Method for producing extracellular vesicles

Abstract

To provide methods for producing extracellular vesicles capable of increasing the inclusion amount of nucleic acid medicines.SOLUTION: The method for producing extracellular vesicles encapsulating a nucleic acid medicine comprises a step 1 of culturing a cell supplying extracellular vesicles in the presence of the nucleic acid medicine, where the nucleic acid medicine used in the step 1 comprises an antisense strand and a sense strand whose 3' end and 5' end are respectively modified. Preferably, the 3' end of the sense strand of the nucleic acid medicine is modified with a nucleic acid aptamer or a compound having a polyethylene glycol chain, or the 5' end of the sense strand of the nucleic acid medicine is modified with a nucleic acid aptamer or a compound having a polyethylene glycol chain.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a method for producing extracellular vesicles. [Background technology]

[0002] Conventionally, studies have been conducted on technologies that spatially, temporally, and quantitatively control the distribution of drugs in the body from the viewpoint of enhancing pharmacological effects and reducing side effects. The above technologies are called drug delivery systems (DDS), and in recent years, there has been a demand for improvements in DDS technology at the cellular level in order to efficiently deliver targeted drugs to targeted cells, such as cancer cells.

[0003] As a technology related to such DDS at the cellular level, for example, the technology described in Patent Document 1 is known. Patent Document 1 proposes exosomes for introducing a foreign substance such as a compound having antitumor activity into target cells (e.g., cancer cells), the exosomes encapsulating the foreign substance. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] International Publication No. 2016 / 076347 Summary of the Invention [Problem to be solved by the invention]

[0005] The above-mentioned Patent Document 1 describes an electroporation method (electroporation method) as a method for encapsulating a foreign substance in an exosome. In the electroporation method, a suspension containing a foreign substance is applied with a predetermined electric pulse to open minute holes in the exosome, thereby introducing the foreign substance, which may destroy the exosome. In addition, the method has a problem that the introduction rate of the foreign substance into the exosome is low (the amount of the foreign substance encapsulated is small), and improvements are required.

[0006] An object of the present invention is to provide a method for producing extracellular vesicles that can improve the amount of nucleic acid medicine encapsulated. [Means for solving the problem]

[0007] The present inventors have conducted intensive research to solve the above problems, and have arrived at the present invention. That is, the present invention is a method for producing extracellular vesicles encapsulating a nucleic acid drug, which includes a step 1 of culturing a source cell of the extracellular vesicles in the presence of the nucleic acid drug, and the nucleic acid drug used in the step 1 is a nucleic acid drug having a sense strand and an antisense strand modified at the 3'-end and 5'-end, respectively. Effect of the Invention

[0008] According to the present invention, a method for producing extracellular vesicles capable of increasing the amount of nucleic acid medicine encapsulated therein can be provided. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0009] The method for producing extracellular vesicles of the present invention includes step 1 of culturing a source cell of extracellular vesicles in the presence of a nucleic acid drug. Step 1 is a step of culturing a source cell of extracellular vesicles in the presence of a nucleic acid drug. In the following explanation, "sequence (1)" means "sequence number (1)" in this specification or in the sequence listing, and the same applies to sequences other than sequence (1).

[0010] Nucleic acid drugs act directly on the body without the involvement of gene expression. In addition, nucleic acid drugs are drugs that have high specificity for target substances. Examples of nucleic acid drugs include siRNA and double-stranded heterogeneous nucleic acids. The nucleic acid drug used in step 1 has a sense strand modified at the 3' end and 5' end, and an antisense strand.

[0011] As the nucleic acid drug used in step 1, a nucleic acid drug having a sense strand whose 3' end is modified by a nucleic acid aptamer or a polyethylene glycol chain, and a nucleic acid drug having a sense strand whose 5' end is modified by a compound having a polyethylene glycol chain or a nucleic acid aptamer are preferred, and a nucleic acid drug having a sense strand whose 3' end is modified by a nucleic acid aptamer and whose 5' end is modified by a compound having a polyethylene glycol chain are more preferred. A nucleic acid drug having a sense strand whose 3' end is modified by a nucleic acid aptamer is easily introduced into extracellular vesicles, so that the amount of nucleic acid drug contained in the extracellular vesicles can be increased. A nucleic acid drug having a sense strand whose 5' end is modified by a compound having a polyethylene glycol chain is excellent in stability because it suppresses degradation by degradative enzymes, and can extend the residence time in the target cells.

[0012] Examples of the nucleic acid aptamer that can modify the 3' end of the sense strand include single-stranded nucleic acids such as single-stranded RNA and single-stranded DNA, and double-stranded nucleic acids such as double-stranded RNA and double-stranded DNA. The nucleic acid aptamer refers to a nucleic acid molecule that can specifically bind to a specific target substance, and may be naturally derived or produced by a known method (such as the SELEX method described below).

[0013] The nucleic acid aptamer may be modified at either or both of the 3'-end and 5'-end. The stability of the nucleic acid can be improved by modifying the ends. The binding affinity of the nucleic acid aptamer to the target substance is provided by the three-dimensional structure of the nucleic acid aptamer, so as long as the three-dimensional structure is maintained, the binding affinity of the nucleic acid aptamer to the target substance can be maintained even if other base sequences or modifying substances are added to the end of the nucleic acid aptamer. Examples of end modifications include biotin, polyethylene glycol (PEG), fluorescent substances, luminescent substances, carboxyfluorescein (FAM), peptides, amino acids, lipids, etc. The above modifications may be bound to the nucleic acid aptamer via a spacer sequence. The spacer sequence may be of any length, but is preferably 0 to 20 bases.

