Use of the rice OsCKX3 gene in regulating leaf angle in rice

Abstract

To provide the use of the rice cytokinin oxidase OsCKX3 gene in regulation of rice leaf angles.SOLUTION: The invention discloses applications for the rice gene OsCKX3 or a protein coded by the rice gene OsCKX3 in the improvement of rice crops. It is used for regulating rice leaf pillow development and leaf angles, thereby improving rice plant types and increasing rice yield.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] The present invention relates to the technical field of plant genetic engineering, and in particular to the use of rice OsCKX3 gene in regulating leaf angle in rice. [Background technology]

[0002] At present, China's total annual grain production exceeds 660 million tons, of which rice production accounts for about 32%. However, with China's growing population and improving living standards, people's demand for grain production is increasing more and more. In the current situation where the cultivated land area remains unchanged, scientists need to develop new varieties with high yields and high quality to significantly increase grain production, especially rice production. Leaf angle refers to the inclination angle between the leaf and the stem, which greatly affects the light-receiving area of ​​rice and is an important factor in forming an ideal plant type, playing an important role in crop cultivation. Upright leaves are suitable for dense planting, which can reduce mutual shading between plants, increase photosynthetic efficiency, and increase crop yields (Tong and Chu, 2018). The magnitude of the leaf angle is mainly controlled by the pulvinus, and the leaf inclination angle changes due to cell division and elongation during the development of the pulvinus (Feng et al., 2016).

[0003] Plant hormones play an important role in regulating leaf angle. Brassinosteroids (BR), gibberellic acid (GA), and auxin (IAA) have all been found to be involved in the formation of leaf angle (Tong and Chu, 2018; Duan et al., 2019). Cytokinin (CK) is one of the important hormones that regulate crop morphology, physiology, and yield, and is closely related to stem cell division, panicle development, plant type, nitrogen fertilizer use, environmental stress, etc. (Hwang et al., 2012; Wang et al., 2018; Yang et al., 2021). However, the molecular mechanism of CK regulating leaf angle has not yet been reported. As a key enzyme regulating CK levels, cytokinin oxidase / cytokinin dehydrogenase (CKX) catalyzes the oxidative decomposition of CK to generate adenine and side chains, completely inactivating CK (Ashikari et al., 2005). CKX plays an important role in regulating CK activity levels. Reduction of CKX gene expression can significantly increase CK content and promote apical meristem formation. The number of flowers, pods, and seeds in Arabidopsis CKX3CKX5 double mutants was significantly increased, and the number of seeds increased by more than 50% (Bartrina et al., 2011). In rice CKX2 and DST (OsCKX2 positive regulator) mutants, CK content was significantly increased and the number of grains per panicle increased by more than 20% (Ashikari, 2005; Li et al., 2013). Rice OsCKX9 is involved in the strigolactone (SL) signaling pathway via D53 and controls rice tiller bud development (Duan et al., 2019). Rice CKX11 is involved in the ABA metabolic pathway and controls leaf senescence (Zhang et al., 2021). Rice OsCKX4 is also involved in the control of Zn uptake (Gao et al., 2019).CK and CKX genes have been identified to be involved in apical meristem development, root development, leaf senescence and tiller bud development in rice. However, the mechanism of CKX regulating leaf angle formation and its application have not yet been investigated. Summary of the Invention [Problem to be solved by the invention]

[0004] The technical problem to be solved by the present invention is to provide a use of the rice cytokinin oxidase OsCKX3 gene in regulating rice leaf angle. [Means for solving the problem]

[0005] To solve the above technical problems, the present invention provides a use of rice gene OsCKX3 or the protein encoded thereby in rice crop improvement, namely, regulating rice leaf angle.

[0006] The improvement of the use of the present invention is to regulate the development of pulvinus and leaf angle of rice, improve rice varieties, and increase rice yield.

[0007] In a further refinement of the use of the present invention, the nucleotide sequence of the rice gene OsCKX3 is as shown in SEQ ID NO: 1. It also includes a complementary nucleotide sequence, a homologous nucleotide sequence, or a nucleotide sequence having the same function formed by inserting or mutating some nucleotides in the sequence.

[0008] In a further refinement of the use of the present invention, the amino acid sequence encoded by the gene OsCKX3 is as shown in SEQ ID NO:2.

[0009] As a further improvement of the use of the present invention, knocking out the OsCKX3 gene results in smaller leaf angle and larger rice grains.

