How to Treat Hepatitis B Infection

Abstract

To provide oligonucleotides that produce durable knockdown of HBV surface antigen (HBsAg) expression.SOLUTION: An oligonucleotide comprises an antisense strand and induces RNA interference (RNAi)-mediated recognition and destruction of mRNA which encodes all forms of HBsAg in hepatocytes. In some embodiments, the oligonucleotide further comprises a sense strand and the sense strand forms a duplex region with the antisense strand.SELECTED DRAWING: Figure 10

Description

[Technical field]

[0001] This application relates to oligonucleotides and uses thereof, particularly in relation to the treatment of Hepatitis B infection. [Background technology]

[0002] Chronic hepatitis B virus (HBV) infection remains a significant cause of morbidity and mortality worldwide. Current HBV treatments, such as nucleoside analogues, require lifelong treatment to reduce plasma viremia and are generally not effective in the long term. Traditionally, functional recovery has been the best treatment outcome for chronic HBV. RNA interference (RNAi) technology offers the potential for pharmacological intervention.

[0003] The envelope proteins are collectively known as Hepatitis B surface antigen (HBsAg). HBsAg consists of three related polypeptides, designated S, M, and L, encoded by overlapping open reading frames (ORFs). The smallest envelope protein is S, with 226 amino acids, designated the S-ORF. M and L are generated from the upstream translation initiation site and add 55 and 108 amino acids to S, respectively. HBV S, M, and L glycoproteins are found in the viral envelope of intact infectious HBV virions, called Dane particles, and all three are produced and secreted in great excess to form non-infectious subviral spherical and filamentous particles (both designated decoy particles) found in the blood of chronic HBV patients. HBsAg, abundantly present on the surface of the decoy particles, is believed to inhibit humoral immunity and natural clearance in patients with chronic HBV infection (CHB). Summary of the Invention

[0004] Aspects of the present disclosure relate to improved oligonucleotide-based compositions and methods of treating HBV infection in a subject. In some embodiments, the present disclosure relates to the development of potent oligonucleotides that generate durable knockdown of HBV surface antigen (HBsAg) expression. The oligonucleotides induce RNA interference (RNAi)-mediated recognition and destruction of mRNAs encoding all forms of HBsAg in hepatocytes, including proteins translated from viral RNAs transcribed from both cccDNA integrated in the host genome and HBV DNA. Oligonucleotides herein are designed to target a broad set of HBsAg transcripts encoded by the HBV genome across all known genotypes. In some embodiments, it has been found that the oligonucleotides disclosed herein that target HBsAg transcripts in hepatocytes can stably reduce HBsAg expression with high specificity that persists for extended periods of time (e.g., more than 7 weeks to several months) following administration to a subject (see, e.g., Examples 1 and 3). In some embodiments, targeting HBsAg expression using the oligonucleotides disclosed herein has been found to reduce pregenomic RNA (pgRNA) and other viral life cycle intermediates. It has also been found that certain RNAi oligonucleotides disclosed herein can knock down HBsAg mRNA transcripts derived from either cccDNA or integrated virus. In a further aspect, targeting HBsAg expression using the oligonucleotides disclosed herein has been found to reduce expression of all HBV proteins (except HBx), i.e., HBcAg, HBeAg, and HBV polymerase, and preserve cytosolic HBV core protein. Furthermore, in some embodiments, clearance of circulating HBsAg resulting from mRNA knockdown using the methods provided herein is clinically advantageous because it allows for the breaking of HBV immune tolerance caused by high levels of circulating HBsAg in CHB patients. Reactivation of immune system activity against HBV infection is believed to be the basis for achieving functional recovery, defined as permanent seroclearance of HBsAg.

[0005] Previous studies have shown that HBV replication and gene expression can be effectively inhibited using a combination of RNAi agents targeting multiple different HBV genes (i.e., S, C, P, and X genes), or in some cases, targeting only the X gene transcript. However, it is clear from the results provided here that the use of RNAi oligonucleotides targeting only the HBsAg transcript effectively inhibits HBV replication and gene expression, providing a new therapeutic approach for the treatment of HBV infection. In addition to the direct effect of silencing viral RNA, the HSB(s)-219 precursor prevents the nuclear localization of HBV core antigen (HBcAg). Importantly, targeting HBV-X, or both genes simultaneously, does not prevent the nuclear localization of HBcAg. Preclinical data strongly suggest that the inhibition of central nuclear localization resulting from RNAi therapy targeting S significantly improves the duration of HBsAg inhibition. Notably, elimination of nuclear localization of HBcAg in patients has been found to correlate with a favorable response to antiviral therapy.

[0006] Some embodiments of the present disclosure provide an oligonucleotide for reducing expression of hepatitis B virus surface antigen (HBsAg) mRNA. The oligonucleotide comprises an antisense strand having a length of 19 to 30 nucleotides, and the antisense strand comprises a region complementary to the sequence of HBsAg mRNA defined as ACAANAAUCCUCACAAUA (SEQ ID NO: 1).

[0007] In some embodiments, the oligonucleotide further comprises a sense strand 19-50 nucleotides in length, the sense strand forming a duplex region with the antisense strand. In some embodiments, the sense strand comprises a region complementary to the sequence set forth in UUNUUGUGAGGAUUN (SEQ ID NO:2). In some embodiments, the sense strand comprises a region complementary to the sequence set forth in 5'-UUAUUGUGAGGAUUNUUGUC (SEQ ID NO:3).

[0008] In some embodiments, the antisense strand comprises the sequence set forth in UUAUUGUGAGGAUUNUUGUCGG (SEQ ID NO: 4). In some embodiments, the antisense strand consists of the sequence set forth in UUAUUGUGAGGAUUCUUGUCGG (SEQ ID NO: 5). In some embodiments, the antisense strand consists of the sequence set forth in UUAUUGUGAGGAUUUUUGUCGG (SEQ ID NO: 5.1).

[0009] In some embodiments, the sense strand comprises a sequence set forth in ACAANAAUCCUCACAAUAA (SEQ ID NO:6). In some embodiments, the sense strand comprises a sequence set forth in GACAANAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO:7). In some embodiments, the sense strand consists of a sequence set forth in GACAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO:8). In some embodiments, the sense strand consists of a sequence set forth in GACAAGAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO:8.1).

[0010] Another aspect of the present disclosure provides an oligonucleotide for reducing expression of Hepatitis B virus surface antigen (HBsAg) mRNA, the oligonucleotide comprising a sense strand forming a duplex region with an antisense strand, the sense strand comprising a sequence set forth in GACAAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO:8), the antisense strand comprising a sequence set forth in UUAUUGUGAGGAUUUUUGUCGG (SEQ ID NO:5.1), the antisense strand and the sense strand each comprising one or more 2'-fluoro and 2'-O-methyl modified nucleotides and at least one phosphorothioate linkage, the 4'-carbon of the sugar of the 5' nucleotide of the antisense strand comprises a phosphate analog, and the sense strand is conjugated to one or more N-acetylgalactosamine (GalNAc) moieties.

[0011] Further provided herein is an oligonucleotide for reducing expression of Hepatitis B virus surface antigen (HBsAg) mRNA, the oligonucleotide comprising a sense strand forming a duplex region with an antisense strand, wherein the oligonucleotide: the sense strand comprises a sequence set forth in GACAAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO:8), comprising 2'-fluoro modified nucleotides at positions 3, 8-10, 12, 13 and 17, 2'-O-methyl modified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26 and 31-36, and at least one phosphorothioate internucleotide linkage, wherein the sense strand is linked to one or more N-acetylgalactosamine (GalNAc) moieties. conjugated to the antisense strand; the antisense strand comprises a sequence set forth in UUAUUGUGAGGAUUUUUGUCGG (SEQ ID NO:5.1), and comprises 2'-fluoro modified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16, and 19, O-methyl modified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18, and 20-22, and at least three phosphorothioate internucleotide linkages, wherein the 4'-carbon of the sugar of the 5'-nucleotide in the antisense strand comprises a phosphate analog, and the sense strand comprises a phosphorothioate linkage between the 1st and 2nd nucleotides.

[0012] In some embodiments, the antisense strand contains five phosphorothioate linkages between nucleotide positions 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22.

[0013] In some embodiments, the 5'-nucleotide of the antisense strand has the following structure: [ka] has.

[0014] In some embodiments, one or more nucleotides of the -GAAA- sequence on the sense strand are conjugated to a monovalent GalNac moiety.

[0015] In some embodiments, each nucleotide of the -GAAA- sequence on the sense strand is conjugated to a monovalent GalNac moiety. In some embodiments, the -GAAA- motif has the following structure: [ka] wherein: L represents a bond, a click chemistry handle, or a linker of 1 to 20 inclusive contiguous covalently bonded atoms in length and is selected from the group consisting of substituted and unsubstituted alkylene, substituted and unsubstituted alkenylene, substituted and unsubstituted alkynylene, substituted and unsubstituted heteroalkylene, substituted and unsubstituted heteroalkenylene, substituted and unsubstituted heteroalkynylene, and combinations thereof; and X is O, S, or N.

[0016] In some embodiments, L is an acetal linker. In some embodiments, X is O.

[0017] In some embodiments, the -GAAA- sequence has the following structure: [ka] Includes.

[0018] In some embodiments, the sense strand comprises a stem loop at its 3' end defined as S1-L-S2, where S1 is complementary to S2, and L forms a loop between S1 and S2 up to 6 nucleotides in length. In some embodiments, L is a tetraloop. In some embodiments, L forms a loop between S1 and S2 up to 4 nucleotides in length. In some embodiments, L comprises a sequence defined as GAAA. In some embodiments, up to 4 nucleotides of L of the stem loop are each conjugated to a separate GalNAc.

[0019] In some embodiments, the oligonucleotide comprises at least one modified nucleotide. In some embodiments, the modified nucleotide comprises a 2'-modification. In some embodiments, the 2'-modification is a modification selected from: 2'-aminoethyl, 2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl, and 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid. In some embodiments, all nucleotides of the oligonucleotide are modified nucleotides. In some embodiments, the oligonucleotide comprises at least one modified internucleotide linkage. In some embodiments, the at least one modified internucleotide linkage is a phosphorothioate linkage. The 4'-carbon of the sugar of the 5'-nucleotide in the antisense strand comprises a phosphate analog.

[0020] In some embodiments, at least one nucleotide of the oligonucleotide is conjugated to a targeting ligand. In some embodiments, the targeting ligand is an N-acetylgalactosamine (GalNAc) moiety.

[0021] Further provided herein is a composition comprising an oligonucleotide according to any one of the preceding claims and a counterion, and a composition comprising an oligonucleotide according to any one of the preceding claims and a pharma- ceutically acceptable carrier.

[0022] Another aspect of the present disclosure provides a method for reducing expression of Hepatitis B Virus (HBV) surface antigen in a cell, the method comprising delivering an oligonucleotide described herein to the cell. In some embodiments, the cell is a hepatocyte. In some embodiments, the cell is an in vivo cell. In some embodiments, the cell is an in vitro cell.

[0023] Another aspect of the present disclosure provides a method of treating Hepatitis B virus (HBV) infection in a subject, the method comprising administering to the subject an oligonucleotide of a composition described herein, or the composition.

[0024] Also provided is a method of treating HBV infection in a subject, comprising administering to the subject an RNAi oligonucleotide that selectively targets HBsAg mRNA, wherein the RNAi oligonucleotide is administered without treatment with an RNAi oligonucleotide that targets an HBV mRNA transcript encoding a non-surface antigen. Also provided is a method of treating HBV infection in a subject, comprising administering to the subject an RNAi oligonucleotide that selectively targets HBsAg mRNA, wherein the RNAi oligonucleotide is not administered to the subject with an RNAi oligonucleotide that selectively targets HBxAg mRNA transcript. In some embodiments, the method further comprises administering to the subject an effective amount of entecavir.

[0025] Another aspect of the disclosure provides an oligonucleotide for reducing expression of Hepatitis B virus surface antigen (HBsAg) mRNA, the oligonucleotide comprising a sense strand that forms a duplex region with an antisense strand, wherein in the oligonucleotide: the sense strand comprises a sequence set forth in GACAAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 8), including 2'-fluoro modified nucleotides at positions 3, 8-10, 12, 13, and 17, 2'-O-methyl modified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26, and 31-36, and a phosphorothioate internucleotide linkage between the nucleotides at positions 1 and 2, wherein each nucleotide of the -GAAA- sequence of the sense strand is conjugated to a monovalent GalNac moiety, and the -GAAA- sequence has the following structure: [ka] Also, The antisense strand comprises a sequence set forth in UUAUUGUGAGGAUUUUUGUCGG (SEQ ID NO:5.1), including 2'-fluoro modified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16, and 19, O-methyl modified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18, and 20-22, and five phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22; and the 4'-carbon of the sugar of the 5'-nucleotide in the antisense strand has the structure: [ka] has.

[0026] Also provided are compositions comprising the oligonucleotides. In some embodiments, the compositions further comprise a Na+ counterion.

[0027] Also provided are methods of reducing expression of a Hepatitis B Virus (HBV) surface antigen in a cell, the methods comprising delivery of an oligonucleotide or composition. In some embodiments, the cell is a hepatocyte. In some embodiments, the cell is an in vivo cell. In some embodiments, the cell is an in vitro cell.

[0028] Methods of treating a Hepatitis B virus (HBV) infection in a subject are provided, the methods comprising administering to the subject an oligonucleotide or composition. In some embodiments, the methods further comprise administering to the subject an effective amount of entecavir.

[0029] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate certain embodiments and, together with the written description, serve to provide non-limiting examples of certain aspects of the compositions and methods disclosed herein. [Brief description of the drawings]

