Method for amplifying complementary DNA strands

Abstract

Disclosed is a cDNA amplification method in which mRNA can be amplified from a very small amount of a cell sample, comprehensively, with high efficiency, and at low bias. A complimentary DNA strand amplification method according to the present invention comprises a step in which: a reverse transcriptase having terminal transferase activity is used to capture, in a liquid-phase system or solid-phase system, a target RNA and to synthesize a complimentary DNA strand; a base such as CCC is added to the end of the complimentary DNA strand; and thereafter homopolymer tailing is carried out via a TdT reaction in the copresence of a chain terminating nucleotide triphosphate. If a template switching reaction is further combined, the complementary DNA strand can be amplified with higher efficiency and at lower bias.

Description

[Technical field]

[0001] The present invention relates to a method for amplifying a complementary DNA strand, which enables high-sensitivity amplification of cDNA from minute amounts of mRNA. [Background technology]

[0002] Recently, comprehensive gene expression analysis using minute samples such as individual cells has been performed. Such technology enables single-cell RNA-seq analysis (scRNA-seq analysis) that comprehensively captures the properties of thousands to hundreds of thousands of individual cells, leading to the identification of the presence or absence of diversity within a cell population, the identification of new cell subpopulations, and the identification of special cell populations correlated with pathology. An international project to create an atlas at the single-cell level in humans was launched in 2016 (Non-Patent Document 1), and is a driving force for promoting understanding of biology at an unprecedented resolution.

[0003] scRNA-seq analysis is particularly useful for elucidating the complex immune mechanisms in pathological conditions. Representative trace samples include tumor-infiltrating T cells contained in biopsy specimens of primary and metastatic lesions taken for diagnostic purposes in cancer patients, and B cells that specifically react to viruses and vaccines against them. The true nature of cytotoxic T lymphocytes (CTLs), which are the essence of immunotherapy such as anti-PD-1 antibodies, has been revealed in CD8 + From the perspective of T cells, CD8 has the ability to specifically recognize cancer antigens. +Attention is being focused on methods to measure the extent to which T cells are induced (Non-Patent Document 2). In addition, in the SARS-CoV2 pandemic since 2019 and the development of an effective vaccine against it, attention is being focused on investigating the properties of B cells with high antibody production ability that has strong neutralizing activity against the virus and CD4 / CD8 T cells that react specifically to antigens. One of the measurement methods is to analyze the sequences of T cell receptors (T cell receptors; TCR) on T cells and B cell receptors (B cell receptors; BCR) on B cells to determine the TCR / BCR repertoire (type of clones and the frequency of each clone), and at the same time, to discuss the response of antigen-specific clones and the differences in the properties of those cells by performing scRNA-seq analysis (scTCR / BCR / RNA-seq). It has been reported that TCR repertoire fluctuations are actually correlated with the therapeutic effect of anti-CD4 antibodies against cancer, and that the type of T cells changes with multiple vaccinations against SARS-CoV2 (Non-Patent Documents 3, 4). However, in order to discuss gene expression of each cell type that controls such immune responses at the same level, it would be ideal to obtain equal amounts of cellular mRNA, but the amount of mRNA contained in T / B cells is significantly smaller than that of epithelial cells, tumor cells, macrophages, etc. Therefore, it is becoming increasingly important to develop a method to sensitively amplify mRNA from individual cells derived from a sample for high-resolution scTCR / BCR / RNA-seq analysis of these cells.

[0004] Various techniques are known for amplifying cDNA from a small amount of sample. If the cDNA amplification methods are classified according to whether the capture of mRNA and the synthesis of cDNA are performed on a solid phase or not, examples of solid phase systems in which mRNA is captured in a microwell or microdroplet by an mRNA capture oligo immobilized on a solid phase bead and cDNA is synthesized include the BD Rhapsody system (Patent Document 3), Seq-well system (Non-Patent Document 12), and Nx1-seq system (Patent Document 5, Non-Patent Document 14) of Beckton Dickinson Co., Ltd., which use a plate with microwells, the Drop-seq method (Non-Patent Document 13) that captures mRNA in a microdroplet, and the Nadia system of Dolomite Bio Co., Ltd. Examples of liquid-phase systems that capture mRNA in microwells or microdroplets using free mRNA capture oligos that are not bound to a solid phase and synthesize cDNA include the 10X Chromium system (Patent Document 4) by 10X Genomics, which encapsulates hydrogel beads containing mRNA capture oligos and one cell in a microdroplet, melts the hydrogel and dissolves the cell in the microdroplet, and captures mRNA with the released mRNA capture oligos, and Smart-Seq2 (Non-Patent Document 15) which dispenses individual cells or trace amounts of mRNA into a 96-well plate and performs amplification. Further examples of liquid-phase analysis techniques include combinatorial indexing such as sci-RNA-seq3, which suspends fixed cells in a solution containing a cell membrane permeabilization reagent and mRNA capture oligos, and captures mRNA on the mRNA capture oligos in the fixed cells.

[0005] Furthermore, methods for amplifying cDNA from a trace sample can be classified based on the reaction mode, such as the second strand synthesis reaction, into the template switching (TS) method, in which a primer of several tens of base pairs containing a base sequence such as [guanosine]-[guanosine]-[guanosine] at the 3' end, called a template switching oligo, is added when synthesizing cDNA from mRNA, thereby adding a desired base sequence to the cDNA end and synthesizing the second strand (Patent Document 1, Non-Patent Document 5, Non-Patent Document 6), and the TdT method, in which a polynucleotide sequence composed of the same bases is added to the synthesized cDNA end by terminal deoxynucleotidyl transferase (TdT), and then second strand synthesis is performed using a primer having a sequence complementary to the polynucleotide at the 3' end and a known adapter sequence at the 5' end (Non-Patent Documents 7 to 9).

[0006] The TS method has the advantage that the number of reaction steps is small, so there is little loss of cDNA due to purification, and the TS reaction occurs mainly with mRNA having a 5' cap structure, so that full-length cDNA is easily generated. On the other hand, the efficiency of the TS reaction is highly dependent on the terminal structure of the mRNA, and the efficiency decreases in the order of terminal bases G>A>C>U. The efficiency is relatively high (about 20%-60%) for full-length cDNA having a cap structure at the 5' end, but is low (several %-40%) for incomplete-length mRNA without a cap structure, immature mRNA, partially degraded mRNA, etc., and the uneven efficiency leads to amplification bias (Non-Patent Document 6). Furthermore, the efficiency is lower than the polynucleotide addition efficiency in the TdT method (92-95%, Non-Patent Document 10).

[0007] On the other hand, the TdT method is more efficient than the TS method, but has the disadvantages that it is difficult to control the TdT reaction, there are many steps, and when single-stranded DNA is used as a template, the efficiency can be greatly reduced if the end forms a higher-order structure and becomes a recessed end (Non-Patent Document 10), and therefore it is more difficult to synthesize long, full-length cDNA, which is more likely to form a higher-order structure, than with the TS reaction.

[0008] The TAS-Seq method, which the inventors of the present application previously developed, is a technology that solves the difficulty of controlling the TdT reaction in the TdT method (Patent Document 2, Non-Patent Document 11). The TAS-Seq method is a solid-phase cDNA amplification method in which a target nucleic acid is captured on a solid phase and cDNA is synthesized. A certain amount of chain-terminating nucleotide triphosphate is added to the TdT reaction system, and the TdT reaction is stochastically controlled, so that the nucleotide homopolymer addition reaction by the TdT reaction is controlled to be within a certain range even under various conditions. As a result, the TAS-Seq method is excellent in the detection sensitivity of expressed genes and the quantification of cell composition, and is a technology that can more reliably detect intercellular communication that is difficult to detect with conventional technologies. [Prior art documents] [Patent documents]

[0009] [Patent Document 1] WO 2015 / 027135 A1 [Patent Document 2] WO 2021 / 006353 A1 [Patent Document 3] US 2018 / 0258500 A1 [Patent Document 4] WO 2015 / 200893 A2 [Patent Document 5] WO 2015 / 166768 A1 [Non-patent literature]

[0010] [Non-Patent Document 1] Regev A., et al. The Human Cell Atlas. eLife 2017;e27041. [Non-Patent Document 2] Zaretsky JM, Garcia-Diaz A, Shin DS, et al. Mutations Associated with Acquired Resistance to PD-1 Blockade in Melanoma. N Engl J Med 2016;375:819-2. [Non-Patent Document 3] Aoki H., et al. TCR Repertoire Analysis Reveals Mobilization of Novel CD8+ T Cell Clones Into the Cancer-Immunity Cycle Following Anti-CD4 Antibody Administration. Front Immunol. 2019 Jan; 9(3185). [Non-Patent Document 4] Aoki H., et al.. T cell responses induced by SARS-CoV-2 mRNA vaccination are associated with clonal replacement bioRxiv. 2022 Aug. [Non-Patent Document 5] Picelli S., et al. Full-length RNA-seq from single cells using Smart-seq2. Nat Protoc. 2014 Jan;9(1):171-81. [Non-Patent Document 6] Wulf MG., et al. Non-templated addition and template switching by Moloney murine leukemia virus (MMLV)-based reverse transcriptases co-occur and compete with each other. J Biol. Chem. 2019 Nov;294(48):18220-18231. [Non-Patent Document 7] Matsunaga H, Goto M, Arikawa K, et al. A highly sensitive and accurate gene expression analysis by sequencing ("bead-seq") for a single cell. Anal Biochem 2015;471:9–16.

Outdoor Tools 8

Outdoor Tools9

Outdoor Tools 10

Outdoor Content11

Outdoor Tools 12

[0011] A method for amplifying individual single-cell mRNA from various specimens with high sensitivity and low bias is an important issue in terms of constructing a more advanced and accurate single-cell atlas, capturing tumor-reactive T cells, and capturing B cells with high vaccine responsiveness. However, the existing TS method and TdT method each have their own unique advantages and disadvantages as described above, and there is no highly sensitive cDNA amplification method that can cover all the advantages. The TAS-Seq method previously developed by the present inventors also has the problem that, due to the nature of adding a certain amount of terminator nucleotides, a certain amount of cDNA is produced to which a polynucleotide of a length sufficient to form a stable complementary strand with the primer used for second strand synthesis is not added. Since the TAS-Seq method is a type of TdT method, it is similar to the general TS method in that it has more steps than the TS method and long full-length cDNA is less easily synthesized than in the TS reaction. In addition, the known TAS-Seq method is a solid-phase cDNA amplification method, and its application to a liquid-phase system is not known.

[0012] An object of the present invention is to provide a cDNA amplification method capable of comprehensively amplifying mRNA with high efficiency and low bias even from a very small amount of cell sample. [Means for solving the problem]

[0013] When the TS method and the TdT method are combined, it is expected that the advantage of the TS method, that is, the increase in cDNA yield due to the small number of reaction steps, will be negated, and the advantage of the TdT method, that is, the good reaction efficiency, will be negated because the 3' end of the cDNA may become exposed during the template switching reaction of the TS method, and the terminal structure may no longer be a favorable protruding end for the TdT reaction. In addition, in the liquid-phase TS method, in order to avoid a decrease in the product during the purification process, the removal of unreacted (non-target-capturing) target RNA capture oligos after cDNA synthesis is not usually performed (Non-Patent Document 15). In other words, in the liquid-phase TS method, if a purification step for removing unreacted target RNA capture oligos is performed after cDNA synthesis, the cDNA product will decrease, leading to a decrease in the final cDNA amplification efficiency. On the other hand, if the TdT method is applied to the product of the TS method without performing a step to remove unreacted target RNA capture oligos according to this common technical knowledge, it is expected that the unreacted target RNA capture oligos and template switching oligos, which are present in much greater quantities than the cDNA product, will be preferentially amplified by the TdT method, resulting in a significant decrease in the efficiency of cDNA amplification. Therefore, there is no method that combines the TS method and the TdT method, and there is no reason to expect that a significant advantage will be obtained that exceeds the negation of the advantages.

