ng and 1 μg (e.g., 100 ng to 1 μg), or between 1 μg and 100 μg, such as 10 ng, 50 ng, 100 ng, 150 ng, 200 ng, 250 ng, 500 ng, 750 ng, or 1 μg. An effective amount of nucleic acid can include between 1 μg and 500 μg, such as between 1 μg and 200 μg, such as between 10 and 100 μg, such as 1 μg, 2 μg, 5 μg, 10 μg, 20 μg, 50 μg, 75 μg, 100 μg, 150 μg, or even 200 μg. Alternatively, a typical effective amount of nucleic acid can be between 100 μg and 1 mg, such as between 100 μg and 500 μg, such as 100 μg, 150 μg, 200 μg, 250 μg, 300 μg, 400 μg, 500 μg, 600 μg, 700 μg, 800 μg, 900 μg, or 1 mg.

[0154] Generally, a human dose will range from 0.5 ml to 2 ml in volume. Thus, the compositions described herein can be formulated as, for example, 0.5, 1.0, 1.5 or 2.0 ml human doses in volume for the individual or combined immunogenic components.

[0155] One skilled in the art can increase or decrease the above dosages depending on the route of administration and the therapeutic or vaccine application for which the recombinant vector is used. Expression levels of the antigenic sequences can be monitored to determine the frequency of dosage administration. (Example) EXAMPLES

[0156] Preparation and in vivo immunogenicity testing of a series of mouse Ii fragments fused to OVA

[0157] An E1E3 deleted Ad5 construct was made containing the ovalbumin antigen (OVA, SEQ ID NO:8) fused to the C-terminus of a fragment of the mouse Ii sequence (mIi), isoform p31, via a human influenza hemagglutinin (HA) tag (SEQ ID NO:121). The mIis tested are shown in Figure 2, where the numbers indicate the amino acid position in the fragment relative to mIi p31 (see SEQ ID NO:11), "D+ER" indicates the addition of an endoplasmic reticulum retention sequence, and "D-17" indicates the removal of the intralysosomal sorting sequence (ESS). An Ad5 construct was made containing: 1. OVA alone (not shown in Figure 2) 2. mIi (full length)-OVA 3. mIi(1-105)-OVA 4. mIi(1-80)-OVA 5. mIi(1-75)-OVA 6. mIi(1-70)-OVA 7. mIi(1-65)-OVA 8. mIi(1-60)-OVA 9. mIi(1-50)-OVA 10. mIi(D+ER)-OVA 11. mIi(D-17)-OVA 12. mIi(50-215)-OVA

[0158] The polypeptide sequence of mli(D+ER) is set forth in SEQ ID NO: 138. The polypeptide sequence of mli(D-17) (N-terminal Met+residues 18-215 of p31 mli) is set forth in SEQ ID NO: 139. The polypeptide sequence of mIi(50-215) (N-terminal Met+residues 51-215 of p31 mli) is set forth in SEQ ID NO: 140. Contrary to what is indicated, mli(50-215) does not contain residues 50-215 of p31, but instead comprises residues 51-215.

[0159] The mIiThe promoter used in all constructs in this example and below was the HCMV promoter or a variant thereof (e.g., pacCMV). Viral cotransfections were performed using the HCMV promoter, Sv40 polyA sequence, and pJM17 as described by Becker et al. 1994. The immunological potency of the various constructs was 3x10 6 Particles (vp) were evaluated by injecting a single intramuscular dose into C57BL / 6 mice. Two weeks after injection, splenocytes were harvested and tested by IFN-γ ELISpot using the OVA 257-264 dominant CD8 peptide SIINFEKL (SEQ ID NO: 118, previously identified and mapped in C57BL / 6 mice) as antigen. Results are shown in FIG. 3, where responses are expressed as the number of IFNγ producing T cells per million splenocytes. The statistical test applied was a one-way analysis of variance (Dunnett's multiple comparison test), where *p<0,05; **p<0,01; ***p<0,001; ****p<0,0001.

[0160] As expected, the mIi(full length)-OVA construct produced a higher average response compared to OVA alone (see FIG. 3, mIi-OVA and OVA). Similarly, the prior art constructs mIi(D+ER)-OVA, mIi(D-17)-OVA and mIi(50-215)-OVA produced a higher average response than OVA alone. Comparison of mIi(full length)-OVA with similar constructs containing mIi fragments revealed that, among the mIi fragments tested, the mIi(1-75) sequence was the smallest sequence that maintained the full adjuvant effect of full length mIi. Indeed, mIi(1-75) showed a higher average level of immunogenicity enhancement than full length mIi. This is a surprising finding because mIi(1-75) not only lacks the trimerization domain (important for its role as an MHC-II chaperone and MIF signaling receptor), but also the KEY and CLIP domains previously thought to be important for the adjuvant effect of Ii. In contrast, further truncation to the mIi(1-70) fragment resulted in a significant loss of immunogenicity. No data are shown for mIi(1-105)-OVA. mIi(1-105)-OVA elicited responses similar to mIi(full length)-OVA. EXAMPLES

[0161] In vitro testing of antigen presentation by mouse Ii1-50, Ii1-75, Ii1-80, Ii50-215, or mouse Ii (full length) fused to OVA The activity of the truncated mIi was also evaluated in vitro for its effect on MHC-I antigen presentation. The in vitro test consisted of infection of bone marrow-derived dendritic cells (BMDCs) with Ad5 containing OVA and individual mIi fragments fused to OVA via the HA tag (mIi(1-50)-OVA, mIi(1-75)-OVA, mIi(1-80)-OVA, mIi(50-215)-OVA and mIi(full length)-OVA) in the same orientation as outlined in Example 1.

[0162] 24 hours after infection, cells were stained with a fluorescent monoclonal antibody that recognizes the ovalbumin-derived peptide SIINFEKL (SEQ ID NO: 118) bound to H-2Kb of MHC-I, and CD11 expression was observed after infection with Ad5-mIi(full length)-OVA and Ad5-mIi(truncated)-OVA relative to the Ad5-OVA control, as shown in FIG. + / SIINFEKL + Antigen presentation levels were established by measuring the % of cells expressing OVA. The antibody reacts specifically with the OVA-derived peptide SIINFEKL bound to H-2Kb of MHC class I, but not with unbound H-2Kb or with H-2Kb bound to irrelevant peptides. Thus, Figure 4 shows the fold difference in OVA antigen presentation for mIi(full length)-OVA or variants compared to OVA. Statistical significance was determined by unpaired two-tailed parametric Student's t-test (* p<0,05, ** p<0,01, *** p<0,001, **** p<0,001). Both mIi(1-75) and mIi(50-215) were found to increase antigen presentation to a similar level as full length mIi (labeled mIi-OVA in Figure 4). In contrast, mIi(1-50) resulted in a low level of antigen presentation similar to OVA alone (labeled OVA in Figure 5). Data is not shown for mIi(1-80)-OVA, which elicited a similar response to mIi(full length)-OVA. EXAMPLES

[0163] Preparation, in vivo immunogenicity, and in vitro antigen presentation tests of mouse Ii1-75 or Ii50-75 fused to OVA An Ad5 construct was made containing OVA, which was fused to the C-terminus of a fragment of the mouse p31 Ii sequence via an HA tag. The Ad5 construct was deleted from E1E3E4, reinserted with Ad5 E4ORF6, and contained a variant of the HCMV promoter and a bovine growth hormone polyadenylation signal (BGHpolyA). Ad5 constructs containing mIi(1-75)-OVA and mIi(50-75)-OVA were made (see schematic diagram in Figure 5).

