Oncolytic viral vectors and uses thereof

Abstract

To provide an oncolytic virus vector and use thereof.SOLUTION: The present disclosure relates to recombinant viral vectors for cancer treatment and prevention. Oncolytic viral vectors incorporate one or more of the following features: restricting viral replication by inserting a microRNA (miRNA) targeting sequence into the viral genome, interfering with the function of oncogenic miRNAs, remodelling the cancer microenvironment, and targeting cancer cells by incorporating protease-activating antibodies into viral particles.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 62 / 537,359, filed July 26, 2017, and U.S. Provisional Application No. 62 / 686,802, filed June 19, 2018, the disclosures of each of which are incorporated herein by reference in their entirety.

[0002] Description of sequence listing The sequence listing associated with this application is provided in text format as an alternative to a paper copy and is incorporated herein by reference. The name of the text file containing the sequence listing is ONCR_010_02WO_ST25.txt. The text file is 500KB, was created on July 26, 2018, and has been submitted electronically via EFS-Web.

[0003] The present disclosure relates to recombinant viral vectors for the treatment and prevention of cancer. In particular, the present disclosure relates to oncolytic viral vectors. [Background technology]

[0004] Current targeted cancer treatments are only effective in a narrow range of cancers due to the heterogeneity of tumor protein expression profiles.In addition, many cancer treatments, including existing viral vectors, chemotherapy, radiation, and surgery, lack the specificity to selectively treat cancerous cells while maintaining the health and viability of normal non-cancerous cells, and may produce undesirable off-target effects.Therefore, there is a need in the art for cancer treatments that are broadly effective in multiple cancers and can selectively eliminate cancerous cells.

[0005] Oncolytic viruses are viruses that preferentially infect cancer cells and have been used in multiple preclinical and clinical studies for cancer treatment. The use of oncolytic viruses carries the risk of non-specific viral infection of healthy cells, leading to the death of non-cancerous cells and tissues. However, genetic engineering of the viruses to utilize pathways, proteins, and genes that are differentially expressed in normal and cancerous tissues may increase the specificity of these viruses and limit off-target infection and cell death.

[0006] MicroRNAs (miRNAs or miRs) are small non-coding endogenous RNAs that regulate gene expression by directing their target messenger RNAs for degradation or translational repression. miRs are closely associated with normal cellular processes, so deregulation of miRNAs contributes to a wide range of diseases, including cancer. Many miR genes are located in cancer-associated genomic regions or chromosomal fragile sites, further strengthening the evidence that miRs play a pivotal role in cancer. miRs are differentially expressed in cancer cells compared to normal tissues and may be causally linked to tumorigenesis. By taking advantage of this differential miR expression in various tumor types, the cancer treatments described herein in which oncolytic virus replication is regulated based on the expression of a specific miR or group of miRs have a broad range of safety and efficacy profiles. In addition, the oncolytic viruses described herein may also express proteins that facilitate viral spread throughout the tumor, such as those that alter the expression of genes and proteins that regulate the extracellular matrix, thereby enhancing therapeutic efficacy.

[0007] There remains a need in the art for improved oncolytic viral vectors. The present disclosure provides such improved oncolytic viral vectors, among others. Summary of the Invention [Means for solving the problem]

[0008] The present disclosure provides oncolytic viral vectors that exhibit improved technical effects compared to the prior art. The present inventors have designed various oncolytic viral vectors and performed extensive experiments described herein to identify oncolytic viral vectors with superior properties for clinical use in the treatment of cancer.

[0009] The present invention relates to recombinant viral vectors useful for the treatment and prevention of cancer. The oncolytic viral vectors described herein are capable of restricting viral vector replication to cancer or tumor cells by a microRNA (miR) target sequence inserted into the viral genome. In certain embodiments described herein, the viral vector comprises two, three, four or more copies of a miR target sequence integrated into one or more essential viral genes. In further embodiments, the viral vector comprises integration of one or more polynucleotide sequences into the viral genome, the product(s) of which interfere with the function of oncogenic miRs and / or alter the extracellular matrix. In further embodiments, the viral vector comprises a protease-activated antibody integrated into the viral particle, thereby allowing highly selective targeting of the vector to cancer / tumor cells. Further provided herein are compositions of the viral vectors and methods of use in killing cancerous cells and treating cancer.

[0010] In an embodiment, the present disclosure provides a recombinant oncolytic herpes simplex virus (HSV) comprising at least two microRNA (miRNA) target sequences inserted into the locus of one or more essential viral genes, wherein the one or more viral genes are selected from the group consisting of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39 / 40, and UL42. In an embodiment, the replication of the recombinant HSV is reduced in non-cancerous cells compared to the replication of the recombinant HSV in cancerous cells of the same cell type. In an embodiment, the one or more viral genes are selected from the group consisting of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39 / 40, and UL42. In an embodiment, the one or more viral genes are selected from the group consisting of UL8, ICP8, and UL30. In embodiments, the one or more viral genes are selected from the group consisting of ICP27 and ICP4. In embodiments, the one or more viral genes are selected from the group consisting of ICP4, ICP27, UL8, UL42, and ICP34.5.

[0011] In an embodiment, the cell is selected from the group consisting of a neuron, a cardiac cell, a muscle cell, and a liver cell. In an embodiment, the neuron is a central nervous system cell, a peripheral nervous system cell, a brain cell, or a spinal cell. In an embodiment, the muscle cell is a striated muscle cell or a smooth muscle cell. In an embodiment, the non-cancerous cell and the cancerous cell are brain cells, and the target sequences of the at least two miRNAs are the target sequences of miRNAs selected from the group consisting of miR-137, miR-219a, miR-124, miR-9, miR-487b, and miR-128. In an embodiment, the target sequences of the at least two miRNAs are the target sequences of miRNAs selected from the group consisting of miR-137, miR-219a, miR-124, and miR-128. In embodiments, the non-cancerous and cancerous cells are cardiac or striated muscle cells, and the target sequences of the at least two miRNAs are target sequences of a miRNA selected from the group consisting of miR-208b, miR-1, miR-208a, miR-133a, miR-4284, miR-499a, miR-126, miR-30e, miR-378i, miR-30b, and miR-378. In embodiments, the target sequences of the at least two miRNAs are target sequences of a miRNA selected from the group consisting of miR-208b, miR-1, and miR-208a. In embodiments, the non-cancerous and cancerous cells are spinal cord cells and the target sequences of the at least two miRNAs are selected from the group consisting of miR-219a, miR-9, miR-204, miR-577, miR-99a, miR-100, miR-132, and miR-135. In embodiments, the target sequences of the at least two miRNAs are selected from the group consisting of miR-219a, miR-9, and miR-204. In embodiments, the non-cancerous and cancerous cells are peripheral nervous system cells and the target sequences of the at least two miRNAs are selected from the group consisting of miR-204, miR-1, miR-206, miR-9, miR-99a, miR-199b, miR-145, miR-100, and miR-574.In embodiments, the non-cancerous and cancerous cells are hepatocytes and the target sequences of the at least two miRNAs are target sequences of a miRNA selected from the group consisting of miR-122 and miR-126.In embodiments, the non-cancerous and cancerous cells are smooth muscle cells and the target sequences of the at least two miRNAs are target sequences of a miRNA selected from the group consisting of miR-143 and miR-145.

