Methods for early prediction of breast cancer and for monitoring treatment response, recurrence and prognosis - Patents.com

Abstract

The present invention provides a method for early prediction of breast cancer and for monitoring treatment response, recurrence and prognosis. The present invention discloses a set of novel epigenetic biomarkers for early prediction of breast cancer and monitoring treatment response, recurrence, and prognosis. Aberrant gene methylation can be detected in tumor tissue and plasma samples from breast cancer patients, but not in normal healthy individuals. The present disclosure also discloses primers and probes used therein. [Selection diagram] None

Description

[Technical field]

[0001] FIELD OF THEINVENTION The present invention relates to genetic biomarkers for predicting breast cancer risk or susceptibility and / or breast cancer prognosis and aggressiveness. In particular, the present invention detects breast cancer, predicts breast cancer risk or susceptibility and / or breast cancer prognosis and aggressiveness based on the methylation of genetic biomarkers. [Background technology]

[0002] 2. Background of the Invention Cancer, a group of diseases involving abnormal cell growth that can invade or spread to other parts of the body, is the leading cause of death worldwide.

[0003] Methylated DNA has been investigated as a class of promising biomarkers in tissues of most tumor types. In many cases, DNA methyltransferases add methyl groups to DNA at cytosine-phosphate-guanine (CpG) island sites as an epigenetic control of gene expression. US 2008 / 0311570(A1A) provides a method for screening cancer, which includes the steps of: (1) providing a test sample; (2) detecting the methylation status of CpG sequences in at least one target gene in the genomic DNA of the test sample, the target genes consisting of SOX1, PAX1, LMX1A, NKX6-1, WT1 and ONECUT1; and (3) determining the presence of cancer or cancerous pathological changes in the sample based on the presence or absence of methylation status in the target gene. WO 2016 / 071477(A1) relates to the evaluation of a cancer patient's response to treatment by analyzing CpG methylation in the shox2 gene. EP 2828405(B1) provides a method for detecting colorectal neoplasia by evaluating multiple genetic markers in blood or plasma and stool. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] US Patent Application Publication No. 2008 / 0311570(A1A) [Patent Document 2] International Publication No. 2016 / 071477(A1) Brochure [Patent Document 3] European Patent No. 2828405(B1) Summary of the Invention

[0005] This disclosure discloses a set of novel epigenetic biomarkers for early prediction of breast cancer, monitoring treatment response, recurrence and prognosis. Aberrant methylation of genes can be detected in tumor tissue and plasma samples from cancer patients, but not in normal healthy individuals. This disclosure also discloses primers and probes used herein.

[0006] In one embodiment, the present disclosure discloses a method for detecting methylation status in a human subject in need of detection of breast cancer, the method comprising the steps of (a) providing a biological sample, and (b) assaying the methylation status of epigenetic biomarkers in target DNA sequences GCM2 and ITPRIPL1 or fragments thereof, wherein the presence of hypermethylation in said DNA sequences in the human subject relative to a control methylation status is indicative of breast cancer.

[0007] In one embodiment, the present disclosure discloses a method for detecting predisposition to or incidence of breast cancer or predicting treatment response, prognosis or recurrence of breast cancer in a human subject, the method comprising: (a) providing a biological sample; and (b) assaying the methylation status of epigenetic biomarkers in target DNA sequences GCM2 and ITPRIPL1 or fragments thereof, wherein the presence of hypermethylation in said DNA sequences of the human subject relative to the methylation status of a control indicates predisposition to or incidence of breast cancer, poor treatment response, poor prognosis or recurrence.

[0008] In some embodiments, a GCM2 methylation-specific probe and an ITPRIPL1 methylation-specific probe are used to assay the methylation levels of target GCM2 and ITPRIPL1 DNA sequences or fragments thereof and a control DNA sequence in a sample.

[0009] In one embodiment, the present disclosure provides a method comprising the steps of: (a) providing a biological sample containing target DNA sequences GCM2 and ITPRIPL1 or fragments thereof; (b) assaying the methylation levels of the target GCM2 and ITPRIPL1 DNA sequences or fragments thereof and a control DNA sequence in the sample using a GCM2 methylation specific probe and an ITPRIPL1 methylation specific probe; (c) measuring the relative methylation status of the target GCM2 and ITPRIPL1 DNA sequences or fragments thereof relative to the control DNA sequence to detect the presence of hypermethylated GCM2 and ITPRIPL1; and (d) identifying the human subject as needing breast cancer treatment when the target DNA sequences GCM2 and ITPRIPL1 DNA sequences or fragments thereof of the human subject are hypermethylated compared to the methylation of the control DNA sequence in the human subject. The method can detect the methylation status in a human subject in need of breast cancer detection.

[0010] In one embodiment, the disclosure provides a method comprising the steps of: (a) providing a biological sample comprising target DNA sequences GCM2 and ITPRIPL1 or fragments thereof; (b) assaying the methylation levels of the target GCM2 and ITPRIPL1 DNA sequences or fragments thereof and a control DNA sequence in the sample using a GCM2 methylation-specific probe and an ITPRIPL1 methylation-specific probe; (c) measuring the relative methylation status of the target GCM2 and ITPRIPL1 DNA sequences or fragments thereof relative to the control DNA sequence to detect the presence of hypermethylated GCM2 and ITPRIPL1; and (d) identifying the human subject as having a predisposition to or suffering from breast cancer, poor treatment response or poor prognosis or recurrence when the target DNA sequences GCM2 and ITRPIPL1 of the subject are hypermethylated compared to the methylation status of the control DNA sequence in the subject.

[0011] In some embodiments, the biological sample is a tissue, a cell, blood, urine, serum or plasma.

[0012] In some embodiments, methylation in the DNA sequences GCM2 and ITPRIPL1 or fragments thereof described herein that is about 64% higher than that of the control is indicative of breast cancer. In further embodiments, methylation in the DNA sequences GCM2 and ITPRIPL1 or fragments thereof that is about 69% higher than that of the control is indicative of breast cancer. In further embodiments, methylation in the DNA sequences GCM2 and ITPRIPL1 or fragments that is about 69% and about 80% higher than that of the control, respectively, is indicative of breast cancer.

[0013] In some embodiments, hypermethylation as described herein is indicated when methylation of the target DNA sequence in a human subject is at least 0.5-fold, 1-fold, 2-fold, or 3-fold higher than methylation in a control. In one embodiment, hypermethylation is indicated when methylation of the target DNA sequence in a human subject is at least 2-fold higher than methylation in a control.

