Recombinant adeno-associated virus for the treatment of GRN-associated adult-onset neurodegeneration

Abstract

A recombinant AAV (rAAV) suitable for use in treating adult-onset neurodegeneration caused by Granulin (GRN) haploinsufficiency, such as Progranulin (PGRN)-associated frontotemporal dementia (FTD), is provided. The rAAV comprises (a) an adeno-associated virus 1 capsid and (b) a vector genome packaged within the AAV capsid, the vector genome comprising AAV inverted terminal repeats, a coding sequence for human Progranulin, and regulatory sequences directing the expression of Progranulin. Also provided is a method for treating human patients with PGRN-FTD and other adult-onset neurodegeneration caused by granulin (GRN) haploinsufficiency, the method comprising delivering to the central nervous system (CNS) a recombinant adeno-associated virus (rAAV) having an adeno-associated virus 1 (AAV1) capsid, the rAAV further comprising a vector genome packaged within the AAV capsid, the vector genome comprising AAV inverted terminal repeats, a coding sequence for human progranulin, and regulatory sequences that direct expression of the progranulin.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of and priority to U.S. Provisional Application No. 62 / 809,329, filed February 22, 2019, U.S. Provisional Application No. 62 / 923,812, filed October 21, 2019, and U.S. Provisional Application No. 62 / 969,108, filed February 2, 2020, which are hereby incorporated by reference in their entireties for all purposes. [Background technology]

[0002] Frontotemporal dementia (FTD) is a fatal neurodegenerative disease that typically manifests in the sixth or seventh decade of life and involves impairments in executive function, behavior, speech, or language comprehension. These symptoms are associated with a characteristic pattern of brain atrophy affecting the frontal and temporal cortices. Patients universally show a progressive course, with a median survival from onset of symptoms of 8 years (Coyle-Gilchrist IT,et al.Neurology.2016;86(18):1736-43).

[0003] FTD is highly hereditary, with approximately 40% of patients having a positive family history (Rohrer JD,et al.Neurology.2009;73(18):1451-6.). In 5-10% of FTD patients, pathogenic loss-of-function mutations can be identified in the granulin (GRN) gene, which encodes the ubiquitous lysosomal protein progranulin (PGRN) (Rohrer JD,et al.Neurology.2009;73(18):1451-6.). Carriers of GRN mutations can exhibit rapid and widespread brain atrophy and present with clinical features of other neurodegenerative diseases such as progressive supranuclear palsy, basal ganglia syndrome, Parkinson's disease, dementia with Lewy bodies, or Alzheimer's disease (Le Ber I,et al.Brain:a journal of neurology.2008;131(3):732-46.). GRN mutations are inherited in an autosomal dominant manner with a penetrance of over 90% by age 70 years (Gass J,et al.Human molecular genetics.2006;15(20):2988-3001). Inheritance of a single GRN mutation causes FTD and other late-onset neurodegenerative diseases, but patients with homozygous loss-of-function mutations present much earlier in life with neuronal ceroid lipofuscinosis (NCL, Batten disease), characterized by accumulation of autofluorescent material (lipofuscin) within neuronal lysosomes, rapid cognitive decline and retinal degeneration (Smith Katherine R,et al.American Journal of Human Genetics.2012;90(6):1102-7). Patients heterozygous for GRN mutations have a much delayed onset of symptoms but eventually develop identical lysosomal storage lesions in the brain and retina as NCL patients and similarly experience progressive neurodegeneration (Ward ME, et al. Science Translational Medicine. 2017;9(385); Gotzl JK, et al. Acta neuropathologica. 2014;127(6):845-60).Progranulin was recently found to play an important role in lysosomal function by promoting lysosomal acidification and functioning as a chaperone for lysosomal proteases including cathepsin D (CTSD) (Beel S,et al.Human molecular genetics.2017 Aug 1;26(15):2850-2863, Tanaka Y,et al.Human molecular genetics.2017;26(5):969-88). Mutations in the gene encoding CTSD also result in NCL phenotypes, supporting a common pathophysiology associated with defective lysosomal protease activity (Siintola E,et al.Brain:a journal o. f neurology.2006;129(Pt 6):1438-45).

[0004] Currently, there are no disease-modifying therapies for adult-onset neurodegeneration caused by GRN haploinsufficiency. Disease management involves supportive care and off-label treatments aimed at reducing behavioral, cognitive, and / or motor symptoms associated with the disease (Tsai and Boxer, 2016, J Neurochem. 138 Suppl 1:211-21). Furthermore, more patients could be reached at an earlier stage by screening individuals with a family history of dementia, which is currently not indicated given the lack of treatment. Thus, this disease spectrum represents an area of ​​high unmet medical need.

[0005] What is needed is a treatment for adult-onset neurodegenerative diseases associated with GRN haploinsufficiency and their associated conditions. Summary of the Invention

[0006] Provided is a recombinant AAV (rAAV) suitable for use in the treatment of neurodegeneration caused by progranulin (PGRN)-associated frontotemporal dementia (FTD) and other adult-onset neurodegenerative diseases associated with GRN haploinsufficiency. The rAAV comprises an adeno-associated virus 1 capsid and a vector genome packaged in the AAV capsid, the vector genome comprising an AAV inverted terminal repeat (ITR), a coding sequence encoding human progranulin, and a regulatory sequence directing the expression of progranulin. In a specific embodiment, the vector genome comprises an AAV 5' inverted terminal repeat (ITR), a human PGRN coding sequence and a regulatory element directing its expression, and an AAV 5' ITR.

[0007] Also provided is a pharmaceutical composition comprising an aqueous liquid and a recombinant AAV (rAAV). In certain embodiments, the aqueous liquid comprises an artificial cerebrospinal fluid comprising a surfactant suitable for intrathecal administration.

[0008] Provided is a method for treating human patients with progranulin-associated frontotemporal dementia (FTD) neurodegeneration or other adult-onset neurodegenerative diseases caused by GRN haploinsufficiency. The method comprises delivering rAAV comprising a coding sequence of human progranulin to the central nervous system (CNS). The recombinant adeno-associated virus (rAAV) comprises an adeno-associated virus 1 (AAV1) capsid, the rAAV further comprises a vector genome packaged in the AAV capsid, the vector genome comprises an AAV inverted terminal repeat, a coding sequence of human progranulin, and a regulatory sequence that directs the expression of progranulin.

[0009] Provided is rAAV1.hPGRN for use in a method of treating a human patient with PGRN-FTD or other adult-onset neurodegenerative disease caused by GRN haploinsufficiency. The method includes administering to the CNS an rAAV having an adeno-associated virus 1 capsid encoding human progranulin that targets ependymal cells. The rAAV1 further includes a vector genome packaged in the AAV capsid, the vector genome including an AAV inverted terminal repeat, a coding sequence for human progranulin, and a regulatory sequence that directs the expression of progranulin in ependymal cells. In one embodiment, secretable human progranulin is expressed after delivery of rAAV1 gene therapy.

[0010] Methods are provided for treating a human patient with brain pathology associated with progranulin-associated frontotemporal dementia (FTD) neurodegeneration caused by GRN haploinsufficiency or other adult-onset neurodegenerative diseases, comprising administering to the central nervous system (CNS) a recombinant adeno-associated virus (rAAV) having an adeno-associated virus 1 (AAV1) capsid, the rAAV further comprising a vector genome packaged in the AAV capsid. The vector genome comprises an AAV inverted terminal repeat, a coding sequence for human Progranulin, and a regulatory sequence that directs expression of Progranulin.

[0011] In certain embodiments, the methods provided herein may further include (a) non-invasively assessing the patient for reduction in retinal storage lesions as a predictor of reduction in brain lesions, (b) performing magnetic resonance imaging to assess brain volume, and / or (c) measuring the concentration of progranulin in the CSF.

[0012] These and other aspects of the present invention will become apparent from the following detailed description of the invention. [Brief description of the drawings]

[0013] [Figure 1]A linear map of the AAV1.hPGRN vector genome. The AAV1.CB7.CI.hPGRN.rBG vector genome contains the coding sequence for human PGRN under the control of the ubiquitous CB7 promoter, which is composed of a hybrid between the CMV IE enhancer and the chicken β-actin promoter. Abbreviations: BA: β-actin, bp: base pairs, CMV IE: cytomegalovirus immediate early, ITR: inverted terminal repeat, PolyA: polyadenylation, rBG: rabbit β-globin. [Diagram 2] 1 is a linear vector map of the cis-plasmid carrying the vector genome. [Figure 3A-3D] We provide a natural history of lipofuscin accumulation and hexosaminidase activity in the brains of GRN- / - mice. GRN- / - mice (KO) or GRN+ / + (WT) controls were sacrificed at the indicated ages (n=10 / time point). Unstained brain sections were imaged for autofluorescent material (lipofuscin) in the hippocampus, thalamus, and frontal cortex, and lipofuscin deposits were quantified and averaged by three blinded reviewers (Figure 3A-C). The number of lipofuscin is expressed relative to the total area of ​​the region of interest. Hexosaminidase activity was measured in brain samples and normalized to total protein concentration (Figure 3D). Values ​​are expressed as a percentage relative to wild-type controls. [Figure 4A-4G]Figure 4 shows correction of lysosomal pathology in the brains of young adult GRN- / - mice by AAV-mediated PGRN expression. GRN- / - mice (KO) or GRN+ / + (WT) controls were treated with a single ICV injection of vehicle (PBS) or an AAVhu68 vector expressing human PGRN (1011GC) at 2 months of age (n=10 per group). Animals were sacrificed 60 days after injection and human PGRN was measured in the CSF (Figure 4A) and frontal lobes of the brain (Figure 4B) by ELISA. Hexosaminidase activity was measured in brain samples (Figure 4C). Brain PGRN concentration and Hex activity were normalized to total protein. Unstained brain sections were imaged for autofluorescent material (lipofuscin) in the hippocampus, thalamus, and frontal cortex. Lipofuscin deposits in the hippocampus, thalamus, and frontal cortex were quantified by a blinded reviewer (Figure 4D-G). Lipofuscin counts are expressed per high power field. n=10 per group, except for KO+PBS hippocampus (n=8). *p<0.05, **p<0.005, ***p<0.001, ****p<0.0001, one-way ANOVA followed by Tukey's multiple comparison test. Hexosaminidase activity was measured in serum (Figure 4G). [Figure 5A-5D] Figure 5 shows correction of lysosomal pathology in the brains of aged GRN- / - mice by AAV-mediated expression of human PGRN. At 7 months of age, GRN- / - mice (KO) or GRN+ / + (WT) controls were treated with a single ICV injection of vehicle (PBS) or an AAVhu68 vector expressing human PGRN (1011GC). Animals were sacrificed 4 months after injection. Hexosaminidase activity was measured in brain samples (Figure 5A), and lipofuscin deposits were quantified in the hippocampus, thalamus, and cortex by blinded reviewers (Figure 5B-D). Lipofuscin counts are expressed per high power field. *p<0.05, **p<0.005, one-way ANOVA followed by Tukey's multiple comparison test. [Figure 6A-6C]Correction of brain microgliosis in aged GRN- / - mice by AAV-mediated PGRN expression. At 7 months of age, GRN- / - mice (KO) or GRN+ / + (WT) controls were treated with a single ICV injection of vehicle (PBS) or an AAVhu68 vector expressing human PGRN (1011GC). Animals were sacrificed 4 months after injection, and brain sections were stained for CD68. CD68-positive areas in images of the hippocampus, thalamus, and frontal cortex were quantified by blinded reviewers using ImageJ software (Figure 6A-C). Areas are represented per high-power field. *p<0.05, **p<0.005, ***p<0.001, ****p<0.0001, one-way ANOVA followed by Tukey's multiple comparison test. [Figure 7A-7C] Figure 7 shows human PGRN expression in rhesus macaques after AAV delivery. On study day 0, adult rhesus macaques were administered AAV1, AAV5, or AAVhu68 vectors (3x1013GC) expressing human PGRN from the chicken beta actin promoter by ICM injection (n=2 per vector). Two additional macaques were administered AAVhu68 vectors expressing hPGRN from the ubiquitin C promoter (AAVhu68 V2). ICM injections were performed under fluoroscopic guidance. After confirmation of needle placement and CSF return injection of contrast agent by fluoroscopy, distribution within the cisterna magna was demonstrated. Subsequent vector injections revealed displacement of contrast agent. Human PGRN was measured by ELISA in the CSF of treated macaques (Figure 7A) and healthy adult human subjects (Figure 7B), as well as in the serum of treated macaques (Figure 7C). In Figures 7A and 7B, the dotted line indicates the lower limit of quantification of hPGRN diluted 1:5 in CSF. [Figure 8A-8C]Figure 8 shows immune responses to human PGRN in vector-treated non-human primates. After ICM administration of AAV1, AAV5 or AAVhu68 vectors (3x1013GC) expressing human PGRN from the chicken beta-actin promoter or ubiquitin C promoter (AAVhu68 V2), CSF was collected weekly for chemical and cytological analysis. Increased white blood cell counts (mainly small lymphocytes) were evident in most animals (Figure 8A). Antibody responses to human PGRN were measured by ELISA in CSF (Figure 8B) and serum (Figure 8C) of animals treated with AAVhu68 or AAV1. Antibodies to human PGRN were not assessed in serum or CSF samples from animals treated with AAV5. [Figure 9] Levels of brain transduction following ICM administration of AAV1 and AAVhu68 vectors to non-human primates are shown. Adult rhesus macaques were administered 3x1013 GC of AAVhu68 (n=2) or AAV1 (n=2) vectors expressing GFP from the chicken beta-actin promoter by ICM injection. 28 days after vector administration, animals were necropsied and sections of five regions of the right hemisphere of the brain were analyzed by GFP immunohistochemistry or immunofluorescence by staining for GFP and DAPI. Co-staining with markers of specific cell types (NeuN, GFAP, and Olig2) allowed quantification of transduced astrocytes, and oligodendrocytes. The average transduction of each cell type was calculated for all sampled brain regions. Error bars = SEM of five sections. [Figure 10]A table is provided showing the percentage of transduction of neurons, astrocytes, and oligodendrocytes following ICM administration of AAV1 (animal IDs 1826 and 2068) and AAVhu68 (animal IDs 1518 and 2076) vectors to non-human primates. On study day 0, adult rhesus monkeys were administered 3x1013 GC of AAVhu68 (n=2) or AAV1 (n=2) vectors expressing GFP from the chicken beta-actin promoter by ICM injection. 28 days after vector administration, animals were necropsied and sections of five regions of the right hemisphere of the brain were analyzed by GFP immunofluorescence with co-staining for specific cell types (NeuN, GFAP, and Olig2). The number of total cells of each cell type and GFP-expressing cells of each type were quantified using HALO software. For each region, the percentage of each cell type transduced is shown. For some animals, two sections from region 5 were analyzed. [Figure 11A-11B] 1 shows the results of median sensory nerve conduction studies in non-human primates. The Y-axis represents the latency from onset to peak amplitude (peak latency) measured over time (x-axis) after administration of three different doses (3x1012GC, 1x1013GC, or 3x1013GC of rAAV1.hPGRN or vehicle control). [Figure 12A-12D] 1 shows the results of neuropathological studies of the dorsal root ganglia (DRG), median nerve, and spinal cord (SC) in non-human primates (NHPs) 90 days after treatment with rAAV1.hPGRN. [Figure 13] 1 shows a flow diagram of the manufacturing process for vector production. Abbreviations: AEX: Anion Exchange, CRL: Charles River Laboratories, ddPCR: Digital Droplet Polymerase Chain Reaction, DMEM: Dulbecco's Modified Eagle's Medium, DNA: Deoxyribonucleic Acid, FFB: Final Formulation Buffer, GC: Genome Copy, HEK293: Human Embryonic Kidney 293 Cells, ITFFB: Intrathecal Final Formulation Buffer, PEI: Polyethylenimine, SDS-PAGE: Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis, TFF: Tangential Flow Filtration, USP: United States Pharmacopeia, WCB: Working Cell Bank. [Figure 14]A flow diagram of the manufacturing process for vector formulation. Manufacturing process for producing GTP-205 drug product. Abbreviations: Ad5: Adenovirus serotype 5, AUC: analytical ultracentrifugation, BDS: bulk drug substance, BSA: bovine serum albumin, CZ: Crystal Zenith, ddPCR: droplet digital polymerase chain reaction, E1A: early region 1A (gene), ELISA: enzyme-linked immunosorbent assay, FDP: final formulation, GC: genome copies, HEK293: human embryonic kidney 293 cells, ITFFB: intrathecal final formulation buffer, KanR: kanamycin resistance (gene), MS: mass spectrometry, NGS: next generation sequencing, qPCR: quantitative polymerase chain reaction, SDS-PAGE: sodium dodecyl sulfate polyacrylamide gel electrophoresis, TCID50 50% tissue culture infectious dose, UPLC: ultraperformance liquid chromatography, USP: United States Pharmacopeia. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0014] Recombinant AAV (rAAV) suitable for use in the treatment of neurodegenerative conditions associated with GRN-haploinsufficiency, such as Progranulin (PGRN)-associated frontotemporal dementia (FTD), and compositions comprising them are provided. In certain preferred embodiments, the rAAV comprises an adeno-associated virus 1 capsid and a vector genome packaged in the AAV capsid, the vector genome comprising an AAV inverted terminal repeat, a coding sequence for human Progranulin, and a regulatory sequence directing the expression of Progranulin. In certain embodiments, the vector genome comprises an AAV 5' inverted terminal repeat (ITR), a human PGRN coding sequence, and a regulatory element directing its expression, and an AAV 3' ITR. Also provided is a pharmaceutical composition comprising an aqueous liquid and the recombinant AAV (rAAV). In certain embodiments, the aqueous liquid comprises an artificial cerebrospinal fluid comprising a surfactant suitable for intrathecal administration. Also provided is a method for treating a human patient with PGRN-FTD and / or a method for treating a patient with brain lesions associated with PGRN-FTD. In certain embodiments, a method is provided for treating or reducing microgliosis in a patient. The method comprises delivering rAAV.PGRN to the central nervous system (CNS). In certain embodiments, the method provided herein may further comprise (a) non-invasively assessing the patient for reduction in retinal storage lesions as a predictor of reduction in brain lesions, (b) performing magnetic resonance imaging to assess brain volume, and / or (c) monitoring the treatment by measuring the concentration of PGRN concentration in CSF. Optionally, the concentration of PGRN in plasma may be measured.