[0030] [Figure 1] 1 shows examples of RNAi target sites on a schematic diagram of the organization of the HBV genome. [Diagram 2] 1 shows a single dose evaluation of oligonucleotides to reduce HBsAg expression in HDI mice. [Diagram 3] 1 is a graph of plasma HBsAg levels over time during a particular dosing regimen using an oligonucleotide targeting HBsAg. As can be seen from this example, the oligonucleotide demonstrated preclinical efficacy, maintaining reduced levels over the dosing period. [Figure 4] Figure 1 shows the results of HBsAg mapping in HeLa cells using a reporter assay. Unmodified siRNA targeting position 254 of the HBV genome was used as a positive control at the specified concentrations. Silencer siRNA commercially available from Thermo Fisher served as a negative control for these experiments. Error bars represent SEM. [Diagram 5] A genotype-conserving comparison is shown showing that mismatches engineered into HBsAg-targeting oligonucleotides HBV-219 are increased across HBV genotypes. [Figure 6] 1 shows vectors designed for the psiCHECK2 reporter assay using HBV Genotype A as the prototype sequence. [Figure 7] Some examples of oligonucleotides designed to assess the effect of introducing mismatches are shown. The oligonucleotide sequences of the parental and mismatched strands are aligned and shown with the position of the mismatch in a box. The corresponding reporter sequences used in the psiCHECK2 reporter assay are also shown. [Figure 8] Single dose titration plots of the oligonucleotides evaluated in the mismatch study are shown, demonstrating that guide strand mismatches are tolerated in vivo. [Figure 9] 1 shows an in vivo dose titration plot demonstrating that incorporation of mismatches into oligonucleotides targeting HBsAg does not adversely affect potency in vivo. [Figure 10]An example of an oligonucleotide targeting HBsAg (HBV(s)-219) in a double-stranded form with chemical modifications is shown. Dark shading indicates 2'-O-methylribonucleotides. Light shading indicates 2'-fluoro-deoxyribonucleotides. [Figure 11A] 1 shows the results of immunohistochemical staining to detect the intracellular distribution of HBV core antigen (HBcAg) in hepatocytes. [Figure 11B] 1 shows the results of RNA sequencing that mapped detected RNA transcript sequences to HBV pgRNA. [Figure 12A] Figure 2 shows the time course of HBsAg mRNA expression following treatment with the HBV(s)-219 oligonucleotide precursor HBV(s)-219P2 targeting HBsAg mRNA compared with vehicle control and RNAi oligonucleotides targeting HBxAg mRNA in a hydrodynamic injection (HDI) model of HBV. [Figure 12B] Figure 2 shows the time course of HBsAg mRNA expression following treatment with the HBV(s)-219 oligonucleotide precursor HBV(s)-219P2 targeting HBsAg mRNA compared with vehicle control and RNAi oligonucleotides targeting HBxAg mRNA in an AAV-HBV model. [Figure 13] HBV(s)-219 oligonucleotides targeting HBsAg mRNA compared to vehicle control and RNAi oligonucleotides targeting HBxAg mRNA (GalXC-HBVX), showing the results of immunohistochemical staining demonstrating the intracellular distribution of HBcAg in stem cells derived from AAV-HBV and HDI models of HBV. [Figure 14A]Antiviral activity of HBV(s)-219 precursor 1 (HBV(s)-219 P1) in the PXB-HBV model. Cohorts of nine mice were subcutaneously dosed every three weeks with HBV-219P1 at either 0 mg / kg or 3 mg / kg in PBS. Six mice from each cohort were analyzed by non-peripheral mandibular cheek bleeding at each time point indicated (Figure 14A and Figure 14B) for serum HBsAg and serum HBV DNA. On day 28 (from the first dose of HBV(s)-219P1), all remaining mice were euthanized and liver biopsies were taken for hepatic HBV DNA (Figure 14C) and hepatic cccDNA (Figure 14D) by RT-qPCR. [Figure 14B] Antiviral activity of HBV(s)-219 precursor 1 (HBV(s)-219 P1) in the PXB-HBV model. Cohorts of nine mice were subcutaneously dosed every three weeks with HBV-219P1 at either 0 mg / kg or 3 mg / kg in PBS. Six mice from each cohort were analyzed by non-peripheral mandibular cheek bleeding at each time point indicated (Figure 14A and Figure 14B) for serum HBsAg and serum HBV DNA. On day 28 (from the first dose of HBV(s)-219P1), all remaining mice were euthanized and liver biopsies were taken for hepatic HBV DNA (Figure 14C) and hepatic cccDNA (Figure 14D) by RT-qPCR. [Figure 14C] Antiviral activity of HBV(s)-219 precursor 1 (HBV(s)-219 P1) in the PXB-HBV model. Cohorts of nine mice were subcutaneously dosed every three weeks with HBV-219P1 at either 0 mg / kg or 3 mg / kg in PBS. Six mice from each cohort were analyzed by non-peripheral mandibular cheek bleeding at each time point indicated (Figure 14A and Figure 14B) for serum HBsAg and serum HBV DNA. On day 28 (from the first dose of HBV(s)-219P1), all remaining mice were euthanized and liver biopsies were taken for hepatic HBV DNA (Figure 14C) and hepatic cccDNA (Figure 14D) by RT-qPCR. [Figure 14D]Antiviral activity of HBV(s)-219 precursor 1 (HBV(s)-219 P1) in the PXB-HBV model. Cohorts of nine mice were subcutaneously dosed every three weeks with HBV-219P1 at either 0 mg / kg or 3 mg / kg in PBS. Six mice from each cohort were analyzed by non-peripheral mandibular cheek bleeding at each time point indicated (Figure 14A and Figure 14B) for serum HBsAg and serum HBV DNA. On day 28 (from the first dose of HBV(s)-219P1), all remaining mice were euthanized and liver biopsies were taken for hepatic HBV DNA (Figure 14C) and hepatic cccDNA (Figure 14D) by RT-qPCR. [Figure 15A] We show that HBV(s)-219 precursor 2 (HBV(s)-219P2) enhances the antiviral activity of entecavir. In the HBV mouse hydrodynamic injection (HDI) model, mice were administered a single subcutaneous dose of HBV(s)-219P2 on day 1, followed by oral administration of 500 ng / kg entecavir (ETV) daily for 14 days. Circulating viral load (HBV DNA) was measured by qPCR (Figure 15A). Plasma HBsAg levels were measured by ELISA (Figure 15B). Liver HBV mRNA and pgRNA levels were measured by qPCR (Figure 15C). Results show a clear additive effect of combination therapy. ETV therapy alone shows no effect on circulating HBsAg or hepatic viral RNA. The antiviral activity of HBV(s)-219P2, as measured by HBsAb or HBV RNA, is not affected by coadministration of ETV. "BLOD" stands for "below limit of detection." [Figure 15B]We show that HBV(s)-219 precursor 2 (HBV(s)-219P2) enhances the antiviral activity of entecavir. In the HBV mouse hydrodynamic injection (HDI) model, mice were administered a single subcutaneous dose of HBV(s)-219P2 on day 1, followed by oral administration of 500 ng / kg entecavir (ETV) daily for 14 days. Circulating viral load (HBV DNA) was measured by qPCR (Figure 15A). Plasma HBsAg levels were measured by ELISA (Figure 15B). Liver HBV mRNA and pgRNA levels were measured by qPCR (Figure 15C). Results show a clear additive effect of combination therapy. ETV therapy alone shows no effect on circulating HBsAg or hepatic viral RNA. The antiviral activity of HBV(s)-219P2, as measured by HBsAb or HBV RNA, is not affected by coadministration of ETV. "BLOD" stands for "below limit of detection." [Figure 15C] We show that HBV(s)-219 precursor 2 (HBV(s)-219P2) enhances the antiviral activity of entecavir. In the HBV mouse hydrodynamic injection (HDI) model, mice were administered a single subcutaneous dose of HBV(s)-219P2 on day 1, followed by oral administration of 500 ng / kg entecavir (ETV) daily for 14 days. Circulating viral load (HBV DNA) was measured by qPCR (Figure 15A). Plasma HBsAg levels were measured by ELISA (Figure 15B). Liver HBV mRNA and pgRNA levels were measured by qPCR (Figure 15C). Results show a clear additive effect of combination therapy. ETV therapy alone shows no effect on circulating HBsAg or hepatic viral RNA. The antiviral activity of HBV(s)-219P2, as measured by HBsAb or HBV RNA, is not affected by coadministration of ETV. "BLOD" stands for "below limit of detection." [Figure 16A]Figure 16 shows a comparison of HBsAg suppressive activity of GalNac-conjugated oligonucleotides targeting S antigen (HBV(s)-219P2) or X antigen (designated GalXC-HBVX). Results show that HBVS-219P2 suppresses HBsAg for a longer period than GalBC-HBVX or equimolar combination of both RNAi agents. Figure 16A shows that the location of the RNAi target site in the HBV genome influences the kinetics of HBsAg recovery in HBV-expressing mice. Figure 16B shows plasma HBsAg levels 2 weeks (left panel) and 9 weeks (right panel) after treatment, indicating that targeting the HBVX coding region alone or in combination with HBV(s)-219P2 results in a shorter duration of activity. Data from individual animals are shown. Several data points (greyest circles) were below the detection limit. [Figure 16B] Figure 16 shows a comparison of HBsAg suppressive activity of GalNac-conjugated oligonucleotides targeting S antigen (HBV(s)-219P2) or X antigen (designated GalXC-HBVX). Results show that HBVS-219P2 suppresses HBsAg for a longer period than GalBC-HBVX or equimolar combination of both RNAi agents. Figure 16A shows that the location of the RNAi target site in the HBV genome influences the kinetics of HBsAg recovery in HBV-expressing mice. Figure 16B shows plasma HBsAg levels 2 weeks (left panel) and 9 weeks (right panel) after treatment, indicating that targeting the HBVX coding region alone or in combination with HBV(s)-219P2 results in a shorter duration of activity. Data from individual animals are shown. Several data points (greyest circles) were below the detection limit. [Figure 17A]Figure 17 shows the intracellular location of HBV core antigen (HBcAg) in HBV-expressing mice treated with HBV(s)-219P2, GalXC-HBVX, or a 1:1 combination of these. Figure 17A shows representative hepatocytes in liver sections obtained 1, 2, 6, 9, and 13 weeks after treatment and stained for HBcAg. Figure 17B shows the percentage of nuclear stained HBcAg positive cells in each animal (n=3 / group, 50 cells per animal, 2 weeks after treatment). Alternative sequences were designed and tested targeting within the X and S open reading frames. Figure 17C shows the intracellular distribution of HBcAg in hepatocytes obtained 2, 3, and 9 weeks after treatment with alternative RNAi oligos targeting either the S and X antigens. [Figure 17B] Figure 17 shows the intracellular location of HBV core antigen (HBcAg) in HBV-expressing mice treated with HBV(s)-219P2, GalXC-HBVX, or a 1:1 combination of these. Figure 17A shows representative hepatocytes in liver sections obtained 1, 2, 6, 9, and 13 weeks after treatment and stained for HBcAg. Figure 17B shows the percentage of nuclear stained HBcAg positive cells in each animal (n=3 / group, 50 cells per animal, 2 weeks after treatment). Alternative sequences were designed and tested targeting within the X and S open reading frames. Figure 17C shows the intracellular distribution of HBcAg in hepatocytes obtained 2, 3, and 9 weeks after treatment with alternative RNAi oligos targeting either the S and X antigens. [Figure 17C] Figure 17 shows the intracellular location of HBV core antigen (HBcAg) in HBV-expressing mice treated with HBV(s)-219P2, GalXC-HBVX, or a 1:1 combination of these. Figure 17A shows representative hepatocytes in liver sections obtained 1, 2, 6, 9, and 13 weeks after treatment and stained for HBcAg. Figure 17B shows the percentage of nuclear stained HBcAg positive cells in each animal (n=3 / group, 50 cells per animal, 2 weeks after treatment). Alternative sequences were designed and tested targeting within the X and S open reading frames. Figure 17C shows the intracellular distribution of HBcAg in hepatocytes obtained 2, 3, and 9 weeks after treatment with alternative RNAi oligos targeting either the S and X antigens. [Figure 18]Shown are dose by cohort information for studies designed to evaluate the safety and tolerability of HBV(s)-219 in healthy patients and the therapeutic efficacy of HBV(s)-219 in patients with HBV. [Figure 19A-1] The chemical structures of HBV(s)-219 and HBV(s)-219P2 are shown. (Figure 19A) Chemical structure of HBV(s)-219. (Figure 19B) Chemical structure of HBV(s)-219P2. [Figure 19A-2] The chemical structures of HBV(s)-219 and HBV(s)-219P2 are shown. (Figure 19A) Chemical structure of HBV(s)-219. (Figure 19B) Chemical structure of HBV(s)-219P2. [Figure 19A-3] The chemical structures of HBV(s)-219 and HBV(s)-219P2 are shown. (Figure 19A) Chemical structure of HBV(s)-219. (Figure 19B) Chemical structure of HBV(s)-219P2. [Figure 19A-4] The chemical structures of HBV(s)-219 and HBV(s)-219P2 are shown. (Figure 19A) Chemical structure of HBV(s)-219. (Figure 19B) Chemical structure of HBV(s)-219P2. [Figure 19B-1] The chemical structures of HBV(s)-219 and HBV(s)-219P2 are shown. (Figure 19A) Chemical structure of HBV(s)-219. (Figure 19B) Chemical structure of HBV(s)-219P2. [Figure 19B-2] The chemical structures of HBV(s)-219 and HBV(s)-219P2 are shown. (Figure 19A) Chemical structure of HBV(s)-219. (Figure 19B) Chemical structure of HBV(s)-219P2. [Figure 19B-3] The chemical structures of HBV(s)-219 and HBV(s)-219P2 are shown. (Figure 19A) Chemical structure of HBV(s)-219. (Figure 19B) Chemical structure of HBV(s)-219P2. [Figure 19B-4] The chemical structures of HBV(s)-219 and HBV(s)-219P2 are shown. (Figure 19A) Chemical structure of HBV(s)-219. (Figure 19B) Chemical structure of HBV(s)-219P2. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0031] According to some aspects, the present disclosure provides potent oligonucleotides that are effective in reducing HBsAg expression in cells, particularly liver cells (e.g., hepatocytes) for treating HBV infection. In certain embodiments, the HBsAg-targeting oligonucleotides provided herein are designed to be delivered to selected cells of target tissues (e.g., hepatocytes) and treat HBV infection in these tissues. Thus, in a related aspect, the present disclosure provides a method of treating HBV infection comprising selectively reducing HBV surface antigen gene expression in cells (e.g., liver cells).

[0032] Further aspects of the disclosure, including explanations of defined terms, are provided below. I. Definition

[0033] Approximately: As used herein, the term "approximately" or "about" as applied to one or more values ​​of interest refers to a value similar to the stated reference value. In certain embodiments, unless otherwise stated or clear from the context (unless such value exceeds 100% of the possible values), the term "approximately" or "about" refers to 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or a range of values ​​in either direction ("greater than" or "less than") of the stated reference value.

[0034] Administer: As used herein, the terms "administer" or "administration" mean providing a substance (e.g., an oligonucleotide) to a subject in a manner that is pharmacologically useful (e.g., to treat a condition in the subject).

[0035] Asialoglycoprotein receptor (ASGPR): As used herein, the term "asialoglycoprotein receptor" or "ASGPR" refers to a bipartite C-type lectin formed by a larger 48 kDa (ASGPR-1) and a smaller 40 kDa (ASGPR-2) subunit. ASGPR is expressed primarily on the sinusoidal surface of hepatocytes and plays a major role in the binding, internalization, and subsequent clearance of circulating glycoproteins that contain terminal galactose or N-acetylgalactosamine residues (asialoglycoproteins).

[0036] Complementary: As used herein, the term "complementary" refers to a structural relationship between two nucleotides (e.g., on two opposing nucleic acids, or on opposing regions of a single nucleic acid strand) or two nucleotide sequences that allows the two nucleotides or two nucleotide sequences to base pair with each other. For example, purine nucleotides of one nucleic acid that are complementary to pyrimidine nucleotides of an opposing nucleic acid can base pair together by forming hydrogen bonds with each other. In some embodiments, complementary nucleotides can base pair in a Watson-Crick manner, or in any other manner that allows the formation of a stable duplex. In some embodiments, as described herein, two nucleic acids may have a region of multiple nucleotides that are complementary to each other to form a region of complementarity.

[0037] Deoxyribonucleotide: As used herein, the term "deoxyribonucleotide" refers to a nucleotide that has a hydrogen instead of a hydroxyl at the 2' position of its pentose sugar, as compared to a ribonucleotide. Modified deoxyribonucleotides are deoxyribonucleotides that have one or more modifications or substitutions of atoms other than the 2' position, including modifications or substitutions in the sugar, phosphate group, or base, or modifications or substitutions of the sugar, phosphate group, or base.

[0038] Double-stranded oligonucleotide: As used herein, the term "double-stranded oligonucleotide" refers to an oligonucleotide that is substantially in a double-stranded form. In some embodiments, the complementary base pairs of the duplex region(s) of the double-stranded oligonucleotide are formed between the antiparallel sequence of nucleotides of the covalently separated nucleic acid strands. In some embodiments, the complementary base pairs of the duplex region(s) of the double-stranded oligonucleotide are formed between the antiparallel sequence of nucleotides of the covalently linked nucleic acid strands. In some embodiments, the complementary base pairs of the duplex region(s) of the double-stranded oligonucleotide are formed from a single nucleic acid strand that is folded back (e.g., via a hairpin) to provide a complementary antiparallel sequence of nucleotides that base-pair with each other. In some embodiments, the double-stranded oligonucleotide comprises two covalently separated nucleic acid strands that are fully duplexed with each other. However, in some embodiments, the double-stranded oligonucleotide comprises two covalently separated nucleic acid strands that are partially duplexed, e.g., with an overhang at one or both ends. In some embodiments, the double-stranded oligonucleotide comprises an antiparallel sequence of nucleotides that are partially complementary and thus may have one or more mismatches, which may include internal or terminal mismatches.

[0039] Duplex: As used herein, the term "duplex" with respect to nucleic acids (eg, oligonucleotides) refers to the structure formed via complementary base-pairing of two antiparallel sequences of nucleotides.

[0040] Excipient: As used herein, the term "excipient" refers to a non-therapeutic agent that may be included in a composition, for example, to provide or contribute to a desired consistency or stabilizing effect.

[0041] Hepatocyte: As used herein, the term "hepatocyte(s)" refers to cells of the liver parenchyma. These cells comprise approximately 70-85% of the liver mass and produce serum albumin, fibrinogen, and the prothrombin group of clotting factors (excluding factors 3 and 4). Markers of hepatocyte lineage cells include, but are not limited to, transthyretin (Ttr), glutamine synthetase (Glul), hepatocyte nuclear factor 1a (Hnf1a), and hepatocyte nuclear factor 4a (Hnf4a). Markers of mature hepatocytes include, but are not limited to, cytochrome P450 (Cyp3a11), fumarylacetoacetate hydrolase (Fah), glucose 6-phosphate (G6p), albumin (Alb), and OC2-2F8. See, e.g., Huch et al., (2013), Nature, 494(7436):247-250, the contents of which regarding hepatocyte markers are incorporated herein by reference.

[0042] Hepatitis B Virus: As used herein, the term "Hepatitis B Virus" or "HBV" refers to a small DNA virus belonging to the Hepadnaviridae family and classified as the type species of the Orthohepadnavirus genus. The HBV virion (virion) contains an outer lipid coat and an icosahedral nucleocapsid core made of proteins. The nucleocapsid generally encapsulates viral DNA and a DNA polymerase with reverse transcriptase activity similar to retroviruses. Embedded in the HBV coat are proteins involved in viral binding and entry into susceptible cells. HBV, which attacks the liver, is classified according to at least 10 genotypes (A-J) based on the sequence. In general, there are four genes encoded by the genome, which are designated C, P, S, and X. The core protein is encoded by gene C (HBcAg) and is preceded by an upstream in-frame AUG initiation codon from which the precore protein is generated. HBeAg is generated by proteolytic processing of the precore protein. The DNA polymerase is encoded by gene P. Gene S encodes the surface antigen (HBsAg). The HBsAg gene is one long open reading frame, but contains three in-frame "start" (ATG) codons that divide the gene into three segments, pre-S1, pre-S2, and S. The presence of multiple initiation codons results in the generation of three different sized polypeptides, designated large, medium, and small (pre-S1+pre-S2+S, pre-S2+S, or S). The ratio of these may be 1:1:4 (Heermann et al., 1984).

[0043] Hepatitis B virus (HBV) proteins can be organized into several categories and functions. The polymerase functions as a reverse transcriptase (RT) to produce viral DNA from the pregenomic RNA (pgRNA) and as a DNA-dependent polymerase to produce covalently closed circular DNA (cccDNA) from the viral DNA. The polymerase covalently binds to the 5' end of the minus strand. The core protein produces the viral capsid and secreted E antigen. The surface antigen is a hepatocyte internalization ligand and is also the major component of the aviral spherical and filamentous particles. Aviral particles are produced >1000 times more often than Dane particles (infectious virus particles) and can act as immune decoys.

[0044] Hepatitis B virus surface antigen: As used herein, the term "hepatitis B virus surface antigen" or "HBsAg" refers to the S domain protein encoded by gene S (e.g., ORF S) of the HBV genome. Hepatitis B virus particles carry viral nucleic acid in a core particle that is covered by three proteins encoded by gene S. These three proteins are the large surface protein, the intermediate surface protein, and the major surface protein. Among these proteins, the major surface protein is generally about 226 amino acids and contains only the S domain.

[0045] Infection: As used herein, the term "infection" refers to the pathogenic invasion and / or spread of a microorganism, such as a virus, in a subject. Infection may be lysogenic, e.g., viral DNA may lie dormant in a cell. Alternatively, infection may be lytic, e.g., the virus actively replicates and causes the destruction of infected cells. Infection may or may not cause clinically evident symptoms. Infection may remain localized or spread, e.g., via the blood or lymphatic system of a subject. For example, an individual infected with HBV can be identified by detection of one or more of viral load, surface antigen (HBsAg), e-antigen (HBeAg), and various other assays for detecting HBV infection known in the art. Assays for detecting HBV infection include testing serum or blood samples for the presence or absence of HBsAg and / or HBeAg, and optionally screening for the presence or absence of one or more viral antibodies (e.g., IgM and / or IgG) to account for periods during which HBV antigens may be at undetectable levels.

[0046] Hepatitis: As used herein, the term "hepatitis" or "hepatitis" refers to a physical condition involving swelling, dysfunction, and / or pain in the liver, especially as a result of injury or infection, such as from exposure to a hepatotoxic agent. Symptoms include jaundice (yellowing of the skin and eyes), fatigue, weakness, nausea, vomiting, loss of appetite, and weight loss. If left untreated, hepatitis can progress to fibrosis, cirrhosis, liver failure, or liver cancer.

[0047] Hepatic fibrosis: As used herein, the term "hepatic fibrosis" or "fibrosis of the liver" refers to the excessive accumulation in the liver of extracellular matrix proteins, including collagens (I, III, and IV), fibronectin, undulin, elastin, laminin, hyaluronan, and proteoglycans, which result from inflammation and liver cell death. If left untreated, hepatic fibrosis can progress to cirrhosis, liver failure, and liver cancer.

[0048] Loop: As used herein, the term "loop" refers to an unpaired region of a nucleic acid (e.g., an oligonucleotide) flanked on either side by two antiparallel regions of nucleic acid that are sufficiently complementary to each other such that under appropriate hybridization conditions (e.g., in a phosphate buffer, in a cell), the two antiparallel regions flanking the unpaired region hybridize and form a duplex (referred to as a "stem").

[0049] Modified internucleotide linkage: As used herein, the term "modified internucleotide linkage" refers to an internucleotide linkage that has one or more chemical modifications compared to a reference internucleotide linkage that includes a phosphodiester bond. In some embodiments, the modified nucleotide is a non-naturally occurring linkage. Typically, the modified internucleotide linkage confers one or more desirable properties to the nucleic acid in which the modified internucleotide linkage is present. For example, the modified nucleotide may improve thermal stability, resistance to degradation, resistance to nucleases, solubility, bioavailability, biological activity, reduced immunogenicity, etc.

