Compositions and methods comprising TTR guide RNA and polynucleotides encoding RNA-guided DNA binders

Abstract

Compositions and methods are provided for editing, e.g., introducing a double-strand break, within the TTR gene. Compositions and methods are provided for treating a subject with transthyretin-associated amyloidosis (ATTR).

Description

[Technical Field]

[0001] This patent application claims priority to U.S. Provisional Application No. 62 / 825,637, filed March 28, 2019, the contents of which are incorporated herein by reference in their entirety for all purposes.

[0002] This application contains a Sequence Listing that has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy, created on March 24, 2020, is titled 2020-03-24_01155-0028-00PCT_ST25.txt and is 451KB in size. [Background technology]

[0003] Transthyretin (TTR) is a protein produced by the TTR gene that normally functions to transport retinol and thyroxine throughout the body. TTR is primarily synthesized in the liver, with small amounts produced in the choroid plexus and retina. TTR normally circulates as a soluble tetrameric protein in the blood.

[0004] Pathogenic variants that can disrupt the stability of the tetramer can be encoded by mutant alleles of the TTR gene. Mutant TTR can result in misfolded TTR, which can generate amyloid (i.e., aggregates of misfolded TTR protein). In some cases, pathogenic variants of TTR can cause amyloidosis, i.e., a disease resulting from the accumulation of amyloid. For example, misfolded TTR monomers can polymerize into amyloid fibrils in tissues such as peripheral nerves, the heart, and the digestive tract. Amyloid plaques can also contain wild-type TTR deposited on misfolded TTR.

[0005] Additionally, misfolding and deposition of wild-type TTR has been observed in men over 60 years of age, which has been linked to heart rhythm problems, heart failure, and carpal tunnel.

[0006] Amyloidosis characterized by the deposition of TTR may be referred to as "ATTR," "TTR-related amyloidosis," "TTR amyloidosis," or "ATTR amyloidosis," "ATTR familial amyloidosis" (when associated with a genetic mutation within a family), or "ATTRwt" or "wild-type ATTR" (when resulting from the misfolding and deposition of wild-type TTR).

[0007] ATTR can present with a wide range of symptoms, and patients with different types of ATTR may have different characteristics and prognosis. Some types of ATTR include familial amyloid polyneuropathy (FAP), familial amyloid cardiomyopathy (FAC), and wild-type TTR amyloidosis (wt-TTR amyloidosis). FAP generally presents with sensory motor neuropathy, while FAC and wt-TTR amyloidosis generally present with congestive heart failure. FAP and FAC are usually associated with genetic mutations in the TTR gene, and more than 100 different mutations in the TTR gene have been associated with ATTR. In contrast, wt-TTR amyloidosis is associated with aging and is not associated with genetic mutations in TTR. It is estimated that approximately 50,000 patients worldwide may suffer from FAP and FAC.

[0008] Although over 100 mutations in TTR are associated with ATTR, certain mutations are more closely associated with neuropathy and / or cardiomyopathy. For example, mutations at T60 of TTR are associated with both cardiomyopathy and neuropathy, mutations at V30 are more associated with neuropathy, and mutations at V122 are more associated with cardiomyopathy.

[0009] Various therapeutic approaches for the treatment of ATTR have been investigated, but no approved medications have been shown to halt disease progression or improve quality of life. Liver transplantation has been studied for the treatment of ATTR, but its use is declining because it carries significant risks and disease progression can continue after transplant. Small molecule stabilizers such as diflunisal and tafamidis appear to slow the progression of ATTR, but these agents do not halt disease progression.

[0010] Approaches using small interfering RNA (siRNA) knockdown, antisense knockdown, or monoclonal antibodies to target amyloid fibrils for destruction are also currently being investigated, but results on short-term inhibition of TTR expression show encouraging preliminary data, and a need exists for therapies that can produce long-lasting inhibition of TTR. Summary of the Invention [Problem to be solved by the invention]

[0011] Therefore, the following embodiments are provided. In some embodiments, the present invention provides compositions and methods for using guide RNA together with an RNA-guided DNA binding agent, such as a CRISPR / Cas system, to substantially reduce or knock out the expression of the TTR gene, thereby substantially reducing or eliminating the production of TTR protein associated with ATTR. Substantially reducing or eliminating the production of TTR protein associated with ATTR by modifying the TTR gene can be a long-term reduction or elimination. [Means for solving the problem]

[0012] The following embodiments are provided herein:

[0013] Embodiment 1 is a composition comprising: (i) a nucleic acid comprising an open reading frame encoding an RNA-guided DNA binder, a. the open reading frame comprises a sequence having at least 93% identity to SEQ ID NO: 311, and / or b. the open reading frame has at least 93% identity to SEQ ID NO: 311 over at least its first 50, 200, 250, or 300 nucleotides, or has at least 95% identity to SEQ ID NO: 311 over at least its first 30, 50, 70, 100, 150, 200, 250, or 300 nucleotides; and / or c. the open reading frame consists of a set of codons in which at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% of the codons are listed in Table 4, the low A set of Table 5, or the low A / U set of Table 5; and / or d. the open reading frame has an adenine content ranging from its minimum adenine content to 123% of its minimum adenine content; and / or e. an open reading frame having an adenine dinucleotide content ranging from its minimum adenine dinucleotide content to 150% of its minimum adenine dinucleotide content; (ii) a guide RNA or a vector encoding a guide RNA, wherein the guide RNA comprises a guide sequence selected from SEQ ID NOs: 5 to 72, 74 to 78, and 80 to 82; and a guide RNA or a vector encoding a guide RNA.

[0014] Embodiment 2 is a method of modifying the TTR gene and / or inducing a double-strand break (DSB) in the TTR gene, comprising delivering a composition to a cell, wherein the composition comprises: (i) a nucleic acid comprising an open reading frame encoding an RNA-guided DNA binder, a. the open reading frame comprises a sequence having at least 93% identity to SEQ ID NO: 311, and / or b. the open reading frame has at least 93% identity to SEQ ID NO: 311 over at least its first 50, 200, 250, or 300 nucleotides, or has at least 95% identity to SEQ ID NO: 311 over at least its first 30, 50, 70, 100, 150, 200, 250, or 300 nucleotides; and / or c. the open reading frame consists of a set of codons in which at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% of the codons are listed in Table 4, the low A set of Table 5, or the low A / U set of Table 5; and / or d. the open reading frame has an adenine content ranging from its minimum adenine content to 123% of its minimum adenine content; and / or e. an open reading frame having an adenine dinucleotide content ranging from its minimum adenine dinucleotide content to 150% of its minimum adenine dinucleotide content; (ii) a guide RNA or a vector encoding a guide RNA, wherein the guide RNA comprises a guide sequence selected from SEQ ID NOs: 5 to 72, 74 to 78, and 80 to 82; and

[0015] Embodiment 3 is a method of reducing TTR serum concentrations, treating TTR-associated amyloidosis (ATTR), and / or reducing or preventing accumulation of amyloid or amyloid fibrils comprising TTR in a subject, comprising administering to a subject in need thereof a composition, wherein the composition: (i) a nucleic acid comprising an open reading frame encoding an RNA-guided DNA binder, a. the open reading frame comprises a sequence having at least 95% identity to SEQ ID NO: 311; and / or b. the open reading frame has at least 95% identity to SEQ ID NO: 311 over at least its first 30, 50, 70, 100, 150, 200, 250, or 300 nucleotides; and / or c. the open reading frame consists of a set of codons in which at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% of the codons are listed in Table 4, the low A set of Table 5, or the low A / U set of Table 5; and / or d. the open reading frame has an adenine content ranging from its minimum adenine content to 150% of its minimum adenine content; and / or e. an open reading frame having an adenine dinucleotide content ranging from its minimum adenine dinucleotide content to 150% of its minimum adenine dinucleotide content; (ii) a guide RNA or a vector encoding the guide RNA, wherein the guide RNA comprises a guide sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82, thereby reducing TTR serum concentrations, treating TTR-associated amyloidosis (ATTR), and / or reducing or preventing accumulation of amyloid or amyloid fibrils comprising TTR in a subject.

[0016] Embodiment 4 is the composition or method of any one of the preceding embodiments, wherein the guide RNA comprises a guide sequence selected from SEQ ID NOs: 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 22, 23, 27, 29, 30, 35, 36, 37, 38, 55, 61, 63, 65, 66, 68, or 69.

[0017] Embodiment 5 is the composition of embodiment 1 or 4 for use in inducing a double-strand break (DSB) in the TTR gene in a cell or a subject.

[0018] Embodiment 6 is the composition of Embodiment 1, 4, or 5 for use in modifying the TTR gene in a cell or a subject.

[0019] Embodiment 7 is the composition of Embodiment 1, 4, 5, or 6 for use in treating TTR-associated amyloidosis (ATTR) in a subject.

[0020] Embodiment 8 is the composition of Embodiment 1, 4, 5, 6, or 7 for use in reducing TTR serum concentrations in a subject.

[0021] Embodiment 9 is the composition of embodiment 1, 4, 5, 6, 7, or 8 for use in reducing or preventing amyloid or amyloid fibril accumulation in a subject.

[0022] Embodiment 10 is the composition or method for use of any one of Embodiments 2 to 9, wherein the method comprises administering the composition by infusion for more than 30 minutes.

[0023] Embodiment 11 is the composition for the method or use of Embodiment 10, wherein the composition is administered by infusion over about 45 to 75 minutes, 75 to 105 minutes, 105 to 135 minutes, 135 to 165 minutes, 165 to 195 minutes, 195 to 225 minutes, 225 to 255 minutes, 255 to 285 minutes, 285 to 315 minutes, 315 to 345 minutes, or 345 to 375 minutes.

[0024] Embodiment 12 is the composition for the method or use of embodiment 10 or 11, wherein the composition is administered by infusion over about 1.5 to 6 hours.

[0025] Embodiment 13 is a composition for the method or use of embodiment 10, wherein the composition is administered by infusion over about 60 minutes, about 90 minutes, about 120 minutes, about 150 minutes, about 180 minutes, or about 240 minutes.

[0026] Embodiment 14 is the composition for the method or use of embodiment 10, wherein the composition is administered by infusion over about 120 minutes.

[0027] Embodiment 15 is a composition for the method or use of any one of Embodiments 2 to 14, wherein the composition reduces serum TTR levels.

[0028] Embodiment 16 is a composition for the method or use of embodiment 15, wherein the serum TTR level is reduced by at least 50% compared to the serum TTR level before administration of the composition.

[0029] Embodiment 17 is a composition for the method or use of embodiment 151, which reduces serum TTR levels by 50-60%, 60-70%, 70-80%, 80-90%, 90-95%, 95-98%, 98-99%, or 99-100% compared to serum TTR levels before administration of the composition.

[0030] Embodiment 18 is a composition for the method or use of any one of Embodiments 2 to 17, wherein the composition causes editing of the TTR gene.

[0031] Embodiment 19 is the composition for the method or use of embodiment 18, wherein the editing is calculated as a percentage of the population that is edited (percent editing).

[0032] Embodiment 20 is a composition for the method or use of embodiment 19, wherein the editing percentage is 30-99% of the population.

[0033] Embodiment 21 is a composition for the method or use of embodiment 19, wherein the percent edited is 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95-99% of the population.

[0034] Embodiment 22 is the composition for the method or use of any one of embodiments 2 to 21, wherein the composition reduces amyloid deposition in at least one tissue.

[0035] Embodiment 23 is a composition for the method or use of embodiment 22, wherein the at least one tissue comprises one or more of the stomach, colon, sciatic nerve, or dorsal root ganglion.

[0036] Embodiment 24 is a composition for the method or use of embodiment 22 or 23, wherein amyloid deposits are measured 8 weeks after administration of the composition.

[0037] Embodiment 25 is a composition for the method or use of any one of embodiments 22 to 24, wherein amyloid deposits are compared to a negative control, or to levels measured before administration of the composition.

[0038] Embodiment 26 is the method or composition for use of any one of embodiments 22 to 25, wherein amyloid deposits are measured in biopsy samples and / or by immunostaining.

[0039] Embodiment 27 is a composition for the method or use of any one of embodiments 22 to 26, wherein amyloid deposits are reduced by 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95-99% of the amyloid deposits seen in a negative control.

[0040] Embodiment 28 is a composition for the method or use of any one of embodiments 22 to 27, wherein amyloid deposits are reduced by 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95-99% of the amyloid deposits seen before administration of the composition.

[0041] Embodiment 29 is a composition for the method or use of any one of embodiments 2 to 28, wherein the composition is administered or delivered at least twice.

[0042] Embodiment 30 is a composition for the method or use of embodiment 29, wherein the composition is administered or delivered at least three times.

[0043] Embodiment 31 is a composition for the method or use of embodiment 29, wherein the composition is administered or delivered at least four times.

[0044] Embodiment 32 is a composition for the method or use of embodiment 29, wherein the composition is administered or delivered 5, 6, 7, 8, 9, or up to 10 times.

[0045] Embodiment 33 is a composition for the method or use of any one of Embodiments 29-32, wherein the administration or delivery occurs at intervals of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 days.

[0046] Embodiment 34 is a composition for the method or use of any one of Embodiments 29-32, wherein the administration or delivery occurs at intervals of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 weeks.

[0047] Embodiment 35 is a composition for the method or use of any one of Embodiments 29-32, wherein the administration or delivery occurs at intervals of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 months.

[0048] Embodiment 36 is the method or composition of any one of the preceding embodiments, wherein the guide RNA comprises a guide sequence and further comprises a crRNA comprising the nucleotide sequence of SEQ ID NO: 126, wherein the nucleotides of SEQ ID NO: 126 follow the guide sequence at its 3' end.

[0049] Embodiment 37 is the method or composition of any one of the preceding embodiments, wherein the guide RNA is a dual guide (dgRNA).

[0050] Embodiment 38 is the method or composition of embodiment 37, wherein the dual guide RNA comprises the nucleotide sequence of SEQ ID NO: 126, and comprises a crRNA and a trRNA, wherein the guide sequence is followed at its 3' end by nucleotides of SEQ ID NO: 126.

[0051] Embodiment 39 is the method or composition of any one of embodiments 1 to 36, wherein the guide RNA is a single guide (sgRNA).

[0052] Embodiment 40 is the method or composition of embodiment 39, wherein the sgRNA comprises a guide sequence having the pattern of SEQ ID NO:3.

[0053] Embodiment 41 is the method or composition of embodiment 39, wherein the sgRNA comprises the sequence of SEQ ID NO:3.

[0054] Embodiment 42 is the method or composition of any one of embodiments 39 to 41, wherein the sgRNA comprises any one of the guide sequences of SEQ ID NOs: 5-72, 74-78, and 80-82, and the nucleotides of SEQ ID NO: 126.

[0055] Embodiment 43 is the method or composition of any one of embodiments 39-42, wherein the sgRNA comprises a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 87-113, 115-120, and 122-124.

[0056] Embodiment 44 is the method or composition of embodiment 39, wherein the sgRNA comprises a sequence selected from SEQ ID NOs: 87-113, 115-120, and 122-124.

[0057] Embodiment 45 is the method or composition of any one of the preceding embodiments, wherein the guide RNA comprises at least one modification.

[0058] Embodiment 46 is the method or composition of embodiment 45, wherein at least one modification comprises a 2'-O-methyl (2'-O-Me) modified nucleotide.

[0059] Embodiment 47 is the method or composition of embodiment 45 or 46, wherein at least one modification comprises an internucleotide phosphorothioate (PS) linkage.

[0060] Embodiment 48 is the method or composition of any one of embodiments 45 to 47, wherein at least one modification comprises a 2'-fluoro (2'-F) modified nucleotide.

[0061] Embodiment 49 is the method or composition of any one of embodiments 45 to 48, wherein the at least one modification comprises a modification in one or more of the first five nucleotides at the 5' end.

[0062] Embodiment 50 is the method or composition of any one of embodiments 45 to 49, wherein the at least one modification comprises a modification in one or more of the last five nucleotides at the 3' end.

[0063] Embodiment 51 is the method or composition of any one of embodiments 45 to 50, wherein at least one modification comprises a PS bond between the first four nucleotides.

[0064] Embodiment 52 is the method or composition of any one of embodiments 45 to 51, wherein at least one modification comprises a PS bond between the last four nucleotides.

[0065] Embodiment 53 is the method or composition of any one of embodiments 45 to 52, wherein at least one modification comprises 2'-O-Me modified nucleotides in the first three nucleotides at the 5' end.

[0066] Embodiment 54 is the method or composition of any one of embodiments 45 to 53, wherein at least one modification comprises 2'-O-Me modified nucleotides in the last three nucleotides at the 3' end.

[0067] Embodiment 55 is the method or composition of any one of embodiments 45 to 54, wherein the guide RNA comprises modified nucleotides of SEQ ID NO:3.

[0068] Embodiment 56 is the method or composition of any one of embodiments 1 to 55, wherein the composition further comprises a pharmaceutically acceptable excipient.

[0069] Embodiment 57 is the method or composition of any one of embodiments 1 to 56, wherein the nucleic acid comprising the open reading frame encoding the guide RNA and the RNA-guided DNA binder is associated with a lipid nanoparticle (LNP).

[0070] Embodiment 58 is the method or composition of embodiment 57, wherein the LNP comprises a CCD lipid.

[0071] Embodiment 59 is the method or composition of embodiment 58, wherein the CCD lipid is lipid A or lipid B, and optionally, the CCD lipid is lipid A.

[0072] Embodiment 60 is the method or composition of any one of embodiments 57-59, wherein the LNP comprises a helper lipid.

[0073] Embodiment 61 is the method or composition of embodiment 60, wherein the helper lipid is cholesterol.

[0074] Embodiment 62 is the method or composition of any one of embodiments 57-61, wherein the LNP comprises a stealth lipid (e.g., a PEG lipid).

[0075] Embodiment 63 is the method or composition of embodiment 62, wherein the stealth lipid is PEG2k-DMG.

[0076] Embodiment 64 is (i) the LNP comprises a lipid component, the lipid component comprising about 50-60 mol % of an amine lipid, such as lipid A, about 8-10 mol % of a neutral lipid, and about 2.5-4 mol % of a stealth lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid; and the N / P ratio of the LNP composition is about 6; (ii) the LNP comprises about 50-60 mol% amine lipid, such as lipid A, about 27-39.5 mol% helper lipid, about 8-10 mol% neutral lipid, and about 2.5-4 mol% stealth lipid (e.g., PEG lipid), and the N / P ratio of the LNP composition is about 5-7 (e.g., about 6); (iii) the LNP comprises a lipid component, the lipid component comprising about 50-60 mol % of an amine lipid, such as lipid A, about 5-15 mol % of a neutral lipid, and about 2.5-4 mol % of a stealth lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid, and the N / P ratio of the LNP composition is about 3-10; (iv) the LNP comprises a lipid component, the lipid component comprising about 40-60 mol % of an amine lipid, such as lipid A, about 5-15 mol % of a neutral lipid, and about 2.5-4 mol % of a stealth lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid; and the N / P ratio of the LNP composition is about 6; (v) the LNP comprises a lipid component, the lipid component comprising about 50-60 mol % of an amine lipid, such as lipid A, about 5-15 mol % of a neutral lipid, and about 1.5-10 mol % of a stealth lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid; and the N / P ratio of the LNP composition is about 6; (vi) the LNP comprises a lipid component, the lipid component comprising about 40-60 mol % of an amine lipid, such as lipid A, about 0-10 mol % of a neutral lipid, and about 1.5-10 mol % of a stealth lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid; and the N / P ratio of the LNP composition is about 3-10; (vii) the LNP comprises a lipid component, the lipid component comprising about 40-60 mol % of an amine lipid, such as lipid A, less than about 1 mol % of a neutral lipid, and about 1.5-10 mol % of a stealth lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid, and the N / P ratio of the LNP composition is about 3-10; (viii) the LNP comprises a lipid component, the lipid component comprising about 40-60 mol % of an amine lipid, such as lipid A, and about 1.5-10 mol % of a stealth lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid, the N / P ratio of the LNP composition being about 3-10, and the LNP composition is essentially free of, or free of, neutral phospholipids; or (ix) The method or composition of any one of embodiments 57-63, wherein the LNP comprises a lipid component comprising about 50-60 mol % amine lipid, such as lipid A, about 8-10 mol % neutral lipid, and about 2.5-4 mol % stealth lipid (e.g., PEG lipid), with the remainder of the lipid component being helper lipid, and the N / P ratio of the LNP composition being about 3-7.

[0077] Embodiment 64a is the method or composition of embodiment 64, wherein the mol % of the PEG lipid is about 3.

[0078] Embodiment 64b is the method or composition of embodiment 64 or 64a, wherein the mol % of the amine lipid is about 50.

[0079] Embodiment 64c is the method or composition of any one of Embodiments 64-64b, wherein the mol % of the amine lipid is about 55.

[0080] Embodiment 64d is the method or composition of any one of Embodiments 64-64c, wherein the mol % of the amine lipid is ±3 mol %.

[0081] Embodiment 64e is the method or composition of any one of Embodiments 64-64d, wherein the mol % of the amine lipid is ±2 mol %.

[0082] Embodiment 64f is the method or composition of any one of Embodiments 64-64e, wherein the mol % of the amine lipid is 47-53 mol %.

[0083] Embodiment 64g is the method or composition of any one of Embodiments 64-64f, wherein the mol % of the amine lipid is 48-53 mol %.

[0084] Embodiment 64h is the method or composition of any one of Embodiments 64-64g, wherein the mol % of the amine lipid is 53-57 mol %.

[0085] Embodiment 64i is the method or composition of any one of Embodiments 64-64h, wherein the N / P ratio is 6±1.

[0086] Embodiment 64j is the method or composition of any one of Embodiments 64-64i, wherein the N / P ratio is 6±0.5.

[0087] Embodiment 64k is the method or composition of any one of Embodiments 64-64j, wherein the amine lipid is lipid A.

[0088] Embodiment 641 is the method or composition of any one of Embodiments 64-641, wherein the amine lipid is a lipid A analog.

[0089] Embodiment 64m is the method or composition of embodiment 64l, wherein the analog is an acetal analog.

[0090] Embodiment 64n is the method or composition of embodiment 64m, wherein the acetal analog is a C4-C12 acetal analog.

[0091] Embodiment 64o is the method or composition of Embodiment 64m, wherein the acetal analog is a C5-C12 acetal analog.

[0092] Embodiment 64p is the method or composition of Embodiment 64m, wherein the acetal analog is a C5-C10 acetal analog.

[0093] Embodiment 64q is the method or composition of embodiment 64m, wherein the acetal analog is selected from C4, C5, C6, C7, C9, C10, C11, and C12 analogs.

[0094] Embodiment 64r is the method or composition of any one of embodiments 64-64q, wherein the helper lipid is cholesterol.

[0095] Embodiment 64s is the method or composition of any one of embodiments 64-64r, wherein the neutral lipid is DSPC.

[0096] Embodiment 64t is the method or composition of any one of embodiments 64-64s, wherein the neutral lipid is DPPC.

[0097] Embodiment 64u is the method or composition of any one of Embodiments 64-64t, wherein the PEG lipid comprises dimyristoylglycerol (DMG).

[0098] Embodiment 64v is the method or composition of any one of Embodiments 64-64u, wherein the PEG lipid comprises PEG-2k.

[0099] Embodiment 64w is the method or composition of any one of embodiments 64-64v, wherein the PEG lipid is PEG-DMG.

[0100] Embodiment 64x is the method or composition of embodiment 64w, wherein the PEG-DMG is PEG2k-DMG.

[0101] Embodiment 64y is the method or composition of any one of embodiments 64-64x, wherein the LNP composition is essentially free of neutral lipids.

[0102] Embodiment 64z is the method or composition of embodiment 64y, wherein the neutral lipid is a phospholipid.

[0103] Embodiment 65 is the method or composition of any one of embodiments 57-64z, wherein the LNP comprises a neutral lipid, and optionally the neutral lipid is DSPC.

[0104] Embodiment 66 is the method or composition of embodiment 64 or 65, wherein the amine lipid is present at about 50 mol %.

[0105] Embodiment 67 is the method or composition of any one of embodiments 64-66, wherein the neutral lipid is present at about 9 mol %.

[0106] Embodiment 68 is the method or composition of any one of embodiments 62-67, wherein the stealth lipid is present at about 3 mol %.

[0107] Embodiment 69 is the method or composition of any one of embodiments 60-68, wherein the helper lipid is present at about 38 mol %.

[0108] Embodiment 70 is the method or composition of any one of the preceding embodiments, wherein the LNPs have an N / P ratio of about 6.

[0109] Embodiment 71 is the method or composition of embodiment 70, wherein the LNP comprises a lipid component comprising about 50 mol% of an amine lipid, such as lipid A, about 9 mol% of a neutral lipid, such as DSPC, and about 3 mol% of a stealth lipid, such as a PEG lipid (e.g., PEG2k-DMG), with the remainder of the lipid component being a helper lipid, such as cholesterol, and the N / P ratio of the LNP composition is about 6.

[0110] Embodiment 72 is the method or composition of any one of embodiments 64 to 71, wherein the amine lipid is lipid A.

[0111] Embodiment 73 is the method or composition of any one of embodiments 64 to 72, wherein the neutral lipid is DSPC.

[0112] Embodiment 74 is the method or composition of any one of embodiments 62-73, wherein the stealth lipid is PEG2k-DMG.

[0113] Embodiment 75 is the method or composition of any one of embodiments 60-74, wherein the helper lipid is cholesterol.

[0114] Embodiment 76 is the method or composition of any one of embodiments 70, wherein the LNP comprises a lipid component comprising about 50 mol% lipid A, about 9 mol% DSPC, and about 3 mol% PEG2k-DMG, with the remainder of the lipid component being cholesterol, and the N / P ratio of the LNP composition is about 6.

[0115] Embodiment 77 is the method or composition of any one of the preceding embodiments, wherein the RNA-guided DNA-binding agent is a Cas cleavase.

[0116] Embodiment 78 is the method or composition of embodiment 77, wherein the RNA-guided DNA binding agent is Cas9.

[0117] Embodiment 79 is the method or composition of any one of the preceding embodiments, wherein the RNA-guided DNA-binding agent is modified.

[0118] Embodiment 80 is the method or composition of embodiment 79, wherein the modified RNA-guided DNA binding agent comprises a nuclear localization signal (NLS).

[0119] Embodiment 81 is the method or composition of any one of the preceding embodiments, wherein the RNA-guided DNA binding agent is a Cas from a type II CRISPR / Cas system.

[0120] Embodiment 82 is the method or composition of any one of the preceding embodiments, wherein the composition is a pharmaceutical formulation and further comprises a pharmaceutically acceptable carrier.

[0121] Embodiment 83 is a composition for the method or use of any one of embodiments 2 to 82, wherein the composition reduces or prevents amyloid or amyloid fibrils comprising TTR.

[0122] Embodiment 84 is a composition for the method or use of embodiment 83, wherein the amyloid or amyloid fibrils are in the nerves, heart, or gastrointestinal tract.

[0123] Embodiment 85 is the method or composition for use of any one of embodiments 2 to 84, wherein non-homologous end joining (NHEJ) causes mutations during repair of the DSB in the TTR gene.

[0124] Embodiment 86 is a composition for the method or use of embodiment 85, wherein the NHEJ causes a deletion or insertion of a nucleotide during repair of the DSB in the TTR gene.

[0125] Embodiment 87 is the composition for the method or use of embodiment 86, wherein the deletion or insertion of the nucleotide mutation induces a frameshift or nonsense in the TTR gene.

[0126] Embodiment 88 is the composition for the method or use of embodiment 86, wherein a frameshift or nonsense mutation is induced in the TTR gene in at least 50% of the liver cells.

[0127] Embodiment 89 is a composition for the method or use of embodiment 88, wherein a frameshift or nonsense mutation is induced in the TTR gene in 50% to 60%, 60% to 70%, 70% or 80%, 80% to 90%, 90 to 95%, 95% to 99%, or 99% to 100% of liver cells.

[0128] Embodiment 90 is the method or composition for use of any one of embodiments 86 to 89, wherein nucleotide deletions or insertions occur at least 50 times more frequently in the TTR gene than in off-target sites.

[0129] Embodiment 91 is a composition for the method or use of embodiment 90, wherein nucleotide deletions or insertions occur 50-fold to 150-fold, 150-fold to 500-fold, 500-fold to 1500-fold, 1500-fold to 5000-fold, 5000-fold to 15000-fold, 15000-fold to 30000-fold, or 30000-fold to 60000-fold more frequently in the TTR gene than at off-target sites.

[0130] Embodiment 92 is the method or composition for use of any one of embodiments 86 to 91, wherein the nucleotide deletions or insertions occur at no more than 3, no more than 2, no more than 1, or no off-target sites in the primary human hepatocyte, and optionally, the off-target sites do not occur in protein-coding regions within the genome of the primary human hepatocyte.

[0131] Embodiment 93 is a composition for the method or use of embodiment 92, wherein the nucleotide deletions or insertions occur at a number of off-target sites in the primary human hepatocytes that is fewer than the number of off-target sites at which nucleotide deletions or insertions occur in cells overexpressing Cas9, and optionally, the off-target sites do not occur within protein-coding regions in the genome of the primary human hepatocytes.

[0132] Embodiment 94 is the composition for the method or use of embodiment 93, wherein the cells overexpressing Cas9 are HEK293 cells stably expressing Cas9.

[0133] Embodiment 95 is a composition for the method or use of any one of embodiments 92 to 94, wherein the number of off-target sites in primary human hepatocytes is determined by analyzing genomic DNA from primary human hepatocytes transfected in vitro with Cas9 mRNA and guide RNA, and optionally, the off-target sites do not occur within protein-coding regions in the genome of the primary human hepatocytes.

[0134] Embodiment 96 is the method or composition for use of any one of embodiments 92-94, wherein the number of off-target sites in primary human hepatocytes is determined by an oligonucleotide insertion assay comprising analyzing genomic DNA from primary human hepatocytes transfected in vitro with Cas9 mRNA, guide RNA, and donor oligonucleotide, and optionally, the off-target sites do not occur within protein-coding regions in the genome of the primary human hepatocytes.

[0135] Embodiment 97 is a method for producing a guide RNA comprising the steps of: a) SEQ ID NO: 92 or 104, b) SEQ ID NO: 87, 89, 96, or 113; c) SEQ ID NO: 100, 102, 106, 111, or 112, or d) The method or composition of any one of embodiments 1-36 or 39-96, wherein the sequence is SEQ ID NO: 88, 90, 91, 93, 94, 95, 97, 101, 103, 108, or 109.

[0136] Embodiment 98 is the method or composition of embodiment 97, wherein the guide RNA does not generate indels at off-target sites occurring within protein-coding regions in the genome of the primary human hepatocyte.

[0137] Embodiment 99 is a composition for the method or use of any one of embodiments 2 to 98, wherein administering the composition reduces the level of TTR in a subject.

[0138] Embodiment 100 is a composition for the method or use of embodiment 99, wherein the level of TTR is reduced by at least 50%.

[0139] Embodiment 101 is a composition for the method or use of embodiment 100, wherein the level of TTR is reduced by 50% to 60%, 60% to 70%, 70% or 80%, 80% to 90%, 90 to 95%, 95% to 99%, or 99% to 100%.

[0140] Embodiment 102 is a composition for the method or use of embodiment 100 or 101, wherein the level of TTR is measured in serum, plasma, blood, cerebrospinal fluid, or sputum.

[0141] Embodiment 103 is a composition for the method or use of embodiment 100 or 101, wherein the level of TTR is measured in the liver, choroid plexus, and / or retina.

[0142] Embodiment 104 is the method or composition for use of any one of embodiments 99 to 103, wherein the level of TTR is measured via enzyme-linked immunosorbent assay (ELISA).

[0143] Embodiment 105 is the composition for the method or use of any one of embodiments 2 to 104, wherein the subject has ATTR.