[0164] The immunological potency of the various constructs was 6 vp was evaluated by injecting a single dose intramuscularly into female C57BL / 6 mice. Two weeks after injection, splenocytes were harvested and tested by IFN-γ ELISpot using the OVA 257-264 dominant CD8 peptide of SEQ ID NO: 118 (SIINFEKL, previously identified and mapped in C57BL / 6 mice) as antigen. Results are shown in Figure 6, where responses are expressed as the number of IFN-γ producing T cells per million splenocytes. Boxes represent data distribution (1st and 3rd quartiles), the line within the box is the median, and the two whiskers of each box are the minimum and maximum of the data.

[0165] Binding of the full-length mIi sequence and mIi1-75 to the OVA antigen resulted in higher responses than unbound Ad5-OVA, confirming the findings of Example 1. These data indicate that mIi(50-75) has the ability to increase immune responses to similar levels as full-length mIi and mIi(1-75). mIi(1-75) showed the highest mean response level.

[0166] The activity of truncated mIi(50-75) was also evaluated in vitro for its effect on MHC-I antigen presentation as described above in Example 2. Bone marrow derived dendritic cells (BMDCs) were infected with OVA and Ad5 containing individual mIi fragments fused to OVA via an HA tag (mIi(1-75)-OVA and mIi(50-75)-OVA). 24 hours after infection, cells were stained with a fluorescent monoclonal antibody that recognizes the ovalbumin-derived peptide SIINFEKL (SEQ ID NO: 118) bound to the H-2Kb of MHC-I, and CD11 expression was compared with Ad5-OVA control. + / SIINFEKL + The antigen presentation levels as % of cells are shown in FIG.

[0167] Thus, Figure 7 shows the fold difference in OVA presentation for mIi(1-75)-OVA or mIi(50-75)-OVA variants compared to OVA. Statistical significance was determined by unpaired two-tailed Student's t-test (* p<0.05, **** p<0.0001). mIi(1-75) and mIi(50-75) were found to increase antigen presentation compared to OVA alone (labeled OVA).

[0168] In this example, in vivo and in vitro tests About mIi(50-75) The observation made is surprising because mIi(50-75) (corresponding to hIi(67-92)) is a very short fragment of the invariant chain that not only lacks the trimerization domain, KEY and CLIP domains of Ii (as is the case with mIi(1-75)), but also all residues from the N-terminus up to residue 50, including the lysosomal sorting sequence (ESS). EXAMPLES

[0169] Preparation and in vivo immunogenicity testing of various human Ii fragments fused to MAGE A3 PanAd3 constructs containing melanoma associated antigen 3 (MAGE A3, SEQ ID NO: 4) alone, as well as fusions in which MAGE A3 was fused to the C-terminus of full-length human p35 Ii (hIi) or a fragment thereof, hIi(full length)-MAGE A3, hIi(1-97)-MAGE A3, and hIi(17-97)-MAGE A3, were generated. The PanAd3 constructs were deleted for E1 E4 and Ad5 E4 ORF6 was inserted. hIi(17-97) is a region similar to mIi(1-80), but hIi(1-97) further contains an additional 16 residues at the N-terminus for alternative translation initiation (see Figures 1 and 12).

[0170] The immunogenicity of these constructs was evaluated in CB6F1 mice at 10 6vp dose. Splenocytes were harvested two weeks after immunization and tested by IFN-γ ELISpot using MAGE A3 dominant CD8 peptide as antigen. Results are shown in Figure 8, where immunization with PanAd3 containing MAGE A3 alone is labeled "MAGE", responses with PanAd3 containing full length hIi fused to MAGE A3 are labeled "hIi MAGE" and responses with PanAd3 containing hIi fragment fused to MAGE A3 are labeled "1-97 MAGE and 17-97 MAGE". Responses are expressed as the number of IFN-γ producing T cells per million splenocytes.

[0171] As can be seen in Figure 8, hIi(1-97) (which contains the ER retention sequence) provided a lower adjuvant effect than full-length hIi, whereas hIi(17-97) induced T cell responses comparable to full-length hIi. The findings regarding hIi(17-97) were further confirmed in independent repeat experiments (not shown). EXAMPLES

[0172] Preparation and in vivo immunogenicity testing of various human Ii fragments fused to HCV-NS ChAd3 constructs were generated that contained the Hepatitis C virus nonstructural protein (HCV-NS, SEQ ID NO: 117) alone, as well as fusions in which HCV-NS was fused to the C-terminus of full-length human p35 Ii (hIi) or a fragment thereof, hIi(full-length)-HCV-NS, hIi(1-97)-HCV-NS, and hIi(17-97)-HCV-NS. The ChAd3 constructs were deleted for E1, E3, and E4, and inserted with Ad5 E4 ORF6.

[0173] The immunogenicity of these constructs was evaluated in outbred CD1 mice at 10 6 vp dose. Splenocytes were harvested 2 weeks after immunization and tested by IFN-γ ELISpot using a peptide pool covering the entire NS sequence as antigen (Figure 9).

[0174] As can be seen from FIG. 9, hIi(full length)-HCV-NS, hIi(1-97)-HCV-NS, and hIi(17-97)-HCV-NS all produced higher mean responses than HCV-NS. EXAMPLES

[0175] Targeting of Ii antigen to the proteasome via ubiquitin signaling To characterize the molecular mechanism / pathway of Ii responsible for enhanced antigen presentation, we investigated the effect of Ii binding on antigen processing in the presence of the proteasome inhibitor MG-132. Proteasomal protein degradation is a key step in class I antigen processing and is a highly specific process that crucially requires the covalent attachment of one or more ubiquitin molecules to the protein to be degraded.

[0176] To confirm whether ubiquitin promotes proteasome-mediated Ii-OVA degradation, two experiments were performed. In the first experiment, HeLa cells were transiently transfected with a ubiquitin expression plasmid and then infected with 50 MOI of Ad5-mIi(full length)-OVA, Ad5-mIi(1-75)-OVA, and Ad5-mIi(1-50)-OVA in the presence or absence of 10 μM MG-132. Cell extracts were immunoprecipitated with anti-Lys48 antibody, followed by Western blotting with anti-HA tag antibody. Mock samples corresponding to uninfected cells were used as controls. In the second experiment, the same procedure was performed but with Ad5-OVA, Ad5-mIi(full length)-OVA, Ad5-mIi(1-75)-OVA, and Ad5-mIi(50-75)-OVA.

[0177] The results of the first experiment are shown in Figure 10, and the results of the second experiment are shown in Figure 11. The results revealed the presence and accumulation of polyubiquitinated Ii-OVA after proteasome inhibition for Ad5-mIi(full length)-OVA, Ad5-mIi(1-75)-OVA, and Ad5-mIi(50-75)-OVA (Figure 11). Thus, binding of this antigen to full length mIi, mIi(1-75), and mIi(50-75) leads to ubiquitination of the antigen, which can be detected by blocking the proteasome. This polyubiquitination phenomenon does not occur with mIi(1-50) (Figure 10).