[0014] Certain embodiments of the probes used in the methylation assay have about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or higher percent homology to a sequence selected from the group consisting of SEQ ID NOs: 13-18. In some embodiments, the GCM2 methylation specific probe has a sequence having at least 85% homology to SEQ ID NO: 15 and the ITPRIPL1 methylation specific probe has a sequence having at least 85% homology to SEQ ID NO: 16. In some embodiments, the GCM2 methylation specific probe has a sequence of SEQ ID NO: 15 and the ITPRIPL1 methylation specific probe has a sequence of SEQ ID NO: 16.

[0015] In a further embodiment, the method of the present disclosure further comprises assaying the methylation level of one or more of the following target DNA sequences or any combination thereof: C1orf114 or a fragment thereof, ZNF177 or a fragment thereof, and C8orf47 or a fragment thereof. In addition, the methylation level of RKL001 is further assayed.

[0016] In some embodiments, any of C1orf114 methylation specific probe, ZNF177 methylation specific probe or C8orf47 methylation specific probe or combinations thereof are further used to assay the methylation level of one or more of the following target DNA sequences or any of their combinations: C1orf114 or a fragment thereof, ZNF177 or a fragment thereof and C8orf47 or a fragment thereof. Furthermore, the methylation specific probes of the targets C1orf114, ZNF177 and C8orf47 or a fragment thereof have sequences with at least 85% homology to SEQ ID NO: 17, 18 and 14, respectively. In further embodiments, the methylation specific probes of the targets C1orf114 or a fragment thereof, ZNF177 or a fragment thereof and C8orf47 or a fragment thereof have sequences with SEQ ID NO: 17, 18 and 14, respectively.

[0017] In some embodiments, the relative methylation status of the target C1orf114, ZNF177 and / or C8orf47 DNA sequence or fragments thereof, relative to the control DNA sequence, has a sensitivity of about 75% or higher and a specificity of about 76% for C1orf114, and a sensitivity of about 62% or higher and a specificity of about 82% for ZNF177. In some embodiments, the relative methylation status of the target GCM2 and ITPRIPL1 or fragments thereof; the target GCM2, ITPRIPL1 and C1orf114 or fragments thereof; and the combination of GCM2, ITPRIPL1, C1orf114 and ZNF177 or fragments thereof, relative to the control DNA sequence, has a sensitivity of about 87% or higher and a specificity of about 96%, a sensitivity of about 95% or higher and a specificity of about 72%, a sensitivity of about 87% or higher and a specificity of about 96%, respectively. In further embodiments, the criteria further comprise measuring specificity and sensitivity by analysis of weighted sum scores. In some further embodiments, the criteria of relative methylation status of the combination of targets GCM2, ITPRIPL1 and C1orf114 or fragments thereof or targets GCM2, ITPRIPL1, C1orf114 and ZNF177 or fragments thereof have a sensitivity of greater than about 87% and a specificity of about 96%, and a sensitivity of greater than about 91% and a specificity of about 96%, respectively.

[0018] In a further embodiment, a RKL001 methylation specific probe is further used to assay the methylation level of RKL001. Preferably, the RKL001 methylation specific probe has a sequence having at least 85% homology to SEQ ID NO: 13. More preferably, the RKL001 methylation specific probe has a sequence having homology to SEQ ID NO: 13.

[0019] In some embodiments, the methylation status is detected by polymerase chain reaction, nucleic acid sequencing (e.g., bisulfite sequencing or pyrosequencing), bisulfite conversion, mass spectrometry, methylation-specific nucleases, mass-based separation, target capture, or microarray. In certain embodiments, the methylation status is detected by polymerase chain reaction.

[0020] Certain embodiments of primers used in the polymerase chain reaction have about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or higher percent homology to a sequence selected from the group consisting of SEQ ID NOs: 1-12. In some embodiments, primers having sequences of SEQ ID NOs: 5-8 or probes having sequences of SEQ ID NOs: 15 and 16 are used to detect or measure the methylation status of the target DNA sequences GCM2 and ITPRIPL1 or fragments thereof.

[0021] The present disclosure also provides a kit for detecting and / or characterizing the methylation profile of epigenetic biomarkers in target DNA sequences as described herein.The kit may further comprise sodium bisulfite, and an adaptor for amplifying the entire target gene, and a polynucleotide (e.g., detectably labeled polynucleotide) for quantifying the presence of the converted methylation sequence and / or the converted non-methylation sequence of at least one cytosine from the DNA region of epigenetic biomarkers in target DNA sequences as described herein.In addition, the kit may further comprise methylation sensing restriction enzymes for amplifying the entire target sequence or gene.

[0022] In one embodiment, the kit further comprises one or more primers having sequences of SEQ ID NOs: 9-12 and 1-4 and / or one or more probes having sequences of SEQ ID NOs: 17, 18, 12 and 13 in combination with one or more target DNA sequences C1orf114 or a fragment thereof, ZNF177 or a fragment thereof, C8orf47 or a fragment thereof and RKL0014 or a combination thereof for assaying the methylation status of epigenetic biomarkers in the target DNA sequences GCM2 and ITPRIPL1 or a fragment thereof.

[0023] In one embodiment, the kit may be used to detect and / or characterize the methylation profile of epigenetic biomarkers in target DNA sequences GCM2 or a fragment thereof and ITPRIPL1 or a fragment thereof, together with one or more target DNA sequences C1orf114 or a fragment thereof, ZNF177 or a fragment thereof, C8orf47 or a fragment thereof, and RKL0014 or any combination thereof. The kit further comprises one or more primers having sequences of SEQ ID NOs: 9-12 and 1-4 and / or one or more probes having sequences of SEQ ID NOs: 17, 18, 12, and 13 for detecting or measuring the methylation status of the target DNA sequences.

[0024] In a further embodiment, the kit further comprises a methylation-sensitive restriction enzyme for amplifying the entire target sequence or gene. [Brief description of the drawings]

[0025] [Figure 1] Figures 1A-F show heat maps of the differences in methylation status of target nucleic acids and promoter, exon and gene body regions of genes between tumor tissues and adjacent normal tissues, respectively (A: RKL001; B: C8orf47; C: GCM2; D: C1orf114; E: ITPRIPL1; F: ZNF177).

[0026] [Diagram 2] FIG. 2 shows the differences in early detection of the methylation status of epigenetic biomarkers of target genes in plasma samples of healthy subjects and breast cancer patients.