[0144] Embodiment 106 is a composition for the method or use of any one of embodiments 2 to 105, wherein the subject is a human.

[0145] Embodiment 107 is a composition for the method or use of embodiment 105 or 106, wherein the subject has ATTRwt.

[0146] Embodiment 108 is the composition for the method or use of embodiment 105 or 106, wherein the subject has an inherited ATTR.

[0147] Embodiment 109 is the composition for the method or use of any one of embodiments 2 to 106 or 108, wherein the subject has a family history of ATTR.

[0148] Embodiment 110 is a composition for the method or use of any one of embodiments 2-106 or 108-109, wherein the subject has familial amyloid polyneuropathy.

[0149] Embodiment 111 is the method or composition for use of any one of Embodiments 2 to 110, wherein the subject has only or primarily neurological symptoms of ATTR.

[0150] Embodiment 112 is the composition for the method or use of any one of embodiments 2 to 111, wherein the subject has familial amyloidotic cardiomyopathy.

[0151] Embodiment 113 is the composition for the method or use of any one of embodiments 2-110 or 112, wherein the subject has only or primarily cardiac symptoms of ATTR.

[0152] Embodiment 114 is the composition for the method or use of any one of Embodiments 2 to 113, wherein the subject expresses TTR with the V30 mutation.

[0153] Embodiment 115 is the composition for the method or use of embodiment 114, wherein the V30 mutation is V30A, V30G, V30L, or V30M.

[0154] Embodiment 116 is the composition for the method or use of any one of embodiments 2 to 113, wherein the subject expresses TTR with a T60 mutation.

[0155] Embodiment 117 is the composition for the method or use of embodiment 116, wherein the T60 mutation is T60A.

[0156] Embodiment 118 is the composition for the method or use of any one of embodiments 2 to 113, wherein the subject expresses TTR with the V122 mutation.

[0157] Embodiment 119 is a composition for the method or use of embodiment 118, wherein the V122 mutation is V122A, V122I, or V122(-).

[0158] Embodiment 120 is the composition for the method or use of any one of embodiments 2 to 113, wherein the subject expresses wild-type TTR.

[0159] Embodiment 121 is the composition for the method or use of any one of embodiments 2 to 107, or 120, wherein the subject does not express TTR with the V30, T60, or V122 mutation.

[0160] Embodiment 122 is a composition for the method or use of any one of embodiments 2 to 107, or 120 to 121, wherein the subject does not express TTR with a deleterious mutation.

[0161] Embodiment 123 is a composition for the method or use of embodiment 122, wherein the subject is homozygous for wild-type TTR.

[0162] Embodiment 124 is a composition for the method or use of any one of embodiments 2 to 123, wherein the subject experiences improvement, stabilization, or slowed change in symptoms of sensory motor neuropathy after administration.

[0163] Embodiment 125 is a composition for the method or use of embodiment 124, wherein the sensorimotor neuropathy improves, stabilizes, or slows down in change as measured using electromyography, nerve conduction studies, or patient-reported outcomes.

[0164] Embodiment 126 is a composition for the method or use of any one of embodiments 2 to 125, wherein the subject experiences improvement, stabilization, or slowed change in symptoms of congestive heart failure.

[0165] Embodiment 127 is a composition for the method or use of embodiment 126, wherein the improvement, stabilization, or slowing of congestive heart failure is measured using cardiac biomarker testing, pulmonary function testing, chest x-ray, or electrocardiography.

[0166] Embodiment 128 is a composition for the method or use of any one of Embodiments 2 to 127, wherein the composition or pharmaceutical formulation is administered via a viral vector.

[0167] Embodiment 129 is a composition for the method or use of any one of embodiments 2 to 127, wherein the composition or pharmaceutical formulation is administered via lipid nanoparticles.

[0168] Embodiment 130 is a composition for the method or use of any one of embodiments 2 to 129, wherein the subject is tested for a specific mutation in the TTR gene prior to administering the composition or formulation.

[0169] Embodiment 131 is the method or composition of any one of the preceding embodiments, in which the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 5, 6, 9, 13, 14, 15, 16, 17, 22, 23, 27, 30, 35, 36, 37, 38, 55, 63, 65, 66, 68, or 69.

[0170] Embodiment 132 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 5.

[0171] Embodiment 133 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 6.

[0172] Embodiment 134 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 7.

[0173] Embodiment 135 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 8.

[0174] Embodiment 136 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 9.

[0175] Embodiment 137 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 10.

[0176] Embodiment 138 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 11.

[0177] Embodiment 139 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 12.

[0178] Embodiment 140 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 13.

[0179] Embodiment 141 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 14.

[0180] Embodiment 142 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 15.

[0181] Embodiment 143 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 16.

[0182] Embodiment 144 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 17.

[0183] Embodiment 145 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 18.

[0184] Embodiment 146 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 19.

[0185] Embodiment 147 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 20.

[0186] Embodiment 148 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 21.

[0187] Embodiment 149 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 22.

[0188] Embodiment 150 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 23.

[0189] Embodiment 151 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 24.

[0190] Embodiment 152 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 25.

[0191] Embodiment 153 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 26.

[0192] Embodiment 154 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 27.

[0193] Embodiment 155 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 28.

[0194] Embodiment 156 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 29.

[0195] Embodiment 157 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 30.

[0196] Embodiment 158 ​​is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 31.

[0197] Embodiment 159 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 32.

[0198] Embodiment 160 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 33.

[0199] Embodiment 161 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 34.

[0200] Embodiment 162 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 35.

[0201] Embodiment 163 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 36.

[0202] Embodiment 164 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 37.

[0203] Embodiment 165 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 38.

[0204] Embodiment 166 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 39.

[0205] Embodiment 167 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 40.

[0206] Embodiment 168 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 41.

[0207] Embodiment 169 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 42.

[0208] Embodiment 170 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 43.

[0209] Embodiment 171 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 44.

[0210] Embodiment 172 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 45.

[0211] Embodiment 173 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 46.

[0212] Embodiment 174 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 47.

[0213] Embodiment 175 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 48.

[0214] Embodiment 176 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 49.

[0215] Embodiment 177 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 50.

[0216] Embodiment 178 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 51.

[0217] Embodiment 179 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 52.

[0218] Embodiment 180 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 53.

[0219] Embodiment 181 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 54.

[0220] Embodiment 182 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 55.

[0221] Embodiment 183 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 56.

[0222] Embodiment 184 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 57.

[0223] Embodiment 185 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 58.

[0224] Embodiment 186 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 59.

[0225] Embodiment 187 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 60.

[0226] Embodiment 188 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 61.

[0227] Embodiment 189 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 62.

[0228] Embodiment 190 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 63.

[0229] Embodiment 191 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 64.

[0230] Embodiment 192 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 65.

[0231] Embodiment 193 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 66.

[0232] Embodiment 194 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 67.

[0233] Embodiment 195 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 68.

[0234] Embodiment 196 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 69.

[0235] Embodiment 197 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 70.

[0236] Embodiment 198 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 71.

[0237] Embodiment 199 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 72.

[0238] Embodiment 200 is the method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 74.

[0239] Embodiment 201 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 75.

[0240] Embodiment 202 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 76.

[0241] Embodiment 203 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 77.

[0242] Embodiment 204 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 78.

[0243] Embodiment 205 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 80.

[0244] Embodiment 206 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 81.

[0245] Embodiment 207 is the method or composition of any one of embodiments 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 82.

[0246] Embodiment 208 is the composition or method of any one of the preceding embodiments, wherein the open reading frame has at least 95% identity to SEQ ID NO: 311 over at least the first 10%, 12%, 15%, 20%, 25%, 30%, or 35% of its sequence.

[0247] Embodiment 209 is the composition or method of any one of the preceding embodiments, wherein the open reading frame comprises a sequence having at least 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity to SEQ ID NO: 311.

[0248] Embodiment 210 is the composition or method of any one of the preceding embodiments, wherein at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% of the codons of the open reading frame are codons listed in Table 4, Table 5, or Table 7.

[0249] Embodiment 211 is the composition or method of embodiment 210, wherein the codons listed in Table 4, Table 5, or Table 7 are codons listed in Table 4.

[0250] Embodiment 212 is the composition or method of embodiment 210, wherein the codon listed in Table 4, Table 5, or Table 7 is a codon of the low U codon set of Table 5.

[0251] Embodiment 213 is the composition or method of embodiment 210, wherein the codon listed in Table 4, Table 5, or Table 7 is a codon of the low-A codon set of Table 5.

[0252] Embodiment 214 is the composition or method of embodiment 210, wherein the codon listed in Table 4, Table 5, or Table 7 is a codon of the low A / U codon set of Table 5.

[0253] Embodiment 215 is the composition or method of embodiment 210, wherein the codon listed in Table 4, Table 5, or Table 7 is a codon listed in Table 7.

[0254] Embodiment 216 is the composition or method of any one of the preceding embodiments, wherein the open reading frame has an adenine content ranging from its minimum adenine content to 101%, 102%, 103%, 105%, 110%, 115%, 120%, or 123% of its minimum adenine content.

[0255] Embodiment 217 is the composition or method of any one of the preceding embodiments, wherein the open reading frame has an adenine dinucleotide content ranging from its minimum adenine dinucleotide content to 101%, 102%, 103%, 105%, 110%, 115%, 120%, 125%, 130%, 135%, 140%, 145%, or 150% of its minimum adenine dinucleotide content.

[0256] Embodiment 218 is the composition or method of any one of the preceding embodiments, wherein the nucleic acid comprises a 5'UTR having at least 90% identity to any one of SEQ ID NOs: 232, 234, 236, 238, 241, or 275-277.

[0257] Embodiment 219 is the composition or method of any one of the preceding embodiments, wherein the nucleic acid comprises a 3'UTR having at least 90% identity to any one of SEQ ID NOs: 233, 235, 237, 239, or 240.

[0258] Embodiment 220 is the composition or method of any one of the preceding embodiments, wherein the nucleic acid comprises a 5' UTR and a 3' UTR from the same source.

[0259] Embodiment 221 is the composition or method of any one of the preceding embodiments, wherein the nucleic acid is an mRNA comprising a 5' cap selected from Cap0, Cap1, and Cap2.

[0260] Embodiment 222 is the composition or method of any one of the preceding embodiments, wherein the open reading frame comprises a sequence having at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity to SEQ ID NO: 377.

[0261] Embodiment 223 is the composition or method of any one of the preceding embodiments, wherein the nucleic acid is an mRNA in which at least 10% of uridines are substituted with modified uridines.

[0262] Embodiment 224 is the composition or method of embodiment 223, wherein the modified uridine is one or more of N1-methyl-pseudouridine, pseudouridine, 5-methoxyuridine, or 5-iodouridine.

[0263] Embodiment 225 is the composition or method of embodiment 223, wherein the modified uridine is one or both of N1-methyl-pseudouridine or 5-methoxyuridine.

[0264] Embodiment 226 is the composition or method of embodiment 223, wherein the modified uridine is N1-methyl-pseudouridine.

[0265] Embodiment 227 is the composition or method of embodiment 223, wherein the modified uridine is 5-methoxyuridine.

[0266] Embodiment 228 is the composition or method of any one of embodiments 223 to 210, wherein between 15% and 45% of the uridines in the mRNA are substituted with modified uridines.

[0267] Embodiment 229 is the composition or method of any one of embodiments 223 to 211, wherein at least 20% or at least 30% of the uridines in the mRNA are substituted with modified uridines.

[0268] Embodiment 230 is the composition or method of embodiment 229, wherein at least 80% or at least 90% of the uridines in the mRNA are substituted with modified uridines.

[0269] Embodiment 231 is the composition or method of embodiment 229, wherein 100% of the uridines in the mRNA are substituted with modified uridines.

[0270] Embodiment 232 is the use of a composition or formulation of any of embodiments 1 or 4 to 231 for the preparation of a medicament for treating a human subject with ATTR. [Brief explanation of the drawings]

[0271] [Figure 1A] 1 shows % editing in primary human hepatocytes from two donors as described in Example 2. [Figure 1B] (As shown above (Figure 1A)). [Figure 2] 1 shows % editing in primary cynomolgus monkey hepatocytes as described in Example 2. [Figure 3A] Serum TTR levels (Figure 3A), hepatic TTR editing (Figure 3B), and circulating ALT levels (Figure 3C) in an in vivo study in non-human primates comparing 30-minute administration of LNPs with a longer dosing protocol are shown. [Figure 3B] (As mentioned above.) [Figure 3C] (As mentioned above.) DETAILED DESCRIPTION OF THE INVENTION

[0272] Reference will now be made in detail to certain embodiments of the invention, examples of which are illustrated in the accompanying drawings. While the invention will be described in conjunction with the illustrated embodiments, it will be understood that they are not intended to limit the invention to those embodiments. On the contrary, the invention is intended to cover all alternatives, modifications, and equivalents, which may be included within the invention as defined by the appended claims.

[0273] Before describing the present teachings in detail, it should be understood that the present disclosure is not limited to particular compositions or process steps, as such may vary. It should be noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, a reference to "a conjugate" includes a plurality of conjugates, a reference to "a cell" includes a plurality of cells, and so forth.

[0274] Numerical ranges are inclusive of the numbers defining the range. Measured and measurable values ​​are understood to be approximate, taking into account significant orders of magnitude and the error associated with the measurements. Additionally, the use of "comprise," "comprises," "comprising," "contain," "contains," "containing," "include," "includes," and "including" is not intended to be limiting. It should be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the teachings herein.

[0275] Unless otherwise stated in the specification above, embodiments herein that recite various components as "comprising" are also assumed to "consist of" or "consist essentially of" the recited components. Embodiments herein that recite various components as "consisting of" are also assumed to "comprising" or "consisting essentially of" the recited components. Embodiments herein that recite various components as "consisting essentially of" are also assumed to "consist of" or "comprising" the recited components (this interchangeability does not apply to the use of these terms in the claims). The term "or" is used in its inclusive sense, i.e., equivalent to "and / or," unless the context clearly dictates otherwise.

[0276] The chapter headings used herein are for organizational purposes only and should not be construed as limiting the desired subject matter in any way. In the event that any material incorporated by reference contradicts any term defined herein or any other explicit content of this specification, this specification shall control. While the present teachings are described in conjunction with various embodiments, it is not intended that the present teachings be limited to such embodiments. To the contrary, the present teachings encompass various alternatives, modifications, and equivalents, as will be understood by those skilled in the art.

[0277] I. Definition Unless otherwise stated, the following terms and phrases used herein are intended to have the following meanings:

[0278] "Polynucleotide" and "nucleic acid" are used herein to refer to polymeric compounds comprising nucleosides or nucleoside analogs (including traditional RNA, DNA, mixed RNA-DNA, and polymers of their analogs) with nitrogenous heterocyclic bases or base analogs linked together along the backbone. The nucleic acid "backbone" can be composed of various linkages, including one or more of sugar phosphodiester linkages, peptide-nucleic acid linkages ("peptide nucleic acid" or PNA, PCT Publication No. WO 95 / 32305), phosphorothioate linkages, methylphosphonate linkages, or combinations thereof. The sugar moiety of the nucleic acid can be ribose, deoxyribose, or similar compounds with substitutions, e.g., 2' methoxy or 2' halide substitutions. The nitrogenous bases can be the traditional bases (A, G, C, T, U), their analogs (e.g., modified uridines such as 5-methoxyuridine, pseudouridine, or N1-methylpseudouridine), derivatives of inosine, purine, or pyrimidine (e.g., N 4 -methyldeoxyguanosine, deaza- or aza-purines, deaza- or aza-pyrimidines, pyrimidine bases with a substituent at the 5- or 6-position (e.g., 5-methylcytosine), purine bases with a substituent at the 2-, 6-, or 8-position, 2-amino-6-methylaminopurine, O 6 -methylguanine, 4-thio-pyrimidine, 4-amino-pyrimidine, 4-dimethylhydrazine-pyrimidine, and O 4 11-alkyl-pyrimidines, U.S. Pat. No. 5,378,825 and PCT Publication No. WO 93 / 13121). For a general discussion, see The Biochemistry of the Nucleic Acids, vol. 5-36, edited by Adams et al., 11 th(See U.S. Pat. No. 5,585,481). Nucleic acids may contain one or more "abasic" residues, where the backbone does not contain a nitrogenous base at any position in the polymer (U.S. Pat. No. 5,585,481). Nucleic acids may contain only conventional RNA or DNA sugars, bases, and linkages, or may contain both conventional components and substitutions (e.g., conventional bases with 2' methoxy linkages, or polymers containing both conventional bases and one or more base analogs). Nucleic acids include "locked nucleic acids" (LNAs), analogs containing one or more LNA nucleotide monomers with a bicyclic furanose unit locked to an RNA-mimetic sugar structure, enhancing hybridization affinity for complementary RNA and DNA sequences (Vester and Wengel, 2004, Biochemistry 43(42):13233-41). RNA and DNA have different sugar moieties and may differ by the presence of uracil or its analogs in RNA and thymine or its analogs in DNA.

[0279] As used herein, "polypeptide" refers to a multimeric compound comprising amino acid residues capable of adopting a three-dimensional conformation. Polypeptides include, but are not limited to, enzymes, proenzyme proteins, regulatory proteins, structural proteins, receptors, nucleic acid binding proteins, antibodies, and the like. Polypeptides may, but do not necessarily, include post-translational modifications, unnatural amino acids, artificial groups, and the like.

[0280] "Guide RNA," "gRNA," and "guide" are used interchangeably herein to refer to either crRNA (also known as CRISPR RNA) or a combination of crRNA and trRNA (also known as tracrRNA). The crRNA and trRNA can associate as a single-stranded RNA molecule (single guide RNA, sgRNA) or in two separate RNA molecules (dual guide RNA, dgRNA). "Guide RNA" or "gRNA" refers to each type. The trRNA can be a naturally occurring sequence or a trRNA sequence that has modifications or variations compared to the naturally occurring sequence. The guide RNA can include modified RNA as described herein.

[0281] As used herein, a "guide sequence" refers to a sequence within a guide RNA that is complementary to a target sequence and functions to direct the guide RNA to the target sequence for binding or modification (e.g., cleavage) by an RNA-guided DNA-binding agent. A "guide sequence" may also be referred to as a "targeting sequence" or a "spacer sequence." A guide sequence may be 20 base pairs in length, for example, in the case of Streptococcus pyogenes (i.e., Spy Cas9) and related Cas9 homologs / orthologs. Shorter or longer sequences, such as 15, 16, 17, 18, 19, 21, 22, 23, 24, or 25 nucleotides in length, can also be used as a guide. In some embodiments, the guide sequence and the target sequence are 100% complementary or identical. In other embodiments, the guide sequence and the target sequence may contain at least one mismatch. For example, the guide sequence and target sequence may contain 1, 2, 3, or 4 mismatches, and the total length of the target sequence is at least 17, 18, 19, 20, or more base pairs. In some embodiments, the guide sequence and target sequence may contain 1 to 4 mismatches, and the guide sequence comprises at least 17, 18, 19, 20, or more nucleotides. In some embodiments, the guide sequence and target sequence may contain 1, 2, 3, or 4 mismatches, and the guide sequence comprises 20 nucleotides.

[0282] Because the nucleic acid substrate of a Cas protein is a double-stranded nucleic acid, the target sequence of the Cas protein includes both the plus and minus strands of genomic DNA (i.e., a given sequence and its reverse complement). Thus, when a guide sequence is said to be "complementary to a target sequence," it should be understood that it can direct the guide RNA to bind to the reverse complement of the target sequence. Thus, in some embodiments, when the guide sequence binds to the reverse complement of the target sequence, the guide sequence is identical to certain nucleotides of the target sequence (e.g., the target sequence without the PAM), except for the substitution of U for T in the guide sequence.

[0283] As used herein, "RNA-guided DNA binding agent" refers to a polypeptide or polypeptide complex having RNA and DNA binding activity, or a DNA-binding subunit of such a complex, wherein the DNA-binding activity is sequence-specific and dependent on the sequence of the RNA. Exemplary RNA-guided DNA binding agents include Cas cleavase / nickases and their inactivated forms ("dCas DNA binding agents"). As used herein, "Cas nuclease," also referred to as "Cas protein," encompasses Cas cleavase, Cas nickase, and dCas DNA binding agents. Cas cleavase / nickases and dCas DNA binding agents include the Csm or Cmr complex of type III CRISPR systems, Cas10, Csm1, or their Cmr2 subunits, the Cascade complex of type I CRISPR systems, their Cas3 subunits, and class 2 Cas nucleases. As used herein, a "Class 2 Cas nuclease" is a single-chain polypeptide with RNA-guided DNA-binding activity, such as Cas9 or Cpfl nuclease. Class 2 Cas nucleases include Class 2 Cas cleavases and Class 2 Cas nickases (e.g., H840A, D10A, or N863A variants) that also have RNA-guided DNA cleavase or nickase activity, as well as Class 2 dCas DNA binders in which the cleavase / nickase activity has been inactivated. Class 2 Cas nucleases include, for example, Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants), HypaCas9 (e.g., N692A, M694A, Q695A, H698A variants), eSPCas9(1.0) (e.g., K810A, K1003A, R1060A variants), and eSPCas9(1.1) (e.g., K848A, K1003A, R1060A variants) proteins, and modifications thereof. The Cpf1 protein (Zetsche et al., Cell, 163:1-13 (2015)) is homologous to Cas9 and contains a RuvC-like nuclease domain.The Cpf1 sequences of Zetsche are incorporated by reference in their entirety. See, for example, Tables S1 and S3 of Zetsche. "Cas9" encompasses Spy Cas9, the Cas9 variants listed herein, and their equivalents. See, for example, Makarova et al., Nat Rev Microbiol, 13(11):722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015).

[0284] The term "modified uridine" is used herein to refer to a nucleoside other than thymidine that has the same hydrogen bond acceptor as uridine and has one or more structural differences from uridine. In some embodiments, the modified uridine is a substituted uridine, i.e., a uridine in which one or more aprotic substituents (e.g., alkoxy, e.g., methoxy) are placed in place of a proton. In some embodiments, the modified uridine is a pseudouridine. In some embodiments, the modified uridine is a substituted pseudouridine, i.e., a pseudouridine in which one or more aprotic substituents (e.g., alkyl, e.g., methyl) are placed in place of a proton, e.g., N1-methylpseudouridine. In some embodiments, the modified uridine is any of a substituted uridine, pseudouridine, or substituted pseudouridine.

[0285] As used herein, a "uridine position" refers to a position in a polynucleotide that is occupied by a uridine or modified uridine. Thus, for example, a polynucleotide in which "100% of the uridine positions are modified uridines" contains modified uridines at all positions that would be uridines in conventional RNA of the same sequence (where all bases are standard A, U, C, or G bases). Unless otherwise indicated, U in a polynucleotide sequence in this disclosure or in the accompanying sequence tables or sequence listings can be a uridine or a modified uridine.

[0286] As used herein, a first sequence is considered to "contain a sequence having at least X% identity" with a second sequence if alignment of the first sequence to the second sequence shows that X% or more of the positions of the second sequence are matched overall by the first sequence. For example, the sequence AAGA contains a sequence having 100% identity with the sequence AAG, because the alignment gives 100% identity in that there is a match at all three positions in the second sequence. Differences between RNA and DNA (generally, the exchange of thymidine with uridine, or vice versa), and the presence of nucleoside analogs such as modified uridines, do not contribute to the difference in identity or complementarity between polynucleotides, as long as the related nucleotides (such as thymidine, uridine, or modified uridine) have the same complement (e.g., adenosine for all thymidine, uridine, or modified uridine; another example is cytosine and 5-methylcytosine, both of which have guanosine or modified guanosine as their complement). Thus, for example, the sequence 5'-AXG, where X is any modified uridine, such as pseudouridine, N1-methylpseudouridine, or 5-methoxyuridine, is considered 100% identical to AUG, in that both are fully complementary to the same sequence (5'-CAU). Exemplary alignment algorithms are the Smith-Waterman and Needleman-Wunsch algorithms, which are well known in the art. Those skilled in the art will understand what algorithm and parameter setting is appropriate for a given pair of sequences to be aligned. Generally, for sequences of similar length and predicted identity greater than 50% for amino acids or 75% for nucleotides, the Needleman-Wunsch algorithm, using the default settings of the Needleman-Wunsch algorithm interface provided by EBI at the www.ebi.ac.uk web server, is generally appropriate.

[0287] "mRNA" is used herein to refer to a polynucleotide that is RNA or modified RNA and contains an open reading frame that can be translated into a polypeptide (i.e., can serve as a substrate for translation by ribosomes and aminoacylated tRNAs). mRNA can contain a phosphate sugar backbone that includes ribose residues or analogs thereof, such as 2'-methoxyribose residues. In some embodiments, the sugars of the nucleic acid phosphate sugar backbone consist essentially of ribose residues, 2'-methoxyribose residues, or combinations thereof. Generally, mRNA does not contain a substantial amount of thymidine residues (e.g., 0 residues or less than 30, 20, 10, 5, 4, 3, or 2 thymidine residues; or a thymidine content of less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 4%, 3%, 2%, 1%, 0.5%, 0.2%, or 0.1%). mRNA can contain modified uridines at some or all of its uridine positions.

[0288] As used herein, the "minimum uridine content" of a given ORF is the uridine content of an ORF that (a) uses a minimum uridine codon at all positions and (b) encodes the same amino acid sequence as the given ORF. The minimum uridine codon for a given amino acid is the codon with the fewest uridines (usually 0 or 1, except for the codon for phenylalanine, which has two uridines). Modified uridine residues are considered equivalent to uridine for the purposes of assessing minimum uridine content.

[0289] As used herein, the "minimum uridine dinucleotide content" of a given ORF is the minimum possible uridine dinucleotide (UU) content of the ORF that (a) uses a minimum of uridine codons (as described above) at all positions and (b) encodes the same amino acid sequence as the given ORF. Uridine dinucleotide (UU) content can be expressed in absolute terms based on percentages, either as a count of UU dinucleotides in the ORF or as the percentage of positions occupied by uridine dinucleotides (e.g., AUUAU has a uridine dinucleotide content of 40% because two of the five positions are occupied by uridine dinucleotides). Modified uridine residues are considered equivalent to uridine for purposes of assessing minimum uridine dinucleotide content. As used herein, the "minimum adenine content" of a given open reading frame (ORF) is the adenine content of an ORF that (a) uses a minimum of adenine codons at all positions and (b) encodes the same amino acid sequence as the given ORF. The minimal adenine codon for a given amino acid is the codon with the fewest adenines (usually 0 or 1, except for codons for lysine and asparagine, where the minimal adenine codon has 2 adenines). Modified adenine residues are considered equivalent to adenine for the purposes of assessing the minimum adenine content.

[0290] As used herein, the "minimum adenine dinucleotide content" of a given open reading frame (ORF) is the minimum possible adenine dinucleotide (AA) content of the ORF that (a) uses a minimum of adenine codons (as described above) at all positions and (b) encodes the same amino acid sequence as the given ORF. Adenine dinucleotide (AA) content can be expressed in absolute terms based on percentages, as a count of AA dinucleotides in the ORF, or as the percentage of positions occupied by adenine dinucleotides (e.g., UAAUA has an adenine dinucleotide content of 40% because two of the five positions are occupied by adenine dinucleotides). Modified adenine residues are considered equivalent to adenine for purposes of assessing minimum adenine dinucleotide content.

[0291] As used herein, "TTR" refers to transthyretin, the gene product of the TTR gene.

[0292] As used herein, "amyloid" refers to abnormal aggregates of normally soluble proteins or peptides. Amyloids are insoluble and can form proteinaceous deposits in organs and tissues. The proteins or peptides in amyloids can misfold into a form that allows many copies of the protein to stick together and form fibrils. While some forms of amyloids can function normally in the human body, "amyloid" as used herein refers to abnormal or pathological aggregates of proteins. Amyloids can contain a single protein or peptide, such as TTR, or multiple proteins or peptides, such as TTR and additional proteins.

[0293] As used herein, "amyloid fibrils" refer to insoluble fibers of amyloid that are resistant to degradation. Amyloid fibrils can cause symptoms based on the particular protein or peptide and the tissue and cell type in which they aggregate.

[0294] As used herein, "amyloidosis" refers to a disease characterized by symptoms caused by the deposition of amyloid or amyloid fibrils. Amyloidosis can affect many organs, including the heart, kidneys, liver, spleen, nervous system, and gastrointestinal tract.

[0295] As used herein, "ATTR," "TTR-associated amyloidosis," "TTR amyloidosis," "ATTR amyloidosis," or "amyloidosis associated with TTR" refers to amyloidosis associated with deposits of TTR.

[0296] As used herein, "familial amyloidotic cardiomyopathy" or "FAC" refers to hereditary transthyretin amyloidosis (ATTR), which is primarily characterized by restrictive cardiomyopathy. Congestive heart failure is common in FAC. The average age of onset is approximately 60-70 years, with an estimated life expectancy of 4-5 years after diagnosis.

[0297] As used herein, "familial amyloid polyneuropathy" or "FAP" refers to hereditary transthyretin amyloidosis (ATTR), which is primarily characterized by sensorimotor neuropathy. Autonomic neuropathy is common in FAP. Although neuropathy is the primary feature, symptoms of FAP can also include cachexia, renal failure, and heart disease. The average age of onset of FAP is approximately 30-50 years, with an estimated life expectancy of 5-15 years after diagnosis.

[0298] As used herein, "wild-type ATTR" and "ATTRwt" refer to ATTR not associated with a pathogenic TTR mutation, such as T60A, V30M, V30A, V30G, V30L, V122I, V122A, or V122(-). ATTRwt has also been called senile systemic amyloidosis. Onset typically occurs in men over 60 years of age, and the most common symptoms are congestive heart failure and abnormal heart rhythms, such as atrial fibrillation. Additional symptoms include consequences of poor cardiac function, such as shortness of breath, fatigue, dizziness, swelling (especially in the legs), nausea, angina, sleep disturbances, and weight loss. A history of carpal tunnel syndrome indicates an increased risk of ATTRwt and, in some cases, may indicate early-stage disease. ATTRwt generally causes a decline in cardiac function over time, but wild-type TTR deposits accumulate more slowly, potentially resulting in a better prognosis than hereditary ATTR. Existing treatments are similar to other forms of ATTR (except liver transplantation) and generally aim to support or improve cardiac function, ranging from diuretics and restriction of fluid and salt intake to anticoagulants and, in severe cases, heart transplantation. Nevertheless, like FAC, ATTRwt can lead to death from heart failure within 3–5 years of diagnosis.

[0299] Guide sequences useful in the guide RNA compositions and methods described herein are provided in Table 1 and throughout the application.

[0300] As used herein, "inherited ATTR" refers to an ATTR associated with a mutation in the sequence of the TTR gene. Known mutations in the TTR gene associated with ATTR include mutations that result in a TTR with a substitution of T60A, V30M, V30A, V30G, V30L, V122I, V122A, or V122(-).

[0301] As used herein, "indel" refers to an insertion / deletion mutation consisting of a number of nucleotides that are either inserted or deleted at the site of a double-strand break (DSB) in a target nucleic acid.

[0302] As used herein, "knockdown" refers to a reduction in the expression of a particular gene product (e.g., protein, mRNA, or both). Protein knockdown can be measured either by detecting the protein secreted by a tissue or cell aggregate (e.g., in serum or cell culture medium) or by detecting the total cellular amount of protein from a tissue or cell aggregate of interest. Methods for measuring mRNA knockdown are known and include sequencing mRNA isolated from a tissue or cell aggregate of interest. In some embodiments, "knockdown" can refer to some loss of expression of a particular gene product, for example, a reduction in the amount of transcribed mRNA, or a reduction in the amount of protein expressed or secreted by a cell aggregate (including in vivo aggregates such as those found in tissues).