[0014] However, the inventors of the present application decided to carry out a step of removing unreacted target RNA capture oligo as well as unreacted template switching oligo from the product of the TS reaction in a liquid phase system, and then further applied the TdT method to the product. They surprisingly found that the cDNA yield was significantly increased compared to each reaction alone, that the amount of long cDNA synthesized was greater than that of the TdT reaction alone, and that the amount of short cDNA synthesized was greater than that of the TS reaction alone.

[0015] Furthermore, the inventors of the present application discovered that when a TAS-Seq step (TdT method) is performed using a reverse transcriptase with terminal transferase activity without combining it with a TS reaction, the addition of bases such as CCC to the cDNA ends reduces the proportion of homopolymer portions (especially polyC) that are too short, enabling the TAS-Seq method to be performed efficiently even in a liquid phase system that does not use a solid phase.

[0016] The present invention, which has been completed as a result of the above-mentioned intensive studies, is a method for amplifying a complementary DNA strand, which includes the steps of capturing a target RNA and synthesizing a complementary DNA strand in a liquid phase or solid phase system using a reverse transcriptase having terminal transferase activity, adding bases such as CCC to the end of the complementary DNA strand, and then performing homopolymer tailing by a TdT reaction in the presence of chain-terminating nucleotide triphosphates, and is a technology that can amplify a complementary DNA strand with higher efficiency and lower bias by further combining a TS reaction using a template switching oligo, and includes the following aspects.

[0017] [1] a target RNA capture step of capturing a target RNA using a target RNA capture oligo containing a target capture portion; a complementary strand synthesis step in which a complementary DNA strand having a sequence complementary to the captured RNA is synthesized by performing a reverse transcription reaction using a reverse transcriptase having terminal transferase activity, and an additional sequence consisting of any number of bases is added to the 3' end of at least a part of the complementary DNA; an unreacted oligo removal step for removing target RNA capture oligos that have not captured the target RNA; an RNA degradation step in which RNA is degraded by RNAase; a homopolymer addition step in which a terminal deoxynucleotidyl transferase reaction is carried out in the presence of dATP, dTTP, dCTP or dGTP and a chain-terminating nucleotide triphosphate to add a nucleotide homopolymer to the 3' end of the complementary DNA strand; a second strand synthesis step of synthesizing a second strand on the complementary DNA strand using a primer for second strand synthesis, the primer including a complementary homopolymer portion of a sequence complementary to the nucleotide homopolymer, to generate a DNA double strand composed of a complementary DNA strand and a second strand; and a nucleic acid amplification step in which a nucleic acid amplification reaction is carried out using the DNA double strand as a template; 1. A method for amplifying a complementary DNA strand, comprising: [2] The method described in [1], wherein the target RNA capture oligo comprises a first adaptor portion on the 5' side of the target capture portion, and the primer for second strand synthesis comprises a long primer comprising a second adaptor portion on the 5' side of a complementary homopolymer portion, and in the nucleic acid amplification step, a nucleic acid amplification reaction is carried out using a primer targeting the first adaptor and a primer targeting the second adaptor. [3] The method described in [1], wherein the primer for second strand synthesis comprises a long primer comprising a second adaptor portion on the 5' side of the complementary homopolymer portion, and in the nucleic acid amplification step, a nucleic acid amplification reaction is carried out using a primer targeting the second adaptor and a primer targeting a desired region in the complementary DNA strand. [4] The method described in [2] or [3], wherein the long primer comprises a molecular barcode portion consisting of a random sequence between the second adapter portion and the complementary homopolymer portion. [5] The method according to any one of [2] to [4], wherein the chain length of the complementary homopolymer portion of the long primer is 6 to 15 bases. [6] The method according to any one of [1] to [5], wherein the target RNA capture oligo is a free oligo that is not bound to a solid support, and the step of removing the unreacted oligo is carried out by nucleic acid size fractionation. [7] The method described in [6], wherein the target RNA capture oligo comprises, from the 5' to 3' side, a first adapter portion, a cell identification barcode portion, and a target capture portion. [8] The method according to any one of [1] to [5], wherein the target RNA capture oligo is a solid-phase oligo bound to a solid support, and the unreacted oligo removal step is carried out by exonuclease treatment. [9] The method described in [8], wherein the solid phase support is a bead, and the target RNA capture oligo comprises, from the 5' to 3' side, a first adapter portion, a bead identification barcode portion, and a target capture portion.

[10] The method described in [8], wherein the solid phase support is a plate, and the target RNA capture oligo is immobilized in multiple compartments of the plate and comprises, from the 5' side to the 3' side, a first adapter portion, a compartment identification barcode portion, and a target capture portion.

[11] The method according to any one of [1] to

[10] , wherein the target RNA capture oligo comprises a target polyA RNA capture oligo containing a polyT portion as a target capture portion, and the target RNA comprises polyA RNA.

[12] The method described in

[11] , wherein in the complementary strand synthesis step, a reverse transcription reaction is carried out in the presence of a template switching oligo that contains a sequence at its 3' end that can hybridize to the additional sequence and that contains a switching sequence on the 5' side of the sequence, the template switching oligo is hybridized to the complementary DNA strand to which the additional sequence has been added, and a sequence complementary to the switching sequence is further added to the 3' end of the complementary DNA strand.

[13] The method described in

[12] , wherein the template switching oligo comprises an oligonucleotide comprising GGG, GUG or NGG (wherein G and U are ribonucleotide bases, and N is any ribonucleotide base selected from A, U, G and C, which may contain one or more nucleotide analogs) at its 3' end as a sequence hybridizable with the additional sequence, and the switching sequence comprises a second adapter portion.

[14] The method described in

[13] , wherein the switching sequence comprises a molecular barcode portion consisting of a random sequence on the 3' side of the second adapter portion.

[15] The method according to any one of

[12] to

[14] , wherein the target RNA capture oligo is a free oligo that is not bound to a solid phase support, and the unreacted oligo removal step includes removal by nucleic acid size fractionation of the target RNA capture oligo that has not captured the target RNA and the template switching oligo that has not hybridized to a complementary DNA strand.

[16] The method according to any one of

[11] to

[15] , wherein the primer for second strand synthesis comprises a long primer comprising a second adaptor portion on the 5' side of a complementary homopolymer portion, and a short primer not comprising a complementary homopolymer portion and comprising the second adaptor portion on its 3' side.

[17] The method described in

[16] , wherein the long primer comprises a molecular barcode portion consisting of a random sequence between the second adapter portion and the complementary homopolymer portion.

[18] The method according to any one of

[12] to

[17] , wherein in the complementary strand synthesis step, a reverse transcription reaction is carried out using a reverse transcriptase further having strand displacement activity in the presence of the template switching oligo, and a second strand is synthesized for the complementary DNA strand hybridized with the template switching oligo.

[19] The method according to any one of [1] to

[18] , wherein the chain-terminating nucleotide triphosphate is ddNTP, a derivative of ddNTP, 3'-dNTP, or 3'-deoxy-5-methyluridine-5'-triphosphate.

[20] The method according to

[19] , wherein the ddNTP derivative is a ddNTP modified at the 3' position with an atomic group that does not have an OH group.

[21] The method of

[19] , wherein the chain-terminating nucleotide triphosphate is a ddNTP.

[22] The method according to any one of [1] to

[21] , wherein in the homopolymer addition step, polyC addition is carried out by adding dCTP and chain-terminating CTP.

[23] The method according to any one of [1] to

[22] , wherein the RNA degradation step and the homopolymer addition step are carried out simultaneously. Effect of the Invention

[0018] According to the present invention, by using a reverse transcriptase having terminal transferase activity, it is possible to comprehensively amplify mRNA from a very small amount of sample with higher efficiency and lower bias than the conventional TAS-Seq method (Patent Document 2, Non-Patent Document 11), and the TAS-Seq method can be efficiently performed even in a liquid phase system without using a solid phase. When a TS reaction is combined, the yield of both long-chain cDNA and short-chain cDNA can be significantly increased. In particular, in the liquid phase TS method, according to conventional technical common sense, a problem is expected in that the efficiency of cDNA amplification decreases both when a purification step for removing unreacted oligos is performed after cDNA synthesis and when it is not performed. However, contrary to this expectation, high efficiency and low bias can be achieved, and the yield of both long-chain cDNA and short-chain cDNA can be significantly increased. According to the method of the present invention, for example, the accuracy of therapeutic effect determination using expression analysis or TCR analysis, and the separation and identification of rare cells (e.g., cancer cells) by scRNA-seq analysis can be significantly improved compared to conventional methods, so that it can further contribute to suppressing waste of medical resources. [Brief description of the drawings]

[0019] [Figure 1] 1 is an outline of the steps of a liquid-phase nonTS / TAS-Seq method using a reverse transcriptase having terminal transferase activity, which is one embodiment of the present invention. [Diagram 2] 1 is an outline of steps of a solid-phase TS / TAS-Seq method using a reverse transcriptase that has terminal transferase activity but not strand displacement activity, which is one embodiment of the present invention. [Diagram 3] 1 is an outline of steps of a solid-phase TS / TAS-Seq method using a reverse transcriptase having terminal transferase activity and strand displacement activity, which is one embodiment of the present invention. [Figure 4] 1 is an outline of steps of a liquid-phase TS / TAS-Seq method using a reverse transcriptase that has terminal transferase activity but does not have strand displacement activity, which is one embodiment of the present invention. [Diagram 5]1 is an outline of steps of a liquid-phase TS / TAS-Seq method using a reverse transcriptase having terminal transferase activity and strand displacement activity, which is one embodiment of the present invention. [Figure 6] Comparison of the yield of total cDNA amplification products between the TdT method and the template-switch + TdT method in a solid-phase system (BD Rhapsody single-cell analysis system). The template-switch + TdT method produced significantly higher total cDNA yields. [Figure 7] Comparison of size distribution of total cDNA amplified products using the TdT method and the template-switch + TdT method in a solid-phase system (BD Rhapsody single-cell analysis system). The template-switch + TdT method produces a higher yield of long-stranded cDNA. [Figure 8] Comparison of yield and size distribution of total cDNA amplification products between the TdT method and the template-switch + TdT method in a liquid phase system (10X Chromium single cell analysis system). The template-switch + TdT method produced higher cDNA yields and longer cDNAs. [Figure 9] Comparison of the yield of total cDNA amplification products between the template-switch method and the template-switch + TdT method in a liquid phase system (Smart-seq2 method). The template-switch + TdT method produced significantly higher cDNA yields. [Figure 10] Comparison of size distribution of total cDNA amplified products by the template-switch method and the template-switch + TdT method in a liquid phase system (Smart-seq2 method). The proportion of short cDNAs in the total cDNA is higher in the template-switch + TdT method. [Figure 11]Comparison of the number of detected genes and reads in each cell in single-cell RNA sequencing analysis data using the TdT method, random priming method, and template-switch + TdT method in a solid-phase system (BD Rhapsody single-cell analysis system). Under similar conditions for the distribution of reads per cell, the template-switch + TdT method was able to detect the most genes. [Figure 12] Comparison of the number of detected genes and reads in each cell in single-cell RNA sequencing analysis data using the template-switch method and the template-switch + TdT method in a liquid phase system (10X Chromium single cell analysis system). Under similar conditions for the distribution of reads per cell, the template-switch + TdT method was able to detect more genes. [Figure 13] Results of single-cell clustering analysis of single-cell RNA sequencing data obtained using the template-switch and template-switch + TdT methods in a liquid-phase system (10X Chromium single-cell analysis system). The template-switch + TdT method has better separation ability for cell populations. [Figure 14] Comparison of the number of detected genes when the number of reads was changed in each cell subset in single-cell RNA sequencing analysis data using the template-switch method and the template-switch + TdT method in a liquid phase system (10X Chromium single cell analysis system). In all cell populations, the template-switch + TdT method was able to detect more genes. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0020] In the present invention, the A, T, G, and C that constitute the base sequences of target RNA capture oligos, template switching oligos, primers, adapters, nucleotide homopolymers, and the like, include not only deoxyribonucleotides that constitute DNA (A, T, G, and C of DNA), but also ribonucleotides that constitute RNA (A, T, G, and C of RNA), and further include corresponding nucleotide analogs (for example, bridged nucleic acids such as LNA, ENA, and PNA, and modified bases such as Super T (5-hydroxybutynl-2'-deoxyuridine), Super G (8-aza-7-deazaguanosine), deoxyinosine, 5-methyl dC, deoxyuridine, 2,6-diaminopurine, 2-aminopurine, and 2-Amino-dATP). That is, the target RNA capture oligo (e.g., the target capture portion, the first adaptor portion, the barcode portion, or any other portion), the template switching oligo (the 3'-terminal portion capable of hybridizing to the additional sequence, the second adaptor portion, the barcode portion, or any other portion), the nucleotide homopolymer, the primer for second strand synthesis (e.g., the complementary homopolymer portion, the second adaptor portion, the barcode portion, or any other portion), and each primer used in the nucleic acid amplification step may contain one or more (e.g., about 1 to 15, about 1 to 12, or about 1 to several) monomers selected from ribonucleotides and nucleotide analogs.