[0027] [Diagram 3] Figure 3 shows receiver operating characteristic (ROC) curve analysis showing early detection of epigenetic biomarker methylation status of target genes in breast cancer patients and healthy subjects. GI: ​​GCM2, ITPRIPL1; GIC: GCM2, ITPRIPL1, C1orf114; GICZ: GCM2, ITPRIPL1, C1orf114, ZNF177; G(a*)I(b*)C(c*)Z(d*): GCM2+ITPRIPL1+C1orf114+ZNF177 after analysis of weighted sum scores.

[0028] [Figure 4] Figures 4A-C show treatment response according to the methylation status of epigenetic biomarkers for target genes C1orf114 (A), CA-153 (B) and CEA (C) in breast cancer patients pre- and post-surgery.

[0029] [Diagram 5] Figure 5 shows poor prognosis in breast cancer patients based on Kaplan-Meier curves of the methylation status of the ITPRIPL1 gene. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0030] It is understood that the invention is not limited to the particular materials and methods described herein. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments, and is not intended to limit the scope of the present invention, which is limited only by the appended claims.

[0031] It should be noted that as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to "a biomarker" includes a mixture of two or more biomarkers, and the like.

[0032] The term "AUC" as used herein is an abbreviation for area under the curve. In particular, this term refers to the area under the receiver operating characteristic (ROC) curve. The ROC curve plots the true positive rate against the false positive rate for various possible cut points of a diagnostic test. The ROC curve shows a trade-off between sensitivity and specificity depending on the cut point selected (as sensitivity increases, specificity decreases). The area under the ROC curve (AUC) is a measure for the accuracy of a diagnostic test (larger areas are better, with 1 being the best, and for a randomized test, the ROC curve will be on the diagonal and have an area of ​​0.5; see J.P. Egan. Signal Detection Theory and ROC Analysis, Academic Press, New York, 1975).

[0033] The term "biological sample" refers to a sample of tissue, cells or bodily fluid isolated from a subject, including, but not limited to, blood, buffy coat, plasma, serum, blood cells (e.g., peripheral blood mononuclear cells (PBMCS), band cells, neutrophils, metamyelocytes, monocytes or T cells), feces, urine, bone marrow, bile, cerebrospinal fluid, lymphatic fluid, skin samples, external secretions of the skin, respiratory tract, intestinal and genitourinary tract, tears, saliva, milk, organs, biopsies, and samples of constituents of in vitro cell cultures (including, but not limited to, cells and tissues in culture, e.g., conditioned medium, and cellular components from the growth of recombinant cells).

[0034] The term "biomarker" refers to a nucleic acid molecule present in a sample taken from a patient with human cancer compared to an equivalent sample taken from a control subject (e.g., a person with a negative diagnosis or undetectable cancer, a normal or healthy subject). Biomarkers can be nucleic acids, fragments of nucleic acids, polynucleotides or oligonucleotides that can be detected and / or quantified. Biomarkers include polynucleotides that contain nucleotide sequences derived from genes.

[0035] The term "CpG island" as used herein refers to a stretch of DNA in a genome that is GC-rich relative to the rest of the genome. The GC content of these regions, which span hundreds and sometimes thousands of base pairs, is usually 50% or more. These regions often mark the 5' ends of genes.

[0036] A "control amount" of a biomarker can be any amount or range of amounts that is compared to a test amount of the biomarker.

[0037] As used herein, the term "early detection" of cancer refers to the detection of possible cancer before metastasis. Preferably, the term refers to the detection of possible cancer before morphological changes in sample tissue or cells are observed.

[0038] As used herein, the terms "detect," "detecting," or "detection" can describe the general act of finding or distinguishing, or the specific observation of a detectably labeled composition.

[0039] The term "gene" refers to a nucleic acid (e.g., DNA) sequence that comprises coding sequences necessary for the production of a polypeptide, precursor, or RNA (e.g., non-coding RNA, e.g., ribosomal RNA, transfer RNA, splicosomal RNA, microRNA). A polypeptide or non-coding RNA can be encoded by a full-length coding sequence or any portion of a coding sequence, so long as the desired activity or functional properties of the full-length or fragment polypeptide (e.g., enzymatic activity, ligand binding, signal transduction, immunogenicity, etc.) are retained. Thus, a gene may include or exclude promoter sequences, terminators, translation control sequences (e.g., ribosome binding sites and internal ribosome entry sites), enhancers, silencers, insulators, border regions, origins of replication, matrix attachment sites, and locus control regions. The term also encompasses the coding region of a structural gene, and sequences located adjacent to the coding region at both the 5' and 3' ends of the coding region for a distance of about 1 kb or more on either end, such that the length of the gene corresponds to a full-length mRNA. The term "gene" also encompasses both cDNA and genomic forms of a gene.

[0040] As used herein, the term "homology" refers to a first sequence that shares a certain degree of sequence identity with a second sequence, but the sequence is not identical to the second sequence.For example, a polynucleotide that comprises the wild-type sequence of a mutant gene is homologous to the sequence of the mutant gene, but is not identical.In some embodiments, the degree of homology between two sequences is sufficient to allow homologous recombination between them under appropriate stringent conditions.

[0041] Techniques for measuring nucleic acid sequence identity and amino acid sequence identity include determining the nucleotide sequence of the mRNA for a gene and / or determining the amino acid sequence encoded thereby, and comparing these sequences to a second nucleotide or amino acid sequence. Genomic sequences can also be determined and compared in this manner. In general, identity refers to the exact nucleotide-to-nucleotide or amino acid-to-amino acid match of two polynucleotide or polypeptide sequences, respectively. Two or more sequences (polynucleotide or amino acid) can be compared by determining their percent identity. The percent identity of two sequences, whether nucleic acid or amino acid sequences, is the number of exact matches between the two aligned sequences divided by the length of the shorter sequence, multiplied by 100.

[0042] In some embodiments, the degree of sequence similarity between polynucleotides can be measured by hybridization of the polynucleotides under conditions that allow the formation of stable duplexes between homologous regions, followed by digestion with single-strand specific nucleases and size measurement of the digested fragments. Two nucleic acid sequences or two polypeptide sequences are substantially homologous to each other when their sequences show at least about 70%-75%, preferably 80%-82%, more preferably 85%-90%, even more preferably 92%, even more preferably 95%, and most preferably 98% sequence identity over a defined length of the molecules determined using the above method. As used herein, substantially homologous also refers to a sequence that shows complete identity with a specific DNA sequence or polypeptide sequence. Substantially homologous DNA sequences can be identified, for example, in a Southern hybridization experiment under stringent conditions defined for that particular system. See, e.g., Sambrook et al., supra; Nucleic Acid Hybridization: A Practical Approach, editors BD Hames and SJ Higgins, (1985) Oxford; Washington, DC; IRL Press).