[0014] The nucleic acid aptamer may be obtained, for example, by the SELEX (Systematic Evolution of Ligands by EXpotential enrichment) method (Tuerk, C. and Gold, L., Science, Vol. 249, pp. 505-510, 1990). The SELEX method is a method for selecting only nucleic acids that bind to a target molecule with high affinity by repeating a cycle of selecting and amplifying a nucleic acid that binds to a target molecule from a nucleic acid library containing random sequences, for example, 5 to 20 times. The nucleic acid aptamer obtained by the SELEX method can be prepared by various conventionally known synthesis methods after determining its base sequence. For example, the nucleic acid aptamer can be prepared by a chemical synthesis method.

[0015] Examples of compounds having a polyethylene glycol chain that can modify the 5' end of the sense strand include polyethylene glycol, linear or branched polyethylene glycol N-hydroxysuccinimide (NHS) esters, etc. Examples of compounds having a polyethylene glycol chain include polyethylene glycol modifiers [SUNBRIGHT (registered trademark) series] manufactured by Yuka Sangyo Co., Ltd. The sense strand modified at the 5' end with a compound having a polyethylene glycol chain can be obtained, for example, by reacting a nucleic acid having an amino group at the 5' end (nucleic acid to be the sense strand) with a compound having a polyethylene glycol chain.

[0016] The antisense strand of the nucleic acid drug may be modified at the 5'-end and / or 3'-end. The 5'-end and 3'-end of the antisense strand of the nucleic acid drug are located opposite the 3'-end and 5'-end of the sense strand, respectively, and the base sequence of the antisense strand is complementary to the base sequence of the sense strand.

[0017] Specific examples of nucleic acid medicines that can be used in the present invention will be described below. The nucleic acid drug may be a nucleic acid drug having a sense strand having the base sequence of sequence (1) and an antisense strand having the base sequence of sequence (2), the 5' end of which is modified with a compound having a polyethylene glycol chain, the 3' end of which is modified with a nucleic acid aptamer, the sense strand having the base sequence of sequence (3), and the antisense strand having the base sequence of sequence (4); the 5' end of which is modified with a compound having a polyethylene glycol chain, the 3' end of which is modified with a nucleic acid aptamer, the sense strand having the base sequence of sequence (5), and the antisense strand having the base sequence of sequence (6); the 5' end of which is modified with a compound having a polyethylene glycol chain, the 3' end of which is modified with a nucleic acid aptamer, the sense strand having the base sequence of sequence (7), and the antisense strand having the base sequence of sequence (8); the 5' end of which is modified with a compound having a polyethylene glycol chain, the 3' end of which is modified with a nucleic acid aptamer, and the sense strand having the base sequence of sequence (8); a nucleic acid drug having a sense strand having the base sequence of sequence (10) and an antisense strand having the base sequence of sequence (11), the 5'-end of which is modified with a compound having a polyethylene glycol chain and the 3'-end of which is modified with a nucleic acid aptamer, and the antisense strand having the base sequence of sequence (12); a nucleic acid drug having a sense strand having the base sequence of sequence (13) and an antisense strand having the base sequence of sequence (14), the 5'-end of which is modified with a compound having a polyethylene glycol chain and the 3'-end of which is modified with a nucleic acid aptamer; Examples of such nucleic acid drugs include a nucleic acid drug having an antisense strand having the base sequence of sequence (15), a nucleic acid drug whose 5' end is modified with a compound having a polyethylene glycol chain and whose 3' end is modified with a nucleic acid aptamer, and which has a sense strand having the base sequence of sequence (15) and an antisense strand having the base sequence of sequence (16), and a nucleic acid drug whose 5' end is modified with a nucleic acid aptamer and whose 3' end is modified with a compound having a polyethylene glycol chain, and which has a sense strand having the base sequence of sequence (21) and an antisense strand having the base sequence of sequence (22).

[0018] The source cells of the extracellular vesicles are not particularly limited, but examples thereof include various cultured cells such as human-derived mesenchymal stem cells, primary cultured cells, passaged cells, and cell lines derived from animals other than humans (specifically mammals), as well as various cells present in the living body (e.g., epithelial cells, fibroblasts, muscle cells, immune system cells, hematopoietic cells, etc.).

[0019] In step 1, when culturing the source cells of the extracellular vesicles in the presence of the nucleic acid drug, it is preferable to use a transfection reagent together with the nucleic acid drug. The use of the transfection reagent makes it easier to introduce the nucleic acid drug into the source cells. The transfection reagent may be selected from the group consisting of cationic polymers, cationic lipids, polyamine-based reagents, polyimine-based reagents, and calcium phosphate. The Lipofectamine (registered trademark) series manufactured by Thermo may also be used as the transfection reagent.

[0020] The culture conditions (temperature, environment, time, etc.) of the source cells of the extracellular vesicles are not particularly limited and can be selected in consideration of the type of the source cells, the type of the nucleic acid drug, etc. For example, when the source cells are human-derived mesenchymal stem cells and the nucleic acid drug is siRNA that suppresses the expression of luciferase, the culture temperature is preferably 35°C to 39°C, and the culture is preferably performed under CO2 conditions. The culture time can be appropriately set in consideration of the properties of the cells.