[0012] In an embodiment, the target sequences of the two or more miRs are incorporated into a miR-T cassette that is inserted into the 5' untranslated region (UTR) or 3' UTR of the one or more essential viral genes. In an embodiment, the miR-T cassette comprises less than 1000 nucleotides in length. In an embodiment, the miR-T cassette comprises about 25 to about 500 nucleotides in length. In an embodiment, the miR-T cassette comprises about 100 to about 500 nucleotides in length.

[0013] In embodiments, the present disclosure provides a recombinant oncolytic herpes simplex virus (HSV) comprising: (i) a first microRNA (miRNA) target sequence cassette (miR-TS cassette) inserted into a first viral gene, the cassette comprising at least two target sequences for each of miR-124, miR-1, and miR-143; (ii) a second miR-TS cassette inserted into a second viral gene, the cassette comprising at least two target sequences for each of miR-128, miR-219a, and miR-122; and (iii) a third miR-TS cassette inserted into a third viral gene, the cassette comprising at least two target sequences for each of miR-219a, miR-204, and miR-128. In embodiments, the recombinant HSV further comprises a fourth miR-TS cassette inserted into a fourth viral gene, the fourth miR-TS cassette comprising (a) at least two target sequences for each of miR-137, miR-208b-3p, and miR-126, or (b) at least two target sequences for each of miR-137, miR-217, and miR-126.

[0014] In an embodiment, each of the miR-TS cassettes comprises four target sequences for each of the miRNAs, respectively. In an embodiment, the first viral gene is ICP4. In an embodiment, the second viral gene is ICP27. In an embodiment, the third viral gene is ICP34.5. In an embodiment, the fourth viral gene is UL8. In an embodiment, the replication of the recombinant HSV is reduced in a non-cancerous cell compared to the replication of the recombinant HSV in a cancerous cell of the same cell type, and the cell is selected from the group consisting of a neuronal cell, a cardiac cell, a muscle cell, and a hepatic cell.

[0015] In an embodiment, the first miR-TS cassette comprises a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 852. In an embodiment, the first miR-TS cassette comprises or consists of the nucleic acid sequence of SEQ ID NO: 852. In an embodiment, the second miR-TS cassette comprises a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 853. In an embodiment, the second miR-TS cassette comprises or consists of the nucleic acid sequence of SEQ ID NO: 853. In an embodiment, the third miR-TS cassette comprises a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 854. In an embodiment, the third miR-TS cassette comprises or consists of the nucleic acid sequence of SEQ ID NO: 854. In an embodiment, the fourth miR-TS cassette comprises a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 855. In an embodiment, the fourth miR-TS cassette comprises or consists of the nucleic acid sequence of SEQ ID NO: 855.

[0016] In embodiments, the recombinant HSV further comprises a heterologous polynucleotide sequence encoding one or more payload molecules. In embodiments, the heterologous polynucleotide sequence encodes a payload selected from the group consisting of IL-12, CCL4, and CXCL10. In embodiments, the heterologous polynucleotide sequence encodes two or more payloads selected from the group consisting of IL-12, CCL4, and CXCL10. In embodiments, the heterologous polynucleotide sequence encodes three payloads including IL-12, CCL4, and CXCL10.

[0017] In an embodiment, the present disclosure provides a recombinant oncolytic virus comprising one or more microRNA (miR) target sequences inserted into the locus of one or more viral genes required for viral replication, wherein the virus is a herpes simplex virus (HSV), and the one or more viral genes are selected from the group consisting of UL8, ICP34.5, UL42, UL19, ICP4, and ICP27. In an embodiment, the one or more miR target sequences are integrated into the 5' untranslated region (UTR) or 3' UTR of the one or more viral genes required for viral replication. In embodiments, the target sequence of the miR is a target sequence of a miR selected from the group consisting of miR-122, miR-184, miR-34a, let7a, miR-145-5p, miR-199a-5p, miR-451a, miR-125a, miR-125a-5p, miR-126-3p, miR-233-3p, miR-143-3p, miR-1-3p, miR-133a-3p, miR-127a-3p, miR-133b, miR-134-3p, miR-124, miR-101, miR-125b, miR-145, miR-559, miR-213, miR-31-5p, and miR-205p.

[0018] In an embodiment, one or more copies of the target sequence of the one or more miRs are inserted into the locus of one or more viral genes. In an embodiment, two, three, four or more copies of the target sequence of the one or more miRs are inserted into the locus of one or more viral genes. In an embodiment, the viral replication is reduced or attenuated in a first cell compared to the viral replication in a second cell, and the first cell has an increased expression of a miR capable of binding to a target sequence of one or more miRs compared to the expression of the miR in the second cell. In an embodiment, the expression level of the miR in the first cell is at least 5% higher than the expression level of the miR in the second cell. In an embodiment, the first cell is a non-cancerous cell. In an embodiment, the second cell has a decreased expression of a miR capable of binding to a target sequence of the one or more miRs compared to the expression of the miR in the first cell. In an embodiment, the expression level of the miR in the second cell is at least 5% lower than the expression level of the miR in the first cell. In an embodiment, the second cell is a cancerous cell.

[0019] In an embodiment, one copy of the target sequence of miR-122 is inserted into the locus of one or more viral genes required for viral replication. In an embodiment, four copies of the target sequence of miR-122 are inserted into the locus of one or more viral genes required for viral replication. In an embodiment, the one or more viral genes are ICP27. In an embodiment, one copy of the target sequence of miR-125a is inserted into the locus of one or more viral genes required for viral replication. In an embodiment, four copies of the target sequence of miR-125a are inserted into the locus of one or more viral genes required for viral replication. In an embodiment, the one or more viral genes are UL42. In an embodiment, four copies of the target sequence of miR-122 are inserted into the locus of ICP27, and one copy of the target sequence of miR-125a is inserted into the locus of UL42. In an embodiment, one copy of the target sequence of miR-122 is inserted into the locus of ICP27, and one copy of the target sequence of miR-125a is inserted into the locus of UL42.In an embodiment, one copy of the target sequence of miR-122 is inserted into the locus of ICP27, and three copies of the target sequence of miR-125a are inserted into the locus of UL42.In an embodiment, four copies of the target sequence of miR-122 are inserted into the locus of ICP27, and four copies of the target sequence of miR-125a are inserted into the locus of UL42.