[0043] As used herein, the term "prediction" refers to the likelihood that a patient will respond favorably or unfavorably to a drug or set of drugs, and also to the degree of those responses. Thus, treatment predictors are variables that relate to an individual patient's response to a particular treatment, independent of prognosis.

[0044] The term "methylation," as used herein, refers to the presence of a methyl group added to a cytosine base in a region of a nucleic acid, e.g., genomic DNA, by the action of a DNA methyltransferase enzyme.

[0045] The term "methylation status," "methylation profile," or "methylation state" of a nucleic acid molecule refers to the presence or absence of one or more methylated nucleotide bases in the nucleic acid molecule. For example, a nucleic acid molecule that contains a methylated cytosine is considered to be methylated (i.e., the methylation status of the nucleic acid molecule is methylated). A nucleic acid molecule that does not contain any methylated nucleotides is considered to be unmethylated.

[0046] The term "hypermethylation" refers to an average methylation status corresponding to an increased presence of methylated nucleotide bases in a nucleic acid molecule at one or more CpG dinucleotides in a DNA sequence of a test DNA sample compared to the amount of methylated nucleotide bases in the nucleic acid molecule at the corresponding CpG dinucleotides in a normal control DNA sample.

[0047] The term "hypomethylation" refers to an average methylation status corresponding to a reduced presence of methylated nucleotide bases in a nucleic acid molecule at one or more CpG dinucleotides in a DNA sequence of a test DNA sample compared to the amount of methylated nucleotide bases in the nucleic acid molecule at the corresponding CpG dinucleotides in a normal control DNA sample.

[0048] The term "subject" refers to a human.

[0049] The term "susceptibility" refers to a constitution or state of the body that causes tissues to react in a special way to certain external stimuli and thus predisposes the individual to be more susceptible than usual to certain diseases.

[0050] The term "target site" or "target sequence" refers to a nucleic acid sequence that defines a portion of a nucleic acid to which a binding molecule will bind when sufficient conditions for binding are present.

[0051] The term "risk" refers to an estimate of the probability of acquiring a disease within a certain time period (eg, within the next 10 years) or during a subject's lifetime.

[0052] The term "prognosis" as used herein generally refers to a prediction of the likely course and outcome of a clinical condition or disease. A patient's prognosis is usually made by evaluating factors or symptoms of a disease that indicate a favorable or unfavorable course or outcome of the disease.

[0053] The term "weighted sum score" refers to all possible options evaluated by a score that includes all objectives, each weighted separately to emphasize the importance of different objectives.

[0054] Cancer is characterized by abnormal cell growth due to one or more mutations or modifications in genes, which leads to dysregulation of the balance between cell proliferation and cell death. In many disease processes, such as cancer, CpG islands in gene promoters acquire abnormal hypermethylation, resulting in transcriptional silencing that can be inherited by daughter cells after cell division. Silencing due to DNA methylation in cancer usually occurs at multiple CpG sites in CpG islands present in the promoters of protein-coding genes. Changes in DNA methylation have been recognized as an important component of cancer development. DNA methylation profiling provides higher clinical sensitivity and a wider dynamic range than other cancer detection. Thus, the present disclosure provides methods and kits for early prediction of breast cancer, monitoring treatment response and prognosis or recurrence.

[0055] In the present disclosure, the methylation status of the target DNA sequences GCM2 and ITPRIPL1 or their fragments is measured in a biological sample to detect breast cancer in a human subject, or to detect predisposition to or incidence of breast cancer, or to predict treatment response, prognosis, or recurrence of breast cancer. In a further embodiment, the methylation status of the target DNA sequences C1orf114, ZNF177, and / or C8orf47 or their fragments is measured in a biological sample to detect breast cancer in a human subject, or to detect predisposition to or incidence of breast cancer, or to predict treatment response, prognosis, or recurrence of breast cancer. In a further embodiment, the methylation status of the nucleic acid sequence RKL001 in human chromosome 19 is further measured.

[0056] The GCM2 gene encodes glial cell defect homolog 2, which is believed to act as a binary switch between neuronal and glial cell determination. GCM proteins and mammalian GCM homologs contain a conserved N-terminal GCM motif that has DNA binding activity. The GCM2 sequence and its function are known in the art and described, for example, on the website: https: / / www.genecards.org / cgi-bin / carddisp.pl?gene=GCM2.

[0057] The ITPRIPL1 gene encodes inositol 1,4,5-triphosphate receptor interacting protein-like 1. The ITPRIPL1 sequence and its function are known in the art and are described, for example, on the website: https: / / www.genecards.org / cgi-bin / carddisp.pl?gene=ITPRIPL1.

[0058] ZNF177 encodes zinc finger protein 177. The ZNF177 sequence and its function are known in the art and are described, for example, at the website: https: / / www.genecards.org / cgi-bin / carddisp.pl?gene=ZNF177.

[0059] C8orf47 encodes glutamic acid-rich protein 5. The C8orf47 sequence and its function are known in the art and described, for example, on the website: https: / / www.genecards.org / cgi-bin / carddisp.pl?gene=ERICH5.

[0060] RKL001 is a nucleic acid sequence in chromosome 19 and has the following sequence: CGCAGGCCAGGCCCTCTATTCCTGTCGCTGCGCCCCGCCTTGCCGGCTGCGTGTCACCCCCCCCCCTGCCGCGCTGGCTCCCCGTCCGTCCCACCAGCCTTGCTGTCCTGGGCAGGCCGGGGAATTCCTCCCGGTTCCTGGAAAAAACA (SEQ ID NO: 19).

[0061] In some embodiments, the methylation comprises a cytosine methylation site. In some cases, the cytosine methylation comprises 5-methylcytosine (5-mCyt) and 5-hydroxymethylcytosine. In some cases, the cytosine methylation site is present in a CpG dinucleotide motif. In other cases, the cytosine methylation site is present in a CHG or CHH motif, where the cytosine is an adenine, a cytosine, or a thymine. In some cases, one or more CpG dinucleotide motifs or CpG sites form a CpG island, which is a short DNA sequence rich in CpG dinucleotides. In some cases, the CpG island is usually, but not necessarily, about 0.2 to about 1 kb in length. In some cases, the methylation comprises methylation of a CpG island.