[0021] The method for producing extracellular vesicles of the present invention may include a step (step 2) of purifying and / or separating extracellular vesicles from the culture medium obtained after performing step 1. Examples of methods for purifying or separating extracellular vesicles from the culture medium include centrifugation methods.

[0022] The extracellular vesicles obtained by the production method of the present invention preferably have a diameter of 10 nm or more, more preferably 20 nm or more, and preferably 200 nm or less, more preferably 150 nm or less. When the diameter of the extracellular vesicles is equal to or greater than the lower limit, the amount of nucleic acid drug encapsulated therein can be increased, and when the diameter of the extracellular vesicles is equal to or less than the upper limit, the extracellular vesicles encapsulating the nucleic acid drug are easily secreted from the source cell to the outside. In addition, when the extracellular vesicles are administered to the target cells, the extracellular vesicles are easily taken up by the target cells through endocytosis. The diameter of the extracellular vesicles can be measured, for example, by using a nanoparticle multi-analyzer (qNano). The diameter of the extracellular vesicles refers to the average particle size.

[0023] Examples of extracellular vesicles include exosomes, microvesicles, apoptotic bodies, ectosomes, microparticles, secretory microvesicles, etc. In the present invention, the extracellular vesicles are preferably exosomes.

[0024] According to the present invention, it is possible to increase the amount of nucleic acid drug contained inside extracellular vesicles (amount of nucleic acid drug encapsulated) by culturing a source cell of extracellular vesicles in the presence of a nucleic acid drug having a sense strand and an antisense strand, each of which is modified at the 3'-end and 5'-end. The mechanism by which such an effect is obtained is presumed to be as follows, but the mechanism by which the effect of the present invention is obtained is not limited to the following.

[0025] When a source cell of extracellular vesicles is cultured in the presence of a nucleic acid drug having a sense strand and an antisense strand, each of which is modified at the 3'-end and 5'-end, the nucleic acid drug is introduced from the cell membrane of the source cell into the inside of the source cell. The nucleic acid drug introduced into the source cell is transported into an endosome. In the early endosome into which the nucleic acid drug is transported, the internal pH decreases, and the nucleic acid drug is protonated to increase the osmotic pressure in the endosome, which causes endosomal escape of the nucleic acid drug. The endosomal escaped nucleic acid drug binds to the inner layer of the cell membrane of the source cell and the outer layer of the late endosome that has been transferred from the early endosome. In the late endosome, the endosome is constricted inward to form multiple intraluminal membrane vesicles. The nucleic acid drug is introduced into the intraluminal vesicles, which forms extracellular vesicles encapsulating the nucleic acid drug. The extracellular vesicles encapsulating the nucleic acid drug thus formed fuse with the cell membrane of the source cell and are released outside the source cell. In the present invention, by using a nucleic acid drug having a sense strand modified at the 3'-end and 5'-end, and an antisense strand, the nucleic acid drug is easily bound to the inner layer of the cell membrane of the source cell and the outer layer of the late endosome, and as a result, it is believed that it is possible to increase the amount of the nucleic acid drug contained inside the intracellular vesicles. In addition, in the present invention, when introducing a nucleic acid drug, it is not necessary to open a small hole in the cell membrane of the extracellular vesicle by electroporation or the like, so that the destruction of the extracellular vesicle is unlikely to occur. As a result, it is possible to increase the number of particles of the extracellular vesicle containing the nucleic acid drug, and further, it is believed that the amount of the nucleic acid drug introduced into the extracellular vesicle can be increased.

[0026] According to the production method of the present invention, the amount of nucleic acid drug encapsulated can be improved, and as a result, the nucleic acid drug can be made to act efficiently by using the extracellular vesicles obtained by the production method of the present invention. Therefore, for example, when a nucleic acid drug having an effect of suppressing the expression of a target gene is used as the nucleic acid drug, it is possible to easily produce extracellular vesicles encapsulating a nucleic acid drug having a high effect of suppressing the expression of a target gene. The extracellular vesicles obtained by the production method of the present invention can be suitably used in a drug delivery system that allows a target drug (nucleic acid drug) to act on a target cell, and are therefore extremely useful in the practical application of nucleic acid drugs. EXAMPLES

[0027] The present invention will be further described below with reference to examples and comparative examples, but the present invention is not limited thereto. Unless otherwise specified, % means % by weight and parts means parts by weight. The base sequence (sequence) of the nucleic acid is written from left to right in the direction from the 5' end to the 3' end.