[0303] As used herein, "mutant TTR" refers to a gene product of TTR (i.e., TTR protein) that has a change in the amino acid sequence of TTR compared to the wild-type amino acid sequence of TTR. The human wild-type TTR sequence is available at NCBI Gene ID: 7276; Ensembl: Ensembl: ENSG00000118271. For example, mutant forms of TTR associated with ATTR in humans include T60A, V30M, V30A, V30G, V30L, V122I, V122A, or V122(-).

[0304] As used herein, "ribonucleoprotein" (RNP) or "RNP complex" refers to a guide RNA comprising an RNA-guided DNA-binding agent, e.g., a Cas nuclease, e.g., a Cas cleavase, a Cas nickase, or a dCas DNA-binding agent (e.g., Cas9). In some embodiments, the guide sequence guides the RNA-guided DNA-binding agent, such as Cas9, to a target sequence, the guide RNA hybridizes to the target sequence, and an agent binds to the target sequence, where the agent is a cleavase or nickase and can perform cleavage or nicking after binding.

[0305] As used herein, "target sequence" refers to a nucleic acid sequence within a target gene that has complementarity to the guide sequence of a gRNA. The interaction between the target sequence and the guide sequence directs the RNA-guided DNA-binding agent to bind and potentially (depending on the activity of the agent) nick or cleave within the target sequence.

[0306] As used herein, "treatment" refers to any administration or treatment for a disease or disorder in a subject, including inhibiting the disease, halting its progression, alleviating one or more symptoms of the disease, curing the disease, or preventing the recurrence of one or more symptoms of the disease. For example, treating ATTR can include alleviating the symptoms of ATTR.

[0307] As used herein, the term "pathogenic mutation" refers to a mutation that likely prevents a gene product, such as TTR, from causing, promoting, contributing to, or inhibiting the development of a disease, such as ATTR.

[0308] As used herein, the term "lipid nanoparticle" (LNP) refers to a particle comprising a plurality (i.e., more than one) of lipid molecules physically associated with each other by intermolecular forces. LNPs can be, for example, microspheres (unilamellar and multilamellar vesicles, e.g., "liposomes," which in some embodiments are substantially spherical and, in more specific embodiments, comprise a lamellar phase lipid bilayer that may include an aqueous core, e.g., a substantial portion of RNA molecules), the dispersed phase in an emulsion, a micelle, or the internal phase in a suspension. See, for example, WO2017173054A1 and WO2019067992A1, the contents of which are incorporated herein by reference in their entirety. Any LNP known to those skilled in the art capable of delivering nucleotides to a subject can be utilized with a guide RNA and a nucleic acid encoding an RNA-guided DNA binder described herein.

[0309] As used herein, the term "donor oligonucleotide" or "donor template" refers to an oligonucleotide containing a desired nucleic acid sequence to be inserted into a target site (e.g., a target site in genomic DNA). The donor oligonucleotide may be a single-stranded oligonucleotide or a double-stranded oligonucleotide. In some embodiments, the donor oligonucleotide may be delivered together with a nucleic acid sequence encoding a guide RNA and an RNA-guided DNA-binding agent (e.g., Cas9) via the use of LNP or transfection.

[0310] As used herein, the term "nuclear localization signal" (NLS) or "nuclear localization sequence" refers to an amino acid sequence that directs the transport of a molecule containing or linked to such a sequence into the nucleus of a eukaryotic cell. The nuclear localization signal may form part of the molecule to be transported. In some embodiments, the NLS may be linked to the remainder of the molecule by a covalent bond, a hydrogen bond, or an ionic interaction.

[0311] As used herein, the phrase "pharmaceutically acceptable" means useful in preparing pharmaceutical compositions that are generally non-toxic, not biologically undesirable, and not otherwise acceptable for pharmaceutical use.

[0312] As used herein, "infusion" refers to the active administration of one or more agents, e.g., over an infusion period of approximately 30 minutes to 12 hours. In some embodiments, the one or more agents include, e.g., an LNP comprising an mRNA encoding an RNA-guided DNA-binding agent (e.g., Cas9) described herein and a gRNA described herein.

[0313] As used herein, "infusion prophylaxis" refers to a regimen administered to a subject prior to treatment (e.g., including administration of LNP) that includes one or more or all of the following: intravenous corticosteroid (e.g., dexamethasone 10 mg or equivalent), antipyretic (e.g., oral acetaminophen or paracetamol 500 mg), intravenous H1 blocker (e.g., diphenhydramine 50 mg or equivalent), and intravenous H2 blocker (e.g., ranitidine 50 mg or equivalent). Infusion prophylaxis is optionally combined with pre-administration of oral corticosteroid (e.g., dexamethasone 8 mg or equivalent). In some embodiments, oral corticosteroid is administered 8 to 24 hours prior to treatment. In some embodiments, one or more or all of the following are administered 1-2 hours prior to treatment: an intravenous corticosteroid (e.g., dexamethasone 10 mg or equivalent), oral acetaminophen 500 mg, an intravenous H1 blocker (e.g., diphenhydramine 50 mg or equivalent), an intravenous H2 blocker (e.g., ranitidine 50 mg or equivalent). In some embodiments, the H1 blocker and / or H2 blocker are administered orally.

[0314] The term "about" or "approximately" refers to an acceptable error for a particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined.

[0315] II. Methods and Compositions Targeting the TTR Gene Disclosed herein are methods for inducing double-strand breaks (DSBs) in TTR gene in a subject, modifying TTR gene in cells or a subject, treating TTR-associated amyloidosis (ATTR) in a subject, reducing TTR serum concentration in a subject, and / or reducing or preventing the accumulation of amyloid or amyloid fibrils in a subject, as well as related compositions, including compositions for use in such methods.Generally, the disclosed compositions comprise a guide RNA that targets TTR and a nucleic acid comprising an open reading frame that encodes an RNA-guided DNA binding agent (for example, CRISPR / Cas system).The subject treated with such methods and compositions may have wild-type or non-wild-type TTR gene sequence, and may be, for example, a subject with ATTR (which may be ATTRwt, or an inherited or familial form of ATTR).

[0316] In some embodiments, the composition is administered by infusion for more than 30 minutes. In some embodiments, the composition is administered by infusion for more than 30 minutes. In some embodiments, the composition is administered by infusion for more than 60 minutes. In some embodiments, the composition is administered by infusion for more than 90 minutes. In some embodiments, the composition is administered by infusion for more than 120 minutes, more than 150 minutes, more than 180 minutes, more than 240 minutes, more than 300 minutes, or more than 360 minutes. In some embodiments, the composition is administered by infusion for at least 1 hour, at least 2 hours, at least 4 hours, at least 6 hours, at least 7 hours, at least 8 hours, at least 9 hours, at least 10 hours, at least 11 hours, or at least 12 hours. In some embodiments, the composition is administered by infusion over a period of 0.5 to 1.5 hours, 1.5 to 2.5 hours, 2.5 to 3.5 hours, 3.5 to 4.5 hours, 4.5 to 5.5 hours, 5.5 to 6.5 hours, 6.5 to 7.5 hours, 7.5 to 8.5 hours, 8.5 to 9.5 hours, 9.5 to 10.5 hours, 10.5 to 11.5 hours, or 11.5 to 12.5 hours. In some embodiments, the composition is administered by infusion over a period of about 60 minutes, about 90 minutes, about 120 minutes, about 150 minutes, about 180 minutes, about 240 minutes, about 300 minutes, or about 360 minutes. In some embodiments, the composition is administered by infusion over about 45 to 75 minutes, 75 to 105 minutes, 105 to 135 minutes, 135 to 165 minutes, 165 to 195 minutes, 195 to 225 minutes, 225 to 255 minutes, 255 to 285 minutes, 285 to 315 minutes, 315 to 345 minutes, or 345 to 375 minutes. In some embodiments, the composition is administered by infusion over about 1.5 to 6 hours.

[0317] A. Guide RNA (gRNA) The guide RNAs used in the disclosed methods and compositions include guide sequences that target the TTR gene. Exemplary guide sequences that target the TTR gene are shown in Table 1 as SEQ ID NOS: 5-82. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7] [Table 1-8] [Table 1-9]

[0318] Each of the above-mentioned guide sequences may further include additional nucleotides to form a crRNA, for example, having the following exemplary nucleotide sequence at its 3' end following the guide sequence: GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 126). In the case of an sgRNA, the above-mentioned guide sequences may further include additional nucleotides to form an sgRNA, for example, having the following exemplary nucleotide sequence at its 3' end following the guide sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 125) in the 5' to 3' direction.

[0319] In some embodiments, the sgRNA is modified. In some embodiments, the sgRNA comprises the modification pattern shown below in SEQ ID NO: 3, where N is any natural or unnatural nucleotide, the entire N comprises a guide sequence as described herein, and the modified sgRNA comprises the following sequence: mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 3), where "N" can be any natural or unnatural nucleotide. For example, encompassed herein is SEQ ID NO: 3, where N is replaced with any of the guide sequences disclosed herein. The modifications remain as shown in SEQ ID NO: 3, regardless of the N substitution for the guide nucleotide. That is, the guide nucleotide replaces "N", but the first three nucleotides are 2'OMe modified and there are phosphorothioate linkages between the first and second nucleotides, between the second and third nucleotides, and between the third and fourth nucleotides.

[0320] In some embodiments, any one of the sequences listed in Table 2 is included. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9] [Table 2-10]

[0321] Alignment mapping of guide IDs with corresponding sgRNA IDs, as well as homology to the cynomolgus genome and cynomolgus-matched guide IDs, is provided in Table 3. [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5]

[0322] In some embodiments, the gRNA comprises a guide sequence that directs an RNA-guided DNA-binding agent, which may be a nuclease (e.g., a Cas nuclease such as Cas9), to a target DNA sequence in the TTR. The gRNA may comprise a crRNA comprising a guide sequence shown in Table 1. The gRNA may comprise a crRNA comprising 17, 18, 19, or 20 consecutive nucleotides of a guide sequence shown in Table 1. In some embodiments, the gRNA comprises a crRNA comprising a sequence having about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to at least 17, 18, 19, or 20 consecutive nucleotides of a guide sequence shown in Table 1. In some embodiments, the gRNA comprises a crRNA comprising a sequence having about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a guide sequence shown in Table 1. The gRNA may further comprise a trRNA. In each composition and method embodiment described herein, the crRNA and trRNA may be associated as a single RNA (sgRNA) or may reside on separate RNAs (dgRNA). In the context of an sgRNA, the crRNA and trRNA components may be covalently linked, for example, via a phosphodiester bond or other covalent bond.

[0323] In each of the composition, use, and method embodiments described herein, the guide RNA may comprise two RNA molecules as a "dual guide RNA" or "dgRNA." The dgRNA comprises a first RNA molecule comprising a crRNA, e.g., comprising a guide sequence as shown in Table 1, and a second RNA molecule comprising a trRNA. The first and second RNA molecules may not be covalently linked, but may form an RNA duplex by base pairing between portions of the crRNA and trRNA.

[0324] In embodiments of each of the compositions, uses, and methods described herein, the guide RNA may comprise a single RNA molecule referred to as a "single guide RNA" or "sgRNA." The sgRNA may comprise a crRNA (or a portion thereof) comprising a guide sequence shown in Table 1 covalently linked to a trRNA. The sgRNA may comprise 17, 18, 19, or 20 consecutive nucleotides of a guide sequence shown in Table 1. In some embodiments, the crRNA and trRNA are covalently linked via a linker. In some embodiments, the sgRNA forms a stem-loop structure by base pairing between portions of the crRNA and trRNA. In some embodiments, the crRNA and trRNA are covalently linked via one or more bonds that are not phosphodiester bonds.

[0325] In some embodiments, the trRNA may comprise all or part of a trRNA sequence from a naturally occurring CRISPR / Cas system. In some embodiments, the trRNA comprises a truncated or modified wild-type trRNA. The length of the trRNA depends on the CRISPR / Cas system used. In some embodiments, the trRNA comprises or consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, or more than 100 nucleotides. In some embodiments, the trRNA may comprise a specific secondary structure, such as one or more hairpin or stem-loop structures, or one or more bulges.

[0326] In some embodiments, the composition comprises one or more guide RNAs comprising a guide sequence selected from SEQ ID NOs: 5-82.

[0327] In some embodiments, the composition comprises a gRNA comprising a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 5-82.

[0328] In some embodiments, the composition comprises one or more guide RNAs comprising a guide sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82. In some embodiments, the composition comprises a gRNA comprising a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82. In some embodiments, the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 22, 23, 27, 29, 30, 35, 36, 37, 38, 55, 61, 63, 65, 66, 68, or 69. In some embodiments, the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 5, 6, 9, 13, 14, 15, 16, 17, 22, 23, 27, 30, 35, 36, 37, 38, 55, 63, 65, 66, 68, or 69. In particular, a guide RNA comprising a guide sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 can be an sgRNA. A guide RNA comprising a guide sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 can be a chemically modified sgRNA, e.g., a terminally modified RNA. A guide RNA comprising a guide sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 can be a dgRNA, e.g., a chemically modified dgRNA.

[0329] In other embodiments, the composition comprises at least one, e.g., at least two, gRNAs comprising a guide sequence selected from any two or more of the guide sequences of SEQ ID NOs: 5-82. In some embodiments, the composition comprises at least two gRNAs each comprising a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the nucleic acids of SEQ ID NOs: 5-82.

[0330] In other embodiments, the composition comprises at least one, e.g., at least two, gRNAs comprising a guide sequence selected from any two or more of the guide sequences selected from SEQ ID NOs: 5-72, 74-78, and 80-82. In some embodiments, the composition comprises at least two gRNAs each comprising a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the sequences selected from SEQ ID NOs: 5-72, 74-78, and 80-82. In some embodiments, the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 comprises one or two sequences selected from SEQ ID NOs: 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 22, 23, 27, 29, 30, 35, 36, 37, 38, 55, 61, 63, 65, 66, 68, or 69. In some embodiments, the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 comprises one or two sequences selected from SEQ ID NOs: 5, 6, 9, 13, 14, 15, 16, 17, 22, 23, 27, 30, 35, 36, 37, 38, 55, 63, 65, 66, 68, or 69.

[0331] In some embodiments, the gRNA is an sgRNA comprising any one of the sequences shown in Table 2 (SEQ ID NOS: 87-124). In some embodiments, the gRNA is an sgRNA comprising any one of the sequences shown in Table 2 (SEQ ID NOS: 87-124), but without the indicated modification (i.e., unmodified SEQ ID NOS: 87-124). In some embodiments, the sgRNA comprises a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the nucleic acids in SEQ ID NOS: 87-124. In some embodiments, the sgRNA comprises a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the nucleic acids in SEQ ID NOS: 87-124, but without the indicated modification (i.e., unmodified SEQ ID NOS: 87-124). In some embodiments, the sgRNA comprises any one of the guide sequences shown in Table 1, with or without modifications, in place of the guide sequences shown in the sgRNA sequences of Table 2 in SEQ ID NOs: 87-124.

[0332] In some embodiments, the gRNA is an sgRNA comprising any one of SEQ ID NOs: 87-113, 115-120, or 122-124. In some embodiments, the gRNA is an sgRNA comprising any one of SEQ ID NOs: 87-113, 115-120, or 122-124, but not including the modifications shown in Table 2 (i.e., unmodified SEQ ID NOs: 87-113, 115-120, or 122-124). In some embodiments, the gRNA is an sgRNA comprising any one of SEQ ID NOs: 87-113, 115-120, or 122-124, but with at least one chemical modification and not including the modification pattern shown in Table 2 (i.e., chemically modified SEQ ID NOs: 87-113, 115-120, or 122-124). Chemically modified guide RNAs may include one or more of the modifications as shown in Table 2. In some embodiments, the chemically modified SEQ ID NOs: 87-113, 115-120, or 122-124 that do not contain the modification patterns shown in Table 2 contain 5' and / or 3' end modifications. In some embodiments, the sgRNA comprises a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the nucleic acids of SEQ ID NOs: 87-113, 115-120, or 122-124. In some embodiments, the sgRNA comprises a sequence at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the nucleic acids in SEQ ID NOs: 87-113, 115-120, or 122-124, but does not contain the modifications as indicated (i.e., unmodified SEQ ID NOs: 87-113, 115-120, or 122-124). In some embodiments, the sgRNA comprises any one of the guide sequences shown in Table 1 in place of the guide sequence shown in the sgRNA sequences in Table 2 in SEQ ID NOs: 87-113, 115-120, or 122-124, with or without modifications.

[0333] The guide RNAs provided herein can be useful for recognizing (e.g., hybridizing to) target sequences within the TTR gene. For example, the TTR target sequence can be recognized and cleaved by the provided Cas cleavase containing the guide RNA. Thus, an RNA-guided DNA binding agent, e.g., Cas cleavase, can direct the guide RNA to the target sequence of the TTR gene, the guide sequence of the guide RNA hybridizes to the target sequence, and the RNA-guided DNA binding agent, e.g., Cas cleavase, cleaves the target sequence.

[0334] In some embodiments, the selection of one or more guide RNAs is determined based on a target sequence within the TTR gene.

[0335] Without being bound by any particular theory, mutations in certain regions of a gene (e.g., frameshift mutations resulting from indels resulting from nuclease-mediated DSBs) may be less tolerated than mutations in other regions of a gene, and therefore the location of the DSB is an important factor in the amount or type of protein knockdown that can be achieved. In some embodiments, a gRNA that is complementary to or has complementarity with a target sequence within TTR is used to direct an RNA-guided DNA-binding agent to a specific location within the TTR gene. In some embodiments, the gRNA is designed to have a guide sequence that is complementary to or has complementarity with a target sequence within exon 1, exon 2, exon 3, or exon 4 of TTR.

[0336] B. gRNA Modification In some embodiments, the gRNA is chemically modified. A gRNA that includes one or more modified nucleosides or nucleotides is referred to as a "modified" gRNA or a "chemically modified" gRNA to describe the presence of one or more non-natural and / or naturally occurring components or structures used in place of, or in addition to, the standard A, G, C, and U residues. In some embodiments, the modified gRNA is synthesized using non-standard nucleosides or nucleotides and is referred to herein as "modified." Modified nucleosides or nucleotides can include one or more of the following: (i) an alteration in the phosphodiester backbone linkage, e.g., replacement of one or both of the non-bridging phosphate oxygens and / or one or more of the bridging phosphate oxygens (exemplary backbone modifications); (ii) an alteration, e.g., replacement, of a component of the ribose sugar, e.g., the 2' hydroxyl of the ribose sugar (exemplary sugar modifications); (iii) extensive replacement of a phosphate moiety with a "dephosphorylated" linker (exemplary backbone modifications); (iv) a modification or replacement of a naturally occurring nucleobase, including with a non-standard nucleobase (exemplary base modifications); (v) a replacement or modification of the ribose phosphate backbone (exemplary backbone modifications); (vi) a modification of the 3' or 5' end of the oligonucleotide, e.g., removal, modification, or replacement of a terminal phosphate group, or conjugation of a moiety, cap, or linker (such 3' or 5' cap modifications can include sugar and / or backbone modifications); and (vii) a modification or replacement of the sugar (exemplary sugar modifications). Chemical modifications such as those listed above can be combined to provide modified gRNAs containing nucleosides and nucleotides (collectively "residues") that may have two, three, four, or more modifications. For example, modified residues may have modified sugars and modified nucleobases. In some embodiments, each base of the gRNA is modified, e.g., all bases have modified phosphate groups, such as phosphorothioate groups. In certain embodiments, all or substantially all of the phosphate groups of the gRNA molecule are replaced with phosphorothioate groups. In some embodiments, the modified gRNA contains at least one modified residue at or near the 5' end of the RNA.In some embodiments, the modified gRNA comprises at least one modified residue at or near the 3' end of the RNA.

[0337] In some embodiments, the gRNA comprises one, two, three, or more modified residues. In some embodiments, at least 5% (e.g., at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%) of the positions in the modified gRNA are modified nucleosides or nucleotides.

[0338] Unmodified nucleic acids may be susceptible to degradation, for example, by intracellular nucleases or those found in serum. For example, nucleases can hydrolyze phosphodiester bonds of nucleic acids. Thus, in one aspect, the gRNAs described herein may contain one or more modified nucleosides or nucleotides to introduce stability against, for example, intracellular or serum-derived nucleases. In some embodiments, the modified gRNA molecules described herein may exhibit a reduced innate immune response when introduced into cell populations both in vivo and ex vivo. The term "innate immune response" includes cellular responses to exogenous nucleic acids, including single-stranded nucleic acids, including induction of cytokine (particularly interferon) expression and release and cell death.

[0339] In some embodiments of backbone modification, the phosphate group of the modified residue can be modified by replacing one or more oxygen atoms with different substituents.In addition, modified residues, such as modified residues present in modified nucleic acids, can include large-scale replacement of unmodified phosphate moieties with modified phosphate groups, as described herein.In some embodiments, backbone modification of phosphate backbone can include modifications that result in either uncharged linkers or charged linkers with asymmetric charge distribution.

[0340] Examples of modified phosphate groups include phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, alkyl or aryl phosphonates, and phosphotriesters. The phosphate atom in an unmodified phosphate group is achiral. However, replacing one of the non-bridging oxygens with one of the atoms or groups of atoms described above can make the phosphorus atom chiral. The stereogenic phosphorus atom can have either the "R" configuration (Rp herein) or the "S" configuration (Sp herein). The backbone can also be modified by replacing the bridging oxygen (i.e., the oxygen connecting the phosphate to the nucleoside) with nitrogen (bridging phosphoramidates), sulfur (bridging phosphorothioates), and carbon (bridging methylene phosphonates). Replacement can occur at either or both bridging oxygens.

[0341] The phosphate group can be replaced by a non-phosphorus-containing linking group in certain backbone modifications. In some embodiments, the charged phosphate group can be replaced by a neutral moiety. Examples of moieties that can replace the phosphate group can include, but are not limited to, methylphosphonate, hydroxylamino, siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioformacetal, formacetal, oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo, and methyleneoxymethylimino. Scaffolds that can mimic nucleic acids can also be constructed in which the phosphate linker and ribose sugar are replaced with nuclease-resistant nucleoside or nucleotide surrogates. Such modifications can include backbone and sugar modifications. In some embodiments, the nucleobases can be tethered by surrogate backbones. Examples can include, but are not limited to, morpholino, cyclobutyl, pyrrolidine, and peptide nucleic acid (PNA) nucleoside surrogates.

[0342] Modified nucleosides and modified nucleotides can include one or more modifications to the sugar, i.e., sugar modifications. For example, the 2' hydroxyl group (OH) can be modified, for example, replaced with many different "oxy" or "deoxy" substituents. In some embodiments, the modification of the 2' hydroxyl group can enhance the stability of nucleic acids, since the hydroxyl can no longer be further deprotonated to form a 2'-alkoxide ion.

[0343] Examples of 2' hydroxyl group modifications include alkoxy or aryloxy (OR, where "R" can be alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), polyethylene glycol (PEG), O(CH2CHO) nExamples of 2' hydroxyl group modifications include CH2CH2OR, where R is, for example, H or optionally substituted alkyl, and n can be an integer from 0 to 20 (e.g., 0 to 4, 0 to 8, 0 to 10, 0 to 16, 1 to 4, 1 to 8, 1 to 10, 1 to 16, 1 to 20, 2 to 4, 2 to 8, 2 to 10, 2 to 16, 2 to 20, 4 to 8, 4 to 10, 4 to 16, and 4 to 20). In some embodiments, the 2' hydroxyl group modification can be 2'-O-Me. In some embodiments, the 2' hydroxyl group modification can be a 2'-fluoro modification, where the 2'-hydroxyl group is replaced with fluorine. In some embodiments, the 2' hydroxyl group modification can be a 2'-fluoro modification, where the 2' hydroxyl is, for example, C1-6 alkylene or C 1-6 They may also include "locked" nucleic acids (LNAs) that may be connected to the 4' carbon of the same ribose sugar via a heteroalkylene bridge, exemplary bridges being methylene, propylene, ether, or amino bridges, O-amino (where amino can be, for example, NH, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino), and aminoalkoxy, O(CH) n -amino (wherein amino can be, for example, NH, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino). In some embodiments, the 2' hydroxyl group modification can include an "unlocked" nucleic acid (UNA), in which the ribose ring lacks a C2'-C3' bond. In some embodiments, the 2' hydroxyl group modification can include a methoxyethyl group (MOE), (OCH2CH2OCH3, e.g., a PEG derivative).

[0344] A "deoxy" 2' modification can be hydrogen (i.e., a deoxyribose sugar, e.g., an overhanging portion of a partial dsRNA), halo (e.g., bromo, chloro, fluoro, or iodo), amino (where amino can be, e.g., NH, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid), NH(CHCHNH) n may include CH2CH2-amino (wherein amino is, e.g., as described herein), -NHC(O)R (wherein R may be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), cyano, mercapto, alkyl-thio-alkyl, thioalkoxy, and alkyl, cycloalkyl, aryl, alkenyl, and alkynyl, optionally substituted by amino, e.g., as described herein. Sugar modifications can include sugar groups that contain one or more carbons and have the opposite stereochemical configuration to that of the corresponding carbon in ribose. Thus, modified nucleic acids can include nucleotides containing, for example, arabinose as the sugar. Modified nucleic acids can also include abasic sugars. These abasic sugars can also be further modified at one or more of the constituent sugar atoms. Modified nucleic acids can also include one or more sugars that are L-configured, such as L-nucleosides.

[0345] The modified nucleosides and modified nucleotides described herein that can be incorporated into modified nucleic acids can contain modified bases, also referred to as nucleobases. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or completely replaced to produce modified residues that can be incorporated into modified nucleic acids. The nucleobases of the nucleotides can be independently selected from purines, pyrimidines, purine analogs, or pyrimidine analogs. In some embodiments, the nucleobases can include, for example, naturally occurring bases and synthetic derivatives of bases. In embodiments using dual guide RNAs, each of the crRNA and tracrRNA can contain modifications. Such modifications may be present at one or both ends of the crRNA and / or tracrRNA. In embodiments involving an sgRNA, one or more residues at one or both ends of the sgRNA may be chemically modified, or the entire sgRNA may be chemically modified. Certain embodiments include 5'-end modifications. Certain embodiments include 3'-end modifications. In certain embodiments, one or more or all of the nucleotides in the single-stranded overhangs of the guide RNA molecule are deoxynucleotides.

[0346] In some embodiments, the guide RNAs disclosed herein comprise one of the modification patterns disclosed in US 62 / 431,756, filed December 8, 2016, entitled "Chemically Modified Guide RNAs," the contents of which are incorporated herein by reference in their entirety. In some embodiments, the present invention includes gRNAs comprising one or more modifications. In some embodiments, the modifications comprise 2'-O-methyl (2'-O-Me) modified nucleotides. In some embodiments, the modifications comprise internucleotide phosphorothioate (PS) linkages.

[0347] The terms "mA," "mC," "mU," or "mG" may be used to refer to nucleotides modified with 2'-O-Me.

[0348] The 2'-O-methyl modification can be depicted as follows: [ka]

[0349] Another chemical modification that has been shown to affect the nucleotide sugar ring is halogen substitution. For example, 2'-fluoro (2'-F) substitution on the nucleotide sugar ring can increase oligonucleotide binding affinity and nuclease stability.

[0350] In this application, the terms "fA," "fC," "fU," or "fG" may be used to refer to nucleotides substituted with 2'-F.

[0351] The substitution of 2'-F can be depicted as follows: [ka]

[0352] Phosphorothioate (PS) linkage or bond refers to a phosphodiester linkage, e.g., a bond in which a sulfur substitutes for one non-bridging phosphate oxygen in the bond between nucleotide bases. When phosphorothioates are used to generate oligonucleotides, the modified oligonucleotides may also be referred to as S-oligos.

[0353] "*" may be used to indicate a PS modification. In this application, the terms A*, C*, U*, or G* may be used to indicate a nucleotide that is linked to the adjacent (e.g., 3') nucleotide by a PS bond.

[0354] In this application, the terms "mA*," "mC*," "mU*," or "mG*" may be used to refer to a nucleotide that is substituted with 2'-O-Me and linked to the next (e.g., 3') nucleotide with a PS bond.

[0355] The diagram below shows the substitution of S- for the non-bridging phosphate oxygen, resulting in a PS bond instead of a phosphodiester bond. [ka]

[0356] An abasic nucleotide is one that lacks a nitrogenous base. The diagram below depicts an oligonucleotide with an abasic (also known as apurinic) site that lacks a base. [ka]

[0357] Inverted bases refer to those having a linkage that is inverted from the normal 5' to 3' linkage (i.e., either a 5' to 5' linkage or a 3' to 3' linkage). For example, [ka]

[0358] The abasic nucleotide can be connected with an inverted linkage. For example, the abasic nucleotide can be attached to the terminal 5' nucleotide via a 5' to 5' linkage, or the abasic nucleotide can be attached to the terminal 3' nucleotide via a 3' to 3' linkage. An inverted abasic nucleotide at either the terminal 5' or 3' nucleotide can also be referred to as an inverted abasic end cap.

[0359] In some embodiments, one or more of the first 3, 4, or 5 nucleotides at the 5' end and one or more of the last 3, 4, or 5 nucleotides at the 3' end are modified. In some embodiments, the modifications are 2'-O-Me, 2'-F, inverted abasic nucleotides, PS linkages, or other nucleotide modifications known in the art to increase stability and / or performance.

[0360] In some embodiments, the first four nucleotides at the 5' end and the last four nucleotides at the 3' end are linked using phosphorothioate (PS) bonds.

[0361] In some embodiments, the first three nucleotides at the 5' end and the last three nucleotides at the 3' end comprise 2'-O-methyl (2'-O-Me) modified nucleotides. In some embodiments, the first three nucleotides at the 5' end and the last three nucleotides at the 3' end comprise 2'-fluoro (2'-F) modified nucleotides. In some embodiments, the first three nucleotides at the 5' end and the last three nucleotides at the 3' end comprise inverted abasic nucleotides.

[0362] In some embodiments, the guide RNA comprises a modified sgRNA. In some embodiments, the sgRNA comprises the modification pattern shown in SEQ ID NO: 3, where N is any natural or unnatural nucleotide, and the entirety of N comprises a guide sequence that directs a nuclease to a target sequence.

[0363] In some embodiments, the guide RNA comprises an sgRNA set forth in any one of SEQ ID NOs: 87 to 124. In some embodiments, the guide RNA comprises an sgRNA comprising any one of guide sequences set forth in SEQ ID NOs: 5 to 82 and the nucleotide of SEQ ID NO: 125, wherein the nucleotide of SEQ ID NO: 125 is at the 3' end of the guide sequence, and the guide sequence may be modified as set forth in SEQ ID NO: 3.

[0364] In some embodiments, the guide RNA comprises an sgRNA comprising a guide sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 and the nucleotide of SEQ ID NO: 125, wherein the nucleotide of SEQ ID NO: 125 is at the 3' end of the guide sequence, and the guide sequence may be modified as shown in SEQ ID NO: 3.

[0365] C. A nucleic acid comprising an open reading frame encoding an RNA-guided DNA binder A nucleic acid comprising an ORF encoding an RNA-guided DNA-binding agent (e.g., a Cas9 nuclease, such as S. pyogenes Cas9) disclosed herein may be combined with any of the compositions or methods employing any of the gRNAs disclosed herein. In any of the embodiments described herein, the nucleic acid comprising an open reading frame encoding the RNA-guided DNA-binding agent may be an mRNA.