[0062] In some embodiments, the methylation status is analyzed by digestion with methylation-specific enzymes; bisulfite sequencing; an analysis selected from promoter methylation, CpG island methylation, MSP, HeavyMethyl, MethyLight, and Ms-SNuPE; and other methods that rely on detection of amplified DNA. TM"refers to a fluorescence-based real-time PCR method. MethylLight is described in Eads et al., Cancer Res. 59:2302-2306, 1999, which is incorporated herein by reference.

[0063] The term "HeavyMethyl" assay refers to an assay in which methylation-specific selective amplification of a nucleic acid sample is enabled by methylation-specific blocking probes (also referred to herein as blockers) that cover the CpG positions between or are covered by the amplification primers.

[0064] The term "Ms-SNuPE" refers to Methylation-sensitive Single Nucleotide Primer Extension. MsSNuPE is described in Gonzalgo & Jones, Nucleic Acids Res. 25:2529-2531, 1997, which is incorporated herein by reference.

[0065] The term "MSP" refers to methylation specific PCR. MSP is described in Herman et al. Proc. Natl. Acad. Sci. USA 93:9821-9826, 1996 and U.S. Patent No. 5,786,146, each of which is incorporated herein by reference.

[0066] Bisulfite modification of DNA is a method to evaluate the CpG methylation status. 5-methylcytosine is the most frequent covalent base modification in eukaryotic DNA. However, since 5-methylcytosine shows the same base pairing behavior as cytosine, the position of 5-methylcytosine cannot be directly identified by sequencing or hybridization methods. Furthermore, the epigenetic information carried by 5-methylcytosine is completely lost, for example during PCR amplification. Bisulfite sequencing is a method for analyzing DNA for the presence of 5-methylcytosine, which is based on the specific reaction of bisulfite with cytosine, whereby upon subsequent alkaline hydrolysis, cytosine is converted to uracil, whose base pairing behavior corresponds to thymine. However, 5-methylcytosine remains unmodified even under the above-mentioned conditions. Thus, the original DNA is converted so that methylcytosine, which was initially indistinguishable from cytosine by its hybridization behavior, can be detected as the only remaining cytosine by molecular biology techniques, e.g., amplification and hybridization or sequencing.

[0067] In one embodiment, the methylation status is detected by polymerase chain reaction, nucleic acid sequencing (e.g., bisulfite sequencing or pyrosequencing), bisulfite conversion, mass spectrometry, methylation-specific nuclease, mass-based separation, target capture, or microarray. In one embodiment, the methylation status is detected by amplifying methylated CpGs of target genes using primers. In a further embodiment, the detection of methylation is performed by PCR, methylation-specific PCR (MSP), real-time methylation-specific PCR, quantitative methylation-specific PCR (QMSP), PCR using methylated DNA-specific binding protein, or quantitative PCR.

[0068] In one embodiment of the present disclosure, primers that can amplify the methylated CpG of the genes described herein can be used. These primers contain at least one or more CpG dinucleotides in the region that hybridizes to the methylated CpG of these genes. In particular, the primers for amplifying the methylated CpG of these genes include sequences that have about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or higher percent homology to the sequence selected from the group consisting of the following sequences: [Table 1]

[0069] A probe that can hybridize with the methylated CpG of the genes described herein can be used. The probe that can hybridize with the methylated CpG of those genes comprises at least one or more CpG dinucleotides in the region that hybridizes with the methylated CpG of those genes. In particular, the probe can comprise a sequence that has about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or higher percent homology with the sequence selected from the group consisting of the following sequences: [Table 2]

[0070] In one embodiment, detecting the methylation status of the target genes comprises the presence of hypermethylation in those genes relative to the normal status of the target genes.

[0071] In some embodiments, the biological sample is tissue, cells, blood, urine, serum or plasma from a patient suspected of having breast cancer or from a subject to be detected.

[0072] As used herein, the term "patient suspected of having cancer" refers to an individual who has received an initial diagnosis (e.g., a CT scan shows a mass or elevated levels of biomarkers) but the stage of the cancer or the presence or absence of methylated genes indicative of cancer is unknown. The term also includes people who have previously had cancer (e.g., individuals in remission).

[0073] In some embodiments, a detection test that accurately predicts a condition is measured as the sensitivity of the assay, the specificity of the assay, or the area under the receiver operating characteristic (ROC) curve (AUC). The larger the area under the ROC curve, for example, the more accurate or convincing the predictive value of the test.

[0074] In one embodiment, weighted sum score is measured to measure methylation status in nucleic acid sequence and genes as indicators. Weighted sum model (WSM) is the most well-known and simplest multi-criteria decision analysis (MCDA) / multi-criteria decision-making method to evaluate several options with respect to several decision criteria. According to the present disclosure, analysis of weighted sum score shows that the combination of GCM2, ITPRIPL1, C1orf114 and ZNF177 shows sensitivity higher than about 91% and specificity higher than about 96% compared to control.

[0075] In some embodiments, one or more of the biomarkers disclosed herein show a statistically significant difference of at least p<0.05 in different samples. Detection tests using these biomarkers may show an AUC of at least 0.9.

[0076] In some embodiments, the hypermethylation status of the epigenetic biomarkers in the DNA sequences described herein correlates with a "bad" prognosis or the likelihood that a subject will respond unfavorably to a drug or set of drugs, leading to cancer progression and / or refractory to one or more therapeutic agents. In some cases, a "bad" prognosis refers to the likelihood that a subject will not respond to a drug or set of drugs, leading to cancer progression. In some cases, a "bad" prognosis refers to a subject's survival time of less than 5 years to less than 1 month. In some cases, a "bad" prognosis refers to a subject's survival time of less than 5 years to less than 1 month when treated. In some cases, a "bad" prognosis further refers to the likelihood that a subject will develop a cancer that is refractory to one or more drugs.

[0077] In some embodiments, the present disclosure provides a kit for detecting and / or characterizing the methylation profile of the target DNA sequence 19 described herein. In some embodiments, the target DNA sequence comprises a combination selected from the group consisting of GCM2 and ITPRIPL1; GCM2, ITPRIPL1 and C1orf114; GCM2, ITPRIPL1, C1orf114 and ZNF177; GCM2, ITPRIPL1, C1orf114, ZNF177 and RKL1001; and GCM2, ITPRIPL1, C1orf114 and ZNF177, RKL1001 and C8orf47.