[0015] As used herein, the term "AAV.hPGRN" or "rAAV.hPGRN" is used to refer to a recombinant adeno-associated virus having an AAV capsid with a vector genome therein that includes a coding sequence for human progranulin under the control of a regulatory sequence. A particular capsid type may be specified, for example, AAV1.hPGRN refers to a recombinant AAV having an AAV1 capsid, AAVhu68.hPGRN refers to a recombinant AAV having an AAVhu68 capsid, and AAVhu68.hPGRN refers to a recombinant AAV having an AAVhu68 capsid. AAV5.hPGRN refers to a recombinant AAV having an AAV5 capsid.

[0016] "Recombinant AAV" or "rAAV" is a DNAse-resistant viral particle that contains two elements, an AAV capsid, and a vector genome that contains at least a non-AAV coding sequence packaged within the AAV capsid.Unless otherwise specified, this term can be used interchangeably with the phrase "rAAV vector".rAAV is a "replication-defective virus" or "replication-defective viral vector" because it lacks any functional AAV rep gene or functional AAV cap gene and cannot generate progeny.In certain embodiments, the only AAV sequence is the AAV inverted terminal repeat (ITR), which is typically located at the 5' and 3' extreme ends of the vector genome to allow the genes and regulatory sequences located between the ITRs to be packaged within the AAV capsid.

[0017] As used herein, "vector genome" refers to a nucleic acid sequence that is packaged inside the rAAV capsid that forms the viral particle. Such a nucleic acid sequence includes AAV inverted terminal repeats (ITRs). In the examples herein, the vector genome includes, at least 5' to 3', the AAV 5'ITR, a coding sequence, and the AAV 3'ITR. ITRs from AAV2, a source AAV different from the capsid, or other than the full-length ITRs can be selected. In certain embodiments, the ITRs are from the same AAV source as the AAV that provides the rep function or trans-complementing AAV during production. Additionally, other ITRs can be used. Additionally, the vector genome includes a control sequence that directs the expression of a gene product. Suitable components of the vector genome are discussed in more detail herein.

[0018] Therapeutic proteins and coding sequences: The rAAV contains a coding sequence for the human progranulin (hPGRN) protein or a variant thereof that performs one or more of the biological functions of hPGRN, and the coding sequence for this protein is engineered into the vector genome for expression in the central nervous system (CNS).

[0019] HuPGRN1 is most commonly characterized by a sequence of 593 amino acids of GenBank NP_002078 reproduced in SEQ ID NO: 1. This sequence has a signal peptide at positions 1-17 with secreted progranulin protein or secreted granulin containing amino acids 18 to about 593. The protein can be cleaved into eight chains, with reference to the numbering of SEQ ID NO: 1: Granulin 1 (also known as Granulin G: about aa 58 about amino acid 113), Granulin 2 (about amino acid 123 to about amino acid 179), Granulin 3 (about amino acid 206 to about amino acid 261), Granulin 4 (about amino acid 281 to about amino acid 336), Granulin 5 (about amino acid 364 to about amino acid 417), Granulin 6 (about amino acid 442 to about amino acid 496), and Granulin 7 (about amino acid 518 to about amino acid 573). In certain embodiments, a heterologous signal peptide can be substituted in place of the native signal peptide. However, other embodiments may include Progranulin with an exogenous signal peptide (e.g., human IL2 leader). Also see, for example, www.signalpeptide.de / index.php?m=listspdb_mammalia. Thus, fusion proteins comprising Progranulin and / or fragments thereof are contemplated. Such fusion proteins may include one or more of the active GRNs (e.g., GRN1, 2, 3, 4, 4, 6, or 7) in various combinations with each other, or may combine one or more of these peptides with full-length PGRN or another protein or peptide (e.g., another active protein or peptide, and / or a signal peptide exogenous to human PGRN).

[0020] The vector genome carries the coding sequence for this protein and is capable of expressing it in human cells (especially In a particular embodiment, the coding sequence is found in GenBank: NM_002087.3 and reproduced in SEQ ID NO:2.

[0021] In certain embodiments, the coding sequence is provided in SEQ ID NO:3. Certain other embodiments include coding sequences with 95% to 99.9% or 100% identity to SEQ ID NO:3, including values ​​therebetween. In some embodiments, the coding sequence is codon-optimized for better therapeutic outcomes (e.g., enhanced expression in mammalian cells). Identity may be assessed across the coding sequence of full-length Progranulin with a signal (leader) sequence, across Progranulin without a signal (leader) sequence, or across the length of the coding sequence of a fusion protein as defined herein. In certain embodiments, the coding sequence is provided in SEQ ID NO:3. Certain other embodiments include coding sequences with 95% to less than 100% identity to SEQ ID NO:4. Identity may be assessed across the coding sequence of full-length Progranulin with a signal (leader) sequence, across Progranulin without a signal (leader) sequence, or across the length of the coding sequence of a fusion protein as defined herein.

[0022] Suitably, these coding sequences encode full-length progranulin. However, other embodiments may include active granulin chains with heterologous signal peptides (e.g., the human IL2 leader). See also, e.g., www.signalpeptide.de / index.php?m=listspdb_mammalia.

[0023] In certain embodiments, a fragment of the coding sequence of human PGRN (e.g., SEQ ID NO:3 or SEQ ID NO:4), or a sequence about 95%-99.9% or 100% identical thereto, may be utilized. Such a fragment may encode active human GRN (aa 18-593), or a fusion peptide comprising an active human GRN together with a heterologous signal peptide. In certain embodiments, one or more of the coding sequences of one or more of the active GRNs (e.g., GRN1, 2, 3, 4, 4, 6, or 7) may be included in the vector genome in various combinations with each other, or one or more of these peptides may be combined with full-length PGRN or another coding sequence.

[0024] Without intending to be bound by theory, it is believed that AAV-mediated PGRN expression in a subset of cells of the CNS (e.g., ependymal cells) provides a depot of secreted proteins. Secreted PGRN protein (and / or one or more GRNs) is taken up by other cells via sortilin or mannose-6-phosphate receptors and then transported to lysosomes. In certain embodiments, the secreted protein is progranulin. In certain embodiments, the secreted protein is granulin. In certain embodiments, the secreted protein comprises a mixture of progranulin and granulin.

[0025] In certain embodiments, in addition to the coding sequence for Progranulin, another non-AAV coding sequence may be included, such as a peptide, polypeptide, protein of interest, a functional RNA molecule (e.g., miRNA, miRNA inhibitor), or other gene product. Useful gene products also include miRNAs. miRNAs and other small interfering nucleic acids control gene expression through cleavage / degradation of target RNA transcripts or translational repression of target messenger RNAs (mRNAs). miRNAs are typically naturally expressed as final 19-25 untranslated RNA products. miRNAs exhibit their activity through sequence-specific interactions with the 3' untranslated region (UTR) of target mRNAs. These endogenously expressed miRNAs form hairpin precursors, which are then processed into miRNA duplexes and further into "mature" single-stranded miRNA molecules. The mature miRNAs are then synthesized based on their complementarity with the mature miRNAs. , for example, to induce the multiprotein complex miRISC, which identifies a target site in the 3′UTR region of the target mRNA.

[0026] In certain embodiments, the expression cassette further comprises one or more miRNA target sequences that suppress expression of hPGRN in dorsal root ganglia (drg). In certain embodiments, the expression cassette comprises at least two tandem repeats of drg-specific miRNA target sequences, the at least two tandem repeats comprising at least a first miRNA target sequence and at least a second miRNA target sequence, which may be the same or different. In certain embodiments, the tandem miRNA target sequences are contiguous or separated by a spacer of 1-10 nucleic acids, which is not a miRNA target sequence. In certain embodiments, there are at least two drg-specific miRNA target sequences, which are located 3' of the hPGRN coding sequence. In certain embodiments, the start of the first of the at least two drg-specific miRNA tandem repeats is within 20 nucleotides of the 3' end of the hPGRN coding sequence. In certain embodiments, the start of the first of the at least two drg-specific miRNA tandem repeats is at least 100 nucleotides of the 3' end of the hPGRN coding sequence. In certain embodiments, the miRNA tandem repeat comprises 200-1200 nucleotides in length. In certain embodiments, there are at least two drg-specific miRNA target sequences and are located 5' of the hPGRN coding sequence. In certain embodiments, the at least two drg-specific miRNA target sequences are located both 5' and 3' of the hPGRN coding sequence. In certain embodiments, at least the first miRNA target sequence and / or at least the second miRNA target sequence of the expression cassette mRNA or DNA positive strand is selected from (i) AGTGAATTCTAACCAGTGCCATA (miR183, SEQ ID NO: 32), (ii) AGCAAAAATGTGCTAGTGCCAAA (SEQ ID NO: 33), (iii) AGTGTGAGTCTACCATTGCCAAA (SEQ ID NO: 34), and (iv) AGGGATTCCTGGGAAAACTGGAC (SEQ ID NO: 35). In certain embodiments, the two or more consecutive miRNA target sequences are contiguous and not separated by a spacer.In certain embodiments, two or more miRNA target sequences are separated by a spacer, each spacer being independently selected from one or more of: (A) GGAT, (B) CACGTG, or (C) GCATGC. In certain embodiments, the spacer located between the miRNA target sequences may be located 3' of the first miRNA target sequence and / or 5' of the last miRNA target sequence. In certain embodiments, the spacers between the miRNA target sequences are the same. See U.S. Provisional Patent Application No. 62 / 783,956, filed December 21, 2018, and International Patent Application No. PCT / US19 / 67872, filed February 12, 2020, which are incorporated herein by reference.

[0027] AAV1 AAVhu68 from clade F can be used to generate vectors that target and express hPGRN in the CNS. However, AAV1-mediated PGRN delivery was unexpectedly observed to provide superior PGRN expression in the CNS than AAVhu68, despite comparable plasma concentrations being observed. The inventors have discovered that intrathecal delivery of rAAV1.PGRN is an attractive delivery route for the therapies described herein. Therefore, in a particularly desirable embodiment, the AAV1 capsid is selected.

[0028] In certain embodiments, a composition is provided, comprising an aqueous liquid suitable for intrathecal injection and a stock of rAAV having an AAV capsid that preferentially targets ependymal cells, the rAAV further comprising a vector genome having a PGRN coding sequence for delivery to the central nervous system (CNS). In certain embodiments, the composition is formulated for suboccipital injection into the cisterna magna (intracisternal). In certain embodiments, the rAAV is administered by computed tomography (CT)-guided rAAV injection. The composition is administered via AAV infusion. In certain embodiments, the patient is administered a single dose of the composition.

[0029] AAV1 capsid refers to a capsid having AAV vp1 protein, AAV vp2 protein, and AAV vp3 protein. In a specific embodiment, AAV1 capsid is composed of AAV vp1 protein, AAV vp2 protein, and AAV vp3 protein in a predetermined ratio of about 1:1:10, and assembled into a T1 icosahedral capsid of 60 total vp proteins. AAV1 capsid can package genome sequences to form AAV particles (e.g., recombinant AAV whose genome is a vector genome). Typically, the capsid nucleic acid sequence encoding the longest vp protein (i.e., VP1) is expressed in trans during the production of rAAV with AAV1 capsid. For example, see U.S. Patent Nos. 6,759,237, 7,105,345, 7,186,552, 8,637,255, and 9,567,607, which are incorporated herein by reference.

[0030] The coding sequence of the capsid is not present in the final assembled rAAV1.hPGRN. However, such a sequence is utilized for the production of recombinant AAV. In certain embodiments, the coding sequence of the AAV1 capsid is any nucleic acid sequence that encodes the full-length AAV1 VP1 protein of SEQ ID NO:26, or its VP2 or VP3 regions. See, for example, U.S. Patent No. 6,759,237, U.S. Patent No. 7,105,345, U.S. Patent No. 7,186,552, U.S. Patent No. 8,637,255, and U.S. Patent No. 9,567,607, which are incorporated herein by reference. In certain embodiments, the coding sequence of the AAV1 capsid is SEQ ID NO:25. In some embodiments, the AAV1 capsid is a protein produced from the coding sequence of SEQ ID NO:25 with or without post-translational modification. However, variants of this coding sequence can be engineered and / or other coding sequences can be reverse translated for a desired expression system using the amino acid sequences of AAV1 VP1, AAV1 VP2, and / or AAV VP3.

[0031] In certain embodiments, a composition comprising a recombinant AAV1 having a capsid, based on the numbering of the primary sequence of AAV1 VP1 reproduced in SEQ ID NO:26, the AAV1 comprises five highly deamidated amino acids (N57, N383, N512, and N718). [Table 1]

[0032] In certain embodiments, the AAV1 is characterized by a capsid composition of a heterogeneous population of deamidated VP isoforms as defined in the table below, based on the total amount of VP protein in the capsid determined using mass spectrometry. In certain embodiments, the AAV capsid is modified at one or more of the following positions, in the ranges provided below, as determined using mass spectrometry. Residue numbers are based on the published AAV1 sequence reproduced in SEQ ID NO:26. [Table 2]

[0033] Suitable modifications include those described in the paragraph above, labeled by deamidation, and are incorporated herein. In certain embodiments, one or more of the following positions, or glycines following N, are modified as described herein. In certain embodiments, AAV1 mutations are constructed in which the glycines following N at positions 57, 383, 512, and / or 718 are preserved (i.e., left unmodified). In certain embodiments, the NGs at the four positions shown in the previous sentence are preserved in the native sequence. The residue numbers are based on the published AAV1 VP1 reproduced in SEQ ID NO:26. In certain embodiments, an artificial NG is introduced at a position different from one of the positions specified in the table above.

[0034] rAAV vectors As mentioned above, recombinant AAV having an AAV1 capsid is a preferred vector described herein for the treatment of FTD. In certain embodiments, for example, as described in the following examples, Other AAV capsids may be used to generate rAAV (e.g., AAVhu68 or AAV5). In certain embodiments, the AAV1 capsid may be selected and one or more of the elements of the vector genome, including the coding sequence for hPGRN, may be replaced.

[0035] As used herein, AAVhu68 capsid refers to the capsid defined in WO2018 / 160582 (herein incorporated by reference). As described herein, rAAVhu68 has rAAVhu68 capsid and is produced in a production system expressing capsid from an AAVhu68 nucleic acid sequence (SEQ ID NO:30) encoding the vp1 amino acid sequence of SEQ ID NO:31, and optionally additional nucleic acid sequences (e.g., sequences encoding vp3 proteins that do not include the unique regions of vp1 and / or vp2). rAAVhu68 resulting from production using a single nucleic acid sequence vp1 produces a heterogeneous population of vp1, vp2, and vp3 proteins. AAVhu68 capsid contains subpopulations within the vp1, vp2, and vp3 proteins with modifications from the predicted amino acid residues of SEQ ID NO:31. These subpopulations include at least deamidated asparagine (N or Asn) residues. For example, asparagine in an asparagine-glycine pair is highly deamidated. In one embodiment, the AAVhu68 vp1 nucleic acid sequence has the sequence of SEQ ID NO: 30, or a complementary strand thereto, e.g., the corresponding mRNA or tRNA. In certain embodiments, vp2 and / or vp3 proteins may additionally or alternatively be expressed from a nucleic acid sequence different from vp1, e.g., to alter the ratio of vp proteins in a selected expression system. In certain embodiments, a nucleic acid sequence encoding the AAVhu68 vp3 amino acid sequence of SEQ ID NO: 31 (about aa203-736) or a complementary strand thereto, the corresponding mRNA or tRNA (about nt607 to about nt2211 of SEQ ID NO: 30) that does not include the vp1 unique region (about aa1 to about aa137) and / or the vp2 unique region (about aa1 to about aa202) is also provided. In certain embodiments, a nucleic acid sequence encoding the AAVhu68 vp2 amino acid sequence of SEQ ID NO: 31 (about aa 138-736) or a complementary strand thereto, the corresponding mRNA or tRNA (nt 411-2211 of SEQ ID NO: 30), without the vp1 unique region (about aa 1 to about 137), is also provided.

[0036] As used herein, the AAV5 capsid has a predicted amino acid sequence of SEQ ID NO: 29. In certain embodiments, the AAV5 capsid is expressed from the nucleic acid sequence of SEQ ID NO: 28.

[0037] The genomic sequence packaged in AAV capsid and delivered to host cell typically consists of a transgene at a minimum, and its regulatory sequence, and AAV inverted terminal repeat (ITR). Both single-stranded and self-complementary (sc) AAV are included in rAAV. A transgene is a nucleic acid coding sequence heterologous to the vector sequence that codes for a polypeptide, protein, functional RNA molecule (e.g., miRNA, miRNA inhibitor), or other gene product of interest. The nucleic acid coding sequence is operably linked to the regulatory element in a manner that allows the transcription, translation, and / or expression of the transgene in the cells of the target tissue.