[0028] <Production Example 1: Synthesis of nucleic acid drug (A-1)> Nucleic acid 1 having the base sequence of sequence (1) containing an amino group at the 5' end and a nucleic acid aptamer at the 3' end, and nucleic acid 2 having the base sequence of sequence (2) were synthesized by Thermo Custom Nucleic Acid Synthesis. Nucleic acid 1 was dissolved in phosphate buffer (pH 7.5), and two equivalents of linear polyethylene glycol N-hydroxysuccinimide (NHS) ester (Sunbright ME-200AS, Yuka Sangyo Co., Ltd.) were added to carry out a crosslinking reaction at room temperature for 4 hours. The solution after the reaction was purified by ethanol precipitation and mixed with nucleic acid 2 to obtain a nucleic acid drug (A-1) having a sense strand whose 5' end was modified with a compound having a polyethylene glycol chain and a 3' end modified with a nucleic acid aptamer, and an antisense strand. The nucleic acid drug (A-1) is an siRNA that inhibits the expression of luciferase. [SEQ ID NO: (1): sense strand] 5'-cuuacgcugaguacuucgattaaaaga-3' [SEQ ID NO: (2): antisense strand] 5'-ucgaaguacucagcguaagttaaaaga-3'

[0029] <Production Example 2: Synthesis of nucleic acid drug (A-2)> The same procedure as in Production Example 1 was carried out except that 2 equivalents of N-hydroxysuccinimide (NHS) ester of branched polyethylene glycol (Sunbright GL2-200GS2 manufactured by Yuka Sangyo Co., Ltd.) was used instead of 2 equivalents of N-hydroxysuccinimide (NHS) ester of linear polyethylene glycol in Production Example 1, and a nucleic acid drug (A-2) having a sense strand modified with a compound having a polyethylene glycol chain at the 5' end and a nucleic acid aptamer at the 3' end, and an antisense strand was obtained. The nucleic acid drug (A-2) is an siRNA that inhibits the expression of luciferase.

[0030] <Production Example 3: Synthesis of nucleic acid drug (A-3)> Nucleic acid 3 having the base sequence of sequence (3) containing an amino group at the 5' end and a nucleic acid aptamer at the 3' end, and nucleic acid 4 having the base sequence of sequence (4) were synthesized by Thermo Custom Nucleic Acid Synthesis. The same procedure as in Production Example 1 was carried out except that nucleic acid 3 was used instead of nucleic acid 1 and nucleic acid 4 was used instead of nucleic acid 2 in Production Example 1, to obtain a nucleic acid drug (A-3) having a sense strand whose 5' end was modified with a compound having a polyethylene glycol chain and whose 3' end was modified with a nucleic acid aptamer, and an antisense strand. The nucleic acid drug (A-3) is an siRNA that inhibits the expression of luciferase. [SEQ ID NO: (3): sense strand] 5'-cuuacgcugaguacuucgattcaccccacctcgctcccgtgacactaatgcta-3' [SEQ ID NO: (4): antisense strand] 5'-ucgaaguacucagcguaagttcaccccacctcgctcccgtgacactaatgcta-3'

[0031] <Production Example 4: Synthesis of nucleic acid drug (A-4)> Nucleic acid 5 having the base sequence of sequence (5) containing an amino group at the 5' end and a nucleic acid aptamer at the 3' end, and nucleic acid 6 having the base sequence of sequence (6) were synthesized by Thermo Custom Nucleic Acid Synthesis. The same procedure as in Production Example 1 was carried out except that nucleic acid 5 was used instead of nucleic acid 1 and nucleic acid 6 was used instead of nucleic acid 2 in Production Example 1, to obtain a nucleic acid drug (A-4) having a sense strand whose 5' end was modified with a compound having a polyethylene glycol chain and whose 3' end was modified with a nucleic acid aptamer, and an antisense strand. The nucleic acid drug (A-4) is an siRNA that inhibits the expression of luciferase. [SEQ ID NO: (5): sense strand] 5'-cuuacgcugaguacuucgattaaagac-3' [SEQ ID NO: (6): antisense strand] 5'-ucgaaguacucagcguaagttaaagac-3'

[0032] <Production Example 5: Synthesis of nucleic acid drug (A-5)> Nucleic acid 7 having the base sequence of sequence (7) containing an amino group at the 5' end and a nucleic acid aptamer at the 3' end, and nucleic acid 8 having the base sequence of sequence (8) were synthesized by Thermo Custom Nucleic Acid Synthesis. The same procedure as in Production Example 1 was carried out except that nucleic acid 7 was used instead of nucleic acid 1 and nucleic acid 8 was used instead of nucleic acid 2 in Production Example 1, to obtain a nucleic acid drug (A-5) having a sense strand whose 5' end was modified with a compound having a polyethylene glycol chain and whose 3' end was modified with a nucleic acid aptamer, and an antisense strand. The nucleic acid drug (A-5) is an siRNA that inhibits the expression of luciferase. [SEQ ID NO: (7): sense strand] 5'-cuuacgcugaguacuucgattggggaggcgattcggtgtgtcctccagaagatatttccga-3' [SEQ ID NO: (8): antisense strand] 5'-ucgaaguacucagcguaagttggggaggcgattcggtgtgtcctccagaagatatttccga-3'

[0033] <Production Example 6: Synthesis of nucleic acid drug (A-6)> We commissioned Thermo Nucleic Acid Synthesis to synthesize nucleic acid 9 (luciferase RNA) having the base sequence of sequence (9) containing an amino group at the 5' end and a nucleic acid aptamer at the 3' end, and nucleic acid 10 (luciferase DNA) having the base sequence of sequence (10). Nucleic acid 9 was dissolved in phosphate buffer (pH 7.5), and two equivalents of linear polyethylene glycol N-hydroxysuccinimide (NHS) ester (Sunbright ME-200AS, Yuka Sangyo Co., Ltd.) were added to carry out a crosslinking reaction at room temperature for 4 hours. The solution after the reaction was purified by ethanol precipitation and mixed with nucleic acid 10 to obtain a nucleic acid drug (A-6) having a sense strand modified at the 5' end with a compound having a polyethylene glycol chain and an antisense strand modified at the 3' end with a nucleic acid aptamer. The nucleic acid drug (A-6) is a heteroduplex nucleic acid that inhibits the expression of luciferase. [SEQ ID NO: (9): sense strand] 5'-cuuacgcugaguacuucgaaaaaga-3' [SEQ ID NO: (10): antisense strand] 5'-tcgaagtactcagcgtaagaaaaga-3'