[0021] In the present invention, "several" means a plurality of from 2 to 9. "1 to several" can be 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 to 2.

[0022] In the present invention, a primer targeting a certain region X means a primer that specifically hybridizes to this region X or its complementary strand. A primer that targets region X includes a primer that contains a sequence identical to region X or a sequence complementary thereto. The same is true for the term primer set in region X, which means a primer that specifically hybridizes to region X or its complementary strand, and includes a primer that contains a sequence identical to region X or a sequence complementary thereto.

[0023] In the present invention, the terms complementary DNA strand and cDNA refer to a DNA strand consisting of a base sequence complementary to a target RNA, and are not limited to a DNA strand consisting of a sequence complementary to an mRNA.

[0024] In the present invention, the term "oligonucleotide" or "oligo" refers to a single-stranded polynucleotide having a relatively short chain length. The chain length of an oligonucleotide is typically about several tens of bases to about 200 bases, for example, about 50 bases to 150 bases, but is not limited thereto.

[0025] In the present invention, the term "terminal transferase activity" refers to the activity of terminal deoxynucleotidyl transferase to add a nucleotide to the 3'-end of a nucleotide chain in a template-independent manner. The 3'-end of a single-stranded nucleotide, the 3'-protruding end of a double-stranded nucleotide, and the 3'-end of a blunt end of a double-stranded nucleotide are targets for nucleotide addition by the terminal transferase activity.

[0026] In the present invention, the target RNA includes various RNAs including polyA RNA. PolyA RNA is RNA having a polyA tail at the 3' end, and the most typical example is mRNA. The cells from which the target RNA is derived are not particularly limited, and various cells are targeted, such as cells derived from individual mice, various cultured cells, cells derived from healthy individuals, cells derived from cancer patients, and cells derived from patients with various diseases. The cells derived from cancer patients may be cells derived from cancer patients undergoing cancer immunotherapy. The cells derived from healthy individuals or patients may be cells collected from peripheral blood or lesions (e.g., tumors). When the amplification method of the present invention is used in an analysis method such as transcriptome analysis, cells may be used as samples, or cell nuclei isolated from various cells may be used as samples.

[0027] The complementary DNA strand amplification method of the present invention includes a target RNA capture step, a complementary strand synthesis step, an unreacted oligo removal step, an RNA degradation step, a homopolymer addition step, a second strand synthesis step, and a nucleic acid amplification step. The amplification method of the present invention includes an embodiment in which a reverse transcription reaction is carried out in the presence of a template switching oligo in the complementary strand synthesis step, and a template switching (TS) reaction is carried out, and an embodiment in which a reverse transcription reaction is carried out in the absence of a template switching oligo. Hereinafter, for convenience, the former embodiment is called the TS / TAS-Seq method, and the latter embodiment is called the nonTS / TAS-Seq method. As an embodiment of the amplification method of the present invention, the TS / TAS-Seq method is more preferable. The nonTS / TAS-Seq method is preferable when a significantly undesirable product (for example, a strand invasion product by a template switching oligo, a cDNA reverse complementary strand product derived from mispriming to a synthesized cDNA, etc.) is generated by the TS reaction. In both the TS / TAS-Seq method and the nonTS / TAS-Seq method, the target RNA capture step includes a solid-phase system in which the target RNA is captured by a target RNA capture oligo bound to a solid phase such as beads, and a liquid-phase system in which the target RNA is captured by a free target RNA capture oligo not bound to a solid phase. Figure 1 is an outline of the liquid-phase nonTS / TAS-Seq method. Figures 2 to 5 are an outline of the TS / TAS-Seq method, with Figures 2 and 3 showing the solid-phase system and Figures 4 and 5 showing the liquid-phase system.

[0028] Below, with reference to the drawings as appropriate, each step of the solid-phase TS / TAS-Seq method, the liquid-phase TS / TAS-Seq method, and the nonTS / TAS-Seq method will be explained in that order.

[0029] A. Solid-phase TS / TAS-Seq method A-1. Target RNA capture process (Step 1 in Figures 2 and 3) In the target RNA capture step of the solid-phase TS / TAS-Seq method, the target RNA is captured by a target RNA capture oligo bound to a solid-phase carrier. The target RNA is captured on the solid-phase carrier via the target RNA capture oligo. As described below, the target RNA capture step is carried out in a microwell or microdroplet, or in a solution that does not fall under these.

[0030] The solid-phase carrier may be beads or a plate such as a slide glass. Examples of single-cell analysis systems using bead solid-phase carriers include the BD Rhapsody system (Patent Document 3) of Beckton Dickinson Co., Ltd., which uses a plate having a microwell, the Seq-well system (Non-Patent Document 12), and the Nx1-seq system (Patent Document 5, Non-Patent Document 14), the Drop-seq method (Non-Patent Document 13) that captures mRNA in a microdroplet, and the Nadia system of Dolomite Bio Co., Ltd. are known. In addition, as a system using a plate as a solid-phase carrier, a spatial transcriptome method platform is also known in which a tissue sample is permeabilized on a plate on which target capture oligos are aligned and immobilized, and the mRNA coming out of each cell of the tissue sample is captured by the capture oligos on the plate, for example, the Stereo-seq system (Chen et al. Cell 2022 185, 1777-1792. doi: 10.1016 / j.cell.2022.04.003.). The solid-phase TS / TAS-Seq method can be applied to any of these known techniques.

[0031] The material of the beads is not particularly limited, and various materials used for nucleic acid capture carriers in nucleic acid analysis kits and solid-phase particle carriers in immunoassay kits can be used. Examples of the material of the beads include organic polymer beads such as resin beads such as polystyrene and polypropylene, semiconductor beads such as quantum dots (semiconductor nanoparticles) made of semiconductor materials such as cadmium selenide (CdSe), zinc sulfide (ZnS), cadmium sulfide (CdS), zinc selenide (ZnSe), and zinc oxide (ZnO), metal beads such as gold, and polymer beads such as silica beads. Specific examples include beads made of materials such as cellulose, cellulose derivatives, acrylic resins, glass, silica gel, polystyrene, gelatin, polyvinylpyrrolidone, copolymers of vinyl and acrylamide, divinylbenzene cross-linked polystyrene (see Merrifield Biochemistry 1964, 3, 1385-1390), polyacrylamide, latex gel, polystyrene, dextran, rubber, silicon, plastic, nitrocellulose, cellulose, natural sponge, silica gel, glass, metal plastic, cellulose, cross-linked dextran (e.g., Sephadex (trade name)), and agarose gel (Sepharose (trade name)). Either non-magnetic or magnetic materials may be used, but magnetic beads are preferably used because they are easier to handle.

[0032] The material of the plate is not particularly limited, and various materials used for the substrate of a microarray can be used. A typical example of a material that can be used is glass, but other materials such as silicon and plastic can also be used. The solid-phase carrier that is a plate includes various solid-phase carriers with flat or uneven surfaces, such as a microwell plate with aligned microwells, a plate used as a substrate for a microarray, and a flow cell of a sequencer. When the solid-phase carrier is a plate, the target RNA capture oligo is usually immobilized in a plurality of compartments on the plate (typically aligned and immobilized in a spot shape).

[0033] As one embodiment of the target RNA capture step in a solid-phase system, an embodiment can be mentioned in which RNA is extracted from an individual cell in a microwell or microdroplet using an scRNA-seq analysis platform using solid-phase beads, and polyA RNA or mRNA as the target RNA is captured on the beads in the microwell or microdroplet by contacting the RNA with a bead carrier to which a target RNA capture oligo is bound. The term "micro" in the terms microwell and microdroplet typically means that the volume is about 5 to 100 pl. An example of a general method of the scRNA-seq analysis platform using solid-phase beads is as described above, and examples include the BD Rhapsody system (Patent Document 3), Seq-well system (Non-Patent Document 12), and Nx1-seq system (Patent Document 5, Non-Patent Document 14) of Beckton Dickinson using a plate having a microwell, the Drop-seq method (Non-Patent Document 13) that captures mRNA in a microdroplet, and the Nadia system of Dolomite Bio, and these general methods can be preferably used in the present invention.

[0034] Another embodiment of the target RNA capture step in a solid-phase system is to use a spatial transcriptomics platform to permeabilize a tissue sample on a plate on which target RNA capture oligos are aligned and immobilized, and capture polyA RNA or mRNA eluted from each cell of the tissue sample with the capture oligos on the plate. For example, there is the Stereo-seq system (Chen et al. Cell 2022 185, 1777-1792. doi: 10.1016 / j.cell.2022.04.003.). In this embodiment, target RNA is captured in a solution whose volume does not fall within the above-mentioned definition of minute.

[0035] As yet another embodiment of the target RNA capture step in a solid phase system, a polyA RNA sample or an mRNA sample is prepared from a cell sample such as a diseased tissue specimen or a cell suspension, and the polyA RNA is captured on a solid phase carrier by contacting the polyA RNA sample or the mRNA sample with a solid phase carrier to which a polyA RNA capture oligo is bound. In this embodiment, the target RNA is captured in a solution whose volume does not meet the above-mentioned definition of "micro". In this embodiment, the preparation of the polyA RNA sample or the mRNA sample may be carried out by first extracting total RNA from the cell sample and then extracting polyA RNA or mRNA, or polyA RNA or mRNA may be directly extracted from the cell sample without extracting total RNA.

[0036] The target RNA in the TS / TAS-Seq method includes polyA RNA. Only polyA RNA may be targeted, or RNA other than polyA RNA may also be targeted. That is, in the TS / TAS-Seq method, the target RNA capture oligo may include a target polyA RNA capture oligo, and may also include a target RNA capture oligo that captures an RNA other than polyA RNA. In addition to the target RNA capture oligo, a target capture oligo that captures a nucleic acid molecule other than RNA as a target may be further included. On the solid phase, one or more types of target RNA capture oligos may be immobilized, and a target capture oligo that captures a nucleic acid molecule other than RNA may be further immobilized. An example of a target capture oligo that captures a nucleic acid molecule other than RNA is an oligonucleotide that captures a labeled oligo DNA in an scRNA-seq analysis technique that uses an oligo DNA labeling antibody in combination, such as TotalSeq by BioLegend. A technique that combines such an oligo DNA labeling antibody with the TdT method is also known (Patent Document 2). Another example of a target capture oligo that captures a nucleic acid molecule other than RNA is an oligonucleotide that captures a DNA fragment recombined by Tn5 transposase in a single-cell chromatin structure analysis technique that uses Tn5 transposase in combination. In an embodiment in which a plurality of types of capture oligos are used in combination, when the solid phase is a bead, a plurality of types of capture oligos may be immobilized on one bead, or each of the plurality of types of capture oligos may be immobilized on a different bead. When the solid phase is a plate, a plurality of types of capture oligos may be immobilized in one section, or each of the plurality of types of capture oligos may be immobilized in a different section.