[0020] In an embodiment, the present disclosure provides a recombinant oncolytic virus comprising: (a) one or more microRNA (miR) target sequences inserted into the locus of one or more viral genes required for viral replication; and (b) (i) one or more proteins or oligonucleotides that reduce expression or inhibit function of a miR, gene, or tissue inhibitor of metalloproteinase (TIMP), or (ii) one or more polynucleotides encoding a protease-activating antibody, wherein the virus is HSV and the one or more viral genes are selected from the group consisting of UL42, UL19, ICP4, and ICP27. In an embodiment, the miR is an oncogenic miR or a microenvironment remodeling miR. In an embodiment, the oncogenic miR is selected from the miRs listed in Table 4. In an embodiment, the gene is an oncogenic gene. In an embodiment, the oncogenic gene is selected from the genes listed in Table 7. In an embodiment, the microenvironment remodeling miR is selected from the miRs listed in Table 5. In embodiments, the target sequences of the one or more miRs are integrated into the 5' untranslated region (UTR) or 3' UTR of one or more viral genes required for viral replication. In embodiments, the target sequence of the miR is a target sequence of a miR selected from the group consisting of miR-122, miR-184, miR-34a, let7a, miR-145-5p, miR-199a-5p, miR-451a, miR-125a, miR-125a-5p, miR-126-3p, miR-233-3p, miR-143-3p, miR-1-3p, miR-133a-3p, miR-127a-3p, miR-133b, miR-134-3p, miR-124, miR-101, miR-125b, miR-145, miR-559, miR-213, miR-31-5p, and miR-205p.

[0021] In an embodiment, one or more copies of the target sequence of the one or more miRs are inserted into the locus of one or more viral genes. In an embodiment, two, three, four or more copies of the target sequence of the one or more miRs are inserted into the locus of one or more viral genes. In an embodiment, one copy of the target sequence of miR-122 is inserted into the locus of one or more viral genes required for viral replication. In an embodiment, four copies of the target sequence of miR-122 are inserted into the locus of one or more viral genes required for viral replication. In an embodiment, the one or more viral genes are ICP27. In an embodiment, one copy of the target sequence of miR-125a is inserted into the locus of one or more viral genes required for viral replication. In an embodiment, four copies of the target sequence of miR-125a are inserted into the locus of one or more viral genes required for viral replication. In an embodiment, the one or more viral genes are UL42. In an embodiment, four copies of the target sequence of miR-122 are inserted into the locus of ICP27, and one copy of the target sequence of miR-125a is inserted into the locus of UL42. In an embodiment, one copy of the target sequence of miR-122 is inserted into the locus of ICP27, and one copy of the target sequence of miR-125a is inserted into the locus of UL42. In an embodiment, one copy of the target sequence of miR-122 is inserted into the locus of ICP27, and three copies of the target sequence of miR-125a are inserted into the locus of UL42. In an embodiment, four copies of the target sequence of miR-122 are inserted into the locus of ICP27, and four copies of the target sequence of miR-125a are inserted into the locus of UL42.

[0022] In an embodiment, the TIMP is selected from TIMP1, TIMP2, TIMP3 and TIMP4. In an embodiment, the oligonucleotide is shRNA or decoy oligonucleotide. In an embodiment, the protein is a nuclease, a bispecific T cell inducer (BiTE), an anti-immunosuppressive protein or an immunogenic antigen. In an embodiment, the nuclease is selected from clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease, zinc finger nuclease (ZFN) or transcription activator-like effector nuclease (TALEN). In embodiments, the CRISPR-associated endonuclease is selected from the group consisting of SpCas9, SpCas9-HF1, SpCas9-HF2, SpCas9-HF3, SpCas9-HF4, SaCas9, FnCpf, FnCas9, eSpCas9, C2C1, C2C3, Cpf1, Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Csy l, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, Csx10, Csx16, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, and Csf4. In embodiments, the recombinant virus further comprises a heterologous polynucleotide encoding a tracr-RNA (trRNA) and a crispr-RNA (crRNA), wherein the crRNA targets a genomic DNA sequence encoding a miR or TIMP, and the trRNA promotes binding and activation of a CRISPR-associated endonuclease.

[0023] In an embodiment, the anti-immunosuppressive protein is an anti-regulatory T cell (Treg) protein or an anti-myeloid-derived suppressor cell (MDSC) protein. In an embodiment, the anti-immunosuppressive protein is a VHH-derived blocker or a VHH-derived BiTE. In an embodiment, the protein induces an anti-tumor immune response. In an embodiment, the protein binds to an antigen expressed on a cell surface, the antigen being selected from the group consisting of EpCAM, CTLA-4, PD1, FGF2, FGFR / FGFR2b, endothelin B receptor, and SEMA4D. In embodiments, the protein is selected from folate, IFNβ, A2A, CCL5, CD137, CD200, CD38, CD44, CSF-1R, CXCL10, CXCL13, IL-12, IL-15, IL-2, IL-21, IL-35, ISRE7, LFA-1, NG2 (also known as SPEG4), SMAD proteins, STING, TGFβ, and VCAM1. In embodiments, the at least one protease-activated antibody is incorporated into the glycoprotein envelope of a virus. In embodiments, the protease-activated antibody is activated by a protease selected from a cysteine ​​cathepsin, an aspartic cathepsin, a kallikrein (hK), a serine protease, a caspase, a matrix metalloproteinase (MMP), and a disintegrin metalloproteinase (ADAM). In embodiments, the protease is selected from cathepsin K, cathepsin B, cathepsin L, cathepsin E, cathepsin D, hK1, PSA (hK3), hK10, hK15, uPA, uPAR, MMP-1, MMP-2, MMP-3, MMP-7, MMP-8, MMP-9, MMP-10, MMP-11, MMP-12, MMP-13, MMP-14, MMP-15, MMP-16, MMP-17, MMP-18, MMP-19, MMP-20, MMP-21, MMP-23A, MMP-23B, MMP-24, MMP-25, MMP-26, MMP-27, MMP-28, or a protease listed in Table 6. In embodiments, the protease-activating antibody binds to a protein that is more highly expressed by cancer cells or in the cancer microenvironment than by non-cancer cells or in the non-cancer microenvironment.In embodiments, the protease-activated antibody binds to NKG2D, c-met, HGFR, CD8, heparan sulfate, VSPG4 (also known as NG2), EGFR, EGFRvIII, CD133, CXCR4, carcinoembryonic antigen (CEA), CLC-3, annexin II, human transferrin receptor, or EpCAM.