[0178] This result suggests that in the presence of full-length mIi, mIi(1-75), and mIi(50-75), antigens are more efficiently processed by the proteasome, resulting in higher amounts of antigenic peptides that are successfully presented on dendritic cells by MHC class I. These same fragments are highly effective in enhancing the immunogenicity of antigens in vivo. However, this effect was not observed with the mIi(1-50) fragment (i.e., an Ii fragment that is not effective in enhancing the immunogenicity of antigens in vivo). EXAMPLES

[0179] Preparation and in vivo immunogenicity testing of small mouse Ii fragments fused to OVA In Example 3, it was demonstrated that the mIi(50-75) fragment (corresponding to hIi(67-92)) has the ability to increase immunological responses to levels similar to full-length mIi and mIi(1-75). In this example, Ad5 vectors encoding further truncated fragments of mouse p31 Ii (mIi) fused to ovalbumin antigen (OVA) were generated and their immunogenicity was tested in mice after a single immunization.

[0180] Ad5 constructs were made containing: mIi(28-75)-OVA, mIi(55-75)-OVA and mIi(60-75)-OVA. The mIi(28-75)-OVA construct was included to examine the effect of including a transmembrane domain (TM). These new constructs were compared to Ad5 constructs containing OVA only, mIi(full length)-OVA and mIi(50-75)-OVA (Figure 15, OVA alone and mIi(full length)-OVA not shown). The Ad5 construct used in this example was as described in Example 3 (E1 E3 E4 deleted and Ad5 E4 ORF6 inserted, containing a variant of the HCMV promoter and a bovine growth hormone polyadenylation signal (BGHpolyA)).

[0181] The immunological potency of the various constructs was determined in C57BL / 6 mice at 10 6 The responses were evaluated after a single intramuscular dose of viral particles (vp). Splenocytes were harvested 2 weeks after injection and tested by IFN-γ ELISpot using the OVA 257-264 dominant CD8 peptide SIINFEKL (SEQ ID NO: 118, previously identified and mapped in C57BL / 6 mice) as antigen. Median ELISpot responses are shown in Table 2.

[0182] [Table 2]

[0183] It was found that the binding of these mIi fragments (28-75, 55-75, and 60-75) to the OVA antigen resulted in significantly (p<0.05) higher responses than unconjugated OVA vector. Specifically, it is noteworthy that mIi-60-75, a fragment only 16 amino acids long, appears to have the ability to produce an adjuvant effect equal to or even higher than mIi(full length) or mIi(50-75) (Figure 16). The boxes represent the distribution of the data (first and third quartiles), the line within the box is the median, and the two whiskers of each box are the minimum and maximum values ​​of the data.

[0184] mIi55-75 corresponds to hIi(72-92), and mIi60-75 corresponds to hIi(77-92).

[0185] As also discussed in Examples 1 and 2, the enhanced immunogenicity conferred by mIi(55-75) and mIi(60-75) is particularly surprising given that these short regions of the invariant chain contain no known functional domains (see Figure 15). EXAMPLES

[0186] Preparation and in vivo immunogenicity testing of mutant mouse Ii and mouse Ii fragments fused to OVA Ad5 constructs containing the following mutant mouse Ii and mouse Ii fragments were generated: mIi(full length)LLLmut-OVA, mIi(full length)K63R-OVA, and mIi(1-75)K63R-OVA.

[0187] In mIi(full length)LLLmut (SEQ ID NO: 135), the three amino acids LLL at positions 42, 43, and 44 of full length p31 mIi are all mutated to A, whereas in mIi(full length)K63R (SEQ ID NO: 136) and mIi(1-75)K63R (SEQ ID NO: 137), the K at position 63 of full length p31 mIi is mutated to R. These new constructs were compared to Ad5 constructs containing OVA only, mIi(full length)-OVA, and mIi(1-75)-OVA. The Ad5 constructs used in this example were as described in Example 3 (E1 E3 E4 deleted and Ad5 E4 ORF6 inserted, containing a variant of the HCMV promoter and a bovine growth hormone polyadenylation signal (BGHpolyA)).

[0188] The immunological potency of the various Ad5-mIi mutant constructs was evaluated in C57BL / 6 mice at 10 6Evaluation was performed after a single intramuscular dose of viral particles. Splenocytes were harvested 2 weeks after injection and tested by IFN-γ ELISpot using the OVA 257-264 dominant CD8 peptide SIINFEKL (SEQ ID NO: 118, previously identified and mapped in C57BL / 6 mice) as antigen.

[0189] The results are shown in Figure 17. The boxes represent the distribution of the data (1st and 3rd quartiles), the line within the box is the median, and the two whiskers of each box are the minimum and maximum of the data. It was found that the 63K to 63R mutation did not substantially affect the adjuvant activity of either the full-length Ii or the 1-75Ii fragment. Similarly, no effect was seen due to the mutation of LLL to AAA at positions 42, 43, and 44.