[0010] In a further improvement of the use of the present invention, overexpression of OsCKX3 increases leaf angle in rice.

[0011] In a further refinement of the use of the present invention, the nucleotide sequence of the OsCKX3 mutant is as set forth in any of SEQ ID NO:4 to SEQ ID NO:5.

[0012] The present invention also provides a use of a gRNA target sequence for editing rice OsCKX3 gene in controlling plant leaf angle, the gRNA target sequence being located at positions 332 to 351 of the CDS sense strand of rice OsCKX3 gene, and its nucleotide sequence is as shown in SEQ ID NO: 3.

[0013] This invention proposes a positive regulator of leaf angle in rice and its use, and a reverse genetics approach was used to screen for OsCKX3 gene, which regulates leaf angle size by participating in cell division and growth of rice pulvinus tissue. This invention studies the molecular biological functions and uses of genes that regulate leaf angle in rice, and provides potential new genetic resources for breeding new densely planted high-yielding rice varieties.

[0014] The present invention provides a positive regulator for controlling leaf angle in rice, which is gene OsCKX3, whose nucleotide sequence is as shown in SEQ ID NO: 1 and whose amino acid sequence is as shown in SEQ ID NO: 2. The use of rice OsCKX3 gene in controlling leaf angle in plants is specifically as follows: OsCKX3 gene regulates the development of pulvinus by regulating the asymmetric growth of pulvinus cells to regulate the formation of leaf angle in rice.

[0015] The technical solution of the present invention is realized as follows. In the present invention, by screening 11 OsCKX gene mutants, it was found that the OsCKX3 mutant had a significantly smaller leaf angle, and all the patterns of rice leaf angle at different developmental stages demonstrated that OsCKX3 regulates the size of the leaf angle.

[0016] In this study, a CRISPR / CAS9 vector for OsCKX3 was constructed and introduced into Nipponbare by Agrobacterium-mediated method to knock out the OsCKX3 gene, and the leaf angle of the resulting knockout mutant was significantly reduced. Therefore, this method can increase the cytokinin content in pulvinus tissue, increase the number of pulvinus cell layers, reduce the leaf angle, improve the plant type and planting density of rice, and increase the yield. Effect of the Invention

[0017] Compared with the prior art, the present invention has the following beneficial effects: 1. The OsCKX3 gene can alter the leaf angle of crop plants without compromising other yield traits, and create rice breeding materials with compact plant size and small leaf angle, which has important practical significance for rice breeding.

[0018] 2. The OsCKX3 gene is an effective gene for changing the leaf angle, and by changing the number of cell layers and vascular bundles in the pulvinus, the leaf angle of rice can be changed.

[0019] 3. Currently, there are no reports of genes that regulate leaf angle by cytokinin, and it has been revealed that the gene of the present invention is involved in regulating leaf angle by controlling the cytokinin content in the pulvinus.

[0020] The discovery of OsCKX3 and its use in the present invention to regulate leaf angle fills the gap in the technology regarding CKs regulating leaf angle and provides a gene with potential application value for improving rice planting density and increasing rice yield.

[0021] It should be noted that there is no relationship between promoting an increase in cytokinin content and regulating the leaf angle in rice. For example, although the currently known OsCKX2 and OsCKX11 genes both have the function of promoting an increase in cytokinin content, there have been no reports on their correlation with the leaf angle in rice.

[0022] To summarize the above, the present invention relates to the field of plant genetic engineering, and in particular to the use of rice cytokinin oxidase OsCKX3 gene in regulating plant leaf angle. The present invention uses CRISPR / CAS9 technology to knock out the Nipponbare rice gene OsCKX3, and uses transgenic technology to obtain OsCKX3 overexpression material. Compared with the wild type, the leaf angle of the mutant is greatly reduced and the plant type becomes more upright, while the leaf angle of the overexpression material is greatly increased. Hormonal analysis showed that the cytokinin content of the mutant was significantly increased. In addition, cytological structure observation of the pulvinus showed that the number of cell layers and vascular bundles at the adaxial and abaxial ends of the pulvinus of the mutant was significantly increased. It was shown that the cytokinin increased the cell number and changed the formation of the leaf angle. Analysis of agronomic traits showed that the rice grain size of the mutant was significantly increased, and the grain size of the overexpression material was significantly smaller. Therefore, by knocking out the OsCKX3 gene using recombinant gene technology, it is possible to change the angle at which rice leaves form and the size of rice grains, thereby improving plant shape and planting density and increasing yields. [Brief description of the drawings]