[0024] In embodiments, one or more polynucleotides are inserted into a locus of the viral genome or between two loci of the viral genome. In embodiments, the viral locus includes the internal repeat joint region (containing one copy each of the diploid genes ICP0, ICP34.5, LAT, ICP4, and ICP47 promoters), ICP0, LAT, UL1, UL5, UL6, UL7, UL8, UL9, UL11, UL12, UL14, UL15, UL17, UL18, UL19, UL20, UL22, UL25, UL26, UL26.5, UL27, UL28, UL29, UL30, UL31, UL32, UL33, UL34, UL35, UL36, UL37, UL38, UL39, UL40, UL41, UL42, UL43, UL44, UL45, UL46, UL47, UL48, UL49, UL50, UL51, UL52, UL53, UL54, UL55, UL56, UL57, UL58, UL59, UL60, UL61, UL62, UL63, UL64, UL65, UL66, UL67, UL68, UL69, UL70, UL71, UL72, UL73, UL74, UL75, UL76, UL77, UL78, UL79, UL80, UL81, UL82, UL83, UL84, UL85, UL86, UL87, UL88, UL89, UL90, UL91, UL92, UL93, UL94 L28, UL29, UL30, UL31, UL32, UL33, UL34, UL35, UL36, UL37, UL38, UL39, UL40, UL42, UL48, UL49, UL52, UL53, UL54, ICP0, ICP4, ICP22, ICP27, ICP47, gamma-34.5, US3, US4, US5, US6, US7, US8, US9, US10, US11, and US12.

[0025] In embodiments, the present disclosure provides a nucleic acid molecule encoding an oncolytic virus described herein. In embodiments, the present disclosure provides a viral stock comprising an oncolytic virus described herein. In embodiments, the present disclosure provides a composition comprising an oncolytic virus described herein and a pharma- ceutically acceptable carrier.

[0026] In an embodiment, the present disclosure provides a method for killing a cancerous cell, comprising exposing the cancerous cell to an oncolytic virus or a composition thereof described herein under conditions sufficient for the oncolytic virus to infect and replicate in the cancerous cell, where replication of the oncolytic virus in the cancerous cell results in cell death. In an embodiment, the cancerous cell has a reduced expression of a miR capable of binding to one or more target sequences of the miR compared to the expression of the miR in a non-cancerous cell. In an embodiment, the expression level of the miR in the cancerous cell is at least 5% lower than the expression level of the miR in the non-cancerous cell. In an embodiment, the replication of the oncolytic virus is increased or maintained in a cancerous cell with a reduced expression of the miR capable of binding to one or more target sequences of the miR. In an embodiment, the viral replication is at least 5% higher in the cancerous cell compared to the viral replication in the non-cancerous cell. In an embodiment, the cell is in vivo. In an embodiment, the cell is in a tumor.

[0027] In an embodiment, the present disclosure provides a method of treating cancer in a subject in need thereof, the method comprising administering an oncolytic virus or a composition thereof described herein to a subject in need thereof. In an embodiment, the subject is a mouse, a rat, a rabbit, a cat, a dog, a horse, a non-human primate, or a human. In an embodiment, the oncolytic virus or a composition thereof is administered intravenously, subcutaneously, intratumorally, intramuscularly, or intranasally. In an embodiment, the cancer is selected from lung cancer, breast cancer, ovarian cancer, cervical cancer, prostate cancer, testicular cancer, colorectal cancer, colon cancer, pancreatic cancer, liver cancer, gastric cancer, head and neck cancer, thyroid cancer, malignant glioma, glioblastoma, melanoma, B-cell chronic lymphocytic leukemia, diffuse large B-cell lymphoma (DLBCL), and marginal zone lymphoma (MZL). In an embodiment, the lung cancer is small cell lung cancer or non-small cell lung cancer. In embodiments, the liver cancer is hepatocellular carcinoma (HCC).