[0034] <Production Example 7: Synthesis of nucleic acid drug (A-7)> The same procedure as in Production Example 6 was carried out except that 2 equivalents of N-hydroxysuccinimide (NHS) ester of branched polyethylene glycol (Sunbright GL2-200GS2 manufactured by Yuka Sangyo Co., Ltd.) was used instead of 2 equivalents of N-hydroxysuccinimide (NHS) ester of linear polyethylene glycol in Production Example 6, to obtain a nucleic acid drug (A-7) having a sense strand and an antisense strand, the 5' end of which is modified with a compound having a polyethylene glycol chain and the 3' end of which is modified with a nucleic acid aptamer. The nucleic acid drug (A-7) is a heteroduplex nucleic acid that inhibits the expression of luciferase.

[0035] <Production Example 8: Synthesis of nucleic acid drug (A-8)> We commissioned Thermo Nucleic Acid Synthesis to synthesize nucleic acid 11 (luciferase RNA) having the base sequence of sequence (11) containing an amino group at the 5' end and a nucleic acid aptamer at the 3' end, and nucleic acid 12 (luciferase DNA) having the base sequence of sequence (12). The same procedure as in Production Example 1 was carried out except that nucleic acid 11 was used instead of nucleic acid 1, and nucleic acid 12 was used instead of nucleic acid 2 in Production Example 1, to obtain a nucleic acid drug (A-8) having a sense strand whose 5' end was modified with a compound having a polyethylene glycol chain and whose 3' end was modified with a nucleic acid aptamer, and an antisense strand. The nucleic acid drug (A-8) is a heteroduplex nucleic acid that inhibits the expression of luciferase. [SEQ ID NO: (11): sense strand] 5'-cuuacgcugaguacuucgacaccccacctcgctcccgtgacactaatgcta-3' [SEQ ID NO: (12): antisense strand] 5'-tcgaagtactcagcgtaagcaccccacctcgctcccgtgacactaatgcta-3'

[0036] <Production Example 9: Synthesis of nucleic acid drug (A-9)> We commissioned Thermo Nucleic Acid Synthesis to synthesize nucleic acid 13 (luciferase RNA) having the base sequence of sequence (13) containing an amino group at the 5' end and a nucleic acid aptamer at the 3' end, and nucleic acid 14 (luciferase DNA) having the base sequence of sequence (14). The same procedure as in Production Example 1 was carried out except that nucleic acid 13 was used instead of nucleic acid 1, and nucleic acid 14 was used instead of nucleic acid 2 in Production Example 1, to obtain a nucleic acid drug (A-9) having a sense strand whose 5' end was modified with a compound having a polyethylene glycol chain and whose 3' end was modified with a nucleic acid aptamer, and an antisense strand. The nucleic acid drug (A-9) is a heteroduplex nucleic acid that inhibits the expression of luciferase. [SEQ ID NO: (13): sense strand] 5'-cuuacgcugaguacuucgaaaagac-3' [SEQ ID NO: (14): antisense strand] 5'-tcgaagtactcagcgtaagaaagac-3'

[0037] <Production Example 10: Synthesis of nucleic acid drug (A-10)> We commissioned Thermo Nucleic Acid Synthesis to synthesize nucleic acid 15 (luciferase RNA) having the base sequence of sequence (15) containing an amino group at the 5' end and a nucleic acid aptamer at the 3' end, and nucleic acid 16 (luciferase DNA) having the base sequence of sequence (16). The same procedure as in Production Example 1 was carried out except that nucleic acid 15 was used instead of nucleic acid 1, and nucleic acid 16 was used instead of nucleic acid 2, to obtain a nucleic acid drug (A-10) having a sense strand whose 5' end was modified with a compound having a polyethylene glycol chain and whose 3' end was modified with a nucleic acid aptamer, and an antisense strand. The nucleic acid drug (A-10) is a heteroduplex nucleic acid that inhibits the expression of luciferase. [SEQ ID NO: (15): sense strand] 5'-cuuacgcugaguacuucgaggggaggcgattcggtgtgtcctccagaagatatttccga-3' [SEQ ID NO: (16): antisense strand] 5'-tcgaagtactcagcgtaagggggaggcgattcggtgtgtcctccagaagatatttccga-3'

[0038] <Production Example 11: Synthesis of Comparative Nucleic Acid Drug (A-11)> Nucleic acid 17 (neither the 5' nor the 3' end is modified) having the base sequence of sequence (17) and nucleic acid 18 (luciferase RNA) having the base sequence of sequence (18) were synthesized by Thermo Nucleic Acid Synthesis. A nucleic acid drug (A-11) having a sense strand and an antisense strand whose 5'-end and 3'-end are unmodified was obtained by mixing the nucleic acid 17 and the nucleic acid 18. The nucleic acid drug (A-11) is an siRNA that suppresses the expression of luciferase. [SEQ ID NO: (17): sense strand] 5'-cuuacgcugaguacuucgatt-3' [SEQ ID NO: (18): antisense strand] 5'-ucgaaguacucagcguaagtt-3'