[0038] The AAV sequences of the vector typically contain cis-acting 5' and 3' inverted terminal repeat sequences (see, e.g., BJ Carter, in "Handbook of Parvoviruses", ed., P. Tijsser, CRC Press, pp. 155 168 (1990)). The ITR sequences are approximately 145 bp in length. Preferably, substantially the entire sequences encoding the ITRs are used in the molecule, although some minor modification of these sequences is tolerated. The ability to modify these ITR sequences is within the skill of the art. (See, e.g., Sambrook et al, "Molecular Cloning. A Laboratory Manual", 2d ed., Cold Spring Harbor Laboratory, New York (1989); an d K. Fisher et al., J. Virol., 70:520 532 (1996). One example of such a molecule utilized in the present invention is a "cis-acting" plasmid containing a transgene with selected transgene sequence and associated regulatory elements flanked by 5' and 3' AAV ITR sequences. In one embodiment, the ITRs are from a different AAV than the one providing the capsid. In one embodiment, the ITR sequences are from AAV2. A shortened version of the 5' ITR, called ΔITR, has been described, in which the D sequence and terminal separation site (trs) are deleted. In other embodiments, full-length AAV 5' and 3' ITRs are used. However, ITRs from other AAV origins may be selected. If the origin of the ITRs is from AAV2 and the AAV capsid is from another AAV origin, the resulting vector may be referred to as pseudotyped. However, other configurations of these elements may also be suitable.

[0039] In addition to the major elements described above for recombinant AAV vectors, the vectors also contain the necessary conventional control elements operably linked to the transgene in a manner that allows for its transcription, translation, and / or expression in cells transfected with the plasmid vector or infected with the virus produced by the invention. As used herein, "operably linked" sequences include both expression control sequences that are adjacent to the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest.

[0040] Regulatory control elements typically include promoter sequences located as part of expression control sequences, for example between selected 5'ITR sequences and coding sequences. Constitutive promoters, regulatable promoters [see, for example, WO2011 / 126808 and WO2013 / 04943], tissue-specific promoters, or promoters that respond to physiological cues can be used in the vectors described herein. The promoter may be selected from different sources, for example, the human cytomegalovirus (CMV) immediate early enhancer / promoter, the SV40 immediate early enhancer / promoter, the JC polymomavirus promoter, the myelin basic protein (MBP) or glial fibrillary acidic protein (GFAP) promoter, the herpes simplex virus (HSV-1) latency-associated promoter (LAP), the Rous sarcoma virus (RSV) long terminal repeat (LTR) promoter, the neuron-specific promoter (NSE), the platelet-derived growth factor (PDGF) promoter, hSYN, the melanin-concentrating hormone (MCH) promoter, CBA, the matrix metalloprotein promoter (MPP), and the chicken beta-actin promoter. In addition to the promoter, the vector may include one or more other suitable transcription initiation, termination, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (polyA) signals, sequences that stabilize cytoplasmic mRNA, such as WPRE, sequences that increase translation efficiency (i.e., Kozak consensus sequences), sequences that enhance protein stability, and, if necessary, sequences that enhance secretion of the encoded product. An example of a suitable enhancer is the CMV enhancer. Other suitable enhancers include those appropriate for the desired target tissue indication. In one embodiment, the expression cassette includes one or more expression enhancers. In one embodiment, the expression cassette includes two or more expression enhancers. These enhancers may be the same or different from each other. For example, the enhancer may include a CMV immediate early enhancer. This enhancer may be present in two copies located adjacent to each other. Alternatively, the double copy of the enhancer is separated by one or more sequences.In yet another embodiment, the expression cassette further comprises an intron, for example, a chicken beta actin intron. Other suitable introns include those known in the art, for example, described in International Publication No. WO2011 / 126808. Examples of suitable polyA sequences include, for example, SV40, SV50, bovine growth hormone (bGH), human growth hormone, and synthetic polyA. Optionally, one or more sequences may be selected to stabilize the mRNA. One example of such a sequence is a modified WPRE sequence, which is engineered upstream of the polyA sequence and downstream of the coding sequence. (See, e.g., MA Zanta-Boussif, et al, Gene Therapy (2009) 16:605-619).

[0041] In one embodiment, the vector genome comprises an AAV 5'ITR, a promoter, an optional enhancer, an optional intron, a coding sequence for human PGRN or a fusion protein comprising the same, polyA, and an AAV 3'ITR. In a particular embodiment, the vector genome comprises an AAV 5'ITR, a promoter, an optional enhancer, an optional intron, a coding sequence for human PGRN or a fusion protein comprising the same, polyA, and an AAV 3'ITR. In a particular embodiment, the vector genome comprises an AAV 5'ITR, a promoter, an optional enhancer, an optional intron, a huPGRN coding sequence, polyA, and an AAV 3'ITR. In a particular embodiment, the vector genome comprises an AAV2 5'ITR, an EF1a promoter, an optional enhancer, an optional promoter, huPGRN, SV40 polyA, and an AAV2 3'ITR. In certain embodiments, the vector genome is AAV2 5'ITR, UbC promoter, optional enhancer, optional intron, huPGRN, SV40 polyA, and AAV2 3'ITR. In certain embodiments, the vector genome is AAV2 5'ITR, CB7 promoter, intron, huPGRN, SV40 polyA, and AAV2 3'ITR. In certain embodiments, the vector genome is AAV2 5'ITR, CB7 promoter, intron, huPGRN, rabbit β-globin polyA, and AAV2 3'ITR. See, for example, SEQ ID NO: 22 (EF1a.huPGRN.SV40), SEQ ID NO: 23 (UbC.PI.huPGRN.SV40), or SEQ ID NO: 24 (CB7.CI.hPGRN1.rGB). The coding sequence of huPGRN is selected from the sequences defined herein. See, for example, SEQ ID NO: 3, or a sequence that is 95% to 99.9% identical thereto, or SEQ ID NO: 4, or a sequence that is 95% to 99.9% identical thereto, or a fragment thereof as defined herein.Exemplary sequences of vector elements used in the following examples are provided in, for example, SEQ ID NO:6 (rabbit globin polyA), AAV ITRs (SEQ ID NOs:7 and 8), human CMV IE promoter (SEQ ID NO:9), CB promoter (SEQ ID NO:10), chimeric intron (SEQ ID NO:11), UbC promoter (SEQ ID NO:12), EF-1a promoter (SEQ ID NO:17), intron (SEQ ID NO:13), and SV40 late polyA (SEQ ID NO:14). Other elements of the vector genome or variations on these sequences may be selected for the vector genome for particular embodiments of the invention.

[0042] Vector production For use in producing AAV viral vectors (e.g., recombinant (r)AAV), the expression cassette can be carried on any suitable vector, e.g., a plasmid, that is delivered to a packaging host cell. Plasmids useful in the present invention can be engineered to be suitable for in vitro replication and packaging in prokaryotic, insect, mammalian cells, among others. Suitable transfection techniques and packaging host cells are known and / or can be readily designed by one of skill in the art.

[0043] Methods for generating and isolating AAV suitable for use as a vector are known in the art. See generally, e.g., Grieger & Samulski, 2005, "Adeno-associated virus as a gene therapy vector: Vector development, production and clinical applications," Adv. Biochem. Engin / Biotechnol. 99:119-145; Buning et al., 2008, "Recent developments in adeno-associated virus vector technology," J. Gene Med. 10:717-733, and the references cited below (these references are incorporated herein by reference in their entirety). (Each of which is incorporated herein by reference in its entirety.) The ITRs are the only AAV components required in cis in the same construct as the nucleic acid molecule containing the expression cassette to package the transgene into virions. The cap and rep genes can be supplied in trans.

[0044] In one embodiment, the expression cassette described herein is engineered into a genetic element (e.g., shuttle plasmid) that introduces the immunoglobulin construct sequence carried thereon into a packaging host cell to produce a viral vector. In one embodiment, the selected genetic element can be delivered to the AAV packaging cell by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion techniques, high-speed DNA-coated pellets, viral infection, and protoplast fusion. Stable AAV packaging cells can also be created. Alternatively, the expression cassette can be used to generate viral vectors other than AAV, or for the production of a mixture of antibodies in vitro. The methods used to create such constructs are known to those skilled in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, for example, Molecular Cloning: A Laboratory Manual, ed. Green and Sambrook, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).

[0045] The term "AAV intermediate" or "AAV vector intermediate" refers to an assembled rAAV capsid that lacks the desired genomic sequence packaged therein. These may be referred to as "empty" capsids. Such capsids may not contain detectable genomic sequences of an expression cassette, or may contain only partially packaged genomic sequences that are insufficient to achieve expression of a gene product. These empty capsids are non-functional for introducing a gene of interest into a host cell.

[0046] The recombinant adeno-associated virus (AAV) described herein may be produced using known techniques. For example, see WO2003 / 042397; WO2005 / 033321, WO2006 / 110689, US7588772B2. Such methods include culturing a host cell that contains an expression cassette consisting of a nucleic acid sequence encoding an AAV capsid protein, a functional rep gene, at a minimum an AAV inverted terminal repeat (ITR) and a transgene, and sufficient helper functions to allow the expression cassette to be packaged into an AAV capsid protein. Methods for producing capsids, coding sequences therefor, and methods for producing rAAV viral vectors have been described. For example, see Gao, et al, Proc. Natl. Acad. Sci. USA100(10), 6081-6086(2003) and US2013 / 0045186A1.

[0047] In one embodiment, a producer cell culture is provided that is useful for producing recombinant AAV.Such cell culture comprises a nucleic acid that expresses AAV capsid protein in host cell, a nucleic acid molecule suitable for packaging into AAV capsid, such as a vector genome that includes AAV ITRs, and a non-AAV nucleic acid sequence that encodes a gene product that is operably linked with a sequence that directs the expression of the product in host cell, and sufficient AAV rep function and adenovirus helper function to allow packaging of the nucleic acid molecule into recombinant AAV capsid.In one embodiment, the cell culture is composed of mammalian cells (e.g., human embryonic kidney 293 cells, among others) or insect cells (e.g., baculovirus).

[0048] Typically, the rep function is derived from the same AAV source as the AAV that provides the ITRs flanking the vector genome. In the examples herein, AAV2 ITRs were selected, and AAV2 rep is used. The coding sequence is reproduced in SEQ ID NO: 27. Optionally, other r The ep sequence or another rep source (and optionally another ITR source) may be selected. For example, rep may be, but is not limited to, AAV1 rep protein, AAV2 rep protein, or rep78, rep68, rep52, rep40, rep68 / 78, and rep40 / 52, or fragments thereof. Optionally, the rep and cap sequences are on the same genetic element in the cell culture. There may be a spacer between the rep sequence and the cap gene. Any of these AAV or mutant AAV capsid sequences may be under the control of exogenous regulatory sequences that direct their expression in the host cell.

[0049] In one embodiment, the cells are produced in suitable cell culture (e.g., HEK293) cells. The method for producing the gene therapy vector described herein includes well-known methods in the art, such as the production of plasmid DNA used for the production of gene therapy vector, the production of vector, and the purification of vector. In some embodiments, the gene therapy vector is an AAV vector, and the produced plasmid is an AAV cis-plasmid that encodes the AAV genome and the gene of interest, an AAV trans-plasmid that contains AAV rep and cap genes, and an adenovirus helper plasmid. The vector production process may include method steps such as starting cell culture, passaging cells, seeding cells, transfecting cells with plasmid DNA, replacing medium with serum-free medium after transfection, and collecting cells and culture medium containing vector.

[0050] In a specific embodiment, the manufacturing process of rAAV.hPGRN involves transient transfection of HEK293 cells with plasmid DNA. Single or multiple batches are produced by PEI-mediated triple transfection of HEK293 cells in a PALL iCELLis bioreactor. The harvested AAV material is sequentially purified, when possible, by clarification, TFF, affinity chromatography, and anion exchange chromatography in a single-use closed bioprocessing system.

[0051] The cells and culture medium containing the harvested vector are referred to herein as crude cell harvest. In yet another system, gene therapy vectors are introduced into insect cells by infection with baculovirus-based vectors. For a review of these production systems, see generally, for example, Zhang et al., 2009, "Adenovirus-adeno-associated virus hybrid for large-scale recombinant adeno-associated virus production," Human Gene Therapy 20:922-929 (the contents of each of which are incorporated herein by reference in their entirety). Methods of making and using these and other AAV production systems are also described in the following U.S. patents, the contents of which are incorporated by reference in their entireties: 5,139,941; 5,741,683; 6,057,152; 6,204,059; 6,268,213; 6,491,907; 6,660,514; 6,951,753; 7,094,604; 7,172,893; 7,201,898; 7,229,823; and 7,439,065, the contents of which are incorporated by reference in their entireties.

[0052] The crude cell harvest is then subjected to additional process steps, such as concentration of the vector harvest, diafiltration of the vector harvest, microfluidization of the vector harvest, nuclease digestion of the vector harvest, filtration of the microfluidized intermediate, crude purification by chromatography, crude purification by ultracentrifugation, buffer exchange by tangential flow filtration, and / or formulation and filtration to prepare bulk vector.

[0053] Two-step high salt affinity chromatography purification, followed by anion exchange resin Chromatography is used to purify the vector drug product and remove empty capsids. These methods are described in further detail in International Patent Application No. PCT / US2016 / 065970, filed December 9, 2016, which is incorporated herein by reference. Methods for purifying AAV8: International Patent Application No. PCT / US2016 / 065976, filed December 9, 2016, and methods for purifying rh10: International Patent Application No. PCT / US16 / 66013, filed December 9, 2016 and entitled "Scalable Purification Method for AAVrh10" (also filed December 11, 2015), and methods for purifying AAV1: International Patent Application No. PCT / US2016 / 065974, filed December 9, 2016, entitled "Scalable Purification Method for AAV1", filed December 11, 2015, are all incorporated herein by reference.

[0054] To calculate the empty and filled particle content, the VP3 band volume for a selected sample (e.g., in the examples herein, a preparation purified on an iodixanol gradient, where number of GC = number of particles) is plotted against the GC particles loaded. The resulting linear equation (y = mx + c) is used to calculate the number of particles in the band volume of the test article peak. The number of particles (pt) per 20 μL loaded is then multiplied by 50 to obtain particles (pt) / mL. Pt / mL is divided by GC / mL to obtain the ratio of particles to genome copies (pt / GC). Pt / mL to GC / mL gives empty pt / mL. Empty pt / mL is divided by pt / mL and then multiplied by 100 to obtain the percentage of empty particles.

[0055] In general, methods for assaying AAV vector particles containing empty capsids and packaged genomes are known in the art.See, for example, Grimm et al., Gene Therapy (1999) 6:1322-1330; Sommer et al., Molec. Ther. (2003) 7:122-128.To test for denatured capsids, the method involves subjecting the processed AAV stock to SDS-polyacrylamide gel electrophoresis, consisting of any gel capable of separating the three capsid proteins (e.g., gradient gels containing 3-8% Tris-acetate in buffer), then running the gel until the sample material is separated, and blotting the gel onto a nylon or nitrocellulose membrane (preferably nylon). The anti-AAV capsid antibody is then used as a primary antibody, preferably an anti-AAV capsid monoclonal antibody, most preferably a B1 anti-AAV-2 monoclonal antibody, that binds to the denatured capsid protein (Wobus et al., J. Virol. (2000) 74:9281-9293). A secondary antibody is then used that binds to the primary antibody and includes a means for detecting binding with the primary antibody, more preferably an anti-IgG antibody containing a detection molecule covalently bound to the antibody, most preferably a sheep anti-mouse IgG antibody covalently bound to horseradish peroxidase. To semi-quantitatively determine the binding between the primary antibody and the secondary antibody, a method for detecting binding is used, preferably a detection method capable of detecting radioisotope radiation, electromagnetic radiation, or colorimetric changes, most preferably a chemiluminescence detection kit. For example, for SDS-PAGE, samples from column fractions can be taken and heated in SDS-PAGE loading buffer containing a reducing agent (e.g., DTT), and capsid proteins resolved in precast gradient polyacrylamide gels (e.g., Novex). Silver staining can be performed using SilverXpress (Invitrogen, CA) according to the manufacturer's instructions, or other suitable staining methods, i.e., SYPRO Ruby or Coomassie staining.In one embodiment, the concentration of AAV vector genome (vg) in the column fractions can be measured by quantitative real-time PCR (Q-PCR). The sample is diluted and digested with DNase I (or another suitable nuclease) to remove exogenous DNA. After inactivation of the nuclease, the sample is further diluted and the primers and the DNA sequence between the primers are digested. The DNA is amplified using a TaqMan™ fluorogenic probe specific for AAV. The number of cycles required to reach a defined level of fluorescence (threshold cycle, Ct) is measured for each sample on an Applied Biosystems Prism 7700 sequence detection system. Plasmid DNA containing the same sequence as that contained in the AAV vector is used to generate a standard curve in the Q-PCR reaction. The cycle threshold (Ct) value obtained from the sample was used to determine the vector genome titer by normalizing it to the Ct value of the plasmid standard curve. An endpoint assay based on digital PCR can also be used.

[0056] In one embodiment, an optimized q-PCR method is used that utilizes a broad-spectrum serine protease, such as proteinase K (e.g., commercially available from Qiagen). More specifically, the optimized qPCR genomic titer assay is similar to the standard assay, except that after DNase I digestion, the sample is diluted with protease K buffer and treated with protease K, followed by heat inactivation. Suitably, the sample is diluted with an amount of protease K buffer equal to the sample size. The protease K buffer can be concentrated two-fold or more. Typically, the protease K treatment is about 0.2 mg / mL, but can vary from 0.1 mg / mL to about 1 mg / mL. The treatment step is generally carried out at about 55° C. for about 15 minutes, but may be carried out at lower temperatures (e.g., about 37° C. to about 50° C.) for longer times (e.g., about 20 minutes to about 30 minutes), or at higher temperatures (e.g., up to about 60° C.) for shorter times (e.g., about 5 to 10 minutes). Similarly, heat inactivation is generally at about 95° C. for about 15 minutes, but may be performed at lower temperatures (e.g., about 70 to about 90° C.) and for longer times (e.g., about 20 minutes to about 30 minutes). The sample is then diluted (e.g., 1000-fold) and subjected to TaqMan analysis as described for standard assays.