[0028] In embodiments, the recombinant oncolytic viruses described herein further comprise a payload molecule, wherein the payload molecule or protein is an anti-FAP / anti-CD3 bispecific T cell-inducing. In embodiments, the recombinant oncolytic viruses described herein further comprise a payload molecule, wherein the payload molecule or protein is an anti-PD1-Fc-41BBL protein. In certain embodiments, for example, the following items are provided: (Item 1) A recombinant oncolytic herpes simplex virus (HSV) comprising target sequences of at least two microRNAs (miRNAs) inserted into the locus of one or more essential viral genes, wherein the one or more viral genes are selected from the group consisting of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39 / 40, and UL42; The recombinant oncolytic herpes simplex virus, wherein replication of the recombinant HSV is reduced in non-cancerous cells compared to replication of the recombinant HSV in cancerous cells of the same cell type. (Item 2) 2. The oncolytic virus of item 1, wherein the one or more viral genes are selected from the group consisting of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39 / 40, and UL42. (Item 3) 3. The oncolytic virus according to item 2, wherein the one or more viral genes are selected from the group consisting of UL8, ICP8, and UL30. (Item 4) 2. The oncolytic virus of item 1, wherein the one or more viral genes are selected from the group consisting of ICP27 and ICP4. (Item 5) 2. The oncolytic virus of item 1, wherein the one or more viral genes are selected from the group consisting of ICP4, ICP27, UL8, UL42, and ICP34.5. (Item 6) 2. The oncolytic virus of item 1, wherein the cell is selected from the group consisting of a neuronal cell, a cardiac cell, a muscle cell, and a hepatic cell. (Item 7) 7. The oncolytic virus of item 6, wherein the neural cell is a central nervous system cell, a peripheral nervous system cell, a brain cell, or a spinal cord cell. (Item 8) 7. The oncolytic virus of item 6, wherein the muscle cell is a striated muscle cell or a smooth muscle cell. (Item 9) The oncolytic virus according to item 1, wherein the non-cancerous cells and the cancerous cells are brain cells, and the target sequences of the at least two miRNAs are target sequences of miRNAs selected from the group consisting of miR-137, miR-219a, miR-124, miR-9, miR-487b, and miR-128. (Item 10) 10. The oncolytic virus according to item 9, wherein the target sequences of the at least two miRNAs are target sequences of miRNAs selected from the group consisting of miR-137, miR-219a, miR-124, and miR-128. (Item 11) The oncolytic virus according to item 1, wherein the non-cancerous cell and the cancerous cell are cardiac cells or striated muscle cells, and the target sequences of the at least two miRNAs are target sequences of miRNAs selected from the group consisting of miR-208b, miR-1, miR-208a, miR-133a, miR-4284, miR-499a, miR-126, miR-30e, miR-378i, miR-30b, and miR-378. (Item 12) 12. The oncolytic virus according to item 11, wherein the target sequences of the at least two miRNAs are target sequences of a miRNA selected from the group consisting of miR-208b, miR-1, and miR-208a. (Item 13) The oncolytic virus according to item 1, wherein the non-cancerous cell and the cancerous cell are spinal cord cells, and the target sequences of the at least two miRNAs are target sequences of miRNAs selected from the group consisting of miR-219a, miR-9, miR-204, miR-577, miR-99a, miR-100, miR-132, and miR-135. (Item 14) 14. The oncolytic virus according to item 13, wherein the target sequences of the at least two miRNAs are target sequences of miRNAs selected from the group consisting of miR-219a, miR-9, and miR-204. (Item 15) The oncolytic virus according to item 1, wherein the non-cancerous and cancerous cells are peripheral nervous system cells, and the target sequences of the at least two miRNAs are selected from the group consisting of miR-204, miR-1, miR-206, miR-9, miR-99a, miR-199b, miR-145, miR-100, and miR-574. (Item 16) The oncolytic virus according to item 1, wherein the non-cancerous cells and the cancerous cells are hepatocytes, and the target sequences of the at least two miRNAs are target sequences of miRNAs selected from the group consisting of miR-122 and miR-126. (Item 17) The oncolytic virus according to item 1, wherein the non-cancerous cells and the cancerous cells are smooth muscle cells, and the target sequences of the at least two miRNAs are target sequences of miRNAs selected from the group consisting of miR-143 and miR-145. (Item 18) 18. The oncolytic virus according to any one of items 1 to 17, wherein the target sequences of the two or more miRs are incorporated into a miR-T cassette that is inserted into the 5' untranslated region (UTR) or 3' UTR of the one or more essential viral genes. (Item 19) 19. The oncolytic virus of item 18, wherein the miR-T cassette comprises less than 1000 nucleotides in length. (Item 20) 20. The oncolytic virus according to item 19, wherein the miR-T cassette comprises about 25 to about 500 nucleotides in length. (Item 21) 19. The oncolytic virus according to item 18, wherein the miR-T cassette comprises about 100 to about 500 nucleotides in length. (Item 22) Recombinant oncolytic herpes simplex virus (HSV) including: (i) a first microRNA (miRNA) target sequence cassette (miR-TS cassette) inserted into a first viral gene, the cassette comprising at least two target sequences for each of miR-124, miR-1, and miR-143; (ii) a second miR-TS cassette inserted into a second viral gene, the cassette comprising at least two target sequences for each of miR-128, miR-219a, and miR-122; and (iii) a third miR-TS cassette inserted into a third viral gene, the cassette comprising at least two target sequences for each of miR-219a, miR-204, and miR-128. (Item 23) 23. The recombinant HSV according to item 22, further comprising a third miR-TS cassette inserted into a third viral gene, wherein the third miR-TS cassette is (a) at least two target sequences for each of miR-137, miR-208b-3p, and miR-126; or (b) the recombinant HSV, which comprises at least two target sequences for each of miR-137, miR-217, and miR-126. (Item 24) 24. The recombinant HSV of item 22 or 23, wherein each of the miR-TS cassettes comprises four target sequences for each of the miRNAs, respectively. (Item 25) 24. The recombinant HSV according to any one of items 22 to 23, wherein the first viral gene is ICP4. (Item 26) 24. The recombinant HSV according to any one of items 22 to 23, wherein the second viral gene is ICP27. (Item 27) 24. The recombinant HSV according to any one of items 22 to 23, wherein the third viral gene is ICP34.5. (Item 28) 24. The recombinant HSV of item 23, wherein the fourth viral gene is UL8. (Item 29) 29. The recombinant HSV according to any one of items 22 to 28, wherein replication of the recombinant HSV is reduced in a non-cancerous cell compared to replication of the recombinant HSV in a cancerous cell of the same cell type, the cell being selected from the group consisting of a neuronal cell, a cardiac cell, a muscle cell, and a hepatic cell. (Item 30) 30. The recombinant HSV of any one of items 22 to 29, wherein the first miR-TS cassette comprises a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 852. (Item 31) 31. The recombinant HSV of item 30, wherein the first miR-TS cassette comprises or consists of the nucleic acid sequence of SEQ ID NO: 852. (Item 32) 30. The recombinant HSV of any one of items 22 to 29, wherein the second miR-TS cassette comprises a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 853. (Item 33) 33. The recombinant HSV of item 32, wherein the second miR-TS cassette comprises or consists of the nucleic acid sequence of SEQ ID NO: 853. (Item 34) 30. The recombinant HSV of any one of items 22 to 29, wherein the third miR-TS cassette comprises a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 854. (Item 35) 35. The recombinant HSV of item 34, wherein the third miR-TS cassette comprises or consists of the nucleic acid sequence of SEQ ID NO: 854. (Item 36) 30. The recombinant HSV of any one of items 23 to 29, wherein the fourth miR-TS cassette comprises a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 855. (Item 37) 37. The recombinant HSV of item 36, wherein the fourth miR-TS cassette comprises or consists of the nucleic acid sequence of SEQ ID NO: 855. (Item 38) 38. The recombinant HSV of any one of items 1 to 37, further comprising a heterologous polynucleotide sequence encoding one or more payload molecules. (Item 39) 39. The recombinant