[0039] <Production Example 12: Synthesis of Comparative Nucleic Acid Drug (A-12)> We commissioned Thermo Nucleic Acid Synthesis to synthesize nucleic acid 17 (without modification at the 3' end) having the base sequence of sequence (17) containing an amino group at the 5' end and nucleic acid 18 (luciferase RNA) having the base sequence of sequence (18). The same procedures as in Production Example 1 were carried out except that nucleic acid 17 was used instead of nucleic acid 1, and nucleic acid 18 was used instead of nucleic acid 2, to obtain a nucleic acid drug (A-12) having a sense strand modified at the 5' end with a compound having a polyethylene glycol chain and an antisense strand. The nucleic acid drug (A-12) is an siRNA that suppresses the expression of luciferase.

[0040] <Production Example 13: Synthesis of Comparative Nucleic Acid Drug (A-13)> We commissioned Thermo Nucleic Acid Synthesis to synthesize nucleic acid 19 (without modification at the 5' end) having the base sequence of sequence (19) containing a nucleic acid aptamer at the 3' end and nucleic acid 20 (luciferase RNA) having the base sequence of sequence (20). A nucleic acid drug (A-13) having a sense strand whose 3' end is modified with a nucleic acid aptamer and an antisense strand was obtained by mixing the nucleic acid 19 and the nucleic acid 20. The nucleic acid drug (A-13) is an siRNA that suppresses the expression of luciferase. [SEQ ID NO: (19): sense strand] 5'-cuuacgcugaguacuucgattaaaaga-3' [SEQ ID NO: (20): antisense strand] 5'-ucgaaguacucagcguaagttaaaaga-3'

[0041] <Production Example 14: Synthesis of nucleic acid drug (A-14)> We commissioned Thermo Nucleic Acid Synthesis to synthesize nucleic acid 21 (luciferase RNA) having the base sequence of sequence (21) containing a nucleic acid aptamer at the 5' end and an amino group at the 3' end, and nucleic acid 22 (luciferase DNA) having the base sequence of sequence (22). The same procedure as in Production Example 1 was carried out except that nucleic acid 21 was used instead of nucleic acid 1 and nucleic acid 22 was used instead of nucleic acid 2 in Production Example 1, to obtain a nucleic acid drug (A-14) having a sense strand whose 5' end was modified with a nucleic acid aptamer and whose 3' end was modified with a compound having a polyethylene glycol chain, and an antisense strand. The nucleic acid drug (A-14) is a heteroduplex nucleic acid that inhibits the expression of luciferase. [SEQ ID NO: (21): sense strand] 5'-aaagaccuuacgcugaguacuucga-3' [SEQ ID NO: (22): antisense strand] 5'-aaagactcgaagtactcagcgtaag-3'

[0042] <Examples 1 to 11 and Comparative Examples 1 to 3: Production and Evaluation of Extracellular Vesicles> (1) Production of extracellular vesicles 1×10 6 Human mesenchymal stem cells (hMSCs) cultured on a 10 cm culture plate were transfected with 5 μg of the nucleic acid drugs synthesized in Production Examples 1 to 14 using a transfection reagent (Thermo Lipofectamine 2000), and cultured for 24 hours at 37°C and 5% CO2. After 24 hours, the supernatant was collected from the culture medium with a pipette and centrifuged according to the following procedures (a) to (d), and the extracellular vesicles were purified and collected. (a) The supernatant collected from the culture medium was centrifuged at 2,000×g for 15 minutes, and the supernatant was collected. (b) The supernatant obtained in (a) was centrifuged at 10,000×g for 30 minutes, and the supernatant was collected. (c) The supernatant obtained in (b) was centrifuged at 100,000×g for 60 minutes, and the precipitate was collected. (d) The precipitate obtained in (c) was suspended in 10 mL of phosphate-buffered saline (PBS) and centrifuged at 100,000 × g for 60 minutes. The precipitate was collected to obtain extracellular vesicles (EVs) encapsulating the nucleic acid drug.

[0043] (2) Evaluation of extracellular vesicle particle number The precipitate obtained in (1)(d) (EVs encapsulating nucleic acid drugs) was suspended in 0.5 mL of PBS to prepare an EV sample solution. The number of EV particles per mL of the EV sample solution was measured using a nanoparticle multi-analyzer qNano. The ratio of the number of EV particles per mL of the EV sample solution in each example to the number of EV particles per mL of the EV sample solution in Comparative Example 4 was calculated as 1.00. The results are shown in Table 1.

[0044] (3) Evaluation of the amount of nucleic acid drugs encapsulated in extracellular vesicles Using the lysis buffer, nucleic acids in EVs were extracted from the EV sample solution prepared in (2), and the amount of nucleic acid drug encapsulated in EVs was measured by quantitative PCR. The ratio of the amount of nucleic acid drug per mL of EV sample solution in each example to the amount of nucleic acid drug per mL of EV sample solution in Comparative Example 4 was calculated. The results are shown in Table 1.