[0190] References Altschul et al., Nuc. Acids Res. 25:3389-3402 (1977) Altschul et al., J. Mol. Biol. 215:403-410 (1990) Ausubel et al., Current Protocols in Molecular Biology eds. 1995 supplement Becker et al., Methods Cell Biol. 43(A):161-189 (1994) Brazolot-Millan et al., Proc. Natl. Acad. Sci., USA, 95:15553-8 (1998) Boshart et al., Cell, 41:521-530 (1985) Colloca et al., Sci. Transl. Med. 4:1-9 (2012) Davis et al., J. Immunol, 160:870-876 (1998) Devereaux et al., Nuc. Acids Res. 12:387-395 (1984) Diebold et al., Gene Ther. 8: 487-493 (2001) Feng & Doolittle, J. Mol. Evol. 35:351-360 (1987) Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989) Higgins & Sharp, CABIOS 5:151-153 (1989) Hilgers et al., Int. Arch. Allergy. Immunol. 79(4):392-6 (1986) Hilgers et al., Immunology, 60(1):141-6 (1987) Holmes et al., Journal of Clinical Oncology 26(20):3426-3433 (2008) Holst et al., Journal of Immunology 180(5):3339-3346 (2008) Kallinteris et al., Expert Opinion Biol Ther 6(12):1311-1321 (2006) Karlin & Altschul, Proc. Nat’l. Acad. Sci. USA 90:5873-5787 (1993) Leuenberger, H.G.W, Nagel, B. and Klbl, H. eds. (1995), Helvetica Chimica Acta, CH-4010 Basel, Switzerland Kensil et al., J. Immunology, 146:431-437 (1991) Kensil, Crit. Rev. Ther. Drug Carrier Syst., 12:1-55 (1996) Krieg, Nature 374:546-549 (1995) Lacaille-Dubois, M and Wagner H, Phytomedicine 2:363-386 (1996) Martin, EW "Remington's Pharmaceutical Sciences" Mayr, A., Hochstein-Mintzel, V. & Stickl, H. Infection 3, 6-14 (1975) Mayr A, Stickl H, Mueller HK, Danner K, Singer H. Zentralbl Bakteriol B. 167(5-6):375-90 (1978) McCluskie and Davis, J. Immunol., 161:4463-4466 (1998) Mittendorf et al., Expert Opin. Biol. Ther., 9:71-78 (2009) Morris et al., Immunol. Res., 30: 171-179 (2004) Needleman & Wunsch, J. Mol. Biol. 48:443 (1970) Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988) Pieters J. Curr. Opin. Immunol., 9: 8996 (1997) Roy et al., Virol. 324:361-372 (2004) Roy et al., J. of Gene Med. 13:17-25 (2010) Smith & Waterman, Adv. Appl. Math. 2:482-489 (1981) Strubin et al., EMBO Journal, 5:3483-3488 (1986) Strumptner-Cuvelette and Benaroch, Biochem. Biophys. Acta, 1542:1-13 (2002) Molecular Therapy 10:616–629 (2004). Tatsis and Hildegund, Molecular Therapy 10:616–629 (2004) Waelchli et al., Eur J Immunol. 44(3):774–784 (2014) The present disclosure includes the following embodiments. [1] A fusion protein comprising a polypeptide comprising a fragment of an invariant chain operably linked to an antigenic sequence, the invariant chain fragment comprising: (a) a portion of residues 17-97 of SEQ ID NO:1, the portion comprising at least 5 contiguous residues from residues 77-92 of SEQ ID NO:1; (b) contains a sequence of at least 5 consecutive residues, no longer than 80 residues, which sequence shares at least 80% identity with at least 5 consecutive residues derived from residues 77-92 of SEQ ID NO:1; (c) residues 1-97 of SEQ ID NO:1; (d) 91 to 103 residues that share at least 95% identity with residues 1-97 of SEQ ID NO:1; (e) residues 17-97 of SEQ ID NO:1; (f) 76 to 84 residues that share at least 95% identity with residues 17-97 of SEQ ID NO:1; (g) residues 1-92 of SEQ ID NO:1; (h) 88 to 96 residues that share at least 95% identity with residues 1-92 of SEQ ID NO:1; (i) residues 17-92 of SEQ ID NO:1; or (j) 71 to 79 residues which share at least 95% identity with residues 17-92 of SEQ ID NO:1; The fusion protein comprising: [2] A polynucleotide encoding a fusion protein containing a polypeptide, the polypeptide consisting of a fragment of an invariant chain operably linked to an antigen sequence, the invariant chain fragment being: (a) a portion of residues 17-97 of SEQ ID NO:1, said portion containing at least five contiguous residues from residues 77-92 of SEQ ID NO:1; (b) contains a sequence of at least 5 consecutive residues, no longer than 80 residues, which sequence shares at least 80% identity with at least 5 consecutive residues derived from residues 77-92 of SEQ ID NO:1; (c) residues 1-97 of SEQ ID NO:1; (d) 91 to 103 residues that share at least 95% identity with residues 1-97 of SEQ ID NO:1; (e) residues 17-97 of SEQ ID NO:1; (f) 76 to 84 residues that share at least 95% identity with residues 17-97 of SEQ ID NO:1; (g) residues 1-92 of SEQ ID NO:1; (h) 88 to 96 residues that share at least 95% identity with residues 1-92 of SEQ ID NO:1; (i) residues 17-92 of SEQ ID NO:1; or (j) 71 to 79 residues which share at least 95% identity with residues 17-92 of SEQ ID NO:1; The polynucleotide comprising: [3] A viral vector containing a polynucleotide encoding a fusion protein containing a polypeptide, the polypeptide consisting of a fragment of the invariant chain operably linked to an antigenic sequence, the invariant chain fragment being: (a) a portion of residues 17-97 of SEQ ID NO:1, said portion containing at least five contiguous residues from residues 77-92 of SEQ ID NO:1; (b) contains a sequence of at least 5 consecutive residues, no longer than 80 residues, which sequence shares at least 80% identity with at least 5 consecutive residues derived from residues 77-92 of SEQ ID NO:1; (c) residues 1-97 of SEQ ID NO:1; (d) 91 to 103 residues that share at least 95% identity with residues 1-97 of SEQ ID NO:1; (e) residues 17-97 of SEQ ID NO:1; (f) 76 to 84 residues that share at least 95% identity with residues 17-97 of SEQ ID NO:1; (g) residues 1-92 of SEQ ID NO:1; (h) 88 to 96 residues that share at least 95% identity with residues 1-92 of SEQ ID NO:1; (i) residues 17-92 of SEQ ID NO:1; or (j) 71 to 79 residues which share at least 95% identity with residues 17-92 of SEQ ID NO:1; The viral vector comprising: [4] A fusion protein, polynucleotide, or viral vector described in any of embodiments 1 to 3, wherein the fragment of the invariant chain consists of a portion of residues 17-97 of SEQ ID NO:1, said portion comprising at least five consecutive residues from residues 77-92 of SEQ ID NO:1. [5] The fusion protein, polynucleotide, or viral vector of embodiment 4, wherein the portion comprises at least 8 consecutive residues from residues 77-92 of SEQ ID NO:1. [6] The fusion protein, polynucleotide, or viral vector of embodiment 5, wherein the portion comprises at least 12 consecutive residues from residues 77-92 of SEQ ID NO:1. [7] A fusion protein, polynucleotide, or viral vector described in any of embodiments 1 to 3, wherein the fragment of the invariant chain consists of 80 residues or less and comprises a sequence of at least 5 consecutive residues, which sequence shares at least 80% identity with at least 5 consecutive residues from residues 77-92 of SEQ ID NO:1. [8] The fusion protein, polynucleotide, or viral vector of embodiment 7, wherein the fragment of the invariant chain consists of 80 residues or less and comprises a sequence of at least 5 consecutive residues, the sequence comprising at least 5 consecutive residues from residues 77-92 of SEQ ID NO:1. [9] A fusion protein, polynucleotide, or viral vector described in any of embodiments 1 to 3, wherein the fragment of the invariant chain comprises at least 7 consecutive residues, and the at least 7 consecutive residues share at least 80% identity with at least 7 consecutive residues from residues 77-92 of SEQ ID NO:1.

[10] The fusion protein, polynucleotide, or viral vector of embodiment 9, wherein the fragment of the invariant chain comprises at least 7 consecutive residues, which at least 7 consecutive residues share at least 90% identity with at least 7 consecutive residues from residues 77-92 of SEQ ID NO:1.

[11] The fusion protein, polynucleotide, or viral vector of embodiment 10, wherein the fragment of the invariant chain comprises at least 7 consecutive residues, and the at least 7 consecutive residues comprise at least 7 consecutive residues from residues 77-92 of SEQ ID NO:1.

[12] A fusion protein, polynucleotide, or viral vector described in any of embodiments 1 to 3, wherein the fragment of the invariant chain comprises at least 9 consecutive residues, which at least 9 consecutive residues share at least 80% identity with at least 9 consecutive residues from residues 77-92 of SEQ ID NO:1.

[13] The fusion protein, polynucleotide, or viral vector of embodiment 12, wherein the fragment of the invariant chain comprises at least 9 consecutive residues, which at least 9 consecutive residues share at least 90% identity with at least 9 consecutive residues from residues 77-92 of SEQ ID NO:1.

[14] The fusion protein, polynucleotide, or viral vector of embodiment 13, wherein the fragment of the invariant chain comprises at least 9 consecutive residues, and the at least 9 consecutive residues comprise at least 9 consecutive residues from residues 77-92 of SEQ ID NO:1.