[0050] Modified nucleotide: As used herein, the term "modified nucleotide" refers to a nucleotide having one or more chemical modifications compared to a corresponding reference nucleotide selected from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, adenine deoxyribonucleotide, guanine deoxyribonucleotide, cytosine deoxyribonucleotide, and thymidine deoxyribonucleotide. In some embodiments, the modified nucleotide is a non-naturally occurring nucleotide. In some embodiments, the modified nucleotide has one or more chemical modifications in its sugar, nucleobase, and / or phosphate group. In some embodiments, the modified nucleotide has one or more chemical moieties conjugated to the corresponding reference nucleotide. Typically, the modified nucleotide confers one or more desirable properties to the nucleic acid in which the modified nucleotide is present. For example, the modified nucleotide may improve thermal stability, resistance to degradation, resistance to nucleases, solubility, bioavailability, biological activity, reduced immunogenicity, etc.

[0051] Nicked tetraloop structure: A "nicked tetraloop structure" is a structure of an RNAi oligonucleotide characterized by separate sense (passenger) and antisense (guide) strands, where the sense strand has a region complementary to the antisense strand, and at least one of the strands, typically the sense strand, has a tetraloop configured to stabilize an adjacent stem region formed within at least one strand.

[0052] Oligonucleotide: As used herein, the term "oligonucleotide" refers to a short nucleic acid, for example, less than 100 nucleotides in length. An oligonucleotide may be single-stranded or double-stranded. An oligonucleotide may or may not have a double-stranded region. As a non-limiting set of examples, an oligonucleotide may be, but is not limited to, a small interfering RNA (siRNA), a microRNA (miRNA), a short hairpin RNA (shRNA), a dicer substrate interfering RNA (dsiRNA), an antisense oligonucleotide, a short siRNA, or a single-stranded siRNA. In some embodiments, the double-stranded oligonucleotide is an RNAi oligonucleotide.

[0053] Overhang: As used herein, the term "overhang" refers to terminal unpaired nucleotides that originate from one strand or region that extends beyond the end of the complementary strand with which it forms a duplex. In some embodiments, an overhang comprises one or more unpaired nucleotides that extend from the duplex region at the 5'-end or 3'-end of a double-stranded oligonucleotide. In certain embodiments, an overhang is a 3' or 5' overhang on the antisense or sense strand of a double-stranded oligonucleotide.

[0054] Phosphate analog: As used herein, the term "phosphate analog" refers to a chemical moiety that mimics the electrostatic and / or steric properties of a phosphate group. In some embodiments, the phosphate analog is located at the 5'-terminal nucleotide of an oligonucleotide in place of the 5'-phosphate, which is often subject to enzymatic removal. In some embodiments, the 5' phosphate analog comprises a phosphatase-resistant linkage. Examples of phosphate analogs include 5' phosphonic acids, such as 5' methylene phosphonate (5'-MP) and 5'-(E)-vinyl phosphonate (5'-VP). In some embodiments, an oligonucleotide has a phosphate analog at the 4' carbon position of the sugar of the 5'-terminal nucleotide (referred to as a "4'-phosphate analog"). An example of a 4'-phosphate analog is an oxymethyl phosphonate, in which the oxygen atom of the oxymethyl group is attached to the sugar moiety (e.g., at its 4'-carbon) or an analog thereof. See, for example, U.S. Provisional Application No. 62 / 383,207, filed September 2, 2016, and U.S. Provisional Application No. 62 / 393,401, filed September 12, 2016, the contents of each of which are incorporated herein by reference with respect to phosphate analogues. Other modifications have been developed for the 5' end of oligonucleotides (see, for example, WO 2011 / 133871, U.S. Pat. No. 8,927,513, and Prakash et al., (2015), Nucleic Acids Res., 43(6):2993-3011, the contents of each of which are incorporated herein by reference with respect to phosphate analogues).

[0055] Reduced expression: As used herein, the term "reduced expression" of a gene refers to a decrease in the amount of RNA transcript or protein encoded by the gene and / or a decrease in the amount of activity of the gene in a cell or subject, compared to an appropriate reference cell or subject. For example, treatment of cells with a double-stranded oligonucleotide (e.g., one having an antisense strand complementary to the HBsAg mRNA sequence) may reduce the amount of RNA transcript, protein and / or enzyme activity (e.g., encoded by the S gene of the HBV genome) compared to cells not treated with the double-stranded oligonucleotide. Similarly, "reduced expression" as used herein refers to an effect that results in reduced expression of a gene (e.g., the S gene of the HBV genome).

[0056] Region of complementarity: As used herein, the term "region of complementarity" refers to a nucleotide sequence of a nucleic acid (e.g., a double-stranded oligonucleotide) that is sufficiently complementary to an antiparallel sequence of nucleotides to permit hybridization between the two sequences of nucleotides under appropriate hybridization conditions, such as, for example, in a phosphate buffer, in a cell, etc.

[0057] Ribonucleotide: As used herein, the term "ribonucleotide" refers to a nucleotide having ribose as its pentose sugar containing a hydroxyl group at its 2' position. A modified ribonucleotide is a ribonucleotide that has one or more modifications or substitutions of an atom other than the 2' position, such as a modification or substitution of the ribose, the phosphate group, or the base.

[0058] RNAi Oligonucleotide: As used herein, the term "RNAi oligonucleotide" refers to either: (a) a double-stranded oligonucleotide having a sense strand (passenger) and an antisense strand (guide), where the antisense strand or a portion of the antisense strand is used by Argonaute 2 (Ago2) endonuclease to cleave the target mRNA; or (b) a single-stranded oligonucleotide having a single antisense strand, where the antisense strand (or a portion of the antisense strand) is used by Ago2 endonuclease to cleave the target mRNA.

[0059] Strand: As used herein, the term "strand" refers to a single continuous sequence of nucleotides linked together via internucleotide bonds (e.g., phosphodiester bonds, phosphorothioate bonds). In some embodiments, the strand has two free ends, e.g., a 5' end and a 3' end.

[0060] Subject: As used herein, the term "subject" refers to any mammal, including mice, rabbits, and humans. In one embodiment, the subject is a human or non-human primate. The terms "individual" or "patient" may be used interchangeably with "subject."

[0061] Synthetic: As used herein, the term "synthetic" refers to a nucleic acid or other molecule that is synthesized artificially (e.g., using a machine (e.g., a solid-state nucleic acid synthesizer)) or that is not derived from a natural source (e.g., a cell or organism) that normally produces the molecule.

[0062] Targeting Ligand: As used herein, the term "targeting ligand" refers to a molecule (e.g., carbohydrate, amino sugar, cholesterol, polypeptide, or lipid) that selectively binds to a cognate molecule (e.g., a receptor) in a tissue or cell of a subject and is conjugated to another substance for the purpose of targeting the other substance to the tissue or cell of a subject. For example, in some embodiments, a targeting ligand may be conjugated to an oligonucleotide for the purpose of targeting the oligonucleotide to a specific tissue or cell of a subject. In some embodiments, the targeting ligand selectively binds to a cell surface receptor. Thus, in some embodiments, the targeting ligand when conjugated to an oligonucleotide facilitates delivery of the oligonucleotide to a specific cell through selective binding to a receptor expressed on the surface of the cell and endosomal internalization by the cell of a complex comprising the oligonucleotide, the targeting ligand, and the receptor. In some embodiments, the targeting ligand is conjugated to the oligonucleotide via a linker that is cleaved after or during cellular internalization, thereby releasing the oligonucleotide from the targeting ligand inside the cell.

[0063] Tetraloop: As used herein, the term "tetraloop" refers to a loop that enhances the stability of a contiguous duplex formed by hybridization of adjacent sequences of nucleotides. The enhanced stability can be achieved by lowering the melting temperature (T m ), which is detectable as an increase in the T of adjacent stem duplexes expected on average from a set of loops of comparable length composed of randomly selected nucleotide sequences. mFor example, in 10 mM NaHPO4 added to a hairpin containing a duplex at least 2 base pairs in length, the tetraloop provides a melting temperature of at least 50°C, at least 55°C, at least 56°C, at least 58°C, at least 60°C, at least 65°C, or at least 75°C. In some embodiments, the tetraloop can stabilize the base pairs of the adjacent stem duplex through stacking interactions. In addition, interactions between nucleotides in the tetraloop include, but are not limited to, non-Watson-Crick base pairing, stacking interactions, hydrogen bonding, and contact interactions (Cheong et al., Nature, 1990 Aug. 16; 346(6285):680-2; Heus and Pardi, Science, 1991 Jul. 12; 253(5016):191-4). In some embodiments, the tetraloop comprises 4 or 5 nucleotides. In certain embodiments, the tetraloop comprises or consists of 3, 4, 5, or 6 nucleotides, which may or may not be modified (e.g., conjugated to a targeting moiety). In one embodiment, the tetraloop consists of 4 nucleotides. Any nucleotide may be used in the tetraloop, and the standard IUPAC-IUB symbols for such nucleotides may be used as described in Cornish-Bowden (1985) Nucl. Acids Res. 13:3021-3030. For example, the letter "N" denotes the possibility of any base being present at that position, the letter "R" may be used to indicate the presence of A (adenine) or G (guanine) at that position, and "B" may be used to indicate the presence of C (cytosine), G (guanine), or T (thymine) at that position. Examples of tetraloops include the UNCG family of tetraloops (e.g., UUCG), the GNRA family of tetraloops (e.g., GAAA), and the CUUG tetraloop (Woese et al., Proc Natl Acad Sci USA, 1990 Nov;87(21):8467-71; Antao et al., Nucleic Acids Res. 1991 Nov. 11;19(21):5901-5).Examples of DNA tetraloops include the d(GNNA) family of tetraloops (e.g., d(GTTA)), the d(GNRA) family of tetraloops, the d(GNAB) family of tetraloops, the d(CNNG) family of tetraloops, and the d(TNCG) family of tetraloops (e.g., d(TTCG)). See, e.g., Nakano et al., Biochemistry, 41(48), 14281-14292, 2002; SHINJI et al., Nippon Kagakkai Koen Yokoshu, Vol. 78; No. 2; p. 731 (2000), which are incorporated herein by reference for their relevant disclosures. In some embodiments, the tetraloop is comprised within a nicked tetraloop structure.

[0064] Treatment: As used herein, the term "treat" refers to the act of caring for a subject in need thereof, for example, via administration of a therapeutic agent (e.g., an oligonucleotide) to the subject. The purpose is to improve the health and / or well-being of the subject with respect to a current condition (e.g., current HBV infection) or to prevent or reduce the likelihood of the occurrence of a condition (e.g., prevention of liver fibrosis, hepatitis, liver cancer, or other conditions associated with HBV infection). In some embodiments, treatment includes reducing the frequency or severity of at least one sign, symptom, or contributing factor of a condition (e.g., HBV infection or related condition) experienced by the subject. During HBV infection, subjects may exhibit symptoms such as yellowing of the skin or eyes (jaundice), dark urine, extreme fatigue, nausea, vomiting, abdominal pain, etc. Thus, in some embodiments, treatments provided herein may reduce the frequency or severity of one or more such symptoms. However, HBV infection may progress to one or more liver conditions, such as cirrhosis, liver fibrosis, hepatitis, liver cancer, etc. Thus, in some embodiments, the treatments provided herein may reduce the frequency or severity of, or prevent or ameliorate, one or more of such conditions. II. Oligonucleotide Inhibitors i.HBV surface antigen targeting

[0065] In some embodiments, oligonucleotide-based inhibitors of HBV surface antigen expression are provided herein that can be used to achieve therapeutic benefit. Through investigation of HBV surface antigen mRNA and various oligonucleotide tests, potent oligonucleotides have been developed that reduce HBV surface antigen (HBsAg) expression for treating HBV infection. In some embodiments, oligonucleotides provided herein are designed to target HBsAg mRNA sequences that cover >95% of the known HBV genome across all known genotypes. In some embodiments, such oligonucleotides reduce HBV pregenomic RNA (pgRNA) and HBsAg mRNA in the liver by more than 90%. In some embodiments, the reduction in HBsAg expression is sustained over an extended period of time after a single dose or treatment regimen.

[0066] Thus, in some embodiments, the oligonucleotides provided herein are designed to have a region of complementarity to HBsAg mRNA for the purpose of targeting and inhibiting expression of the transcripts in cells. The region of complementarity is generally a region of suitable length and base content for annealing the oligonucleotide (or a strand thereof) to HBsAg mRNA for the purpose of inhibiting HBsAg mRNA expression. In some embodiments, the region of complementarity is at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 nucleotides in length. In some embodiments, the oligonucleotides provided herein have a region of complementarity to HBsAg mRNA ranging from 12-30 (e.g., 12-30, 12-22, 15-25, 17-21, 18-27, 19-27, or 15-30) nucleotides in length. In some embodiments, the oligonucleotides provided herein have a region of complementarity to HBsAg mRNA that is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.

[0067] In some embodiments, the oligonucleotides provided herein are designed to target an mRNA sequence encoding HBsAg. For example, in some embodiments, oligonucleotides are provided having an antisense strand with a region complementary to a sequence set forth in ACAANAAUCCUCACAAUA (SEQ ID NO: 1), where N refers to any nucleotide (A, G, T, or C). In some embodiments, the oligonucleotide further comprises a sense strand that forms a double-stranded region with the antisense strand. In some embodiments, the sense strand has a region complementary to a sequence set forth in UUNUUGUGAGGAUUN (SEQ ID NO: 2). In some embodiments, the sense strand comprises a region complementary to a sequence set forth in (shown in the 5' to 3' direction): UUAUUGUGAGGAUUNUUGUC (SEQ ID NO: 3).

[0068] In some embodiments, the antisense strand comprises or consists of the sequence set forth in UUAUUGUGAGGAUUNUUGUCGG (SEQ ID NO: 4). In some embodiments, the antisense strand comprises or consists of the sequence set forth in UUAUUGUGAGGAUUCUUGUCGG (SEQ ID NO: 5). In some embodiments, the antisense strand comprises or consists of the sequence set forth in UUAUUGUGAGGAUUUUUUGUCGG (SEQ ID NO: 5.1). In some embodiments, the sense strand comprises or consists of the sequence set forth in ACAANAAUCCUCACAAUAA (SEQ ID NO: 6). In some embodiments, the sense strand comprises or consists of the sequence set forth in GACAANAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 7). In some embodiments, the sense strand comprises or consists of the sequence set forth in GACAAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 8). In some embodiments, the sense strand comprises or consists of the sequence set forth in GACAAGAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO:8.1).

[0069] In some embodiments, an oligonucleotide for reducing expression of HBsAg mRNA comprises a sense strand that forms a duplex region with the antisense strand, the sense strand comprising a sequence set forth in any one of SEQ ID NOs: 6-8.1, and the antisense strand comprising a sequence set forth in any one of SEQ ID NOs: 4-5.1. In some embodiments, the sense strand comprises 2'-fluoro and 2'-O-methyl modified nucleotides and at least one phosphorothioate internucleotide linkage. In some embodiments, the sense strand is conjugated to an N-acetylgalactosamine (GalNAc) moiety. In some embodiments, the antisense strand comprises 2'-fluoro and 2'-O-methyl modified nucleotides and at least one phosphorothioate internucleotide linkage. In some embodiments, the 4'-carbon of the sugar of the 5'-nucleotide of the antisense strand comprises a phosphate analog. In some embodiments, the antisense strand and the sense strand each contain 2'-fluoro and 2'-O-methyl modified nucleotides and at least one phosphorothioate internucleotide linkage, the 4'-carbon of the sugar of the 5'-nucleotide of the antisense strand contains a phosphate analog, and the sense strand is conjugated to an N-acetylgalactosamine (GalNAc) moiety.

[0070] In some embodiments, a sense strand comprising a sequence set forth in any one of SEQ ID NOs: 7-8.1 comprises 2'-fluoro modified nucleotides at positions 3, 8-10, 12, 13, and 17. In some embodiments, the sense strand comprises 2'-O-methyl modified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26, and 31-36. In some embodiments, the sense strand comprises one phosphorothioate internucleotide linkage. In some embodiments, the sense strand comprises a phosphorothioate internucleotide linkage between the nucleotides at positions 1 and 2. In some embodiments, the sense strand is conjugated to an N-acetylgalactosamine (GalNAc) moiety.

[0071] In some embodiments, the antisense strand comprising a sequence set forth in any one of SEQ ID NOs: 4-5.1 comprises 2'-fluoro modified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16, and 19. In some embodiments, the antisense strand comprises 2'-O-methyl modified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18, and 20-22. In some embodiments, the antisense strand comprises three phosphorothioate internucleotide linkages. In some embodiments, the antisense strand comprises phosphorothioate internucleotide linkages between nucleotides 1 and 2, between nucleotides 2 and 3, between nucleotides 3 and 4, between nucleotides 20 and 21, and between nucleotides 21 and 22. In some aspects, the 4'-carbon of the sugar of the 5'-nucleotide of the antisense strand comprises a phosphate analog. ii. Double-stranded oligonucleotides

[0072] Oligonucleotides useful for targeting HBsAg mRNA expression in the methods of the present disclosure have various structures, including RNAi, antisense, miRNA, etc. Any of the structures described herein or elsewhere can be used as a backbone to incorporate or target the sequences described herein. Double-stranded oligonucleotides for targeting HBV antigen expression (e.g., via the RNAi pathway) generally have a sense strand and an antisense strand that form a duplex with each other. In some embodiments, the sense strand and the antisense strand are not covalently linked. However, in some embodiments, the sense strand and the antisense strand are covalently linked.

[0073] In some embodiments, the double-stranded oligonucleotide for reducing the expression of HBsAg mRNA involves RNA interference (RNAi). For example, RNAi oligonucleotides have been developed in which each strand has a size of 19-25 nucleotides and at least one 3' overhang is 1-5 nucleotides (see, e.g., U.S. Pat. No. 8,372,968). Longer oligonucleotides have also been developed that are processed by Dicer to generate active RNAi products (see, e.g., U.S. Pat. No. 8,883,996). Further research has produced extended double-stranded oligonucleotides in which at least one end of at least one strand extends beyond the double target region, including structures in which one of the strands contains a thermodynamically stable tetraloop structure (see, e.g., U.S. Pat. Nos. 8,513,207 and 8,927,705, and WO2010033225, the disclosures of which are incorporated herein by reference). Such structures can include single-stranded extensions (on one or both sides of the molecule) as well as double-stranded extensions.

[0074] In some embodiments, the oligonucleotides provided herein are cleavable by Dicer enzyme. Such oligonucleotides may have an overhang (e.g., 1, 2, or 3 nucleotides long) at the 3' end of the sense strand. Such oligonucleotides (e.g., siRNAs) may include a 21-nucleotide guide strand that is antisense to the target RNA and a complementary passenger strand, where both strands anneal to form a 19 bp duplex and a 2-nucleotide overhang at one or both of the 3' ends. It is also possible to design longer oligonucleotides, including oligonucleotides with a 23-nucleotide guide strand and a 21-nucleotide passenger strand, where there is a blunt end on the right side of the molecule (3' end of the passenger strand / 5' end of the guide strand) and a 2-nucleotide 3'-guide strand overhang on the left side of the molecule (5' end of the passenger strand / 3' end of the guide strand). In such molecules, there is a 21-base pair duplex region. See, for example, U.S. Patent Nos. 9,012,138, 9,012,621, and 9,193,753, each of which is incorporated herein by reference for its relevant disclosure.