[0366] 1. Low adenine content ORFs In some embodiments, an ORF encoding an RNA-guided DNA binder, e.g., a Cas9 nuclease such as S. pyogenes Cas9, has an adenine content ranging from its minimum adenine content to about 150% of its minimum adenine content. In some embodiments, the adenine content of the ORF is about 145% or less, 140% or less, 135% or less, 130% or less, 125% or less, 120% or less, 115% or less, 110% or less, 105% or less, 104% or less, 103% or less, 102% or less, or 101% or less of its minimum adenine content. In some embodiments, the ORF has an adenine content equal to its minimum adenine content. In some embodiments, the ORF has an adenine content about 150% or less of its minimum adenine content. In some embodiments, the ORF has an adenine content about 145% or less of its minimum adenine content. In some embodiments, an ORF has an adenine content of about 140% or less of its minimum adenine content. In some embodiments, an ORF has an adenine content of about 135% or less of its minimum adenine content. In some embodiments, an ORF has an adenine content of about 130% or less of its minimum adenine content. In some embodiments, an ORF has an adenine content of about 125% or less of its minimum adenine content. In some embodiments, an ORF has an adenine content of about 120% or less of its minimum adenine content. In some embodiments, an ORF has an adenine content of about 115% or less of its minimum adenine content. In some embodiments, an ORF has an adenine content of about 110% or less of its minimum adenine content. In some embodiments, an ORF has an adenine content of about 105% or less of its minimum adenine content. In some embodiments, an ORF has an adenine content of about 104% or less of its minimum adenine content. In some embodiments, an ORF has an adenine content of about 103% or less of its minimum adenine content. In some embodiments, an ORF has an adenine content of about 102% or less of its minimum adenine content.In some embodiments, an ORF has an adenine content of about 101% or less of its minimum adenine content.

[0367] In some embodiments, an ORF has an adenine dinucleotide content ranging from its minimum adenine dinucleotide content to 200% of its minimum adenine dinucleotide content. In some embodiments, the adenine dinucleotide content of an ORF is about 195% or less, 190% or less, 185% or less, 180% or less, 175% or less, 170% or less, 165% or less, 160% or less, 155% or less, 150% or less, 145% or less, 140% or less, 135% or less, 130% or less, 125% or less, 120% or less, 115% or less, 110% or less, 105% or less, 104% or less, 103% or less, 102% or less, or 101% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content equal to its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 200% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 195% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 190% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 185% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 180% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 175% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 170% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 165% or less of its minimum adenine dinucleotide content, hi some embodiments, an ORF has an adenine dinucleotide content of about 160% or less of its minimum adenine dinucleotide content.In some embodiments, an ORF has an adenine dinucleotide content of about 155% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content equal to its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 150% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 145% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 140% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 135% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 130% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 125% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 120% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 115% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 110% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 105% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 104% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 103% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 102% or less of its minimum adenine dinucleotide content.In some embodiments, an ORF has an adenine dinucleotide content of about 101% or less of its minimum adenine dinucleotide content.

[0368] In some embodiments, an ORF has an adenine dinucleotide content ranging from its minimum adenine dinucleotide content to an adenine dinucleotide content that is 90% or less of the maximum adenine dinucleotide content of a reference sequence that encodes the same protein as the mRNA in question. In some embodiments, the adenine dinucleotide content of an ORF is about 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, or 5% or less of the maximum adenine dinucleotide content of a reference sequence that encodes the same protein as the mRNA in question.

[0369] In some embodiments, ORFs have an adenine trinucleotide content ranging from 0 adenine trinucleotides to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, or 50 adenine trinucleotides (longer numbers of adenines count as the number of unique three-adenine segments therein, e.g., an adenine tetranucleotide contains two adenine trinucleotides, an adenine pentanucleotide contains three adenine trinucleotides, etc.). In some embodiments, an ORF has an adenine trinucleotide content ranging from 0% adenine trinucleotides to 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 1.5%, or 2% adenine trinucleotides, where percent adenine trinucleotide content is calculated as the percent of positions in the sequence occupied by adenines that form part of an adenine trinucleotide (or a longer number of adenines), such that the sequences UUUAAA and UUUUAAAA each have an adenine trinucleotide content of 50%. For example, in some embodiments, an ORF has an adenine trinucleotide content of 2% or less. For example, in some embodiments, an ORF has an adenine trinucleotide content of 1.5% or less. In some embodiments, an ORF has an adenine trinucleotide content of 1% or less. In some embodiments, an ORF has an adenine trinucleotide content of 0.9% or less. In some embodiments, the ORF has an adenine trinucleotide content of 0.8% or less. In some embodiments, the ORF has an adenine trinucleotide content of 0.7% or less. In some embodiments, the ORF has an adenine trinucleotide content of 0.6% or less. In some embodiments, the ORF has an adenine trinucleotide content of 0.5% or less. In some embodiments, the ORF has an adenine trinucleotide content of 0.4% or less. In some embodiments, the ORF has an adenine trinucleotide content of 0.3% or less.In some embodiments, the ORF has an adenine trinucleotide content of 0.2% or less. In some embodiments, the ORF has an adenine trinucleotide content of 0.1% or less. In some embodiments, a nucleic acid encoding an RNA-guided DNA binder is provided that comprises an ORF that does not contain adenine trinucleotides.

[0370] In some embodiments, an ORF has an adenine trinucleotide content ranging from its minimum adenine trinucleotide content to an adenine trinucleotide content that is 90% or less of the maximum adenine trinucleotide content of a reference sequence that encodes the same protein as the mRNA in question. In some embodiments, the adenine trinucleotide content of an ORF is about 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, or 5% or less of the maximum adenine trinucleotide content of a reference sequence that encodes the same protein as the mRNA in question.

[0371] For example, by using minimal adenine codons in a sufficient fraction of the ORF, a given ORF can have a reduced adenine content or adenine dinucleotide or adenine trinucleotide content. For example, the amino acid sequence of an RNA-guided DNA binder can be reverse-translated into an ORF sequence by converting amino acids to codons, with some or all of the ORF using the exemplary minimal adenine codons shown below. In some embodiments, at least about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, or about 100% of the codons in the ORF are codons listed in Table 4. [Table 4]

[0372] In some embodiments, nucleic acids encoding an RNA-guided DNA binder (e.g., a Cas9 nuclease, such as S. pyogenes Cas9) are provided, comprising an ORF consisting of a set of codons in which at least about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, or about 100% of the codons are codons listed in Table 4. In some embodiments, the ORF has minimal nucleotide homopolymers, e.g., repeated strings of the same nucleotide. For example, in some embodiments, when selecting a minimal uridine codon from the codons listed in Table 4, the nucleic acid is constructed by selecting minimal adenine codons that reduce the number and length of nucleotide homopolymers, e.g., selecting GCG instead of GCC for alanine, or selecting GGC instead of GGG for glycine.

[0373] In any of the foregoing embodiments, the nucleic acid may be mRNA.

[0374] 2. Codons that increase translation and / or correspond to highly expressed tRNAs, exemplary codon sets In some embodiments, the nucleic acid comprises an ORF with codons that increase translation in a mammal, such as a human. In further embodiments, the nucleic acid comprises an ORF with codons that increase translation in a mammalian (e.g., human) organ (e.g., liver). In further embodiments, the nucleic acid comprises an ORF with codons that increase translation in a mammalian (e.g., human) cell type (e.g., hepatocyte). The increase in translation in a mammal, cell type, mammalian organ, human, human organ, etc. can be determined relative to the extent of translation of the wild-type sequence of the ORF, or relative to an ORF with a codon distribution that matches the codon distribution of the organism from which the ORF is derived or the organism containing the most similar ORF at the amino acid level (e.g., S. pyogenes, S. aureus, or, in the case of a Cas nuclease derived from a prokaryote, another prokaryote, e.g., a Cas nuclease derived from another prokaryote described below). Alternatively, in some embodiments, the increase in translation of the Cas9 sequence in a mammal, cell type, mammalian organ, human, human organ, etc. is determined relative to the translation of an ORF having the sequence of SEQ ID NO: 205, all else being equal, including any applicable point mutations, heterologous domains, etc. Codons useful for increasing expression in humans, including human liver and human hepatocytes, may be codons corresponding to highly expressed tRNAs in human liver / hepatocytes, as described in Dittmar KA, PLos Genetics 2(12):e221 (2006). In some embodiments, at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in the ORF are codons corresponding to highly expressed tRNAs in a mammal, such as a human (e.g., the highest expressed tRNA for each amino acid). In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in the ORF are codons that correspond to highly expressed tRNAs (e.g., the highest expressed tRNAs for each amino acid) in a mammalian organ, such as a human organ.In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in the ORF are codons that correspond to highly expressed tRNAs (e.g., the highest expressed tRNA for each amino acid) in mammalian liver, such as human liver. In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in the ORF are codons that correspond to highly expressed tRNAs (e.g., the highest expressed tRNA for each amino acid) in mammalian liver cells, such as human hepatocytes.

[0375] Alternatively, codons corresponding to highly expressed tRNAs in an organism (eg, humans) may generally be used.

[0376] Any of the foregoing approaches to codon selection can be combined with the minimal adenine codon set forth above, for example, by starting with a codon in Table 4 and then, if more than one choice is available, using the codon that corresponds to the more highly expressed tRNA, either in the organism in general (e.g., human) or in the organ or cell type of interest, e.g., liver or hepatocyte (e.g., human liver or human hepatocyte).

[0377] In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in an ORF are from a codon set shown in Table 5 (e.g., a low-U, low-A, or low-A / U codon set). Codons in the low-A and low-A / U sets use codons that minimize the indicated nucleotides while also using codons corresponding to more highly expressed tRNAs when more than one option is available. In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in an ORF are from a low-U codon set shown in Table 5. In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in an ORF are from the low-A codon set shown in Table 5. In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in an ORF are from the low-A / U codon set shown in Table 5. [Table 5]

[0378] 3. Exemplary Sequences In some embodiments, the ORF encoding the RNA-guided DNA binder comprises a sequence having at least 93% identity to SEQ ID NO: 311, and / or the ORF has at least 93% identity to SEQ ID NO: 311 over at least its first 50, 200, 250, or 300 nucleotides, or at least 95% identity to SEQ ID NO: 311 over at least its first 30, 50, 70, 100, 150, 200, 250, or 300 nucleotides. and / or the ORF is comprised of a set of codons where at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% of the codons are codons listed in Table 4 or 5, and / or the ORF has an adenine content ranging from its minimum adenine content to 123% of its minimum adenine content, and / or the ORF has an adenine dinucleotide content ranging from its minimum adenine dinucleotide content to 150% of its minimum adenine dinucleotide content.

[0379] In some embodiments, the ORF encoding the RNA-guided DNA binder comprises a sequence having at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity to SEQ ID NO:377.

[0380] In some embodiments, the ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to any one of SEQ ID NOs: 311-313, 328, 329, 346-348, 355, 356, 363, or 364. In some embodiments, the mRNA comprises an ORF encoding an RNA-guided DNA binder, wherein the RNA-guided DNA binder comprises an amino acid sequence having at least 90% identity to any one of SEQ ID NOs: 203, 213, 268, or 386-396, and the ORF has an adenine content ranging from its minimum adenine content to 150% of its minimum adenine content and / or an adenine dinucleotide content ranging from its minimum adenine dinucleotide content to 150% of its minimum adenine dinucleotide content. In some embodiments, the encoded RNA-guided DNA binder comprises an amino acid sequence having at least 90% identity to any one of SEQ ID NOs: 203, 213, 268, or 386-396, and the ORF has a uridine content ranging from its minimum uridine content to 150% of its minimum uridine content and / or a uridine dinucleotide content ranging from its minimum uridine dinucleotide content to 150% of its minimum uridine dinucleotide content. In some such embodiments, both the adenine and uridine nucleotide content are less than or equal to 150% of their respective minimum values. In some embodiments, both the adenine and uridine dinucleotide content are less than or equal to 150% of their respective minimum values. In some embodiments, any of the foregoing identity levels is at least 95%, at least 98%, at least 99%, or 100%.

[0381] In some embodiments, an ORF encoding an RNA-guided DNA binder has at least 90% identity over at least its first 30, 50, 70, 100, 150, 200, 250, or 300 nucleotides to any one of SEQ ID NOs: 311-313, 328, 329, 346-348, 355, 356, 363, or 364, where the first 30, 50, 70, 100, 150, 200, 250, or 300 nucleotides are measured from the first nucleotide of the start codon (typically ATG), so that A is nucleotide 1, T is nucleotide 2, and so on. In some embodiments, an open reading frame has at least 90% identity over at least the first 10%, 12%, 15%, 20%, 25%, 30%, or 35% of its sequence to any one of SEQ ID NOs: 311-313, 328, 329, 346-348, 355, 356, 363, or 364. The length of the sequence of an ORF is the number of nucleotides from the beginning of the start codon to the end of the stop codon, with the first 10%, 12%, 15%, 20%, 25%, 30%, or 35% of the sequence corresponding to the number of nucleotides starting from the first nucleotide of the start codon that make up a given percentage of the total sequence length.

[0382] In some embodiments, the nucleic acid comprising an ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 243, wherein the ORF of SEQ ID NO: 243 (i.e., SEQ ID NO: 204) is replaced with the ORF of any one of SEQ ID NOs: 311-313, 328, 329, 346-348, 355, 356, 363, or 364.

[0383] In some embodiments, the nucleic acid comprising an ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 244, wherein the ORF of SEQ ID NO: 244 (i.e., SEQ ID NO: 204) is replaced with the ORF of any one of SEQ ID NOs: 311-313, 328, 329, 346-348, 355, 356, 363, or 364.

[0384] In some embodiments, the nucleic acid comprising an ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 256, wherein the ORF of SEQ ID NO: 256 (i.e., SEQ ID NO: 204) is replaced with the ORF of any one of SEQ ID NOs: 311-313, 328, 329, 346-348, 355, 356, 363, or 364.

[0385] In some embodiments, the nucleic acid comprising an ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 257, wherein the ORF of SEQ ID NO: 257 (i.e., SEQ ID NO: 204) is replaced with the ORF of any one of SEQ ID NOs: 311-313, 328, 329, 346-348, 355, 356, 363, or 364.

[0386] In some embodiments, the nucleic acid comprising an ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 258, wherein the ORF of SEQ ID NO: 258 (i.e., SEQ ID NO: 204) is replaced with the ORF of any one of SEQ ID NOs: 311-313, 328, 329, 346-348, 355, 356, 363, or 364.

[0387] In some embodiments, the nucleic acid comprising an ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 259, wherein the ORF of SEQ ID NO: 259 (i.e., SEQ ID NO: 204) is replaced with the ORF of any one of SEQ ID NOs: 311-313, 328, 329, 346-348, 355, 356, 363, or 364.

[0388] In some embodiments, the nucleic acid comprising an ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 260, wherein the ORF of SEQ ID NO: 260 (i.e., SEQ ID NO: 204) is replaced with the ORF of any one of SEQ ID NOs: 311-313, 328, 329, 346-348, 355, 356, 363, or 364.

[0389] In some embodiments, the nucleic acid comprising an ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 261, wherein the ORF of SEQ ID NO: 261 (i.e., SEQ ID NO: 204) is replaced with the ORF of any one of SEQ ID NOs: 311-313, 328, 329, 346-348, 355, 356, 363, or 364.

[0390] In some embodiments, the nucleic acid comprising an ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 376, optionally wherein the ORF of SEQ ID NO: 376 is replaced with an alternative ORF of any one of SEQ ID NOs: 311-313, 328, 329, 346-348, 355, 356, 363, or 364.

[0391] In some embodiments, the nucleic acid comprising an ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 377, optionally wherein the ORF of SEQ ID NO: 377 is replaced with an alternative ORF of any one of SEQ ID NOs: 311-313, 328, 329, 346-348, 355, 356, 363, or 364.

[0392] In some embodiments, the nucleic acid comprising an ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 378, optionally wherein the ORF of SEQ ID NO: 378 is replaced with an alternative ORF of any one of SEQ ID NOs: 311-313, 328, 329, 346-348, 355, 356, 363, or 364.

[0393] In some embodiments, the nucleic acid comprising an ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 379, wherein the ORF of SEQ ID NO: 379 is replaced with the ORF of any one of SEQ ID NOs: 311-313, 328, 329, 346-348, 355, 356, 363, or 364.

[0394] In some embodiments, the nucleic acid comprising an ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 380, wherein the ORF of SEQ ID NO: 380 is replaced with the ORF of any one of SEQ ID NOs: 311-313, 328, 329, 346-348, 355, 356, 363, or 364.

[0395] In some embodiments, the nucleic acid comprising an ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 381, wherein the ORF of SEQ ID NO: 381 is replaced with the ORF of any one of SEQ ID NOs: 311-313, 328, 329, 346-348, 355, 356, 363, or 364.

[0396] In some embodiments, the nucleic acid comprising an ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 382, ​​wherein the ORF of SEQ ID NO: 382 is replaced with the ORF of any one of SEQ ID NOs: 311-313, 328, 329, 346-348, 355, 356, 363, or 364.

[0397] In some embodiments, the nucleic acid comprising an ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 383, wherein the ORF of SEQ ID NO: 383 is replaced with the ORF of any one of SEQ ID NOs: 311-313, 328, 329, 346-348, 355, 356, 363, or 364.

[0398] In some embodiments, the nucleic acid comprising an ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 384, wherein the ORF of SEQ ID NO: 384 is replaced with the ORF of any one of SEQ ID NOs: 311-313, 328, 329, 346-348, 355, 356, 363, or 364.

[0399] In some embodiments, the nucleic acid comprising an ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 385, wherein the ORF of SEQ ID NO: 385 is replaced with the ORF of any one of SEQ ID NOs: 311-313, 328, 329, 346-348, 355, 356, 363, or 364.

[0400] In some embodiments, the degree of identity to an optionally substituted sequence of SEQ ID NO: 243, 244, 256-261, or 376-385 is at least 95%. In some embodiments, the degree of identity to an optionally substituted sequence of SEQ ID NO: 243, 244, 256-261, or 376-385 is at least 98%. In some embodiments, the degree of identity to an optionally substituted sequence of SEQ ID NO: 243, 244, 256-261, or 176-385 is at least 99%. In some embodiments, the degree of identity to an optionally substituted sequence of SEQ ID NO: 243, 244, 256-261, or 376-385 is 100%.

[0401] 4. Additional Characteristics of Nucleic Acids, mRNAs, and ORFs Any of the additional features described herein may be combined with any of the above-described embodiments to the extent feasible.

[0402] a) Low uridine content In some embodiments, an ORF encoding an RNA-guided DNA binder (e.g., a Cas9 nuclease such as S. pyogenes Cas9) has a uridine content ranging from its minimum uridine content to about 150% of its minimum uridine content. In some embodiments, the uridine content of the ORF is about 145% or less, 140% or less, 135% or less, 130% or less, 125% or less, 120% or less, 115% or less, 110% or less, 105% or less, 104% or less, 103% or less, 102% or less, or 101% or less of its minimum uridine content. In some embodiments, the ORF has a uridine content equal to its minimum uridine content. In some embodiments, the ORF has a uridine content of about 150% or less of its minimum uridine content. In some embodiments, the ORF has a uridine content of about 145% or less of its minimum uridine content. In some embodiments, an ORF has a uridine content of about 140% or less of its minimum uridine content. In some embodiments, an ORF has a uridine content of about 135% or less of its minimum uridine content. In some embodiments, an ORF has a uridine content of about 130% or less of its minimum uridine content. In some embodiments, an ORF has a uridine content of about 125% or less of its minimum uridine content. In some embodiments, an ORF has a uridine content of about 120% or less of its minimum uridine content. In some embodiments, an ORF has a uridine content of about 115% or less of its minimum uridine content. In some embodiments, an ORF has a uridine content of about 110% or less of its minimum uridine content. In some embodiments, an ORF has a uridine content of about 105% or less of its minimum uridine content. In some embodiments, an ORF has a uridine content of about 104% or less of its minimum uridine content. In some embodiments, the ORF has a uridine content of about 103% or less of its minimum uridine content, hi some embodiments, the ORF has a uridine content of about 102% or less of its minimum uridine content.In some embodiments, an ORF has a uridine content of about 101% or less of its minimum uridine content.

[0403] In some embodiments, an ORF has a uridine dinucleotide content ranging from its minimum uridine dinucleotide content to 200% of its minimum uridine dinucleotide content. In some embodiments, the uridine dinucleotide content of an ORF is about 195% or less, 190% or less, 185% or less, 180% or less, 175% or less, 170% or less, 165% or less, 160% or less, 155% or less, 150% or less, 145% or less, 140% or less, 135% or less, 130% or less, 125% or less, 120% or less, 115% or less, 110% or less, 105% or less, 104% or less, 103% or less, 102% or less, or 101% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content equal to its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 200% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 195% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 190% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 185% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 180% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 175% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 170% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 165% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 160% or less of its minimum uridine dinucleotide content.In some embodiments, an ORF has a uridine dinucleotide content of about 155% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content equal to its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 150% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 145% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 140% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 135% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 130% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 125% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 120% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 115% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 110% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 105% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 104% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 103% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 102% or less of its minimum uridine dinucleotide content.In some embodiments, an ORF has a uridine dinucleotide content of about 101% or less of its minimum uridine dinucleotide content.

[0404] In some embodiments, an ORF has a uridine dinucleotide content ranging from its minimum uridine dinucleotide content to a uridine dinucleotide content that is 90% or less of the maximum uridine dinucleotide content of a reference sequence encoding the same protein as the mRNA in question. In some embodiments, the uridine dinucleotide content of an ORF is about 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, or 5% or less of the maximum uridine dinucleotide content of a reference sequence encoding the same protein as the mRNA in question.

[0405] In some embodiments, the ORF has a uridine trinucleotide content ranging from 0 uridine trinucleotides to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, or 50 uridine trinucleotides (longer numbers of uridines count as the number of unique three-uridine segments therein, e.g., a uridine tetranucleotide contains two uridine trinucleotides, a uridine pentanucleotide contains three uridine trinucleotides, etc.). In some embodiments, an ORF has a uridine trinucleotide content ranging from 0% uridine trinucleotides to 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 1.5%, or 2% uridine trinucleotides, where the percent uridine trinucleotide content is calculated as the percent of positions in the sequence occupied by uridines that form part of a uridine trinucleotide (or a longer number of uridines), such that the sequences UUUAAA and UUUUAAAA each have a uridine trinucleotide content of 50%. For example, in some embodiments, an ORF has a uridine trinucleotide content of 2% or less. For example, in some embodiments, an ORF has a uridine trinucleotide content of 1.5% or less. In some embodiments, an ORF has a uridine trinucleotide content of 1% or less. In some embodiments, an ORF has a uridine trinucleotide content of 0.9% or less. In some embodiments, the ORF has a uridine trinucleotide content of 0.8% or less. In some embodiments, the ORF has a uridine trinucleotide content of 0.7% or less. In some embodiments, the ORF has a uridine trinucleotide content of 0.6% or less. In some embodiments, the ORF has a uridine trinucleotide content of 0.5% or less. In some embodiments, the ORF has a uridine trinucleotide content of 0.4% or less. In some embodiments, the ORF has a uridine trinucleotide content of 0.3% or less.In some embodiments, the ORF has a uridine trinucleotide content of 0.2% or less. In some embodiments, the ORF has a uridine trinucleotide content of 0.1% or less. In some embodiments, the ORF has no uridine trinucleotides.

[0406] In some embodiments, an ORF has a uridine trinucleotide content ranging from its minimum uridine trinucleotide content to a uridine trinucleotide content that is 90% or less of the maximum uridine trinucleotide content of a reference sequence encoding the same protein as the mRNA in question. In some embodiments, the uridine trinucleotide content of an ORF is about 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, or 5% or less of the maximum uridine trinucleotide content of a reference sequence encoding the same protein as the mRNA in question.

[0407] For example, by using minimal uridine codons in a sufficient fraction of the ORF, a given ORF can have a reduced uridine content, or a uridine dinucleotide content, or a uridine trinucleotide content. For example, the amino acid sequence of an RNA-guided DNA binder can be reverse-translated into an ORF sequence by converting amino acids to codons, with some or all of the ORF using the exemplary minimal uridine codons shown below. In some embodiments, at least about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, or about 100% of the codons in the ORF are codons listed in Table 6. [Table 6]

[0408] In some embodiments, the ORF consists of a set of codons where at least about 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons are codons listed in Table 6.

[0409] b) Low adenine and uridine content To the extent practicable, any of the features described herein with respect to low adenine content can be combined with any of the features described herein with respect to low uridine content, for example, a uridine content ranging from its minimum uridine content to about 150% of its minimum uridine content (e.g., the uridine content of the ORF is about 145% or less, 140% or less, 135% or less, 130% or less, 125% or less, 120% or less, 115% or less, 110% or less, 105% or less, 104% or less, 103% or less, 102% or less, or 101% or less of its minimum uridine content), and an adenine content Nucleic acids (e.g., mRNA) encoding RNA-guided DNA binders (e.g., Cas9 nucleases, such as S. pyogenes Cas9) can be provided that include an ORF that has a minimum adenine content ranging from about 150% of the minimum adenine content (e.g., about 145% or less, 140% or less, 135% or less, 130% or less, 125% or less, 120% or less, 115% or less, 110% or less, 105% or less, 104% or less, 103% or less, 102% or less, or 101% or less of the minimum adenine content). The same applies to uridine and adenine dinucleotides. Similarly, the content of uridine nucleotides and adenine dinucleotides in the ORF can be as described above. Similarly, the content of uridine dinucleotides and adenine nucleotides in the ORF can be as described above.

[0410] For example, by using minimal uridine and adenine codons in a sufficient fraction of the ORF, a given ORF can have a reduced uridine and adenine nucleotide and / or dinucleotide content. For example, the amino acid sequence of an RNA-guided DNA binder can be reverse-translated into an ORF sequence by converting amino acids to codons, with some or all of the ORF using the exemplary minimal uridine and adenine codons shown below. In some embodiments, at least about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, or about 100% of the codons in the ORF are those listed in Table 7. [Table 7]

[0411] In some embodiments, the ORF is comprised of a set of codons in which at least about 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons are codons listed in Table 7. As can be seen from Table 7, each of the three serine codons listed contains either one A or one U. In some embodiments, uridine minimization is preferred by using the AGC codon for serine. In some embodiments, adenine minimization is preferred by using the UCC and / or UCG codons for serine.

[0412] c) an encoded RNA-guided DNA binder In some embodiments, the RNA-guided DNA binding agent is a class 2 Cas nuclease. In some embodiments, the RNA-guided DNA binding agent has cleavage activity, which may also be referred to as double-stranded endonuclease activity. In some embodiments, the RNA-guided DNA binding agent comprises a Cas nuclease, e.g., a class 2 Cas nuclease (e.g., a type II, type V, or type VI Cas nuclease). Class 2 Cas nucleases include, for example, Cas9, Cpf1, C2c1, C2c2, and C2c3 proteins, and modifications thereof. Examples of Cas9 nucleases include those in type II CRISPR systems of S. pyogenes, S. aureus, and other prokaryotes (see, e.g., the list in the next paragraph), as well as modified (e.g., engineered or mutant) versions thereof. See, e.g., US2016 / 0312198(A1), US2016 / 0312199(A1). Other examples of Cas nucleases include the Csm or Cmr complex of a type III CRISPR system, or the Cas10, Csm1, or Cmr2 subunit thereof, and the Cascade complex of a type I CRISPR system, or the Cas3 subunit thereof. In some embodiments, the Cas nuclease may be derived from a type IIA, type IIB, or type IIC system. For a discussion of various CRISPR systems and Cas nucleases, see, for example, Makarova et al., Nat. Rev. Microbiol. 9:467-477 (2011); Makarova et al., Nat. Rev. Microbiol, 13:722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015). In some embodiments, the RNA-guided DNA-binding agent is a Cas cleavase, such as a Cas9 cleavase. In some embodiments, the RNA-guided DNA binding agent is a Cas nickase, e.g., a Cas9 nickase. In some embodiments, the RNA-guided DNA binding agent is a S. pyogenes Cas9 nuclease, e.g., a cleavase.

[0413] Non-limiting exemplary species from which Cas nucleases can be derived include Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Listeria innocua, Lactobacillus gasseri, Francisella novicida, Wolinella succinogenes, Sutterella wadsworthensis, Gammaproteobacterium, Neisseria meningitidis, Campylobacter jejuni, Pasteurella multocida, Fibrobacter succinogene, Rhodospirillum rubrum, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Lactobacillus buchneri, Treponema denticola, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp.、Crocosphaera watsonii、Cyanothece sp.、Microcystis aeruginosa、Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohlobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Streptococcus pasteurianus, Neisseria cinerea, Campylobacter lari, Parvibaculum lavamentivorans, Corynebacterium diphtheria, Acidaminococcus sp., Lachnospiraceae bacterium ND2006, and Acaryochloris marina are included.

[0414] In some embodiments, the Cas nuclease is a Cas9 nuclease from Streptococcus pyogenes. In some embodiments, the Cas nuclease is a Cas9 nuclease from Streptococcus thermophilus. In some embodiments, the Cas nuclease is a Cas9 nuclease from Neisseria meningitidis. In some embodiments, the Cas nuclease is a Cas9 nuclease from Staphylococcus aureus. In some embodiments, the Cas nuclease is a Cpf1 nuclease from Francisella novicida. In some embodiments, the Cas nuclease is a Cpf1 nuclease from Acidaminococcus sp.. In some embodiments, the Cas nuclease is a Cpf1 nuclease from Lachnospiraceae bacterium ND2006. In further embodiments, the Cas nuclease is a Cpf1 nuclease from Francisella tularensis, Lachnospiraceae bacterium, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium, Parcubacteria bacterium, Smithella, Acidaminococcus, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi, Leptospira inadai, Porphyromonas crevioricanis, Prevotella disiens, or Porphyromonas macacae. In certain embodiments, the Cas nuclease is a Cpf1 nuclease from Acidaminococcus or Lachnospiraceae.

[0415] Wild-type Cas9 has two nuclease domains, RuvC and HNH. The RuvC domain cleaves the non-target DNA strand, and the HNH domain cleaves the target strand of DNA. In some embodiments, the Cas9 nuclease contains more than one RuvC domain and / or more than one HNH domain. In some embodiments, the Cas9 nuclease is wild-type Cas9. In some embodiments, the Cas9 is capable of inducing a double-stranded break in the target DNA. In certain embodiments, the Cas nuclease may cleave dsDNA, cleave one strand of dsDNA, or may not have DNA cleavase or nickase activity. An exemplary Cas9 amino acid sequence is provided as SEQ ID NO:203. An exemplary Cas9 mRNA ORF sequence, including start and stop codons, is provided as SEQ ID NO:311. An exemplary Cas9 mRNA coding sequence suitable for inclusion in a fusion protein is provided as SEQ ID NO:346.

[0416] In some embodiments, chimeric Cas nucleases are used, in which one domain or region of a protein is replaced with a portion of a different protein. In some embodiments, the Cas nuclease domain may be replaced with a domain from a different nuclease, such as Fok1. In some embodiments, the Cas nuclease may be a modified nuclease.

[0417] In other embodiments, the Cas nuclease may be derived from a type I CRISPR / Cas system. In some embodiments, the Cas nuclease may be a component of a cascade complex of a type I CRISPR / Cas system. In some embodiments, the Cas nuclease may be a Cas3 protein. In some embodiments, the Cas nuclease may be derived from a type III CRISPR / Cas system. In some embodiments, the Cas nuclease may have RNA cleavage activity.

[0418] d) Heterologous functional domains, nuclear localization signals In some embodiments, the RNA-guided DNA-binding agent (e.g., a Cas9 nuclease such as S. pyogenes Cas9) comprises one or more heterologous functional domains (e.g., is or comprises a fusion polypeptide).