[0023] [Figure 1] FIG. 1 shows a diagram illustrating the construction of an OsCKX3 mutant according to an embodiment of the present invention and a diagram illustrating the expression level of the OsCKX3 gene in overexpression materials. FIG. A shows the OsCKX3 gene structure and CRISPR target, FIG. B shows the mutation site of the OsCKX3 gene, and FIG. C shows the expression level of the OsCKX3 gene in OsCKX3 overexpression materials. [Diagram 2]Figure 1 shows the phenotypes of the wild type (WT), OsCKX3 mutant and OsCKX3 overexpressing materials of the present invention after 10 days (A) and 90 days (B) of growth, and Figures C and D show the statistical data of leaf angles for Figures A and B, respectively. [Diagram 3] FIG. 1 shows the phenotypes of the adaxial and abaxial ends of the pulvinus of the wild type (WT), OsCKX3 mutant, and OsCKX3 overexpressing material according to an embodiment of the present invention. Figures A to C show the cross-section structures of the pulvinus of the WT (A), OsCKX3 mutant (B), and OsCKX3 overexpressing material (C). Figures D to F show the adaxial end structures of the pulvinus of the WT (D), OsCKX3 mutant (E), and OsCKX3 overexpressing material (F). Figures G to I show the phenotypes of the WT (G) shows the abaxial end structure of the pulvinus of the OsCKX3 mutant (H) and the OsCKX3 overexpressing material (I). Panel J shows the lengths of D1 and D2 of the pulvinus of the wild type (WT, left), OsCKX3 mutant (center) and the OsCKX3 overexpressing material (right). Panel K shows the number of thin-walled cell layers in D1 and D2 of the pulvinus of the wild type (WT, left), OsCKX3 mutant (center) and the OsCKX3 overexpressing material (right). Panel L shows the number of vascular bundles in the pulvinus of the wild type (WT, left), OsCKX3 mutant (center) and the OsCKX3 overexpressing material (right). [Figure 4] Figure 1 shows the expression pattern and subcellular localization of OsCKX3 gene. A shows the expression level of OsCKX3 gene in roots, stems, pulvinus and leaves. B to E show GUS staining images of 7-day-old seedlings (B), pulvinus sections (C), leaves (D) and nodes (E) of transgenic rice plants carrying a GUS reporter gene vector driven by the OsCKX3 promoter. F shows the hormone-induced expression pattern of OsCKX3. G shows the subcellular localization of OsCKX3. In the figures, IAA is 3-Indoleacetic acid. acid, indole acetic acid, BL, brassinolide, cZ, cis-zeatin, tZ, trans-zeatin, and iP, isopentenyladenine. Mock refers to 10-day-old rice seedlings treated with 0.1% ethanol, and IAA, BL, cZ, tZ, and iP each refer to 10-day-old rice seedlings treated with 1 μM. [Diagram 5] Figure 1 shows the catalytic activity of OsCKX3 protein. Panel A shows the catalytic reaction scheme of OsCKX3, panel B shows the reaction of tZ and iP catalyzed by OsCKX3, and panel C shows the cytokinin contents of the wild type (WT), OsCKX3 mutant, and OsCKX3 overexpression materials. [Figure 6] Figure 1 shows the analysis of agronomic traits of wild type (WT), OsCKX3 mutant and OsCKX3 overexpression plants. Figure A shows phenotypic photographs of wild type (WT), OsCKX3 mutant and OsCKX3 overexpression plants at maturity. Figures B-C show the angles of the flag leaf and inverted second leaf of wild type (WT), OsCKX3 mutant and OsCKX3 overexpression plants. Figure D shows rice grains of wild type (WT), OsCKX3 mutant and OsCKX3 overexpression plants. Figure E shows the plant height, number of productive tillers, number of panicle primary branches, number of panicle secondary branches, fruit set rate, number of grains per panicle, grain length, grain width and thousand kernel weight of wild type (WT), OsCKX3 mutant and OsCKX3 overexpression plants. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0024] Hereinafter, the embodiment of the present invention will be described more specifically with reference to the drawings. In order to make the objectives, technical solutions and advantages of the present invention clearer, the present invention is described in more detail below through embodiments. It should be understood that the specific embodiments described herein are only used to illustrate the present invention, rather than limiting the present invention.

[0025] The gene regulating rice leaf angle according to the embodiment of the present invention can be obtained by identifying a rice OsCKX3 mutant.