[15] The polypeptide comprises a fragment of an invariant chain operably linked to an antigen sequence, the invariant chain fragment comprising: (a) a portion of residues 17-97 of SEQ ID NO:1, said portion containing at least 10 contiguous residues from residues 67-92 of SEQ ID NO:1; (b) contains a sequence of at least 10 contiguous residues, no longer than 80 residues, which sequence shares at least 80% identity with at least 10 contiguous residues derived from residues 67-92 of SEQ ID NO:1; (c) residues 1-97 of SEQ ID NO:1; (d) 91 to 103 residues that share at least 95% identity with residues 1-97 of SEQ ID NO:1; (e) residues 17-97 of SEQ ID NO:1; (f) 76 to 84 residues that share at least 95% identity with residues 17-97 of SEQ ID NO:1; (g) residues 1-92 of SEQ ID NO:1; (h) 88 to 96 residues that share at least 95% identity with residues 1-92 of SEQ ID NO:1; (i) residues 17-92 of SEQ ID NO:1; or (j) 71 to 79 residues which share at least 95% identity with residues 17-92 of SEQ ID NO:1; The fusion protein, polynucleotide, or viral vector according to any one of embodiments 1 to 3, comprising:

[16] The fusion protein, polynucleotide, or viral vector of embodiment 15, wherein the fragment of the invariant chain consists of a portion of residues 17-97 of SEQ ID NO:1, said portion comprising at least 10 consecutive residues from residues 67-92 of SEQ ID NO:1.

[17] The fusion protein, polynucleotide, or viral vector of embodiment 16, wherein the portion comprises at least 15 consecutive residues from residues 67-92 of SEQ ID NO:1.

[18] The fusion protein, polynucleotide, or viral vector of embodiment 17, wherein the portion comprises at least 20 consecutive residues from residues 67-92 of SEQ ID NO:1.

[19] The fusion protein, polynucleotide, or viral vector of embodiment 18, wherein the portion comprises residues 67-92 of SEQ ID NO:1.

[20] The fusion protein, polynucleotide, or viral vector of embodiment 18, wherein the portion consists of residues 67-92 of SEQ ID NO:1.

[21] The fusion protein, polynucleotide, or viral vector of embodiment 15, wherein the fragment of the invariant chain consists of 80 residues or less and comprises a sequence of at least 10 consecutive residues, which sequence shares at least 80% identity with at least 10 consecutive residues from residues 67-92 of SEQ ID NO:1.

[22] The fusion protein, polynucleotide, or viral vector of embodiment 21, wherein the fragment of the invariant chain consists of 80 residues or less and comprises a sequence of at least 10 consecutive residues, which sequence shares at least 90% identity with at least 10 consecutive residues from residues 67-92 of SEQ ID NO:1.

[23] The fusion protein, polynucleotide, or viral vector of embodiment 22, wherein the fragment of the invariant chain consists of 80 residues or less and comprises a sequence of at least 10 consecutive residues, the sequence comprising at least 10 consecutive residues from residues 67-92 of SEQ ID NO:1.

[24] The fusion protein, polynucleotide, or viral vector of embodiment 23, wherein the fragment of the invariant chain comprises residues 67-76, 68-77, 69-78, 70-79, 71-80, 72-81, 73-82, 74-83, 75-84, 76-85, 77-86, 78-87, 79-88, 80-89, 81-90, 82-91 or 83-92 of SEQ ID NO:1.

[25] The fusion protein, polynucleotide, or viral vector of embodiment 24, wherein the fragment of the invariant chain consists of residues 67-76, 68-77, 69-78, 70-79, 71-80, 72-81, 73-82, 74-83, 75-84, 76-85, 77-86, 78-87, 79-88, 80-89, 81-90, 82-91 or 83-92 of SEQ ID NO:1.

[26] The fusion protein, polynucleotide, or viral vector of embodiment 15, wherein the fragment of the invariant chain comprises at least 15 consecutive residues, which at least 15 consecutive residues share at least 80% identity with at least 15 consecutive residues from residues 67-92 of SEQ ID NO:1.

[27] The fusion protein, polynucleotide, or viral vector of embodiment 26, wherein the fragment of the invariant chain comprises at least 15 consecutive residues, which at least 15 consecutive residues share at least 90% identity with at least 15 consecutive residues from residues 67-92 of SEQ ID NO:1.

[28] The fusion protein, polynucleotide, or viral vector of embodiment 27, wherein the fragment of the invariant chain comprises at least 15 consecutive residues, wherein the at least 15 consecutive residues comprise at least 15 consecutive residues from residues 67-92 of SEQ ID NO:1.

[29] The fusion protein, polynucleotide, or viral vector of embodiment 28, wherein the fragment of the invariant chain comprises residues 67-81, 68-82, 69-83, 70-84, 71-85, 72-86, 73-87, 74-88, 75-89, 76-90, 77-91 or 78-92 of SEQ ID NO:1.

[30] The fusion protein, polynucleotide, or viral vector of embodiment 29, wherein the fragment of the invariant chain consists of residues 67-81, 68-82, 69-83, 70-84, 71-85, 72-86, 73-87, 74-88, 75-89, 76-90, 77-91 or 78-92 of SEQ ID NO:1.

[31] The fusion protein, polynucleotide, or viral vector described in embodiment 28, wherein the fragment of the invariant chain comprises residues 77-92 of SEQ ID NO:1.

[32] The fusion protein, polynucleotide, or viral vector described in embodiment 31, wherein the fragment of the invariant chain consists of residues 77-92 of SEQ ID NO:1.

[33] The fusion protein, polynucleotide, or viral vector of embodiment 15, wherein the fragment of the invariant chain comprises at least 20 consecutive residues, which at least 20 consecutive residues share at least 80% identity with at least 20 consecutive residues from residues 67-92 of SEQ ID NO:1.

[34] The fusion protein, polynucleotide, or viral vector of embodiment 33, wherein the fragment of the invariant chain comprises at least 20 consecutive residues, which at least 20 consecutive residues share at least 90% identity with at least 20 consecutive residues from residues 67-92 of SEQ ID NO:1.

[35] The fusion protein, polynucleotide, or viral vector of embodiment 34, wherein the fragment of the invariant chain comprises at least 20 consecutive residues, wherein the at least 20 consecutive residues comprise at least 20 consecutive residues from residues 67-92 of SEQ ID NO:1.

[36] The fusion protein, polynucleotide, or viral vector of embodiment 35, wherein the fragment of the invariant chain comprises residues 67-86, 68-87, 69-88, 70-89, 71-90, 72-91, or 73-92 of SEQ ID NO:1.

[37] The fusion protein, polynucleotide, or viral vector of embodiment 36, wherein the fragment of the invariant chain consists of residues 67-86, 68-87, 69-88, 70-89, 71-90, 72-91 or 73-92 of SEQ ID NO:1.

[38] The fusion protein, polynucleotide, or viral vector described in embodiment 35, wherein the fragment of the invariant chain comprises residues 72-92 of SEQ ID NO:1.

[39] The fusion protein, polynucleotide, or viral vector described in embodiment 38, wherein the fragment of the invariant chain consists of residues 72-92 of SEQ ID NO:1.

[40] The fusion protein, polynucleotide, or viral vector of embodiment 15, wherein the fragment of the invariant chain comprises at least 25 consecutive residues, which at least 25 consecutive residues share at least 80% identity with at least 25 consecutive residues from residues 67-92 of SEQ ID NO:1.