[0057] Additionally or alternatively, droplet digital PCR (ddPCR) can be used.For example, the method for measuring single-stranded and self-complementary AAV vector genome titer by ddPCR is described.For example, see M. Lock et al, Hu Gene Therapy Methods, Hum Gene Ther Methods.2014 Apr;25(2):115-25.doi:10.1089 / hgtb.2013.131.Epub 2014 Feb 14.

[0058] Briefly, a method for separating rAAV particles with packaged genome sequences from genome-defective AAV intermediates includes subjecting a suspension containing recombinant AAV viral particles and AAV capsid intermediates to high performance liquid chromatography, in which the AAV viral particles and AAV intermediates are bound to a strong anion exchange resin equilibrated at high pH and subjected to a salt gradient while monitoring the eluate for ultraviolet absorbance at about 260 and about 280. The pH can be adjusted depending on the AAV selected. See, for example, WO2017 / 160360 (AAV9), WO2017 / 100704 (AAVrh10), WO2017 / 100676 (e.g., AAV8), and WO2017 / 100674 (AAV1), which are incorporated herein by reference. In this method, AAV full capsids are recovered from the fraction that elutes when the A260 / A280 ratio reaches the infection point. In one example, for the affinity chromatography step, the diafiltered product may be applied to Capture Select™ Poros-AAV2 / 9 affinity resin (Life Technologies), which efficiently captures AAV2 serotypes. Under these ionic conditions, a significant percentage of residual cellular DNA and proteins flow through the column, while the AAV particles are efficiently captured.

[0059] composition As used herein, at least one rAAV.hPGRN stock (e.g., rAAV stock Compositions are provided that include a rAAV stock, a rAAV vector, and optionally a carrier, excipient, and / or preservative. An rAAV stock refers to multiple rAAV vectors that are the same, e.g., in the amounts described below in the discussion of concentrations and dosage units.

[0060] In certain embodiments, the composition comprises a virus stock that is a recombinant AAV (rAAV) suitable for use in treating progranulin-associated frontotemporal dementia (FTD), the rAAV comprising (a) an adeno-associated virus 1 capsid, and (b) a vector genome packaged in the AAV capsid, the vector genome comprising an AAV inverted terminal repeat, a coding sequence for human progranulin, and a regulatory sequence directing the expression of progranulin. In certain embodiments, the vector genome comprises a promoter, an enhancer, an intron, a coding sequence for human PGRN, and a polyadenylation signal. In certain embodiments, the intron comprises elements of chicken beta actin splice donor and rabbit beta splice acceptor. In certain embodiments, the vector genome further comprises an AAV2 5'ITR and an AAV2 3'ITR, which flank all elements of the vector genome.

[0061] The rAAV.hPGRN may be administered to a human or non-human mammalian patient, preferably suspended in a physiologically compatible carrier. In certain embodiments, for administration to a human patient, the rAAV is suitably suspended in an aqueous solution containing saline, a surfactant, and a physiologically compatible salt or mixture of salts. Suitably, the formulation is adjusted to a physiologically acceptable pH, for example, in the range of pH 6-9, or pH 6.5-7.5, pH 7.0-7.7, or pH 7.2-7.8. The pH of cerebrospinal fluid is about 7.28 to about 7.32, or for intrathecal delivery, about 7.2 to about 7.4, so a pH within this range is desirable, while for intravenous delivery, a pH of about 6.8 to about 7.2 may be desirable. However, other pHs within the broadest range, and subranges of these, may be selected for other delivery routes.

[0062] In certain embodiments, the formulation may contain a buffered saline solution that does not contain sodium bicarbonate. Such formulation may contain a buffered saline solution, such as Harvard buffer, which contains one or more of sodium phosphate, sodium chloride, potassium chloride, calcium chloride, magnesium chloride, and mixtures thereof in water. The aqueous solution may further contain the poloxamer Kolliphor® P188, which is commercially available from BASF and was previously sold under the trade name Lutrol® F68. The aqueous solution may have a pH of 7.2 or a pH of 7.4.

[0063] In another embodiment, the formulation may comprise a buffered saline solution, including 1 mM sodium phosphate (Na3PO4), 150 mM sodium chloride (NaCl), 3 mM potassium chloride (KCl), 1.4 mM calcium chloride (CaCl2), 0.8 mM magnesium chloride (MgCl2), and 0.001% Kolliphor® 188. See, e.g., harvardapparatus.com / harvard-apparatus-perfusion-fluid.html. In certain embodiments, Harvard buffer is preferred.

[0064] In other embodiments, the formulation may include one or more permeation enhancers. Examples of suitable permeation enhancers may include, for example, mannitol, sodium glycocholate, sodium taurocholate, sodium deoxycholate, sodium salicylate, sodium caprylate, sodium caprate, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether, or EDTA.

[0065] In another embodiment, the composition comprises a carrier, diluent, excipient and / or adjuvant. Suitable carriers can be easily selected by those skilled in the art, taking into consideration the indication for which the introduced virus is intended. For example, one suitable carrier includes saline, which can be formulated with various buffer solutions (e.g., phosphate-buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The buffer / carrier should contain components that prevent rAAV from adhering to the injection tube, but do not interfere with rAAV binding activity in vivo.

[0066] Optionally, the composition may contain other conventional pharmaceutical ingredients such as preservatives or chemical stabilizers in addition to the rAAV and carrier.Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol.Suitable chemical stabilizers include gelatin and albumin.

[0067] As used herein, "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharma- ceutical active substances is well known in the art. Supplementary active ingredients can also be incorporated into the composition. The phrase "pharmacologically acceptable" refers to molecular entities and compositions that do not produce allergic or similar adverse reactions when administered to a host. Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, and the like can be used to introduce the compositions of the present invention into suitable host cells. In particular, rAAV vector-delivered transgenes can be formulated for delivery either encapsulated in lipid particles, liposomes, vesicles, nanospheres, or nanoparticles, and the like.

[0068] In one embodiment, the composition comprises a final formulation suitable for delivery to a subject, for example, an aqueous liquid suspension that is buffered to a physiologically compatible pH and salt concentration.Optionally, one or more surfactants are present in the formulation.In another embodiment, the composition can be delivered as a concentrate that is diluted for administration to a subject.In other embodiments, the composition can be lyophilized and reconstituted when administered.

[0069] Suitable surfactants or surfactant combinations may be selected from non-toxic non-ionic surfactants. In one embodiment, a primary hydroxyl terminated bifunctional block copolymer surfactant is selected, such as Pluronic® F68 [BASF], also known as Poloxamer 188, with neutral pH and average molecular weight of 8400. Other surfactants and other poloxamers may be selected, i.e., a non-ionic triblock copolymer consisting of a central hydrophobic chain of polyoxypropylene (poly(propylene oxide)) adjacent to two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)), SOLUTOL HS15 (macrogol-15 hydroxystearate), LABRASOL (polyoxycaprylic acid glyceride), polyoxy 10 oleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid ester), ethanol, and polyethylene glycol. In one embodiment, the formulation contains a poloxamer. These copolymers are generally named using the letter "P" (for poloxamer) followed by three digits, the first two digits x 100 giving the approximate molecular mass of the polyoxypropylene core, and the last digit x 10 giving the percentage of polyoxyethylene content. In one embodiment, poloxamer 188 is selected. The surfactant may be present in an amount up to about 0.0005% to about 0.001% of the suspension.

[0070] The vectors are administered in an amount sufficient to transfect the cells and provide sufficient levels of gene transfer and expression to cause physiological changes without undue adverse effects or that are medically acceptable. The therapeutic effect of the present invention is provided with a therapeutic effect with a therapeutic effect, which can be determined by one skilled in the art. Optionally, routes other than intrathecal administration can be used, such as direct delivery to the desired organ (e.g., liver (optionally via the hepatic artery), lung, heart, eye, kidney), oral, inhalation, intranasal, intratracheal, intraarterial, intraocular, intravenous, intramuscular, subcutaneous, intradermal, and other parental routes of administration. Routes of administration can be combined, if desired.

[0071] The dosage of the viral vector depends primarily on factors such as the condition being treated, the age, weight, and health of the patient, and may therefore vary between patients. For example, a therapeutically effective human dosage of a viral vector is generally about 1×10 (to treat an average subject weighing 70 kg) in the range of about 25 to about 1000 microliters to about 100 mL. 9 ~1×10 16 The concentration of the genomic viral vector (including all integers or fractions within the range, preferably 1.0×10 12 GC~1.0×10 14 In one embodiment, the composition comprises at least 1 x 10 per dose, including all integer or fractional amounts within the range. 9 , 2×10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , or 9×10 9 In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including all integers or fractions within the range. 10 , 2×10 10 , 3×10 10 , 4×10 10 , 5×10 10 , 6×10 10 , 7×10 10 , 8×10 10 , or 9×10 10In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including all integers or fractions within the range. 11 , 2×10 11 , 3×10 11 , 4×10 11 , 5×10 11 , 6×10 11 , 7×10 11 , 8×10 11 , or 9×10 11 In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including all integers or fractions within the range. 12 , 2×10 12 , 3×10 12 , 4×10 12 , 5×10 12 , 6×10 12 , 7×10 12 , 8×10 12 , or 9×10 12 In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including all integers or fractions within the range. 13 , 2×10 13 , 3×10 13 , 4×10 13 , 5×10 13 , 6×10 13 , 7×10 13 , 8×10 13 , or 9×10 13 In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including all integers or fractions within the range. 14 , 2×10 14 , 3×10 14 , 4×10 14 , 5×10 14 , 6×10 14 , 7×10 14 , 8×10 14 , or 9×10 14 In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including all integers or fractions within the range. 15 , 2×10 15 , 3×10 15, 4×10 15 , 5×10 15 , 6×10 15 , 7×10 15 , 8×10 15 , or 9×10 15 In one embodiment, for human applications, the dose is formulated to contain 1×10 per dose, including all integers or fractions within the range. 10 ~Approx. 1×10 12 It may be in the GC range.

[0072] In certain embodiments, the dose is about 1×10 9 GC / g brain mass ~ approx. 1×10 12 GC / g brain mass. In certain embodiments, the dose is about 1×10 10 GC / g brain mass ~ approx. 3.33×10 11 GC / g brain mass. In certain embodiments, the dose is about 3.33×10 11 GC / g brain mass ~ approx. 1.1×10 12 GC / g brain mass. In certain embodiments, the dose is about 1×10 12 GC / g brain mass ~ approx. 3.33×10 13 GC / g brain mass range. In certain embodiments, the dose is 3.33×10 11 GC / g brain mass. In certain embodiments, the dose is 1.1×10 12 GC / g brain mass. In certain embodiments, the dose is 3.33×10 13 lower than GC / g brain mass.

[0073] In certain embodiments, the dose is about 1×10 10 GC / g brain mass. In certain embodiments, the dose is about 2×10 10 GC / g brain mass. In certain embodiments, the dose is about 2×10 10 GC / g brain mass. In certain embodiments, the dose is about 3×10 10 GC / g brain mass. In certain embodiments, the dose is about 4×10 10 GC / g brain mass In certain embodiments, the dose is about 5×10 10GC / g brain mass. In certain embodiments, the dose is about 6×10 10 GC / g brain mass. In certain embodiments, the dose is about 7×10 10 GC / g brain mass. In certain embodiments, the dose is about 8×10 10 GC / g brain mass. In certain embodiments, the dose is about 9×10 10 GC / g brain mass. In certain embodiments, the dose is about 1×10 11 GC / g brain mass. In certain embodiments, the dose is about 2×10 11 GC / g brain mass. In certain embodiments, the dose is about 3×10 11 GC / g brain mass. In certain embodiments, the dose is about 4×10 11 GC / g brain mass.

[0074] In certain embodiments, the dose is about 1.44×10 13 ~4.33×10 14 The dose is administered to a human as a flat dose in the range of GC. In a specific embodiment, the dose is about 1.44 x 10 13 ~2×10 14 The dose is administered to a human as a flat dose in the range of GC. In certain embodiments, the dose is about 3×10 of rAAV. 13 ~1×10 14 The dose is administered to a human as a flat dose in the range of GC. In certain embodiments, the dose is about 5×10 of rAAV. 13 ~1×10 14 It is administered to humans as a flat dose in the range of GC.

[0075] In some embodiments, the composition is formulated in a dosage unit and contains about 1×10 13 ~8×10 14 In some embodiments, the composition may contain an amount of AAV in the range of about 1.44×10 rAAV. 13 ~4.33×10 14 In some embodiments, the composition may contain an amount of rAAV in the range of about 3×10 13 ~1×10 14In some embodiments, the composition may contain an amount of rAAV in the range of about 5×10 13 ~1×10 14 It may contain an amount of rAAV in the range of GC.

[0076] In certain embodiments, the rAAV is administered to the subject in a single dose. In certain embodiments, multiple doses (e.g., two doses) are desired.

[0077] Dosage may be adjusted to balance therapeutic benefits against any side effects, and such dosage may vary according to the therapeutic use for which recombinant vector is used.The expression level of transgene can be monitored to determine the dosage frequency that results in viral vector, preferably AAV vector containing minigene.Optionally, the same dosage regimen as described for therapeutic purposes can be used for immunization using the composition of the present invention.

[0078] As used herein, the term "intrathecal delivery" or "intrathecal administration" refers to the route of administration of a drug via injection into the spinal canal, more specifically, via injection into the subarachnoid space to reach the cerebrospinal fluid (CSF). Intrathecal delivery may include lumbar puncture, intraventricular (including intraventricular ventricle (ICV)), suboccipital / intracisternal, and / or C1-2 puncture. For example, the material may be introduced by lumbar puncture to diffuse across the subarachnoid space. In another example, the injection may be intracisternal or via intraparenchymal delivery. In certain embodiments, rAAV is administered via computed tomography (CT)-guided suboccipital injection into the cisterna magna (intracisternal). In certain embodiments, the patient is administered a single dose.

[0079] As used herein, the term "intracisternal delivery" or "intracisternal administration" refers to the administration of a drug directly into the cerebrospinal fluid of the cerebellum-medullary cisterna magna, more specifically, by suboccipital puncture or by direct injection into the cisterna magna, or by a permanently placed tube.

[0080] In certain embodiments, the rAAV.hPGRN stock is formulated in intrathecal final formulation buffer (ITFFB; artificial CSF with 0.001% Pluronic F-68). Batches are frozen, then thawed, pooled as necessary, adjusted to target concentration, sterile filtered through a 0.22 μm filter, and filled into vials. In a specific embodiment, a suspension of rAAV1.hPGRN with formulation buffer is adjusted to pH 7.2-7.4.

[0081] In one embodiment, the volume for delivery of a dose of rAAV1.hPGRN provided herein can be determined by one of skill in the art. For example, a volume of about 1 μL to 150 mL may be selected, and for adults, a higher volume may be selected. Typically, a suitable volume for a neonate is about 0.5 mL to about 10 mL, and for older infants, about 0.5 mL to about 15 mL may be selected. For infants, a volume of about 0.5 mL to about 20 mL may be selected. For children, a volume of up to about 30 mL may be selected. For preteens and teens, a volume of up to about 50 mL may be selected. In yet other embodiments, patients may receive intrathecal administration at a selected volume of about 5 mL to about 15 mL, or about 7.5 mL to about 10 mL. Other suitable volumes and dosages may be determined. Dosages may be adjusted to balance therapeutic benefit against any side effects, and such dosages may vary depending on the therapeutic application for which the recombinant vector is utilized.

[0082] In certain embodiments, the composition comprises rAAV.EF1a.huPGRN.SV40, rAAV.UbC.PI.huPGRN.SV40, or rAAVCB7.CI.hPGRN1.rGB. Compositions in which the rAAV capsid is AAVhu68, AAV5, or AAV1 are exemplified in the Examples below. In particularly preferred embodiments, the rAAV is AAV1. In certain embodiments, the coding sequence of huPGRN is selected from the sequences defined herein. See, for example, SEQ ID NO: 3 or a sequence 95%-99.9% identical thereto, or SEQ ID NO: 4 or a sequence 95%-99.9% identical thereto, or a fragment thereof as defined herein. Exemplary sequences for vector elements used in the examples below are provided in, e.g., SEQ ID NO:6 (rabbit globin polyA), AAV ITRs (SEQ ID NOs:7 and 8), human CMV IE promoter (SEQ ID NO:9), CB promoter (SEQ ID NO:10), chimeric intron (SEQ ID NO:11), UbC promoter (SEQ ID NO:12), EF-1a promoter (SEQ ID NO:17), intron (SEQ ID NO:13), and SV40 late polyA (SEQ ID NO:14).

[0083] use As used herein, PGRN haploinsufficiency refers to patients with a mutation in the PGRN gene, resulting in deficient PGRN and / or GRN levels. The target population of rAAV1-PGRN therapy includes patients with PGRN haploinsufficiency and / or other deficient PGRN or GRN levels. In certain embodiments, the patient is heterozygous for the PGRN mutation. In yet another embodiment, the patient is homozygous from the PGRN mutation. In certain embodiments, the patient is administered an immunosuppressive regimen in combination with the rAAV1-mediated hPGRN therapy provided herein.