[0037] A typical example of a target polyA RNA capture oligo is an oligonucleotide containing a polyT portion as a target capture portion, which captures the polyA portion of the target RNA. Examples of target RNA capture oligos that capture a portion other than polyA include oligonucleotides containing a random sequence of 6 to 15 bases as a target capture portion, and oligonucleotides containing a sequence complementary to a desired region in a specific RNA sequence (e.g., a T cell receptor constant region, a B cell receptor constant region, a region near the 5' end of an RNA, etc.) as a target capture portion.

[0038] The target RNA capture oligo has a 5' end directly or indirectly bound to a solid phase support and a target capture portion at the 3' end. The oligo may contain a first adaptor portion on the 5' side of the target capture portion, i.e., on the solid phase support side. The portion shown as Universal 1 in Figures 2 and 3 is the first adaptor portion. The first adaptor portion is a region for setting one of the primers in the nucleic acid amplification step.

[0039] Furthermore, the target RNA capture oligo may include a barcode portion between the first adaptor portion and the target capture portion for identifying each solid phase carrier or a position on the solid phase carrier. This barcode portion is a bead identification barcode when the solid phase carrier is a bead, and a compartment identification barcode for identifying which compartment on the plate the solid phase carrier is immobilized in when the solid phase carrier is a plate. That is, the target RNA capture oligo may include, from the 5' side to the 3' side, the first adaptor portion, the bead or compartment identification barcode portion, and the target capture portion. In an embodiment including such a barcode portion, the complementary DNA strand amplified in the nucleic acid amplification step includes a barcode sequence derived from the identification barcode portion. The bead identification barcode portion has the same sequence on the same bead, and a different sequence for each bead. This allows cDNA derived from mRNA captured on the same bead to be distinguished from cDNA derived from mRNA captured on other beads. In scRNA-seq analysis, cDNA derived from the same cell can be distinguished from cDNA derived from other cells. Such a solid-phased polyA RNA capture oligo containing a bead identification barcode portion can be prepared by a known method (see, for example, WO 2015 / 166768 A1). In addition, the compartment identification barcode portion has the same sequence within the same compartment (spot) on the plate, and has a different sequence for each compartment (spot). This makes it possible to know what kind of mRNA is expressed in which part of the tissue, for example, when the sample is a tissue specimen.

[0040] A large number of target RNA capture oligo molecules are usually immobilized on one bead or in one compartment. In Fig. 2 and Fig. 3, the solid phase is a bead, the target RNA capture oligo is a target polyA RNA capture oligo containing a polyT portion as a target capture portion, and an embodiment is shown in which mRNA is captured as the target polyA RNA (the polyT portion of the capture oligo is partially omitted in the figure). For convenience, the state in which one molecule of mRNA is captured on one bead carrier is shown, but in reality, a large number of mRNA molecules are captured on one bead carrier. Not only full-length mRNA having a 5' cap structure, but also "non-full-length mRNA" such as incomplete-length mRNA without a cap structure, immature mRNA, and partially degraded mRNA can be captured on the solid phase by the target polyA RNA capture oligo if it has polyA.

[0041] A-2. Complementary strand synthesis process (Step 2 in Figures 2 and 3) After the target RNA capture step, the solid phase carrier is washed, and the complementary strand synthesis step is carried out in a state in which the target RNA is captured on the solid phase carrier. In the complementary strand synthesis step in TS / TAS-Seq, a reverse transcriptase having terminal transferase activity is used to carry out a reverse transcription reaction in the presence of a template switching oligo, thereby carrying out the reverse transcription reaction and the template switching reaction simultaneously (in one step). There is no particular limitation on the timing of adding the template switching oligo to the reaction system, and it may be added before, simultaneously with, or after the initiation of the reverse transcription reaction, or after a certain time has elapsed during the reverse transcription reaction. The reverse transcription reaction and template switching reaction themselves can be carried out in the usual manner.

[0042] Reverse transcriptases having terminal transferase activity are widely known and various types are commercially available, including, in addition to wild-type MMLV RT, Thermo Fisher Scientific's SuperScript II, SuperScript IV, Maxima H minus reverse transcriptase, Takara Bio's SmartScribe reverse transcriptase, and New England Biolabs' template switching RT.

[0043] By reverse transcription reaction, a DNA strand (complementary DNA strand, first strand) having a complementary sequence to the target RNA captured on the solid support is synthesized. Then, an additional sequence consisting of any number of bases is added to the 3'-end of at least a part of the synthesized complementary DNA by the terminal transferase activity of the reverse transcriptase. In the template-independent base addition reaction to the 3'-end by the terminal transferase activity, it is known that the number of bases added is generally within the range of 1 to 5 bases, and 3 bases are often added, and when the template RNA is a full-length mRNA having a cap structure at the 5'-end, CCC is likely to be added to the 3'-end of the cDNA. The template switching oligo is an oligonucleotide that contains a sequence hybridizable with this additional sequence at its 3'-end and contains a switching sequence on the 5'-side of the sequence. Therefore, in this process, the template switching oligo hybridizes to the complementary DNA strand to which the additional sequence has been added, and the complementary DNA strand extends to the 5' end of the template switching oligo, thereby further adding a complementary strand of the switching sequence to the 3' end of the complementary DNA.

[0044] The template switching oligo preferably contains an oligonucleotide containing GGG, GUG or NGG (G and U are ribonucleotide bases, N is any ribonucleotide base selected from A, U, G and C, and may contain one or more nucleotide analogs) at the 3' end as a sequence hybridizable with the additional sequence. Figures 2 and 3 show an example in which the hybridizable 3' end sequence is the ribonucleotide base GGG. Two or more types of template switching oligos having different 3' end sequences may be mixed and used.

[0045] The switching sequence may include a second adaptor portion. The portion shown as Universal 2 in the figure is the second adaptor portion. The second adaptor portion becomes a region for setting one of the primers in the subsequent nucleic acid amplification step.

[0046] The switching sequence may include a molecular barcode portion consisting of a random sequence on the 3' side of the second adaptor portion (between the second adaptor portion and the 3' end sequence in the template switching oligo). The DNA molecules amplified in the subsequent nucleic acid amplification step will have the same molecular barcode if they are derived from the same double-stranded cDNA, and will have different molecular barcodes if they are derived from different double-stranded cDNAs. By counting only DNAs having different molecular barcodes, it is possible to estimate the number of cDNA molecules at the start and correct the difference in PCR amplification efficiency between different cDNAs. The chain length of the molecular barcode is not particularly limited, but is typically about 12 bases to 30 bases. The molecular barcode may have a configuration in which a specific fixed sequence is inserted into a random base sequence to provide resistance to sequence errors. As described later, the long primer used as a second strand synthesis primer in the second strand synthesis step may also include a similar molecular barcode portion.

[0047] The 5' or 3' end (either one or both) of the switching sequence may contain chemical modifications or bases, such as amino modifications, biotin modifications, C3 spacer modifications, etc., to prevent polymerization of the template switching oligo.

[0048] As shown in the first row of Step 2 in Figures 2 and 3, when cDNA is synthesized for the entire length of mRNA on the target RNA capture oligo that captured the full-length mRNA, CCC is added to the 3' end of the cDNA with a high probability due to the terminal transferase activity of the reverse transcriptase. When a template switching oligo with a 3' end sequence of GGG is hybridized to this CCC portion, a complementary strand of the switching sequence is synthesized consecutively to the CCC at the 3' end of the cDNA (template-switched cDNA) due to the DNA-dependent DNA polymerase activity of the reverse transcriptase. In the illustrated example, the complementary strand of the second adaptor, Universal 2, is synthesized, but if a molecular barcode is included between Universal 2 and rGrGrG of the template switching oligo, the molecular barcode complementary strand + Universal 2 complementary strand is synthesized following the CCC at the 3' end of the cDNA. As a result of synthesis of the complementary strand of the switching sequence, the end of the mRNA-cDNA hybrid becomes blunt, and any number of additional bases (indicated as NNN in the figure) may be added to the 3' end of the cDNA strand by the terminal transferase activity of the reverse transcriptase (although this may not always be the case).

[0049] After cDNA is synthesized for the entire length of the full-length mRNA and CCC is added to the 3' end, any cDNA to which the template switching oligo does not hybridize, or any cDNA to which other bases to which the template switching oligo does not hybridize, are added to the 3' end, remain on the solid phase as cDNA that has not undergone the template switching reaction (the second row of Step 2, non-switched cDNA).

[0050] On target RNA capture oligos that capture non-full-length mRNA, any number of bases other than CCC (NNN) are likely to be added to the ends of the synthesized cDNA (although in some cases they may not be added), and such cDNAs also remain on the solid phase as cDNAs that have not undergone the template switching reaction (third row of Step 2, non-switched cDNA).

[0051] Even if full-length mRNA is captured, if cDNA synthesis stops midway, the cDNA end of the mRNA-cDNA hybrid will be a recessed end. In this case, no base addition occurs to the cDNA end, so it remains on the solid phase without undergoing the template switching reaction (Step 2, 4th row, non-switched cDNA).

[0052] In the complementary strand synthesis step, it is possible to use a reverse transcriptase that has not only terminal transferase activity but also strand displacement activity. In this case, as shown in Step 2 of Figure 3, in the hybrid double-stranded template-switched cDNA and mRNA, second strand synthesis proceeds while peeling off the mRNA from the cDNA due to the strand displacement activity of the reverse transcriptase.

[0053] Reverse transcriptases having terminal transferase activity and strand displacement activity are also known, and various types are commercially available. Representative examples include wild-type MMLV RT, as well as SuperScript II, SuperScript IV, and Maxima H minus reverse transcriptase (Thermo Fisher Scientific), SmartScribe reverse transcriptase (Takara Bio), and template switching RT (New England Biolabs).

[0054] A-3. Unreacted oligo removal process (Step 3 in Figures 2 and 3) After the complementary strand synthesis step, the solid phase carrier is washed and the process proceeds to the unreacted oligo removal step. In this step, the target RNA capture oligo (unreacted capture oligo) remaining on the solid phase and not capturing the target RNA is removed. In the solid phase system, the template switching oligo (unreacted template switching oligo) remaining in the reaction solution and not hybridized to the complementary DNA strand is removed by washing the solid phase, so the unreacted capture oligo on the solid phase is decomposed and removed by exonuclease treatment. Examples of general exonucleases that specifically decompose single-stranded DNA include Exonuclease I and Exonuclease T. In the present invention, at least one of such general exonucleases can be used. After exonuclease treatment, the solid phase carrier is washed and the process proceeds to the next step.

[0055] A-4. RNA decomposition process (Step 4 in Figures 2 and 3) In the RNA degradation step, the mRNA of the mRNA-cDNA hybrid bound to the solid support is degraded with an RNase. If the 3'-terminal sequence of the template switching oligo is a ribonucleotide base, the 3'-terminal portion is also degraded. In this step, a general RNase such as RNase H can be used, and alkaline treatment with NaOH solution, KOH solution, etc. can also be used. After RNA degradation, the solid support can be washed and recovered before proceeding to the homopolymer addition step, or it can be directly proceeded to the homopolymer addition step without washing. As described below, the RNA degradation step and the homopolymer addition step can also be performed simultaneously.