[0078] In some cases, the kit comprises a plurality of primers or probes that detect or measure the methylation status / level of one or more target genes. Such a kit, in some cases, comprises at least one polynucleotide that hybridizes to at least one of the methylation biomarker sequences described herein and at least one reagent for detecting gene methylation. Reagents for detecting methylation include, for example, sodium bisulfate, polynucleotides designed to hybridize to sequences that are products of the marker sequences when the marker sequences are not methylated (e.g., containing at least one CU conversion), and / or methylation-sensitive or methylation-dependent restriction enzymes. In some cases, the kit provides a solid support in the form of an assay device adapted for use in the assay. In some cases, the kit further comprises a detectable label, optionally linked to a polynucleotide, e.g., a probe, in the kit. In some embodiments, the kit further comprises a process device for obtaining a weighted sum score as described herein.

[0079] Optionally, one or more detectably labeled polypeptides that can hybridize to the amplified portion are also included in the kit. In some embodiments, the kit includes sufficient primers to amplify the target DNA sequence described herein, and optionally includes detectably labeled polynucleotides that can hybridize to each amplified DNA region or a portion thereof. The kit may further include a methylation-dependent or methylation-sensitive restriction enzyme and / or sodium bisulfite.

[0080] In some embodiments, the kit comprises sodium bisulfite, primers and adapters for amplifying the entire target gene, and a polynucleotide (e.g., a detectably labeled polynucleotide) for quantifying the presence of converted methylated and or converted unmethylated sequences of at least one cytosine from a DNA region of an epigenetic biomarker described herein.

[0081] In some embodiments, the kit comprises a methylation-sensing restriction enzyme, primers and adaptors for amplifying the entire target gene, and a polynucleotide for quantifying the copy number of at least a portion of a DNA region of an epigenetic marker described herein. In some embodiments, the kit comprises a methylation-binding moiety, and one or more polynucleotides for quantifying the copy number of at least a portion of a DNA region of a marker described herein.

[0082] The invention described and claimed herein has many characteristics and embodiments, including but not limited to those shown or described or mentioned in this detailed disclosure. Not intended to be exhaustive, the invention described and claimed herein is not limited to the features or embodiments specified in this detailed disclosure, which are included for illustrative purposes only and not for limiting purposes. Those skilled in the art will readily recognize that many components and parameters may be changed or modified to a certain extent or may be substituted for known equivalents without departing from the scope of the invention. Such modifications and equivalents should be recognized as being incorporated herein as if individually set forth. The invention also includes all of the steps, features, compositions and compounds mentioned or shown herein, individually or collectively, and includes any and all combinations of any two or more of said steps or features.

[0083] All patents, publications, scientific articles, websites, and other documents and materials referenced or mentioned in this specification are indicative of the level of skill of those skilled in the art to which this invention pertains, and each such referenced document and material is incorporated by reference in its entirety to the same extent as if it were individually incorporated by reference or set forth in its entirety herein. Applicant reserves the right to physically incorporate into this specification any materials and information from such patents, publications, scientific articles, websites, electronically available information, and other referenced materials or documents. Reference to any application, patent, and publication in this specification is not, and should not be construed as, an admission or any form of suggestion that they constitute valid prior art or form part of the common general knowledge in any country in the world.

[0084] The specific methods and compositions described herein are representative of preferred embodiments, are illustrative, and are not intended as limitations on the scope of the invention. Other objects, aspects, and embodiments will occur to those skilled in the art in light of this specification. These other objects, aspects, and embodiments are encompassed within the spirit of the invention as defined by the scope of the claims. It will be readily apparent to those skilled in the art that various substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. The invention illustratively described herein as applicable may be practiced in the absence of any element or limitation not specifically disclosed herein as essential. Thus, for example, in each example, embodiment, or example of the invention herein, any of the terms "comprising", "consisting essentially of" and "consisting of" may be replaced with either of the other two terms herein. Also, the terms "comprising", "including", "containing", and the like, should be interpreted broadly and without limitation. The methods and processes illustratively described herein as applicable may be performed in different sequences of steps, and are not necessarily limited to the sequences of steps shown herein or in the claims. Also, as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Under no circumstances should this patent be construed as being limited to the particular examples or embodiments or methods specifically disclosed herein. Under no circumstances should this patent be construed as being limited by any statements made by any examiner or any other officer or employee of the Patent and Trademark Office unless such statements are expressly adopted in the applicant's response, clearly and without qualification or reservation. Furthermore, titles, headings, and the like are provided to enhance the reader's comprehension of this document and should not be construed as limiting the scope of the invention. Any examples of aspects, embodiments, or components of the invention mentioned herein should be considered non-limiting.

[0085] The terms and expressions used are used as terms of description and not as terms of limitation, and there is no intention in the use of such terms and expressions to exclude equivalents of the features shown and described or portions thereof, recognizing that various modifications are possible within the scope of the invention as claimed. Thus, while the invention has been specifically disclosed by preferred embodiments and optional features, it will be understood that modifications and variations of the concepts disclosed herein may rest upon those skilled in the art, and that such modifications and variations are deemed to be within the scope of the invention as defined by the appended claims.

[0086] The invention has been described broadly and generically herein, and each of the narrower species and subgeneric groupings falling within that generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether the omitted material is specifically set forth herein.

[0087] Other embodiments are within the scope of the following claims. Furthermore, when features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention also is described in terms of any individual members or subgroups of members of the Markush group.

[0088] Without further elaboration, it is believed that one skilled in the art can, based on the preceding description, utilize the present invention to its fullest extent. Thus, the following examples are to be construed as merely illustrative, and in no way as a limitation of the scope of the present invention.

[0089] Although the present disclosure has been described with exemplary embodiments, various changes and modifications may occur to those skilled in the art, and the present disclosure is intended to cover such changes and modifications as fall within the scope of the appended claims. EXAMPLES

[0090] Example 1 Methylation status of target nucleic acids and genes in breast cancer tissues

[0091] Beta values ​​for data based on Illumina Methylation 450K array were generated from The Cancer Genome Atlas (TCGA) Research Network. Target nucleic acids and genes were selected when the beta value of normal tissue was less than 0.15; and the delta beta value (tumor value minus normal tissue value) was higher than 0.3. The delta beta values ​​of GCM2, ITPRIPL1, C1orf114 and ZNF177, RKL1001 and C8orf47 are significantly higher than 0.3. [Table 3] β value (T), methylation level of tumor tissue; Beta values ​​(T) >0.3 labeled in blue are calculated as biomarkers for other cancers.