HSV of item 38, wherein the heterologous polynucleotide sequence encodes a payload selected from the group consisting of IL-12, CCL4, and CXCL10. (Item 40) 39. The recombinant HSV of item 38, wherein the heterologous polynucleotide sequence encodes two or more payloads selected from the group consisting of IL-12, CCL4, and CXCL10. (Item 41) 39. The recombinant HSV of item 38, wherein the heterologous polynucleotide sequence encodes three payloads including IL-12, CCL4, and CXCL10. (Item 42) A recombinant oncolytic virus comprising one or more microRNA (miR) target sequences inserted into a locus of one or more viral genes required for viral replication, wherein the virus is a herpes simplex virus (HSV), and the one or more viral genes are selected from the group consisting of UL8, ICP34.5, UL42, UL19, ICP4, and ICP27. (Item 43) 43. The oncolytic virus according to item 42, wherein the target sequence of the one or more miRs is integrated into the 5' untranslated region (UTR) or 3' UTR of one or more viral genes required for viral replication. (Item 44) 44. The oncolytic virus according to item 42 or 43, wherein the target sequence of the miR is a target sequence of a miR selected from the group consisting of miR-122, miR-184, miR-34a, let7a, miR-145-5p, miR-199a-5p, miR-451a, miR-125a, miR-125a-5p, miR-126-3p, miR-233-3p, miR-143-3p, miR-1-3p, miR-133a-3p, miR-127a-3p, miR-133b, miR-134-3p, miR-124, miR-101, miR-125b, miR-145, miR-559, miR-213, miR-31-5p, and miR-205p. (Item 45) 45. The oncolytic virus according to any one of items 42 to 44, wherein one or more copies of the target sequences of the one or more miRs are inserted into the locus of one or more viral genes. (Item 46) 46. ​​The oncolytic virus of item 45, wherein two, three, four or more copies of the target sequence of the one or more miRs are inserted into the locus of one or more viral genes. (Item 47) 47. The oncolytic virus according to any one of items 42 to 46, wherein the viral replication is reduced or attenuated in a first cell compared to the viral replication in a second cell, and the first cell has increased expression of a miR capable of binding to a target sequence of the one or more miRs compared to the expression of the miRs in the second cell. (Item 48) 48. The oncolytic virus of item 47, wherein the expression level of the miR in the first cell is at least 5% higher than the expression level of the miR in the second cell. (Item 49) 48. The oncolytic virus of item 47, wherein the first cell is a non-cancerous cell. (Item 50) 48. The oncolytic virus of item 47, wherein the second cell has reduced expression of an miR capable of binding to a target sequence of the one or more miRs compared to expression of the miR in the first cell. (Item 51) 51. The oncolytic virus of item 50, wherein the expression level of the miR in the second cell is at least 5% lower than the expression level of the miR in the first cell. (Item 52) 48. The oncolytic virus of item 47, wherein the second cell is a cancerous cell. (Item 53) 43. The oncolytic virus of item 42, wherein one copy of the target sequence of miR-122 is inserted into the locus of one or more viral genes required for viral replication. (Item 54) 54. The oncolytic virus of item 53, wherein four copies of the target sequence of miR-122 are inserted into the locus of one or more viral genes required for viral replication. (Item 55) 55. The oncolytic virus according to item 53 or 54, wherein the one or more viral genes is ICP27. (Item 56) 54. The oncolytic virus of item 53, further comprising one copy of a target sequence of miR-125a inserted into the locus of one or more viral genes required for viral replication. (Item 57) 57. The oncolytic virus of item 56, wherein four copies of the target sequence of miR-125a are inserted into the locus of one or more viral genes required for viral replication. (Item 58) 59. The oncolytic virus of item 56 or 58, wherein the one or more viral genes is UL42. (Item 59) 53. The oncolytic virus according to any of items 42 to 52, wherein four copies of the target sequence of miR-122 are inserted into the ICP27 locus and one copy of the target sequence of miR-125a is inserted into the UL42 locus. (Item 60) 53. The oncolytic virus according to any of items 42 to 52, wherein one copy of the target sequence of miR-122 is inserted into the locus of ICP27 and one copy of the target sequence of miR-125a is inserted into the locus of UL42. (Item 61) 53. The oncolytic virus according to any of items 42 to 52, wherein one copy of the target sequence of miR-122 is inserted into the locus of ICP27 and three copies of the target sequence of miR-125a are inserted into the locus of UL42. (Item 62) 53. The oncolytic virus according to any of items 42 to 52, wherein four copies of the target sequence of miR-122 are inserted into the ICP27 locus and four copies of the target sequence of miR-125a are inserted into the UL42 locus. (Item 63) 1. A recombinant oncolytic virus comprising: (a) a target sequence for one or more microRNAs (miRs) inserted into the locus of one or more viral genes required for viral replication; and (b)(i) one or more proteins or oligonucleotides that reduce the expression or inhibit the function of a miR, a gene, or a tissue inhibitor of metalloproteinase (TIMP); or (ii) Protease-activating antibodies wherein the virus is HSV and the one or more viral genes are selected from the group consisting of UL42, UL19, ICP4, and ICP27. (Item 64) 64. The oncolytic virus of item 63, wherein the miR is an oncogenic miR or a microenvironment remodeling miR. (Item 65) 65. The oncolytic virus of item 64, wherein the oncogenic miR is selected from the miRs listed in Table 4. (Item 66) 64. The oncolytic virus according to item 63, wherein the gene is an oncogene. (Item 67) 67. The oncolytic virus according to item 66, wherein the oncogene is selected from the genes listed in Table 7. (Item 68) 64. The oncolytic virus of item 63, wherein the microenvironment remodeling miR is selected from the miRs listed in Table 5. (Item 69) 23. The oncolytic virus according to item 22, wherein the target sequence of the one or more miRs is integrated into the 5' untranslated region (UTR) or 3' UTR of the one or more viral genes required for viral replication. (Item 70) 70. The oncolytic virus according to item 69, wherein the target sequence of the miR is a target sequence of a miR selected from the group consisting of miR-122, miR-184, miR-34a, let7a, miR-145-5p, miR-199a-5p, miR-451a, miR-125a, miR-125a-5p, miR-126-3p, miR-233-3p, miR-143-3p, miR-1-3p, miR-133a-3p, miR-127a-3p, miR-133b, miR-134-3p, miR-124, miR-101, miR-125b, miR-145, miR-559, miR-213, miR-31-5p, and miR-205p. (Item 71) 64. The oncolytic virus of item 63, wherein one or more copies of the target sequence of the one or more miRs are inserted into the locus of one or more viral genes. (Item 72) 72. The oncolytic virus of item 71, wherein two, three, four or more copies of the target sequence of the one or more miRs are inserted into the locus of one or more viral genes. (Item 73) 73. The oncolytic virus according to any of items 63 to 72, wherein one copy of the target sequence of miR-122 is inserted into the locus of one or more viral genes required for viral replication. (Item 74) 74. The oncolytic virus of item 73, wherein four copies of the target sequence of miR-122 are inserted into the locus of one or more viral genes required for viral replication. (Item 75) 75. The oncolytic virus according to item 73 or 74, wherein the one or more viral genes is ICP27. (Item 76) 74. The oncolytic virus of item 73, further comprising one copy of a target sequence of miR-125a inserted into the locus of one or more viral genes required for viral replication. (Item 77) 77. The oncolytic virus of item 76, wherein four copies of the target sequence of miR-125a are inserted into the locus of one or more viral genes required for viral replication. (Item 78) 78. The oncolytic virus according to item 76 or 77, wherein the one or more viral genes is UL42. (Item 79) 64. The oncolytic virus of item 63, wherein four copies of the target sequence of miR-122 are inserted into the ICP27 locus and one copy of the target sequence of miR-125a is inserted into the UL42 locus. (Item 80) 64. The oncolytic virus of item 63, wherein one copy of the target sequence of miR-122 is inserted into the ICP27 locus and one copy of the target sequence of miR-125a is inserted into the UL42 locus. (Item 81) 64. The oncolytic virus of item 63, wherein one copy of the target sequence of miR-122 is inserted into the ICP27 locus and three