[0056] A-5. Homopolymer addition process (Step 4 in Figures 2 and 3) In the homopolymer addition step, a reaction is carried out with terminal deoxynucleotidyl transferase (TdT) in the presence of dATP, dTTP, dCTP, or dGTP and a chain-terminating nucleotide triphosphate (chain-terminating NTP) to add a nucleotide homopolymer to the 3' end of the complementary DNA strand synthesized on the solid phase (Step 4 in Figures 2 and 3; an example of polyC is shown in the figure). A nucleotide homopolymer is added to both template-switched cDNA and non-switched cDNA. As is well known in the art, a chain-terminating NTP (chain-terminating ATP, chain-terminating TTP, chain-terminating CTP, or chain-terminating GTP) is a nucleotide that has been modified or altered so that the OH group at the 3' position of the nucleotide cannot form a phosphate ester bond with the 5'-phosphate moiety of another nucleotide molecule, and can also be called a nucleotide triphosphate that does not have an OH group at the 3' position (the atomic group bonded to the 3' position does not contain an OH group). Specific examples of common chain-terminating NTPs that can be used in the present invention include dideoxynucleotide triphosphates (ddNTPs) (ddATP, ddCTP, ddGTP, ddTTP, ddUTP), ddNTP derivatives (typically ddNTPs modified at the 3' position with an atomic group that does not have an OH group, e.g., ddNTPs modified at the 3' position with an azide group or an amino group, such as 3'-Azido-ddATP, 3'-Azido-ddCTP, 3'-Azido-ddGTP, 3'-Azido-ddTTP, 3'-Azido-ddUTP, 3'-Amino-ddATP, 3'-Amino-ddCTP, 3'-Amino-ddGTP, 3'-Amino-ddTTP), 3'-deoxynucleotide triphosphates (3'-dNTPs) (3'-dATP, 3'-dCTP, 3'-dGTP, 3'-dTTP, 3'-dUTP), 3'-deoxy-5-methyluridine-5'-triphosphate, for example, ddNTP, or ddNTP modified at the 3' position with an azide group, particularly ddNTP, may be used, but is not limited thereto. It is desirable that the base chains of the chain-terminating NTP and the substrate (dNTP) forming the homopolymer are the same.Since the minimum homopolymer length required for the second strand synthesis reaction, the necessary length of the 3'-terminal homopolymer portion of the primer used in second strand synthesis, and the chain length of the free primer-derived by-product can be particularly desirably suppressed, it is preferable to perform poly-C addition or poly-G addition by using, for example, a combination of chain-terminating CTP such as ddCTP+dCTP, or chain-terminating GTP such as ddGTP+dGTP. In the TS / TAS-Seq method in which the TS reaction is used in combination, it is particularly preferable to perform poly-C addition by using a combination of chain-terminating CTP+dCTP, since the cytosine base added to the 3'-terminal of the cDNA strand for the full-length mRNA during the TS reaction can also be counted as a homopolymer site.

[0057] The amount of chain-terminating NTP added, for example, when ddNTP is used, may be about ddNTP:dNTP=1:10 to 1:100 in terms of ratio to dNTP (dATP, dTTP, dCTP, or dGTP), and may be, for example, 1:10 to 1:80, 1:10 to 1:60, 1:10 to 1:40, 1:15 to 1:80, 1:15 to 1:60, or 1:15 to 1:40. The amount of other chain-terminating NTPs used can also be set according to this ratio. In the case of the conventional TdT method in which the TdT reaction is performed in the absence of chain-terminating NTPs, in order to control the chain length of homopolymers, it is necessary to strictly control the reaction time according to the difference in activity between enzyme lots and the difference in the amount of substrates such as primers and cDNA. On the other hand, in the TAS-Seq method developed by the inventors of the present application, the homopolymer addition reaction by TdT is carried out in the presence of a chain-terminating NTP, and the chain-terminating NTP is stochastically incorporated to terminate the homopolymer extension reaction, thereby significantly increasing the tolerance to differences in reaction time and enzyme activity due to TdT.

[0058] Homopolymer addition reactions using TdT are generally carried out in the presence of divalent cations. 2+ , Cu 2+ , Ni 2+ , Co 2+ , Mn 2+ , Mg 2+ Examples of divalent metal cations include Co 2+ , Mn2+ or Mg 2+ It may be, but is not limited to,

[0059] The addition of chain-terminating NTPs greatly increases the tolerance for differences in reaction time, etc., caused by TdT, so that the RNA degradation reaction and the homopolymer addition reaction can be carried out simultaneously by adding RNase H to the TdT reaction solution. Thus, in one embodiment of the present invention, the RNA degradation step and the homopolymer addition step are carried out simultaneously.

[0060] A-6. Second strand synthesis step (Step 5 in Figure 2 and Figure 3) After the homopolymer addition reaction, the solid support is washed and the second strand synthesis step is started. The second strand synthesis primer used in the second strand synthesis step of the TS / TAS-Seq method includes a primer (hereinafter, long primer) that contains a complementary homopolymer portion of a sequence complementary to the nucleotide homopolymer added to the end of the first strand of the complementary DNA and contains a second adapter portion on the 5' side of the complementary homopolymer portion, and a primer (hereinafter, short primer) that does not contain a complementary homopolymer portion and contains a second adapter portion on its 3' side. The template-switched cDNA derived from the full-length mRNA contains a complementary strand of the second adapter (Universal 2) derived from the template switching oligo, so both the long primer and the short primer can hybridize. In general, the primer on the inside is easier to extend, so the figure shows the state of extension from the short primer. The long primer hybridizes to the non-switched complementary DNA strand, and the second strand is extended and synthesized. By the second strand synthesis, a DNA double strand consisting of a complementary DNA (first strand) and a second strand is formed on the solid phase. If a molecular barcode is included in the template switching oligo, the molecular barcode is incorporated into the second strand synthesized in this step for the template-switched cDNA first strand.

[0061] The complementary homopolymer portion is present at the 3'-end of the long primer. The length of the complementary homopolymer portion is usually about 6 to 15 bases, for example about 7 to 13 bases, when the homopolymer tail added to the first strand of the complementary DNA is polyC or polyG, and is usually about 15 to 30 bases, for example about 18 to 25 bases, when the homopolymer tail is polyA or polyT. The complementary homopolymer portion may have an anchor sequence of about 1 to 2 bases added to its 3'-end. Adding an anchor sequence can increase the probability that the long primer anneals to the starting point of the homopolymer tail added to the cDNA by TdT. The anchor sequence can be H or HN (H = A, T or C; N = any base (A, T, C or G)) when the complementary homopolymer portion is polyG, D or DN (D = A, T or G; N = any base (A, T, C or G)) when the complementary homopolymer portion is polyC, B or BN (B = T, G or C; N = any base (A, T, C or G)) when the complementary homopolymer portion is polyA, or V or VN (V = A, G or C; N = any base (A, T, C or G)) when the complementary homopolymer portion is polyT.

[0062] The second adaptor contained in the long primer and the short primer is the same as the second adaptor contained in the template switching oligo, and will be the region where one of the primers is set in the subsequent nucleic acid amplification step.

[0063] The long primer may contain a molecular barcode portion consisting of a random sequence, similar to the template switching oligo. The long primer may contain a molecular barcode between the second adaptor portion and the complementary homopolymer portion. The molecular barcode contained in the switching sequence of the template switching oligo functions in the amplification product derived from the template switched cDNA. The molecular barcode carried by the long primer functions in the amplification product derived from the non-switched cDNA.

[0064] The polymerase used in the second strand synthesis step may be a general polymerase such as Taq polymerase used in normal PCR, or a polymerase known as a highly accurate PCR enzyme or a polymerase having strand displacement activity such as Bst DNA polymerase.

[0065] In the second strand synthesis step, after heat denaturation as necessary, only one cycle of annealing and extension reaction of the primer for second strand synthesis may be carried out, or cycles may be carried out by thermal cycling reaction.Furthermore, after one or more cycles of reaction, a follow-up reaction may be carried out using a polymerase having strand displacement activity such as Bst DNA polymerase.

[0066] A-7. Nucleic acid amplification process (Step 6 in Figures 2 and 3) After the synthesis of the second strand, the solid phase carrier may or may not be washed before proceeding to the nucleic acid amplification step. In the nucleic acid amplification step, a nucleic acid amplification reaction is carried out using the double-stranded DNA synthesized on the solid phase carrier as a template (Step 6 in Figures 2 and 3). Since high accuracy is required in this nucleic acid amplification reaction, it is desirable to use a polymerase that is generally known as a high-accuracy PCR enzyme. Various high-accuracy PCR enzymes are commercially available. In this step, the nucleic acid amplification reaction may be carried out directly by adding additional nucleic acid amplification reaction solution to the solid phase carrier without washing it.

[0067] In the embodiment in which the first and second adaptors are used, a nucleic acid amplification reaction can be performed with a set of primers set for those adaptors. In the case of scRNA-seq analysis, since the mRNA expressed in each cell is comprehensively reverse transcribed and amplified, it is common to perform total cDNA amplification with a primer set targeting the first and second adaptors. In this case, the primer set is typically a set of a primer consisting of a first adaptor sequence and a primer consisting of a second adaptor sequence, but it may contain any additional sequence or modification with biotin or the like on the 5' side.

[0068] Alternatively, a nucleic acid amplification reaction may be carried out using a primer targeting a desired region in the complementary DNA strand instead of a primer targeting the first adaptor. In cases where it is necessary to amplify only a specific region of a complementary DNA molecule synthesized on a solid support, such as in the preparation of a TCR variable region library in TCR repertoire analysis, a nucleic acid amplification reaction can be carried out using a primer targeting the second adaptor and a primer targeting a desired region in the complementary DNA strand (for example, a primer targeting a TCR constant region). The nucleic acid amplification reaction itself may be carried out by PCR in a conventional manner. If desired, one or more stages of PCR may be carried out. For example, several cycles of 1st PCR are carried out using a primer set targeting the first and second adaptors, and the amplified products are size-selected and purified. Then, several dozen cycles of 2nd PCR are carried out using a primer set targeting the same site, or a set of a primer targeting the second adaptor and a primer targeting a partial region inside the first adaptor, and the amplified products are size-selected and purified again, thereby obtaining the amplified products of all cDNA. In the 2nd PCR, both primers may be bound to spacers such as biotin or amine at their 5' ends, which makes it easier to recover the DNA fragments to be sequenced.

[0069] B. Liquid phase TS / TAS-Seq method B-1. Target RNA capture process (Step 1 in Figures 4 and 5) In the target RNA capture step of the liquid-phase TS / TAS-Seq method, the target RNA is captured by a free target RNA capture oligo that is not bound to a solid-phase carrier. Even in the liquid-phase system, the target RNA capture step can be performed in a microwell or microdroplet, or in a solution that does not fall under these categories.

[0070] Examples of liquid-phase analysis techniques include the 10X Chromium system (Patent Document 4) of 10X Genomics, which encapsulates hydrogel beads containing mRNA capture oligos and one cell in a microdroplet, melts the hydrogel and dissolves the cell in the microdroplet, and captures the mRNA with the released mRNA capture oligos, Smart-Seq2 (Non-Patent Document 15) which dispenses individual cells or trace amounts of mRNA into a 96-well plate for amplification, and sci-RNA-seq3 which suspends fixed cells in a solution containing a cell membrane permeabilization reagent and mRNA capture oligos, and captures the mRNA on the mRNA capture oligos within the fixed cells. The liquid-phase TS / TAS-Seq method can be applied to any of these known transcriptome analysis techniques.

[0071] One embodiment of the target RNA capture process in a liquid phase system is one in which a target RNA capture oligo is encapsulated in beads made of a material (such as a hydrogel) that can melt under mild conditions such as room temperature, the beads and cells are encapsulated in microdroplets or added to microwells in a 1:1 ratio, and the beads are melted and the cells are lysed in the microdroplets or microwells to capture the target RNA such as mRNA on the target RNA capture oligo.

[0072] Another embodiment is a mode in which a target RNA capture oligo is added to a solution containing a cell lysate or RNA extracted from a cell, and target RNA such as mRNA is captured on the capture oligo in the solution. This embodiment includes a method in which individual cells or mRNA extracted therefrom are dispensed into a microwell and target RNA such as mRNA is captured on the target RNA capture oligo in the microwell, a method in which individual cells are trapped in a microdroplet and target RNA is captured on the target RNA capture oligo in the microdroplet, and a method in which target RNA is captured on the target RNA capture oligo in a solution that does not correspond to a microvolume.

[0073] In yet another embodiment, fixed cells are suspended in a solution containing a cell membrane permeation reagent and a target RNA capture oligo, and target RNA such as mRNA is captured on the target RNA capture oligo within the fixed cells.