[41] The fusion protein, polynucleotide, or viral vector of embodiment 40, wherein the fragment of the invariant chain comprises at least 25 consecutive residues, which at least 25 consecutive residues share at least 90% identity with at least 25 consecutive residues from residues 67-92 of SEQ ID NO:1.

[42] The fusion protein, polynucleotide, or viral vector of embodiment 41, wherein the fragment of the invariant chain comprises at least 25 consecutive residues, wherein the at least 25 consecutive residues comprise at least 25 consecutive residues from residues 67-92 of SEQ ID NO:1.

[43] The fusion protein, polynucleotide, or viral vector of embodiment 42, wherein the fragment of the invariant chain comprises residues 67-91 or 68-92 of SEQ ID NO: 1.

[44] The fusion protein, polynucleotide, or viral vector of embodiment 43, wherein the fragment of the invariant chain consists of residues 67-91 or 68-92 of SEQ ID NO: 1.

[45] The fusion protein, polynucleotide, or viral vector of embodiment 15, wherein the fragment of the invariant chain consists of residues 1-97 of SEQ ID NO:1.

[46] The fusion protein, polynucleotide, or viral vector of embodiment 15, wherein the fragment of the invariant chain consists of 91 to 103 residues and shares at least 95% identity with residues 1-97 of SEQ ID NO:1.

[47] A fusion protein, polynucleotide, or viral vector described in embodiment 46, wherein the fragment of the invariant chain consists of 93 to 101 residues.

[48] ​​A fusion protein, polynucleotide, or viral vector described in embodiment 47, wherein the fragment of the invariant chain consists of 95 to 99 residues.

[49] A fusion protein, polynucleotide, or viral vector described in embodiment 48, wherein the fragment of the invariant chain consists of 97 residues.

[50] A fusion protein, polynucleotide, or viral vector described in any of embodiments 46 to 49, wherein the fragment of the invariant chain shares at least 97% identity with residues 1-97 of SEQ ID NO:1.

[51] The fusion protein, polynucleotide, or viral vector of embodiment 15, wherein the fragment of the invariant chain consists of residues 1-97 of SEQ ID NO:1, or consists of residues of SEQ ID NOs:5, 9, 11, 13, and 15-52 corresponding to residues 1-97 of SEQ ID NO:1.

[52] The fusion protein, polynucleotide, or viral vector of embodiment 15, wherein the fragment of the invariant chain consists of residues 17-97 of SEQ ID NO:1.

[53] The fusion protein, polynucleotide, or viral vector of embodiment 15, wherein the fragment of the invariant chain consists of 76 to 84 residues and shares at least 95% identity with residues 17-97 of SEQ ID NO:1.

[54] A fusion protein, polynucleotide, or viral vector described in embodiment 53, wherein the fragment of the invariant chain consists of 78 to 82 residues.

[55] A fusion protein, polynucleotide, or viral vector described in embodiment 54, wherein the fragment of the invariant chain consists of 80 to 82 residues.

[56] The fusion protein, polynucleotide, or viral vector described in embodiment 55, wherein the fragment of the invariant chain consists of 81 residues.

[57] A fusion protein, polynucleotide, or viral vector described in any of embodiments 53 to 56, wherein the fragment of the invariant chain shares at least 97% identity with residues 17-97 of SEQ ID NO:1.

[58] The fusion protein, polynucleotide, or viral vector described in embodiment 15, wherein the fragment of the invariant chain consists of any one of SEQ ID NOs: 53-84.

[59] The fusion protein, polynucleotide, or viral vector of embodiment 15, wherein the fragment of the invariant chain consists of residues 1-92 of SEQ ID NO:1.

[60] The fusion protein, polynucleotide, or viral vector of embodiment 15, wherein the fragment of the invariant chain consists of 88 to 96 residues and shares at least 95% identity with residues 1-92 of SEQ ID NO:1.

[61] A fusion protein, polynucleotide, or viral vector described in embodiment 60, wherein the fragment of the invariant chain consists of 90 to 95 residues.

[62] A fusion protein, polynucleotide, or viral vector described in embodiment 61, wherein the fragment of the invariant chain consists of 91 to 93 residues.

[63] A fusion protein, polynucleotide, or viral vector described in embodiment 62, wherein the fragment of the invariant chain consists of 92 residues.

[64] A fusion protein, polynucleotide, or viral vector described in any of embodiments 60 to 63, wherein the fragment of the invariant chain shares at least 97% identity with residues 1-92 of SEQ ID NO:1.

[65] The fusion protein, polynucleotide, or viral vector of embodiment 15, wherein the fragment of the invariant chain consists of residues 1-92 of SEQ ID NO:1, or consists of residues of SEQ ID NOs:5, 9, 11, 13, and 15-52, which correspond to residues 1-92 of SEQ ID NO:1.

[66] The fusion protein, polynucleotide, or viral vector of embodiment 15, wherein the fragment of the invariant chain consists of residues 17-92 of SEQ ID NO:1.

[67] The fusion protein, polynucleotide, or viral vector of embodiment 15, wherein the fragment of the invariant chain consists of 71 to 79 residues and shares at least 95% identity with residues 17-92 of SEQ ID NO:1.

[68] A fusion protein, polynucleotide, or viral vector described in embodiment 67, wherein the fragment of the invariant chain consists of 74 to 78 residues.

[69] A fusion protein, polynucleotide, or viral vector described in embodiment 68, wherein the fragment of the invariant chain consists of 75 to 77 residues.

[70] The fusion protein, polynucleotide, or viral vector described in embodiment 69, wherein the fragment of the invariant chain consists of 76 residues.

[71] A fusion protein, polynucleotide, or viral vector described in any of embodiments 67 to 70, wherein the fragment of the invariant chain shares at least 97% identity with residues 17-92 of SEQ ID NO:1.

[72] The fusion protein, polynucleotide, or viral vector described in embodiment 15, wherein the fragment of the invariant chain comprises any one of SEQ ID NOs: 53-84.

[73] The fusion protein, polynucleotide, or viral vector described in embodiment 72, wherein the fragment of the invariant chain comprises either SEQ ID NO:53 or SEQ ID NO:54.

[74] The fusion protein, polynucleotide, or viral vector described in embodiment 73, wherein the fragment of the invariant chain comprises SEQ ID NO:53.

[75] The fusion protein, polynucleotide, or viral vector described in embodiment 72, wherein the fragment of the invariant chain consists of any one of SEQ ID NOs: 53-84.

[76] The fusion protein, polynucleotide, or viral vector described in embodiment 75, wherein the fragment of the invariant chain consists of either SEQ ID NO: 53 or SEQ ID NO: 54.

[77] The fusion protein, polynucleotide, or viral vector described in embodiment 76, wherein the fragment of the invariant chain consists of SEQ ID NO:53.

[78] The fusion protein, polynucleotide, or viral vector described in embodiment 15, wherein the fragment of the invariant chain comprises a sequence selected from any one of SEQ ID NOs: 85-116.

[79] The fusion protein, polynucleotide, or viral vector described in embodiment 78, wherein the fragment of the invariant chain comprises a sequence selected from either SEQ ID NO: 85 or SEQ ID NO: 86.

[80] The fusion protein, polynucleotide, or viral vector described in embodiment 78, wherein the fragment of the invariant chain consists of an sequence selected from any one of SEQ ID NOs: 85-116.