[0084] In certain embodiments, rAAV1.PGRN is useful for treating patients with GRN haploinsufficiency. Such patients may be diagnosed with adult-onset neurodegeneration caused by GRN haploinsufficiency or may be presymptomatic. rAAV1.PGRN can be administered as a single dose via computed tomography (CT)-guided suboccipital injection into the cisterna magna (intracisternal [ICM]). The single dose is administered at a predetermined dose level. This route of administration was chosen due to the superior brain transduction achieved by single ICM injection in NHPs. In certain embodiments, administration of vector into the ICM also results in a reduced anti-PGRN T cell response compared to alternative routes of administration (e.g., injection into the lateral ventricle). In common procedures, ICM injection (also known as suboccipital puncture) was previously replaced by lumbar puncture. However, other dosage levels and delivery routes may be selected and / or used in conjunction with this rAAV1-mediated hPGRN therapy. stomach.

[0085] In certain embodiments, the rAAV1-mediated therapy described herein may provide PGRN expression at approximately average, normal physiological levels for humans without GRN mutations (haploinsufficient). However, the therapy may provide therapeutic benefit even when the increase in PGRN expression is lower than normal levels, providing about 40% to 99% of the normal average level, e.g., 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or other values ​​therebetween. In certain embodiments, this may result from an increase in PGRN levels of at least 5% to about 70%, or more, above the patient's expression levels prior to treatment. In certain embodiments, the therapy provides therapeutic efficacy where administration of rAAV1-mediated hPGRN results in an increase in the level of PGRN in the CSF (e.g., 10-fold to 40-fold higher than normal levels).

[0086] In certain embodiments, efficacy is evaluated by one or more of the following: increase in the level of PGRN protein in CSF, and / or change in thickness of brain cortex.In certain embodiments, efficacy of rAAV1-mediated therapy is evaluated after administration of a single ICM dose, and is measured by one or more of long-term survival, and improvement in clinical symptoms and daily function as assessed by Mini-Mental State Examination (MMSE), Clinical Global Impression-C (CGI-C), Frontal Function Assessment Board (FAB), Frontotemporal Dementia Rating Scale (FRS), Frontal Behavior Inventory (FBI), Unified Parkinson's Disease Rating Scale (UPDRS), Verbal Fluency Test, Clinical Dementia Scale for Frontotemporal Lobar Degeneration (CDR-FTLD sb), and / or Neuropsychiatric Inventory (NPI).In certain embodiments, efficacy is demonstrated by improvement in CSF levels of neurofilament light chain (NFL), tau, phosphorylated tau, and inflammatory markers, and / or increase in plasma levels of PGRN. In certain embodiments, efficacy is assessed by measuring the reduction or reversal of levels of microgliosis.

[0087] In certain embodiments, efficacy is measured by improvement in one or more of the clinical symptoms associated with GRN patients, including, for example, behavioral deficits (disinhibition, apathy, loss of compassion or empathy, compulsive or stereotyped behavior, or lip-spatial tendencies) and cognitive deficits (decreased executive function without significant impact on episodic memory or visuospatial skills).

[0088] In certain embodiments, improvements are observed in some other more atypical symptoms, including psychiatric features (delusions, hallucinations, and obsessive-compulsive behavior) and / or other cognitive impairments (episodic memory impairment, apraxia, and visuospatial dysfunction). Evaluations may be performed using FTDC criteria, including brain imaging for signs of frontal and / or temporal lobar degeneration, evaluation of reductions in clinical rating scales (such as the Clinical Dementia Scale for Frontotemporal Lobar Degeneration [CDR-FTLD], the Frontal Behavior Inventory [FBI], the Neuropsychiatric Inventory [NPI], and the Frontotemporal Dementia Rating Scale [FRS]), and finally genetic testing to confirm pathogenic GRN mutations. Cerebrospinal fluid (CSF) biomarkers may be used, including tau and amyloid-β, and positron emission tomography (PET) imaging of amyloid.

[0089] In certain embodiments, improvements are observed in GRN mutation carriers with primary progressive aphasia (PPA), which is characterized by symptoms related to speech and language. These can be diagnosed using guidelines based on Mesulam criteria that distinguish between three clinical types of PPA: semantic PPA (svPPA), non-fluent PPA (nfvPPA), and logopenic PPA (lvPPA) (Gorno-Tempini et al., (2011) "Classification of primary progressive aphasia and its variants." Neurology. 76(11):1006-14). nfvPPA presents with deficits in the ability to produce speech. Cardinal features include agrammatism in language production, effortful speech, and apraxia of speech. svPPA presents with a deficit in the ability to understand the meaning of words, and cardinal features include impaired word naming and word comprehension. lvPPA is characterized by difficulty finding the appropriate word during speech, but without impaired word comprehension. The cardinal feature of lvPPA is a deficit in the ability to recall words and recite sentences. GRN mutation carriers, most commonly in nfvPPA, may have a broader range of symptoms across the clinical spectrum of PPA, resulting in a diagnosis of "PPA-not otherwise specified" (Gorno-Tempini et al., 2011; Woollacott and Rohrer, 2016).

[0090] Provided is a method for treating human patients with neurodegenerative conditions associated with GRN haploinsufficiency.In certain embodiments, the condition is progranulin-associated frontotemporal dementia (FTD).The method comprises delivering the coding sequence of progranulin to central nervous system (CNS) via recombinant adeno-associated virus (rAAV) with adeno-associated virus 1 (AAV1) capsid, the rAAV further comprises a vector genome packaged in the AAV capsid, the vector genome comprises AAV inverted terminal repeat, the coding sequence of human progranulin, and the regulatory sequence that directs the expression of progranulin.

[0091] A method is provided for treating a human patient with brain pathology associated with Progranulin-associated frontotemporal dementia or another neurodegenerative condition associated with GRN haploinsufficiency. The method includes administering a coding sequence for Progranulin to the central nervous system (CNS) via a recombinant adeno-associated virus (rAAV) having an adeno-associated virus 1 (AAV1) capsid, the rAAV further comprising a vector genome packaged in the AAV capsid, the vector genome comprising an AAV inverted terminal repeat, a coding sequence for human Progranulin, and a regulatory sequence directing expression of Progranulin.

[0092] In certain embodiments, the method provided herein may further comprise: (a) non-invasively assessing the patient for the reduction of retinal storage lesions as a predictor of the reduction of brain lesions; (b) performing magnetic resonance imaging to assess brain volume; and / or (c) monitoring the treatment by measuring the concentration of progranulin in CSF. Optionally, the concentration of progranulin in plasma may be evaluated.

[0093] In certain embodiments, the efficacy of the rAAV.hPGRN composition is assessed by one or more of primarily cognitive, primarily behavioral, or cognitive / other methods. Suitable assessments are described below.

[0094] The primary cognitive assessments include the Verbal Fluency Test, the Clinical Dementia Ratio for FTLD, or the Mini-Mental State Examination (MMSE). The Verbal Fluency Test may be performed by presenting each subject with the same picture / picture and asking them to provide a verbal description. During the description, speech rate (words / min) is counted, recorded, and finally compared to a rate that reflects a neurotypical adult. The CDR-FTLD is an extension of the classic CDR, historically used to assess the severity of Alzheimer's spectrum disorders. This assessment includes the original six domains of the CDR (memory, orientation, judgment and problem solving, social adaptation, home situation and hobbies, and caregiving situation), as well as two additional domains, language and behavior, making it more sensitive in detecting decline in FTLD. A rating of "0" indicates normal behavior or language, while a score of "1," "2," or "3" indicates mild to severe impairment. The "sum of boxes," or the sum of the individual domain scores, is used to determine the overall dementia severity. The MMSE is an 11-question global cognitive assessment that is widely used in clinical and research practice. Questions include, "What year is it? What season is it? What day of the month is it? What day of the week is it? What month is it?" and each correct answer is scored. One point is awarded for each question, with a maximum score being awarded for each question. The total score limit is 30 points, with two cut-offs, 24 and 27 points, which are indicators of cognitive decline.

[0095] Primary motor assessments include, for example, the Unified Parkinson's Disease Rating Scale (UPDRS). The UPDRS is a 42-item, 4-part assessment of several domains relevant to parkinsonism, including mental health, behavior, and mood and activities of daily living. Each item typically includes a rating scale ranging from 0 (typically indicating no impairment) to 4 (typically indicating the most severe impairment). Scores for each part are tallied to provide a disease severity rating, with a high score of 199 indicating the worst / most complete impairment.

[0096] Primary behavioral assessments include, for example, the Neuropsychiatric Inventory (NPI) or the Frontal Behavior Inventory (FBI). The NPI is used to elucidate the presence of psychopathology in patients with brain disorders. Initially, it was developed for use in Alzheimer's disease populations, but it may be useful to evaluate behavioral changes in other conditions. The assessment consists of 10 behavioral domains and two autonomic domains, among which there are four scores: frequency, severity, overall burden, and caregiver burden. The total score of the NPI is obtained by adding the domain scores of the behavioral domains and subtracting the score of caregiver burden. The FBI is a 24-item assessment that aims to evaluate behavioral and personality changes specifically related to bvFTD and to differentiate between FTD and other dementias. It is conducted as a face-to-face interview with the primary caregiver, as patients diagnosed with bvFTD generally do not have sufficient insight into these types of changes. It focuses on several areas related to behavior and personality, and each question is scored from 0 (none) to 3 (severe / most of the time). The total score provides insight into the severity of the disease and can be used to assess change over time.

[0097] Other / both cognitive and motor assessments include, for example, the Columbia-Suicide Severity Rating Scale (C-SSRS), Clinical Global Impression-of-Change (CGI-C), Frontal Abdominal Function Test (FAB), and / or the Frontotemporal Dementia Rating Scale (FDR). The C-SSRS is a three-part scale that measures suicidal ideation, ideation intensity, and suicidal behavior through questions to assess suicidal ideation and behavior. The results of this assessment consist of a suicidal behavior lethality rating, a suicide ideation score, and a suicide ideation intensity rating, which are obtained directly from the scale. An ideation score above 0 may indicate the need for intervention, based on the assessment guidelines. The intensity rating ranges from 0 to 25, with 0 representing no endorsement of suicidal ideation. The CGI-C is one of three-part, brief, widely used assessments, consisting of three items and rated by clinicians and observers. The CGI-C is rated on a 7-point scale ranging from 1 (very improved) to 7 (very worse), beginning with enrollment in the study, regardless of whether the improvement is entirely due to treatment. The FAB is a brief assessment to aid in the differentiation between fronto-executive phenotype dementia and Alzheimer's dementia. It is particularly useful in patients with mild dementia (MMSE>24). The assessment consists of 6 parts addressing cognitive, motor, and behavioral domains, with a total score of 18, with higher scores indicating better performance. The FDR is a brief staging assessment for patients with frontotemporal dementia to detect differences in disease progression of FTD subtypes over time. This brief interview is administered with the primary caregiver and consists of 30 items, categorized as "never," "sometimes," or "always." Percentage scores are then calculated and converted to a logit score and, ultimately, a severity score. Severity scores range from "very mild" to "very severe."

[0098] Another measure of efficacy would be the increase in survival from the time of diagnosis after the onset of symptoms, which is a measure of efficacy. Currently, the average life expectancy of patients diagnosed with neurodegeneration caused by GRN mutations is 7 to 11 years from the onset of symptoms. The most common outcome is stabilization and / or increase in atrophy in the thickness of the medial frontal and parietal regions, which are the brain regions most commonly affected across all clinical conditions in the setting of rheumatoid arthritis. This can be assessed using MRI or other imaging techniques. Further assessments include biochemical biomarkers. The levels of PGRN protein in the CSF and plasma are measured as a readout of AAV transduction and are expected to increase in patients after administration of rAAV1.hPGRN. In other embodiments, CSF levels of neurofilament light chain (NFL), tau, phosphorylated tau, and other inflammatory markers are assessed. In certain embodiments, modulation and / or reduction in the levels of these biomarkers correlates with efficacy.

[0099] Although the examples below focus on the treatment of certain conditions associated with heterozygous GRN haploinsufficiency, in certain embodiments, the vectors and compositions described herein may be used to treat other diseases, e.g., diseases associated with homozygous mutations in the GRN gene, such as neuronal ceroid lipofuscinosis, cancer (e.g., ovarian, breast, adrenal, and / or pancreatic cancer), atherosclerosis, type 2 diabetes, and metabolic diseases.

[0100] As used herein, the term computed tomography (CT) refers to radiography in which a three-dimensional image of a body structure is constructed by a computer from a series of planar cross-sectional images made along an axis.

[0101] The terms "substantial homology" or "substantial similarity," when referring to a nucleic acid or a fragment thereof, when optimally aligned with another nucleic acid (or its complementary strand), with appropriate nucleotide insertions or deletions, there is nucleotide sequence identity in at least about 95-99% of the aligned sequence. Preferably, the homology is over the full length sequence, or its open reading frame, or another suitable fragment that is at least 15 nucleotides in length. Examples of suitable fragments are described herein.

[0102] The terms "sequence identity," "percent sequence identity," or "percent identical" in the context of nucleic acid sequences refer to residues in two sequences that are the same when aligned for maximum correspondence. The length of sequence identity comparison can be over the entire length of a genome, the entire length of a gene coding sequence, or a fragment of at least about 500-5000 nucleotides, desirably. However, identity between smaller fragments, e.g., of at least about 9 nucleotides, usually at least about 20-24 nucleotides, at least about 28-32 nucleotides, at least about 36 nucleotides or more, may also be desired. Similarly, "percent sequence identity" can be readily determined for amino acid sequences over the entire length of a protein or fragments thereof. Preferably, the fragments are at least about 8 amino acids in length and can be up to about 700 amino acids in length. Examples of suitable fragments are described herein.

[0103] The term "substantial homology" or "substantial similarity", when referred to an amino acid or a fragment thereof, when optimally aligned with another amino acid (or its complementary strand) with appropriate amino acid insertions or deletions, there is amino acid sequence identity in at least about 95-99% of the aligned sequence. Preferably, the homology is over the full length sequence, or a protein thereof, e.g., cap protein, rep protein, or a fragment thereof that is at least 8 amino acids in length, or more preferably, at least 15 amino acids in length. Examples of suitable fragments are described herein.

[0104] The term "highly conserved" means at least 80% identity, preferably at least 90% identity, more preferably greater than 97% identity. Identity is readily determined by those of skill in the art using algorithms and computer programs known to those of skill in the art.

[0105] Generally, when referring to "identity", "homology", or "similarity" between two different adeno-associated viruses, the "identity", "homology", or "similarity" is determined with reference to "aligned" sequences. An "aligned" sequence or "alignment" refers to multiple nucleic acid or protein (amino acid) sequences, often including corrections for missing or additional bases or amino acids, as compared to a reference sequence. In the examples, the AAV alignment is performed using the published AAV9 sequence as a reference point. The alignment is performed using a variety of multiple sequence alignment programs, either public or commercially available. Examples of such programs include "Clustal Omega", "Clustal W", "CAP Sequence Assembly", "MAP", and "MEME", which are accessible through web servers on the Internet. Other sources of such programs are known to those of skill in the art. Alternatively, the Vector NTI utility is also used. There are also several algorithms known in the art that can be used to measure nucleotide sequence identity, including those included in the programs described above. As another example, polynucleotide sequences can be compared using Fasta™, a program in GCG version 6.1. Fasta™ provides alignment and percent sequence identity of the best overlap region between query sequence and search sequence. For example, percent sequence identity between nucleic acid sequences can be determined using Fasta™ with its default parameters (word size 6 and NOPAM factor for scoring matrix) as provided in GCG version 6.1 (hereby incorporated by reference). Multiple sequence alignment programs such as "Clustal Omega", "Clustal X", "MAP", "PIMA", "MSA", "BLOCKMAKER", "MEME" and "Match-Box" programs are also available for amino acid sequences. Generally, any of these programs are used with default settings, but if necessary, those skilled in the art can change these settings.Alternatively, one of skill in the art can utilize another algorithm or computer program that provides at least the level of identity or alignment as provided by the referenced algorithms and programs. See, e.g., JD Thomson et al, Nucl. Acids. Res., "A. See, “Comprehensive comparison of multiple sequence alignments”, 27(13):2682-2690 (1999).

[0106] It should be noted that the terms "a" or "an" refer to one or more. As such, the terms "a" (or "an"), "one or more," and "at least one" are used interchangeably herein.

[0107] The terms "comprise," "comprises," and "comprising" are to be interpreted inclusively rather than exclusively. The terms "consist," "consisting," and variations thereof are to be interpreted exclusively rather than inclusively. Although various embodiments herein are set forth using the word "comprising," it is also intended that in other circumstances the relevant embodiment should be construed and described using the word "consisting of" or "consisting essentially of."

[0108] As used herein, the term "about" means a variability of 10% (±10%, e.g., ±1, ±2, ±3, ±4, ±5, ±6, ±7, ±8, ±9, ±10, or any value therebetween) from a given reference, unless otherwise specified.

[0109] As used herein, "disease," "disorder," and "condition" are used interchangeably to refer to an abnormal condition in a subject.

[0110] Unless otherwise defined herein, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art and by reference to published documents which provide general guidance to those of ordinary skill in the art for many of the terms used herein.

[0111] The term "expression" is used herein in the broadest sense and includes the production of RNA or RNA and protein. With respect to RNA, the terms "expression" or "translation" particularly relate to the production of peptides or proteins. Expression can be transient or stable.

[0112] As used herein, "expression cassette" refers to a nucleic acid molecule that includes a coding sequence, a promoter, and may include other regulatory sequences therefor, which can be delivered to a packaging host cell by a genetic element (e.g., a plasmid) and packaged into a viral vector capsid (e.g., a viral particle). Typically, such expression cassettes for producing viral vectors include coding sequences for gene products described herein adjacent to packaging signals of the viral genome, and other expression control sequences such as those described herein.

[0113] As used herein, the term "operably linked" refers both to expression control sequences that are contiguous with a gene of interest, and to expression control sequences that act in trans or at a distance to control the gene of interest.