[0074] As explained in the solid-phase system, the target RNA also includes polyA RNA in the liquid-phase TS / TAS-Seq method. Only polyA RNA may be targeted, or RNA other than polyA RNA may also be targeted. That is, in the TS / TAS-Seq method, the target RNA capture oligo may include a target polyA RNA capture oligo and may also include a target RNA capture oligo that captures RNA other than polyA RNA. In addition to the target RNA capture oligo, it may further include a target capture oligo that captures a nucleic acid molecule other than RNA as a target. When capturing a target RNA in a microwell or microdroplet, multiple types of capture oligos may be contained in one microwell or microdroplet, or multiple types of capture oligos may be contained in different microwells or microdroplets.

[0075] Typical examples of target polyA RNA capture oligos and examples of target RNA capture oligos that capture sites other than polyA are the same as those in the solid-phase TS / TAS-Seq method. As shown in Step 1 of Figures 4 and 5, not only full-length mRNAs with a 5' cap structure, but also "non-full-length mRNAs" such as incomplete-length mRNAs without a cap structure, immature mRNAs, and partially degraded mRNAs are captured by target polyA RNA capture oligos having a T portion as a target capture portion if they have polyA.

[0076] The target RNA capture oligo has a target capture portion at the 3' end. The 5' side of the target capture portion may contain a first adaptor portion (shown as Universal 1 in Fig. 4 and Fig. 5) that can be used as a primer setting region in the nucleic acid amplification step, and may contain a cell identification barcode portion for identifying individual cells from which the target RNA is derived between the first adaptor portion and the target capture portion. This cell identification barcode is a barcode corresponding to the bead identification barcode portion and the compartment identification barcode portion in a solid phase system. The target RNA capture oligo to be encapsulated together with one cell in the same microwell or microdroplet has a cell identification barcode of the same sequence, and the sequence of the cell identification barcode differs for each microwell or microdroplet. This makes it possible to distinguish cDNA derived from mRNA captured by the capture oligo in the same microwell or microdroplet from cDNA derived from mRNA captured in another microwell or microdroplet, and thus to distinguish cDNA derived from the same cell from cDNA derived from other cells.

[0077] B-2. Complementary strand synthesis process (Step 2 in Figures 4 and 5) In the liquid phase system, after the target RNA capture step, the complementary strand synthesis step is continued without purification, etc. A reverse transcriptase with terminal transferase activity and a template switching oligo are added to the reaction solution after the target RNA capture, and the reverse transcription reaction and TS reaction are carried out in one step.

[0078] The details of this step and the structure of the template switching oligo are the same as those of solid-phase TS / TAS-Seq. The first row of Step 2 in Figures 4 and 5 is the template-switched cDNA. cDNA that was synthesized for the entire length of full-length mRNA but did not hybridize with the template switching oligo (second row of Step 2 in Figures 4 and 5), cDNA that was synthesized for the entire length of non-full-length mRNA and did not hybridize with the template switching oligo (third row of Step 2), and cDNA whose synthesis stopped midway (fourth row of Step 2) remain in the reaction solution as cDNA that did not undergo template switching reaction.

[0079] When a reverse transcriptase that has strand displacement activity in addition to terminal transferase activity is used, second-strand synthesis proceeds in the hybrid double-strand of template-switched cDNA and mRNA, peeling off mRNA from cDNA by the strand displacement activity of the reverse transcriptase, as shown in Step 2 of Figure 5. The difference from the solid-phase system is that the 3'-end of the synthesized second strand and the 5'-end of the cDNA strand are blunt, so bases can be added to the 3'-end of the second strand by the terminal transferase activity of the reverse transcriptase (although there are cases where they are not added).

[0080] B-3. ​​Unreacted oligo removal process (Step 3 in Figures 4 and 5) In the case of a liquid phase system, the reaction solution after the completion of complementary strand synthesis can be purified by nucleic acid size fractionation to separate and remove the unreacted target RNA capture oligos with very short chain length from the complementary DNA strand (mRNA-cDNA hybrid). Unreacted template switching oligos can also be removed in one step together with the unreacted capture oligos. Purification methods by nucleic acid size fractionation are well known and can be carried out in the usual manner, such as purification by a silica membrane column or purification using magnetic beads to which DNA is bound. In this process, the nucleic acid size fractionation may be combined with removal by exonuclease, which can further increase the efficiency of removing the unreacted oligos. A general exonuclease that specifically degrades single-stranded DNA can be used, and examples of such an exonuclease include Exonuclease I and Exonuclease T. Exonuclease can also be removed at the same time by adding exonuclease to the reaction solution after the completion of complementary strand synthesis, and then purifying by nucleic acid size fractionation.

[0081] B-4. RNA degradation process (Step 4 in Figures 4 and 5) After purification by size fractionation, an RNase is added to the reaction solution to degrade the mRNA of the mRNA-cDNA hybrid in the reaction solution and the 3'-terminal sequence of the template switching oligo (if the sequence is a ribonucleotide base).

[0082] After adding RNase to degrade RNA, reagents such as dNTP, chain-terminating NTP and TdT may be added to the reaction solution to carry out the next homopolymer addition step, but it is preferable to add RNase and these reagents simultaneously or sequentially to the reaction solution to carry out RNA degradation and homopolymer addition simultaneously. When an alkaline solution such as NaOH or KOH is used in the RNA degradation step, the reaction solution is neutralized after the degradation reaction with the alkaline solution before carrying out the TdT reaction.

[0083] B-5. Homopolymer addition process (Step 4 in Figure 4 and Figure 5) A TdT-catalyzed reaction is carried out in the presence of dATP, dTTP, dCTP, or dGTP and a chain-terminating NTP to add a homopolymeric nucleotide to the 3' end of the complementary DNA strand (Step 4 in Figures 4 and 5; an example of polyC is shown in the figure). Details of this step, such as preferred examples of chain-terminating NTPs and the ratio of dNTPs and chain-terminating NTPs added, are the same as those of solid-phase TS / TAS-Seq, except for the points described below.

[0084] 5 shows an embodiment in which the reverse transcriptase used in the complementary strand synthesis step further has strand displacement activity. In this embodiment, since the second strand (the strand indicated by an asterisk in Step 4) for the template-switched cDNA is synthesized in the complementary strand synthesis step, a DNA double strand composed of the first and second strands of cDNA is present in the reaction solution at the start of the homopolymer addition step, and both ends of this DNA double strand are blunt ends or 3'-overhanging ends (see the first row of Step 2 in FIG. 5). Therefore, in the DNA double strand, a homopolymer can be added not only to the 3' end of the template-switched cDNA first strand but also to the 3' end of the second strand.

[0085] B-6. Second strand synthesis step (Step 5 in Figure 4 and Figure 5) The reaction solution after RNA degradation and homopolymer addition is purified to remove reagents such as RNase and TdT, and then the second strand synthesis step proceeds. The second strand synthesis step of the liquid-phase TS / TAS-Seq is carried out using second strand synthesis primers including a long primer and a short primer, as in the solid-phase system. The composition and preferred conditions of each primer, as well as the details of this step, are the same as those of the solid-phase TS / TAS-Seq, except for the points described below.

[0086] 5 is used, the second strand (the strand marked with an asterisk) synthesized in the complementary strand synthesis step for the template-switched cDNA may also have a homopolymer at the 3'-end, and thus a reaction may occur in which the long primer hybridizes to the homopolymer of this strand and is extended, as shown in the dashed box in Step 5. The DNA strand generated by this extension reaction does not contain an adapter sequence necessary for PCR amplification at its 5'-end, and therefore the DNA strand will not be amplified when primers targeting the first and second adapters are used in the subsequent nucleic acid amplification step.

[0087] B-7. Nucleic acid amplification process (Step 6 in Figures 4 and 5) After second strand synthesis, the reaction solution is purified as necessary to remove excess primers and reagents such as polymerase, and the nucleic acid amplification step is then carried out. This step in the liquid phase system can be carried out in the same manner as in the solid phase system TS / TAS-Seq.

[0088] C. nonTS / TAS-Seq method (Figure 1) Although an example of a liquid phase system is shown in Figure 1, it can also be performed in a solid phase system. In the complementary strand synthesis step, the reverse transcription reaction is performed in the absence of a template switching oligo, and a reverse transcriptase having terminal transferase activity is used; strand displacement activity is not required, except that the method can be performed in the same manner as the TS / TAS-Seq method. Below, each step of the nonTS / TAS-Seq method is explained, focusing on the differences from the TS / TAS-Seq method.

[0089] C-1. Target RNA capture process (Step 1 in Figure 1) In the nonTS / TAS-Seq method, the main target RNA is mRNA, which is polyA RNA, and it is generally preferred that the target RNA capture oligo contains a target polyA RNA capture oligo. However, since the TS reaction using CCC addition to cDNA for full-length mRNA is not used in combination, the effects of this method can be obtained even when nonTS / TAS-Seq is performed only for non-polyA RNA. Therefore, in the nonTS / TAS-Seq method, it is not essential that the target RNA capture oligo contains a target polyA RNA capture oligo.

[0090] C-2. Complementary strand synthesis process (Step 2 in Figure 1) In the complementary strand synthesis step, a reverse transcription reaction is carried out in the absence of a template switching oligo using a reverse transcriptase having terminal transferase activity, whereby a complementary DNA strand for the mRNA captured by the immobilized or free target RNA capture oligo is synthesized, and any number of bases are added to the 3'-end of at least a part of the complementary DNA strand.

[0091] C-3. Unreacted oligo removal process (Step 3 in Figure 1) In the case of a solid phase system, the reaction can be carried out in the same manner as in A-3, and in the case of a liquid phase system, the reaction can be carried out in the same manner as in B-3.

[0092] C-4. RNA decomposition process (Step 4 in Figure 1) In the case of a solid phase system, the reaction can be carried out in the same manner as in A-4, and in the case of a liquid phase system, the reaction can be carried out in the same manner as in B-4.

[0093] C-5. Homopolymer addition process (Step 4 in Figure 1) In the case of a solid-phase system, the procedure can be the same as that of A-5, and in the case of a liquid-phase system, the procedure can be the same as that of B-5. In the nonTS / TAS-Seq method, the homopolymer addition step may be performed after RNA degradation, or RNA degradation and homopolymer addition may be performed simultaneously.

[0094] C-6. Second strand synthesis process (Step 5 in Figure 1) The primers used for second strand synthesis include long primers. Short primers are not necessary.

[0095] C-7. Nucleic acid amplification process (Step 6 in Figure 1) It can be carried out in the same manner as the nucleic acid amplification reaction in the liquid-phase and solid-phase TS / TAS-Seq methods.

[0096] The complementary DNA strand amplified by the method of the present invention, including nonTS / TAS-Seq and TS / TAS-Seq, may be subjected to processing such as fragmentation, end repair, A-tailing, and addition of a sequencing adapter in order to be subjected to sequencing by a next-generation sequencer. By these processing, a library of cDNA processed into a sequencing construct is obtained. As a fragmentation means, ultrasound or an enzyme can be used. A commonly used reagent can be used to create a sequencing construct, and as a representative example of the enzymatic method, the NEBNext UltraII FS kit of New England Biolabs or the KAPA HyperPlus kit of KAPA Biosystems can be used, and as an ultrasonic fragmentation device, machines such as Covaris or Bioruptor can be used, but other equivalent products can also be used. As the sequencing adapter, an appropriate adapter can be used depending on the next-generation sequencer to be used.

[0097] The sequencing of the library may be carried out using a sequencer generally called a next-generation sequencer. Specific examples of next-generation sequencers that can be preferably used include Illumina's Novaseq 6000 system, Novaseq X system, Hiseq system, Nextseq system, Nextseq2000 system, Nextseq3000 system, and MiSeq system; MGI's DNBseq T7 system, DNBseq G400 system, and DNBseq G40 system; Thermo Fisher Scientific's Ion S5 / Ion S5 XL system, etc. EXAMPLES

[0098] The present invention will be described in more detail below with reference to examples, although the present invention is not limited to the following examples.