[81] The fusion protein, polynucleotide, or viral vector described in embodiment 80, wherein the fragment of the invariant chain consists of a sequence selected from either SEQ ID NO: 85 or SEQ ID NO: 86.

[82] A fusion protein, polynucleotide, or virus vector described in any one of embodiments 1 to 81, wherein the fragment of the invariant chain consists of fewer than 30 residues.

[83] The fusion protein, polynucleotide, or viral vector described in embodiment 82, wherein the fragment of the invariant chain consists of fewer than 25 residues.

[84] The fusion protein, polynucleotide, or viral vector described in embodiment 83, wherein the fragment of the invariant chain consists of fewer than 20 residues.

[85] The fusion protein, polynucleotide, or viral vector described in embodiment 84, wherein the fragment of the invariant chain consists of fewer than 15 residues.

[86] A fusion protein, polynucleotide, or viral vector described in any one of embodiments 1 to 81, wherein the fragment of the invariant chain consists of at least 25 residues.

[87] The fusion protein, polynucleotide, or viral vector described in embodiment 86, wherein the fragment of the invariant chain consists of at least 35 residues.

[88] The fusion protein, polynucleotide, or viral vector described in embodiment 87, wherein the fragment of the invariant chain consists of at least 45 residues.

[89] The fusion protein, polynucleotide, or viral vector described in embodiment 88, wherein the fragment of the invariant chain consists of at least 55 residues.

[90] The fusion protein, polynucleotide, or viral vector of any one of embodiments 1 to 89, wherein the fragment of the invariant chain is derived from the human invariant chain.

[91] The fusion protein, polynucleotide, or viral vector of embodiment 90, wherein the fragment of the invariant chain is derived from the human invariant chain p33, p35, p41, p43, or c isoform.

[92] The fusion protein, polynucleotide, or viral vector of any one of embodiments 1 to 89, wherein the fragment of the invariant chain is derived from mouse invariant chain.

[93] The fusion protein, polynucleotide, or viral vector of embodiment 92, wherein the fragment of the invariant chain is derived from mouse invariant chain p31 or p41 isoform.

[94] A fusion protein, polynucleotide, or viral vector described in any one of embodiments 1 to 93, wherein the invariant chain fragment is directly linked to an antigen sequence.

[95] The fusion protein, polynucleotide, or viral vector of any one of embodiments 1 to 93, wherein the fragment of the invariant chain is indirectly linked to the antigen sequence.

[96] The fusion protein, polynucleotide, or viral vector of embodiment 95, wherein the fragment of the invariant chain is indirectly linked to the antigen sequence by a peptide sequence.

[97] The fusion protein, polynucleotide, or viral vector described in embodiment 96, wherein the peptide sequence does not include the consecutive sequence of residues 98-150 of SEQ ID NO:1.

[98] The fusion protein, polynucleotide, or viral vector described in embodiment 97, wherein the peptide sequence does not include the consecutive sequence of residues 98-125 of SEQ ID NO:1.

[99] The fusion protein, polynucleotide, or viral vector described in embodiment 98, wherein the peptide sequence does not include the consecutive sequence of residues 98-110 of SEQ ID NO:1.

[0100] A fusion protein, polynucleotide, or viral vector described in embodiment 99, wherein the peptide sequence does not include the consecutive sequence of residues 98-105 of SEQ ID NO:1.

[0101] A fusion protein, polynucleotide, or viral vector described in embodiment 100, wherein the peptide sequence does not include the consecutive sequence of residues 98-100 of SEQ ID NO:1.

[0102] A fusion protein, polynucleotide, or viral vector described in embodiment 96, wherein the peptide sequence does not include a consecutive sequence of 4 or more consecutive residues from residues 98-232 of SEQ ID NO:1.

[0103] A fusion protein, polynucleotide, or viral vector described in embodiment 102, wherein the peptide sequence does not include a consecutive sequence of 6 or more consecutive residues from residues 98-232 of SEQ ID NO:1.

[0104] A fusion protein, polynucleotide, or viral vector described in embodiment 103, wherein the peptide sequence does not include a consecutive sequence of 8 or more consecutive residues from residues 98-232 of SEQ ID NO:1.

[0105] A fusion protein, polynucleotide, or viral vector described in embodiment 104, wherein the peptide sequence does not include a consecutive sequence of 11 or more consecutive residues from residues 98-232 of SEQ ID NO:1.

[0106] A fusion protein, polynucleotide, or viral vector described in embodiment 96, wherein the peptide sequence does not include the consecutive sequence of residues 93-150 of SEQ ID NO:1.

[0107] A fusion protein, polynucleotide, or viral vector described in embodiment 106, wherein the peptide sequence does not include the consecutive sequence of residues 93-125 of SEQ ID NO:1.

[0108] A fusion protein, polynucleotide, or viral vector described in embodiment 107, wherein the peptide sequence does not include the consecutive sequence of residues 93-110 of SEQ ID NO:1.

[0109] A fusion protein, polynucleotide, or viral vector described in embodiment 108, wherein the peptide sequence does not include the consecutive sequence of residues 93-105 of SEQ ID NO:1.

[0110] A fusion protein, polynucleotide, or viral vector described in embodiment 109, wherein the peptide sequence does not include the consecutive sequence of residues 93-100 of SEQ ID NO:1.

[0111] A fusion protein, polynucleotide, or viral vector described in embodiment 96, wherein the peptide sequence does not include a consecutive sequence of 4 or more consecutive residues from residues 93-232 of SEQ ID NO:1.

[0112] A fusion protein, polynucleotide, or viral vector described in embodiment 111, wherein the peptide sequence does not include a consecutive sequence of 6 or more consecutive residues from residues 93-232 of SEQ ID NO:1.

[0113] A fusion protein, polynucleotide, or viral vector described in embodiment 112, wherein the peptide sequence does not include a consecutive sequence of 8 or more consecutive residues from residues 93-232 of SEQ ID NO:1.

[0114] A fusion protein, polynucleotide, or viral vector described in embodiment 113, wherein the peptide sequence does not include a consecutive sequence of 11 or more consecutive residues from residues 93-232 of SEQ ID NO:1.

[0115] A fusion protein, polynucleotide, or viral vector described in any of embodiments 96 to 114, wherein the peptide sequence consists of 50 residues or less.

[0116] A fusion protein, polynucleotide, or viral vector described in embodiment 115, wherein the peptide sequence consists of 30 residues or less.

[0117] A fusion protein, polynucleotide, or viral vector described in embodiment 116, wherein the peptide sequence consists of 10 residues or less.

[0118] A fusion protein, polynucleotide, or viral vector described in embodiment 117, wherein the peptide sequence consists of 5 residues or less.

[0119] A fusion protein, polynucleotide, or viral vector described in any of embodiments 96 to 118, wherein the peptide sequence consists of glycine and serine residues.

[0120] A fusion protein, polynucleotide, or viral vector described in any of embodiments 1 to 119, wherein the invariant chain fragment is linked to the antigen sequence by the N-terminus of the invariant chain fragment.

[0121] A fusion protein, polynucleotide, or viral vector described in any of embodiments 1 to 119, wherein the invariant chain fragment is linked to the antigen sequence by the C-terminus of the invariant chain fragment.

[0122] The fusion protein, polynucleotide or viral vector of any of embodiments 1 to 119, wherein the invariant chain fragment is at the N-terminus of the fusion protein.