[0114] When used in reference to a protein or nucleic acid, the term "heterologous" indicates that the protein or nucleic acid comprises two or more sequences or subsequences that are not found in the same relationship to each other in nature. For example, nucleic acids with two or more sequences from unrelated genes arranged to create a new functional nucleic acid are typically produced recombinantly. For example, in one embodiment, a nucleic acid has a promoter from one gene arranged to direct the expression of a coding sequence from a different gene. Thus, with respect to the coding sequence, the promoter is heterologous.

[0115] The term "translation" in the context of the present invention relates to the process in which a ribosome controls the assembly of an amino acid sequence to produce a protein or peptide.

[0116] The following examples are illustrative only and are not intended to limit the invention. EXAMPLES

[0117] [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6]

[0118] Example 1: Materials and Methods: vector An engineered human PGRN cDNA was cloned into an expression construct containing a chicken beta actin promoter with a cytomegalovirus early enhancer, a chimeric intron, and a rabbit beta globin polyadenylation sequence (Figure 1). A second engineered human PGRN cDNA was cloned into an expression construct containing a human ubiquitin C promoter. The expression construct was flanked by AAV2 inverted terminal repeats. Adeno-associated virus serotypes 1, 5, and human 68 (AAVhu68) were generated from this construct by triple transfection of HEK293 cells and iodixanol purification as previously described (Lock M, et al. Hum Gene Ther. 2010;21(10):1259-71).

[0119] Animal procedures All animal protocols were approved by the Institutional Animal Care and Use Committee of the University of Pennsylvania. Pairs of GRN knockout mice were purchased from The Jackson laboratory (stock no. 013175) and a colony was maintained at the University of Pennsylvania. Wild-type C57BL / 6 (stock no. 000664) served as controls. In the first study, 2-month-old mice were anesthetized with isoflurane and inoculated with 1 × 10 11 Vector genome copies (GC) were injected into the lateral ventricle (ICV) in a volume of 5 μL. Sixty days after injection, mice were euthanized by exsanguination under ketamine / xylazine anesthesia, and death was confirmed by cervical dislocation. In the second study, mice were treated at 7 months of age and sacrificed at 11 months of age. At necropsy, serum was collected by cardiac puncture and CSF was collected by suboccipital puncture using a 32-gauge needle connected to polyethylene tubing. Serum and CSF samples were snap frozen on dry ice and stored at -80°C until analysis. Frontal cortices were collected and snap frozen on dry ice for biochemistry, and the remaining brains were fixed in 10% formalin for histology.

[0120] Rhesus macaques, 3-4 years old, were purchased from Covance. For vector administration, animals were sedated with intramuscular dexmedetomidine and ketamine and administered 3 × 10 13 AAV vectors for GC were administered by a single intracisternal (ICM) injection. Needle placement was verified by myelography using a fluoroscopic device (OEC9800 C-Arm, GE) as previously described (Katz N, et al. Hum Gene Ther Methods. 2018 Oct;29(5):212-219). Animals were euthanized by barbiturate overdose. Recovered tissues were either immediately frozen on dry ice or fixed in 10% formalin for histology.

[0121] Histology and imaging Mouse brains were fixed in 10% formalin, cryopreserved in sucrose, embedded in optimal cutting temperature (OCT) compound, and sectioned on a cryostat. Low-magnification images of autofluorescent material (lipofuscin) were taken in the regions of interest. Lipofuscin deposits were quantified in a blinded fashion using ImageJ software. Nonhuman primate tissues were fixed in 10% formalin, embedded in paraffin, and stained with hematoxylin and eosin (H&E). Slides were reviewed by a board-certified veterinary pathologist (ELB). For animals treated with the GFP vector, brain sections were stained with antibodies against olig2, GFAP, or NeuN. All sections were co-stained with DAPI and antibodies against GFP, followed by fluorescent secondary antibodies. Slides were scanned with a Leica Aperio Versa 200 slide scanner, downloaded from eSlide Manager, and analyzed with HALO imaging software (Indica Labs). Five regions of the right hemisphere were sampled for each animal and cells were quantified with each cell type marker. Cells were detected by adjusting the following settings: "minimum nuclear intensity," "nuclear size," "nuclear segmentation aggressiveness," and "minimum nuclear roundness" under the nuclear detection tab. Criteria were then defined for each individual dye to further identify cells and generate quantitative total cell counts for each marker. Settings were empirically determined based on the sensitivity and reliability of detection of the desired cell type. In some cases, settings such as detection of NeuN in the cytoplasm did not reflect the true subcellular localization of the marker but provided greater specificity and sensitivity of detection. All cells detected by automated means were manually verified. For neurons, under the "Dye 1" tab, "nuclear positive threshold" and "cytoplasm positive threshold" were adjusted to detect only cells with NeuN present in both the nucleus and cytoplasm. For astrocytes, DAPI and GFAP markers were selected and included in the count if present in both the nucleus and cytoplasm of the cell. For oligodendrocytes, cells were counted if both DAPI and olig2 were present in the nucleus but not in the cytoplasm of the cells.For colocalization, the same settings were used, but GFP was included as an additional dye in the nucleus in neurons, and in both the nucleus and cytoplasm in astrocytes. Cells that did not express all selected markers were excluded from the generated results table by "masking" them using the nuclear or cytoplasmic "mask" function. Due to the rarity of GFP-positive cells colocalizing with olig2, transduced oligodendrocytes were counted manually. In some cases, parts of blood vessels or choroid plexus showing autofluorescence were manually outlined and excluded using the "scissors" tool. The obtained values ​​were expressed as the percentage of GFP-positive cells for each cell type marker.

[0122] Sample preparation for the hexosaminidase (Hex) assay Serum was used directly for Hex activity assays, whereas brain samples were homogenized in lysis buffer (0.2% Triton-X100, 0.9% NaCl, pH 4.0) followed by three freeze-thaw cycles and clarification by centrifugation. Protein concentrations were determined by Bradford assay. Hex activity measurements were performed as previously described (Hinderer C, et al. Molecular therapy: the journal of the American Society of Gene Therapy. 2014;22(12):2018-27).

[0123] ELISA Human PGRN was measured using DuoSet ELISA kit (R&D#DY2420) with minor modifications. Briefly, high-binding polystyrene ELISA plates were coated with 5ug / ml human PGRN capture antibody diluted in phosphate-buffered saline (PBS) overnight at 4°C. After washing, plates were blocked with 1% bovine serum albumin (BSA) in PBS for 2 hours, followed by incubation of samples for 1 hour. Human and non-human primate CSF were diluted 1:5, while mouse CSF samples were diluted 1:40 in PBS. Brain samples were diluted in lysis buffer to a total protein concentration of 2mg / ml. Bound antibodies were detected using biotinylated mouse anti-human progranulin antibody and streptavidin-HRP. Plates were developed using tetramethylbenzidine substrate for 20 minutes, and absorbance was measured at 450nm after stopping the reaction with 2N sulfuric acid.

[0124] Neutralizing antibody assay Neutralizing antibodies against AAVhu68 were assessed as previously described (Calcedo R, et al. J Infect Dis. 2009;199(3):381-90).

[0125] statistics Comparisons of Hex enzyme activity, lipofuscin counts, and CD68+ areas in wild-type, GRN knockout, and AAV-treated GRN knockout mice were performed using one-way ANOVA followed by post hoc Tukey's multiple comparisons test.

[0126] Example 2: AAV-mediated delivery of a human GRN transgene in a mouse disease model A recombinant AAV vector (CB7.CI.hPGRN.rBG) harboring an AAVhu68 capsid expressing human PGRN (SEQ ID NO:3) under the control of the CB7 promoter and a chimeric intron was produced using the published triple transfection technique described, for example, in WO2018 / 160582.

[0127] We evaluated AAV-mediated delivery of the human GRN transgene in a GRN knockout mouse model. Mice with heterozygous GRN mutations (GRN + / - ), do not display the pathological hallmarks of GRN-related neurodegenerative diseases, presumably because the mouse life span does not allow for the development of sequelae of GRN haploinsufficiency that only appear decades later in humans. - / - Complete PGRN deficiency in mice recapitulates some early features of GRN haploinsufficiency in humans (e.g., impaired lysosomal function, accumulation of autofluorescent lysosomal storage material (lipofuscin), and microglial activation), but not GRN - / - Mice do not show neuronal loss even by the age of 2 years (Lui H, et al. Cell. 2016;165(4):921-35; Ward ME, et al.Sci Transl Med.2017 Apr 12;9(385):pii:eaah5642). GRN + / - Mice and GRNs - / - Both mice have been reported to exhibit behavioral abnormalities, although findings are not consistent between groups (Ahmed Z,et al. Am J Pathol. 2010;177(1):311-24; Wils H,et al. The Journal of Pathology. 2012;228(1):67-76; Ghoshal N,et al. Neurobiology of Disease. 2012;45(1):395-408; Filiano AJ,et al. The Journal of neuroscience:the official journal of the Society for Neuroscience.2013;33(12):5352-61, Yin F,et al.The FASEB Journal.2010;24(12):4639-47). Similarly, some reports - / - Although reduced survival rates were observed in mice, In the report, GRN - / -The mice were found to have a normal life span, consistent with our experience (Ahmed Z, et al. Am J Pathol. 2010; 177(1):311-24; Wils H, et al. The Journal of Pathology. 2012; 228(1):67-76). GRN - / - Although mice do not exhibit overt neurodegeneration or neurological signs, the striking biochemical and histological similarities to GRN haploinsufficiency in humans make them a potentially useful model for evaluating novel therapies. - / - Our analysis focused on these biochemical and histological findings in mice.

[0128] The aim of this study was to determine whether delivery of the human GRN gene to the brain could clear existing lysosomal storage material and inhibit GRN - / - The aim of this study was to evaluate whether lysosomal function in mice could be normalized. In response to lysosomal storage, cells upregulate the expression of lysosomal enzymes, which can be used as biomarkers for lysosomal storage diseases (Hinderer C, et al. Molecular therapy: the journal of the American Society of Gene Therapy.2014;22(12):2018-27, Gurda BL,et al.Molecular therapy:the journal of the American Society of Gene Therapy.2016;24(2):206-16, Karageorgos LE,et al.Experimental Cell Research.1997;234(1):85-97). We investigated the effect of GRNs of different ages on the phenotype. - / - and GRN + / +We assessed the activity of the lysosomal enzyme hexosaminidase in brain tissue from mice, as well as lipofuscin deposits in the cortex, hippocampus, and thalamus (Figures 3A-3D). Elevated hexosaminidase activity was evident throughout life, whereas lipofuscin showed progressive accumulation. Lipofuscin was evident as early as 2 months of age, consistent with previous findings (Klein ZA, et al. Neuron 2017;95(2):281-96 e6). Our initial studies were performed with AAV vectors based on AAVhu68, a natural isolate, which is closely related to AAV9, a clade F isolate. 2-3 month old GRNs - / - Mice were treated with intracerebroventricular (ICV) injection of either AAVhu68 vector expressing human GRN or vehicle (PBS) (N=10 per group). In addition, a cohort of wild-type mice was injected with vehicle (N=10). The ICV ROA (involving injection of AAV vector directly into the CSF of the ventricles) was used because the small size of 2-month-old mice makes it difficult to reliably administer vector via the ICM route (which is the ROA used for the NHP study and proposed FIH clinical trial). Previous studies have demonstrated that the dose selected for this study (10 11 ICV administration of AAVhu68 in GCs showed that transduction was restricted to brain regions close to the injected ventricle, providing a useful system to assess whether global amelioration of brain pathology could be achieved by secretion of PGRN by a small cell population.

[0129] Two months after vector administration, animals were euthanized and brain, CSF, and serum were collected. Quantification of human PGRN protein levels in the brain confirmed transduction in the AAV-treated group (Figure 4A-4F). PGRN is a measurable secreted protein in the CSF and is reduced in the CSF of human GRN mutation carriers (Lui H, et al. Cell. 2016; 165(4):921-35, Meeter LH, et al. Dement Geriatr Cogn Dis Extra. 2016; 6(2):330-40). Thus, we conclude that AAV-treated GRN is a secreted protein that is measurable ... / -PGRN protein levels in the CSF of mice were assessed and revealed a mean CSF concentration of 14 ng / mL, whereas in the vehicle-treated group, human PGRN was below detection levels (Figure 4A-F). Expression of PGRN was accompanied by normalization of expression of lysosomal enzymes, and was significantly increased in AAV-treated GRN. - / - Hex activity levels in the mouse brain returned to near normal levels (Figures 4A to 4F).

[0130] GRN - / - After confirming PGRN expression in the mouse brain, we assessed whether PGRN expression reduced the number of lipofuscin deposits in the hippocampus, thalamus, and cortex. To that end, unstained fixed brain sections were mounted on coverslips and imaged for autofluorescent lipofuscin in a blinded fashion. - / - Mice showed reduced lipofuscin in all brain regions compared to vehicle-treated GRN − / − mice, with levels similar to age-matched wild-type controls (Figures 4A-F).

[0131] The first proof of concept study demonstrated the therapeutic activity of AAV-mediated PGRN expression in treated mice at an early stage, when accumulated material was just beginning to appear in the brain. The impact of gene transfer was then evaluated in older mice with more severe pre-existing pathology. In this study, 7-month-old GRN - / - Mice received a single ICV injection of AAVhu68 vectors expressing human PGRN or vehicle and were sacrificed at 11 months of age. In addition to extensive brain lipofuscin deposits (Figure 5A-D), GRN expression at 11 months of age was significantly increased. - / - Mice showed extensive microgliosis (Ahmed Z, et al. Journal of neuroinflammation. J Neuroinflammation. 2007 Feb 11;4:7), similar to patients with FTD caused by GRN mutations (Figures 6A-C). GRN gene transfer reduced brain Hex activity and lipofuscin deposits in aged mice, similar to findings in younger animals (Figures 5A-D). Furthermore, microglia size and number were normalized in the brains of treated mice (Figures 6A-C).

[0132] Taken together, the AAV vector expressing human PGRN was used to - / - ICV delivery to mouse brains cleared lipofuscin aggregates and nearly completely normalized lysosomal enzyme activity, demonstrating that PGRN gene delivery can effectively correct key aspects of the pathophysiology underlying GRN-associated neurodegenerative diseases.

[0133] Example 3: AAV-mediated GRN gene transfer in non-human primates GRN - / -Findings in mice demonstrate that delivery of AAV vectors to the CSF can achieve sufficient brain transduction to produce therapeutic levels of PGRN and prevent or reverse biochemical and histological findings associated with PGRN deficiency. To translate this approach to humans, studies were performed in non-human primates using a clinically relevant route of vector administration, ICM delivery. Intrathecal AAV delivery by injection into the cisterna magna is a minimally invasive approach and results in more extensive brain transduction than administration by lumbar puncture (Hinderer C, et al. Molecular therapy Methods & clinical development. 2014;1:14051). NHPs aged 3–10 years were utilized because this age represents the intended adult patient population. Rhesus macaques (N=2 per group) received a single image-guided ICM injection of AAV1, AAV5, or AAVhu68 vectors, which express human GRN from a transgene designated hPGRN (SEQ ID NO:3) under the control of the chicken BA promoter and CMV IE enhancer (designated CB7 promoter). An additional group was treated with AAVhu68 vectors carrying a different engineered transgene sequence (hPGRN v2, SEQ ID NO:4) expressed from the ubiquitin C promoter (UbC). Human progranulin levels in the CSF were measured weekly, and 35 days after injection, animals were sacrificed for histopathology analysis. Preliminary safety analyses were performed and included daily cageside observations, a full physical examination, complete blood counts, serum chemistry panel, CSF chemistry and cytology, and a complete necropsy with microscopic evaluation of the brain and spinal cord. The treatment groups are summarized in the following table. [Table 4]

[0134] Robust PGRN expression was detected in the CSF of all NHPs after vector administration (Figure 7A). Two animals treated with the AAVhu68 vector showed CSF human PGRN levels up to 10-fold higher than the levels in healthy human controls, and GRN - / -The levels were similar to those seen in reversing lysosomal abnormalities in mouse brains. AAV5 treatment resulted in CSF expression levels nearly equivalent to AAVhu68. Expression of human PGRN was greatest in animals treated with AAV1 vectors, reaching more than 40-fold above normal human levels. Samples of CSF and plasma from NHPs treated with AAVhu68 and AAV1 vectors were tested for antibodies to human PGRN. All four animals expressed antibodies to the human transgene product (Figures 8A-C), which may explain the decline in expression levels at the end of the study. The onset of anti-human PGRN antibody responses in the CSF correlated with transgene expression levels, peaking earlier in the AAV1 group.

[0135] ICM delivery of AAV was well tolerated in all treatment groups, and no treatment-related abnormalities were identified on daily observations, physical examinations, complete blood counts, or serum chemistry panels. Similar to other ICM AAV studies utilizing heterologous transgenes (Hordeaux J, et al. Mol Ther Methods Clin Dev. 2018;10(79-88), CSF analysis revealed asymptomatic lymphocytosis beginning 7–21 days after injection for all vector serotypes, reflecting an antibody response to the transgene product (Figure 8A-C). CSF cell counts declined from peak levels but remained elevated at necropsy for most animals. Brain and spinal cord histopathology was evaluated for AAV1 and AAVhu68 treated groups. Findings were consistent with previous ICM AAV studies (Hordeaux J, et al. Mol Ther Methods Clin Dev. 2018;10:79-88, Hordeaux J, et al. Mol Ther Methods Clin Dev. 2018;10:68-78), with occasional minimal lymphocytic infiltration in the meninges and choroid plexus, and degeneration of sensory neurons and their associated axons in some dorsal root ganglia (DRG) and spinal cord sections. As with previous ICM AAV studies, the sensory neuron findings were typically minimal to mild in severity and without clinical signs (Gurda BL,et al. Molecular therapy:the journal of the American Society of Gene Therapy. 2016;24(2):206-16; Hordeaux J,et al. Mol Ther Methods Clin Dev. 2018;10:79-88; Hordeaux J,et al. Mol Ther Methods Clin Dev. 2018;10:68-78). No vector-associated abnormalities were noted in the brain parenchyma of any animal.