[0026] In an embodiment of the present invention, the CDS sequence of OsCKX3 is as shown in SEQ ID No: 1 or a DNA sequence having at least 70% homology to the CDS sequence shown in SEQ ID No: 1 or a functional analogue thereof obtained by some substitution, insertion or deletion.

[0027] In an embodiment of the present invention, the amino acid sequence of the protein encoded by OsCKX3 is SEQ ID No:2.

[0028] The wild-type rice according to the present invention is Nipponbare.

[0029] The conventional Escherichia coli DH5α strain, Agrobacterium GV3101 strain, and EHA105 strain according to the present invention can all be purchased commercially. The invention is further described below with reference to specific embodiments.

[0030] (Embodiment 1) Obtaining a rice cytokinin oxidase OsCKX3 mutant. 1. OsCKX3 gene CRISPR / Cas9 vector transfection The gene number of rice OsCKX3 in the Rice Genome Annotation Project is LOC_Os10g34230, SEQ ID No: 1 is the complete open reading frame sequence of OsCKX3, and its amino acid sequence is SEQ ID No: 2 in the sequence listing.

[0031] Construct and transform the CRISPR / Cas9 gene knockout vector pGEB31-OsCKX3. Specifically, select the 332-351bp sequence of the CDS sequence of gene OsCKX3 as the target site (GAATTCAATCTCAGAAGGCA), and connect it to the knockout vector pRGEB31 to construct the pRGEB31- OsCKX3 vector. Then, transform according to the usual method (commissioned by Wuhan Boyuan Biotechnology Co., Ltd.) to obtain the knockout strain of OsCKX3 gene.

[0032] 2. Extraction of rice genomic DNA Approximately 0.05 g of rice leaves of the OsCKX3 mutant (OsCKX3 gene knockout line obtained in step 1) are placed in a 2 mL centrifuge tube, and steel beads and 500 μL CTAB solution (100 mM Tris-HCl (pH 8.0) (1 M mother liquor is premixed), 20 mM EDTA, 1.4 M NaCl, 2% CTAB) are added, and the mixture is ground in a tissue grinder at 40 Hz for 60 seconds, placed in a 65 °C water bath for 20 minutes, and centrifuged at 10,000 rpm for 5 minutes. 400 μL of the supernatant is taken and added to a new 1.5 mL centrifuge tube, the same volume of chloroform is added, mixed well, and left at room temperature for 5 minutes. Then, the mixture is centrifuged at 12,000 rpm for 10 minutes, and 300 μL of the supernatant is carefully aspirated, and 2 volumes of absolute ethanol are added, mixed uniformly by inverting the tube upside down, and left at -20 °C for 30 minutes. Centrifuge it at 12000 rpm for 10 min, discard the supernatant, aspirate the residual liquid, and let it stand at room temperature for 5-10 min until the small white spots become transparent. Immediately add 30-50 μL of water or TE to dissolve, gently mix to mix evenly, centrifuge, and store at -20 °C for future use.

[0033] 3. Detection of target sequence genotype in knockout material Using the genomic DNA of the rice gene OsCKX3 knockout T0 generation material obtained in step 2 above as a template, PCR amplification is performed using the primer pair OsCKX3 crispr-F (5'-CCTGCTCATCCTCATCCTTTT-3') and OsCKX3 crispr-R (5'-GGGCAAATATAGACCTTAT-3)').

[0034] The total volume of the PCR amplification system is 50 µL, with the template being 1 µL of genomic DNA (approximately 50 ng), 25 µL of 2x KOD enzyme reaction buffer, 10 µL of 2 mM dNTPs, 4 µL of 10 M primers (2 µL of each primer), 1 µL of KOD enzyme, and ddHO (sterile deionized water) added to 50 µL.

[0035] The PCR program consisted of pre-denaturation at 95°C for 5 minutes, followed by PCR cycling with parameters of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 30 seconds, for a total of 35 cycles. Screening was performed to obtain positive transgenic plants of the T0 generation (the size of the PCR amplified product of the positive plants was 597 bp). The results are shown in Figure 1, and two independent OsCKX3 mutants were obtained, one with a single C base insertion and one with a 25 bp deletion, and their phenotypes were observed.

[0036] The sequence of OsCKX3-1 is shown in SEQ ID NO:4. The sequence of OsCKX3-3 is shown in SEQ ID NO:5.