[0419] In some embodiments, the heterologous functional domain can facilitate transport of the RNA-guided DNA binding agent (e.g., a Cas9 nuclease, such as S. pyogenes Cas9) to the cell nucleus. For example, the heterologous functional domain can be a nuclear localization signal (NLS). In some embodiments, the RNA-guided DNA binding agent can be fused with 1 to 10 NLSs. In some embodiments, the RNA-guided DNA binding agent can be fused with 1 to 5 NLSs. In some embodiments, the RNA-guided DNA binding agent can be fused with one NLS. When one NLS is used, the NLS can be linked at the N-terminal or C-terminal end of the sequence of the RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent can be fused C-terminal to at least one NLS. An NLS can also be inserted within the sequence of the RNA-guided DNA binding agent. In other embodiments, the RNA-guided DNA binding agent can be fused with more than one NLS. In some embodiments, the RNA-guided DNA binding agent can be fused with 2, 3, 4, or 5 NLSs. In some embodiments, the RNA-guided DNA binding agent can be fused with two NLSs. In certain circumstances, the two NLSs may be the same (e.g., two SV40 NLSs) or different. In some embodiments, the RNA-guided DNA binding agent is fused to a sequence of two SV40 NLSs linked at their carboxy-terminal ends. In some embodiments, the RNA-guided DNA binding agent may be fused with two NLSs, one linked at the N-terminal end and one linked at the C-terminal end. In some embodiments, the RNA-guided DNA binding agent may be fused with three NLSs. In some embodiments, the RNA-guided DNA binding agent may be fused without an NLS. In some embodiments, the NLS may be a monokaryotic sequence, such as the SV40 NLS, PKKKRKV (SEQ ID NO: 278) or PKKKRRV (SEQ ID NO: 290). In some embodiments, the NLS may be a bikaryotic sequence, such as the nucleoplasmin NLS, KRPAATKKAGQAKKKK (SEQ ID NO: 291).In some embodiments, the NLS sequence may comprise LAAKRSRTT (SEQ ID NO: 279), QAAKRSRTT (SEQ ID NO: 280), PAPAKRERTT (SEQ ID NO: 281), QAAKRPRTT (SEQ ID NO: 282), RAAKRPRTT (SEQ ID NO: 283), AAAKRSWSMAA (SEQ ID NO: 284), AAAKRVWSMAF (SEQ ID NO: 285), AAAKRSWSMAF (SEQ ID NO: 286), AAAKRKYFAA (SEQ ID NO: 287), RAAKRKAFAA (SEQ ID NO: 288), or RAAKRKYFAV (SEQ ID NO: 289). In certain embodiments, a single PKKKRKV (SEQ ID NO: 278) NLS may be linked at the C-terminal end of the RNA-guided DNA binder. One or more linkers are optionally included in the fusion site. In some embodiments, one or more NLSs of any of the foregoing embodiments are present in the RNA-guided DNA binder in combination with one or more additional heterologous functional domains, such as any of the heterologous functional domains described below. Coding sequences for exemplary NLSs are provided as SEQ ID NOs: 292-304.

[0420] In some embodiments, the heterologous functional domain can alter the intracellular half-life of the RNA-guided DNA binding agent (e.g., a Cas9 nuclease such as S. pyogenes Cas9). In some embodiments, the half-life of the RNA-guided DNA binding agent can be increased. In some embodiments, the half-life of the RNA-guided DNA binding agent can be decreased. In some embodiments, the heterologous functional domain can increase the stability of the RNA-guided DNA binding agent. In some embodiments, the heterologous functional domain can decrease the stability of the RNA-guided DNA binding agent. In some embodiments, the heterologous functional domain can function as a signal peptide for protein degradation. In some embodiments, the protein degradation can be mediated by proteolytic enzymes such as, for example, proteasomes, lysosomal proteases, or calpain proteases. In some embodiments, the heterologous functional domain can comprise a PEST sequence. In some embodiments, the RNA-guided DNA binding agent can be modified by the addition of ubiquitin or polyubiquitin chains. In some embodiments, the ubiquitin can be a ubiquitin-like protein (UBL). Non-limiting examples of ubiquitin-like proteins include small ubiquitin-like modifier (SUMO), ubiquitin cross-reactive protein (UCRP, also known as interferon-stimulated gene-15 (ISG15)), ubiquitin-related modifier-1 (URM1), neural progenitor cell-expressed developmentally downregulated protein-8 (NEDD8, also called Rub1 in S. cerevisiae), human leukocyte antigen F-related (FAT10), autophagy-8 (ATG8) and -12 (ATG12), Fau ubiquitin-like protein (FUB1), membrane-anchored UBL (MUB), ubiquitin-fold modifier-1 (UFM1), and ubiquitin-like protein-5 (UBL5).

[0421] In some embodiments, the heterologous functional domain may be a marker domain. Non-limiting examples of marker domains include fluorescent proteins, purification tags, epitope tags, and reporter gene sequences. In some embodiments, the marker domain may be a fluorescent protein. Non-limiting examples of suitable fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, sfGFP, EGFP, Emerald, Azami Green, Monomeric Azami). Green, CopGFP, AceGFP, ZsGreen1), yellow fluorescent proteins (e.g., YFP, EYFP, Citrine, Venus, YPet, PhiYFP, ZsYellow1), blue fluorescent proteins (e.g., EBFP, EBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-sapphire), cyan fluorescent proteins (e.g., ECFP, Cerulean, CyPet, AmCyan1, Midoriishi-Cyan), red fluorescent proteins (e.g., mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRed1, AsRed2, eqFP611, mRasberry, mStrawberry, Jred), and orange fluorescent proteins (mOrange, mKO, Kusabira-Orange, Monomeric In other embodiments, the marker domain may be a purification tag and / or an epitope tag.Non-limiting exemplary tags include glutathione-S-transferase (GST), chitin-binding protein (CBP), maltose-binding protein (MBP), thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, HA, nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, 6xHis, 8xHis, biotin carboxyl carrier protein (BCCP), poly-His, and calmodulin. Non-limiting exemplary reporter genes include glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), β-galactosidase, β-glucuronidase, luciferase, or fluorescent protein.

[0422] In additional embodiments, the heterologous functional domain may target the RNA-guided DNA binding agent (e.g., a Cas9 nuclease, such as S. pyogenes Cas9) to a specific organelle, cell type, tissue, or organ. In some embodiments, the heterologous functional domain may target the RNA-guided DNA binding agent to mitochondria.

[0423] In further embodiments, the heterologous functional domain may be an effector domain. When an RNA-guided DNA binding agent is directed to its target sequence, for example, when a Cas nuclease is directed to the target sequence by a gRNA, the effector domain can modify or affect the target sequence. In some embodiments, the effector domain can be selected from a nucleic acid binding domain, a nuclease domain (e.g., a non-Cas nuclease domain), an epigenetic modification domain, a transcription activation domain, or a transcription repression domain. In some embodiments, the heterologous functional domain is a nuclease, such as a FokI nuclease. See, for example, U.S. Patent No. 9,023,649. In some embodiments, the heterologous functional domain is a transcription activator or a transcription repressor. See, for example, Qi et al., "Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression," Cell 152:1173-83 (2013); Perez-Pinera et al., "RNA-guided gene activation by CRISPR-Cas9-based transcription factors," Nat. Methods 10:973-6 (2013); Mali et al., "CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering," Nat. Biotechnol. 31:833-8 (2013); Gilbert et al., "CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes," Cell 154:442-51 (2013). Thus, RNA-guided DNA binders essentially become transcription factors that can be directed to bind to desired target sequences using guide RNAs.In certain embodiments, the DNA modifying domain is a methylation domain, such as a demethylation domain or a methyltransferase domain.In certain embodiments, the effector domain is a DNA modifying domain, such as a base editing domain.In certain embodiments, the DNA modifying domain is a nucleic acid editing domain that introduces specific modifications into DNA, such as a deaminase domain.For example, see WO2015 / 089406, US 2016 / 0304846.The nucleic acid editing domain, deaminase domain and Cas9 variants described in WO2015 / 089406 and US2016 / 0304846 are incorporated herein by reference.

[0424] e) UTR, Kozak sequence In some embodiments, the polynucleotide (e.g., mRNA) comprises a 5' UTR, a 3' UTR, or a 5' UTR and a 3' UTR. In some embodiments, the polynucleotide (e.g., mRNA) comprises at least one UTR from hydroxysteroid 17-beta dehydrogenase 4 (HSD17B4 or HSD), e.g., a 5' UTR from an HSD. In some embodiments, the polynucleotide (e.g., mRNA) comprises at least one UTR from a globin mRNA, e.g., human alpha globin (HBA) mRNA, human beta globin (HBB) mRNA, or Xenopus laevis beta globin (XBG) mRNA. In some embodiments, the polynucleotide (e.g., mRNA) comprises a 5' UTR, a 3' UTR, or a 5' and a 3' UTR from a globin mRNA, e.g., HBA, HBB, or XBG. In some embodiments, the polynucleotide (e.g., mRNA) comprises a 5' UTR from bovine growth hormone, cytomegalovirus (CMV), mouse Hba-a1, HSD, albumin gene, HBA, HBB, or XBG. In some embodiments, the polynucleotide (e.g., mRNA) comprises a 3' UTR from bovine growth hormone, cytomegalovirus, mouse Hba-a1, HSD, albumin gene, HBA, HBB, or XBG. In some embodiments, the polynucleotide (e.g., mRNA) comprises 5' and 3' UTRs from bovine growth hormone, cytomegalovirus, mouse Hba-a1, HSD, albumin gene, HBA, HBB, XBG, heat shock protein 90 (Hsp90), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), beta-actin, alpha-tubulin, tumor protein (p53), or epidermal growth factor receptor (EGFR).

[0425] In some embodiments, the polynucleotide (e.g., mRNA) comprises 5' and 3' UTRs from the same source, e.g., a constitutively expressed mRNA such as actin, albumin, or a globin such as HBA, HBB, or XBG.

[0426] In some embodiments, the nucleic acids disclosed herein comprise a 5' UTR having at least 90% identity to any one of SEQ ID NOs: 232, 234, 236, 238, 241, or 275-277. In some embodiments, the nucleic acids disclosed herein comprise a 3' UTR having at least 90% identity to any one of SEQ ID NOs: 233, 235, 237, 239, or 240. In some embodiments, any of the foregoing levels of identity is at least 95%, at least 98%, at least 99%, or 100%. In some embodiments, the nucleic acids disclosed herein comprise a 5' UTR having the sequence of any one of SEQ ID NOs: 232, 234, 236, 238, or 241. In some embodiments, the nucleic acids disclosed herein comprise a 3' UTR having the sequence of any one of SEQ ID NOs: 233, 235, 237, 239, or 240.

[0427] In some embodiments, the polynucleotide (e.g., mRNA) does not include a 5' UTR, e.g., no additional nucleotides between the 5' cap and the start codon. In some embodiments, the polynucleotide (e.g., mRNA) includes a Kozak sequence (described below) between the 5' cap and the start codon, but does not have any additional 5' UTR. In some embodiments, the polynucleotide (e.g., mRNA) does not include a 3' UTR, e.g., no additional nucleotides between the stop codon and the polyA tail.

[0428] In some embodiments, a polynucleotide (e.g., mRNA) contains a Kozak sequence. Kozak sequences can affect translation initiation and overall yield of a polypeptide translated from a nucleic acid. Kozak sequences include a methionine codon that can function as an initiation codon. A minimal Kozak sequence is NNNRUGN, where at least one of the following is true: the first N is A or G and the second N is G. In the context of a nucleotide sequence, R denotes a purine (A or G). In some embodiments, the Kozak sequence is RNNRUGN, NNNRUGG, RNNRUGG, RNNAUGN, NNNAUGG, or RNNAUGG. In some embodiments, the Kozak sequence is rccRUGg with zero, one, or up to two mismatches relative to the lowercase positions. In some embodiments, the Kozak sequence is rccAUGg with zero, one, or up to two mismatches relative to the lowercase positions. In some embodiments, the Kozak sequence is gccRccAUGG (nucleotides 4-13 of SEQ ID NO: 305) with zero, one, two, or up to three mismatches relative to the lowercase positions. In some embodiments, the Kozak sequence is gccAccAUG with zero, one, two, three, or up to four mismatches relative to the lowercase positions. In some embodiments, the Kozak sequence is GCCACCAUG. In some embodiments, the Kozak sequence is gccgccRccAUGG (SEQ ID NO: 305) with zero, one, two, three, or up to four mismatches relative to the lowercase positions.

[0429] f) PolyA tail In some embodiments, a polynucleotide (e.g., mRNA) further comprises a polyadenylation (polyA) tail. In some cases, the polyA tail is "interrupted" with one or more non-adenine nucleotide "anchors" at one or more positions within the polyA tail. The polyA tail can comprise at least eight consecutive adenine nucleotides, but can also comprise one or more non-adenine nucleotides. As used herein, "non-adenine nucleotide" refers to any natural or non-natural nucleotide that does not contain adenine. Guanine, thymine, and cytosine nucleotides are exemplary non-adenine nucleotides. Thus, a polyA tail on a polynucleotide (e.g., mRNA) described herein can comprise consecutive adenine nucleotides located 3' to the nucleotides encoding the RNA-guided DNA-binding agent or sequence of interest. In some cases, the polyA tail on an mRNA comprises non-consecutive adenine nucleotides located 3' to the nucleotides encoding the RNA-guided DNA-binding agent or sequence of interest, with the non-adenine nucleotides interrupting the adenine nucleotides at regular or irregular intervals.

[0430] In some embodiments, the polyA tail is encoded by a plasmid used for in vitro transcription of mRNA and becomes part of the transcription product. The polyA sequence encoded by the plasmid, i.e., the number of consecutive adenine nucleotides in the polyA sequence, may not be precise; for example, 100 polyA sequences in the plasmid may not result in exactly 100 polyA sequences in the transcribed mRNA. In some embodiments, the polyA tail is not encoded by the plasmid but is added by PCR tailing or enzymatic tailing, for example, using E. coli poly(A) polymerase.

[0431] In some embodiments, one or more non-adenine nucleotides are positioned to interrupt consecutive adenine nucleotides so that poly(A) binding proteins can bind to the series of consecutive adenine nucleotides. In some embodiments, one or more non-adenine nucleotides are positioned after at least 8, 9, 10, 11, or 12 consecutive adenine nucleotides. In some embodiments, one or more non-adenine nucleotides are positioned after at least 8-50 consecutive adenine nucleotides. In some embodiments, one or more non-adenine nucleotides are positioned after at least 8-100 consecutive adenine nucleotides. In some embodiments, the non-adenine nucleotide is positioned after 1, 2, 3, 4, 5, 6, or 7 adenine nucleotides, followed by at least 8 consecutive adenine nucleotides.

[0432] A poly-A tail of the present disclosure may comprise a sequence of consecutive adenine nucleotides followed by one or more non-adenine nucleotides, and optionally, additional adenine nucleotides.

[0433] In some embodiments, the poly-A tail comprises or contains one non-adenine nucleotide or a contiguous stretch of 2-10 non-adenine nucleotides. In some embodiments, the non-adenine nucleotide is preceded by at least 8, 9, 10, 11, or 12 contiguous adenine nucleotides. Optionally, the one or more non-adenine nucleotides are preceded by at least 8-50 contiguous adenine nucleotides. In some embodiments, the one or more non-adenine nucleotides are positioned after at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 consecutive adenine nucleotides.

[0434] In some embodiments, the non-adenine nucleotides are guanine, cytosine, or thymine. Optionally, the non-adenine nucleotides are guanine nucleotides. In some embodiments, the non-adenine nucleotides are cytosine nucleotides. In some embodiments, the non-adenine nucleotides are thymine nucleotides. Optionally, when more than one non-adenine nucleotide is present, the non-adenine nucleotides may be selected from a) guanine and thymine nucleotides, b) guanine and cytosine nucleotides, c) thymine and cytosine nucleotides, or d) guanine, thymine, and cytosine nucleotides. An exemplary poly-A tail comprising non-adenine nucleotides is provided as SEQ ID NO: 262.

[0435] g) Modified Nucleotides In some embodiments, a nucleic acid comprising an ORF encoding an RNA-guided DNA binder comprises modified uridines at some or all uridine positions. In some embodiments, the modified uridine is a uridine modified at the 5-position, e.g., with a halogen or a C1-C3 alkoxy. In some embodiments, the modified uridine is a pseudouridine modified at the 1-position, e.g., with a C1-C3 alkoxy. The modified uridine can be, for example, pseudouridine, N1-methyl-pseudouridine, 5-methoxyuridine, 5-iodouridine, or a combination thereof. In some embodiments, the modified uridine is 5-methoxyuridine. In some embodiments, the modified uridine is 5-iodouridine. In some embodiments, the modified uridine is pseudouridine. In some embodiments, the modified uridine is N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-methoxyuridine. In some embodiments, the modified uridine is a combination of N1-methylpseudouridine and 5-methoxyuridine. In some embodiments, the modified uridine is a combination of 5-iodouridine and N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-iodouridine. In some embodiments, the modified uridine is a combination of 5-iodouridine and 5-methoxyuridine.

[0436] In some embodiments, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the uridine positions in a nucleic acid are modified uridines. In some embodiments, 10% to 25%, 15% to 25%, 25% to 35%, 35% to 45%, 45% to 55%, 55% to 65%, 65% to 75%, 75% to 85%, 85% to 95%, or 90% to 100% of the uridine positions in a nucleic acid are modified uridines, such as 5-methoxyuridine, 5-iodouridine, N1-methylpseudouridine, pseudouridine, or a combination thereof. In some embodiments, 10% to 25%, 15% to 25%, 25% to 35%, 35% to 45%, 45% to 55%, 55% to 65%, 65% to 75%, 75% to 85%, 85% to 95%, or 90% to 100% of the uridine positions in the nucleic acid are 5-methoxyuridine, hi some embodiments, 10% to 25%, 15% to 25%, 25% to 35%, 35% to 45%, 45% to 55%, 55% to 65%, 65% to 75%, 75% to 85%, 85% to 95%, or 90% to 100% of the uridine positions in the nucleic acid are pseudouridine. In some embodiments, 10% to 25%, 15% to 25%, 25% to 35%, 35% to 45%, 45% to 55%, 55% to 65%, 65% to 75%, 75% to 85%, 85% to 95%, or 90% to 100% of the uridine positions in the nucleic acid are N1-methylpseudouridine. In some embodiments, 10% to 25%, 15% to 25%, 25% to 35%, 35% to 45%, 45% to 55%, 55% to 65%, 65% to 75%, 75% to 85%, 85% to 95%, or 90% to 100% of the uridine positions in the nucleic acid are 5-iodouridine. In some embodiments, 10% to 25%, 15 to 25%, 25 to 35%, 35 to 45%, 45 to 55%, 55 to 65%, 65 to 75%, 75 to 85%, 85 to 95%, or 90 to 100% of the uridine positions in the nucleic acid are 5-methoxyuridine, and the remainder are N1-methylpseudouridine.In some embodiments, 10% to 25%, 15 to 25%, 25 to 35%, 35 to 45%, 45 to 55%, 55 to 65%, 65 to 75%, 75 to 85%, 85 to 95%, or 90 to 100% of the uridine positions in the nucleic acid are 5-iodouridine, and the remainder are N1-methylpseudouridine.

[0437] h) 5' cap In some embodiments, a nucleic acid (e.g., mRNA) comprising an ORF encoding an RNA-guided DNA binder comprises a 5'-cap, e.g., Cap0, Cap1, or Cap2. The 5'-cap is generally a 7-methylguanine ribonucleotide (e.g., for ARCA, which may be further modified as described below) linked via a 5'-triphosphate to the 5'-position of the first nucleotide (i.e., the first cap-proximal nucleotide) of the 5'-3' strand of the nucleic acid. In Cap0, the riboses of the first and second cap-proximal nucleotides of the mRNA both comprise 2'-hydroxyl. In Cap1, the riboses of the first and second transcribed nucleotides of the mRNA comprise 2'-methoxy and 2'-hydroxy, respectively. In Cap2, the riboses of the first and second cap-proximal nucleotides of the mRNA both comprise 2'-methoxy. See, for example, Katibah et al. (2014) Proc Natl Acad Sci USA 111(33):12025-30 and Abbas et al. (2017) Proc Natl Acad Sci USA 114(11):E2106-E2115. Most endogenous higher eukaryotic mRNAs, including mammalian nucleic acids such as human nucleic acids, contain Cap1 or Cap2. Cap0 and other cap structures distinct from Cap1 and Cap2 are recognized as "non-self" by components of the innate immune system, such as IFIT-1 and IFIT-5, and can be immunogenic in mammals, including humans, leading to elevated levels of cytokines, including type I interferons. Components of the innate immune system, such as IFIT-1 and IFIT-5, can also compete with eIF4E for binding to nucleic acids with caps other than Cap1 or Cap2, potentially inhibiting mRNA translation.

[0438] A cap can be co-transcriptionally incorporated into RNA. For example, ARCA (anti-reverse cap analog, Thermo Fisher Scientific catalog number AM8045) is a cap analog containing 7-methylguanine 3'-methoxy-5'-triphosphate linked to the 5' position of guanine ribonucleotides and can be incorporated into transcripts in vitro at the time of initiation. ARCA results in a Cap0 cap in which the 2' position of the first cap-proximal nucleotide is hydroxyl. See, for example, Stepinski et al. (2001) "Synthesis and properties of mRNAs containing the novel 'anti-reverse' cap analogs 7-methyl(3'-O-methyl)GpppG and 7-methyl(3'deoxy)GpppG," RNA 7:1486-1495. The structure of ARCA is shown below. [ka]

[0439] CleanCap™ AG (m7G(5')ppp(5')(2'OMeA)pG, TriLink Biotechnologies catalog number N-7113) or CleanCap™ GG (m7G(5')ppp(5')(2'OMeG)pG, TriLink Biotechnologies catalog number N-7133) can be used to co-transcriptionally provide the Cap1 structure. 3'-O-methylated versions of CleanCap™ AG and CleanCap™ GG are also available from TriLink Biotechnologies as catalog numbers N-7413 and N-7433, respectively. The structure of CleanCap™ AG is shown below. CleanCap™ structures are sometimes referred to herein using the last three digits of the catalog number listed above (e.g., "CleanCap™ 113" for TriLink Biotechnologies catalog number N-7113). [ka]

[0440] Alternatively, a cap can be added to RNA after transcription. For example, Vaccinia capping enzyme is commercially available (New England Biolabs Catalog No. M2080S), which has RNA triphosphatase and guanylyltransferase activity provided by its D1 subunit and guanine methyltransferase activity provided by its D12 subunit. Thus, in the presence of S-adenosylmethionine and GTP, 7-methylguanine can be added to RNA to give Cap0. See, for example, Guo, P. and Moss, B. (1990) Proc. Natl. Acad. Sci. USA 87, 4023-4027; Mao, X. and Shuman, S. (1994) J. Biol. Chem. 269, 24472-24479. For additional discussion of caps and capping approaches, see, e.g., WO2017 / 053297 and Ishikawa et al., Nucl. Acids. Symp. Ser. (2009) No. 53, 129-130.

[0441] D. Determining RNA validity In some embodiments, the efficacy of the gRNA is determined when delivered together with other components, for example, a nucleic acid encoding an RNA-guided DNA-binding agent, such as any of those described herein. In some embodiments, the efficacy of the combination of the gRNA and the nucleic acid encoding the RNA-guided DNA-binding agent is determined.

[0442] As described herein, the use of the RNA-guided DNA nuclease and guide RNA disclosed herein may cause double-strand breaks in DNA, which may cause errors in the form of insertion / deletion (indel) mutations when repaired by cellular machinery.Many mutations caused by indels change the reading frame or introduce premature stop codons, thus producing non-functional proteins.

[0443] In some embodiments, the efficacy of a particular gRNA or combination is determined based on an in vitro model. In some embodiments, the in vitro model is HEK293 cells. In some embodiments, the in vitro model is HUH7 human liver cancer cells. In some embodiments, the in vitro model is HepG2 cells. In some embodiments, the in vitro model is primary human hepatocytes. In some embodiments, the in vitro model is primary cynomolgus monkey hepatocytes. Regarding the use of primary human hepatocytes, commercially available primary human hepatocytes can be used to provide greater consistency between experiments. In some embodiments, the number of off-target sites at which deletions or insertions occur in an in vitro model (e.g., in primary human hepatocytes) is determined, for example, by analyzing genomic DNA from primary human hepatocytes transfected in vitro with Cas9 mRNA and guide RNA. In some embodiments, such determination involves analyzing genomic DNA from primary human hepatocytes transfected in vitro with Cas9 mRNA, guide RNA, and donor oligonucleotides. An exemplary procedure for such determination is provided in the working examples below.

[0444] In some embodiments, the efficacy of a particular gRNA or combination is determined across multiple in vitro cell models for the gRNA selection process. In some embodiments, cell line comparisons of data with selected gRNAs are performed. In some embodiments, cross-screening is performed across multiple cell models.

[0445] In some embodiments, the effectiveness of a particular gRNA or combination is determined based on an in vivo model.In some embodiments, the in vivo model is a rodent model.In some embodiments, the rodent model is a mouse that expresses the human TTR gene, which may be a mutant human TTR gene.In some embodiments, the in vivo model is a non-human primate, such as a cynomolgus monkey.

[0446] In some embodiments, the efficacy of a guide RNA or combination is measured by the percent editing of TTR. In some embodiments, the percent editing of TTR is compared with the percent editing required to achieve knockdown of TTR protein, for example, in whole cell culture in in vitro models, or in serum or tissue in in vivo models.

[0447] In some embodiments, the effectiveness of a guide RNA or combination is measured by the number and / or frequency of indels in off-target sequences within the genome of a target cell type. In some embodiments, effective guide RNAs and combinations are provided that generate indels at off-target sites at a very low frequency (e.g., less than 5%) compared to the frequency of indel generation in a cell population and / or at the target site. Thus, the present disclosure provides guide RNAs that do not exhibit off-target indel formation in a target cell type (e.g., hepatocytes) or that have a frequency of off-target indel formation of less than 5% compared to the frequency of indel generation in a cell population and / or at the target site. In some embodiments, the present disclosure provides guide RNAs and combinations that do not exhibit any off-target indel formation in a target cell type (e.g., hepatocytes). In some embodiments, guide RNAs and combinations are provided that generate indels at fewer than five off-target sites, e.g., as assessed by one or more methods described herein. In some embodiments, guide RNAs and combinations are provided that generate indels at no more than four, three, two, or one off-target site, e.g., as assessed by one or more methods described herein. In some embodiments, the off-target site does not occur within a protein-coding region in the target cell (eg, hepatocyte) genome.

[0448] In some embodiments, detecting gene editing events, e.g., the formation of insertion / deletion ("indel") mutations, and homology-guided repair (HDR) events in target DNA utilizes linear amplification using tagged primers and isolation of the tagged amplification products (hereinafter referred to as "LAM-PCR" or "linear amplification (LA)" method), as described in WO2018 / 067447 or Schmidt et al., Nature Methods 4:1051-1057 (2007).

[0449] In some embodiments, detecting gene editing events, such as the formation of insertion / deletion (" indel ") mutations, and homology-guided repair (HDR) events in target DNA, further comprises sequencing linear amplification product or further amplification product.Sequencing can comprise any method known to those skilled in the art, including next-generation sequencing, and cloning linear amplification product or further amplification product into plasmid, sequencing of plasmid or part of plasmid.Exemplary next-generation sequencing methods are described, for example, in Shendure et al., Nature 26:1135-1145 (2008). In other embodiments, detecting gene editing events, such as the formation of insertion / deletion ("indel") mutations, and homology-directed repair (HDR) events in the target DNA further comprises performing digital PCR (dPCR) or droplet digital PCR (ddPCR) on the linear amplification product or further amplification product, or contacting the linear amplification product or further amplification product with a nucleic acid probe designed to identify DNA containing an HDR template sequence, and detecting the probe bound to the linear amplification product or further amplification product. In some embodiments, the method further comprises determining the location of the HDR template in the target DNA.

[0450] In certain embodiments, the method further comprises determining the sequence of an insertion site within the target DNA, the insertion site being the position where the HDR template is incorporated into the target DNA, and the insertion site may comprise some target DNA sequence and some HDR template sequence.

[0451] In some embodiments, the effectiveness of the guide RNA or combination is measured by TTR secretion. In some embodiments, TTR secretion is measured using an enzyme-linked immunosorbent assay (ELISA) using cell culture medium or serum. In some embodiments, TTR secretion is measured in the same in vitro or in vivo system or model used to measure editing. In some embodiments, TTR secretion is measured in primary human hepatocytes. In some embodiments, TTR secretion is measured in HUH7 cells. In some embodiments, TTR secretion is measured in HepG2 cells.

[0452] ELISA assays are commonly known to those skilled in the art and can be designed to determine serum TTR levels. In an exemplary embodiment, blood is collected and serum is isolated. Total TTR serum levels can be determined using the Mouse Prealbumin (Transthyretin) ELISA Kit (Aviva Systems Biology, type OKIA00111) or a similar kit for measuring human TTR. If a kit is not available, an ELISA can be developed using a plate pre-coated with a capture antibody specific to TTR at the time of measurement. The plate is incubated at room temperature for a predetermined time and then washed. An enzyme-anti-TTR antibody conjugate is added and incubated. Unbound antibody conjugate is removed, the plate is washed, and then a chromogenic substrate solution that reacts with the enzyme is added. The plate is read in an appropriate plate reader at an absorbance specific to the enzyme and substrate used.

[0453] In some embodiments, the amount of TTR in cells (including those derived from tissues) is used to measure the effectiveness of the gRNA or combination. In some embodiments, the amount of TTR in cells is measured using Western blot. In some embodiments, the cells used are HUH7 cells. In some embodiments, the cells used are primary human hepatocytes. In some embodiments, the cells used are primary cells obtained from an animal. In some embodiments, the amount of TTR is compared to the amount of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (a housekeeping gene) to control for changes in cell number.

[0454] III. LNP formulations and treatment of ATTR In some embodiments, methods are provided for inducing a double-strand break (DSB) in the TTR gene, comprising administering a composition comprising a guide RNA described herein (e.g., comprising any one or more guide sequences of SEQ ID NOs: 5-82, or any one or more sgRNAs of SEQ ID NOs: 87-124). In some embodiments, a gRNA comprising any one or more guide sequences of SEQ ID NOs: 5-82 is administered to induce a DSB in the TTR gene. The guide RNA is administered in conjunction with a nucleic acid (e.g., mRNA) or vector described herein encoding an RNA-guided DNA nuclease, such as a Cas nuclease (e.g., Cas9). The RNA-guided DNA nuclease may be S. pyogenes Cas9. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the nucleic acid encoding the guide RNA and the RNA-guided DNA nuclease is administered in an LNP as described herein, e.g., an LNP comprising a CCD lipid (e.g., an amine lipid such as lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).

[0455] In some embodiments, methods for inducing a double-strand break (DSB) in the TTR gene are provided, comprising administering a composition comprising a guide RNA (e.g., a chemically modified guide RNA) comprising any one or more guide sequences of SEQ ID NOs: 5-72, 74-78, and 80-82, or any one or more sgRNAs of SEQ ID NOs: 87-113, 115-120, and 122-124. In some embodiments, the sgRNAs of SEQ ID NOs: 87-113, 115-120, and 122-124, or the gRNAs comprising any one or more guide sequences of SEQ ID NOs: 5-72, 74-78, and 80-82, are administered to induce a DSB in the TTR gene. The guide RNA is administered in conjunction with a nucleic acid or vector described herein encoding an RNA-guided DNA nuclease, such as a Cas nuclease (e.g., Cas9). The RNA-guided DNA nuclease may be S. pyogenes Cas9. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the nucleic acid encoding the guide RNA and the RNA-guided DNA nuclease is administered in an LNP as described herein, for example, an LNP comprising a CCD lipid (e.g., an amine lipid such as lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).

[0456] In some embodiments, methods of modifying the TTR gene are provided, comprising administering a composition comprising a guide RNA described herein (e.g., comprising any one or more of the guide sequences set forth in SEQ ID NOs: 5-82, or any one or more of the sgRNAs set forth in SEQ ID NOs: 87-124). In some embodiments, a gRNA comprising any one or more of the guide sequences set forth in SEQ ID NOs: 5-82, or any one or more of the sgRNAs set forth in SEQ ID NOs: 87-124, is administered to modify the TTR gene. The guide RNA is administered in conjunction with a nucleic acid or vector described herein encoding an RNA-guided DNA nuclease, e.g., a Cas nuclease (e.g., Cas9). The RNA-guided DNA nuclease may be S. pyogenes Cas9. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the nucleic acid encoding the guide RNA and the RNA-guided DNA nuclease is administered in an LNP as described herein, e.g., an LNP comprising a CCD lipid (e.g., an amine lipid such as lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).