copies of the target sequence of miR-125a are inserted into the UL42 locus. (Item 82) 64. The oncolytic virus of item 63, wherein four copies of the target sequence of miR-122 are inserted into the ICP27 locus and four copies of the target sequence of miR-125a are inserted into the UL42 locus. (Item 83) 64. The oncolytic virus according to item 63, wherein the TIMP is selected from TIMP1, TIMP2, TIMP3 and TIMP4. (Item 84) 64. The oncolytic virus of item 63, wherein the oligonucleotide is an shRNA or a decoy oligonucleotide. (Item 85) 64. The oncolytic virus of item 63, wherein the protein is a nuclease, a bispecific T cell inducer (BiTE), an anti-immunosuppressant protein, or an immunogenic antigen. (Item 86) 86. The oncolytic virus of item 85, wherein the nuclease is selected from a clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease, a zinc finger nuclease (ZFN) or a transcription activator-like effector nuclease (TALEN). (Item 87) The CRISPR-associated endonuclease is SpCas9, SpCas9-HF1, SpCas9-HF2, SpCas9-HF3, SpCas9-HF4, SaCas9, FnCpf, FnCas9, eSpCas9, C2C1, C2C3, Cpf1, Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Csyl, Csy2, Csy3, 87. The oncolytic virus of item 86, selected from Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, Csx10, Csx16, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, and Csf4. (Item 88) 88. The oncolytic virus of item 87, further comprising a heterologous polynucleotide encoding a tracr-RNA (trRNA) and a crispr-RNA (crRNA), wherein the crRNA targets a genomic DNA sequence encoding a miR or TIMP, and the trRNA promotes binding and activation of a CRISPR-associated endonuclease. (Item 89) 86. The oncolytic virus of claim 85, wherein the anti-immunosuppressant protein is an anti-regulatory T cell (Treg) protein or an anti-myeloid-derived suppressor cell (MDSC) protein. (Item 90) 86. The oncolytic virus of item 85, wherein the anti-immunosuppressive protein is a VHH-derived blocker or a VHH-derived BiTE. (Item 91) 91. The oncolytic virus according to any one of items 63 to 90, wherein the protein induces an antitumor immune response. (Item 92) 92. The oncolytic virus of item 91, wherein the protein binds to an antigen expressed on a cell surface, the antigen being selected from the group consisting of EpCAM, CTLA-4, PD1, FGF2, FGFR / FGFR2b, endothelin B receptor, and SEMA4D. (Item 93) 92. The oncolytic virus of item 91, wherein the protein is selected from folate, IFNβ, A2A, CCL5, CD137, CD200, CD38, CD44, CSF-IR, CXCL10, CXCL13, IL-12, IL-15, IL-2, IL-21, IL-35, ISRE7, LFA-1, NG2 (also known as SPEG4), SMAD proteins, STING, TGFβ, and VCAM1. (Item 94) 64. The oncolytic virus of item 63, wherein the at least one protease-activating antibody is incorporated into the glycoprotein envelope of the virus. (Item 95) 95. The oncolytic virus of item 63 or 94, wherein the protease-activated antibody is activated by a protease selected from cysteine ​​cathepsins, aspartic cathepsins, kallikreins (hK), serine proteases, caspases, matrix metalloproteinases (MMPs), and disintegrin metalloproteinases (ADAMs). (Item 96) 96. The oncolytic virus of item 95, wherein the protease is selected from cathepsin K, cathepsin B, cathepsin L, cathepsin E, cathepsin D, hK1, PSA (hK3), hK10, hK15, uPA, uPAR, MMP-1, MMP-2, MMP-3, MMP-7, MMP-8, MMP-9, MMP-10, MMP-11, MMP-12, MMP-13, MMP-14, MMP-15, MMP-16, MMP-17, MMP-18, MMP-19, MMP-20, MMP-21, MMP-23A, MMP-23B, MMP-24, MMP-25, MMP-26, MMP-27, MMP-28, or a protease listed in Table 6. (Item 97) 95. The oncolytic virus of item 63 or 94, wherein the protease-activating antibody binds to a protein that is more highly expressed by cancer cells or in a cancer microenvironment than by non-cancer cells or in a non-cancer microenvironment. (Item 98) 98. The oncolytic virus of item 97, wherein the protease-activating antibody binds to NKG2D, c-met, HGFR, CD8, heparan sulfate, VSPG4 (also known as NG2), EGFR, EGFRvIII, CD133, CXCR4, carcinoembryonic antigen (CEA), CLC-3, annexin II, human transferrin receptor, or EpCAM. (Item 99) 99. The oncolytic virus according to any of items 63 to 98, wherein the one or more polynucleotides are inserted into a locus of the viral genome or between two loci of the viral genome. (Item 100) The viral locus includes the internal repeat joint region (containing one copy each of the diploid genes ICP0, ICP34.5, LAT, ICP4, and ICP47 promoters), ICP0, LAT, UL1, UL5, UL6, UL7, UL8, UL9, UL11, UL12, UL14, UL15, UL17, UL18, UL19, UL20, UL22, UL25, UL26, UL26.5, UL27, UL28, UL29, UL30, UL31, UL32, UL33, UL34, UL35, UL36, UL37, UL38, UL39, UL40, UL41, UL42, UL43, UL44, UL45, UL46, UL47, UL48, UL49, UL50, UL51, UL52, UL53, UL54, UL55, UL56, UL57, UL58, UL59, UL60, UL61, UL62, UL63, UL64, UL65, UL66, UL67, UL68, UL69, UL70, UL71, UL72, UL73, UL74, UL75, UL76, UL77, UL78, UL79, UL80, UL81, UL82, UL83, UL84, UL85, UL86, UL87, UL88, UL89, UL90, UL91, UL92, UL93, UL94, UL95, UL96, UL97, UL98, UL99, UL100, 99. The oncolytic virus of item 99, selected from the group consisting of US0, UL31, UL32, UL33, UL34, UL35, UL36, UL37, UL38, UL39, UL40, UL42, UL48, UL49, UL52, UL53, UL54, ICP0, ICP4, ICP22, ICP27, ICP47, gamma-34.5, US3, US4, US5, US6, US7, US8, US9, US10, US11, and US12. (Item 101) A nucleic acid molecule encoding an oncolytic virus according to any of the preceding items. (Item 102) A virus stock comprising the oncolytic virus according to any one of items 1 to 100. (Item 103) A composition comprising the oncolytic virus according to any of items 42 to 100 and a pharma- ceutically acceptable carrier. (Item 104) 100. A method for killing a cancerous cell, comprising exposing said cancerous cell to an oncolytic virus or a composition thereof according to any one of items 1 to 100 under conditions sufficient for said oncolytic virus to infect said cancerous cell and replicate within said cancerous cell, wherein replication of said oncolytic virus within said cancerous cell results in cell death. (Item 105) 105. The method of claim 104, wherein the cancerous cells have reduced expression of one or more miRs capable of binding to a target sequence of the miR compared to expression of the miR in a non-cancerous cell. (Item 106) 106. The method of claim 105, wherein the expression level of the miR in the cancerous cell is at least 5% lower than the expression level of the miR in the non-cancerous cell. (Item 107) 107. The method according to any one of items 104 to 106, wherein replication of the oncolytic virus is increased or maintained in cancerous cells having reduced expression of the miR capable of binding to a target sequence of the one or more miRs. (Item 108) 108. The method of claim 107, wherein the viral replication is at least 5% higher in the cancerous cells compared to the viral replication in the non-cancerous cells. (Item 109) 109. The method of any one of items 104 to 108, wherein the cell is in vivo. (Item 110) 110. The method of claim 109, wherein the cells are in a tumor. (Item 111) 102. A method for treating cancer in a subject in need thereof, the method comprising administering to a subject in need thereof an oncolytic virus or a composition thereof according to any of items 1 to 100. (Item 112) 112. The method of claim 111, wherein the subject is a mouse, rat, rabbit, cat, dog, horse, non-human primate, or human. (Item 113) 113. The method of item 111 or 112, wherein the oncolytic virus or composition thereof is administered intravenously, subcutaneously, intratumorally, intramuscularly, or intranasally. (Item 114) 112. The method of claim 111, wherein the cancer is selected from lung cancer, breast cancer, ovarian cancer, cervical cancer, prostate cancer, testicular cancer, colorectal cancer, colon cancer, pancreatic cancer, liver cancer, gastric cancer, head and neck cancer, thyroid cancer, malignant glioma, glioblastoma, melanoma, B-cell chronic lymphocytic leukemia, diffuse large B-cell lymphoma (DLBCL), and marginal zone lymphoma (MZL). (Item 115) Item 115. The method of item 114, wherein the lung cancer is small cell lung cancer or non-small cell lung cancer. (Item 116) Item 115. The method of item 114, wherein the liver cancer is hepatocellular carcinoma (HCC). (Item 117) 39. The recombinant HSV of item 38 or the recombinant oncolytic virus of any one of items 63 to 90, wherein the payload molecule or protein is an anti-FAP / anti-CD3 bispecific T cell inducer. (Item 118) 39. The recombinant HSV of item 38 or the recombinant oncolytic virus of any one of items 63 to 90, wherein the payload molecule or protein is an anti-PD1-Fc-41BBL protein. [Brief description of the drawings]