[0037] (Embodiment 2) Obtaining OsCKX3-overexpressing material 1. Construction of fusion protein OsCKX3-GFP vector (1) Extraction of total RNA from rice Leaves from wild-type rice (Nipponbare) are taken and quickly ground into powder. The powder (approximately 0.1 g) is quickly transferred to an RNase-free 1.5 mL centrifuge tube (prepared with 1 mL of Trizol). Vortex for 10 seconds, leave at room temperature for 5 minutes, then centrifuge at 12,000 g for 10 minutes at 4°C, and transfer the supernatant to a new 1.5 mL centrifuge tube. Add 200 μL of chloroform to the centrifuge tube, mix well by inverting the tube, leave at room temperature for 5 minutes, and centrifuge at 12,000 g for 15 minutes at 4°C. Transfer 300 μL of the upper aqueous phase to a new 1.5 mL centrifuge tube, add 300 μL of isopropanol, mix well, leave at room temperature for 10 minutes, and centrifuge at 12,000 g for 10 minutes at 4°C. Discard the supernatant, retain the precipitate, add 1 mL of 70% (prepared with DEPC) alcohol to wash the precipitate, aspirate and resuspend the precipitate, and centrifuge at 7500g at 4°C for 5 minutes. Discard the supernatant, retain the precipitate, centrifuge briefly, suck up excess alcohol with a pipette tip, leave at room temperature for 5 minutes, and dry the RNA. Add 50 μL of DEPC water to dissolve the precipitate, place on ice after dissolution, measure the concentration of RNA for cDNA synthesis, and store in a -80°C refrigerator.

[0038] (2) Reverse transcription of first strand cDNA The extracted total RNA was analyzed using TAKARA's PrimeScript TM II. Reverse transcription is performed according to the instructions of the 1st Strand cDNA Synthesis Kit to obtain the 1st strand cDNA product, which is then stored at -20°C.

[0039] (3) Construction of plasmid OsCKX3-GFP According to the OsCKX3 gene sequence (SEQ ID NO: 1), the following primer pair is designed: OsCKX3-GFP-F (5'- GCAGGCTCCGAATTCATGGAGGTTGCCATGGTCTG -3') and OsCKX3-GFP-R (5'- GAAAGCTGGGTCGAATTCTCAGCTATAGCTTGCAAA -3').

[0040] Using Nipponbare cDNA as a template, PCR amplification was performed using high fidelity enzymes. The PCR amplification system was 50 μL, and consisted of 1 μL (approximately 50 ng) of template cDNA, 25 μL of 2×KOD enzyme reaction buffer, 10 μL of 2 mM dNTP, 4 μL of 10 uM primers (2 μL of each primer), 1 μL of KOD enzyme, and ddH2O (sterile deionized water) added to 50 μL.

[0041] The PCR amplification conditions were 94°C for 5 min, 30 cycles (98°C for 10 sec, 60°C for 30 sec, 68°C for 2 min, 68°C for 30 sec), and 68°C for 10 min to obtain OsCKX3 CDS fragment (amplification product size is 1584 bp, sequence SEQ ID NO: 1). The amplification product was recovered with an agarose gel recovery kit and ligated into PCR8 vector by one-step cloning method, and the constructed vector was assembled into pMDC43 vector by LR reaction to obtain OsCKX3-GFP vector.

[0042] 2. Obtaining OsCKX3-overexpressing material (1) Construction of OsCKX3 overexpression vector After obtaining the OsCKX3-GFP vector, Wuhan Boyuan Bioscience and Technology Co., Ltd. carried out transformation of Nipponbare material to obtain OsCKX3 overexpression material.

[0043] (2) Analysis of OsCKX3 expression levels in OsCKX3-overexpressing materials RNA was extracted from the OsCKX3 overexpressing material, reverse transcriptase was performed, and the expression level of OsCKX3 was detected using the following primers. The results shown in Figure 1C indicate that OsCKX3 is highly expressed in the overexpressing material.

[0044] Use the following primers to analyze the expression of the OsCKX3 gene. Primer F: 5'-AGGCCCTTGATGGCATTGTAG-3' Primer R: 5'-CCACCACCCACATCAGCATAA-3'

[0045] The primers used for the internal reference gene Ubiquitin5 are as follows: Primer F: 5'-GCACAAGCACAAGAAGGTGA-3' Primer R: 5'-CCAAAGAACAGGAGCCTACG-3'.

[0046] In Figure 1C, NIP represents the Nipponbare wild type, and OE1–OE2 represent two lines of OsCKX3 overexpression material.