[0457] In some embodiments, methods for modifying the TTR gene are provided, comprising administering a composition comprising a guide RNA comprising any one or more of the guide sequences set forth in SEQ ID NOS: 5-72, 74-78, and 80-82, or any one or more of the sgRNAs set forth in SEQ ID NOS: 87-113, 115-120, and 122-124. In some embodiments, a gRNA comprising any one or more of the guide sequences set forth in SEQ ID NOS: 5-72, 74-78, and 80-82, or any one or more of the sgRNAs set forth in SEQ ID NOS: 87-113, 115-120, and 122-124 is administered to modify the TTR gene. The guide RNA is administered in conjunction with a nucleic acid or vector described herein encoding an RNA-guided DNA nuclease, e.g., a Cas nuclease (e.g., Cas9). The RNA-guided DNA nuclease may be S. pyogenes Cas9. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the nucleic acid encoding the guide RNA and the RNA-guided DNA nuclease is administered in an LNP as described herein, e.g., an LNP comprising a CCD lipid (e.g., an amine lipid such as lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).

[0458] In some embodiments, methods of treating ATTR are provided, comprising administering a composition comprising a guide RNA described herein (e.g., comprising any one or more of the guide sequences of SEQ ID NOs: 5-82, or any one or more of the sgRNAs of SEQ ID NOs: 87-124). In some embodiments, a gRNA comprising any one or more of the guide sequences of SEQ ID NOs: 5-82, or any one or more of the sgRNAs of SEQ ID NOs: 87-124, is administered to treat ATTR. The guide RNA is administered in conjunction with a nucleic acid or vector described herein encoding an RNA-guided DNA nuclease, e.g., a Cas nuclease (e.g., Cas9). The RNA-guided DNA nuclease may be S. pyogenes Cas9. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the nucleic acid encoding the guide RNA and the RNA-guided DNA nuclease is administered in an LNP as described herein, e.g., an LNP comprising a CCD lipid (e.g., an amine lipid such as lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).

[0459] In some embodiments, a method for treating ATTR is provided, comprising administering a composition comprising a guide RNA comprising any one or more of the guide sequences set forth in SEQ ID NOS: 5-72, 74-78, and 80-82, or any one or more of the sgRNAs set forth in SEQ ID NOS: 87-113, 115-120, and 122-124. In some embodiments, a gRNA comprising any one or more of the guide sequences set forth in SEQ ID NOS: 5-72, 74-78, and 80-82, or any one or more of the sgRNAs set forth in SEQ ID NOS: 87-113, 115-120, and 122-124 is administered to treat ATTR. The guide RNA is administered in conjunction with a nucleic acid or vector described herein encoding an RNA-guided DNA nuclease, e.g., a Cas nuclease (e.g., Cas9). The RNA-guided DNA nuclease may be S. pyogenes Cas9. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the nucleic acid encoding the guide RNA and the RNA-guided DNA nuclease is administered in an LNP as described herein, e.g., an LNP comprising a CCD lipid (e.g., an amine lipid such as lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).

[0460] In some embodiments, methods for reducing TTR serum concentrations are provided, comprising administering a guide RNA described herein (e.g., comprising any one or more of the guide sequences of SEQ ID NOs: 5-82, or any one or more of the sgRNAs of SEQ ID NOs: 87-124). In some embodiments, a gRNA comprising any one or more of the guide sequences of SEQ ID NOs: 5-82, or any one or more of the sgRNAs of SEQ ID NOs: 87-124, is administered to reduce or prevent the accumulation of TTR in amyloid or amyloid fibrils. The gRNA is administered in conjunction with a nucleic acid or vector described herein encoding an RNA-guided DNA nuclease, e.g., a Cas nuclease (e.g., Cas9). The RNA-guided DNA nuclease may be S. pyogenes Cas9. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the nucleic acid encoding the guide RNA and the RNA-guided DNA nuclease is administered in an LNP as described herein, e.g., an LNP comprising a CCD lipid (e.g., an amine lipid such as lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).

[0461] In some embodiments, methods for reducing TTR serum concentrations are provided, comprising administering a guide RNA described herein (e.g., comprising any one or more of the guide sequences set forth in SEQ ID NOS: 5-72, 74-78, and 80-82, or any one or more of the sgRNAs set forth in SEQ ID NOS: 87-113, 115-120, and 122-124). In some embodiments, a gRNA comprising any one or more of the guide sequences set forth in SEQ ID NOS: 5-72, 74-78, and 80-82, or any one or more of the sgRNAs set forth in SEQ ID NOS: 87-113, 115-120, and 122-124, is administered to reduce or prevent the accumulation of TTR in amyloid or amyloid fibrils. The gRNA is administered in conjunction with a nucleic acid or vector described herein encoding an RNA-guided DNA nuclease, e.g., a Cas nuclease (e.g., Cas9). The RNA-guided DNA nuclease may be S. pyogenes Cas9. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the nucleic acid encoding the guide RNA and the RNA-guided DNA nuclease is administered in an LNP as described herein, e.g., an LNP comprising a CCD lipid (e.g., an amine lipid such as lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).

[0462] In some embodiments, methods are provided for reducing or preventing the accumulation of TTR in amyloid or amyloid fibrils in a subject, the methods comprising administering a composition comprising a guide RNA described herein (e.g., comprising any one or more of the guide sequences of SEQ ID NOS: 5-82 or any one or more of the sgRNAs of SEQ ID NOS: 87-124). In some embodiments, methods are provided for reducing or preventing the accumulation of TTR in amyloid or amyloid fibrils in a subject, the methods comprising administering a composition comprising any one or more of the sgRNAs of SEQ ID NOS: 87-113. In some embodiments, a gRNA comprising any one or more of the guide sequences of SEQ ID NOS: 5-82 or any one or more of the sgRNAs of SEQ ID NOS: 87-124 is administered to reduce or prevent the accumulation of TTR in amyloid or amyloid fibrils. The gRNA is administered together with a nucleic acid or vector described herein encoding an RNA-guided DNA nuclease, e.g., a Cas nuclease (e.g., Cas9). The RNA-guided DNA nuclease may be S. pyogenes Cas9. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the nucleic acid encoding the guide RNA and the RNA-guided DNA nuclease is administered in an LNP as described herein, for example, an LNP comprising a CCD lipid (e.g., an amine lipid such as lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).

[0463] In some embodiments, methods are provided for reducing or preventing the accumulation of TTR in amyloid or amyloid fibrils in a subject, the methods comprising administering a composition comprising a guide RNA described herein (e.g., comprising any one or more of the guide sequences set forth in SEQ ID NOS: 5-72, 74-78, and 80-82, or any one or more of the sgRNAs set forth in SEQ ID NOS: 87-124). In some embodiments, methods are provided for reducing or preventing the accumulation of TTR in amyloid or amyloid fibrils in a subject, the methods comprising administering a composition comprising any one or more of the sgRNAs set forth in SEQ ID NOS: 87-113, 115-120, and 122-124. In some embodiments, a gRNA comprising any one or more of the guide sequences set forth in SEQ ID NOS: 5-72, 74-78, and 80-82, or any one or more of the sgRNAs set forth in SEQ ID NOS: 87-113, 115-120, and 122-124 is administered to reduce or prevent the accumulation of TTR in amyloid or amyloid fibrils. The gRNA is administered together with a nucleic acid or vector described herein encoding an RNA-guided DNA nuclease, e.g., a Cas nuclease (e.g., Cas9). The RNA-guided DNA nuclease may be S. pyogenes Cas9. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the guide RNA and the nucleic acid encoding the RNA-guided DNA nuclease are administered in an LNP described herein, e.g., an LNP comprising a CCD lipid (e.g., an amine lipid such as lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).

[0464] In some embodiments, a gRNA comprising a guide sequence from Table 1 or one or more sgRNAs from Table 2, together with an RNA-guided DNA nuclease, e.g., a Cas nuclease translated from the nucleic acid, induces a DSB, and non-homologous end joining (NHEJ) during repair results in a mutation in the TTR gene. In some embodiments, NHEJ causes a deletion or insertion of a nucleotide mutation, inducing a frameshift or nonsense in the TTR gene.

[0465] In some embodiments, administering a nucleic acid encoding a guide RNA and an RNA-guided DNA binder (e.g., in a composition provided herein) reduces the level (e.g., serum level) of TTR in a subject, thus preventing the accumulation and aggregation of TTR in amyloid or amyloid fibrils.

[0466] In some embodiments, reducing or preventing the accumulation and aggregation of TTR in amyloid or amyloid fibrils in a subject includes reducing or preventing TTR deposition in one or more tissues of the subject, such as the stomach, colon, or nervous tissue. In some embodiments, the nervous tissue includes the sciatic nerve or dorsal root ganglion. In some embodiments, TTR deposition is reduced in two, three, or four of the stomach, colon, sciatic nerve, and dorsal root ganglion. The level of deposition in a given tissue can be determined using a biopsy sample, for example, using immunostaining. In some embodiments, reducing or preventing the accumulation of TTR in amyloid or amyloid fibrils in a subject and / or reducing or preventing TTR deposition is inferred based on reducing serum TTR levels for a predetermined period of time. As discussed in the Examples, it has been found that reducing serum TTR levels according to the methods and uses provided herein can cause the clearance of deposited TTR from tissues such as those discussed above and in the Examples, for example, as measured 8 weeks after administration of the composition.

[0467] In some embodiments, the subject is a mammal. In some embodiments, the subject is a human. In some embodiments, the subject is a cow, pig, monkey, sheep, dog, cat, fish, or poultry.

[0468] In some embodiments, the use of one or more guide RNAs described herein (e.g., comprising any one or more of the guide sequences in Table 1, or one or more sgRNAs from Table 2) (e.g., in the compositions provided herein) and a nucleic acid (e.g., mRNA) described herein encoding an RNA-guided DNA binder is provided for the preparation of a medicament for treating a human subject with ATTR. The RNA-guided DNA binder may be Cas9, e.g., S. pyogenes Cas9. In certain embodiments, the guide RNA is chemically modified.

[0469] In some embodiments, the composition comprising the guide RNA and nucleic acid is administered intravenously. In some embodiments, the composition comprising the guide RNA and nucleic acid is administered into the hepatic circulation.

[0470] In some embodiments, a single administration of a composition comprising a guide RNA and a nucleic acid provided herein is sufficient to knock down expression of a mutant protein. In some embodiments, a single administration of a composition comprising a guide RNA and a nucleic acid provided herein is sufficient to knock down expression of a mutant protein in a population of cells. In other embodiments, more than one administration of a composition comprising a guide RNA and a nucleic acid provided herein may be beneficial to maximize editing through a cumulative effect. For example, the compositions provided herein can be administered two, three, four, five, or even more times, e.g., twice. Administration can be separated by periods ranging, for example, from 1 day to 2 years, e.g., from 1 day to 7 days, 7 days to 14 days, 14 days to 30 days, 30 days to 60 days, 60 days to 120 days, 120 days to 183 days, 183 days to 274 days, 274 days to 366 days, or 366 days to 2 years.

[0471] In some embodiments, the composition is administered in an effective amount of 0.01-10 mg / kg (mpk), e.g., 0.01-0.1 mpk, 0.1-0.3 mpk, 0.3-0.5 mpk, 0.5-1 mpk, 1-2 mpk, 2-3 mpk, 3-5 mpk, 5-10 mpk, or 0.1, 0.2, 0.3, 0.5, 1, 2, 3, 5, or 10 mpk. In some embodiments, the composition is administered in an amount of 2-4 mg / kg, e.g., 2.5-3.5 mg / kg. In some embodiments, the composition is administered in an amount of about 3 mg / kg.

[0472] In some embodiments, the efficacy of treatment with the compositions herein is seen 1, 2, 3, 4, 5, or 10 years after delivery. In some embodiments, the efficacy of treatment with the compositions of the present invention is assessed by measuring serum levels of TTR before and after treatment. In some embodiments, the efficacy of treatment with the compositions, as assessed by reduction in serum levels of TTR, is seen at 1 week, 2 weeks, 3 weeks, 4 weeks, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, or 11 months.

[0473] In some embodiments, treatment slows or stops the progression of the disease.

[0474] In some embodiments, treatment slows or stops the progression of FAP, hi some embodiments, treatment improves, stabilizes, or slows changes in the symptoms of sensorimotor or autonomic neuropathy.

[0475] In some embodiments, treatment improves, stabilizes, or slows the change in symptoms of FAC. In some embodiments, treatment improves, stabilizes, or slows the change in symptoms of restrictive cardiomyopathy or congestive heart failure.

[0476] In some embodiments, the efficacy of treatment is measured by an increase in the subject's survival time.

[0477] In some embodiments, the effectiveness of treatment is measured by an improvement in, or a delay in the progression of, symptoms of sensorimotor neuropathy or autonomic neuropathy. In some embodiments, the effectiveness of treatment is measured by an increase in, or a delay in the decline of, the ability to move an area of ​​the body or feel in any area of ​​the body. In some embodiments, the effectiveness of treatment is measured by an improvement in, or an increase in, the ability to swallow, breathe, use an arm, hand, leg, or foot, or ambulation. In some embodiments, the effectiveness of treatment is measured by an improvement in, or a delay in the progression of, neuralgia. In some embodiments, neuralgia is characterized by pain, burning, numbness, or abnormal sensations. In some embodiments, the effectiveness of treatment is measured by an improvement in, or a delay in the increase of, postural hypotension, dizziness, gastrointestinal motility disorders, bladder dysfunction, or sexual dysfunction. In some embodiments, the effectiveness of treatment is measured by an improvement in, or a delay in the progression of weakness. In some embodiments, the effectiveness of treatment is measured using electromyography, nerve conduction studies, or patient-reported outcomes.

[0478] In some embodiments, the effectiveness of treatment is measured by an improvement in or slowing the progression of symptoms of congestive heart failure or CHF. In some embodiments, the effectiveness of treatment is measured by a reduction in or slowing the increase in shortness of breath, difficulty breathing, fatigue, and swelling of the ankles, feet, legs, abdomen, or neck veins. In some embodiments, the effectiveness of treatment is measured by an improvement in or slowing the progression of fluid accumulation in the body, which may be assessed by measures such as weight gain, frequent urination, or nighttime coughing. In some embodiments, the effectiveness of treatment is measured using cardiac biomarker tests (e.g., B-type natriuretic peptide [BNP] or N-terminal pro-brain natriuretic peptide [NT-proBNP]), pulmonary function tests, chest x-rays, or electrocardiograms.

[0479] A. Combination Therapy In some embodiments, the invention includes a combination therapy comprising administering any one of the gRNAs described herein (e.g., comprising any one or more of the guide sequences disclosed in Table 1 or any one or more of the sgRNAs in Table 2) and a nucleic acid encoding an RNA-guided DNA binder described herein (e.g., in a composition provided herein), e.g., a nucleic acid (e.g., mRNA) or vector described herein encoding S. pyogenes Cas9, in conjunction with an additional therapy suitable for alleviating symptoms of ATTR. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the guide RNA and the nucleic acid encoding the RNA-guided DNA nuclease are administered in an LNP described herein, e.g., an LNP comprising a CCD lipid (e.g., an amine lipid such as lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).

[0480] In some embodiments, the additional therapy for ATTR is a treatment for sensorimotor neuropathy or autonomic neuropathy. In some embodiments, the treatment for sensorimotor neuropathy or autonomic neuropathy is a nonsteroidal anti-inflammatory drug, an antidepressant, an anticonvulsant, an antiarrhythmic drug, or a narcotic. In some embodiments, the antidepressant is a tricyclic drug or a serotonin-norepinephrine reuptake inhibitor. In some embodiments, the antidepressant is amitriptyline, duloxetine, or venlafaxine. In some embodiments, the anticonvulsant is gabapentin, pregabalin, topiramate, or carbamazepine. In some embodiments, the additional therapy for sensorimotor neuropathy is transcutaneous electrical nerve stimulation.

[0481] In some embodiments, the additional therapy for ATTR is a treatment for restrictive cardiomyopathy or congestive heart failure (CHF). In some embodiments, the treatment for CHF is an ACE inhibitor, an aldosterone antagonist, an angiotensin receptor blocker, a beta-blocker, digoxin, a diuretic, or isosorbide dinitrate / hydralazine hydrochloride. In some embodiments, the ACE inhibitor is enalapril, captopril, ramipril, perindopril, imidapril, or quinapril. In some embodiments, the aldosterone antagonist is eplerenone or spironolactone. In some embodiments, the angiotensin receptor blocker is azilsartan, cadesartan, eprosartan, irbesartan, losartan, olmesartan, telmisartan, or valsartan. In some embodiments, the beta blocker is acebutolol, atenolol, bisoprolol, metoprolol, nadolol, nebivolol, or propranolol. In some embodiments, the diuretic is chlorothiazide, chlorthalidone, hydrochlorothiazide, indapamide, metolazone, bumetanide, furosemide, torsemide, amiloride, or triamethelen.

[0482] In some embodiments, the combination therapy comprises administering any one of a gRNA comprising any one or more of the guide sequences disclosed in Table 1 or any one or more of the sgRNAs in Table 2, and a nucleic acid encoding an RNA-guided DNA binder (e.g., in a composition provided herein) together with an siRNA targeting TTR or mutant TTR. In some embodiments, the siRNA is any siRNA capable of further reducing or eliminating expression of wild-type or mutant TTR. In some embodiments, the siRNA is the drug patisiran (ALN-TTR02) or ALN-TTRsc02. In some embodiments, the siRNA is administered after any one of a gRNA comprising any one or more of the guide sequences disclosed in Table 1 or any one or more of the sgRNAs in Table 2 (e.g., in a composition provided herein). In some embodiments, the siRNA is administered periodically after treatment with any of the gRNA compositions provided herein.

[0483] In some embodiments, the combination therapy comprises administering any one of a gRNA comprising any one or more of the guide sequences described herein (e.g., those disclosed in Table 1) or any one or more of the sgRNAs in Table 2, and a nucleic acid encoding an RNA-guided DNA binder described herein (e.g., in a composition provided herein) together with an antisense nucleotide targeting TTR or mutant TTR. In some embodiments, the antisense nucleotide is any antisense nucleotide that can further reduce or eliminate expression of wild-type or mutant TTR. In some embodiments, the antisense nucleotide is the drug inotersen (IONS-TTR). Rx). In some embodiments, the antisense nucleotides are administered after any one of the gRNAs comprising any one or more of the guide sequences disclosed in Table 1 or any one or more of the sgRNAs in Table 2, and a nucleic acid encoding an RNA-guided DNA-binding agent (e.g., in a composition provided herein). In some embodiments, the antisense nucleotides are administered periodically after treatment with any of the gRNA compositions provided herein.

[0484] In some embodiments, the combination therapy comprises administering any one of a gRNA comprising any one or more of the guide sequences disclosed in Table 1 or any one or more of the sgRNAs in Table 2, and a nucleic acid encoding an RNA-guided DNA binder (e.g., in a composition provided herein), together with a small molecule stabilizer that promotes dynamic stabilization of the correctly folded tetrameric form of TTR. In some embodiments, the small molecule stabilizer is the drug tafamidis (Vyndaqel®) or diflunisal. In some embodiments, the small molecule stabilizer is administered after any one of a gRNA comprising any one or more of the guide sequences disclosed in Table 1 or any one or more of the sgRNAs in Table 2 (e.g., in a composition provided herein). In some embodiments, the small molecule stabilizer is administered periodically after treatment with any of the compositions provided herein.

[0485] In any of the foregoing embodiments, the guide sequence disclosed in Table 1 may be selected from SEQ ID NOs: 5-72, 74-78, and 80-82, and / or the sgRNA in Table 2 may be selected from SEQ ID NOs: 87-113, 115-120, and 122-124, and / or the guide RNA may be a chemically modified guide RNA.

[0486] In some embodiments, the methods described herein include infusion prophylaxis. In some embodiments, the infusion prophylaxis is administered to the subject prior to the gene-editing composition. In some embodiments, the infusion prophylaxis is administered to the subject 8 to 24 hours or 1 to 2 hours prior to administration of the nucleic acid composition. In some embodiments, the infusion prophylaxis includes a corticosteroid. In some embodiments, the infusion prophylaxis includes one or more, or all, of a corticosteroid, an antipyretic that can reduce pain and fever and / or inhibit COX enzymes and / or prostaglandins (e.g., oral acetaminophen (also known as paracetamol)), an H1 blocker, or an H2 blocker. In some embodiments, the infusion prophylaxis includes intravenous corticosteroid (dexamethasone 8 to 12 mg, e.g., 10 mg or equivalent) and an antipyretic (e.g., oral acetaminophen or paracetamol 500 mg). In some embodiments, the H1 blocker (e.g., diphenhydramine 50 mg or equivalent) and / or H2 blocker (e.g., ranitidine 50 mg or equivalent) are administered orally. In some embodiments, the H1 blocker (e.g., diphenhydramine 50 mg or equivalent) and / or H2 blocker (e.g., ranitidine 50 mg or equivalent) are administered intravenously. In some embodiments, the infusion prophylaxis is administered intravenously 1-2 hours prior to infusion of the nucleic acid composition. In some embodiments, the intravenous H1 blocker and / or intravenous H2 blocker are replaced with oral equivalents. The infusion prophylaxis can function to reduce adverse reactions associated with administering the nucleic acid composition. In some embodiments, the infusion prophylaxis is administered as a necessary premedication prior to administering the nucleic acid composition. The dosage, frequency, and mode of administration of the corticosteroid, infusion prophylaxis, and guide RNA-containing composition described herein can be independently controlled.

[0487] The corticosteroids used in the disclosed methods can be administered according to regimens known in the art, e.g., U.S. FDA-approved regimens. In some embodiments, including, for example, for administration to or for use in a human subject, the corticosteroid can be administered in an amount ranging from about 0.75 mg to about 25 mg. In some embodiments, including, for example, for administration to or for use in a human subject, the corticosteroid can be administered in an amount ranging from about 0.01 to 0.5 mg / kg, e.g., 0.1 to 0.40 mg / kg or 0.25 to 0.40 mg / kg.

[0488] In some embodiments, the corticosteroid is administered before the guide RNA-containing composition described herein. In some embodiments, the corticosteroid is administered after the guide RNA-containing composition described herein. In some embodiments, the corticosteroid is administered simultaneously with the guide RNA-containing composition described herein. In some embodiments, multiple doses of the corticosteroid are administered before or after the administration of the guide RNA-containing composition. In some embodiments, multiple doses of the guide RNA-containing composition are administered before or after the administration of the corticosteroid. In some embodiments, multiple doses of the corticosteroid and multiple doses of the guide RNA-containing composition are administered.

[0489] Where appropriate, a dose of corticosteroid may be administered as at least two subdoses administered separately at appropriate intervals. In some embodiments, the corticosteroid is administered at least twice before the administration of the guide RNA-containing composition described herein. In some embodiments, the corticosteroid is administered at least twice after the administration of the guide RNA-containing composition described herein. In some embodiments, the corticosteroid is administered (e.g., before, with, and / or after the administration of the guide RNA-containing composition described herein) at intervals of 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 12 hours, 18 hours, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 days, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 weeks, or within a time range bounded by any two of the aforementioned values. In some embodiments, the corticosteroid is administered at intervals of 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 12 hours, 18 hours, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 days, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 weeks, or within a range of time bounded by any two of the foregoing values, prior to administration of a guide RNA-containing composition described herein. In some embodiments, the corticosteroid is administered at intervals of 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 12 hours, 18 hours, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 days, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 weeks, or within a range of time bounded by any two of the foregoing values, following administration of a guide RNA-containing composition described herein.

[0490] In some embodiments, the corticosteroid is administered at least twice. In some embodiments, the corticosteroid is administered at least three times. In some embodiments, the corticosteroid is administered at least four times. In some embodiments, the corticosteroid is administered up to five, six, seven, eight, nine, or ten times. The first dose may be administered orally, and the second or subsequent doses may be administered parenterally, for example, by injection. Alternatively, the first dose may be administered parenterally, and the second or subsequent doses may be administered orally.

[0491] In some embodiments, the corticosteroid is administered orally prior to intravenous administration of a guide RNA-containing composition described herein. In some embodiments, the corticosteroid is administered orally during or after intravenous administration of a guide RNA-containing composition described herein.

[0492] In some embodiments, the corticosteroid is dexamethasone. In some embodiments, dexamethasone is administered intravenously 1 to 2 hours prior to injection of the nucleic acid composition. In some embodiments, dexamethasone is administered intravenously in an amount of 8 to 12 mg, e.g., 10 mg, 1 to 2 hours prior to injection of the nucleic acid composition. In some embodiments, dexamethasone is administered orally 8 to 24 hours prior to injection of the nucleic acid composition. In some embodiments, dexamethasone is administered orally in an amount of 8 to 12 mg, e.g., 8 mg, 8 to 24 hours prior to injection of the nucleic acid composition. In some embodiments, dexamethasone is administered orally in an amount of 8 to 12 mg, e.g., 8 mg, 8 to 24 hours prior to injection of the nucleic acid composition, and dexamethasone is administered intravenously in an amount of 8 to 12 mg, e.g., 10 mg, 1 to 2 hours prior to injection of the nucleic acid composition.

[0493] B. Delivery of Nucleic Acid Compositions In some embodiments, the nucleic acid compositions described herein, which comprise the nucleic acids described herein encoding the RNA-guided DNA binders as gRNA and RNA or are encoded on one or more vectors, are formulated in or administered via lipid nanoparticles. See, for example, WO2017173054A1 entitled "LIPID NANOPARTICLE FORMULATIONS FOR CRISPR / CAS COMPONENTS" and WO2019067992A1 entitled "FORMULATIONS," the contents of which are incorporated herein by reference in their entireties. Any lipid nanoparticle (LNP) known to those skilled in the art capable of delivering nucleotides to a subject can be utilized with the guide RNAs described herein and nucleic acids encoding RNA-guided DNA nucleases.

[0494] Various embodiments of LNP formulations for RNA, including CRISPR / Cas cargo, are disclosed herein. Such LNP formulations may include (i) CCD lipids, e.g., amine lipids; (ii) neutral lipids; (iii) helper lipids; and (iv) stealth lipids, e.g., PEG lipids. Some embodiments of LNP formulations include "amine lipids" along with helper lipids, neutral lipids, and stealth lipids, such as PEG lipids. In some embodiments, the LNP formulations include less than 1% neutral phospholipids. In some embodiments, the LNP formulations include less than 0.5% neutral phospholipids. By "lipid nanoparticle" is meant a particle comprising multiple (i.e., more than one) lipid molecules physically bound to each other by intermolecular forces.

[0495] CCD lipids The lipid composition for delivering CRISPR / Cas mRNA and guide RNA components to liver cells comprises a CCD lipid.

[0496] In some embodiments, the CCD lipid is lipid A, which is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)-octadeca-9,12-dienoate. Lipid A can be depicted as follows: [ka]

[0497] Lipid A can be synthesized according to WO2015 / 095340 (e.g., pages 84 to 86).

[0498] In some embodiments, the CCD lipid is lipid B, which is ((5-((dimethylamino)methyl)-1,3-phenylene)bis(oxy))bis(octane-8,1-diyl)bis(decanoate), also known as ((5-((dimethylamino)methyl)-1,3-phenylene)bis(oxy))bis(octane-8,1-diyl)bis(decanoate). Lipid B can be depicted as follows: [ka]

[0499] Lipid B can be synthesized according to WO2014 / 136086 (e.g., pages 107-09).

[0500] In some embodiments, the CCD lipid is lipid C, which is 2-((4-(((3-(dimethylamino)propoxy)carbonyl)oxy)hexadecanoyl)oxy)propane-1,3-diyl(9Z,9'Z,12Z,12'Z)-bis(octadeca-9,12-dienoate). Lipid C can be depicted as follows: [ka]

[0501] In some embodiments, the CCD lipid is lipid D, which is 3-(((3-(dimethylamino)propoxy)carbonyl)oxy)-13-(octanoyloxy)tridecyl 3-octylundecanoate.

[0502] Lipid D can be depicted as follows: [ka]

[0503] Lipid C and lipid D can be synthesized according to WO2015 / 095340.

[0504] The CCD lipid may also be an equivalent to lipid A, lipid B, lipid C, or lipid D. In certain embodiments, the CCD lipid is an equivalent to lipid A, an equivalent to lipid B, an equivalent to lipid C, or an equivalent to lipid D.

[0505] Amine lipids In some embodiments, an LNP composition for delivery of a bioactive agent comprises an "amine lipid," which is defined as lipid A, lipid B, lipid C, lipid D, or an equivalent of lipid A (including the acetal analog of lipid A), an equivalent of lipid B, an equivalent of lipid C, and an equivalent of lipid D.

[0506] In some embodiments, the amine lipid is lipid A, (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also referred to as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate. Lipid A can be depicted as follows: [ka]

[0507] Lipid A can be synthesized according to WO2015 / 095340 (e.g., pages 84-86). In certain embodiments, the amine lipid is an equivalent to lipid A.

[0508] In certain embodiments, the amine lipid is an analog of lipid A. In certain embodiments, the lipid A analog is an acetal analog of lipid A. In certain LNP compositions, the acetal analog is a C4-C12 acetal analog. In some embodiments, the acetal analog is a C5-C12 acetal analog. In additional embodiments, the acetal analog is a C5-C10 acetal analog. In further embodiments, the acetal analog is selected from C4, C5, C6, C7, C9, C10, C11, and C12 acetal analogs.

[0509] Amine lipids suitable for use in the LNPs described herein are biodegradable in vivo and suitable for delivering bioactive agents (e.g., RNA) to cells. Amine lipids have low toxicity (e.g., RNA cargo at doses of 10 mg / kg or greater is tolerated in animal models without adverse reactions). In certain embodiments, LNPs comprising amine lipids include those in which at least 75% of the amine lipids are cleared from plasma within 8, 10, 12, 24, or 48 hours, or within 3, 4, 5, 6, 7, or 10 days. In certain embodiments, LNPs comprising amine lipids include those in which at least 50% of the mRNA or gRNA are cleared from plasma within 8, 10, 12, 24, or 48 hours, or within 3, 4, 5, 6, 7, or 10 days. In certain embodiments, LNPs comprising amine lipids include those in which at least 50% of the LNPs are cleared from plasma within 8, 10, 12, 24, or 48 hours, or within 3, 4, 5, 6, 7, or 10 days, e.g., by measuring lipid (e.g., amine lipid), RNA (e.g., mRNA), or another component. In certain embodiments, lipid-encapsulated versus free lipid, RNA, or nucleic acid components of the LNPs are measured.

[0510] Lipid clearance may be measured as described in the literature. See Maier, MA, et al., "Biodegradable Lipids Enabling Rapidly Eliminated Lipid Nanoparticles for Systemic Delivery of RNAi Therapeutics," Mol. Ther. 2013, 21(8), 1570-78 ("Maier"). For example, in Maier, an LNP-siRNA system containing siRNA targeting luciferase was administered at 0.3 mg / kg via intravenous bolus injection via the lateral tail vein to 6-8 week-old male C57Bl / 6 mice. Blood, liver, and spleen samples were collected at 0.083, 0.25, 0.5, 1, 2, 4, 8, 24, 48, 96, and 168 hours post-administration. Mice were perfused with saline prior to tissue collection, and blood samples were processed to obtain plasma. All samples were processed and analyzed by LC-MS. Furthermore, Maier describes a procedure for assessing the toxicity of LNP-siRNA formulations after administration. For example, siRNA targeting luciferase was administered to male Sprague-Dawley rats at 0, 1, 3, 5, and 10 mg / kg (5 animals / group) via a single intravenous bolus injection at a dose volume of 5 mL / kg. After 24 hours, approximately 1 mL of blood was obtained from the jugular vein of conscious animals, and serum was isolated. Seventy-two hours after administration, all animals were euthanized for necropsy. Clinical signs, body weight, serum chemistry, organ weight, and histopathology were assessed. While Maier describes methods for assessing siRNA-LNP formulations, these methods can be applied to assessing clearance, pharmacokinetics, and toxicity of the LNP compositions of the present disclosure.