[0092] Figure 1 shows the difference in methylation status (β value) of target nucleic acids and genes between tumor tissues and adjacent normal tissues (n=97). Darker colors indicate higher methylation status of tissues according to data based on Illumina Methylation 450K array. Example 2 Detection of differences in methylation status between target nucleic acids and genes in breast cancer and normal tissues

[0093] Genomic DNA was extracted from matched pairs of primary tumors and adjacent breast tissues from the same breast cancer patients, followed by bisulfite conversion. Methylation-specific real-time PCR (qMSP) was used to detect DNA methylation analysis in breast tumor tissues and adjacent normal tissues. The ACTB gene was used as the reference gene. Targets were considered hypermethylated when the methylation level of the target gene relative to the methylation level of the ACTB gene was at least two-fold higher in breast tumors compared to the paired normal breast tissue samples. GCM2, ITPRIPL1, C1orf114 and ZNF177, RKL1001 and C8orf47 were all hypermethylated at rates higher than 64% in breast tumors compared to adjacent normal tissues. [Table 4] Example 3 Early detection of the methylation status of epigenetic biomarkers of target genes in plasma samples of healthy subjects and breast cancer patients

[0094] Circulating cell-free DNA was extracted from plasma. Briefly, 3.5 mL of plasma was immediately isolated from 10 mL of peripheral blood. Circulating cell-free DNA (cfDNA) was extracted from plasma from 24 breast cancer patients and 25 healthy subjects, followed by bisulfite conversion of cfDNA. Probe-based methylation-specific real-time PCR (qMSP) was used for cfDNA methylation analysis. Early prediction with GCM2, ITPRIPL1, C1orf114 and ZNF177 showed a sensitivity of 91.7% and a specificity of 96.0% (AUC: 0.954). [Table 5]

[0095] Figure 2 shows the difference in early detection of the methylation status of the epigenetic biomarkers of the target genes in plasma samples of healthy subjects and breast cancer patients. Furthermore, the receiver operating characteristic (ROC) curve analysis as shown in Figure 3 showed the early detection of the methylation status of the epigenetic biomarkers of the target genes in breast cancer patients and healthy subjects. Example 4 Treatment response monitored by methylation status of epigenetic biomarkers of target genes in breast cancer patients

[0096] cfDNA from plasma of breast cancer patients was analyzed by probe-based methylation-specific real-time PCR (qMSP). CA-153 and CEA tumor markers are currently used as cancer biomarkers in clinical practice, and were used as comparative markers. The results showed that the methylation status of epigenetic biomarkers could sensitively respond to medical surgical treatment. As shown in Figure 4, treatment response according to the methylation status of epigenetic biomarkers of target genes in breast cancer patients before and after surgery. Example 5. Prognosis prediction by methylation status of epigenetic biomarkers of target genes in breast cancer patients

[0097] Data and follow-up information based on Illumina Methylation 450K array were generated from The Cancer Genome Atlas (TCGA) Research Network. Overall survival curves were calculated using the Kaplan-Meier method and comparisons were performed using the log-rank test and Wilcoxon test by SPSS software (SPSS Inc., Chicago, IL, USA). The Kaplan-Meier curves shown in Figure 5 indicate that the methylation status of ITPRIPL1 gene had poor prognosis in breast cancer patients. Overall survival curves of either GCM2, ITPRIPL1, C1orf114, ZNF177, C8orf47 and / or RKL1001 and / or their combinations were also calculated using the Kaplan-Meier method.

Claims

1. 1. A method for detecting a methylation status in a human subject in need of detecting breast cancer, the method comprising: (a) providing a biological sample, and (b) assaying the methylation status in DNA encoding GCM2 and DNA encoding ITPRIPL1; wherein the presence of hypermethylation in said GCM2-encoding DNA and in said ITPRIPL1-encoding DNA of said human subject relative to a control methylation status is indicative of breast cancer; A GCM2 methylation-specific probe and an ITPRIPL1 methylation-specific probe are used to assay the methylation status of DNA encoding GCM2 and DNA encoding ITPRIPL1 in the sample; and A method wherein the GCM2 methylation specific probe has the sequence of SEQ ID NO: 15 and the ITPRIPL1 methylation specific probe has the sequence of SEQ ID NO:

16.

2. 1. A method for detecting a predisposition to or incidence of breast cancer or predicting treatment response, prognosis or recurrence of breast cancer in a human subject, the method comprising: (a) providing a biological sample, and (b) assaying the methylation status in DNA encoding GCM2 and DNA encoding ITPRIPL1; wherein the presence of hypermethylation in said DNA encoding GCM2 and in said DNA encoding ITPRIPL1 of said human subject relative to a control methylation status is indicative of a predisposition to or susceptibility to said breast cancer, poor response to treatment, poor prognosis or recurrence; A GCM2 methylation-specific probe and an ITPRIPL1 methylation-specific probe are used to assay the methylation status of GCM2 and ITPRIPL1 in the sample; and A method wherein the GCM2 methylation specific probe has the sequence of SEQ ID NO: 15 and the ITPRIPL1 methylation specific probe has the sequence of SEQ ID NO:

16.

3. A method for detecting a methylation status in a human subject in need of detection of breast cancer, the method comprising: (a) providing a biological sample containing DNA encoding GCM2 and DNA encoding ITPRIPL1; (b) assaying the methylation levels of the DNA encoding GCM2 and the DNA encoding ITPRIPL1 in the sample and a control DNA using a GCM2 methylation specific probe and an ITPRIPL1 methylation specific probe; (c) measuring the relative methylation status of the GCM2-encoding DNA and the ITPRIPL1-encoding DNA relative to control DNA to detect the presence of hypermethylated GCM2 and ITPRIPL1; and (d) identifying the human subject as in need of breast cancer treatment when the DNA encoding GCM2 and the DNA encoding ITPRIPL1 of the subject are hypermethylated relative to the methylation of control DNA in the subject; wherein a GCM2 methylation-specific probe and an ITPRIPL1 methylation-specific probe are used to assay the methylation status of GCM2 and ITPRIPL1 in a sample; and A method wherein the GCM2 methylation specific probe has the sequence of SEQ ID NO: 15 and the ITPRIPL1 methylation specific probe has the sequence of SEQ ID NO:

16.