[0047] (Embodiment 3) Phenotypic identification of rice mutants and overexpression materials Leaf angles of wild-type Nipponbare, OsCKX3 knockout mutant, and OsCKX3 overexpression materials were observed. After normal growth for 10 days after sowing and growth to the stage of three leaves and one stem, the pulvinus of the first leaf was photographed and the leaf angle was measured against the incomplete leaf using the software Image J. The pulvinus was taken as the intersection point, the leaf surface as one side of the line, and the leaf sheath as the other side of the line. The developmental phenotype is shown in Figure 2. It can be seen that the leaf angle phenotype of the OsCKX3 mutant was significantly reduced compared to the wild type, while the leaf angle phenotype of the overexpression material was significantly increased. This indicates that OsCKX3 can change the leaf angle of rice.

[0048] Observation of pulvinus tissue sections (Fig. 3A-I) revealed that the distance from the adaxial end of the pulvinus to the vascular bundle (d1) in the mutant was slightly shorter, and the distance from the abaxial end of the pulvinus to the vascular bundle (d2) was significantly longer. On the other hand, both d1 and d2 in the overexpressing material were shorter (Fig. 2D-J). The mutant showed a significant increase in the number of cell layers and vascular bundles at the abaxial end (Fig. 2K-L). The results indicate that OsCKX3 regulates the leaf angle by regulating the length of the pulvinus and the length of the abaxial end.

[0049] Nipponbare, OsCKX3 mutant, and OsCKX3 overexpression materials were observed from normal growth to maturity for 120 days, and the statistical results of agronomic traits are shown in Figure 6. OsCKX3 mutants have larger grains, but there is no significant difference in other traits. This indicates that OsCKX3 mutants have a beneficial trait of reducing leaf angle and making grains larger, but do not affect other traits. This is different from many other mutants that can reduce leaf angle, and those mutants also affect yield traits. This indicates that OsCKX3 can be used as a potential new genetic resource for improving rice yield.

[0050] (Embodiment 4) OsCKX3 gene expression analysis 1. Pro OsCKX3 ::Construction of GUS vector The rice genomic DNA of Nipponbare was used as a template, and the following primer pair was used: OsCKX3 pro-F (5'-GCAGGCTCCGAATTCGTCCATTAGCACCACCAAAAT-3') and OsCKX3 pro-R (5'-AAGCTGGGTCGAATTCGGTGTTGGAGTAGTGATTCT-3') were used for PCR amplification. The total volume of the PCR amplification system was 50 μL, with 1 μL of genomic DNA (approximately 50 ng) as template, 25 μL of 2x KOD enzyme reaction buffer, 10 μL of 2 mM dNTPs, 4 μL of 10 uM primers (2 μL of each primer), 1 μL of KOD enzyme, and ddH2O (sterile deionized water) added to 50 μL.

[0051] The PCR program was denaturation at 95°C for 5 minutes, followed by PCR cycles with the parameters denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 30 seconds, for a total of 35 cycles. The OsCKX3 promoter sequence (sequence is SEQ ID NO: 6 in the sequence table) was obtained. The amplified product was recovered with an agarose gel recovery kit and ligated into the PCR8 vector by one-step cloning method, and the constructed vector was used for LR reaction in pMDC163 vector, and Pro OsCKX3::GUS vector was obtained. Then, transformation was performed according to the usual method (commissioned to Wuhan Boyuan Bioscience and Technology Co., Ltd.) to transform the Pro OsCKX3 ::GUS transformed plants are obtained.

[0052] Pro OsCKX3 The sequence is shown in SEQ ID NO:6.

[0053] 2. OsCKX3 gene expression analysis Pro obtained in step 1 OsCKX3 ::Seedlings, mature leaves, nodes, and pulvinus of GUS transformed plants are collected and the expression status of the target gene is analyzed by the GUS staining method. The transgenic plant samples are placed in a pre-cooled glass bottle filled with 90% acetone and left at room temperature for 30 minutes. After washing twice with ice water, the samples are transferred to GUS staining solution and stained at 37°C for 4-20 hours. The stained samples are decolorized in a decolorization solution of ethanol:acetic acid = 3:1 for 2-12 hours. After decolorization is completed, photographs are taken using a digital camera or microscope to record the staining results. The samples for pulvinus section observation need to be fixed with FAA fixative, the specific components of which are 1mL 38% formaldehyde (final concentration 2%), 1mL glacial acetic acid, and 18mL 50% alcohol, and then embedded in resin. A semi-thin slicer is used to obtain 7μm-thick sections for observation of pulvinus tissue. Expression analysis of OsCKX3 was performed according to the operating instructions of TaKaRa's SYBR Green, using different tissues as templates and quantitative primers for OsCKX3 and the internal reference gene Ubiquitin5 to amplify the target gene and detect the expression of OsCKX3. The results in Figure 4A-E show that OsCKX3 is highly expressed in the pulvinus. The results in Figure 4F show that the OsCKX3 gene is induced by BL, tZ and iP hormones.