[0075] In some embodiments, the oligonucleotides disclosed herein may comprise a sense strand and an antisense strand, both in the range of 17-26 (e.g., 17-26, 20-25, 19-21, or 21-23) nucleotides in length. In some embodiments, the sense and antisense strands are of equal length. In some embodiments, for oligonucleotides in which both the sense and antisense strands are in the range of 21-23 nucleotides in length, the 3' overhang on the sense strand, the antisense strand, or both strands is 1 or 2 nucleotides in length. In some embodiments, the oligonucleotide has a 23 nucleotide guide strand and a 21 nucleotide passenger strand, where there is a blunt end on the right side of the molecule (3' end of the passenger strand / 5' end of the guide strand) and a 2 nucleotide 3'-guide strand overhang on the left side of the molecule (5' end of the passenger strand / 3' end of the guide strand). In such molecules, there is a duplex region of 21 base pairs. In some embodiments, the oligonucleotide comprises a 25 nucleotide sense strand and a 27 nucleotide antisense strand, where the antisense strand is incorporated into mature RISC upon actinization by the Dicer enzyme.

[0076] Other oligonucleotide designs for use in the compositions and methods disclosed herein include 16-mer siRNAs (see, e.g., Nucleic Acids in Chemistry and Biology. Blackburn (ed.), Royal Society of Chemistry, 2006), shRNA (e.g., with a stem of 19 bp or less; see, e.g., Moore et al., Methods Mol. Biol. 2010;629:141-158), blunt siRNA (e.g., 19 bp long; see, e.g., Kraynack and Baker, RNA 12, 163-176 (2006)), asymmetric siRNA (aiRNA; see, e.g., Sun et al., Nat. Biotechnol. 26, 1379-1382 (2008)), asymmetric short duplex siRNA (see, e.g., Chang et al., Mol. Ther. 2009 Apr;17(4):725-32), forked siRNA (see, e.g., Hohjoh, FEBS Letters, Vol. 557, No. 1-3; January 2004, pp. 193-198), single-stranded siRNA (Elsner; Nature Biotechnology 30, 1063 (2012)), dumbbell-shaped circular siRNA (see, e.g., Abe et al., J Am Chem Soc 129:15108-15109 (2007)), and small internally segmented interfering RNA (sisiRNA; see, e.g., Bramsen et al., Nucleic Acids Res. 2007 Sep;35(17):5886-5897). Each of the foregoing references is incorporated by reference in its entirety for the relevant disclosures therein. Further non-limiting examples of oligonucleotide structures that may be used in some embodiments to reduce or inhibit expression of HBsAg include microRNAs (miRNAs), short hairpin RNAs (shRNAs), and short siRNAs (see, e.g., Hamilton et al., Embo J., 2002, 21(17):4671-4679; see also U.S. Application No. 20090099115). A antisense strand

[0077] In some embodiments, the antisense strand of oligonucleotide may be referred to as "guide strand". For example, if the antisense strand can associate with RNA-induced silencing complex (RISC) and bind to Argonaute protein, or associate or bind to one or more similar factors to direct the silencing of target gene, it may be referred to as guide strand. In some embodiments, the sense strand that is complementary to guide strand may be referred to as "passenger strand".

[0078] In some embodiments, the oligonucleotides provided herein comprise an antisense strand that is up to 50 nucleotides in length (e.g., up to 30, up to 27, up to 25, up to 21, or up to 19 nucleotides in length). In some embodiments, the oligonucleotides provided herein comprise an antisense strand that is at least 12 nucleotides in length (e.g., at least 12, at least 15, at least 19, at least 21, at least 25, or at least 27 nucleotides in length). In some embodiments, the antisense strand of the oligonucleotides disclosed herein is in the range of 12-50 or 12-30 (e.g., 12-30, 11-27, 11-25, 15-21, 15-27, 17-21, 17-25, 19-27, or 19-30) nucleotides in length. In some embodiments, the antisense strand of any one of the oligonucleotides disclosed herein is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length.

[0079] In some embodiments, the antisense strand comprises a region complementary to a sequence set forth in (shown in the 5' to 3' direction) AATCCTCACA (SEQ ID NO: 9). In some embodiments, the antisense strand comprises a sequence set forth in (shown in the 5' to 3' direction) UUGGAGGAUU (SEQ ID NO: 10). In some embodiments, the antisense strand comprises a sequence set forth in (shown in the 5' to 3' direction) TGTGAGGATT (SEQ ID NO: 11).

[0080] In some embodiments, an oligonucleotide for reducing expression of HBsAg mRNA may comprise an antisense strand having a region complementary to the sequence set forth in SEQ ID NO: 9, and one or two non-complementary nucleotides at its 3' end. In some embodiments, the antisense strand comprises a nucleotide sequence set forth in any one of SEQ ID NOs: 4-5.1.

[0081] In some embodiments, an oligonucleotide for reducing expression of HBsAg mRNA may comprise an antisense strand having a region complementary to the sequence set forth in SEQ ID NO:9, wherein the antisense strand does not have a sequence set forth in any one of the following sequences (shown in the 5' to 3' direction): TATTGTGAGGATTCTTGTCA (SEQ ID NO:12); CGGTATTGTGAGGATTCTTG (SEQ ID NO:13); TGTGAGGATTCTTGTCAACA (SEQ ID NO:14); UAUUGUGAGGAUUUUUGUCAA (SEQ ID NO:15); UGCGGUAUUGUGAGGAUUCTT (SEQ ID NO:16); ACAGCATTGTGAGGATTCTTGTC (SEQ ID NO:17); UAUUGUGAGGAUUUUUGUCAACA (SEQ ID NO:18); AUUGUGAGGAUUUUUGUCAACAA (SEQ ID NO:19); and UUGUGAGGAUUUUUGUCAACAAG (SEQ ID NO:20). In some embodiments, the antisense strand differs by no more than three nucleotides from the nucleotide sequence set forth in SEQ ID NO:4, 5, or 5.1. B sense strand

[0082] In some embodiments, the double-stranded oligonucleotide may have a sense strand up to 40 nucleotides in length (e.g., up to 40, up to 35, up to 30, up to 27, up to 25, up to 21, up to 19, up to 17, or up to 12 nucleotides in length). In some embodiments, the oligonucleotide may have a sense strand at least 12 nucleotides in length (e.g., at least 12, at least 15, at least 19, at least 21, at least 25, at least 27, at least 30, at least 35, or at least 38 nucleotides in length). In some embodiments, the oligonucleotide may have a sense strand in the range of 12-50 (e.g., 12-40, 12-36, 12-32, 12-28, 15-40, 15-36, 15-32, 15-28, 17-21, 17-25, 19-27, 19-30, 20-40, 22-40, 25-40, or 32-40) nucleotides in length. In some embodiments, the oligonucleotide may have a sense strand that is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length. In some embodiments, the sense strand of the oligonucleotide is longer than 27 nucleotides (e.g., 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides). In some embodiments, the sense strand of the oligonucleotide is longer than 25 nucleotides (e.g., 26, 27, 28, 29, or 30 nucleotides).

[0083] In some embodiments, the sense strand comprises a stem loop at its 3' end. In some embodiments, the sense strand comprises a stem loop at its 5' end. In some embodiments, the strand comprising the stem loop is in the range of 2-66 nucleotides in length (e.g., 2-66, 10-52, 14-40, 2-30, 4-26, 8-22, 12-18, 10-22, 14-26, or 14-30 nucleotides in length). In some embodiments, the strand comprising the stem loop is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the stem comprises a duplex that is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 nucleotides in length. In some embodiments, the stem loop better protects the molecule from degradation (e.g., enzymatic degradation) and promotes targeting properties for delivery to target cells. For example, in some embodiments, the loop adds nucleotides that can be modified without significantly affecting the gene expression inhibitory activity of the oligonucleotide. In certain embodiments, provided herein are oligonucleotides having a sense strand that includes (e.g., at its 3' end) a stem loop as defined below: S1-L-S2, where S1 is complementary to S2 and L forms a loop between S1 and S2 up to 10 nucleotides long (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides long).

[0084] In some embodiments, the loop (L) of the stem loop is a tetraloop (e.g., in a nick tetraloop structure). The tetraloop can include ribonucleotides, deoxyribonucleotides, modified nucleotides, and combinations thereof. Typically, the tetraloop has 4 or 5 nucleotides. c.Double chain length

[0085] In some embodiments, the duplex formed between the sense strand and the antisense strand is at least 12 (e.g., at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21) nucleotides in length. In some embodiments, the duplex formed between the sense strand and the antisense strand is in the range of 12-30 nucleotides in length (e.g., 12-30, 12-27, 12-22, 15-25, 18-30, 18-22, 18-25, 18-27, 18-30, 19-30, or 21-30 nucleotides in length). In some embodiments, the duplex formed between the sense strand and the antisense strand is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the duplex formed between the sense strand and the antisense strand does not span the entire length of the sense strand and / or the antisense strand. In some embodiments, the duplex between the sense strand and the antisense strand spans the entire length of either the sense strand or the antisense strand. In certain embodiments, the duplex between the sense strand and the antisense strand spans the entire length of both the sense strand and the antisense strand. d. Oligonucleotide ends

[0086] In some embodiments, the oligonucleotide comprises a sense strand and an antisense strand, whereby there is a 3'-overhang on either the sense strand or the antisense strand, or on both the sense strand and the antisense strand. In some embodiments, the oligonucleotides provided herein have one 5'-end that is less thermodynamically stable than the other 5'-end. In some embodiments, asymmetric oligonucleotides are provided that include a blunt end on the 3'-end of the sense strand and an overhang on the 3'-end of the antisense strand. In some embodiments, the 3'-overhang on the antisense strand is 1-8 nucleotides in length (e.g., 1, 2, 3, 4, 5, 6, 7, or 8 nucleotides in length).

[0087] Typically, RNAi oligonucleotides have a 2-nucleotide overhang at the 3' end of the antisense (guide) strand, although other overhangs are contemplated. In some embodiments, the overhang is a 3' overhang comprising 1-6 nucleotides, optionally 1-5, 1-4, 1-3, 1-2, 2-6, 2-5, 2-4, 2-3, 3-6, 3-5, 3-4, 4-6, 4-5, 5-6 nucleotides, or 1, 2, 3, 4, 5, or 6 nucleotides in length. However, in some embodiments, the overhang is a 5' overhang comprising 1-6 nucleotides, optionally 1-5, 1-4, 1-3, 1-2, 2-6, 2-5, 2-4, 2-3, 3-6, 3-5, 3-4, 4-6, 4-5, 5-6 nucleotides, or 1, 2, 3, 4, 5, or 6 nucleotides in length.

[0088] In some embodiments, one or more (e.g., 2, 3, 4) terminal nucleotides at the 3'-end or 5'-end of the sense strand and / or antisense strand are modified. For example, in some embodiments, one or two terminal nucleotides at the 3'-end of the antisense strand are modified. In some embodiments, the most extreme nucleotides at the 3'-end of the antisense strand are modified, e.g., include a 2' modification, e.g., 2'-O-methoxyethyl. In some embodiments, the one or two terminal nucleotides at the most extreme 3'-end of the antisense strand are complementary to the target. In some embodiments, the one or two nucleotides at the most extreme 3'-end of the antisense strand are not complementary to the target.

[0089] In some embodiments, a double-stranded oligonucleotide is provided that has a nicked tetraloop structure at the 3'-end sense strand and two terminal overhang nucleotides at the 3'-end of its antisense strand.In some embodiments, the two terminal overhang nucleotides are GG.Typically, one or both of the two terminal GG nucleotides of the antisense strand are complementary or not complementary to the target.

[0090] In some embodiments, the sense or antisense strand has an inverted cap nucleotide at the 5'-end and / or the 3'-end.

[0091] In some embodiments, there are one or more (e.g., 2, 3, 4, 5, 6) modified internucleotide linkages between the terminal nucleotides at the 3' or 5' ends of the sense and / or antisense strands. In some embodiments, the modified internucleotide linkages are between overhanging nucleotides at the 3' or 5' ends of the sense and / or antisense strands. e. Mismatch

[0092] In some embodiments, the oligonucleotide may have one or more (e.g., 1, 2, 3, 4, 5) mismatches between the sense and antisense strands. When there are multiple mismatches between the sense and antisense strands, the mismatches may be arranged consecutively (e.g., 2, 3 or more in a row) or may be interspersed throughout the complementary region. In some embodiments, the 3' end of the sense strand contains one or more mismatches. In one embodiment, two mismatches are incorporated into the 3' end of the sense strand. In some embodiments, base mismatches or destabilization of segments at the 3' end of the sense strand of the oligonucleotide improve the efficacy of synthetic duplexes in RNAi, possibly via facilitating processing by Dicer.

[0093] In some embodiments, the antisense strand may have a region complementary to the HBsAg transcript that contains one or more mismatches compared to the corresponding transcript sequence. The complementary region on the oligonucleotide may have up to 1, up to 2, up to 3, up to 4, up to 5, etc. mismatches, provided that the oligonucleotide maintains the ability to form complementary base pairs with the transcript under appropriate hybridization conditions. Alternatively, the complementary region of the oligonucleotide may have no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 mismatches, provided that the oligonucleotide maintains the ability to form complementary base pairs with the HBsAg mRNA under appropriate hybridization conditions. In some embodiments, when there are multiple mismatches in the complementary region, the mismatches may be located contiguously (e.g., 2, 3, 4 or more) or may be interspersed throughout the complementary region, provided that the oligonucleotide maintains the ability to form complementary base pairs with the HBsAg mRNA under appropriate hybridization conditions. iii. Single-stranded oligonucleotide

[0094] In some embodiments, the oligonucleotides for reducing HBsAg expression described herein are single-stranded oligonucleotides having complementarity to HBsAg mRNA. Such structures include, but are not limited to, single-stranded RNAi oligonucleotides. Recent efforts have demonstrated the activity of single-stranded RNAi oligonucleotides (see, e.g., Matsui et al. (May 2016), Molecular Therapy, vol. 24(5), 946-955). However, in some embodiments, the oligonucleotides provided herein are antisense oligonucleotides (ASOs). Antisense oligonucleotides are single-stranded oligonucleotides having a nucleobase sequence that, when written in the 5' to 3' direction, contains the reverse complement of a target segment of a particular nucleic acid, and are appropriately modified (e.g., as a gapmer) to induce RAaseH-mediated cleavage of that target RNA in a cell, or (e.g., as a mixmer) to inhibit translation of a target mRNA in a cell. Antisense oligonucleotides for use in the present disclosure may be modified in any suitable manner known in the art, for example, as set forth in U.S. Pat. No. 9,567,587. This document is incorporated herein by reference for its disclosure regarding modifications of antisense oligonucleotides (e.g., modifications of the length of the nucleobases (pyrimidines, purines), sugar moieties, and heterocyclic portions of the nucleobases, etc.). Antisense molecules have also been used for decades to reduce the expression of specific target genes (see, e.g., Bennett et al., Pharmacology of Antisense Drugs, Annual Review of Pharmacology and Toxicology, Vol. 57:81-105). iv. Oligonucleotide Modification

[0095] Oligonucleotides may be modified in various ways to improve or control specificity, stability, delivery, bioavailability, resistance to nuclease degradation, immunogenicity, base pairing properties, RNA distribution and cellular uptake, and other characteristics relevant for therapeutic or research applications. See, for example, Bramsen et al., Nucleic Acids Res., 2009, 37, 2867-2881; Bramsen and Kjems (Frontiers in Genetics, 3 (2012): 1-22). Thus, in some embodiments, oligonucleotides of the present disclosure may include one or more suitable modifications. In some embodiments, modified nucleotides have modifications in their base (or nucleobase), sugar (e.g., ribose, deoxyribose), or phosphate groups.

[0096] The number of modifications on an oligonucleotide and the location of the nucleotide modifications can affect the properties of the oligonucleotide. For example, an oligonucleotide may be delivered in vivo by conjugating or incorporating the oligonucleotide into a lipid nanoparticle (LNP) or similar carrier. However, if the oligonucleotide is not protected by a LNP or similar carrier, it may be advantageous to modify at least some of its nucleotides. Thus, in certain embodiments of any of the oligonucleotides provided herein, all or nearly all nucleotides of the oligonucleotide are modified. In certain embodiments, more than half of the nucleotides are modified. In certain embodiments, less than half of the nucleotides are modified. Typically, for naked delivery, all sugars are modified at the 2' position. These modifications may be reversible or irreversible. In some embodiments, the oligonucleotides disclosed herein have a sufficient number and type of modified nucleotides to obtain the desired properties (e.g., protection from enzymatic degradation, ability to target desired cells after in vivo administration, and / or thermodynamic stability). a. Sugar modification

[0097] In some embodiments, modified sugars (also referred to herein as sugar analogs) include modified deoxyribose or ribose moieties, e.g., with one or more modifications at the 2', 3', 4', and / or 5' carbon positions of the sugar. In some embodiments, modified sugars may also include non-natural alternative carbon structures such as those found in locked nucleic acids ("LNAs") (see, e.g., Koshkin et al. (1998), Tetrahedron 54, 3607-3630), unlocked nucleic acids ("UNAs") (see, e.g., Snead et al. (2013), Molecular Therapy-Nucleic Acids, 2, e103), and bridged nucleic acids ("BNAs") (see, e.g., Imanishi and Obika (2002), The Royal Society of Chemistry, Chem. Commun., 1653-1659). Koshkin et al., Snead et al., and Imanishi and Obika are incorporated herein by reference for their disclosures regarding sugar modifications.

[0098] In some embodiments, the nucleotide modification in the sugar comprises a 2'-modification. The 2'-modification may be 2'-aminoethyl, 2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl, and 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid. Typically, the modification is 2'-fluoro, 2'-O-methyl, or 2'-O-methoxyethyl. In some embodiments, the modification in the sugar comprises a modification of the sugar ring, which may comprise a modification of one or more carbons of the sugar ring. For example, the modification of the sugar of the nucleotide may comprise the 2'-oxygen of the sugar, which is attached to the 1'-carbon or 4'-carbon of the sugar, or the 2'-oxygen is attached to the 1'-carbon or 4'-carbon via an ethylene or methylene bridge. In some embodiments, the modified nucleotide has an acyclic sugar that lacks a 2'-carbon to 3'-carbon bond. In some embodiments, the modified nucleotide has a thiol group, for example, at the 4' position of the sugar.