4. A method for detecting a predisposition to or incidence of breast cancer or for predicting treatment response, prognosis or recurrence of breast cancer in a human subject, said method comprising: (a) providing a biological sample containing DNA encoding GCM2 and DNA encoding ITPRIPL1; (b) assaying the methylation levels of the DNA encoding GCM2 and the DNA encoding ITPRIPL1 in the sample and a control DNA using a GCM2 methylation specific probe and an ITPRIPL1 methylation specific probe; (c) measuring the relative methylation status of the GCM2-encoding DNA and the ITPRIPL1-encoding DNA relative to a control DNA to detect the presence of hypermethylated GCM2-encoding DNA and ITPRIPL1-encoding DNA; and (d) identifying the human subject as having a predisposition to or susceptibility to, poor treatment response to, or poor prognosis or recurrence of breast cancer when the DNA encoding GCM2 and the DNA encoding ITRPIPL1 of the subject are hypermethylated relative to the methylation status of control DNA in the subject; wherein a GCM2 methylation-specific probe and an ITPRIPL1 methylation-specific probe are used to assay the methylation status of GCM2 and ITPRIPL1 in a sample; and A method wherein the GCM2 methylation specific probe has the sequence of SEQ ID NO: 15 and the ITPRIPL1 methylation specific probe has the sequence of SEQ ID NO:

16.

5. The method according to any one of claims 1 to 4, wherein the biological sample is a tissue, a cell, blood, urine, serum or plasma.

6. The method according to any one of claims 1 to 4, wherein methylation in the DNA encoding GCM2 and the DNA encoding ITPRIPL1 is 64% higher than that in the control.

7. The method according to any one of claims 1 to 4, wherein methylation in the DNA encoding GCM2 and the DNA encoding ITPRIPL1 is 69% and 80% higher, respectively, than that in the control.

8. The method according to any one of claims 1 to 4, wherein said hypermethylation is indicated when methylation of said DNA encoding GCM2 and said DNA encoding ITPRIPL1 in a human subject is at least 0.5 times higher than methylation in a control.

9. The method according to any one of claims 1 to 4, wherein said hypermethylation is indicated when methylation of the DNA encoding GCM2 and the DNA encoding ITPRIPL1 in a human subject is at least two-fold higher than methylation in a control.

10. The method of claim 1, wherein the criteria for the relative methylation status of the DNA encoding GCM2 and the DNA encoding ITPRIPL1 relative to control DNA have a sensitivity of greater than 54% and a specificity of 100% for GCM2, and a sensitivity of greater than 79% and a specificity of greater than 96% for ITPRIPL1.

11. The method of any of claims 1 to 4, further comprising assaying the methylation levels of any of one or more combinations of the following: C1orf114, ZNF177 and C8orf47.

12. The method of claim 11, wherein the methylation level of RKL001 is further assayed.

13. The method of claim 11, further comprising using any one or more combinations of the following: a C1orf114 methylation-specific probe, a ZNF177 methylation-specific probe or a C8orf47 methylation-specific probe or any combination thereof to assay the methylation levels of C1orf114, ZNF177 and C8orf47.

14. The method of claim 13, wherein the methylation specific probes for C1orf114, ZNF177 and C8orf47 have sequences with at least 85% homology to SEQ ID NOs: 17, 18 and 14, respectively.

15. The method of claim 13, wherein the methylation specific probes for C1orf114, ZNF177 and C8orf47 have the sequences of SEQ ID NOs: 17, 18 and 14, respectively.

16. The method according to any of claims 13 or 14, wherein the relative methylation status measures of C1orf114, ZNF177 and / or C8orf47 DNA relative to control DNA have a sensitivity of greater than 75% and a specificity of 76% for C1orf114, and a sensitivity of greater than 62% and a specificity of 82% for ZNF177, respectively.

17. The method of claim 13, wherein the relative methylation status criteria of the combinations of GCM2 and ITPRIPL1; GCM2, ITPRIPL1 and C1orf114; and GCM2, ITPRIPL1, C1orf114 and ZNF177 relative to control DNA have a sensitivity of greater than 87% and a specificity of 96%, a sensitivity of greater than 95% and a specificity of 72%, and a sensitivity of greater than 87% and a specificity of 96%, respectively.

18. 18. The method of claim 10, 16 or 17, wherein said measuring further comprises measuring said specificity and sensitivity by analysis of weighted sum scores.

19. The method of claim 18, wherein the relative methylation status criteria of the combination of GCM2, ITPRIPL1 and C1orf114 or GCM2, ITPRIPL1, C1orf114 and ZNF177 have a sensitivity of greater than 87% and a specificity of 96%, and a sensitivity of greater than 91% and a specificity of 96%, respectively.

20. The method of claim 12, further comprising using a RKL001 methylation specific probe to assay the methylation level of RKL001.

21. The method of claim 20, wherein the RKL001 methylation specific probe has a sequence having at least 85% homology to SEQ ID NO:

13.

22. The method of claim 20, wherein the RKL001 methylation specific probe has a sequence having homology to SEQ ID NO:

13.

23. The method according to any one of claims 1 to 4, wherein the methylation status is detected by polymerase chain reaction.

24. A kit for detecting a methylation status in a human subject in need of detection of breast cancer, or for detecting a predisposition to or incidence of breast cancer in a human subject, or for predicting treatment response, prognosis or recurrence of breast cancer, said kit comprising primers having the sequences of SEQ ID NOs: 5 to 8 or probes having the sequences of SEQ ID NOs: 15 and 16 for assaying the methylation status in DNA encoding GCM2 and DNA encoding ITPRIPL1.

25. 25. The kit of claim 24, further comprising one or more primers having sequences of SEQ ID NOs: 9-12 and 1-4 and / or one or more probes having sequences of SEQ ID NOs: 17, 18, 12 and 13, in combination with one or more of C1orf114, ZNF177, C8orf47 and RKL0014 or any combination thereof, for assaying the methylation status in DNA encoding GCM2 and DNA encoding ITPRIPL1.

26. The kit of claim 24 or 25, further comprising sodium bisulfite, and an adaptor for amplifying the entire target gene, and a polynucleotide for quantifying the presence of converted methylated and / or converted unmethylated sequences of at least one cytosine from the DNA region of the epigenetic biomarker in the target DNA sequence as set forth in any of claims 1 to 23.

27. 27. The kit of claim 26, further comprising a methylation-sensitive restriction enzyme for amplification of the entire target sequence or gene.

28. The method of claim 3, wherein the method detects a methylation status in a human subject in need of detection of breast cancer.

29. 27. The kit of claim 26, wherein the polynucleotide is a detectably labeled polynucleotide.

Images