[0054] Use the following primers to analyze the expression of the OsCKX3 gene. Primer F: 5'-AGGCCCTTGATGGCATTGTAG-3' Primer R: 5'-CCACCACCCACATCAGCATAA-3'

[0055] The internal reference gene Ubiquitin5 primers used were as follows: Primer F: 5'-GCACAAGCACAAGAAGGTGA-3' Primer R: 5'-CCAAAGAACAGGAGCCTACG-3'.

[0056] (Embodiment 5) Subcellular localization of OsCKX3 The OsCKX3-GFP vector obtained in Example 2 is transformed into Agrobacterium GV3101, streaked on LB solid medium, and cultured for 1-2 days, after which a single colony is selected for experimentation. A single clone is selected from 5 mL of LB liquid culture containing the corresponding antibiotic, and cultured at 28°C, 200-220 rpm with shaking for 1 day. The Agrobacterium is grown at OD 600 Transfer the mixture to 20 mL of LB liquid medium containing antibiotics (1.5 mL per 20 mL of medium) so that the OD of the culture is approximately 0.3, and culture at 28°C with shaking. 600Inspect the value, and a value of about 1.5 is sufficient. Prepare the resuspension in advance (sterile ddH2O, 0.01M MgCl2, 0.01M MES and 100μM AS) and collect the bacteria at 6000 rpm for 5 min. Use 2mL of resuspension first, then add 6-8mL of resuspension and centrifuge at 6000 rpm for 5 min. Discard the supernatant, add 2mL of resuspension solution to the resuspension solution, and finally add 15mL of resuspension solution. Inject the tobacco after 2-3 hours of dark culture at 28 °C. Mix the intrusion solution containing different bacterial solutions in a 1:1:1 ratio in a 5mL centrifuge tube, shake well, then fill a 1mL syringe, and inject into the tobacco leaf (without using the cotyledon) from the lower epidermis of the leaf while pressing the syringe with your thumb. After injection, the tobacco leaf will undergo a wetting phenomenon, so make the number of injection holes as small as possible. The tobacco was observed after 3 days of culture, and the results are shown in Figure 4G. OsCKX3-GFP (first from the left) and endoplasmic reticulum maker fluorescence (second from the left) are fused (fourth from the left), and bright field is third from the left, showing that OsCKX3 localizes to the endoplasmic reticulum.

[0057] (Embodiment 6) Detection of biochemical activity of OsCKX3 1. Detection of OsCKX3 activity in vitro (1) OsCKX3-MBP vector construction Amplify OsCKX3 using the following primers, ligate it into the pMAL vector, transform it into E. coli BL21 (DE3 Invitrogen), add 0.5 mM IPTG to induce expression, and purify the protein of interest using Amylose Resin (New England Biolabs Inc.) to obtain the MBP-OsCKX3 fusion protein.

[0058] Construct OsCKX3 amplification primers for pMAL-c2X vector. OsCKX3-pMAL F: GAAGGATTTCAGAATTCATGGAGGTTGCCATGGTCTG OsCKX3-pMAL R: CTAGAGGATCCGAATTCTCAGCTATAGCTTGCAAATG

[0059] (2) Activity detection Add 14 μg MBP-OsCKX3 fusion protein, 0.1 mM cytokinin substrates (iP and tZ), 0.5 mM 2,6-dichlorophenol indophenol (DCIP), and 75 mM Tris / HCL buffer (pH 8.5) to each reaction solution (100 μL) and react for 30 minutes in a water bath at 37 °C. Then, immediately add trichloroacetic acid to stop the reaction. Centrifuge at 4 °C and 12,000 g for 10 minutes. Filter the supernatant and quantitatively detect the amount of reduced substrate using HPLC. The results in Figure 5A and 5B show that OsCKX3 can catalyze tZ and iP.