[0136] CNS transduction following ICM administration of AAV1 and AAVhu68 vectors in non-human primates Different patterns of entry The significantly higher PGRN expression in the CSF of NHPs treated with AAV1 vector prompted us to further explore the differences in transduction patterns of AAV1, AAV5, and AAVhu68 vectors. 13 A single ICM injection of GC (n = 2 per vector) was administered to NHPs. Animals were sacrificed 28 days after injection for histological analysis of brain transduction.

[0137] Immunohistochemistry revealed scattered patchy transduction throughout the brains of NHPs treated with AAV1 and AAVhu68 vectors (not shown). Minimal transduction was evident in the brains of animals that received AAV5 vectors. To more precisely characterize the differences in transduction between AAV1 and AAVhu68, we developed a semi-automated method to quantify transduced cells in sections collected from multiple brain regions. Using sections stained with GFP and fluorescently labeled antibodies against specific cell type markers, we quantified the total numbers of neurons, oligodendrocytes, and astrocytes, respectively, by staining for NeuN, olig2, and GFAP, followed by quantification of GFP-expressing cells of each type (Figure 9, Figure 10). AAV1 and AAVhu68 each transduced less than 1 percent of each cell type in all regions examined. Transduction of neurons was roughly equivalent between the two vectors, while AAVhu68 appeared to transduce slightly more astrocytes and oligodendrocytes.

[0138] The nearly equivalent brain transduction observed with AAV1 and AAVhu68 vectors was unexpected, given the dramatically higher CSF PGRN levels achieved with AAV1. Transduction of ependymal cells was assessed by immunohistochemistry in multiple regions of the lateral and fourth ventricles in AAVhu68-treated animals and in AAV1-treated animals, RA1826. Interestingly, multiple brain sections from an AAV1-treated animal (RA1826) showed widespread transduction of ependymal cells including parts of the ventricular system and lining the ventricles, which was not observed in any of the AAVhu68-treated animals (not shown). An average of 48% of ependymal cells were transduced across all sampled regions, including the anterior, lateral and posterior horns of the lateral ventricles and the fourth ventricle. In contrast, in the same brain regions in animals that received AAVhu68 vectors, only 1-2% of ependymal cells were transduced. Only a small segment of one lateral ventricle was assessable in the second AAV1-treated animal, showing transduction of approximately 1% of ependymal cells, but the analysis was limited to a small sampling area. These findings suggest that the highly transduced ependymal cells in AAV1-treated animals may be the source of high levels of PGRN in the CSF, given that transduction of other cell types appears to be similar between the two serotypes. Due to the bystander effect mediated by secreted PGRN, FTD caused by GRN mutations is exceptionally suitable for AAV gene therapy. The high CSF PGRN levels achieved with AAV1 vectors (apparently mediated by robust ependymal cell transduction) make AAV1 an ideal choice for GRN gene therapy, since extracellular PGRN can be taken up by neurons.

[0139] Example 4: Recombinant AAV1.PGRN rAAV1.PGRN is generated by triple plasmid transfection of HEK293 cells with 1) an AAV cis plasmid (designated pENN.AAV.CB7.CI.hPGRN.rBG.KanR) encoding a transgene cassette flanked by AAV ITRs, 2) an AAV trans plasmid (designated pAAV2 / 1.KanR) encoding the AAV2 rep and AAV1 cap genes, and 3) a helper adenovirus plasmid (designated pAdΔF6.KanR). The size of the vector genome packaged in rAAV1.PGRN is 4129 bases.

[0140] A. Sequence Elements of AAV Vector Genome Plasmids See Figure 2 for a linear map of the vector genome derived from the cis-plasmid (designated pENN.AAV.CB7.CI.hPGRN.rBG.KanR (p4862)).

[0141] The cis-plasmid contains the following vector genome sequence elements: 1. Inverted terminal repeats (ITRs): ITRs are reverse complement sequences identical to AAV2 (130 base pairs [bp], GenBank: NC_001401) that flank all elements of the vector genome. The ITR sequences function as both an origin of replication for vector DNA and a packaging signal for the vector genome when AAV and adenovirus helper functions are provided in trans. Thus, the ITR sequences represent the only cis sequences required for replication and packaging of the vector genome. 2. Human cytomegalovirus immediate early enhancer (CMV IE): This enhancer sequence, derived from human CMV (382 bp, GenBank: K03104.1), increases the expression of downstream transgenes. 3. Chicken β-actin promoter (BA): This ubiquitous promoter (282 bp, GenBank: X00182.1) was selected to drive transgene expression in any CNS cell type. 4. Chimeric intron (CI): The hybrid intron contains elements of chicken β-actin splice donor (973bp, GenBank:X00182.1) and rabbit β-globin splice acceptor. Introns are transcribed but, together with sequences at either end of them, are removed from the mature messenger RNA (mRNA) by splicing. The presence of introns in expression cassettes has been shown to facilitate mRNA transport from the nucleus to the cytoplasm, thereby enhancing the accumulation of a constant level of mRNA for translation. This is a common feature in genetic vectors intended to increase gene expression levels. 5. Coding sequence: The engineered cDNA of the human GRN gene encodes the human PGRN (hPGRN) protein, involved in lysosomal function and other nervous system roles (1785 bp, GenBank: NM_002087.3, 593 amino acids [aa], GenBank: NP_002078). 6. Rabbit β-globin polyadenylation signal (rBG PolyA): The rBG PolyA signal (127 bp, GenBank: V00882.1) promotes efficient polyadenylation of transgene mRNA in cis. This element functions as a signal for transcription termination, a specific cleavage event at the 3' end of the nascent transcript, and the addition of a long polyadenylation strand.

[0142] B. AAV1 transformer plasmid: pAAV2 / 1.KanR (p0069) The AAV2 / 1 transformer plasmid is pAAV2 / 1.KanR (p0069). The pAAV2 / 1.KanR plasmid is 8113 bp in length and encodes the four wild-type AAV2 replicase (Rep) proteins required for replication and packaging of the AAV vector genome. pAAV2 / 1.KanR also encodes the three wild-type AAV1 virion protein capsid (Cap) proteins, which assemble into the virion shell of AAV serotype 1 (AAV1) to accommodate the AAV vector genome. The AAV1 cap gene contained in pAAV2 / 1.KanR was isolated from a monkey source.

[0143] To generate the pAAV2 / 1.KanR construct, a 3.0 kilobase (kb) fragment from p5E18(2 / 2), a 2.3 kb fragment from pAV1H, and a 1.7 kb fragment from p5E18(2 / 2) were combined to form pAAV2 / 1(p0001), which contains the AAV2 rep and AAV1 cap in an ampicillin resistance (AmpR) cassette (referred to in the literature as p5E18[2 / 1]). In this cloning strategy, the AA The V p5 promoter (which normally drives rep expression) is moved from the 5' end of rep to the 3' end of cap, leaving a truncated p5 promoter upstream of rep. This truncated promoter serves to downregulate expression of rep and thus maximize vector production (Xiao et al., (1999) Gene therapy vectors based on adeno-associated virus type 1.J Virol.73(5):3994-4003).

[0144] To generate pAAV2 / 1.KanR for clinical product production, the ampicillin resistance (AmpR) gene in the backbone sequence of pAAV2 / 1 was replaced with the kanamycin resistance (KanR) gene. All components of the trans-plasmid were verified by direct sequencing.

[0145] C. Adenovirus helper plasmid: pAdDeltaF6(KanR) Plasmid pAdDeltaF6(KanR) was constructed in the laboratory of Dr. Jame M. Wilson and colleagues at the University of Pennsylvania and is 15,774 bp in size. This plasmid contains regions of the adenoviral genome important for AAV replication, namely E2A, E4, and VA RNAs (the function of adenoviral E1 is provided by HEK293 cells). However, this plasmid does not contain other adenoviral replication or structural genes. The plasmid does not contain cis elements important for replication, such as the adenoviral ITRs, and therefore, infectious adenovirus is not expected to be produced. The plasmid was derived from an E1, E3 deleted molecular clone of Ad5 (pBHG10, a pBR322-based plasmid). Deletions were introduced into Ad5 to eliminate expression of unnecessary adenoviral genes and to reduce the amount of adenoviral DNA (from 32 kb to 12 kb). Finally, the ampicillin resistance gene was replaced by the kanamycin resistance gene to generate pAdeltaF6(KanR). The adenoviral genes E2, E4, and VAI remaining in this plasmid, along with E1 present in HEK293 cells, are necessary for AAV vector production. The vector is generated according to the following flow chart shown in Figure 13 and Figure 14.

[0146] The final product is USP <791> pH in the range of 6.2 to 7.7 as determined by USP <785> Osmolarity of 260-320 mOsm / kg as determined by , and 2.5 × 10 as determined by ddPCR 13 The GC titer must be ≥ GC / mL (Lock et al., (2014). “Absolute determination of single-stranded and self-complementary adeno-associated viral vector genome titers by droplet digital PCR.” Hum Gene Ther Methods. 25(2):115-25.

[0147] Example 5: GRN - / -Identifying the minimal effective dose of rAAV1.PGRN in mice [Table 5]

[0148] Grn - / - The impact of different doses of rAAV1.PGRN on CNS pathology in a mouse model is evaluated as follows. Efficacy is assessed by the degree of reduction in brain accumulation pathology (lipofuscin), which serves as a quantitative outcome measure directly related to disease pathophysiology. In addition, a terminal blood draw for complete blood count and serum chemistry panel, as well as target organ histopathology, are included to identify disease-specific toxicities that may not be detected in NHP toxicity studies. Mice are treated at 5-6 months of age, when widespread lipofuscin accumulation is present, to recapitulate the disease state in older subjects with GRN haploinsufficiency. Grn - / - Mice were administered four doses of rAAV1.PGRN (1.30x10 11 GC, 4.40x10 10 GC, 1.30x10 10 GC, or 4.40x10 9 Grn treated with vehicle (N=15) or vehicle (ITFFB [artificial CSF containing 0.001% Pluronic F-68]) + / + Mice serve as normal controls. After 90 days of treatment, animals are sacrificed, brains harvested, sectioned, and lipofuscin lesions quantified. MED is the mean ± SD of vehicle-treated Grn mice. - / - The dose showing a significant reduction in brain accumulation lesions compared to non-treated mice was determined. Significance was determined using one-way ANOVA followed by Tukey's multiple comparison test (α=0.05) where appropriate.

[0149] Example 6: Toxicity studies in non-human primates rAAV1.CB7.CI.hPGRN.rBG is a non-replicating recombinant adeno-associated (AAV) vector consisting of serotype AAV1, which contains an engineered human progranulin (PGRN) cDNA under the control of a chicken beta-actin promoter with a cytomegalovirus enhancer and a rabbit beta-globin polyadenylation sequence flanked by AAV serotype 2 inverted terminal repeats, and was formulated in intrathecal final formulation buffer (ITFFB). The ddPCR titer was 2.04 x 10 13 The dilution was 100% GC / mL. The pH of the ITFFB was adjusted to pH 7.4 to maximize solubility of the test article product. The control article was prepared on the day of dosing. The diluted article was kept on wet ice or at 2-8°C until dosing on the same day.

[0150] A 90-day GLP-compliant safety study was conducted in adult rhesus monkeys to investigate the toxicity of rAAV1.PGRN following ICM administration. NHPs aged 3-10 years were utilized for this study as this age represents the intended adult human patient population. The 90-day evaluation period was selected to allow sufficient time for the secreted transgene product to reach stable steady-state levels following AAV administration of the ICM. Rhesus monkeys were administered three dose levels, a total of 3.00 × 10 12 GC, total 1.00×10 13 GC, or 3.00 x 10 in total 13 Animals received one dose level of rAAV1.hPGRN or vehicle (ITFFB, N=2) in GC (N=3 per dose). Dose levels were selected to be equivalent to those evaluated in the planned minimal effective dose (MED) studies when scaled by brain mass (assuming 0.4 g in mice and 90 g in rhesus monkeys). Baseline neurological examinations, clinical pathology (cell counts with differential, clinical chemistry, and coagulation panel), CSF chemistry, and CSF cytology were performed. Following administration of rAAV1.PGRN or vehicle, animals were monitored daily for signs of distress and abnormal behavior.

[0151] Blood and CSF clinical pathology evaluations and neurological examinations were performed weekly for 30 days after rAAV1.PGRN or vehicle administration and every 30 days thereafter. At baseline and every 30 days thereafter, anti-AAV1 neutralizing antibody (Nab) and cytotoxic T lymphocyte (CTL) responses to AAV1 and rAAV1.PGRN transgene products were assessed by enzyme-linked immunospot (ELISpot) assays for interferon-γ (IFN-γ). [Table 6] [Table 7]

[0152] Ninety days after rAAV1.PGRN or vehicle administration, animals were euthanized and tissues were harvested for comprehensive microscopic histopathological examination. In addition, lymphocytes were harvested from the liver, spleen, and bone marrow to assess the presence of T cells reactive to both the capsid and the transgene product in these organs at necropsy.

[0153] Vector biodistribution was assessed by qPCR in tissue samples. Vector genomes were also quantified in serum and CSF samples. Vector excretion was assessed by analysis of vector genomes detected in urine and feces. Previous studies have demonstrated that the pattern of vector distribution after ICM administration was dose-independent, with higher vector doses resulting in greater overall signal in qPCR-based biodistribution assays and the highest sensitivity in detecting vector deposition in target tissues. Therefore, these analyses were only performed on the highest dose cohort (Hordeaux et al., 2018b).

[0154] Nerve conduction velocity assessment Animals were sedated with a ketamine / dexmedetomidine combination. Sedated animals were placed on the operating table in lateral or supine position and body temperature was maintained with heat packs. Electronic warming devices were not recommended as they may interfere with the acquisition of electrical signals.

[0155] For sensory nerve conduction studies (NCS), the stimulator probe was positioned on the median nerve with the cathode closest to the recording site, and two needle electrodes were inserted subcutaneously at the level of the distal phalanges of the second digit (reference electrode) and the proximal phalanges (recording electrode), while a ground electrode was placed proximal to the stimulator probe (cathode). A pediatric stimulator was used. Evoked responses were differentially amplified and displayed on a monitor. The initial acquisition stimulation intensity was set to 0.0 mA to ensure the absence of background electrical signals. To find the optimal stimulation position, the stimulation intensity was increased up to 10.0 mA and the probe was moved along the median nerve, generating a train of stimuli until the optimal position was found, as judged by a definitive waveform. While keeping the probe in the optimal position, the stimulation intensity was gradually increased in steps until no more peak amplitude responses were observed. Each stimulation response was recorded and stored in the software. Up to 10 maximum stimuli were averaged and reported for the median nerve. The distance (cm) from the recording site to the stimulation cathode was measured and entered into the software, and the onset latency of the response and distance (cm) were used to calculate conduction velocity. Both conduction velocity and mean sensory nerve action potential (SNAP) amplitude were reported. Both median nerves were tested. All raw data generated by the device were retained as part of the study materials.

[0156] Figures 11A and 11B show the results of median sensory nerve conduction studies in NHPs. No effects on median sensory nerve conduction were observed at the doses administered. Preliminary histological analysis showed findings primarily within the dorsal white matter tracts of the DRG, TRG, spinal cord and peripheral nerves (Figures 12A-D). These findings consisted of neuronal degeneration within the DRG / TRG and axonal degeneration (i.e., axonopathy) within the dorsal white matter tracts of the spinal cord and peripheral nerves. Overall, these findings were observed across all treatment groups, although there was a trend toward a higher incidence and severity in individual animals in the mid- and high-dose groups at both time points.

[0157] Given the severity of GRN-associated neurodegenerative disease, it is anticipated that the benefit / risk profile of ICM administration of rAAV1.PGRN will remain favorable.

[0158] Example 7: Human Trials We will conduct a first-in-human (FIH) Phase 1 / 2 dose-escalation study of a single dose of rAAV1.hPGRN in patients with adult-onset neurodegenerative disease caused by mutations in the GRN gene (see table below). rAAV1.hPGRN will be designed to replace the GRN gene. This FIH study will evaluate safety and tolerability and gather preliminary data on efficacy. Up to 12 symptomatic heterozygous GRN mutation carrier patients will be treated with rAAV1.hPGRN and followed initially over a period of 2 years (24 months), with continued long-term follow-up for 5 years post-dosing. This study will provide data to support the initiation of a registrational trial and will utilize the Phase 1 / 2 maximum tolerated dose (MTD). This registrational trial will evaluate the effect of rAAV1.hPGRN on clinical outcomes and biomarkers associated with the disease. All studies will involve administration of a single ICM dose of rAAV1.hPGRN in adult patients with GRN-associated neurodegenerative disease. [Table 8-1] [Table 8-2] [Table 8-3] [Table 8-4]

[0159] Route of Administration and Treatment rAAV1.hPGRN will be administered to subjects as a single dose via CT-guided suboccipital injection into the cisterna magna on Day 1. On Day 1, a syringe containing 5.6 mL of rAAV1.hPGRN at the appropriate strength will be prepared by the Investigational Pharmacy associated with the study and delivered to the procedure room.