[0099] In some embodiments, the terminal 3' end group (e.g., the 3'-hydroxyl) is a phosphate group or other group, which can be used, for example, to attach a linker, adapter or label, or to directly attach the oligonucleotide to another nucleic acid. b. 5' terminal phosphate

[0100] In some embodiments, the 5' terminal phosphate group of the oligonucleotide promotes interaction with Argonaute 2. However, oligonucleotides containing a 5' phosphate group are susceptible to degradation by phosphatases or other enzymes, which may limit their bioavailability in vivo. In some embodiments, the oligonucleotide comprises an analog of the 5' phosphate that is resistant to such degradation. In some embodiments, the phosphate analog may be an oxymethylphosphonate, vinylphosphonate, or malonylphosphonate. In certain embodiments, the 5' end of the oligonucleotide chain is linked to a chemical moiety that mimics the electrostatic and steric properties of the natural 5'-phosphate group (a "phosphate mimetic") (see, e.g., Prakash et al., (2015), Nucleic Acids Res., Nucleic Acids Res. 2015 Mar. 31;43(6):2993-3011, the contents of which regarding phosphate analogs are incorporated herein by reference). Many phosphate mimics that can be attached to the 5' end have been developed (see, for example, U.S. Pat. No. 8,927,513, the contents of which are incorporated herein by reference with respect to phosphate analogues). Other modifications have also been developed for the 5' end of oligonucleotides (see, for example, WO 2011 / 133871, the contents of which are incorporated herein by reference with respect to phosphate analogues). In certain embodiments, a hydroxyl group is attached to the 5' end of oligonucleotides.

[0101] In some embodiments, the oligonucleotides have a phosphate analog at the 4'-carbon position of the sugar (referred to as a "4'-phosphate analog"). See, for example, U.S. Provisional Application No. 62 / 383,207, filed September 2, 2016, entitled "4'-Phosphate Analogs and Oligonucleotides Comprising the Same," and U.S. Provisional Application No. 62 / 393,401, filed September 12, 2016, entitled "4'-Phosphate Analogs and Oligonucleotides Comprising the Same," each of which is incorporated herein by reference with respect to the contents thereof with respect to phosphate analogs. In some embodiments, the oligonucleotides provided herein include a 4'-phosphate analog at the 5'-terminal nucleotide. In some embodiments, the phosphate analog is an oxymethyl phosphonate, in which the oxygen atom of the oxymethyl group is attached to the sugar moiety (e.g., at the 4' carbon) or an analog thereof. In other embodiments, the 4'-phosphate analog is a thiomethylphosphonate or an aminomethylphosphonate, where the sulfur atom of the thiomethyl group or the nitrogen atom of the aminomethyl group is attached to the 4'-carbon of the sugar moiety or analog thereof. In certain embodiments, the 4'-phosphate analog is an oxymethylphosphonate. In some embodiments, the oxymethylphosphonate is represented by the formula -O-CH2-PO(OH)2 or -O-CH2-PO(OR)2, where R is independently selected from H, CH3, an alkyl group, CH2CH2CN, CH2OCOC(CH3)3, CHOCH2CH2Si(CH3)3, or a protecting group. In certain embodiments, the alkyl group is CH2CH3. More typically, R is independently selected from H, CH3, or CH2CH3.

[0102] In certain embodiments, the phosphate analog attached to the oligonucleotide is a methoxyphosphonate (MOP). In certain embodiments, the phosphate analog attached to the oligonucleotide is a 5' mono-methyl protected MOP. In some embodiments, the following uridine nucleotides containing a phosphate analog: [ka] may be used, for example, at the first position of the guide (antisense) strand, this modified nucleotide is called [Mephosphonate-4O-mU] or 5'-methoxy,phosphonate-4'oxy-2'-O-methyluridine. C modified internucleoside linkage

[0103] In some embodiments, the phosphate modification or substitution may result in an oligonucleotide that includes at least one (e.g., at least one, at least two, at least three, or at least five) modified internucleotide linkages. In some embodiments, any one of the oligonucleotides disclosed herein includes 1-10 (e.g., 1-10, 2-8, 4-6, 3-10, 5-10, 1-5, 1-3, or 1-2) modified internucleotide linkages. In some embodiments, any one of the oligonucleotides disclosed herein includes 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 modified internucleotide linkages.

[0104] The modified internucleotide linkage may be a phosphorothioate linkage, a phosphorothioate linkage, a phosphotriester linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a phosphoramidite linkage, a phosphonate linkage, or a boranophosphate linkage. In some embodiments, at least one modified internucleotide linkage of any one of the oligonucleotides disclosed herein is a phosphorothioate linkage. D. Base modification

[0105] In some embodiments, the oligonucleotides provided herein have one or more modified nucleobases. In some embodiments, the modified nucleobase (also referred to herein as a base analog) is attached to the 1' position of the nucleotide sugar moiety. In certain embodiments, the modified nucleobase is a nitrogenous base. In certain embodiments, the modified nucleobase does not contain a nitrogen atom. See, for example, US Published Patent Application No. 20080274462. In some embodiments, the modified nucleotide contains a universal base. However, in certain embodiments, the modified nucleotide does not contain a nucleobase (abasic).

[0106] In some embodiments, the universal base is a heterocyclic moiety that is located at the 1' position of a nucleotide sugar moiety in a modified nucleotide or at an equivalent position in a nucleotide sugar moiety substitution that, when present in a duplex, can face multiple types of bases without substantially altering the structure of the duplex. In some embodiments, a single stranded nucleic acid containing a universal base has a higher T-position than a duplex formed with a complementary nucleic acid, as compared to a reference single stranded nucleic acid (e.g., an oligonucleotide) that is fully complementary to a target nucleic acid. m In some embodiments, however, a single stranded nucleic acid containing a universal base has a lower T than a duplex formed with a nucleic acid containing a mismatched base, as compared to a reference single stranded nucleic acid in which the universal base is replaced with a base that generates a single mismatch. m The β-amino acid forms a duplex with the target nucleic acid at a high concentration.

[0107] Non-limiting examples of universal binding nucleotides include inosine, 1-β-D-ribofuranosyl-5-nitroindole, and / or 1-β-D-ribofuranosyl-3-nitropyrrole (see U.S. Patent Application Publication No. 20070254362, Quay et al.; Van Aerschot et al., An acyclic 5-nitroindazole nucleoside amalogue as ambiguous nucleoside. Nucleic Acids Res. 1995 Nov. 11; 23(21):4363-70; Loakes et al., 3-Nitropyrrole and 5-nitroindole as universal bases in primers for DNA sequencing and PCR. Nucleic Acids Res. 1995 Jul. 11; 23(13):2361-6; Loakes and Brown, 5-Nitroindole as an universal base analogue. Nucleic Acids Res. Res. 1994 Oct. 11;22(20):4039-43, each of the foregoing being incorporated herein by reference for their disclosures regarding base modifications. e. Reversible modification

[0108] While it is possible to carry out certain modifications to protect oligonucleotides from the in vivo environment before reaching the target cell, such modifications may reduce the efficacy or activity of the oligonucleotide once it reaches the cytosol of the target cell.It is possible to carry out reversible modifications so that the molecule retains the desired properties outside the cell, and then the modifications are removed when it enters the cytoplasmic environment of the cell.Reversible modifications can be removed, for example, by the action of intracellular enzymes or by intracellular chemical conditions (e.g., by reduction by intracellular glutathione).

[0109] In some embodiments, the reversibly modified nucleotide comprises a glutathione-sensitive moiety. Typically, the nucleic acid molecule is chemically modified with a cyclic disulfide moiety to shield the negative charge generated by the internucleotide diphosphate bond and improve cellular uptake and nuclease resistance. See U.S. Published Application No. 2011 / 0294869, originally granted to Traversa Therapeutics, Inc. ("Traversa"), PCT Publication No. WO2015 / 188197 to Solstice Biologics, Inc. ("Solstice"), Meade et al., Nature Biotechnology, 2014, 32:1256-1263 ("Meade"), and PCT Publication No. WO2014 / 088920 to Merck Sharp & Dohme, Inc., each of which is incorporated by reference for disclosure of such modifications. This reversible modification of the internucleotide diphosphate bond is designed to be cleaved intracellularly by the reducing environment of the cytosol (e.g., glutathione). Early examples include the neutralization of phosphotriester modifications that have been reported to be cleavable intracellularly (Dellinger et al., J. Am. Chem. Soc. 2003, 125:940-950).

[0110] In some embodiments, such reversible modifications allow protection during in vivo administration (e.g., passing through blood and / or lysosomal / endosomal compartments of cells) where the oligonucleotide is exposed to nucleases and other harsh environmental conditions (e.g., pH). Upon release into the cell cytosol, where glutathione levels are higher than the extracellular space, the modification is reversed, resulting in cleavage of the oligonucleotide. The use of reversible glutathione-sensitive moieties allows the introduction of sterically large chemical groups into the oligonucleotide of interest, compared to available options using irreversible chemical modifications. This is because these large chemical groups are removed in the cytosol and therefore do not interfere with the biological activity of the oligonucleotide in the cell cytosol. As a result, these large chemical groups can be engineered to confer various advantages to the nucleotide or oligonucleotide, such as nuclease resistance, lipophilicity, charge, thermal stability, specificity, reduced immunogenicity, etc. In some embodiments, the structure of the glutathione-sensitive moiety can be engineered to modify the kinetics of its release.

[0111] In some embodiments, the glutathione-sensitive moiety is attached to the sugar of the nucleotide. In some embodiments, the glutathione-sensitive moiety is attached to the 2'-carbon of the sugar of the modified nucleotide. In some embodiments, the glutathione-sensitive moiety is located at the 5'-carbon of the sugar, particularly when the modified nucleotide is the 5'-terminal nucleotide of the oligonucleotide. In some embodiments, the glutathione-sensitive moiety is located at the 3'-carbon of the sugar, particularly when the modified nucleotide is the 3'-terminal nucleotide of the oligonucleotide. In some embodiments, the glutathione-sensitive moiety comprises a sulfonyl group. See, e.g., U.S. Provisional Application No. 62 / 378,635, filed August 23, 2016, entitled Compositions Comprising Reversibly Modified Oligonucleotides and Uses Thereof, the contents of which are incorporated herein by reference for relevant disclosures. v. Targeting Ligand

[0112] In some embodiments, it may be desirable to target the oligonucleotides of the present disclosure to one or more cells or one or more organs. Such a strategy may help to avoid undesirable effects in other organs, or to avoid excessive loss of oligonucleotides to cells, tissues, or organs that do not benefit from the oligonucleotide. Thus, in some embodiments, the oligonucleotides disclosed herein may be modified to facilitate targeting of specific tissues, cells, or organs, for example, to facilitate delivery of the oligonucleotide to the liver. In certain embodiments, the oligonucleotides disclosed herein may be modified to facilitate delivery of the oligonucleotide to hepatocytes in the liver. In some embodiments, the oligonucleotide comprises a nucleotide conjugated to one or more targeting ligands.

[0113] The targeting ligand may comprise carbohydrate, amino sugar, cholesterol, peptide, polypeptide, protein or protein part (e.g., antibody or antibody fragment), or lipid. In some embodiments, the targeting ligand is an aptamer. For example, the targeting ligand may be RGD peptide for targeting tumor vasculature or glioma cells, CREKA peptide for targeting tumor vasculature or stoma, transferrin, lactoferrin or aptamer for targeting transferrin receptor expressed in CNS vasculature, or anti-EGFR antibody for targeting EGFR on glioma cells. In certain embodiments, the targeting ligand is one or more GalNAc moieties.

[0114] In some embodiments, one or more (e.g., 1, 2, 3, 4, 5, or 6) nucleotides of the oligonucleotide are each conjugated to a separate targeting ligand. In some embodiments, 2-4 nucleotides of the oligonucleotide are each conjugated to a separate targeting ligand. In some embodiments, the targeting ligand is conjugated to 2-4 nucleotides at either the sense or antisense end (e.g., the ligand is conjugated to a 2-4 nucleotide overhang or extension at the 5' or 3' end of the sense or antisense strand), such that the targeting ligand resembles toothbrush bristles and the oligonucleotide resembles a toothbrush. For example, the oligonucleotide may include a stem loop at either the 5' or 3' end of the sense strand, and 1, 2, 3, or 4 nucleotides of the stem loop may be individually conjugated to a targeting ligand.

[0115] In some embodiments, it is desirable to target the oligonucleotide that reduces expression of an HBV antigen to hepatocytes in the liver of a subject. Any suitable hepatocyte targeting moiety may be used for this purpose.

[0116] GalNAc is a high affinity ligand for the asialoglycoprotein receptor (ASGPR), which is expressed primarily on the sinusoidal surface of hepatocytes and plays a major role in the binding, internalization, and subsequent clearance of circulating glycoproteins that contain terminal galactose or N-acetylgalactosamine residues (asialoglycoproteins). Conjugation (either indirectly or directly) of a GalNAc moiety to oligonucleotides of the present disclosure may be utilized to target these oligonucleotides to the ASGPR expressed on these hepatocytes.

[0117] In some embodiments, the oligonucleotide of the present disclosure is directly or indirectly conjugated to a monovalent GalNAc. In some embodiments, the oligonucleotide is directly or indirectly conjugated to multiple monovalent GalNAc (i.e., conjugated to 2, 3, or 4 monovalent GalNAc moieties, typically conjugated to 3 or 4 monovalent GalNAc moieties). In some embodiments, the oligonucleotide of the present disclosure is conjugated to one or more divalent, trivalent, or tetravalent GalNAc moieties.

[0118] In some embodiments, one or more (e.g., 1, 2, 3, 4, 5, or 6) nucleotides of the oligonucleotide are each conjugated to a GalNAc moiety. In some embodiments, 2-4 nucleotides of the loop (L) of the stem loop are each conjugated to a separate GalNAc. In some embodiments, the targeting ligand is conjugated to 2-4 nucleotides at either the sense or antisense strand end (e.g., the ligand is conjugated to a 2-4 nucleotide overhang or extension at the 5' or 3' end of the sense or antisense strand), such that the GalNAc moieties resemble toothbrush bristles and the oligonucleotide resembles a toothbrush. For example, the oligonucleotide may comprise a stem loop at either the 5' or 3' end of the sense strand, and 1, 2, 3, or 4 nucleotides of the loop of the stem may be individually conjugated to a GalNAc moiety. In some embodiments, the GalNAc moiety is conjugated to a nucleotide of the sense strand. For example, four GalNAc moieties can be conjugated to nucleotides within the tetraloop of the sense strand, with each GalNAc moiety being conjugated to one nucleotide.

[0119] In some embodiments, the oligonucleotides herein contain a monovalent GalNac linked to a guanidine nucleotide, as shown below, which is referred to as [ademG-GalNAc] or 2'-aminodiethoxymethanol-guanidine-GalNAc. [ka]

[0120] In some embodiments, the oligonucleotides herein contain a monovalent GalNac linked to an adenine nucleotide, as shown below, which is referred to as [ademA-GalNAc] or 2'-aminodiethoxymethanol-adenine-GalNAc. [ka]

[0121] As an example of such a conjugation, a loop and stem attachment point comprising the 5' to 3' nucleotide sequence GAAA (L=linker, X=heteroatom) is shown below. Such a loop may be, for example, at positions 27-30 of the molecule shown in FIG. 1A. In the formula: TIFF0007645323000009.tif66 is the attachment point to the oligonucleotide chain. [ka]

[0122] The targeting ligand can be attached to the nucleotide using a suitable method or chemistry (e.g., click chemistry). In some embodiments, the targeting ligand is conjugated to the nucleotide using a click linker. In some embodiments, the targeting ligand is conjugated to any one of the nucleotides of the oligonucleotides described herein using an acetal-based linker. Acetal-based linkers are disclosed, for example, in International Patent Application Publication No. WO2016100401 A1, published on June 23, 2016, the contents of which regarding such linkers are incorporated herein by reference. In some embodiments, the linker is a labile linker. However, in other embodiments, the linker is fairly stable.

[0123] An example is shown below for a loop containing the 5' to 3' nucleotides GAAA, where an acetal linker is used to attach the GalNac moiety to the nucleotides of the loop. Such a loop may be, for example, located at positions 27-30 of the molecule shown in Figure 10. In the formula: TIFF0007645323000011.tif88 is the attachment point to the oligonucleotide chain. [ka] III. Preparations

[0124] Various formulations have been developed to facilitate the use of oligonucleotides. For example, oligonucleotides can be delivered to a subject or cellular environment using a formulation that minimizes degradation, facilitates delivery and / or uptake, or provides another beneficial property to the oligonucleotide in the formulation. In some embodiments, compositions are provided herein that include an oligonucleotide (e.g., a single-stranded or double-stranded oligonucleotide) for reducing the expression of an HBV antigen (e.g., HBsAg). Such compositions can be appropriately formulated such that, when administered either to the immediate environment of a target cell in a subject or systemically, a sufficient amount of the oligonucleotide enters the cell and reduces HBV antigen expression. As disclosed herein, any of a variety of suitable oligonucleotide formulations can be used to deliver the oligonucleotide for reducing HBV antigen. In some embodiments, the oligonucleotide is formulated in a buffer solution, such as phosphate buffered saline, liposomes, micellar structures, and capsids.

[0125] Formulation of oligonucleotides with cationic lipids can be used to facilitate the transfection of oligonucleotides into cells.For example, cationic lipids such as lipofectin, cationic glycerol derivatives, and polycationic molecules (e.g., polylysine) can be used.Suitable lipids include Oligofectamine, Lipofectamine (Life Technologies), NC388 (Ribozyme Pharmaceuticals, Boulder, Colorado), or FuGene6 (Roche), all of which can be used according to the manufacturer's instructions.

[0126] Thus, in some embodiments, the formulation comprises a lipid nanoparticle. In some embodiments, the excipient comprises a liposome, lipid, lipid complex, microsphere, microparticle, nanosphere, or nanoparticle, or may be otherwise formulated for administration to a cell, tissue, organ, or body of a subject in need thereof (see, e.g., Remington: The Science and Practice of Pharmacy, 22nd ed., Pharmaceutical Press, 2013).

[0127] In some embodiments, the formulations disclosed herein include an excipient. In some embodiments, the excipient improves the stability, absorption, solubility of the active ingredient in the composition and / or facilitates treatment. In some embodiments, the excipient is a buffer (e.g., sodium citrate, sodium phosphate, Tris base, or sodium hydroxide) or a vehicle (e.g., buffer solution, petrolatum, dimethyl sulfoxide, or mineral oil). In some embodiments, the oligonucleotide is lyophilized to extend its shelf life and then put into solution before use (e.g., administration to a subject). Thus, the excipient in a composition comprising any one of the oligonucleotides described herein may be a cryoprotectant (e.g., mannitol, lactose, polyethylene glycol, or polyvinylpyrrolidone), or a disintegration temperature regulator (e.g., dextran, ficoll, or gelatin).

[0128] In some embodiments, a pharmaceutical composition is formulated to be compatible with its intended route of administration, which includes parenteral, such as intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration.

[0129] Pharmaceutical compositions suitable for injection use include sterile aqueous solutions (if water soluble) or dispersions, and sterile powders for extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL.TM. (BASF, Parsippany, NJ), or phosphate buffered saline (PBS). The carrier can be, for example, a solvent or dispersion medium containing water, ethanol, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.), and suitable mixtures thereof. In many cases, it is preferable to include an isotonic agent, for example, sugar, polyalcohol such as mannitol or sorbitol, and sodium chloride in the composition. Sterile injectable solutions can be prepared by incorporating the required amount of oligonucleotide and one or more of the above-listed ingredients in the selected solvent, as needed, followed by filtration sterilization.