[0045] <Comparative Example 4: Production and evaluation of extracellular vesicles by electroporation method> (1) Production of extracellular vesicles 1×10 6 Human mesenchymal stem cells (hMSCs) cultured in 10 cm culture plates were cultured for 24 hours at 37°C and 5% CO2. After 24 hours, the supernatant was collected from the culture medium with a pipette and centrifuged according to the following procedures (a) to (e) to purify and collect extracellular vesicles. (a) The supernatant collected from the culture medium was centrifuged at 2,000×g for 15 minutes, and the supernatant was collected. (b) The supernatant obtained in (a) was centrifuged at 10,000×g for 30 minutes, and the supernatant was collected. (c) The supernatant obtained in (b) was centrifuged at 100,000×g for 60 minutes, and the precipitate was collected. (d) The precipitate obtained in (c) was suspended in 10 mL of PBS and centrifuged at 100,000×g for 60 minutes, and the precipitate was collected. (e) The precipitate obtained in (d) was suspended in 10 μL of PBS as extracellular vesicles (EVs) to obtain an EV suspension. 5 μg of the nucleic acid drug (A-1) was added to this EV suspension, and gene transfer was performed by electroporation using ExoFectin (registered trademark) sRNA-into-Exosome Kit (manufactured by 101 Bio) to produce extracellular vesicles encapsulating the nucleic acid drug.

[0046] (2) Measurement of extracellular vesicle particle number EV sample solution was prepared by adding PBS to the solution obtained in (1)(e) to make a 0.5 mL suspension. The number of EV particles per mL of the EV sample solution was measured using the qNano nanoparticle multi-analyzer.

[0047] (3) Measurement of the amount of nucleic acid drug encapsulated in extracellular vesicles Nucleic acids in EVs were extracted from the EV sample solution prepared in (2) using lysis buffer, and the amount of nucleic acid drug encapsulated in EVs was measured by quantitative PCR.

[0048] In the PEG modification column of Tables 1 and 2, the 5' end of the sense strand of the nucleic acid drug is modified with a compound having a polyethylene glycol chain, and the 5' end of the sense strand is not modified, and the column for nucleic acid aptamer modification in Tables 1 and 2 indicates that the 3' end of the sense strand of the nucleic acid drug is modified with a nucleic acid aptamer, and the column for nucleic acid aptamer modification indicates that the 3' end of the sense strand is not modified, and the column for nucleic acid aptamer modification indicates that the 5' end of the sense strand of the nucleic acid drug is modified with a nucleic acid aptamer, and the column for nucleic acid aptamer modification indicates that the 3' end of the sense strand is not modified, and the column for PEG modification indicates that the 5' end of the sense strand of the nucleic acid drug (A-14) is modified with a nucleic acid aptamer and the 3' end is modified with a compound having a polyethylene glycol chain, and the columns for nucleic acid aptamer modification and PEG modification indicate that the 5' end of the sense strand of the nucleic acid drug is modified with a nucleic acid aptamer and the 3' end of the sense strand ... compound having a polyethylene glycol chain, and the columns for nucleic acid aptamer modification and PEG modification indicate that the 5' end of the sense strand of the nucleic acid drug is modified with a compound having a polyethylene glycol chain, and the columns for nucleic acid aptamer modification and PEG modification indicate that the 5' end of the sense strand of the nucleic acid drug is modified with a compound having a polyethylene glycol chain, and the columns for nucleic acid aptamer modification and PEG modification

[0049] [Table 1]

[0050] <Examples 12 to 22 and Comparative Examples 6 to 8: Evaluation of the luciferase activity suppression effect of extracellular vesicles> (1) Purification of extracellular vesicles 1×10 6 Human mesenchymal stem cells (hMSCs) cultured in 10 cm culture plates were transfected with 5 μg of nucleic acid medicine using a transfection reagent (Lipofectamine 2000 manufactured by Thermo), and cultured for 24 hours at 37°C and 5% CO2. The nucleic acid medicines used were the nucleic acid medicines (A-1) to (A-14) produced in Production Examples 1 to 14, and the types shown in Table 2. After 24 hours, the supernatant was collected from the culture medium with a pipette, and centrifuged according to the following procedure to purify and collect extracellular vesicles. (a) The supernatant collected from the culture medium was centrifuged at 2,000×g for 15 minutes, and the supernatant was collected. (b) The supernatant obtained in (a) was centrifuged at 10,000×g for 30 minutes, and the supernatant was collected. (c) The supernatant obtained in (b) was centrifuged at 100,000×g for 60 minutes, and the precipitate was collected. (d) The precipitate obtained in (c) was suspended in 10 mL of PBS and centrifuged at 100,000×g for 60 minutes, and the precipitate was collected. (e) The precipitate obtained in (d) was suspended in 0.2 mL of PBS to prepare an EV sample. (2) Evaluation of luciferase activity inhibition effect 1×10 5 0.1 mL of the EV sample obtained in (1) was added to luciferase-expressing Hela cells cultured on a 24-well culture plate at a cell concentration of 100 μL / well and cultured for 16 hours. 100 μL of luciferin reagent prepared in PBS at a concentration of 150 μg / mL was added to the cultured Hela cells, and the luciferase activity in the cells was measured using an in vivo imaging system IVIS Lumina (manufactured by Xenogen). The ratio of luciferase activity in each example was calculated when the luciferase activity in Comparative Example 5 (control example: see below) was set to 1.00. The results are shown in Table 2.