[0123] The fusion protein, polynucleotide or viral vector of any of embodiments 1 to 119, wherein the invariant chain fragment is at the C-terminus of the fusion protein.

[0124] The fusion protein, polynucleotide or viral vector of any of embodiments 1 to 123, wherein the fusion protein contains multiple antigen sequences.

[0125] A fusion protein, polynucleotide, or viral vector described in any of embodiments 1 to 124, wherein the fragment of the invariant chain does not contain more than residues 1-97 of SEQ ID NO:1 and no more than one consecutive residue of SEQ ID NO:1.

[0126] A fusion protein, polynucleotide, or viral vector described in any of embodiments 1 to 124, wherein the fragment of the invariant chain does not contain any consecutive residues of SEQ ID NO:1 greater than residues 17-97 of SEQ ID NO:1.

[0127] A fusion protein, polynucleotide, or viral vector described in any of embodiments 1 to 124, wherein the fragment of the invariant chain does not contain more than residues 1-92 of SEQ ID NO:1 and no more than one consecutive residue of SEQ ID NO:1.

[0128] A fusion protein, polynucleotide, or viral vector described in any of embodiments 1 to 124, wherein the fragment of the invariant chain does not contain any consecutive residues of SEQ ID NO:1 greater than residues 17-92 of SEQ ID NO:1.

[0129] A fusion protein, polynucleotide, or viral vector described in any of embodiments 1 to 124, wherein the fragment of the invariant chain does not contain any consecutive residues of SEQ ID NO:1 greater than residues 67-92 of SEQ ID NO:1.

[0130] A fusion protein, polynucleotide, or viral vector described in any of embodiments 1 to 129, wherein the fusion protein does not contain a full-length invariant chain.

[0131] A fusion protein, polynucleotide, or viral vector described in any one of embodiments 1 to 130, wherein the antigen sequence is derived from a pathogen.

[0132] A fusion protein, polynucleotide, or viral vector described in embodiment 131, wherein the antigen sequence is selected from one or more antigens consisting of a MAGE antigen, an OVA antigen, and an HCV-NS antigen.

[0133] A fusion protein, polynucleotide, or viral vector described in embodiment 132, wherein the antigen sequence comprises or consists of one sequence selected from the list consisting of SEQ ID NO: 4, SEQ ID NO: 8, and SEQ ID NO: 117.

[0134] A fusion protein, polynucleotide, or viral vector described in embodiment 131, wherein the pathogen is selected from the group consisting of viruses, bacteria, protozoa and multicellular parasites.

[0135] A fusion protein, polynucleotide, or viral vector described in any one of embodiments 1 to 130, wherein the antigen sequence is derived from a cancer cell.

[0136] A viral vector described in any of embodiments 1 to 135, wherein the viral vector is an adenovirus.

[0137] A viral vector described in embodiment 136, wherein the adenovirus is a human adenovirus.

[0138] A viral vector described in embodiment 137, wherein the adenovirus is an adenovirus selected from the group consisting of Ad1, Ad2, Ad4, Ad5, Ad6, Ad11, Ad19, Ad24, Ad34 and Ad35.

[0139] A viral vector described in embodiment 136, wherein the adenovirus is a non-human primate adenovirus.

[0140] The viral vector described in embodiment 139, wherein the adenovirus is an adenovirus selected from the group consisting of ChAd3, ChAd63, ChAd83, ChAd155, PanAd1, PanAd2, PanAd3, Pan 5, Pan 6, Pan 7 and Pan 9.

[0141] A viral vector described in embodiment 136, wherein the adenovirus comprises hexon, penton and fiber proteins, which hexon, penton and fiber proteins share at least 95% identity with SEQ ID NO: 123, SEQ ID NO: 124 or SEQ ID NO: 125.

[0142] The viral vector of embodiment 136, wherein the adenovirus comprises hexon and fiber proteins, both of which share at least 95% identity with SEQ ID NO: 126 and SEQ ID NO: 127, respectively.

[0143] The viral vector of embodiment 136, wherein the adenovirus comprises hexon and fiber proteins, both of which share at least 95% identity with SEQ ID NO: 128 and SEQ ID NO: 129, respectively.

[0144] The viral vector of embodiment 136, wherein the adenovirus comprises hexon and fiber proteins, both of which share at least 95% identity with SEQ ID NO: 130 and SEQ ID NO: 131, respectively.

[0145] A viral vector described in embodiment 136, wherein the adenovirus comprises hexon, penton and fiber proteins, the hexon, penton and fiber proteins sharing at least 95% identity with sequence numbers 132, 133 and 134, respectively.

[0146] A viral vector described in any one of embodiments 1 to 135, wherein the viral vector is a poxvirus.

[0147] The viral vector described in embodiment 146, wherein the poxvirus is selected from one or more of orthopox, parapox, yatapox, avipox and morsipox viral vectors.

[0148] The viral vector of embodiment 146, wherein the poxvirus is MVA.

[0149] A pharmaceutical composition comprising the fusion protein, polynucleotide or viral vector of any of embodiments 1 to 148, and a pharma- ceutically acceptable excipient.

[0150] A pharmaceutical composition described in embodiment 149, further comprising an adjuvant.

[0151] A fusion protein, polynucleotide, viral vector or pharmaceutical composition described in any one of embodiments 1 to 150 for use as a pharmaceutical.

[0152] A fusion protein, polynucleotide, viral vector or pharmaceutical composition described in embodiment 151 for use in the treatment or prevention of Hepatitis B virus infection or Hepatitis C virus infection.

[0153] Use of the fusion protein, polynucleotide, viral vector or pharmaceutical composition described in any one of embodiments 1 to 150 in the manufacture of a medicament for the prevention or treatment of Hepatitis B viral infection or Hepatitis C viral infection.

[0154] A method for treating or preventing hepatitis B virus infection or hepatitis C virus infection, comprising administering to a person in need thereof an effective amount of a fusion protein, polynucleotide, viral vector or pharmaceutical composition described in any of embodiments 1 to 150.

Claims

1. A pharmaceutical comprising a fusion protein comprising an antigen protein and an invariant chain fragment operably linked to the antigen protein, the invariant chain fragment comprising 16 contiguous residues 77-92 of SEQ ID NO:1 and consisting of fewer than 20 residues, and wherein additional residues at either end of the invariant chain fragment do not result in the invariant chain fragment being a larger invariant chain fragment as defined.

2. A pharmaceutical comprising a polynucleotide encoding a fusion protein comprising an antigen protein and an invariant chain fragment operably linked to the antigen protein, the invariant chain fragment comprising 16 contiguous residues 77-92 of SEQ ID NO:1 and consisting of fewer than 20 residues, and wherein additional residues at either end of the invariant chain fragment do not result in the invariant chain fragment being a larger invariant chain fragment as defined.

3. A pharmaceutical comprising a viral vector containing a polynucleotide encoding a fusion protein comprising an antigen protein and an invariant chain fragment operably linked to the antigen protein, the invariant chain fragment comprising 16 contiguous residues 77-92 of SEQ ID NO:1 and consisting of fewer than 20 residues, and additional residues at either end of the invariant chain fragment do not result in the invariant chain fragment being a larger invariant chain fragment as defined.

4. The pharmaceutical agent according to any one of claims 1 to 3 for use in the treatment or prevention of hepatitis B virus infection or hepatitis C virus infection.

Images