[0130] In some embodiments, the percentage of active ingredient(s) may range from about 1% to about 80% or more by weight or volume of the total composition, although the composition may contain at least about 0.1% of a therapeutic agent (e.g., an oligonucleotide for reducing HBV antigen expression), etc. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, and other pharmacological considerations will be contemplated by those skilled in the art of preparing such pharmaceutical formulations, and therefore various dosages and treatment regimens may be desirable.

[0131] Many embodiments contemplate liver-targeted delivery of any of the oligonucleotides disclosed herein, although targeting of other tissues is also contemplated. IV.How to use

[0132] In some embodiments, methods are provided for delivering an effective amount of any one of the oligonucleotides disclosed herein to a cell for the purpose of reducing the expression of HBsAg. The methods provided herein are useful with any suitable cell type. In some embodiments, the cell is any cell expressing HBV antigens (e.g., hepatocytes, macrophages, monocyte-derived cells, prostate cancer cells, cells of the brain, endocrine tissue, bone marrow, lymph nodes, lung, gallbladder, liver, duodenum, small intestine, pancreas, kidney, gastrointestinal tract, bladder, fat and soft tissue, and skin). In some embodiments, the cell is a primary cell obtained from a subject and may have undergone a limited number of passages, so that the cell largely maintains its natural phenotypic characteristics. In some embodiments, the cell to which the oligonucleotide is delivered is an ex vivo cell or an in vitro cell (i.e., it can be delivered to a cell in culture or to an organism in which the cell resides). In certain embodiments, methods are provided for delivering an effective amount of any one of the oligonucleotides disclosed herein to a cell for the purpose of reducing the expression of HBsAg only in hepatic cells.

[0133] In some embodiments, the oligonucleotides disclosed herein can be introduced using a suitable nucleic acid delivery method, including injection of a solution containing the oligonucleotide, bombardment with particles coated with the oligonucleotide, exposure of cells or organisms to a solution containing the oligonucleotide, or electroporation of cell membranes in the presence of the oligonucleotide. Other suitable methods for delivering oligonucleotides to cells may also be used, including lipid-mediated carrier transport, chemical-mediated transport, and cationic liposome transfection, such as calcium phosphate.

[0134] The results of the inhibition can be confirmed by a suitable assay to assess one or more characteristics of the cell or subject, or by a biochemical technique to assess molecules (e.g., RNA, protein) indicative of HBV antigen expression. In some embodiments, the extent to which the oligonucleotides provided herein reduce the expression level of HBV antigen is assessed by comparing the expression level of HBV antigen (e.g., mRNA or protein level) with a suitable control (e.g., the level of HBV antigen expression in a cell or cell population to which no oligonucleotide or a negative control has been delivered). In some embodiments, a suitable control level of HBV antigen expression may be a predetermined level or value so that it is not necessary to measure the control level at all times. The predetermined level or value can take a variety of forms. In some embodiments, the predetermined level or value can be a single cutoff value, such as a median or mean.

[0135] In some embodiments, administration of the oligonucleotides described herein reduces the level of HBV antigen (e.g., HBsAg) expression in cells. In some embodiments, the reduction in HBV antigen expression level may be 1% or less, 5% or less, 10% or less, 15% or less, 20% or less, 25% or less, 30% or less, 35% or less, 40% or less, 45% or less, 50% or less, 55% or less, 60% or less, 70% or less, 80% or less, or 90% or less compared to a suitable control level of HBV antigen. A suitable control level may be the level of HBV antigen expression in a cell or cell population that has not been contacted with the oligonucleotides described herein. In some embodiments, the effect of cellular delivery of oligonucleotides according to the methods disclosed herein is evaluated over a limited period of time. For example, levels of HBV antigen may be analyzed in cells at least 8 hours, 12 hours, 18 hours, 24 hours; or at least 1, 2, 3, 4, 5, 6, 7, 14, 21, 28, 35, 42, 49, 56, 63, 70, 77, 84, 91, 98, 105, 112, 119, 126, 133, 140, or 147 days after introduction of the oligonucleotide into the cells.

[0136] In some embodiments, the reduction in HBV antigen (e.g., HBsAg) expression levels persists for an extended period of time following administration. In some embodiments, the detectable reduction in HBsAg expression persists within a period of 7-70 days following administration of an oligonucleotide described herein. For example, in some embodiments, the detectable reduction persists within a period of 10-70 days, 10-60 days, 10-50 days, 10-40 days, 10-30 days, or 10-20 days following administration of the oligonucleotide. In some embodiments, the detectable reduction persists within a period of 20-70 days, 20-60 days, 20-50 days, 20-40 days, or 20-30 days following administration of the oligonucleotide. In some embodiments, the detectable reduction persists within a period of 30-70 days, 30-60 days, 30-50 days, or 30-40 days following administration of the oligonucleotide. In some embodiments, the detectable decrease persists within a period of 40-70 days, 40-60 days, 40-50 days, 50-70 days, 50-60 days, or 60-70 days from administration of the oligonucleotide.

[0137] In some embodiments, the detectable reduction in HBsAg expression is sustained within a period of 2-21 weeks from administration of the oligonucleotide described herein. For example, in some embodiments, the detectable reduction is sustained within a period of 2-20 weeks, 4-20 weeks, 6-20 weeks, 8-20 weeks, 10-20 weeks, 12-20 weeks, 14-20 weeks, 16-20 weeks, or 18-20 weeks from administration of the oligonucleotide. In some embodiments, the detectable reduction is sustained within a period of 2-16 weeks, 4-16 weeks, 6-16 weeks, 8-16 weeks, 10-16 weeks, 12-16 weeks, or 14-16 weeks from administration of the oligonucleotide. In some embodiments, the detectable reduction is sustained within a period of 2-12 weeks, 4-12 weeks, 6-12 weeks, 8-12 weeks, or 10-12 weeks from administration of the oligonucleotide. In some embodiments, the detectable decrease persists within a period of 2-10 weeks, 4-10 weeks, 6-10 weeks, or 8-10 weeks from administration of the oligonucleotide.

[0138] In some embodiments, the oligonucleotide is delivered in the form of a transgene engineered to express the oligonucleotide (e.g., its sense and antisense strands) in a cell. In some embodiments, the oligonucleotide is delivered using a transgene engineered to express any of the oligonucleotides disclosed herein. The transgene may be delivered using a viral vector (e.g., adenovirus, retrovirus, vaccinia virus, poxvirus, adeno-associated virus, or herpes simplex virus), or a non-viral vector (e.g., a plasmid or synthetic mRNA). In some embodiments, the transgene can be directly injected into the subject. ii.Treatment method

[0139] Aspects of the present disclosure relate to methods of reducing HBsAg expression (e.g., reducing HBsAg expression) for the treatment of HBV infection in a subject. In some embodiments, the method may comprise administering to a subject in need thereof an effective amount of any one of the oligonucleotides disclosed herein. The present disclosure provides both prophylactic and therapeutic methods of treating a subject at risk for (or susceptible to) HBV infection and / or a disease or disorder associated with HBV infection.

[0140] In certain aspects, the disclosure provides methods of preventing a disease or disorder described herein in a subject by administering a therapeutic agent (e.g., an oligonucleotide or vector or transgene encoding the same) to the subject. In some embodiments, the subject to be treated is one who would benefit therapeutically from a reduction in the amount of HBsAg protein, for example, in the liver. Subjects at risk for a disease or disorder can be identified, for example, by one or a combination of diagnostic or prognostic assays known in the art (e.g., identification of cirrhosis and / or hepatitis). Administration of a prophylactic agent can occur prior to detection of symptoms characteristic of the disease or disorder or before the onset of symptoms, such that the disease or disorder is prevented or its progression is delayed.

[0141] The methods described herein typically include administering to a subject an effective amount of oligonucleotide, i.e., an amount capable of producing a desired therapeutic outcome. A therapeutically acceptable amount refers to an amount capable of treating a disease or disorder. The appropriate dosage for any one subject will depend on certain factors, such as the subject's size, body surface area, age, the particular composition administered, the active ingredient(s) in the composition, the time and route of administration, general health, other drugs used concomitantly, etc. For example, dosages can range from 0.1 to 12 mg / kg. Dosages can also range from 0.5 to 10 mg / kg. Alternatively, dosages can range from 1.0 to 6.0 mg / kg. Dosages can also range from 3.0 to 5.0 mg / kg.

[0142] In some embodiments, any one of the compositions disclosed herein is administered to a subject enterally (e.g., orally, via a gastric feeding tube, a transduodenal feeding tube, a gastrostomy tube, or rectally), parenterally (e.g., subcutaneous injection, intravenous injection or infusion, intraarterial injection or infusion, intraosseous injection, intramuscular injection, intracerebral injection, intraventricular injection, intrathecal injection), topically (e.g., on the skin, inhalation, eye drops, or transmucosally), or by direct injection into a target organ (e.g., the liver of a subject). Typically, the oligonucleotides disclosed herein are administered intravenously or subcutaneously.

[0143] As a non-limiting set of examples, oligonucleotides of the present disclosure are typically administered quarterly (once every three months), bimonthly (once every two months), monthly, or weekly. For example, oligonucleotides may be administered weekly, biweekly, or every three weeks. Oligonucleotides may be administered daily.

[0144] In some embodiments, the subject to be treated is a human or non-human primate or other mammalian subject. Other examples of subjects include pets such as dogs and cats; farm animals such as horses, cows, pigs, sheep, goats, and chickens; and animals such as mice, rats, guinea pigs, and hamsters. EXAMPLES

[0145] Example 1. Development of potent oligonucleotide inhibitors of HBsAg expression

[0146] We identified the HBV surface antigen as a target for RNAi-based therapy to treat HBV infection. As depicted in the HBV genome organization shown in Figure 1, HBsAg is encoded by three RNA molecules transcribed from a single ORF. Oligonucleotides were designed to silence one or more of the RNA transcripts that contribute to HBsAg assembly (examples of RNAi target sites are indicated by "X" in Figure 1). An oligonucleotide targeting HBsAg, HBV-254, was designed and evaluated in vitro and in vivo. HBV-254 was selected and designed based on its ability to directly target the mRNA transcripts of four HBV RNA species. The HBV-254 double-stranded oligonucleotide used in the experiment contained a sense strand having the sequence set forth in the following sequence (shown in the 5' to 3' direction): GUGGUGGACUUCUCUCAAUAGCAGCCGAAAGGCUGC (SEQ ID NO: 21); and an antisense strand having the sequence set forth in the following sequence (shown in the 5' to 3' direction): UAUUGAGAGAAGUCCACCCACGG (SEQ ID NO: 22).

[0147] A single dose evaluation of oligonucleotide HBV-254 was performed in HDI mice, demonstrating its ability to subcutaneously target HBsAg viral transcripts (Figure 2). As shown, HBV-254 systematically reduced HBsAg levels in mice with increasing doses. Preclinical efficacy was further evaluated in mice following a QWx3 dosing regimen of HBV-254 administered subcutaneously at 3 mg / kg (Figure 3). Dosing times are indicated by arrows in the figure. HBsAg levels were monitored in both oligonucleotide-treated and untreated control mice over a 147-day period. Reductions in HBsAg levels were sustained in treated mice throughout the study period, with expression levels (relative to controls) plateauing at a reduced baseline approximately 2 months after the first dose.

[0148] Other potent HBsAg-targeting oligonucleotides were identified by in vitro screening using the psiCHECK reporter assay with unmodified tetraloop forms of the oligonucleotides. Results from three different plates are shown in Figure 4. Each oligonucleotide was evaluated with HBV-254 at three concentrations (1, 10, and 100 pM) in HeLa cells using a fluorescence-based reporter assay. Results reported for each plate are further shown in comparison to positive controls (8, 40, and 200 pM), negative controls (1 nM), and mock transfection. Oligonucleotides highlighted in boxes were scaled up for in vivo testing. Here, HBV-219 and HBV-258 were found to be the most potent oligonucleotides among HBV-254 and the oligonucleotides identified from the screen. HBV-219 showed a log-fold increase in potency over HBV-254 and was selected for further evaluation. Example 2. Sequence conservation analysis and engineering mismatches to enhance global therapeutic utility

[0149] Several of the most potent oligonucleotides evaluated in Example 1 were compared to the genome sequences of HBV genotypes A-I. The results of the initial conservation analysis are listed in Table 1. As shown in the table, the conservation of HBV-219 is relatively low across these genomes. However, when a mismatch (MM) is introduced at position 15 of the guide strand, the conservation rate increases significantly (from 66% to 96%). Genotyped Hepatitis B Virus (HBV) sequence data from the GenBank public database, which is incorporated herein by reference, was used for bioinformatics curation and alignment. [Table 1]

[0150] The following conservation analysis was performed, which focused on several oligonucleotides in Table 1 and included broader search parameters. For example, the initial analysis included only full-length genome sequences, whereas the focused analysis included full-length and partial (>80% identity to the target site) sequences. Also, the number of genomes tested was increased from 5,628 in the initial analysis to more than 17,000 in the focused analysis. The results of the focused analysis were generally consistent with the trends observed in the initial analysis (Table 2). As shown in the table and further shown in Figure 5, HBV-219 was predicted to be inactive against HBV genotypes B, E, F, H, and I unless a mismatch at position 15 of the guide strand was tolerated. [Table 2]

[0151] The psiCHECK-2 dual luciferase reporter system was utilized to evaluate the mismatch effect at selected positions for each of HBV-217, HBV-219, HBV-254, HBV-255, and HBV-258. The psiCHECK vector allows for monitoring changes in expression of target genes fused to a reporter gene, where active RNAi degrades the fusion construct and reduces the corresponding reporter signal. Figure 6 shows the vectors typically utilized in these assays. The parental reporter sequence contained a 120 base pair fragment from genotype A (GenBank: AM282986.1) surrounding the target site of interest in the S ORF. The parental oligonucleotide duplex sequence has 100% homology to the reporter plasmid at the corresponding sites shown in Figure 6. Meanwhile, the mismatched oligonucleotide duplex sequence has a single mismatch to the reporter plasmid. The parental and mismatched sequences of the tested oligonucleotides are aligned to correspond to the parental reporter sequences as shown in Figure 7.

[0152] In the exemplary mismatch assay, the oligonucleotides tested contained the same modification pattern. According to the numbering scheme shown for each oligonucleotide in Figure 7, the modifications were as follows: 5'-methoxy, phosphonate-4'-oxy-2'-O-methyluridine at position 1; 2'-fluoro modified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16, and 19; 2'-O-methyl modified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18, and 20-22; and phosphorothioate internucleotide linkages between nucleotides at positions 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22. The mismatch positions were different for each parent and mismatch set and are indicated in the boxes in Figure 7.

[0153] The psiCHECK2 reporter assay with each oligonucleotide was performed for 3 days by transfecting HeLa cells using a 6-point 5-fold serial dilution starting at 1 nM. On day 1, 10,000 HeLa cells / well (96-well) were seeded (80-90% confluent) in a plate with black walls and clear bottom. On day 2, the vector DNA and RNAi molecules were diluted in an appropriate amount of serum-free Opti-MEM® I medium and mixed gently. After gentle mixing of Lipofectamine® 2000, 0.2 μL was diluted in 25 μL of serum-free Opti-MEM® I medium for each reaction. The dilutions were mixed gently and incubated at room temperature for 5 minutes. After 5 minutes of incubation, equal amounts of diluted DNA and RNAi molecules were mixed with the diluted Lipofectamine® 2000. The mixture was mixed gently and incubated at room temperature for 20 minutes to form complexes. Following this, the DNA-RNAi molecule-Lipofectamine® 2000 complex was added to each well containing cells and medium and mixed gently by rocking the plate back and forth. The cells were then incubated at 37°C in a CO2 incubator until the target genes were ready to be harvested and assayed. On day 3, 100 μL of Dual-Glo reagent was added to each well, mixed, incubated for 10 minutes, and luminescence was read. Additionally, 100 μL of Dual-Glo Stop&Glo was added to each well, mixed, incubated for 10 minutes, and luminescence was read. To assess the effect of mismatch on activity, dose-response curves were generated for each parental and mismatched oligonucleotide. EC 50 The values ​​are shown in Table 3 with the specifications attached. [Table 3]

[0154] Relative EC 50As shown by the values, the in vitro dose-response curves of the HBV-219 duplexes demonstrated no loss of activity due to a single mismatch at position 15 of the guide strand. Subsequent in vitro analysis comparing the HBV-219 parent (here designated HBV(s)-219P1) and the mismatched oligonucleotide (here designated HBV(s)-219P2) confirmed that the introduction of a mismatch did not result in loss of activity (Figure 8). As shown in the single dose titration plot in Figure 9, the HBV-219 mismatched oligonucleotide duplex (HBV(s)-219P2) was tolerated in vivo for up to 70 days after administration.

[0155] Figure 10 shows an example of a modified duplex structure of HBV-219 (herein referred to as HBV(s)-219) with an incorporated mismatch. According to the numbering scheme shown for each oligonucleotide in Figure 7, the sense strand spans nucleotides 1 to 36 and the antisense strand spans oligonucleotides 1 to 22, with the latter strands shown numbered from right to left. The duplex form is shown with a nick between nucleotide 36 of the sense strand and nucleotide 1 of the antisense strand. Modifications on the sense strand were as follows: 2'-fluoro modified nucleotides at positions 3, 8 to 10, 12, 13, and 17; 2'-O-methyl modified nucleotides at positions 1, 2, 4 to 7, 11, 14 to 16, 18 to 26, and 31 to 36; a phosphorothioate internucleotide linkage between the nucleotides at positions 1 and 2; a 2'-OH nucleotide at position 27; 2'-aminodiethoxymethanol-guanidine-GalNAc at position 27; and 2'-aminodiethoxymethanol-adenine-GalNAc at positions 28, 29, and 30, respectively. Modifications of the antisense strand were as follows: 5'-methoxy, phosphonate-4'-oxy-2'-O-methyluridine phosphorothioate at position 1; 2'-fluoro modified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16, and 19; 2'-O-methyl modified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18, and 20-22; and phosphorothioate internucleotide linkages between nucleotides at positions 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22. The antisense strand contained a mismatch incorporated at position 15. The antisense strand of the duplex also contained a "GG" overhang spanning positions 21 to 22, as shown.

[0156] Details about HBV(s)-219 and the two precursors mentioned above (HBV(s)-219P1 and HBV(s)-219P2) are shown in Table 4. [Table 4] Example 3: Antiviral activity of HBV(s)-219 precursors

[0157] We evaluated the effect of treatment with HBV(s)-219 precursor on the intracellular localization of HBV core antigen (HBcAg). scid Mice were subjected to hydrodynamic injection (HDI) of a head-to-tail dimer of the HBV genome. Treatment with oligonucleotides was initiated 2 weeks after HDI. Immunohistochemical staining of hepatocytes isolated from treated mice showed a rapid decrease in HBV core antigen (HBcAg) expression.