[0099] 1. Comparison of the TdT method (TAS-Seq method) and the cDNA amplification method of the present invention in a scRNA-seq analysis system using a solid phase carrier (Figures 6 and 7) A single-cell transcriptome library trapped on solid-phase beads prepared using the BD Rhapsody system (Beckton Dickinson) was amplified by the TdT method (TAS-Seq method, Patent Document 2 and Non-Patent Document 11) and the cDNA amplification method according to the present invention (Template-switch + TdT method, or Template-switch + TAS-Seq method). The sequences of the primers used are shown in Table 1 below.

[0100] Human peripheral blood mononuclear cells (PBMCs) were obtained from LONZA and used after preparation and cryopreservation. Frozen human PBMCs were quickly thawed in a 37°C water bath, 9 ml of pre-warmed RPMI1640 / 5% FBS was added to the suspension, mixed by inversion, centrifuged, the supernatant was removed, and washed again with RPMI1640 / 5% FBS. The number of cells was counted using a flow cytometer, and the cells and beads were loaded at an appropriate density into a microwell cartridge according to the Rhapsody specifications, the cells were lysed, and each cell-derived mRNA was trapped on one bead (containing a Rhapsody universal adapter as a polyA RNA capture oligo) (target RNA capture step). The Rhapsody universal adapter immobilized on the beads is DNA with the following structure, and CLS1 (cell label section 1) to CLS3 each have 96 known unique sequences consisting of 9 bases, for a total of 288 types, constituting a total of approximately 900,000 bead identification barcodes. In SEQ ID NO:1 of the sequence listing, CLS1 to CLS3 are represented as NNNNNNNNN. <Structure of the Rhapsody universal adapter> ACACGACGCTCTTCCGATCT - [none or A or GT or TCA] - (CLS1) - GTGA - (CLS2) - GACA - (CLS3) - NNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTT (SEQ ID NO: 1)

[0101] Four beads that trapped mRNA were each divided into two (for a total of eight). Four of them were subjected to reverse transcription to cDNA amplification by the TAS - Seq method, and the remaining four were subjected to reverse transcription to cDNA amplification by the cDNA amplification method of the present invention.

[0102] In the TAS - Seq method, the above poly(A) RNA - capturing beads were subjected to a reverse transcription reaction as recommended by the manufacturer (using a reverse transcriptase having complementary - strand synthesis activity, terminal transferase activity, and strand - displacement activity). Then, by Exonuclease I treatment, unreacted poly(A) RNA - capturing oligos on the beads were removed (unreacted oligo removal step). Using dCTP and ddCTP as a terminator, mRNA degradation by RNaseH and homopolymer addition reaction by TdT were simultaneously carried out for 20 minutes. After washing the beads, the second - strand synthesis reaction was carried out using a primer having a guanine homopolymer at the 3' end of the universal 2 adapter sequence and a high - fidelity DNA polymerase. The total cDNA was amplified by 9 cycles of PCR using primers for the universal 1 and universal 2 sequences (universal oligo - long, 5'BDWTAv2) against the reaction solution. After size selection using AmPure XP beads, it was additionally amplified by 5 cycles of PCR. The final cDNA amount was measured by a Qubit fluorometer or a nanodrop spectrophotometer (Thermo Fisher Scientific), and the cDNA size distribution was measured by a MultiNA system (Shimadzu Corporation).

[0103] In the cDNA amplification method of the present invention, the above polyA RNA capture beads were subjected to reverse transcription reaction at 42°C for 30 minutes using the reagents provided by the manufacturer, and then template switching oligo (5'BDWTAv2-TSO) and MgCl2 were added, and reverse transcription and template switching reactions were carried out at 42°C for 30 minutes (complementary strand synthesis step). After that, unreacted polyA RNA capture oligo on the beads was removed by Exonuclease I treatment (unreacted oligo removal step). Using dCTP and ddCTP as a terminator, mRNA degradation by RNaseH and homopolymer addition reaction by TdT were carried out simultaneously for 20 minutes. After washing the beads, a second strand synthesis reaction was carried out using a primer having a guanine homopolymer at the 3' end of the universal 2 adaptor sequence and a highly accurate DNA polymerase. The reaction solution was subjected to 9 cycles of PCR amplification of all cDNA using primers for universal 1 and universal 2 sequences (universal oligo-long, 5'BDWTAv2). After size selection using AmPure XP beads (Beckman Coulter), the cDNA was amplified by five additional cycles of PCR. The final cDNA amount was measured using a Qubit fluorometer or nanodrop spectrophotometer (Thermo Fisher Scientific), and the cDNA size distribution was measured using a MultiNA system (Shimadzu Corporation).

[0104] The results of comparing the cDNA yields are shown in Figure 6. The cDNA amplification method of the present invention, which performs both the TS and TdT reactions, yielded significantly more cDNA than the conventional TdT method (TAS-Seq method), which performs only the TdT reaction.

[0105] The results of comparing the cDNA size distributions are shown in Figure 7. In the cDNA amplification method of the present invention, which performs both the TS and TdT reactions, the peak at 1000-2000 base pairs (bp) is higher than in the conventional TdT method (TAS-Seq method), which performs only the TdT reaction, suggesting that a larger amount of long full-length cDNA is synthesized.

[0106] [Table 1]

[0107] 2. Comparison of the TdT method and the cDNA amplification method of the present invention in a liquid-phase scRNA-seq analysis system (Figure 8) Human PBMC samples were obtained using the same method as in 1 above, and after counting the cells, the cells were loaded into the microfluidic system at an appropriate density using 10X Genomics Chromium v3.1 reagent according to the Chromium specifications, and each cell and hydrogel bead were encapsulated in a microdroplet. When loading the cells into Chromium, a cell lysis reagent and a cDNA synthesis reagent containing a reverse transcription reagent, etc. (a reverse transcriptase with terminal transferase activity and strand displacement activity was used) were simultaneously loaded, but for comparison, samples with and without template switching oligo (10X Chromium-TSO) were prepared. After cell lysis, mRNA from each cell was trapped on a polyA RNA capture oligo (10X Chromium adapter) released from the hydrogel (target RNA capture step), and reverse transcription reaction, or reverse transcription reaction and TS reaction were performed in the microdroplet at 37°C or 53°C for 1 hour (complementary strand synthesis step). After the complementary strand synthesis process was completed, the emulsion constituting the microdroplets was broken using the method recommended by 10X, and the cDNA was purified by nucleic acid size fractionation to remove unreacted polyA RNA capture oligos and template switching oligos (unreacted oligo removal process). The 10X Chromium adapter is a DNA having the following structure, and CB is a known identification barcode consisting of 16 bases and has approximately 900,000 different combinations. In sequence number 5 of the sequence table, CB is shown as NNNNNNNNNNNNNNNN. <10X Chromium adapter structure> CTACACGACGCTCTTCCGATCT- (CB) NNNNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN (SEQ ID NO: 5)

[0108] Using the obtained cDNA solution, dCTP and ddCTP as a terminator were used, and mRNA degradation by RNaseH and homopolymer addition reaction by TdT were simultaneously performed for 20 minutes. After purifying the TdT reaction solution, second strand synthesis reaction was performed using a primer with a guanine homopolymer at the 3' end of the universal 2 adaptor sequence and a highly accurate DNA polymerase. The reaction solution was amplified by PCR for 9 cycles using primers for universal 1 and universal 2 sequences (universal oligo-long, 5'BDWTAv2). After size selection using AmPure XP beads (Beckman Coulter), the obtained cDNA was further amplified by 5 cycles of PCR. The final cDNA amount was measured using a nanodrop spectrophotometer, and the size distribution of cDNA was measured using a MultiNA system.

[0109] The results of comparing the cDNA yield and size distribution are shown in Figure 8. Compared to the conventional TdT method in which only the TdT reaction is carried out, the cDNA amplification method of the present invention, which carries out both the TS and TdT reactions, yields more cDNA and the peak at 1000-2000 base pairs (bp) is higher, suggesting that more long, full-length cDNA is synthesized.

[0110] [Table 2]

[0111] 3. Comparison of the TS method and the cDNA amplification method of the present invention in a liquid-phase cDNA amplification system (Figures 9 and 10) NIH3T3 cells were cultured and total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific). PolyA RNA capture oligo (BioEcoP-dT25-adapter) was added to 10 ng of total RNA (6 samples) (target RNA capture step), and reverse transcription and TS reaction were carried out at 42°C for 1 hour using the Smart-seq2 method (Picelli S., et al. Full-length RNA-seq from single cells using Smart-seq2. Nat Protoc. 2014 Jan;9(1):171-81.) (complementary strand synthesis step, using a reverse transcriptase with terminal transferase activity and strand displacement activity). After the complementary strand synthesis step, cDNA was purified by nucleic acid size fractionation using Pronex beads (Promega) (unreacted oligo removal step). For three samples, the total cDNA was amplified by 11 cycles of PCR using 5'BDWTAv2 and 3'WTA primers and purified by AmPure XP. For the remaining three samples, dCTP and ddCTP as a terminator were used, and mRNA degradation by RNaseH and homopolymer addition reaction by TdT were performed simultaneously for 20 minutes. After purifying the TdT reaction solution, second strand synthesis reaction was performed using a primer with a guanine homopolymer at the 3' end of the universal 2 adaptor sequence and a high-fidelity DNA polymerase. For the reaction solution, the total cDNA was amplified by 11 cycles of PCR using primers for universal 1 and universal 2 sequences (5'BDWTAv2 and 3'WTA primers) and purified by AmPure XP. The final cDNA amount was measured by Qubit Fluorometer, the relative contents of Actb and Rps3 genes in the cDNA were measured by quantitative real-time PCR (qPCR), and the size distribution of cDNA was measured by MultiNA system.

[0112] The results of comparing the cDNA yields are shown in Figure 9. Compared to amplification using only the TS method (Smart-seq2 method), the cDNA amplification method of the present invention, which performs both the TS and TdT reactions, significantly increased the total cDNA yield by about three times and the yields of the Rps3 and Actb genes, suggesting a significant increase in the efficiency of cDNA synthesis.

[0113] A comparison of representative cDNA distributions is shown in Figure 10. Compared to amplification using only the TS method (Smart-seq2 method), the cDNA amplification method of the present invention, which performs both the TS and TdT reactions, showed an increased proportion of small cDNAs of 300-700 bp in size, suggesting the possibility that the cDNA amplification method of the present invention may capture nucleic acids that are difficult to react with the TS reaction, such as cDNA in which reverse transcription has stopped midway through the mRNA, immature mRNA, and partially degraded mRNA.

[0114] [Table 3]

[0115] 4. Comparison of the number of detected genes between the TdT method, the random priming method, and the cDNA amplification method of the present invention in scRNA-seq analysis using a solid phase carrier (Figure 11) The spleen of an 8-week-old mouse was removed, and the spleen was gently ground on a 70 μm strainer placed on a 6-well plate filled with red blood cell hemolysis buffer (3 ml ACK buffer (155 mM NH4Cl, 10 mM KHCO3, 0.1 mM EDTA) to collect a cell suspension. 7 ml of DMEM / 5% FBS was added to the suspension, mixed by inversion, centrifuged, the supernatant was removed, and washed again with DMEM / 5% FBS. The obtained cells were used to carry out cDNA amplification by the TdT method (TAS-Seq method), the cDNA amplification method of the present invention, and random priming included in the BD Rhapsody kit. A reverse transcriptase having terminal transferase activity and strand displacement activity was used. A sequencing library was created from the obtained cDNA, and then the sequence was analyzed using Illumina Novaseq. Sequencing was performed on a 6000. The primer sequences used to create the sequence library are shown in Table 4. The obtained sequence data was mapped to the reference sequence (GRCm38-101) to obtain gene expression data for each cell. For comparison, data obtained with 10X Chromium v3.1 for mouse spleen cells (TS method, accession ID: GSE192930) was downloaded from a public database. The obtained data was downsampled so that the median number of reads per cell was uniform, and the data was again mapped to the reference sequence (GRCm38-101) to obtain gene expression data for each cell.