[0511] Amine lipids can increase clearance rate. In some embodiments, the clearance rate is the lipid clearance rate, for example, the rate at which lipids are removed from blood, serum, or plasma. In some embodiments, the clearance rate is the RNA clearance rate, for example, the rate at which mRNA or gRNA is removed from blood, serum, or plasma. In some embodiments, the clearance rate is the rate at which LNPs are removed from blood, serum, or plasma. In some embodiments, the clearance rate is the rate at which LNPs are removed from tissues such as liver tissue or spleen tissue. In certain embodiments, a high clearance rate results in a safety profile without substantial adverse effects. Amine lipids can reduce LNP accumulation in circulation and tissues. In some embodiments, reduced LNP accumulation in circulation and tissues results in a safety profile without substantial adverse effects.

[0512] The amine lipids of the present disclosure may be ionized (e.g., may form salts) depending on the pH of the medium in which they are contained. For example, in a slightly acidic medium, the amine lipids may be protonated and therefore positively charged. Conversely, in a slightly basic medium, such as blood, which has a pH of approximately 7.35, the amine lipids may not be protonated and therefore uncharged. In some embodiments, the amine lipids of the present disclosure may be protonated at a pH of at least about 9. In some embodiments, the amine lipids of the present disclosure may be protonated at a pH of at least about 9. In some embodiments, the amine lipids of the present disclosure may be protonated at a pH of at least about 10.

[0513] The pH at which an amine lipid is largely protonated is related to its inherent pKa. In some embodiments, the amine lipids of the present disclosure may each independently have a pKa in the range of about 5.1 to about 7.4. In some embodiments, the amine lipids of the present disclosure may each independently have a pKa in the range of about 5.5 to about 6.6. In some embodiments, the amine lipids of the present disclosure may each independently have a pKa in the range of about 5.6 to about 6.4. In some embodiments, the amine lipids of the present disclosure may each independently have a pKa in the range of about 5.8 to about 6.2. For example, the amine lipids of the present disclosure may each independently have a pKa in the range of about 5.8 to about 6.5. Because cationic lipids with a pKa in the range of about 5.1 to about 7.4 have been found to be effective in delivering cargo in vivo, for example, to the liver, the pKa of the amine lipid can be an important consideration when formulating LNPs. Additionally, cationic lipids having a pKa in the range of about 5.3 to about 6.4 have been shown to be effective for delivery in vivo, for example, to tumors. See, e.g., WO2014 / 136086.

[0514] Additional fats Suitable "neutral lipids" for use in the lipid compositions of the present disclosure include, for example, a variety of neutral, uncharged, or zwitterionic lipids. Examples of neutral phospholipids suitable for use in the present disclosure include 5-heptadecylbenzene-1,3-diol (resorcinol), dipalmitoylphosphatidylcholine (DPPC), distearoylphosphatidylcholine (DSPC), pohsphocholine (DOPC), dimyristoylphosphatidylcholine (DMPC), phosphatidylcholine (PLPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DAPC), phosphatidylethanolamine (PE), egg phosphatidylcholine (EPC), dilauryloylphosphatidylcholine (DLPC), dimyristoylphosphatidylcholine (DMPC), 1-myristoyl-2-palmitoylphosphatidylcholine (MPPC), 1-palmitoyl-2-myristoylphosphatidylcholine (PMPC), 1-palmitoyl-2-stearo ...

[0033] Examples of phosphatidylcholine include, but are not limited to, 1,2-diarachidoyl-sn-glycero-3-phosphocholine (PSPC), 1,2-diarachidoyl-sn-glycero-3-phosphocholine (DBPC), 1-stearoyl-2-palmitoylphosphatidylcholine (SPPC), 1,2-dieicosenoyl-sn-glycero-3-phosphocholine (DEPC), palmitoyloleoylphosphatidylcholine (POPC), lysophosphatidylcholine, dioleoylphosphatidylethanolamine (DOPE), dilinoleoylphosphatidylcholine, distearoylphosphatidylethanolamine (DSPE), dimyristoylphosphatidylethanolamine (DMPE), dipalmitoylphosphatidylethanolamine (DPPE), palmitoyloleoylphosphatidylethanolamine (POPE), lysophosphatidylethanolamine, and combinations thereof. In one embodiment, the neutral phospholipid may be selected from the group consisting of distearoylphosphatidylcholine (DSPC) and dimyristoylphosphatidylethanolamine (DMPE). In another embodiment, the neutral phospholipid may be distearoylphosphatidylcholine (DSPC). In another embodiment, the neutral phospholipid may be dipalmitoylphosphatidylcholine (DPPC).

[0515] "Helper lipids" include steroids, sterols, and alkylresorcinols. Helper lipids suitable for use in the present disclosure include, but are not limited to, cholesterol, 5-heptadecylresorcinol, and cholesterol hemisuccinate. In one embodiment, the helper lipid may be cholesterol. In one embodiment, the helper lipid may be cholesterol hemisuccinate.

[0516] A "stealth lipid" is a lipid that changes the length of time that nanoparticles can exist in vivo (e.g., in blood vessels). Stealth lipids are useful in formulation processes, for example, by reducing particle aggregation and controlling particle size. Stealth lipids used herein can adjust the pharmacokinetic properties of LNPs. Stealth lipids suitable for use in the lipid compositions of the present disclosure include, but are not limited to, stealth lipids with a hydrophilic head group linked to the lipid moiety. Information on stealth lipids suitable for use in the lipid compositions of the present disclosure and the biochemistry of such lipids can be found in Romberg et al., Pharmaceutical Research, Vol. 25, No. 1, 2008, pp. 55-71 and Hoekstra et al., Biochimica et Biophysica Acta 1660 (2004) 41-52. Additional suitable PEG lipids are disclosed, for example, in WO2006 / 007712.

[0517] In one embodiment, the hydrophilic head group of the stealth lipid comprises a polymer moiety selected from a PEG-based polymer. The stealth lipid may comprise a lipid moiety. In some embodiments, the stealth lipid is a PEG-lipid. The PEG-lipid may aid in the formulation process, for example, by reducing particle aggregation and controlling particle size. The PEG-lipid used herein may regulate the pharmacokinetic properties of LNP. Typically, the PEG-lipid comprises a lipid moiety and a PEG-based polymer moiety.

[0518] In one embodiment, the stealth lipid comprises a polymer moiety selected from PEG-based polymers (sometimes referred to as poly(ethylene oxide)), poly(oxazoline), poly(vinyl alcohol), poly(glycerol), poly(N-vinylpyrrolidone), polyamino acids, and poly[N-(2-hydroxypropyl)methacrylamide].

[0519] In one embodiment, the PEG lipid comprises a PEG-based polymer moiety (sometimes referred to as poly(ethylene oxide)).

[0520] The PEG-lipid further comprises a lipid moiety. In some embodiments, the lipid moiety may be derived from a diacylglycerol or diacylglycamide, including those comprising a diacylglycerol or diacylglycamide group having an alkyl chain length independently comprising from about C4 to about C40 saturated or unsaturated carbon atoms, and the chain may comprise one or more functional groups (e.g., amide or ester). In some embodiments, the alkyl chain length comprises from about C10 to C20. The dialkylglycerol or dialkylglycamide group may further comprise one or more substituted alkyl groups. The chain length may be symmetric or asymmetric.

[0521] Unless otherwise indicated, the term "PEG" as used herein refers to any polyethylene glycol or other polyalkylene ether polymer. In one embodiment, PEG is a linear or branched polymer of optionally substituted ethylene glycol or ethylene oxide. In one embodiment, PEG is unsubstituted. In one embodiment, PEG is substituted, for example, with one or more alkyl, alkoxy, acyl, hydroxy, or aryl groups. In one embodiment, the term includes PEG copolymers such as PEG-polyurethane or PEG-polypropylene (see, e.g., J. Milton Harris, Poly(ethylene glycol) chemistry: biotechnical and biomedical applications (1992)). In another embodiment, the term does not include PEG copolymers. In one embodiment, the PEG has a molecular weight of about 130 to about 50,000, in a subembodiment, about 150 to about 30,000, in a subembodiment, about 150 to about 20,000, in a subembodiment, about 150 to about 15,000, in a subembodiment, about 150 to about 10,000, in a subembodiment, about 150 to about 6,000, in a subembodiment, about 150 to about 5,000, in a subembodiment, about 150 to about 4,000, in a subembodiment, about 150 to about 3,000, in a subembodiment, about 300 to about 3,000, in a subembodiment, about 1,000 to about 3,000, and in a subembodiment, about 1,500 to about 2,500.

[0522] In certain embodiments, the PEG (e.g., conjugated to a lipid moiety or lipid, such as a stealth lipid) is "PEG-2K," also known as "PEG2000," which has an average molecular weight of about 2,000 daltons. PEG-2K is represented herein by the following formula (I): [ka] However, other embodiments of PEG known in the art may be used, for example, having a number average degree of polymerization of about 23 subunits (n=23) and / or 68 subunits (n=68). In some embodiments, n may range from about 30 to about 60. In some embodiments, n may range from about 35 to about 55. In some embodiments, n may range from about 40 to about 50. In some embodiments, n may range from about 42 to about 48. In some embodiments, n may be 45. In some embodiments, R may be selected from H, substituted alkyl, and unsubstituted alkyl. In some embodiments, R may be unsubstituted alkyl. In some embodiments, R may be methyl.

[0523] In any of the embodiments described herein, the PEG lipid may be PEG-dilaurylglycerol, PEG-dimyristoylglycerol (PEG-DMG) (catalog number GM-020 from NOF, Tokyo, Japan), PEG-dipalmitoylglycerol, PEG-distearoylglycerol (PEG-DSPE) (catalog number DSPE-020CN, NOF, Tokyo, Japan), PEG-dilaurylglycamide, PEG-dimyristylglycamide, PEG-dipalmitoylglycamide, and PEG-distearoylglycamide, PEG-cholesterol (1-[8'-(cholesterol)-1-methyl-2-methyl-1-propanol), PEG-cholesterol (1-[8'-(cholesterol)-1 ... [ter-5-ene-3[beta]-oxy)carboxamido-3',6'-dioxaoctanyl]carbamoyl-[omega]-methyl-poly(ethylene glycol), PEG-DMB (3,4-ditetradecoxylbenzyl-[omega]-methyl-poly(ethylene glycol) ether), 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DMG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DSPE) (Avanti The PEG lipid may be selected from Polar Lipids, Alabaster, Alabama, USA, catalog number 880120C), 1,2-distearoyl-sn-glycerol, methoxypolyethylene glycol (PEG2k-DSG, GS-020, NOF Tokyo, Japan), poly(ethylene glycol)-2000-dimethacrylate (PEG2k-DMA), and 1,2-distearyloxypropyl-3-amine-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DSA). In one embodiment, the PEG lipid may be PEG2k-DMG. In some embodiments, the PEG lipid may be PEG2k-DSG. In one embodiment, the PEG lipid may be PEG2k-DSPE. In one embodiment, the PEG lipid may be PEG2k-DMA. In one embodiment, the PEG lipid may be PEG2k-C-DMA.In one embodiment, the PEG lipid may be compound S027 disclosed in WO2016 / 010840 (paragraphs

[0240] to

[0244] ). In one embodiment, the PEG lipid may be PEG2k-DSA. In one embodiment, the PEG lipid may be PEG2k-C11. In some embodiments, the PEG lipid may be PEG2k-C14. In some embodiments, the PEG lipid may be PEG2k-C16. In some embodiments, the PEG lipid may be PEG2k-C18.

[0524] LNP formulation LNPs may contain (i) amine lipids for encapsulation and endosomal escape, (ii) neutral lipids for stabilization, (iii) helper lipids, also for stabilization, and (iv) stealth lipids, e.g., PEG lipids. Neutral lipids may be omitted.

[0525] In some embodiments, the LNP composition may include an RNA component comprising one or more of an RNA-guided DNA binder, a Cas nuclease mRNA, a Class 2 Cas nuclease mRNA, a Cas9 mRNA, and a gRNA. In some embodiments, the LNP composition includes an mRNA encoding a Class 2 Cas nuclease and a gRNA as the RNA component. In certain embodiments, the LNP composition may include an RNA component, an amine lipid, a helper lipid, a neutral lipid, and a stealth lipid. In certain LNP compositions, the helper lipid is cholesterol. In other compositions, the neutral lipid is DSPC. In additional embodiments, the stealth lipid is PEG2k-DMG or PEG2k-C11. In certain embodiments, the LNP composition includes lipid A or an equivalent of lipid A, a helper lipid, a neutral lipid, a stealth lipid, and a guide RNA. In certain compositions, the amine lipid is lipid A. In certain compositions, the amine lipid is lipid A or its acetal analog, the helper lipid is cholesterol, the neutral lipid is DSPC, and the stealth lipid is PEG2k-DMG.

[0526] In certain embodiments, lipid compositions are described according to the respective molar ratios of the lipid components in the formulation. Embodiments of the present disclosure provide lipid compositions described according to the respective molar ratios of the lipid components in the formulation. In one embodiment, the mol% of the amine lipids can be about 30 mol% to about 60 mol%. In one embodiment, the mol% of the amine lipids can be about 40 mol% to about 60 mol%. In one embodiment, the mol% of the amine lipids can be about 45 mol% to about 60 mol%. In one embodiment, the mol% of the amine lipids can be about 50 mol% to about 60 mol%. In one embodiment, the mol% of the amine lipids can be about 55 mol% to about 60 mol%. In one embodiment, the mol% of the amine lipids can be about 50 mol% to about 55 mol%. In one embodiment, the mol% of the amine lipids can be about 50 mol%. In one embodiment, the mol% of the amine lipids can be about 55 mol%. In some embodiments, the amine lipid mol% of an LNP batch is ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2.5% of the target mol%. In some embodiments, the amine lipid mol% of an LNP batch is ±4 mol%, ±3 mol%, ±2 mol%, ±1.5 mol%, ±1 mol%, ±0.5 mol%, or ±0.25 mol% of the target mol%. All mol% numbers are expressed as fractions of the lipid component of the LNP composition. In certain embodiments, the variability of amine lipid mol% between LNP lots will be less than 15%, less than 10%, or less than 5%.

[0527] In one embodiment, the mol% of the neutral lipid, for example, the neutral phospholipid, can be about 5 mol% to about 15 mol%. In one embodiment, the mol% of the neutral lipid, for example, the neutral phospholipid, can be about 7 mol% to about 12 mol%. In one embodiment, the mol% of the neutral lipid, for example, the neutral phospholipid, can be about 0 mol% to about 5 mol%. In one embodiment, the mol% of the neutral lipid, for example, the neutral phospholipid, can be about 0 mol% to about 10 mol%. In one embodiment, the mol% of the neutral lipid, for example, the neutral phospholipid, can be about 5 mol% to about 10 mol%. In one embodiment, the mol% of the neutral lipid, for example, the neutral phospholipid, can be about 8 mol% to about 10 mol%.

[0528] In one embodiment, the mol% of the neutral lipid, e.g., the neutral phospholipid, can be about 5 mol%, about 6 mol%, about 7 mol%, about 8 mol%, about 9 mol%, about 10 mol%, about 11 mol%, about 12 mol%, about 13 mol%, about 14 mol%, or about 15 mol%. In one embodiment, the mol% of the neutral lipid, e.g., the neutral phospholipid, can be about 9 mol%.

[0529] In one embodiment, the mol% of the neutral lipid, e.g., neutral phospholipid, can be about 1 mol% to about 5 mol%. In one embodiment, the mol% of the neutral lipid can be about 0.1 mol% to about 1 mol%. In one embodiment, the mol% of the neutral lipid, e.g., neutral phospholipid, can be about 0.1 mol%, about 0.2 mol%, about 0.5 mol%, 1 mol%, about 1.5 mol%, about 2 mol%, about 2.5 mol%, about 3 mol%, about 3.5 mol%, about 4 mol%, about 4.5 mol%, or about 5 mol%.

[0530] In one embodiment, the mol% of neutral lipids, e.g., neutral phospholipids, can be less than about 1 mol%. In one embodiment, the mol% of neutral lipids, e.g., neutral phospholipids, can be less than about 0.5 mol%. In one embodiment, the mol% of neutral lipids, e.g., neutral phospholipids, can be about 0 mol%, about 0.1 mol%, about 0.2 mol%, about 0.3 mol%, about 0.4 mol%, about 0.5 mol%, about 0.6 mol%, about 0.7 mol%, about 0.8 mol%, about 0.9 mol%, or about 1 mol%. In some embodiments, the formulations disclosed herein do not contain neutral lipids (i.e., 0 mol% neutral lipids). In some embodiments, the formulations disclosed herein are essentially free of neutral lipids (i.e., about 0 mol% neutral lipids). In some embodiments, the formulations disclosed herein do not contain neutral phospholipids (i.e., 0 mol% neutral phospholipids). In some embodiments, the formulations disclosed herein are essentially free of neutral phospholipids (ie, about 0 mol % neutral phospholipids).

[0531] In some embodiments, the mol% neutral lipid of an LNP batch is ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2.5% of the mol% target neutral lipid. In certain embodiments, the variability between lots of LNPs will be less than 15%, less than 10%, or less than 5%.

[0532] In one embodiment, the mol% of the helper lipid may be about 20 mol% to about 60 mol%. In one embodiment, the mol% of the helper lipid may be about 25 mol% to about 55 mol%. In one embodiment, the mol% of the helper lipid may be about 25 mol% to about 50 mol%. In one embodiment, the mol% of the helper lipid may be about 25 mol% to about 40 mol%. In one embodiment, the mol% of the helper lipid may be about 30 mol% to about 50 mol%. In one embodiment, the mol% of the helper lipid may be adjusted based on the concentrations of the amine lipid, neutral lipid, and PEG lipid to make the lipid component 100 mol%. In one embodiment, the mol% of the helper lipid may be adjusted based on the concentrations of the amine lipid and PEG lipid to make the lipid component 100 mol%. In one embodiment, the mol% of helper lipid is adjusted based on the concentration of amine lipid and PEG lipid to make the lipid component at least 99 mol%. In some embodiments, the mol% of helper of an LNP batch is ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2.5% of the target mol%. In certain embodiments, the variability between LNP batches will be less than 15%, less than 10%, or less than 5%.

[0533] In one embodiment, the mol% of PEG lipids can be about 1 mol% to about 10 mol%. In one embodiment, the mol% of PEG lipids can be about 2 mol% to about 10 mol%. In one embodiment, the mol% of PEG lipids can be about 2 mol% to about 8 mol%. In one embodiment, the mol% of PEG lipids can be about 2 mol% to about 4 mol%. In one embodiment, the mol% of PEG lipids can be about 2.5 mol% to about 4 mol%. In one embodiment, the mol% of PEG lipids can be about 3 mol%. In one embodiment, the mol% of PEG lipids in an LNP batch is ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2.5% of the target mol% of PEG lipids. In certain embodiments, the variability between LNP lots will be less than 15%, less than 10%, or less than 5%.

[0534] In certain embodiments, the cargo comprises a nucleic acid encoding an RNA-guided DNA-binding agent (e.g., a Cas nuclease, a class 2 Cas nuclease, or Cas9) and a gRNA or a nucleic acid encoding a gRNA, or a combination of mRNA and gRNA. In one embodiment, the LNP composition may comprise lipid A or an equivalent. In some embodiments, the amine lipid is lipid A. In some embodiments, the amine lipid is a lipid A equivalent, e.g., an analog of lipid A. In certain embodiments, the amine lipid is an acetal analog of lipid A. In various embodiments, the LNP composition comprises an amine lipid, a neutral lipid, a helper lipid, and a PEG lipid. In certain embodiments, the helper lipid is cholesterol. In certain embodiments, the neutral lipid is DSPC. In certain embodiments, the PEG lipid is PEG2k-DMG. In some embodiments, the LNP composition may comprise lipid A, a helper lipid, a neutral lipid, and a PEG lipid. In some embodiments, the LNP composition comprises an amine lipid, DSPC, cholesterol, and a PEG lipid. In some embodiments, the LNP composition comprises a PEG-lipid comprising DMG. In certain embodiments, the amine lipid is selected from lipid A, equivalents of lipid A, including acetal analogs of lipid A. In additional embodiments, the LNP composition comprises lipid A, cholesterol, DSPC, and PEG2k-DMG.

[0535] In various embodiments, the LNP composition comprises an amine lipid, a helper lipid, a neutral lipid, and a PEG lipid. In various embodiments, the LNP composition comprises an amine lipid, a helper lipid, a neutral phospholipid, and a PEG lipid. In various embodiments, the LNP composition comprises a lipid component consisting of an amine lipid, a helper lipid, a neutral lipid, and a PEG lipid. In various embodiments, the LNP composition comprises an amine lipid, a helper lipid, and a PEG lipid. In certain embodiments, the LNP composition does not include a neutral lipid, such as a neutral phospholipid. In various embodiments, the LNP composition comprises a lipid component consisting of an amine lipid, a helper lipid, and a PEG lipid. In certain embodiments, the neutral lipid is selected from one or more of DSPC, DPPC, DAPC, DMPC, DOPC, DOPE, and DSPE. In certain embodiments, the neutral lipid is DSPC. In certain embodiments, the neutral lipid is DPPC. In certain embodiments, the neutral lipid is DAPC. In certain embodiments, the neutral lipid is DMPC. In certain embodiments, the neutral lipid is DOPC. In certain embodiments, the neutral lipid is DOPE. In certain embodiments, the neutral lipid is DSPE. In certain embodiments, the helper lipid is cholesterol. In some embodiments, the PEG lipid is PEG2k-DMG. In some embodiments, the LNP composition can comprise lipid A, a helper lipid, and a PEG lipid. In some embodiments, the LNP composition can comprise a lipid component consisting of lipid A, a helper lipid, and a PEG lipid. In some embodiments, the LNP composition comprises an amine lipid, cholesterol, and a PEG lipid. In some embodiments, the LNP composition comprises a lipid component consisting of an amine lipid, cholesterol, and a PEG lipid. In some embodiments, the LNP composition comprises a PEG lipid comprising DMG. In certain embodiments, the amine lipid is selected from lipid A and equivalents of lipid A, including acetal analogs of lipid A. In certain embodiments, the amine lipid is a C5-C12 or C4-C12 acetal analog of lipid A.In additional embodiments, the LNP composition comprises lipid A, cholesterol, and PEG2k-DMG.

[0536] Embodiments of the present disclosure also provide lipid compositions described according to the molar ratio between the positively charged amine group (N) and the negatively charged phosphate group (P) of the amine lipid of the nucleic acid to be encapsulated. This may be mathematically represented by the formula N / P. In some embodiments, an LNP composition may include a lipid component comprising an amine lipid, a helper lipid, a neutral lipid, and a PEG lipid, and a nucleic acid component, wherein the N / P ratio is about 3-10. In some embodiments, an LNP composition may include a lipid component comprising an amine lipid, a helper lipid, and a PEG lipid, and a nucleic acid component, wherein the N / P ratio is about 3-10. In some embodiments, an LNP composition may include a lipid component comprising an amine lipid, a helper lipid, a neutral lipid, and a helper lipid, and an RNA component, wherein the N / P ratio is about 3-10. In some embodiments, an LNP composition may include a lipid component comprising an amine lipid, a helper lipid, and a PEG lipid, and an RNA component, wherein the N / P ratio is about 3-10. In one embodiment, the N / P ratio may be about 5-7. In one embodiment, the N / P ratio may be about 3 to 7. In one embodiment, the N / P ratio may be about 4.5 to 8. In one embodiment, the N / P ratio may be about 6. In one embodiment, the N / P ratio may be 6±1. In one embodiment, the N / P ratio may be 6±0.5. In some embodiments, the N / P ratio is ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2.5% of the target N / P ratio. In certain embodiments, the lot-to-lot variability of the LNP will be less than 15%, less than 10%, or less than 5%.

[0537] In some embodiments, the RNA component can comprise a nucleic acid, e.g., a nucleic acid disclosed herein, e.g., a nucleic acid encoding a Cas nuclease described herein (e.g., a Cas9 mRNA described herein), and a gRNA described herein. In some embodiments, the RNA component comprises a Cas nuclease mRNA described herein and a gRNA described herein. In some embodiments, the RNA component comprises a Class 2 Cas nuclease mRNA described herein and a gRNA described herein. In any of the foregoing embodiments, the gRNA can be an sgRNA described herein, e.g., a chemically modified sgRNA described herein.

[0538] In certain embodiments, an LNP composition may comprise the above-described RNA component, an amine lipid, a helper lipid, a neutral lipid, and a PEG lipid. In certain LNP compositions, the helper lipid is cholesterol, the neutral lipid is DSPC, and / or the PEG lipid is PEG2k-DMG or PEG2k-C11. In certain compositions, the amine lipid is selected from lipid A and its equivalents, e.g., acetal analogs of lipid A. In one embodiment, the lipid components of an LNP composition consist of an amine lipid, a helper lipid, a neutral lipid, and a PEG lipid. In one embodiment, the lipid components of an LNP composition consist of an amine lipid, a helper lipid, and a PEG lipid. In certain compositions comprising an mRNA and a gRNA encoding a Cas nuclease, the helper lipid is cholesterol. In some compositions comprising an mRNA and a gRNA encoding a Cas nuclease, the neutral lipid is DSPC. Certain compositions comprising an mRNA and a gRNA encoding a Cas nuclease contain less than about 1 mol% neutral lipid, e.g., a neutral phospholipid. Certain compositions comprising mRNA and gRNA encoding a Cas nuclease contain less than about 0.5 mol% of neutral lipids, e.g., neutral phospholipids. In certain compositions, the LNPs do not contain neutral lipids, e.g., neutral phospholipids. In additional embodiments comprising mRNA and gRNA encoding a Cas nuclease, the PEG lipid is PEG2k-DMG or PEG2k-C11. In certain embodiments, the amine lipid is selected from lipid A and its equivalents, e.g., acetal analogs of lipid A.

[0539] In certain embodiments, an LNP composition comprises a Cas nuclease mRNA (e.g., a Class 2 Cas mRNA) described herein and at least one gRNA described herein. In certain embodiments, an LNP composition has a gRNA to Cas nuclease mRNA (e.g., a Class 2 Cas nuclease mRNA) ratio of about 25:1 to about 1:25. In certain embodiments, an LNP formulation has a gRNA to Cas nuclease mRNA (e.g., a Class 2 Cas nuclease mRNA) ratio of about 10:1 to about 1:10. In certain embodiments, an LNP formulation has a gRNA to Cas nuclease mRNA (e.g., a Class 2 Cas nuclease mRNA) ratio of about 8:1 to about 1:8. As measured herein, ratios are by weight. In some embodiments, an LNP formulation has a gRNA to Cas nuclease mRNA (e.g., a Class 2 Cas mRNA) ratio of about 5:1 to about 1:5. In some embodiments, the ratio ranges are about 3:1 to 1:3, about 2:1 to 1:2, about 5:1 to 1:2, about 5:1 to 1:1, about 3:1 to 1:2, about 3:1 to 1:1, about 3:1, or about 2:1 to 1:1. In some embodiments, the ratio of gRNA to mRNA is about 3:1 or about 2:1. In some embodiments, the ratio of gRNA to Cas nuclease mRNA (e.g., Class 2 Cas nuclease) is about 1:1. The ratio can be about 25:1, 10:1, 5:1, 3:1, 1:1, 1:3, 1:5, 1:10, or 1:25.

[0540] In some embodiments, LNPs are formed by mixing an aqueous RNA solution with an organic solvent-based lipid solution (e.g., 100% ethanol). Suitable solutions or solvents may include or contain water, PBS, Tris buffer, NaCl, citrate buffer, ethanol, chloroform, diethyl ether, cyclohexane, tetrahydrofuran, methanol, or isopropanol. For example, a pharmaceutically acceptable buffer for in vivo administration of LNPs may be used. In certain embodiments, a buffer is used to maintain the pH of a composition comprising LNPs at pH 6.5 or above. In certain embodiments, a buffer is used to maintain the pH of a composition comprising LNPs at pH 7.0 or above. In certain embodiments, the composition has a pH in the range of about 7.2 to about 7.7. In additional embodiments, the composition has a pH in the range of about 7.3 to about 7.7, or about 7.4 to about 7.6. In further embodiments, the composition has a pH of about 7.2, 7.3, 7.4, 7.5, 7.6, or 7.7. The pH of the composition may be measured with a micro pH probe. In certain embodiments, a cryoprotectant is included in the composition. Non-limiting examples of cryoprotectants include sucrose, trehalose, glycerol, DMSO, and ethylene glycol. Exemplary compositions may contain up to 10% cryoprotectant, such as sucrose. In certain embodiments, LNP compositions may contain about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10% cryoprotectant. In certain embodiments, LNP compositions may contain about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10% sucrose. In some embodiments, LNP compositions may contain a buffer. In some embodiments, the buffer may include phosphate buffer (PBS), Tris buffer, citrate buffer, and mixtures thereof. In certain exemplary embodiments, the buffer includes NaCl. In certain embodiments, NaCl is omitted. Exemplary amounts of NaCl may range from about 20 mM to about 45 mM. Exemplary amounts of NaCl can range from about 40 mM to about 50 mM, hi some embodiments, the amount of NaCl is about 45 mM.In some embodiments, the buffer is a Tris buffer. Exemplary amounts of Tris may range from about 20 mM to about 60 mM. Exemplary amounts of Tris may range from about 40 mM to about 60 mM. In some embodiments, the amount of Tris is about 50 mM. In some embodiments, the buffer comprises NaCl and Tris. A specific exemplary embodiment of an LNP composition contains 5% sucrose and 45 mM NaCl in a Tris buffer. In other exemplary embodiments, the composition contains about 5% w / v sucrose, about 45 mM NaCl, and about 50 mM Tris at pH 7.5. The amounts of salt, buffer, and cryoprotectant may be varied to maintain the osmolality of the entire formulation. For example, the final osmolality may be maintained below 450 mOsm / L. In further embodiments, the osmolality is between 350 and 250 mOsm / L. Certain embodiments have a final osmolality of 300±20 mOsm / L.

[0541] In some embodiments, microfluidic mixing, T-mixing, or cross-mixing is used. In certain embodiments, the flow rate, junction size, junction geometry, junction shape, tubing diameter, solution, and / or RNA and lipid concentrations may be varied. LNPs or LNP compositions may be concentrated or purified, for example, via dialysis, tangential flow filtration, or chromatography. LNPs may be stored, for example, as a suspension, emulsion, or lyophilized powder. In some embodiments, LNP compositions are stored at 2-8°C, and in certain embodiments, LNP compositions are stored at room temperature. In additional embodiments, LNP compositions are stored frozen, for example, at -20°C or -80°C. In other embodiments, LNP compositions are stored at temperatures ranging from about 0°C to about -80°C. Frozen LNP compositions may be thawed, for example, on ice, at room temperature, or at 25°C, prior to use.

[0542] LNPs may be, for example, microspheres (unilamellar and multilamellar vesicles, e.g., "liposomes," which in some embodiments are substantially spherical and, in more particular embodiments, comprise a lamellar phase lipid bilayer that may include an aqueous core, e.g., containing a substantial portion of RNA molecules), the dispersed phase in an emulsion, a micelle, or the internal phase in a suspension.