[0160] Prior to administration of the study drug, subjects are anesthetized, intubated, and the injection site is prepared and draped using aseptic technique. An LP is performed to remove a predetermined volume of CSF, followed by Iodinated contrast is injected intrathecally (IT) to aid in visualization of relevant anatomical structures in the cisterna magna. Intravenous (IV) contrast may be administered prior to or during needle puncture as an alternative to IT contrast. The decision to use IV or IT contrast is left to the discretion of the interventionalist. Under fluoroscopic guidance, a spinal needle (22-25 G) is advanced into the cisterna magna. A larger introducer needle may be used to aid in needle placement. After needle placement is confirmed, an extension set is attached to the spinal needle and filled with CSF. At the interventionalist's discretion, a syringe containing contrast may be connected to the extension set, and a small volume may be injected to confirm needle placement in the cisterna magna. After needle placement is confirmed, the syringe containing rAAV1.hPGRN is connected to the extension set. The contents of the syringe are slowly injected over 1-2 minutes to deliver a volume of 5.0 mL.

[0161] Safety assessments, including collection of adverse events (AEs), physical / neurological examinations, vital signs, laboratory tests (serum chemistry, hematology, coagulation, LFTs, urinalysis), ECG, nerve conduction studies, and CSF cytology and chemistry tests (cell counts, protein, glucose), will be performed at the indicated times on the study schedule.

[0162] No statistical comparisons were planned for safety evaluation. All results are descriptive only. Data will be listed and summary tables will be prepared.

[0163] Statistical comparisons will be performed for secondary and exploratory endpoints. Measurements at each time point will be compared with baseline values ​​for each subject, as well as natural history data from healthy volunteers and GRN patients with comparable cohort characteristics, when available for each endpoint. All data are presented in the subject data table. Categorical variables will be summarized using frequencies and percentages, and continuous variables will be summarized using descriptive statistics (number of non-missed observations, mean, standard deviation, median, minimum, and maximum). Graphical representations will be presented as appropriate.

[0164] The early clinical manifestations of adult-onset neurodegeneration caused by GRN haploinsufficiency are heterogeneous. This heterogeneity results in a variety of diagnoses with additional symptoms appearing as the disease progresses. After the onset of symptoms, patients typically decline rapidly, so patients with any diagnosis of neurodegeneration can be treated as long as they have a confirmed pathogenic heterozygous GRN mutation. The CDR-FTLD global score may be utilized to screen patients. This rating scale is designed to assess disease severity in patients with an FTLD spectrum diagnosis. The overlap of FTLD-related symptoms with other GRN-related diagnoses, and the number of domains captured in the CDR-FTLD global score (memory, orientation, judgment and problem solving, social adaptation, home situation and hobbies, caregiving situation, behavior, and language) allow this scale to be used for diagnosis. A CDR-FTLD global score greater than 0.5 (including patients with mild symptoms) and less than or equal to 1 would allow treatment of symptomatic patients at an early stage of neurodegeneration, when the benefits of gene therapy are likely to be maximized. Treating patients at this early stage allows for detection of subsequent changes or stabilization of disease progression and delayed onset of additional symptoms.However, in this population, the requirement of a minimum CDR-FTLD global score of 0.5 precludes entry into a motor-specific diagnosis as the scale is not optimized to capture impairments in the motor phenotype.

[0165] It is anticipated that this gene therapy will not result in expression of PGRN above physiological levels. Using doses of rAAV1.hPGRN in the non-clinical NHP study (higher than those used in the FIH trial), PGRN was found to be expressed in serum at near-normal levels following ICM administration of rAAV1.hPGRN. Subjects enrolled in the FIH trial initially had circulating PGRN levels approximately 30% of normal, and it is anticipated that circulating serum PGRN levels may return to normal. Patient blood tests included complete blood count (CB C) Screened through the panel, patients are monitored for tumors via gadolinium-enhanced MRI of the brain and upper spine at 5-year follow-up.

[0166] In addition to measuring safety and tolerability as the primary endpoints, secondary and exploratory efficacy endpoints were selected for this study based on recent literature and in consultation with leading clinicians specializing in the study of GRN-related neurodegeneration. These endpoints will track clinical outcomes and disease biomarkers with the goal of identifying appropriate endpoints for subsequent registrational trials.

[0167] Because neurodegeneration caused by GRN mutations ultimately leads to death, the effect of rAAV1.hPGRN on patient survival is also an efficacy endpoint of this study. However, because most patients have a median life expectancy of 7–11 years from symptom onset, the study duration and sample size may not be sufficient to demonstrate a survival benefit.

[0168] The effect of rAAV1.hPGRN on clinical symptoms and daily functioning of patients will be evaluated. Due to the heterogeneity of the phenotypes exhibited by the target patient population, functional and clinical measures will be used that capture the progression of symptoms expressed across the range of clinical symptoms. The proposed study will utilize the FAB, FRS, MMSE, CGI-C, NPI, and FBI to measure change over time. These measures primarily measure abilities related to cognition, language, neuropsychological behavior, and daily functioning that provide information on the progression or stabilization of various clinical symptoms of the disease. The UPDRS has also been included to capture changes in motor symptoms. At FIH, these efficacy assessments are exploratory in nature and are intended to capture the ability of rAAV.hPGRN to stabilize symptom reduction over time. Data from FIH on the rate of further decline across various clinical parameters in patients with various clinical symptoms will be used to further inform the selection of appropriate endpoints and define clinically meaningful changes for the registration trial.

[0169] Each clinical scale is briefly described below. Clinical measures primarily measuring cognitive function CDR-FTLD: The CDR-FTLD is an extension of the classic Clinical Dementia Rating (CDR) scale historically used to assess the severity of AD spectrum disorders. The assessment includes the original six domains of the CDR (memory, orientation, judgment and problem solving, social adaptation, home situation and hobbies, and caregiving situation). It also includes two additional domains, language and behavior, which allow for the detection of decline in FTLD spectrum patients with higher sensitivity. A rating score of 0 indicates normal behavior or language, while a score of 1, 2, or 3 indicates mild to severe impairment. The CDR-FTLD scale sum (CDR-FTLD sb) represents the sum of the individual domains and is used to determine the overall dementia severity.

[0170] MMSE: The MMSE is an 11-question global cognitive assessment that is widely used in clinical and research practice. Questions include, "What year is it? What season? What date? What day of the week? What month?", with one point awarded for each correct answer and a maximum score for each question. The total score is capped at 30 points, with two cutoffs, 24 and 27 points. These cutoffs are indicators of cognitive decline.

[0171] Verbal fluency testing: Although not one of the proposed exploratory efficacy endpoints, verbal fluency testing will be administered throughout the FIH study. This could be done by presenting identical pictures to each subject and asking for a verbal description. During the description, speech rate (words / min) will be counted, recorded, and ultimately compared to a rate that reflects neurotypical adults.

[0172] Clinical measures primarily measuring motor function UPDRS: The UPDRS is a 42-item, 4-part assessment of several domains relevant to parkinsonism, including mental status, behavior and mood, and activities of daily living. Each item contains a rating scale ranging from 0 (indicating no impairment) to 4 (indicating the most severe impairment). Scores for each part are summed to provide a measure of disease severity, with a high score of 199 indicating the worst / most severe impairment.

[0173] Clinical scales that primarily measure behavior NPI: The NPI is used to elucidate the presence of psychopathology in patients with brain disorders. Initially, it was developed for use in AD populations, but it is considered useful for evaluating behavioral changes in other conditions. The assessment consists of 10 behavioral and 2 autonomic domains, among which there are 4 scores: frequency, severity, overall burden, and caregiver burden. The total score of the NPI is obtained by adding the domain scores of the behavioral domains and subtracting the score of caregiver burden.

[0174] FBI: The FBI is a 24-item assessment of behavioral and personality changes specifically related to bvFTD and distinguishes between bvFTD and other dementias. It is administered as a face-to-face interview with the primary caregiver, as patients diagnosed with bvFTD generally have no awareness of these types of changes. It focuses on several areas related to behavior and personality, with each question scored from 0 (none) to 3 (severe / most of the time). The total score typically correlates with disease severity and can be used to assess change over time.

[0175] Clinical measures of both cognitive and motor function CGI-C: The CGI-C is one of three brief, widely used assessments. It consists of three items and is rated by a clinician. The CGI-C is rated on a 7-point scale ranging from 1 (very improved) to 7 (very worse) beginning with enrollment in the study, regardless of whether the improvement is entirely due to treatment.

[0176] FAB: The FAB is a brief assessment to aid in the differentiation between frontal executive dysfunction phenotype dementia and AD dementia. It is particularly useful in mildly demented patients (MMSE>24). The assessment consists of 6 parts, addressing cognitive, motor, and behavioral domains. A total score of 18 or higher indicates better performance.

[0177] FDR: The FDR is a simple staging assessment for patients diagnosed with frontotemporal dementia (FTD) ab type (i.e., either bvFTD or PPA subtype). The FDR detects differences in disease progression of FTD over time. This brief interview is administered with the primary caregiver and consists of 30 items, categorized as "never," "sometimes," or "always." A percentage score is then calculated and converted to a logit score and, ultimately, a severity score. Severity scores range from "very mild" to "very severe."

[0178] Columbia Suicide Severity Rating Scale (C-SSRS): Although the C-SSRS score is not an exploratory efficacy endpoint of the FIH, this assessment will be conducted across studies. The C-SSRS is a three-part scale that measures suicidal ideation, ideation intensity, and suicidal behavior. The outcomes of this assessment consist of a suicidal behavior lethality rating, which is taken directly from the scale, a suicide ideation score, and a suicidal ideation intensity rating. Ideation scores above 0 may indicate the need for intervention based on assessment guidelines. Intensity ratings range from 0 to 25, with 0 representing no endorsement of suicidal ideation.

[0179] As an additional exploratory endpoint, patient survival will be evaluated. However, patients diagnosed with neurodegeneration due to GRN haploinsufficiency have a median life expectancy of 7-11 years from the onset of symptoms. Therefore, the study duration, sample size, and inclusion of subjects who are in the early stages of the disease may not be sufficient to demonstrate a survival benefit.

[0180] Administration of rAAV1.hPGRN reduces atrophy (loss of neural cells) caused by GRN-associated haploinsufficiency, primarily in the frontal and temporal cortex, and stabilizes whole brain volume over time. MRI can be used to track changes in thickness of the medial frontal cortex and parietal regions.

[0181] Biochemical biomarkers will also be evaluated. Levels of PGRN protein in CSF and plasma will be measured as a readout of AAV transduction and are increased in patients following administration of rAAV1.hPGRN. CSF levels of neurofilament light chain (NFL), tau, phosphorylated tau, and other inflammatory markers will also be tracked. NFL is considered a general indicator of neuronal loss or damage. Tau and phosphorylated tau are associated with pathology seen in AD, PD, and some forms of FTD.

[0182] Patients' blood work will be screened through a complete blood count (CBC) panel, and patients will be monitored for tumors via gadolinium-enhanced MRI of the brain and upper spine at the 5-year follow-up.

[0183] A single dose of rAAV1.hPGRN is safe and well tolerated after administration. A single dose of rAAV1.hPGRN improves survival and / or reduces disease progression as assessed by clinical symptoms and daily functioning of patients. Treatment slows the loss of neurocognitive function.

[0184] (Sequence Listing Free Text) The following information is a numeric identifier <223> Below, sequences including free text are provided. [Table 9-1] [Table 9-2] [Table 9-3]

[0185] All documents cited herein are incorporated herein by reference. U.S. Provisional Patent Application No. 62 / 809,329, filed February 22, 2019, U.S. Provisional Patent Application No. 62 / 923,812, filed October 21, 2019, and U.S. Provisional Patent Application No. 62 / 969,108, filed February 2, 2020, are incorporated by reference in their entirety, together with their sequence listings. Similarly, the sequence listing filed herewith under the name "18-8663PCT_ST25.txt", and the sequences and text therein, are incorporated by reference. The present invention has been described with reference to certain embodiments, but it will be understood that modifications can be made without departing from the spirit of the invention. Such modifications are intended to be within the scope of the appended claims.

Claims

1. A recombinant adeno-associated virus (AAV), comprising: (a) an AAV1 capsid; (b) a vector genome packaged in the AAV1 capsid, the vector genome comprising an AAV inverted terminal repeat (ITR), a coding sequence for human progranulin, and a regulatory sequence operably linked to the coding sequence; The coding sequence is at least 95% identical to SEQ ID NO:3, which encodes the amino acid sequence of SEQ ID NO:

1. Recombinant AAV.

2. A recombinant adeno-associated virus (AAV), comprising: (a) an AAV1 capsid; (b) a vector genome packaged in the AAV1 capsid, the vector genome comprising an AAV inverted terminal repeat (ITR), a coding sequence for human progranulin having the amino acid sequence of SEQ ID NO:1, and a regulatory sequence comprising a CB7 promoter operably linked to the coding sequence; Recombinant AAV.

3. 1. A pharmaceutical composition comprising an aqueous liquid suitable for intrathecal administration and a recombinant AAV suitable for use in treating neurodegeneration in a human patient, said recombinant AAV comprising: (a) an AAV1 capsid; (b) a vector genome packaged in the AAV1 capsid, the vector genome comprising an AAV inverted terminal repeat (ITR), a coding sequence for human progranulin, and a regulatory sequence operably linked to the coding sequence; The coding sequence is at least 95% identical to SEQ ID NO:3, which encodes the amino acid sequence of SEQ ID NO:

1. Pharmaceutical compositions.

4. A pharmaceutical composition comprising an aqueous liquid suitable for intrathecal administration and a recombinant AAV suitable for use in treating neurodegeneration in a human patient, said recombinant AAV being: (a) an AAV1 capsid; (b) a vector genome packaged in the AAV1 capsid, the vector genome comprising an AAV inverted terminal repeat (ITR), a coding sequence for human progranulin having the amino acid sequence of SEQ ID NO:1, and a regulatory sequence comprising a CB7 promoter operably linked to the coding sequence; Pharmaceutical compositions.

5. 5. The recombinant AAV of claim 1 or 2 or the pharmaceutical composition of claim 3 or 4, wherein the coding sequence of human progranulin is SEQ ID NO: 3 or a sequence at least 99% identical thereto.

6. The regulatory sequence is (i) an enhancer sequence comprising SEQ ID NO:9; (ii) a CB7 promoter sequence comprising SEQ ID NO:10; (iii) an intron sequence comprising SEQ ID NO:11; and (iv) a polyadenylation signal sequence comprising SEQ ID NO:6 6. A recombinant AAV according to claim 1, 2 or 5, or a pharmaceutical composition according to claim 3, 4 or 5, comprising:

7. The recombinant AAV of claim 6 or the pharmaceutical composition of claim 6, wherein the AAV ITRs are AAV2 5'ITR and AAV2 3'ITR, which flank the coding and regulatory sequences of human Progranulin.

8. 5. The recombinant AAV of claim 1 or 2 or the pharmaceutical composition of claim 3 or 4, wherein the vector genome comprises the sequence of SEQ ID NO:

24.

9. The pharmaceutical composition of claim 8 , wherein the composition comprises an artificial cerebrospinal fluid comprising a surfactant.

10. 10. The pharmaceutical composition of claim 9, wherein the surfactant is poloxamer 188.

11. A recombinant AAV according to claim 8 or a pharmaceutical composition according to claim 10 for use in a method for treating a patient with adult-onset neurodegeneration.

12. A recombinant AAV according to any one of claims 1, 2 or 5-8 or a pharmaceutical composition according to any one of claims 3-10 for use in a method of treating a human patient with adult-onset neurodegeneration caused by GRN-haploinsufficiency, the method comprising delivering the recombinant AAV or the pharmaceutical composition to the central nervous system (CNS) of the patient, optionally wherein the recombinant AAV targets ependymal cells and the regulatory sequence directs expression of the Progranulin in the ependymal cells.

13. A recombinant AAV according to any one of claims 1, 2 or 5-8, or a pharmaceutical composition according to claims 3-10, for use in a method of treating a human patient having a brain pathology associated with adult-onset neurodegeneration caused by granulin (GRN) haploinsufficiency, said method comprising administering said recombinant AAV or said pharmaceutical composition to the CNS of said patient.

14. A recombinant AAV according to claims 1, 2 or 5 to 8 or a pharmaceutical composition according to claims 3 to 10 for the use according to any one of claims 11 to 13, (a) the patient receives 1 x 10 of the recombinant AAV 10 Genome copies (GC) / g brain mass ∼3.33 × 10 11 A dose of 100 GC / g brain mass is administered intrathecally, or (b) the patient is an adult human and receives 1.44 x 10 of the recombinant AAV 13 ~4.33 x 10 14 Administer a dose of GC; Recombinant AAV or pharmaceutical composition.

15. The recombinant AAV of claims 1, 2 or 5-8 or the pharmaceutical composition of claims 3-10 for use according to any one of claims 11 to 14, further comprising one or more of: (a) non-invasively assessing the patient for reduction in retinal storage pathology as a predictor of reduction in brain pathology; (b) performing magnetic resonance imaging to assess brain volume; and / or (c) measuring the concentration of progranulin in the cerebrospinal fluid of the patient.

16. A recombinant AAV according to claims 1, 2 or 5 to 8 or a pharmaceutical composition according to claims 3 to 10 for the use according to any one of claims 11 to 15, (a) the recombinant AAV comprising the coding sequence for Progranulin is delivered intrathecally via intracerebroventricular delivery or via intraparenchymal delivery; or (b) the recombinant AAV is administered as a single dose via computed tomography (CT)-guided suboccipital injection into the cisterna magna (intracisternal); Recombinant AAV or pharmaceutical composition.

17. The recombinant AAV of claims 1, 2 or 5-8 or the pharmaceutical composition of claims 3-10 for use according to any one of claims 11 to 16, wherein the patient has progranulin-associated frontotemporal dementia (FTD).

Images