[0116] [Table 4]

[0117] The results of comparing the number of detected genes and the number of reads are shown in Figure 11. It was found that more genes were detected in the data obtained by the cDNA amplification method of the present invention (TAS-Seq2) compared to other methods. This demonstrated the usefulness of the amplification method of the present invention in solid-phase single-cell transcriptome analysis.

[0118] 5. Comparison of the number of detected genes between the TS method and the cDNA amplification method of the present invention in scRNA-seq analysis using a liquid phase system (Figures 12 to 14) Human PBMC samples (3 samples) were obtained using the same method as in 1. above, and after counting the cells, the cells were loaded at an appropriate density into the microfluidic system using 10X Genomics Chromium v3.1 reagent according to the Chromium specifications, and each cell and hydrogel bead were encapsulated in a microdroplet. Two libraries were created for each sample. After cell lysis, mRNA from each cell was trapped in a polyA RNA capture oligo (10X Chromium adapter) released from the hydrogel (target RNA capture step), and reverse transcription and TS reactions were performed in the microdroplet at 53°C for 1 hour (complementary strand synthesis step, using a reverse transcriptase with terminal transferase activity and strand displacement activity). After the complementary strand synthesis step was completed, the emulsion constituting the microdroplet was broken using the method recommended by 10X, and the cDNA was purified by nucleic acid size fractionation to remove unreacted polyA RNA capture oligo and template switching oligo (unreacted oligo removal step). Based on the obtained cDNA solution, one of the libraries from each of the three samples was directly amplified by PCR using primers (universal oligo-long, 5'BDWTAv2) for universal 1 and universal 2 sequences for 9 cycles to amplify the entire cDNA. After size selection using AmPure XP beads (Beckman Coulter), the obtained cDNA was further amplified by 5 cycles of PCR. For the other library from each of the remaining three samples, dCTP and ddCTP as a terminator were used, and mRNA degradation by RNaseH and homopolymer addition reaction by TdT were performed simultaneously for 20 minutes. After purifying the TdT reaction solution, second strand synthesis reaction was performed using a primer with a guanine homopolymer at the 3' end of the universal 2 adapter sequence and a high-fidelity DNA polymerase. For the reaction solution, the entire cDNA was amplified by PCR using primers (universal oligo-long, 5'BDWTAv2) for universal 1 and universal 2 sequences for 9 cycles.After size selection using AmPure XP beads (Beckman Coulter), the resulting cDNA was further amplified by five cycles of PCR.

[0119] A sequence library was created from the obtained cDNA, and sequencing was performed using Illumina Novaseq 6000. The primer sequences used to create the sequence library are shown in Table 5. The obtained sequence data was mapped to the human reference sequence using 10X Cell ranger software to obtain gene expression data for each cell. The obtained data was downsampled so that the median number of reads per cell was uniform, and the data was again mapped to the human reference sequence to obtain gene expression data for each cell.

[0120] [Table 5]

[0121] The results of comparing the number of detected genes and the number of reads are shown in Figure 12. It was found that in the data obtained by the cDNA amplification method of the present invention (10XTAS-Seq2), more genes were detected in each of the three samples of the same origin, compared to the data obtained by the TS method alone (10X).

[0122] The results of cell clustering are shown in Figure 13. It was found that the data obtained by the cDNA amplification method of the present invention (10X+TAS-Seq2) showed improved separation of various cell populations with different properties in the UMAP space compared to the data obtained by the TS method alone (10X).

[0123] A comparison of the number of detected genes and the number of reads in various cell populations based on the cell clustering results is shown in Figure 14. In all detected cell populations, the data obtained by the cDNA amplification method of the present invention (10X + TAS-Seq2) showed an increased number of detected genes per cell compared to the data obtained by the TS method alone (10X). One of the major applications of single-cell transcriptome analysis is the separation and identification of cell populations and elucidation of their properties. Therefore, the usefulness of the present invention in the separation and identification of cell populations and elucidation of their properties using liquid-phase single-cell transcriptome analysis was demonstrated.

[0124] Furthermore, according to the present invention, when the analysis cost is the same, the amount of information per cell can be increased by 1.5-2 times compared to the conventional method. On the other hand, when obtaining the same amount of information per cell as the conventional method, the required sequence analysis cost can be reduced to 1 / 2-1 / 3 times (Figure 14). In particular, in recent years, the number of analyzed cells has increased significantly in scRNA-seq analysis from tens of thousands to hundreds of thousands, but the amount of sequence analysis required per cell has not changed, so it is expected that the sequence analysis cost will become a bottleneck in scRNA-seq analysis in the future. The present invention can reduce the sequence analysis cost, which is expected to account for the majority of the scRNA-seq analysis cost in the near future, by 1 / 2-1 / 3 times, increasing cost-effectiveness and making a significant contribution to industrial use.

Claims

1. A target RNA capture step of capturing a target RNA with a target RNA capture oligo that is a free oligo not bound to a solid phase carrier and includes a target capture portion; a complementary strand synthesis step in which a complementary DNA strand having a sequence complementary to the captured RNA is synthesized by performing a reverse transcription reaction using a reverse transcriptase having terminal transferase activity, and an additional sequence consisting of any number of bases is added to the 3' end of at least a part of the complementary DNA; an unreacted oligo removal step in which target RNA capture oligos that have not captured the target RNA are removed by nucleic acid size fractionation; an RNA degradation step of degrading RNA with an RNA degrading enzyme; a homopolymer addition step in which a terminal deoxynucleotidyl transferase reaction is carried out in the presence of dATP, dTTP, dCTP or dGTP and a chain-terminating nucleotide triphosphate to add a nucleotide homopolymer to the 3' end of the complementary DNA strand; a second strand synthesis step of carrying out second strand synthesis on the complementary DNA strand using a primer for second strand synthesis, the primer including a complementary homopolymer portion of a sequence complementary to the nucleotide homopolymer, to generate a DNA double strand composed of a complementary DNA strand and a second strand; and a nucleic acid amplification step in which a nucleic acid amplification reaction is carried out using the DNA double strand as a template; 1. A method for amplifying a complementary DNA strand, comprising:

2. The method according to claim 1, wherein the target RNA capture oligo comprises a first adaptor portion on the 5' side of the target capture portion, the second strand synthesis primer comprises a long primer comprising a second adaptor portion on the 5' side of a complementary homopolymer portion, and the nucleic acid amplification step comprises carrying out a nucleic acid amplification reaction using a primer targeting the first adaptor and a primer targeting the second adaptor.

3. 2. The method according to claim 1, wherein the primer for second strand synthesis comprises a long primer comprising a second adaptor portion on the 5' side of the complementary homopolymer portion, and in the nucleic acid amplification step, a nucleic acid amplification reaction is carried out using a primer targeting the second adaptor and a primer targeting a desired region in the complementary DNA strand.

4. 4. The method of claim 2 or 3, wherein the long primer comprises a molecular barcode portion consisting of a random sequence between the second adapter portion and the complementary homopolymer portion.

5. The method according to claim 2 or 3, wherein the chain length of the complementary homopolymer portion of the long primer is 6 to 15 bases.

6. The method of claim 1, wherein the target RNA capture oligo comprises, from the 5' to 3' direction, a first adapter portion, a cell identification barcode portion, and a target capture portion.

7. The method of claim 1 , wherein the target RNA capture oligo comprises a target polyA RNA capture oligo that includes a polyT portion as a target capture portion, and the target RNA comprises a polyA RNA.

8. A target RNA capture step of capturing a target RNA by a target RNA capture oligo containing a target capture portion; a complementary strand synthesis step in which a complementary DNA strand having a sequence complementary to the captured RNA is synthesized by performing a reverse transcription reaction using a reverse transcriptase having terminal transferase activity, and an additional sequence consisting of any number of bases is added to the 3' end of at least a part of the complementary DNA; an unreacted oligo removal step for removing target RNA capture oligos that have not captured the target RNA; an RNA degradation step of degrading RNA with an RNA degrading enzyme; a homopolymer addition step in which a terminal deoxynucleotidyl transferase reaction is carried out in the presence of dATP, dTTP, dCTP or dGTP and a chain-terminating nucleotide triphosphate to add a nucleotide homopolymer to the 3' end of the complementary DNA strand; a second strand synthesis step of carrying out second strand synthesis on the complementary DNA strand using a primer for second strand synthesis, the primer including a complementary homopolymer portion of a sequence complementary to the nucleotide homopolymer, to generate a DNA double strand composed of a complementary DNA strand and a second strand; and a nucleic acid amplification step in which a nucleic acid amplification reaction is carried out using the DNA double strand as a template; A method for amplifying a complementary DNA strand, comprising: the target RNA capture oligo comprises a target polyA RNA capture oligo comprising a polyT portion as a target capture portion, the target RNA comprises a polyA RNA, The method according to the present invention, wherein in the complementary strand synthesis step, a reverse transcription reaction is carried out in the presence of a template switching oligo that contains a sequence at its 3' end that can hybridize to the additional sequence and that contains a switching sequence on the 5' side of the sequence, and the template switching oligo is hybridized to the complementary DNA strand to which the additional sequence has been added, and a sequence complementary to the switching sequence is further added to the 3' end of the complementary DNA strand.

9. The method of claim 8, wherein the template switching oligo comprises an oligonucleotide comprising GGG, GUG or NGG (wherein G and U are ribonucleotide bases, and N is any ribonucleotide base selected from A, U, G and C, and may comprise one or more nucleotide analogs) at its 3' end as a sequence hybridizable to the additional sequence, and the switching sequence comprises a second adaptor portion.

10. The method of claim 9, wherein the switching sequence comprises a molecular barcode portion consisting of a random sequence on the 3' side of the second adapter portion.

11. The method according to claim 8, wherein the target RNA capture oligo is a free oligo that is not bound to a solid support, and the step of removing unreacted oligos comprises removing the target RNA capture oligo that has not captured the target RNA and the template switching oligo that has not hybridized to a complementary DNA strand by nucleic acid size fractionation.

12. The method described in claim 8, wherein the target RNA capture oligo is a solid-phase oligo bound to a solid support, and the step of removing unreacted oligo is carried out by exonuclease treatment.

13. The method described in claim 12, wherein the solid phase support is a bead, and the target RNA capture oligo comprises, from the 5' side to the 3' side, a first adapter portion, a bead identification barcode portion, and a target capture portion.

14. The method described in claim 12, wherein the solid phase support is a plate, and the target RNA capture oligo is immobilized in multiple compartments of the plate and includes, from the 5' side to the 3' side, a first adapter portion, a compartment identification barcode portion, and a target capture portion.

15. The method according to claim 8, wherein the primers for second strand synthesis comprise a long primer comprising a second adaptor portion on the 5' side of a complementary homopolymer portion, and a short primer not comprising a complementary homopolymer portion and comprising a second adaptor portion on its 3' side.

16. 16. The method of claim 15, wherein the long primer comprises a molecular barcode portion consisting of a random sequence between the second adapter portion and the complementary homopolymer portion.

17. The method according to claim 8, wherein in the complementary strand synthesis step, a reverse transcription reaction is carried out using a reverse transcriptase further having strand displacement activity in the presence of the template switching oligo, and a second strand is synthesized for the complementary DNA strand hybridized with the template switching oligo.

18. 9. The method of claim 1 or 8, wherein the chain-terminating nucleotide triphosphate is a ddNTP, a derivative of a ddNTP, a 3'-dNTP, or a 3'-deoxy-5-methyluridine-5'-triphosphate.

19. The method according to claim 18, wherein the derivative of ddNTP is a ddNTP modified at the 3' position with an atomic group that does not have an OH group.

20. 19. The method of claim 18, wherein the chain-terminating nucleotide triphosphate is a ddNTP.

21. The method according to claim 1 or 8, wherein in the homopolymer addition step, polyC addition is carried out by adding dCTP and a chain-terminating CTP.

22. The method of claim 1 or 8, wherein the RNA degradation step and the homopolymer addition step are carried out simultaneously.

Images