[0051] Comparative Example 5: Example of a control for evaluating the luciferase activity suppression effect of extracellular vesicles The same procedure as in Example 11 was carried out except that no nucleic acid drug was used, and luciferase activity was measured.

[0052] <Comparative Example 9: Evaluation of luciferase activity suppression effect of extracellular vesicles (electroporation method)> (1) Purification of extracellular vesicles 1×10 6 Human mesenchymal stem cells (hMSCs) cultured in 10 cm culture plates were cultured for 24 hours at 37°C and 5% CO2. After 24 hours, the supernatant was collected from the culture medium with a pipette and centrifuged according to the following procedure to purify and collect extracellular vesicles. (a) The culture medium was centrifuged at 2,000×g for 15 minutes, and the supernatant was collected. (b) The supernatant obtained in (a) was centrifuged at 10,000×g for 30 minutes, and the supernatant was collected. (c) The supernatant obtained in (b) was centrifuged at 100,000×g for 60 minutes, and the precipitate was collected. (d) The precipitate obtained in (c) was suspended in 10 mL of PBS and centrifuged at 100,000×g for 60 minutes, and the precipitate was collected. (e) The precipitate obtained in (d) was suspended in 10 μL of PBS as EV to obtain an EV suspension. 5 μg of nucleic acid drug (A-1) was added to the obtained EV suspension, and gene introduction was performed by electroporation using ExoFectin (registered trademark) sRNA-into-Exosome Kit (manufactured by 101 Bio). PBS was added to the obtained solution and suspended to obtain 0.2 mL of EV sample. (2) Evaluation of luciferase activity inhibition effect 1×10 50.1 mL of the EV sample obtained in (1) was added to luciferase-expressing Hela cells cultured on a 24-well culture plate at a cell concentration of 100 μL / well, and cultured for 16 hours. 100 μL of luciferin reagent prepared in PBS at a concentration of 150 μg / mL was added to the cultured Hela cells, and the luciferase activity in the cells was measured using an in vivo imaging system IVIS Lumina (manufactured by Xenogen). The ratio of the luciferase activity of this example to the luciferase activity of Comparative Example 5 (control example: see below) was calculated as 1.00. The results are shown in Table 2.

[0053] [Table 2]

[0054] As shown in Table 1, in Examples 1 to 11 in which extracellular vesicles were produced in the presence of a nucleic acid drug having a sense strand and an antisense strand each modified at the 3' end and 5' end, the amount of nucleic acid drug introduced (encapsulated amount) into EVs was significantly higher than in Comparative Examples 1 to 3. In addition, in Examples 1 to 11, the number of EV particles that could be recovered was significantly higher than in the method of Comparative Example 4. Furthermore, as shown in Table 2, when target gene activity is inhibited by the methods of Examples 12 to 22, the effect of inhibiting target gene activity is significantly higher than that of the methods of Comparative Examples 5 to 8. Also, it is found that the methods of Examples 12 to 22 have a significantly higher effect of inhibiting target gene expression than the method of Comparative Example 9 (a method using EVs produced by electroporation). These results show that the present invention provides a method for producing extracellular vesicles that can improve the amount of nucleic acid drug encapsulated, and can easily produce extracellular vesicles encapsulating nucleic acid drugs that have a high effect of suppressing the expression of target genes.

Claims

1. A method for producing extracellular vesicles encapsulating a nucleic acid drug, comprising: The method includes step 1 of culturing a source cell of extracellular vesicles in the presence of a nucleic acid drug, The nucleic acid drug used in step 1 is a nucleic acid drug having a sense strand and an antisense strand, each of which is modified at its 3' end and 5' end, the nucleic acid drug has a sense strand whose 3'-end is modified with a nucleic acid aptamer and whose 5'-end is modified with a compound having a polyethylene glycol chain, or has a sense strand whose 5'-end is modified with a nucleic acid aptamer and whose 3'-end is modified with a compound having a polyethylene glycol chain, The nucleic acid drug binds to the inner membrane of the cell that supplies the extracellular vesicles and the outer membrane of the late endosome; the antisense strand is modified at its 5'-end or 3'-end with a nucleic acid aptamer; When the nucleic acid drug has a sense strand whose 3' end is modified with a nucleic acid aptamer and whose 5' end is modified with a compound having a polyethylene glycol chain, the sense strand and the antisense strand of the nucleic acid drug have the same base sequence at the 3' end, and the base sequence is the base sequence (AAAGA), the base sequence (CACCCCACCTCGCTCCCGTGACACTAATGCTA), the base sequence (AAAGAC), or the base sequence (GGGGAGGCGATTCGGTGTGTCCTCCAGAAGATATTTCCGA); A method for producing extracellular vesicles, wherein when the nucleic acid drug has a sense strand whose 5' end is modified with a nucleic acid aptamer and whose 3' end is modified with a compound having a polyethylene glycol chain, the sense strand and antisense strand of the nucleic acid drug each have the base sequence (AAAGAC) at the 5' end.

2. The method for producing extracellular vesicles according to claim 1, wherein the diameter of the extracellular vesicles is 10 nm to 200 nm.

3. The method for producing extracellular vesicles according to claim 1 or 2, wherein the extracellular vesicles are exosomes.

Images