[0158] RNA sequencing was performed to examine the effect of HBsAg knockdown on global expression of HBV viral transcripts. Stem cells were isolated 4 days after three weekly doses of 3 mg / kg in HDI mice. Total RNA was extracted from hepatocytes and subjected to Illumina sequencing using the HiSeq Platform. Figure 11B shows the RNA sequencing results mapping the detected RNA transcript sequences to HBV RNA. The target sites of HBV(s)-219 and its precursors are also illustrated, showing that the oligonucleotides target pgRNA (3.5 kb), S1 (2.4 kb), and S2 (2.1 kb) transcripts. The results show that treatment with HBV(s)-219P1 silenced more than 90% of all HBV viral transcripts compared to vehicle controls.

[0159] The sustained effect of HBV(s)-219P1 oligonucleotides was tested in two different mouse models of HBV: a cccDNA-dependent HDI model and a cccDNA-independent AAV model. A time course (12 weeks) analysis of HBsAg mRNA expression was performed in the HDI model of HBV under treatment with HBV(s)-219P1 oligonucleotides targeting HBsAg mRNA at 3 mg / kg once per week for three doses compared to vehicle control and RNAi oligonucleotides targeting HBxAg mRNA (Figure 12A). HBV(s)-219P1 oligonucleotides showed a ≥ 3.9 log reduction in HBsAg mRNA expression with a relatively long duration of activity of more than 7 weeks: whereas, in comparison, oligonucleotides targeting HBV(x) showed a approx. 3.0 log reduction with a shorter duration than the former.

[0160] Further time course (12 weeks) analysis of HBsAg mRNA expression was performed in the AAV-HBV model under treatment with HBV(s)-219P1 oligonucleotide targeting HBsAg mRNA at 3 mg / kg once per week for three doses compared to vehicle control and RNAi oligonucleotide targeting HBxAg mRNA (Figure 12B). In this model, HBV(s)-219P2 oligonucleotide showed a similar log reduction and duration as oligonucleotide targeting HBV(x). The RNAi oligonucleotide targeting HBxAg mRNA used in Figures 12A and 12B has a sense strand sequence of UGCACUUCGCGUCACCUCUAGCAGCCGAAAGGCUGC and an antisense strand sequence of UAGAGGUGACGCGAAGUGCAGG. This RNAi oligonucleotide targeting HBxAg is referred to herein as GalXC-HBVX.

[0161] Immunohistochemical staining was performed to examine the subcellular distribution of HbcAg in hepatocytes from the AAV-HBV and HDI models of HBV following treatment with HBV(s)-219 precursor oligonucleotides targeting HBsAg mRNA as shown above, compared to vehicle controls and RVAi oligonucleotides targeting HBxAg mRNA as described above (Figure 13). Residual core protein (HBcAg) following treatment showed a striking difference in subcellular localization between the two RNAi oligonucleotides in the HDI model, but no differences were seen in the AAV model. Example 4: Evaluation of HBV(s)-219P1 in a PXB-HBV chimeric human liver model genotype C

[0162] We evaluated the antiviral activity of HBV(s)-219P1 in the PXB-HBV model, also known in the literature for HBV as a chimeric human liver model. This technique is based on transplanting human hepatocytes into severely immunocompromised mice and using a genetic mechanism to poison the host mouse hepatocytes (Tateno et al., 2015). This process allows the mice to contain livers that are >70% derived from human tissue and, unlike wild-type mice, to be infected with HBV (Li et al., 2014). The PXB-HBV model serves several purposes in terms of HBV(s)-219 pharmacology: (1) confirm that oligonucleotides may engage the human RNAi machinery (RISC) in vivo; (2) confirm that GalNAc-targeting ligand constructs may be internalized in hepatocytes via human ASGR in vivo; and (3) confirm efficacy in a true (versus genetically engineered) model of HBV infection. Despite the limitation that transplanted human hepatocytes result in irregular chimeric liver physiology ( Tateno et al., 2015 ), significant antiviral effects can be observed in this model.

[0163] Approximately 8 weeks after initial infection of mice with HBV genotype C, plasma was collected from each mouse to serve as baseline HBsAg measurements. Cohorts of 9 mice each (n=3 for PK, n=6 for PD) were then injected SC with 0 (PBS) or 3 mg / kg HBV(s)-219P1 three times per week. The first day of dosing was designated day 0. Non-peripheral blood collections were performed weekly to measure serum HBsAg and circulating HBV DNA levels in each mouse (Figures 14A-D). Mice were euthanized for peripheral tissue endpoints on day 28. Liver samples on day 28 were analyzed for intrahepatic HBV DNA and cccDNA levels. Significant antiviral activity was observed at all endpoints analyzed in mice treated with HBV(s)-219P1, with a >80% reduction in HBsAg and significant reductions in circulating HBV DNA, intrahepatic HBV DNA, and cccDNA (Figures S4A-S4D). These data demonstrate that treatment with HBV(s)-219 results in antiviral activity in infected human hepatocytes after systemic administration. Example 5: HBV(s)-219P2 enhances the antiviral activity of entecavir

[0164] The current standard of care, nucleoside analogues (e.g., entecavir), are effective in reducing circulating HBV genomic DNA but not circulating HBsAg. This results in control of viremia during such treatment, but lifelong treatment is required and functional cure is rarely achieved. RNAi oligonucleotides targeting the S antigen affect both the viral polymerase and the HBsAg protein. In this study, we investigated the combined effect of HBV(s)-219P2 as monotherapy and combination treatment with entecavir in HBV-expressing mice (HDI model) for antiviral activity.

[0165] Mice were orally administered 500 ng / kg entecavir (ETV) daily for 14 days. A single subcutaneous dose of HBV(s)-219P2 was administered. Circulating viral load (HBV DNA) was measured by qPCR (Figure 15A), plasma HBsAg levels were measured by ELISA (Figure 15B), and liver HBV mRNA and pgRNA levels were measured by qPCR. A clear additive effect was observed with combination therapy of HBV(s)-219P2 and ETV. The results show that ETV therapy alone has no effect on circulating HBsAg or liver viral RNA. Furthermore, the antiviral activity of HBV(s)-219P2 measured by HBsAg or HBV RNA was not affected by co-administration of ETV (Figures 15B and 15C).

[0166] As shown in Figures 15A-15C, monotherapy with entecavir at 500 ng / kg PO daily for 14 days resulted in a mean 1.6 log reduction in HBV DNA detected in plasma compared to PBS-treated mice (n=6). No significant reductions were observed in either circulating HBsAg or liver viral RNA. Monotherapy with HBV(s)-219P2 alone at 1 mg / kg or 3 mg / kg SC on day 0 resulted in a mean 0.8 log reduction or 1.8 log reduction in HBV DNA detected in plasma compared to PBS (n=7). Monotherapy with HBV(s)-219P2 alone at 6 mg / kg SC on day 0 resulted in a mean 2.5 log reduction in plasma HBV DNA with two mice having levels below the limit of detection (n=7). Monotherapy with HBV(s)-219P2 administered alone SC on day 0 resulted in a dose-dependent reduction in both circulating HBsAg and liver viral RNA. Combination therapy with entecavir 500 ng / kg PO daily for 14 days and HBV(s)-219P2 administered alone SC at 1 mg / kg on day 0 resulted in an additive mean reduction of approximately 2.3 log in HBV DNA detected in plasma. Similar reductions in plasma HBsAg and liver viral transcript levels were observed with monotherapy with HBV(s)-219P2 administered alone SC at 1 mg / kg, demonstrating additivity in the reduction of plasma HBV DNA but not circulating HBsAg or liver viral transcripts. Example 6. Comparison of antiviral activity between HBV(s)-219P2 and GalXC-HBVX

[0167] In this study, HBV-expressing mice (HDI model) were administered HBV(s)-219P2, GalXC-HBVX (same sequence as GalXC-HBVX used in Figures 12A and 12B), or a combination of the two RNAi oligonucleotides, and plasma HBsAg levels were monitored for 2 or 9 weeks after administration. As shown in Figure 16B, similar levels of HBsAg suppression were observed 2 weeks after treatment with either HBV(s)-219P2 or GalXC-HBVX, or a combination of these, administered alone at a saturating 9 mg / kg SC dose. Long-term suppression of HBsAg was observed in mice treated with S-targeted HBV(s)-219P2 treatment, whereas mice treated with GalXC-HBVX or a combination of these showed significant recovery of HBsAg 9 weeks after treatment (n=3).

[0168] We also evaluated the subcellular localization of HBV core antigen (HBcAg) in HBV-expressing mice in mice administered HBV(s)-219P2, GalXC-HBVX, or a combination of these two RNAi oligonucleotides. HBV-expressing mice (HDI model) were treated with a single saturating dose (9 mg / kg, sc) of HBV(s)-219P2, GalXC-HBVX, or a 1:1 combination of these. Liver sections were stained for HBcAg at the time points indicated in Figure 17A; representative hepatocytes are shown in the figure. Cohorts treated with HBV(s)-219P2, either as monotherapy or in combination with GalXC-HBVX, feature nuclear HBcAg. Cohorts treated only with GalXC-HBVS show only cytoplasmic localization of HBcAg, which has been reported as a favorable prognostic indicator of treatment response (Huang et al., J. Cell. Mol. Med. 2018). The percentage of HBcAg positive cells with nuclear staining in each animal is shown in Figure 17B (n=3 / group, 50 cells per animal, 2 weeks after administration). To confirm that the effect on HBcAg subcellular localization is due to regions of the HBV transcriptome and not due to unknown properties of the RNAi sequence, alternative sequences were designed and tested targeting within the X and S open reading frames (see Figure 17C). HBV-254 was used in Figure 17C. The sequence of HBV-254 is described in Example 1. The alternative oligonucleotides targeting HBxAg used in Figure 17C have a sense strand sequence of GCACCUCUCUUUACGCGGAAGCAGCCGAAAGGCUGC and an antisense sequence of UUCCGCGUAAAGAGAGGUGCGG. Two alternative RNAi oligonucleotides have different RNAi target sequences in the S or X antigens than the RNAi oligonucleotides used in Figure 16B. However, they showed the same differential effect on plasma levels HBcAg, an effect shown to be specific for targeting the S antigen itself, but not for the oligonucleotide used. Example 7 Evaluation of the safety, tolerability in healthy human subjects, and efficacy of HBV(s)-219 in HBV patients

[0169] The study is designed to evaluate the safety and tolerability in healthy subjects (Group A) and efficacy of HBV(s)-219 in HBV patients (Group B). Dose by cohort information is shown in Figure 18. The molecular structure of HBV(s)-219 is shown in Figures 10 and 19A, and is also shown below: TIFF0007645323000017.tif86160

[0170] The patient selection criteria are as follows: Group A - healthy subjects Selection criteria: 1.Age 18 (or age of legal consent, whichever is older) through 65 at the time of signing informed consent. 2. Be apparently healthy at the time of screening as determined by medical evaluation, including medical history, physical examination, and laboratory tests. A. There are no symptoms of ongoing disease. b. No clinically significant abnormalities in temperature, pulse rate, respiratory rate, or blood pressure. c. Absence of clinically significant cardiovascular or pulmonary disease and cardiovascular or pulmonary disease requiring pharmacological medication. 3. Have a 12-lead electrocardiogram (ECG) that is within normal limits or has no clinically significant abnormalities at screening and on Day 1 by investigator opinion. 4. Negative alcohol or drug abuse screens at Screening Visit 1 and on admission (Day 1). 5. Non-smoker for at least 5 years prior to Screening Visit 1 and have a negative urinary cotinine concentration at Screening Visit 1. 6. Body mass index (BMI) is 18.0 kg / m 2 More than 32.0kg / m 2 It must be within the following range. 7. Male or Female: a.Male participant: Male participants must agree to use contraception during the treatment period and for at least 2 weeks after administration of the study intervention and to not donate sperm during this period. b.Female participants: Female participants were eligible to participate if they were not pregnant, not breastfeeding, and at least one of the following conditions was true: women who were not women of childbearing potential (WOCBP) or, depending on region, WOCBP who agreed to follow contraception guidance beginning at study enrollment after screening and continuing for at least 12 weeks after administration of the study intervention and throughout the treatment period. 8. Ability to provide signed informed consent1, including compliance with requirements and limitations.

[0171] Exclusion criteria, group A 1. History of any medical condition that may interfere with the absorption, distribution, or elimination of the study drug or with the clinical and laboratory evaluations in this study, including (but not limited to): chronic or recurrent renal disease, functional bowel disorders (e.g., frequent diarrhea or constipation), gastrointestinal disease, pancreatitis, seizure disorders, mucocutaneous or musculoskeletal disorders, history of suicide attempt(s) or suicidal ideation, or clinically significant depression or other neuropsychiatric disorder requiring pharmacological intervention. 2. Poorly controlled or unstable hypertension; or sustained systolic blood pressure >150mmHg or diastolic blood pressure >95mmHg at screening. 3. History of diabetes mellitus treated with insulin or hypoglycemic agents. 4. History of asthma requiring hospitalization within the past 12 months. 5. Evidence of G-6-PD deficiency as determined by screening results at the central laboratory. 6. Currently inadequately controlled endocrine condition, excluding thyroid conditions (e.g. hyperthyroidism / hypothyroidism) that exclude pharmacologically treated thyroid conditions. 7. Participant has a history of malignancy if the malignancy is in complete remission with chemotherapy and has not undergone any additional medical or surgical intervention within the past 3 years. 8. History of multiple drug allergies or history of allergic reactions to oligonucleotides or GalNAc. 9. History of intolerance to SC injection(s) or significant abdominal scarring that could potentially interfere with administration of the study intervention or assessment of local tolerability. 10. Clinically relevant surgical history. 11. History of persistent ethanol abuse (>40 g ethanol / day) or illicit drug use within the past 3 years. 12. Clinically significant illness occurring within 7 days prior to administration of the study intervention. 13. Donation of blood >500 mL within 2 months prior to administration of the study intervention or plasma donation within 7 days prior to screening. 14. Significant infection or known inflammatory process that occurred during screening (in the opinion of the investigator). 15. Chronic or recurrent urinary tract infection (UTI), or history of UTI within 1 month prior to screening. 16. Patients scheduled for elective surgical procedures during the study. 17. Use of prescription medications within 4 weeks prior to administration of the study intervention. 18. Use of any over-the-counter (OTC) medications or herbal supplements, other than regular vitamins, within 7 days of the first dose unless agreed to be clinically irrelevant by the investigator and sponsor. 19.Having received an investigational drug within 3 months prior to administration or being followed up for another clinical trial prior to the study. 20. Seropositivity for HBV, HIV, HCV, or HDV antibodies at screening (medical history testing may be utilized if performed within 3 months prior to screening). 21. Alanine aminotransferase (ALT), aspartate aminotransferase (AST), gamma-glutamyltransferase (GGT), total bilirubin, alkaline phosphatase (ALP), or albumin outside the reference range at the screening visit or on admission (Day 1). 22. Complete blood count abnormalities judged to be clinically relevant and unacceptable to the investigator; hemoglobin <12.0 g / dL (equivalent to 120 g / L); platelets outside the normal range. 23. Hemoglobin AlC (HbAlC) >7%. 24. Any other safety clinical trial result that is deemed clinically significant and unacceptable to the investigator. 25.Has made or plans to make significant changes to exercise level from 48 hours prior to admission to the Clinical Research Center until the end of the study. 26. Any condition that, in the opinion of the Investigator, makes the participant unsuitable for enrollment or that may interfere with participation in or completion of the study.

[0172] Hepatitis B in adults Selection criteria, group B 1.Age 18 (or age of legal consent, whichever is older) through 65 at the time of signing informed consent. 2. Chronic Hepatitis B infection, including: a. Clinical history consistent with CHB based on applicable clinical information and previous seropositivity for HBsAg and possibly seropositivity for other HBV serological markers (HBeAg, HBV DNA). b. Serum HBsAg >1,000 IU / mL at screening for HBeAg-positive patients or >500 IU / mL for HBeAg-negative patients. c. Serum HBV DNA >20,000 IU / mL at screening in treatment-naive patients as measured by the TaqMan™ HBV DNA v2.0 assay in a central laboratory. d. Serum IgM anti-HBc negative. 3. Clinical history consistent with compensated liver disease, with no evidence of cirrhosis: a. No history of bleeding from esophageal or gastrointestinal varices. b. No history of ascites. c. No history of jaundice due to chronic liver disease. d. No history of hepatic encephalopathy. e. Portal hypertension – no physical signs such as spider angiomas. f. No previous liver biopsy, liver imaging, or elastography results indicating cirrhosis. 4. Hepatitis B treatment naive: No prior antiviral treatment for hepatitis B (no prior HBV nucleoside or interferon-containing therapy) or continuous nucleoside therapy (entecavir or tenofovir) for at least 12 weeks prior to the screening visit with adequate tolerance and compliance. 5. Serum ALT >60U / L (men) or >38U / L (women) (2×ULN; American Association for the Study of Liver Disease (AASLD) HBV guidance criteria; Terault et al., 2016) 6. No clinically significant abnormalities (in the investigator's opinion) on 12-lead ECG at Screening and Day 1. 7. Absence of other recognized causes of liver disease. 8. No other medical conditions requiring ongoing medical management or chronic or recurrent pharmacologic intervention other than statin management of well-controlled hypertension and hypercholesterolemia. 9. BMI is 18.0 kg / m 2 More than 32.0kg / m 2 It must be within the following range. 10. Male or Female: a.Male participant: Male participants must agree to use contraception during the treatment period and for 12 weeks after the last dose of study intervention and to not donate sperm during this period. b.Female participants: Female participants were eligible to participate if they were not pregnant, not breastfeeding, and met at least one of the following criteria: were not WOCBP, or, depending on region, were WOCBP who agreed to follow contraception guidance during the treatment period and for at least 12 weeks after administration of the study intervention. 11. Ability to provide signed informed consent, including compliance with requirements and limitations.