[0060] 2. Detection of in vivo activity (1) Extraction of CK Put 50 mg of sample into a 2 mL centrifuge tube (Eppendorf), add a steel ball, quickly place in liquid nitrogen, and grind the sample using a mill (Tissuelyser-48, Shanghai Jingxin Experimental Technology Co., Ltd.). After powdering, add 1.6 mL of 80% methanol and 50 pg of [ 2 H5]tZ,[ 2 H5]tZR,[ 2 H6]iP,[ 2 Add [H6]iPR. Rotate the tube containing the mixture for 2 h at 4 °C and centrifuge at 15,000 g for 10 min at 4 °C. Carefully aspirate the supernatant into a new tube and blow dry under nitrogen. Add 0.6 mL of 80% methanol solution to the remaining pellet, mix again, and repeat the above procedure. Finally, add the supernatant to a 2 mL tube, dry under nitrogen, and redissolve in 300 μL of 30% methanol. Filter the solution using a 0.22 μm aqueous filter membrane and prepare it for use.

[0061] (2) Measurement of CK content using a GC-MS system CK extracts are separated using an ExionLC (AB SCIEX) liquid chromatography system equipped with an Acquity UPLC BEH C18-type separation column assembly. The column is first equilibrated at 40 °C, and then 30 μL of sample is added for analysis. In the analysis of CK, the mobile phase components A and B are water and methanol, respectively, and elution is performed by a multi-step linear gradient elution method. The specific steps are: 0-2.5 min: 5% A; 2.5-3 min: 5-20% B; 3-12.5 min: 20-50% B; 12.5-13 min: 50-100% B; 13-15 min: 100% B; 15-15.2 min: 100-5% B; 15.2-18 min: 5% B. The flow rate is set to 0.3 mL / min.

[0062] The analysis of CK is performed in multiple reaction detection scan mode (MRM mode) on a QTRAP 5500 triple quadrupole mass spectrometer system (AB SCIEX). Based on the reference of related information, suitable ions are selected for quantitative analysis of hormone content. The optimal conditions for MRM are as follows: air curtain gas pressure: 40 psi; ion spray voltage: positive ion mode 5000 V; negative ion mode -4500 V; turbo heater temperature: 600 °C; atomization gas pressure (Gas 1): 60 psi; heating gas pressure (Gas 2): 60 psi. Analyst (version 1.6.3 AB SCIEX) software is used to control the related instruments and acquire the result data. The obtained raw data is imported into MultiQuant software (version 3.0.2 AB SCIEX) for further analysis and processing, and the results of CK are accurately quantified by internal standard reference. Figure 5C shows that OsCKX3 can catalyze tZ and iP in vivo. We show that after mutation, the contents of tZ and iP in rice increase and the rice leaf angle decreases, while after overexpression, the contents of tZ and iP in rice decrease and the rice leaf angle increases.

[0063] (Embodiment 7) Agronomic trait analysis Nipponbare wild type, OsCKX3 mutant and overexpression species were planted in the field and photographed for agronomic traits after 120 days of growth. All agronomic traits including plant height, number of grains per panicle, number of tillers, thousand kernel weight, kernel length and kernel width were statistically analyzed based on single plant data using SPSS software. The results are shown in Figure 6.

[0064] According to Figure 6, the following summary conclusions can be drawn: After the OsCKX3 gene mutation, rice leaf angle became smaller, thousand-kernel weight increased, and seed set rate decreased slightly, but other agronomic traits had no significant difference. After the OsCKX3 gene overexpression, leaf angle became larger, thousand-kernel weight decreased, seed set rate decreased slightly, plant height decreased, and grain number per panicle decreased, but other agronomic traits had no significant difference. This indicates that the OsCKX3 gene can be used as a genetic resource for breeding improvement.

[0065] Finally, it should be noted that the above examples are merely some specific embodiments of the present invention. Of course, the present invention is not limited to the above embodiments, and many variations are possible. All variations that a person skilled in the art can directly derive or associate with the contents disclosed in the present invention should be considered as within the protection scope of the present invention.

Claims

[Claim 1] 1. Use of rice gene OsCKX3 or its encoded protein in improving rice crops, characterized in that it regulates rice leaf angle, The nucleotide sequence of the rice gene OsCKX3 is shown in SEQ ID NO: 1, The amino acid sequence encoded by the rice gene OsCKX3 is shown in SEQ ID NO: 2, In the use of the rice gene OsCKX3 or the protein encoded thereby, Use of the gene OsCKX3 or the protein encoded thereby, characterized in that the nucleotide sequence is the OsCKX3 variant shown in either SEQ ID NO: 4 or SEQ ID NO: 5.

Images