[0543] Furthermore, the LNP compositions are biodegradable in that they do not accumulate to cytotoxic levels in vivo at therapeutically effective doses. In some embodiments, the LNP compositions do not elicit an innate immune response that results in substantial adverse effects at therapeutic dose levels. In some embodiments, the LNP compositions provided herein do not elicit toxicity at therapeutic dose levels.

[0544] In some embodiments, pdi may be in the range of about 0.005 to about 0.75. In some embodiments, pdi may be in the range of about 0.01 to about 0.5. In some embodiments, pdi may be in the range of about 0 to about 0.4. In some embodiments, pdi may be in the range of about 0 to about 0.35. In some embodiments, pdi may be in the range of about 0 to about 0.3. In some embodiments, pdi may be in the range of about 0 to about 0.25. In some embodiments, pdi may be in the range of about 0 to about 0.2. In some embodiments, pdi may be less than about 0.08, 0.1, 0.15, 0.2, or 0.4.

[0545] The LNPs disclosed herein have a size (e.g., Z-average diameter) of about 1 to about 250 nm. In some embodiments, the LNPs are about 10 to about 200 nm in size. In further embodiments, the LNPs are about 20 to about 150 nm in size. In some embodiments, the LNPs are about 50 to about 150 nm in size. In some embodiments, the LNPs are about 50 to about 100 nm in size. In some embodiments, the LNPs are about 50 to about 120 nm in size. In some embodiments, the LNPs are about 60 to about 100 nm in size. In some embodiments, the LNPs are about 75 to about 150 nm in size. In some embodiments, the LNPs are about 75 to about 120 nm in size. In some embodiments, the LNPs are about 75 to about 100 nm in size. Unless otherwise indicated, all sizes referred to herein are the average size (diameter) of fully formed nanoparticles as measured by dynamic light scattering on a Malvern Zetasizer. Nanoparticle samples are diluted in phosphate-buffered saline (PBS) to yield counts of approximately 200-400 kcp. Data are presented as the weighted average of intensity measurements (Z-average diameter).

[0546] In some embodiments, LNPs are formed with an average encapsulation efficiency ranging from about 50% to about 100%. In some embodiments, LNPs are formed with an average encapsulation efficiency ranging from about 50% to about 70%. In some embodiments, LNPs are formed with an average encapsulation efficiency ranging from about 70% to about 90%. In some embodiments, LNPs are formed with an average encapsulation efficiency ranging from about 90% to about 100%. In some embodiments, LNPs are formed with an average encapsulation efficiency ranging from about 75% to about 95%.

[0547] In some embodiments, LNPs are formed with an average molecular weight ranging from about 1.00E+05 g / mol to about 1.00E+10 g / mol. In some embodiments, LNPs are formed with an average molecular weight ranging from about 5.00E+05 g / mol to about 7.00E+07 g / mol. In some embodiments, LNPs are formed with an average molecular weight ranging from about 1.00E+06 g / mol to about 1.00E+10 g / mol. In some embodiments, LNPs are formed with an average molecular weight ranging from about 1.00E+07 g / mol to about 1.00E+09 g / mol. In some embodiments, LNPs are formed with an average molecular weight ranging from about 5.00E+06 g / mol to about 5.00E+09 g / mol.

[0548] In some embodiments, the polydispersity (Mw / Mn, the ratio of weight average molar mass (Mw) to number average molar mass (Mn)) may be in the range of about 1.000 to about 2.000. In some embodiments, Mw / Mn may be in the range of about 1.00 to about 1.500. In some embodiments, Mw / Mn may be in the range of about 1.020 to about 1.400. In some embodiments, Mw / Mn may be in the range of about 1.010 to about 1.100. In some embodiments, Mw / Mn may be in the range of about 1.100 to about 1.350.

[0549] Dynamic light scattering ("DLS") can be used to characterize the polydispersity index ("pdi") and size of the LNPs of the present disclosure. DLS measures the scattering of light resulting from exposing a sample to a light source. The PDI determined from DLS measurements represents the distribution of particle sizes (around the average particle size) within an aggregate, with a completely uniform aggregate having a PDI of zero. In some embodiments, the pdi may range from 0.005 to 0.75. In some embodiments, the pdi may range from 0.01 to 0.5. In some embodiments, the pdi may range from 0.02 to 0.4. In some embodiments, the pdi may range from 0.03 to 0.35. In some embodiments, the pdi may range from 0.1 to 0.35.

[0550] In some embodiments, the LNPs disclosed herein are 1-250 nm in size. In some embodiments, the LNPs are 10-200 nm in size. In further embodiments, the LNPs are 20-150 nm in size. In some embodiments, the LNPs are 50-150 nm in size. In some embodiments, the LNPs are 50-100 nm in size. In some embodiments, the LNPs are 50-120 nm in size. In some embodiments, the LNPs are 75-150 nm in size. In some embodiments, the LNPs are 30-200 nm in size. Unless otherwise indicated, all sizes referred to herein are the average size (diameter) of fully formed nanoparticles as measured by dynamic light scattering on a Malvern Zetasizer. Nanoparticle samples are diluted with phosphate-buffered saline (PBS) to yield approximately 200-400 kcal counts. Data are presented as a weighted average of intensity measurements. In some embodiments, LNPs are formed with an average encapsulation efficiency ranging from 50% to 100%. In some embodiments, LNPs are formed with an average encapsulation efficiency ranging from 50% to 70%. In some embodiments, LNPs are formed with an average encapsulation efficiency ranging from 70% to 90%. In some embodiments, LNPs are formed with an average encapsulation efficiency ranging from 90% to 100%. In some embodiments, LNPs are formed with an average encapsulation efficiency ranging from 75% to 95%.

[0551] In some embodiments, LNPs associated with a gRNA disclosed herein and a nucleic acid (e.g., mRNA) encoding an RNA-guided DNA binder (e.g., Cas9, Spy Cas9) disclosed herein are for use in the preparation of a medicament for treating ATTR. In some embodiments, LNPs associated with a gRNA disclosed herein and a nucleic acid (e.g., mRNA) encoding an RNA-guided DNA binder (e.g., Cas9, Spy Cas9) disclosed herein are for use in the preparation of a medicament for reducing or preventing TTR accumulation and aggregation in amyloid or amyloid fibrils in a subject with ATTR. In some embodiments, LNPs associated with a gRNA disclosed herein and a nucleic acid (e.g., mRNA) encoding an RNA-guided DNA binder (e.g., Cas9, Spy Cas9) disclosed herein are for use in the preparation of a medicament for reducing serum TTR levels. In some embodiments, the gRNAs disclosed herein and LNPs associated with nucleic acids (e.g., mRNA) encoding the RNA-guided DNA binding agents (e.g., Cas9, Spy Cas9) disclosed herein are for use in treating ATTR in a subject, e.g., a mammal, e.g., a primate such as a human. In some embodiments, the gRNAs disclosed herein and LNPs associated with nucleic acids (e.g., mRNA) encoding the RNA-guided DNA binding agents (e.g., Cas9, Spy Cas9) disclosed herein are for use in reducing or preventing the accumulation and aggregation of TTR in amyloid or amyloid fibrils in a subject, e.g., a mammal, e.g., a primate such as a human, with ATTR. In some embodiments, the gRNAs disclosed herein and LNPs associated with nucleic acids (e.g., mRNA) encoding the RNA-guided DNA binding agents (e.g., Cas9, Spy Cas9) disclosed herein are for use in reducing serum TTR levels in a subject, e.g., a mammal, e.g., a primate such as a human.

[0552] Electroporation is also a well-known means for delivering cargo, and any electroporation methodology can be used to deliver any one of the gRNAs disclosed herein.In some embodiments, electroporation can be used to deliver any one of the gRNAs disclosed herein and RNA-guided DNA nucleases such as Cas9 or nucleic acids encoding RNA-guided DNA nucleases such as Cas9.

[0553] In some embodiments, the present invention includes a method for delivering any one of the gRNAs disclosed herein and nucleic acids (e.g., mRNAs) encoding the RNA-guided DNA-binding agents (e.g., Cas9, Spy Cas9) disclosed herein to a cell ex vivo, wherein the gRNA and nucleic acid are associated with a LNP.

[0554] In certain embodiments, the present invention includes DNA or RNA vectors encoding any of the guide RNAs comprising any one or more of the guide sequences described herein. In some embodiments, in addition to the guide RNA sequence, the vector further comprises a nucleic acid that does not encode the guide RNA. The nucleic acid that does not encode the guide RNA includes, but is not limited to, a promoter, an enhancer, a regulatory sequence, and a nucleic acid encoding an RNA-guided DNA nuclease (which may be a nuclease such as Cas9). In some embodiments, the vector comprises one or more nucleotide sequences encoding a crRNA, a trRNA, or a crRNA and a trRNA. In some embodiments, the vector comprises one or more nucleotide sequences encoding an sgRNA and a nucleic acid encoding an RNA-guided DNA nuclease, which may be a Cas nuclease, such as Cas9 or Cpfl. In some embodiments, the vector comprises one or more nucleotide sequences encoding a crRNA, a trRNA, and a nucleic acid encoding an RNA-guided DNA nuclease, which may be a Cas protein, such as Cas9. In one embodiment, the Cas9 is derived from Streptococcus pyogenes (i.e., Spy Cas9). In some embodiments, the nucleotide sequence encoding the crRNA, trRNA, or crRNA and trRNA (which may also be an sgRNA) comprises or consists of a guide sequence flanked by all or part of repeat sequences from a naturally occurring CRISPR / Cas system. A nucleic acid comprising or consisting of a crRNA, trRNA, or crRNA and trRNA may further comprise a vector sequence, wherein the vector sequence comprises or consists of a nucleic acid sequence not found with the crRNA, trRNA, or crRNA and trRNA in nature.

[0555] In some embodiments, the crRNA and trRNA are encoded by non-contiguous nucleic acids within a single vector. In other embodiments, the crRNA and trRNA may be encoded by contiguous nucleic acids. In some embodiments, the crRNA and trRNA are encoded by opposite strands of a single nucleic acid. In other embodiments, the crRNA and trRNA are encoded by the same strand of a single nucleic acid.

[0556] In some embodiments, the vector may be circular. In other embodiments, the vector may be linear. In some embodiments, the vector may be encapsulated in a lipid nanoparticle, a liposome, a non-lipid nanoparticle, or a viral capsid. Non-limiting exemplary vectors include plasmids, phagemids, cosmids, artificial chromosomes, chromosomes, minichromosomes, transposons, viral vectors, and expression vectors.

[0557] In some embodiments, the vector may be a viral vector. In some embodiments, the viral vector may be genetically modified from its wild-type counterpart. For example, a viral vector may contain insertions, deletions, or substitutions of one or more nucleotides to facilitate cloning or to alter one or more characteristics of the vector. Such characteristics may include packaging ability, transduction efficiency, immunogenicity, genome integration, replication, transcription, and translation. In some embodiments, a portion of the viral genome may be deleted to allow packaging of foreign sequences having larger sizes. In some embodiments, the viral vector may have enhanced transduction efficiency. In some embodiments, the immune response elicited by the virus in the host may be reduced. In some embodiments, a viral gene that facilitates integration of viral sequences into the host genome (e.g., integrase, etc.) may be mutated to render the virus non-integrating. In some embodiments, the viral vector may be replication-deficient. In some embodiments, the viral vector may contain exogenous transcriptional or translational regulatory sequences that drive expression of coding sequences on the vector. In some embodiments, the virus may be helper-dependent. For example, one or more helper viruses may be required to provide viral components (e.g., viral proteins) required for amplification and packaging of vectors into viral particles. In such cases, one or more helper components, including one or more vectors encoding viral components, may be introduced into host cells along with the vector systems described herein. In other embodiments, the virus may be helper-free. For example, the virus may be capable of amplifying and packaging vectors without any helper virus. In some embodiments, the vector systems described herein may also encode viral components required for viral amplification and packaging.

[0558] Non-limiting exemplary viral vectors include adeno-associated viral (AAV) vectors, lentiviral vectors, adenoviral vectors, helper-dependent adenoviral vectors (HDAd), herpes simplex viral (HSV-1) vectors, bacteriophage T4, baculoviral vectors, and retroviral vectors. In some embodiments, the viral vector may be an AAV vector. In some embodiments, the viral vector is AAV2, AAV3, AAV3B, AAV5, AAV6, AAV6.2, AAV7, AAVrh.64R1, AAVhu.37, AAVrh.8, AAVrh.32.33, AAV8, AAV9, AAVrh10, or AAVLK03. In other embodiments, the viral vector may be a lentiviral vector.

[0559] In some embodiments, the lentivirus may be non-integrating. In some embodiments, the viral vector may be an adenovirus vector. In some embodiments, the adenovirus may be a high-cloning-capacity, or "gutless," adenovirus, in which all coding viral regions are removed from the 5' and 3' inverted terminal repeats (ITRs) and the packaging signal ("I") is deleted from the virus to increase its packaging capacity. In yet other embodiments, the viral vector may be an HSV-1 vector. In some embodiments, HSV-1-based vectors are helper-dependent, while in other embodiments, they are vector-independent. For example, amplicon vectors that retain only the packaging sequence require a helper virus with structural components for packaging, while a 30 kb-deleted HSV-1 that removes non-essential viral functions does not require a helper virus. In additional embodiments, the viral vector may be bacteriophage T4. In some embodiments, bacteriophage T4 can package any linear or circular DNA or RNA molecule when the viral head is empty. In a further embodiment, the viral vector can be a baculovirus vector.In yet a further embodiment, the viral vector can be a retrovirus vector.In an embodiment that uses AAV or lentivirus vectors with smaller cloning capacity, it may be necessary to use more than one vector to deliver all the components of the vector system as disclosed herein.For example, one AAV vector can contain the sequence encoding RNA-guided DNA nuclease such as Cas nuclease, while the second AAV vector can contain one or more guide sequences.

[0560] In some embodiments, the vector can drive expression of one or more coding sequences in a cell. In some embodiments, the cell can be a prokaryotic cell, such as a bacterial cell. In some embodiments, the cell can be a eukaryotic cell, such as a yeast, plant, insect, or mammalian cell. In some embodiments, the eukaryotic cell can be a mammalian cell. In some embodiments, the eukaryotic cell can be a rodent cell. In some embodiments, the eukaryotic cell can be a human cell. Suitable promoters for driving expression in different types of cells are known in the art. In some embodiments, the promoter can be wild-type. In other embodiments, the promoter can be modified for more efficient or effective expression. In still other embodiments, the promoter can be shortened but still maintain its function. For example, the promoter can have a normal length or a reduced size for proper packaging of the vector into a virus.

[0561] In some embodiments, the vector may include a nucleotide sequence encoding an RNA-guided DNA nuclease, such as the nucleases described herein. In some embodiments, the nuclease encoded by the vector may be a Cas protein. In some embodiments, the vector system may include one copy of the nucleotide sequence encoding the nuclease. In other embodiments, the vector system may include more than one copy of the nucleotide sequence encoding the nuclease. In some embodiments, the nucleotide sequence encoding the nuclease may be operably linked to at least one transcriptional or translational control sequence. In some embodiments, the nucleotide sequence encoding the nuclease may be operably linked to at least one promoter.

[0562] In some embodiments, the promoter may be constitutive, inducible, or tissue-specific. In some embodiments, the promoter may be a constitutive promoter. Non-limiting exemplary constitutive promoters include the cytomegalovirus immediate early promoter (CMV), the simian virus (SV40) promoter, the adenovirus major late (MLP) promoter, the Rous sarcoma virus (RSV) promoter, the mouse mammary tumor virus (MMTV) promoter, the phosphoglycerin kinase (PGK) promoter, the elongation factor alpha (EF1a) promoter, the ubiquitin promoter, the actin promoter, the tubulin promoter, the immunoglobulin promoter, functional fragments thereof, or any combination of the foregoing. In some embodiments, the promoter may be a CMV promoter. In some embodiments, the promoter may be a truncated CMV promoter. In other embodiments, the promoter may be the EF1a promoter. In some embodiments, the promoter may be an inducible promoter. Non-limiting exemplary inducible promoters include those inducible by heat shock, light, chemicals, peptides, metals, steroids, antibiotics, or alcohol. In some embodiments, the inducible promoter may be one that has a low basal (uninduced) expression level, such as the Tet-On® promoter (Clontech).

[0563] In some embodiments, the promoter may be a tissue-specific promoter, for example, a promoter specific for expression in the liver.

[0564] The vector may further comprise a nucleotide sequence encoding a guide RNA described herein. In some embodiments, the vector comprises one copy of the guide RNA. In other embodiments, the vector comprises more than one copy of the guide RNA. In embodiments with more than one guide RNA, the guide RNAs may be non-identical and target different target sequences, or they may be identical in that they target the same target sequence. In some embodiments in which the vector comprises more than one guide RNA, each guide RNA may have other different properties, such as activity or stability in a complex with an RNA-guided DNA nuclease (e.g., a Cas RNP complex). In some embodiments, the nucleotide sequence encoding the guide RNA may be operably linked to at least one transcriptional or translational regulatory sequence, such as a promoter, a 3'UTR, or a 5'UTR. In one embodiment, the promoter may be a tRNA promoter, e.g., a tRNALys3, or a tRNA chimera. See Mefferd et al., RNA. 2015 21:1683-9; Scherer et al., Nucleic Acids Res. 2007 35:2620-2628. In some embodiments, the promoter can be recognized by RNA polymerase III (Pol III). Non-limiting examples of Pol III promoters include the U6 and H1 promoters. In some embodiments, the nucleotide sequence encoding the guide RNA can be operably linked to a mouse or human U6 promoter. In other embodiments, the nucleotide sequence encoding the guide RNA can be operably linked to a mouse or human H1 promoter. In embodiments with more than one guide RNA, the promoters used to drive expression can be the same or different. In some embodiments, the nucleotides encoding the crRNA of the guide RNA and the nucleotides encoding the trRNA of the guide RNA can be provided on the same vector.In some embodiments, the nucleotides encoding the crRNA and the nucleotides encoding the trRNA can be driven by the same promoter. In some embodiments, the crRNA and the trRNA can be transcribed into a single transcript. For example, the crRNA and the trRNA can be processed from a single transcript to form a dual-molecule guide RNA. Alternatively, the crRNA and the trRNA can be transcribed into a single-molecule guide RNA (sgRNA). In other embodiments, the crRNA and the trRNA can be driven by their corresponding promoters on the same vector. In yet other embodiments, the crRNA and the trRNA can be encoded by different vectors.

[0565] In some embodiments, the nucleotide sequence encoding the guide RNA may be located on the same vector as the nucleotide sequence encoding the RNA-guided DNA nuclease, such as a Cas nuclease. In some embodiments, the expression of the guide RNA and the RNA-guided DNA nuclease, such as a Cas protein, may be driven by their respective promoters. In some embodiments, the expression of the guide RNA may be driven by the same promoter that drives the expression of the RNA-guided DNA nuclease, such as a Cas protein. In some embodiments, the transcripts of the guide RNA and the RNA-guided DNA nuclease, such as a Cas protein, may be contained within a single transcript. For example, the guide RNA may be located within the untranslated region (UTR) of the transcript of the RNA-guided DNA nuclease, such as a Cas protein. In some embodiments, the guide RNA may be located within the 5' UTR of the transcript. In other embodiments, the guide RNA may be located within the 3' UTR of the transcript. In some embodiments, the intracellular half-life of the transcript can be reduced by including the guide RNA within its 3' UTR, thereby shortening the length of the 3' UTR. In additional embodiments, the guide RNA may be located within an intron of the transcript. In some embodiments, suitable splice sites can be added in the intron within which the guide RNA is located to ensure proper splicing of the guide RNA from the transcript. In some embodiments, expression of an RNA-guided DNA nuclease, such as a Cas protein, and a guide RNA from the same vector in close temporal proximity can promote more efficient formation of CRISPR RNP complexes.

[0566] In some embodiments, the composition comprises a vector system. In some embodiments, the vector system may comprise one single vector. In other embodiments, the vector system may comprise two vectors. In additional embodiments, the vector system may comprise three vectors. When different guide RNAs are used for multiplexing or when multiple copies of a guide RNA are used, the vector system may comprise more than three vectors.

[0567] In some embodiments, the vector system may include an inducible promoter to initiate expression only after delivery to the target cell. Non-limiting exemplary inducible promoters include those that are inducible by heat shock, light, chemicals, peptides, metals, steroids, antibiotics, or alcohol. In some embodiments, the inducible promoter may have a low basal (uninduced) expression level, such as the Tet-On® promoter (Clontech).

[0568] In additional embodiments, the vector system may contain tissue-specific promoters to initiate expression only after delivery to a specific tissue.

[0569] The vector can be delivered via liposomes, nanoparticles, exosomes, or microvesicles. The vector can also be delivered via lipid nanoparticles (LNPs). See, for example, WO2017 / 173054, published October 5, 2017, entitled "LIPID NANOPARTICLE FORMULATIONS FOR CRISPR / CAS COMPONENTS," and WO2019067992A1, published April 4, 2019, entitled "FORMULATIONS," the contents of each of which are incorporated herein by reference in their entireties. Any of the LNPs and LNP formulations described herein are suitable for delivering a guide alone or together with a Cas nuclease or a nucleic acid encoding a Cas nuclease. In some embodiments, an LNP composition is included that includes an RNA component and a lipid component, wherein the lipid component includes an amine lipid, a neutral lipid, a helper lipid, and a stealth lipid, and the N / P ratio is about 1 to 10.

[0570] In some cases, the lipid component comprises lipid A or its acetal analog, cholesterol, DSPC, and PEG-DMG, and the N / P ratio is about 1 to 10. In some embodiments, the lipid component comprises about 40 to 60 mol% amine lipid, about 5 to 15 mol% neutral lipid, and about 1.5 to 10 mol% PEG lipid, with the remainder of the lipid component being helper lipid, and the N / P ratio of the LNP composition is about 3 to 10. In some embodiments, the lipid component comprises about 50 to 60 mol% amine lipid, about 8 to 10 mol% neutral lipid, and about 2.5 to 4 mol% PEG lipid, with the remainder of the lipid component being helper lipid, and the N / P ratio of the LNP composition is about 3 to 8. In some cases, the lipid component comprises about 50-60 mol% amine lipid, about 5-15 mol% DSPC, and about 2.5-4 mol% PEG lipid, with the remainder of the lipid component being cholesterol, and the N / P ratio of the LNP composition is about 3 to 8. In some cases, the lipid component comprises 48-53 mol% lipid A, about 8-10 mol% DSPC, and about 1.5-10 mol% PEG lipid, with the remainder of the lipid component being cholesterol, and the N / P ratio of the LNP composition is 3-8 ± 0.2.

[0571] In some embodiments, the LNP comprises a lipid component comprising, consisting essentially of, or consisting of about 50 mol% amine lipid, such as lipid A, about 9 mol% neutral lipid, such as DSPC, and about 3 mol% stealth lipid, such as a PEG lipid (e.g., PEG2k-DMG), with the remainder of the lipid component being a helper lipid, such as cholesterol, and the N / P ratio of the LNP composition is about 6. In some embodiments, the amine lipid is lipid A. In some embodiments, the neutral lipid is DSPC. In some embodiments, the stealth lipid is a PEG lipid. In some embodiments, the stealth lipid is PEG2k-DMG. In some embodiments, the helper lipid is cholesterol. In some embodiments, the LNP comprises a lipid component comprising about 50 mol% lipid A, about 9 mol% DSPC, and about 3 mol% PEG2k-DMG, with the remainder of the lipid component being cholesterol, and the N / P ratio of the LNP composition is about 6.

[0572] In some embodiments, the vector can be delivered systemically, hi some embodiments, the vector can be delivered to the hepatic circulation.

[0573] This description and exemplary embodiments should not be construed as limiting. In this specification and the appended claims, unless otherwise indicated, all numbers expressing quantities, percentages, or proportions, and other numerical values ​​used in the specification and claims should be understood in each instance to be modified by the term "about" and by the unmodified range. Thus, unless otherwise indicated, the numerical parameters set forth in the following specification and the appended claims are approximations that may vary depending on the desired properties sought to be obtained. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0574] It should be noted that, as used in this specification and the appended claims, the singular forms "a," "an," and "the," and the use of the singular form of any word, include plural referents unless expressly and unambiguously limited to one referent. As used herein, the term "include" and its grammatical variations are intended to be open-ended, such that the recitation of items in a list does not exclude other similar items that may be substituted for or added to the listed items. [Example]

[0575] The following examples are provided to illustrate certain disclosed embodiments and should not be construed as limiting the scope of the disclosure in any way.

[0576] General Reagents and Methods Unless otherwise indicated, mRNA was synthesized by in vitro transcription (IVT) using a linear plasmid DNA template and T7 RNA polymerase. Transcription was generally performed from a construct containing a T7 promoter, a transcription sequence disclosed herein, such as SEQ ID NO:243 (encoding the RNA ORF of SEQ ID NO:204), and a plasmid-encoded polyA tail (SEQ ID NO:263).

[0577] For all methods, transcript concentrations were determined by measuring light absorbance at 260 nm (Nanodrop) and transcripts were analyzed by capillary electrophoresis with a Bioanlayzer (Agilent).

[0578] LNP formulation The lipid components were dissolved in 100% ethanol at the lipid component molar ratios listed below. The chemically modified sgRNA and Cas9 mRNA were combined and dissolved in 25 mM citrate, 100 mM NaCl, pH 5.0, resulting in a total RNA cargo concentration of approximately 0.45 mg / mL. LNPs were formulated with an N / P ratio of approximately 6, with a chemically modified sgRNA:Cas9 mRNA ratio of 1:2 w / w, as described below. Unless otherwise indicated, LNPs were formulated with 50% lipid A, 9% DSPC, 38% cholesterol, and 3% PEG2k-DMG.

[0579] LNPs were formed by impinging jet mixing of lipids in ethanol, two parts by volume of RNA solution, and one part by volume of water. The lipids in ethanol were mixed with two parts by volume of RNA solution by cross-mixing. A fourth water stream was mixed with the cross-flow output through an in-line tee (see, e.g., WO2016 / 010840, Figure 2). A 2:1 ratio of aqueous to organic solvent was maintained during mixing using differential flow. The LNPs were held at room temperature for 1 hour and further diluted with water (approximately 1:1 v / v). The diluted LNPs were concentrated using tangential flow filtration on a flat-sheet cartridge (Sartorius, 100 kD MWCO) and then buffer exchanged into 50 mM Tris, 45 mM NaCl, 5% (w / v) sucrose, pH 7.5 (TSS) by di...

Claims

1. 1. A composition comprising: (i) a nucleic acid comprising an open reading frame (ORF) encoding Cas9, wherein the ORF comprises the sequence of SEQ ID NO: 311; (ii) a single guide RNA (sgRNA) comprising the sequence of SEQ ID NO:

87.

2. 1. A composition for use in modifying and / or inducing a double strand break (DSB) in a FAP receptor gene, said composition comprising: (i) a nucleic acid comprising an open reading frame (ORF) encoding Cas9, wherein the ORF comprises the sequence of SEQ ID NO: 311; (ii) a single guide RNA (sgRNA) comprising the sequence of SEQ ID NO:

87.

3. 1. A composition for use in reducing FTR serum concentrations, treating FTR-associated amyloidosis (ATTR), and / or reducing or preventing accumulation of amyloid or amyloid fibrils comprising FTR in a subject, said composition comprising: (i) a nucleic acid comprising an open reading frame (ORF) encoding Cas9, wherein the ORF comprises the sequence of SEQ ID NO: 311; (ii) a single guide RNA (sgRNA) comprising the sequence of SEQ ID NO:

87.

4. 2. The composition of claim 1 for use in inducing a double strand break (DSB) in the FcG2 gene in a cell or subject, modifying the FcG2 gene in a cell or subject, treating FcG2-associated amyloidosis (ATTR) in a subject, reducing FcG2 serum concentrations in a subject, or reducing or preventing amyloid or amyloid fibril accumulation in a subject.

5. The composition of any one of claims 2 to 4, wherein the composition is formulated to be administered by infusion for greater than 30 minutes.

6. The composition, (a) reducing serum TTR levels; (b) causing editing of the TTR gene; (c) reducing amyloid deposition in at least one tissue; or (d) A combination of two or more of (a) to (c); The composition according to any one of claims 2 to 5.

7. A composition described in any one of claims 1 to 6, wherein Cas9 is modified.

8. A composition described in any one of claims 1 to 7, wherein Cas9 includes a nuclear localization signal (NLS).

9. A nucleic acid encoding Cas9, (a) a 5'UTR having at least 90% identity to any one of SEQ ID NOs: 232, 234, 236, 238, 241, or 275-277; or (b) a 3′UTR having at least 90% identity to any one of SEQ ID NOs: 233, 235, 237, 239, or 240. The composition according to any one of claims 1 to 8, comprising:

10. The composition of any one of claims 1 to 9, wherein the nucleic acid encoding Cas9 comprises a 5'UTR and a 3'UTR from the same source.

11. The composition described in any one of claims 1 to 10, wherein the nucleic acid encoding Cas9 is an mRNA including a 5' cap selected from Cap0, Cap1, and Cap2.

12. The composition of any one of claims 1 to 11, wherein the nucleic acid comprising an ORF encoding Cas9 is an mRNA comprising a sequence having at least 95%, 96%, 97%, 98%, 99%, or 99.5% identity to SEQ ID NO:

377.

13. A composition described in any one of claims 1 to 12, wherein the nucleic acid comprising an ORF encoding Cas9 is an mRNA comprising the sequence of SEQ ID NO:

377.

14. The composition of any one of claims 1 to 13, wherein the nucleic acid is an mRNA in which at least 10% of the uridines are replaced with modified uridines.

15. 15. The composition of claim 14, wherein the modified uridine is one or more of N1-methyl-pseudouridine, pseudouridine, 5-methoxyuridine, or 5-iodouridine.

16. The composition of any one of claims 1 to 15, wherein the composition is a lipid nanoparticle (LNP) formulation.

17. The composition described in claim 16, wherein the LNP comprises an ionic lipid, a helper lipid, a stealth lipid, and a neutral lipid.

18. The composition of claim 17, wherein the ionic lipid is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate.

19. The LNP, (i) (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, (ii) distearoylphosphatidylcholine (DSPC); (iii) cholesterol, and (iv) Polyethylene glycol-dimyristoyl glycerol (PEG-DMG) 17. The composition of claim 16, comprising:

20. The LNP formulation is (i) about 50 mol % of (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate; (ii) about 9 mol% distearoylphosphatidylcholine (DSPC); (iii) about 38 mol % cholesterol, and (iv) about 3 mol% polyethylene glycol-dimyristoyl glycerol (PEG-DMG) 17. The composition of claim 16, comprising:

21. The composition of any one of claims 1 to 20, wherein the composition is a pharmaceutical formulation and further comprises a pharma- ceutically acceptable carrier.

22. (i) The subject has ATTR. (ii) the subject has only or primarily neurological symptoms of familial amyloidotic polyneuropathy, or only or primarily cardiac symptoms of familial amyloidotic cardiomyopathy; (iii) the subject expresses a FAP1 gene having a V30 mutation, a FAP1 gene having a T60 mutation, a FAP1 gene having a V122 mutation, or a wild-type FAP1 gene; or A combination of two or more of (i) to (iii) above. The composition according to any one of claims 3 to 21.

23. The composition described in claim 22, wherein the V30 mutation is V30A, V30G, V30L, or V30M.

24. The composition described in claim 22, wherein the T60 mutation is T60A.

25. The composition of claim 22, wherein the V122 mutation is V122A, V122I, or V122(-).

26. The composition according to any one of claims 3 to 25, wherein the subject is a human.

27. The composition of any one of claims 2 to 26, wherein non-homologous end joining (NHEJ) causes a mutation during repair of a DSB in the FAP gene that induces a frameshift or nonsense mutation in the FAP gene.

28. 28. Use of a composition according to any one of claims 1 or 7 to 27 for the preparation of a medicament for treating a human subject having ATTR.

Images