[0173] Exclusion criteria, group B 1. History of any medical condition that may interfere with the absorption, distribution, or elimination of the study drug or with the clinical and laboratory evaluations in this study, including (but not limited to): chronic or recurrent renal disease, functional bowel disorder (e.g., frequent diarrhea or constipation), gastrointestinal disease, pancreatitis, seizure disorder, mucocutaneous or musculoskeletal disorder, history of suicide attempt(s) or suicidal ideation, or clinically significant depression or other neuropsychiatric disorder requiring pharmacologic intervention. 2. Poorly controlled or unstable hypertension. 3. History of diabetes mellitus treated with insulin or hypoglycemic agents. 4. History of asthma requiring hospitalization within the past 12 months. 5. Evidence of G-6-PD deficiency as determined by screening results at the central laboratory. 6.Currently inadequately controlled endocrine condition, excluding any thyroid condition that is not pharmacologically treated (e.g., hyperthyroidism / hypothyroidism, etc.). 7. Chronic or recurrent UTI, or history of UTI within 1 month prior to screening. 8.History of HCC 9. A history of malignancies other than HCC is acceptable if the patient's malignancy is in complete remission with chemotherapy and no additional medical or surgical interventions have been performed within the past 3 years. 10. History of persistent ethanol abuse (>40 g ethanol / day) or illicit drug use within the past 3 years. 11. History of intolerance to SC injection(s) or significant abdominal scarring that could potentially interfere with administration of the study intervention or assessment of local tolerability. 12.Has received a blood transfusion within 6 weeks prior to treatment or is expected to receive a blood transfusion during follow-up after the study. 13. Blood donation or blood loss >500 mL within 2 months prior to screening, or plasma donation within 7 days prior to screening. 14. Receipt of antiviral therapy (other than entecavir or tenofovir) within 3 months of screening or interferon treatment in the past 3 years. 15. Use of (or requirement to use) anticoagulants, systemic corticosteroids, systemic immunomodulators, or systemic immunosuppressants within the past 6 months. 16. Use of prescription medications within 14 days prior to administration of the study intervention that, in the opinion of the PI or sponsor, would interfere with the conduct of the study. Topical products with no systemic absorption, statins (except rosuvastatin), antihypertensive drugs, OTC and prescription pain relievers, or hormonal contraceptives (females) are permitted. 17. Depot injections or implants of any medication within 3 months prior to administration of the study intervention, except for injectable / implantable birth control. 18. Persistent use of herbal supplements or over-the-counter systemic medications; participants must be willing to discontinue for the duration of the study. 19.Has received an investigational drug within 3 months prior to study entry or is undergoing follow-up in another clinical trial prior to study entry. 20. Hepatic elastography (i.e., FibroScan®) of >10.5 kPa at Screening. 21. At screening, systolic blood pressure >150mmHg and diastolic blood pressure >95mmHg after 10 minutes in supine position. 22. Screening confirmed liver transaminases (ALT or AST) >7×ULN. 23. History of persistent or recurrent hyperbilirubinemia unless Gilbert disease or Dubin-Johnson syndrome is recognized. 24. Seropositivity for antibodies to human immunodeficiency virus (HIV) or hepatitis C virus (HCV) or hepatitis delta virus (HDV). 25. Hgb <12g / dL (men) or <11g / dL (women). 26. Serum albumin <3.5 g / dL at screening. 27. Total WBC count <4,000 cells / μL or absolute neutrophil count (ANC) <1,800 cells / μL at screening. 28. Platelet count ≤ 100,000 per μL at screening. 29. International normalized ratio (INR) or prothrombin time (PT) at screening is above the upper limit of the normal reference range (as local laboratory reference range). 30. Serum BUN or creatinine >ULN. 31. Serum amylase or lipase >1.25×ULN. 32. Serum HbA1c >7.0%. 33. Serum alpha fetal protein (AFP) level >100ng / mL. If AFP at screening is >ULN but <100ng / mL, patients are eligible unless liver imaging reveals lesions suspicious for HCC. 34. Any other safety clinical trial result that is deemed clinically significant and acceptable to the investigator. 35.Has made or plans to make significant changes to exercise level from 48 hours prior to admission to the Clinical Research Center until the end of the study. 36. Any condition that, in the opinion of the Investigator, makes the participant unsuitable for enrollment or that may interfere with participation in or completion of the study.

[0174] The disclosure illustratively described herein may be suitably implemented even if any one or more elements and one or more limitations are not specifically disclosed herein. Thus, for example, in each example herein, the terms "comprise", "consist essentially of" and "consist of" can be replaced with either of the other two terms. The terms and expressions used are used as terms of description rather than limitation, and there is no intention in using such terms and expressions to exclude the features shown and described or equivalents of any part thereof. However, it is recognized that various modifications are possible within the scope of the invention as claimed. Thus, although the invention has been specifically disclosed in preferred embodiments, it is understood that any features, modifications and variations of the concepts disclosed herein may be addressed by those skilled in the art, and it is also understood that such modifications and variations are considered to be within the scope of the invention as defined in the specification and the appended claims.

[0175] In the context of describing the present invention (particularly in the context of the claims below), the use of the terms "a" and "an" and "the" and similar referents should be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms "comprises," "has," "includes," and "containing" should be construed as open-ended terms (i.e., meaning "including," but not limited to), unless otherwise indicated. The recitation of ranges of values ​​herein is intended merely to serve as a shorthand method of individually referring to each individual value falling within the range, unless otherwise indicated herein, and each individual value is incorporated herein as if it were individually recited herein. All methods described herein can be performed in any suitable order, unless otherwise indicated herein or clearly contradicted by context. The use of any examples or illustrative descriptions (e.g., "etc.") provided herein is intended merely to more fully illuminate the invention, and does not limit the scope of the invention, unless otherwise claimed. No statement in the specification should be construed as indicating any claimed element essential to the practice of the invention.

[0176] Embodiments of the invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of these embodiments will become apparent to those skilled in the art upon reading the foregoing description.

[0177] The inventors expect that those skilled in the art will make appropriate use of such variations, and the inventors intend that the invention may be practiced in other ways than as specifically described herein. Accordingly, as permitted by applicable law, the present invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto. Moreover, any combination of the above-described elements in all possible variations thereof is incorporated into the present invention unless otherwise indicated herein or clearly contradicted by context. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be incorporated within the scope of the following claims. Yet another aspect of the present invention may be as follows. [1] An oligonucleotide for reducing expression of hepatitis B virus surface antigen (HBsAg) mRNA, the oligonucleotide comprising an antisense strand having a length of 19 to 30 nucleotides, the antisense strand comprising a region complementary to the sequence of HBsAg mRNA defined by ACAANAAUCCUCACAAUA (SEQ ID NO: 1). [2] The oligonucleotide according to [1] above, further comprising a sense strand having a length of 19 to 50 nucleotides, the sense strand forming a double-stranded region with the antisense strand. [3] The oligonucleotide according to [2], wherein the sense strand comprises a region complementary to the sequence defined by UUNUUGUGAGGAUUN (sequence number 2). [4] The oligonucleotide according to [2] or [3], wherein the sense strand comprises a region complementary to the sequence defined by 5'-UUAUUGUGAGGAUUNUUGUC (sequence number 3). [5] The oligonucleotide according to [3], wherein the antisense strand comprises a sequence defined as UUAUUGUGAGGAUUNUUGUCGG (sequence number 4). [6] The oligonucleotide according to [3], wherein the antisense strand consists of the sequence defined by UUAUUGUGAGGAUUCUUGUCGG (sequence number 5). [7] The oligonucleotide according to [3], wherein the antisense strand consists of the sequence defined by UUAUUGUGAGGAUUUUUGUCGG (sequence number 5.1). [8] The oligonucleotide according to any one of [2] to [6] above, wherein the sense strand comprises a sequence defined by ACAANAAUCCUCACAAUAA (SEQ ID NO: 6). [9] The oligonucleotide according to any one of [2] to [8] above, wherein the sense strand comprises a sequence defined by GACAANAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 7).

[10] The oligonucleotide according to any one of [2] to [8] above, wherein the sense strand consists of a sequence defined by GACAAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 8).

[11] The oligonucleotide according to any one of [2] to [8] above, wherein the sense strand consists of a sequence defined by GACAAGAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 8.1).

[12] An oligonucleotide for reducing expression of hepatitis B virus surface antigen (HBsAg) mRNA, the oligonucleotide comprising a sense strand forming a duplex region with an antisense strand, the sense strand comprising a sequence defined by GACAAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 8), and the antisense strand comprising a sequence defined by UUAUUGUGAGGAUUUUUGUCGG (SEQ ID NO: 5.1); An oligonucleotide, wherein the antisense strand and the sense strand each contain one or more 2'-fluoro and 2'-O-methyl modified nucleotides and at least one phosphorothioate linkage, the 4'-carbon of the sugar of the 5'-nucleotide of the antisense strand contains a phosphate analog, and the sense strand is conjugated to one or more N-acetylgalactosamine (GalNAc) moieties.

[13] An oligonucleotide for reducing expression of hepatitis B virus surface antigen (HBsAg) mRNA, the oligonucleotide comprising a sense strand that forms a duplex region with an antisense strand, the sense strand comprises a sequence set forth in GACAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO:8), comprising 2'-fluoro modified nucleotides at positions 3, 8-10, 12, 13, and 17, 2'-O-methyl modified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26, and 31-36, and at least one phosphorothioate internucleotide linkage, and the sense strand is conjugated to one or more N-acetylgalactosamine (GalNAc) moieties; 1. An oligonucleotide comprising: an antisense strand comprising a sequence set forth in SEQ ID NO: 5.1, and comprising 2'-fluoro modified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16, and 19, 2'-O-methyl modified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18, and 20-22, and at least three phosphorothioate internucleotide linkages; and wherein the 4'-carbon of the sugar of the 5'-nucleotide of the antisense strand comprises a phosphate analog.

[14] The oligonucleotide according to

[13] , wherein the sense strand contains a phosphorothioate bond between the nucleotides at positions 1 and 2.

[15] The oligonucleotide according to

[13] or

[14] , wherein the antisense strand contains five phosphorothioate bonds between nucleotides at positions 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22.

[16] The 5'-nucleotide of the antisense strand has the following structure: [ka] The oligonucleotide according to claim 13 or 14, comprising:

[17] The oligonucleotide according to

[13] or

[14] , wherein one or more nucleotides of the -GAAA- sequence on the sense strand are conjugated to a monovalent GalNac moiety.

[18] The oligonucleotide according to

[17] , wherein each nucleotide of the -GAAA- sequence on the sense strand is conjugated to a monovalent GalNac moiety.

[19] The -GAAA- motif has the following structure:

change

[20] The oligonucleotide according to

[19] above, wherein L is an acetal linker.

[21] The oligonucleotide according to

[19] or

[20] above, wherein X is O.

[22] The -GAAA- sequence has the following structure:

change

[23] The sense strand has a 3'-terminal S 1 -L-S 2 and a stem loop defined by S 1 is S 2 and L is a sequence up to 6 nucleotides long, 1 and S. 2 The oligonucleotide according to claim 2, which forms a loop between the amino acids.

[24] The oligonucleotide according to

[23] above, wherein L is a tetraloop.

[25] L is a 4-nucleotide long S 1 and S. 2 The oligonucleotide according to claim 23 or 24, which forms a loop between the

[26] The oligonucleotide according to any one of

[23] to

[25] above, wherein L comprises a sequence defined as GAAA.

[27] The oligonucleotide according to any one of

[23] to

[26] above, wherein the first four nucleotides of L in the stem loop are each conjugated to a different GalNAc.

[28] The oligonucleotide according to any one of [1] to

[10] above, wherein the oligonucleotide contains at least one modified nucleotide.

[29] The oligonucleotide according to

[28] , wherein the modified nucleotide comprises a 2'-modification.

[30] The oligonucleotide according to

[29] , wherein the 2'-modification is selected from 2'-aminoethyl, 2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl, and 2'-deoxy-2'-fluoro-β-d-arabinoic acid.

[31] The oligonucleotide according to any one of [1] to

[10] above, wherein all nucleotides of the oligonucleotide are modified nucleotides.

[32] The oligonucleotide according to any one of [1] to

[10] above, wherein the oligonucleotide contains at least one modified internucleotide bond.

[33] The oligonucleotide according to

[32] , wherein at least one modified internucleotide bond is a phosphorothioate bond.

[34] The oligonucleotide according to any one of [1] to

[10] above, wherein the 4'-carbon of the sugar of the 5'-nucleotide of the antisense strand contains a phosphate analogue.

[35] The oligonucleotide according to any one of [1] to

[10] above, wherein at least one nucleotide of the oligonucleotide is conjugated to a targeting ligand.

[36] The oligonucleotide according to

[35] , wherein the targeting ligand is an N-acetylgalactosamine (GalNAc) moiety.

[37] A composition comprising the oligonucleotide according to any one of [1] to

[36] above and a counter ion.

[38] A composition comprising the oligonucleotide according to any one of [1] to

[37] above and a pharma- ceutically acceptable carrier.

[39] A method for reducing the expression of a hepatitis B virus (HBV) surface antigen in a cell, comprising a step of delivering an oligonucleotide described in any one of [1] to

[36] to the cell.

[40] The method according to

[39] , wherein the cells are hepatocytes.

[41] The method according to any one of

[30] to

[40] above, wherein the cell is an in vivo cell.

[42] The method according to

[39] or

[40] , wherein the cell is an in vitro cell.

[43] A method for treating Hepatitis B virus (HBV) infection in a subject, comprising the step of administering to the subject an oligonucleotide described in any one of [1] to

[36] , or a composition described in

[37] or

[38] .

[44] A method for treating HBV infection in a subject, comprising administering to the subject an RNAi oligonucleotide that selectively targets HBsAg mRNA, characterized in that the RNAi oligonucleotide is administered without treatment with an RNAi oligonucleotide that targets a non-surface antigen-encoding HBV mRNA transcript.

[45] A method for treating HBV infection in a subject, comprising the step of administering to the subject an RNAi oligonucleotide that selectively targets HBsAg mRNA, and not administering to the subject an RNAi oligonucleotide that selectively targets HBxAg mRNA transcripts.

[46] The method according to any one of

[39] to

[45] above, further comprising the step of administering an effective amount of entecavir to the subject.

[47] An oligonucleotide for reducing expression of hepatitis B virus surface antigen (HBsAg) mRNA, the oligonucleotide comprising a sense strand forming a duplex region with an antisense strand, the sense strand comprises a sequence set forth in GACAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 8), and comprises 2'-fluoro modified nucleotides at positions 3, 8-10, 12, 13, and 17, 2'-O-methyl modified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26, and 31-36, and one phosphorothioate internucleotide linkage between the nucleotides at positions 1 and 2, wherein each nucleotide of the -GAAA- sequence of the sense strand is conjugated to a monovalent GalNac moiety, and the -GAAA- sequence has the following structure:

change

change

[48] ​​A composition comprising the oligonucleotide described in

[47] .

[49] The composition described in

[48] above, further comprising a Na+ counter ion.

[50] A method for reducing expression of Hepatitis B virus (HBV) surface antigen in a cell, comprising a step of delivering the oligonucleotide described in

[47] or the composition described in

[48] or

[49] to the cell.

[51] The method according to

[50] , wherein the cells are hepatocytes.

[52] The method according to

[50] or

[51] , wherein the cell is an in vivo cell.

[53] The method according to

[50] or

[51] , wherein the cell is an in vitro cell.

[54] A method for treating Hepatitis B virus (HBV) infection in a subject, comprising administering to the subject the oligonucleotide described in

[47] or the composition described in

[48] or

[49] .

[55] The method according to any one of

[50] to

[54] above, further comprising the step of administering an effective amount of entecavir to the subject.

Claims

1. 1. An oligonucleotide for inhibiting expression of Hepatitis B virus (HBV) surface antigen (HBsAg), comprising a sense strand that forms a duplex region with an antisense strand, An oligonucleotide, wherein the sense strand consists of a sequence defined as GACAAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 8), and the antisense strand consists of a sequence defined as UUAUUGUGAGGAUUUUUGUCGG (SEQ ID NO: 5.1).

2. The oligonucleotide of claim 1 , comprising at least one modified nucleotide.

3. The oligonucleotide of claim 2 , wherein the modified nucleotide comprises a 2′-modification.

4. 4. The oligonucleotide of claim 3, wherein the 2'-modification is a modification selected from 2'-aminoethyl, 2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl, and 2'-deoxy-2'-fluoro-β-d-arabinoic acid.

5. The oligonucleotide of claim 1 , wherein all nucleotides of the oligonucleotide are modified nucleotides.

6. The oligonucleotide of claim 1 , comprising at least one modified internucleotide linkage.

7. The oligonucleotide of claim 6 , wherein the at least one modified internucleotide linkage is a phosphorothioate linkage.

8. The oligonucleotide of claim 1 , wherein the 4'-carbon of the sugar of the 5'-nucleotide of the antisense strand comprises a phosphate analog.

9. The 5′-nucleotide of the antisense strand has the following structure: 【Chemistry 1】 The oligonucleotide of claim 8 , having the formula:

10. The oligonucleotide of claim 1 , wherein at least one nucleotide of the oligonucleotide is conjugated to a targeting ligand.

11. The oligonucleotide of claim 10 , wherein the targeting ligand is an N-acetylgalactosamine (GalNAc) moiety.

12. 12. The oligonucleotide of claim 11, wherein one or more nucleotides of the -GAAA- sequence on the sense strand are conjugated to a monovalent GalNac moiety.

13. 13. The oligonucleotide of claim 12, wherein each nucleotide of the -GAAA- sequence on the sense strand is conjugated to a monovalent GalNac moiety.

14. The -GAAA- sequence has the following structure: 【Chemistry 2】 wherein: L is a bond, a click chemistry handle, or a linker of 1-20 contiguous covalently bonded atoms in length selected from the group consisting of substituted and unsubstituted alkylene, substituted and unsubstituted alkenylene, substituted and unsubstituted alkynylene, substituted and unsubstituted heteroalkylene, substituted and unsubstituted heteroalkenylene, substituted and unsubstituted heteroalkynylene, and combinations thereof; and 14. The oligonucleotide of claim 13, wherein X is O, S or N.

15. 15. The oligonucleotide of claim 14, wherein L is an acetal linker.

16. 15. The oligonucleotide of claim 14, wherein X is O.

17. The -GAAA- sequence has the following structure: 【Chemistry 3】 The oligonucleotide of claim 14, comprising:

18. 2. The oligonucleotide of claim 1, wherein the sense strand comprises 2'-fluoro modified nucleotides at positions 3, 8-10, 12, 13, and 17, 2'-O-methyl modified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26, and 31-36, and one phosphorothioate linkage between the nucleotides at positions 1 and 2, and the sense strand is conjugated to one or more N-acetylgalactosamine (GalNAc) moieties.

19. 2. The oligonucleotide of claim 1, wherein the antisense strand comprises 2'-fluoro modified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16, and 19, 2'-O-methyl modified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18, and 20-22, and five phosphorothioate linkages between nucleotides at positions 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22, and the 4'-carbon of the sugar of the 5'-nucleotide of the antisense strand comprises a phosphate analog.

20. A composition comprising the oligonucleotide of claim 1, a counterion, and a pharma- ceutically acceptable carrier.

21. The counter ion is Na + The composition of claim 20, wherein said counterion is

22. The composition of claim 20 , wherein the pharma- ceutically acceptable carrier comprises water.

23. 20. An in vitro method of reducing expression of Hepatitis B virus (HBV) surface antigen (HBsAg) in a cell, comprising delivering to said cell an oligonucleotide according to any one of claims 1 to 19.

24. 24. The method of claim 23, wherein the cell is a hepatocyte.

25. Use of an oligonucleotide according to any one of claims 1 to 19 or a composition according to any one of claims 20 to 22 in the manufacture of a medicament for the treatment of HBV infection in a patient.

26. 26. The use according to claim 25, wherein the oligonucleotide or composition is administered subcutaneously to the patient.

27. 26. The use according to claim 25, wherein the patient is an HBV e-antigen (HBeAg) positive patient.

28. 28. The use of claim 27, wherein the HBeAg positive patient has serum HBV surface antigen (HBsAg) > 1,000 IU / mL.

29. 26. The use according to claim 25, wherein the patient is an HBeAg negative patient.

30. 30. The use of claim 29, wherein the HBeAg negative patient has serum HBsAg > 500 IU / mL.

31. 26. The use of claim 25, wherein the patient has serum HBV DNA >20,000 IU / mL.

Images