[0029] [Figure 1] 1 shows a heatmap of miRNA expression profiles in cancerous and non-cancerous brain tissues corresponding to 25 selected miRNAs. [Diagram 2] A heatmap of miRNA expression profiles in cancerous and non-cancerous bladder tissues corresponding to 25 selected miRNAs is shown. [Diagram 3] A heatmap of miRNA expression profiles in cancerous and non-cancerous breast tissues corresponding to 25 selected miRNAs is shown. [Figure 4] A heatmap of miRNA expression profiles in cancerous and non-cancerous colon tissues corresponding to 25 selected miRNAs is shown. [Diagram 5] A heatmap of miRNA expression profiles in glioblastoma and non-cancerous brain tissues corresponding to 25 selected miRNAs is shown. [Figure 6] 1 shows a heatmap of miRNA expression profiles in cancerous and non-cancerous head and neck tissues corresponding to 25 selected miRNAs. [Figure 7] A heatmap of miRNA expression profiles in cancerous and non-cancerous lung tissues corresponding to 25 selected miRNAs is shown. [Figure 8]A heatmap of miRNA expression profiles in cancerous and non-cancerous pancreatic tissues corresponding to 25 selected miRNAs is shown. [Figure 9] Heatmap of miRNA expression profiles in schwannoma and non-schwannoma tissues corresponding to 25 selected miRNAs is shown. [Figure 10] Figures 10A-C show the miRNA expression and attenuation reporter gene system described in Example 2. Figure 10A shows a schematic diagram of the pTetR tet repressor plasmid, which induces expression of the miRNA expression plasmid. Figure 10B shows a schematic diagram of the pTF-002 miRNA expression plasmid, which contains tet-inducible mCherry and miRNA expression cassettes. Figure 10C shows a schematic diagram of the pTF-004 miRNA attenuation reporter, which allows readout of destabilized GFP (dsGFP). [Figure 11] FIG. 10 shows the expression and attenuation of miR-122 using the reporter system described in Example 2. [Figure 12] Figure 10 shows miR-122-, miR-184-, miR-34a-, and Let7a-mediated attenuation of GFP using the reporter system described in Example 2. Circled wells indicate reduced levels of GFP expression. [Figure 13] Shown in FIG. 10 is the expression, as indicated by mCherry expression, of miR-122, miR-184, miR-34a, and Let7a using the reporter system described in Example 2. [Figure 14] Figure 10 shows miR-122-, miR-124-, miR-145-, miR-199-, and miR-451-mediated attenuation of GFP using the reporter system described in Example 2. Circled wells indicate reduced levels of GFP expression. [Figure 15] Shown in FIG. 10 is the expression, as indicated by mCherry expression, of miR-122, miR-124, miR-145, miR-199, and miR-451 using the reporter system described in Example 2. [Figure 16] Quantification of GFP fluorescence attenuated by miR-122 and miR-184 is shown. [Figure 17] Quantification of GFP fluorescence attenuated by miR-34a and miR-184 is shown. [Figure 18] Quantification of GFP fluorescence attenuated by Let7a and miR-184 is shown. [Figure 19] Quantification of GFP fluorescence attenuated by miR-124 and miR-184 is shown. [Figure 20] Quantification of GFP fluorescence attenuated by miR-145 and miR-184 is shown. [Figure 21] Quantification of GFP fluorescence attenuated by miR-199 and miR-451 is shown. [Figure 22] Quantification of GFP fluorescence attenuated by miR-125 and miR-451 is shown. [Figure 23] Quantification of GFP fluorescence attenuated by miR-126 and miR-451 is shown. [Figure 24] Quantification of GFP fluorescence attenuated by miR-127 and miR-451 is shown. [Diagram 25] Quantification of GFP fluorescence attenuated by miR-133 and miR-451 is shown. [Figure 26] Quantification of GFP fluorescence attenuated by miR-223 and miR-451 is shown. [Figure 27] Figures 27A-D show fluorescence-based quantification of HSV attenuation by miR-125 in non-cancerous post-mitotic lung cells and cancerous A253 cells. Figure 27A shows fluorescence-based quantification of HSV attenuation in post-mitotic lung cells. Figure 27B shows fluorescence-based quantification of HSV attenuation in A253 cells. Figure 27C shows qPCR-based quantification of HSV attenuation in post-mitotic lung cells. Figure 27D shows qPCR-based quantification of HSV attenuation in A253 cells. [Figure 28] Figures 28A-B show fluorescence-based (Figure 28A) and qPCR-based (Figure 28B) quantification of HSV attenuation by miR-145 in HCC1395 and A253 cells. [Figure 29] Figures 29A-B show fluorescence-based (Figure 29A) and qPCR-based (Figure 29B) quantification of HSV attenuation by miR-199a-5p and miR-143-3p in normal lung cells. [Diagram 30] Figures 30A-C show the expression of miRNA-125a (Figure 30A) and miRNA-122 (Figure 30B) in A253, Huh7, and Hep3B cell lines and their effect on viral replication (Figure 30C). [Figure 31C] Figures 30A-C show the expression of miRNA-125a (Figure 30A) and miRNA-122 (Figure 30B) in A253, Huh7, and Hep3B cell lines and their effect on viral replication (Figure 30C). [Diagram 31] 1 shows Western blots demonstrating reduced viral spread and protein expression following infection with HSV containing miR-T122 and / or miR-T125a in cells expressing miR-122 and miR-125a. [Figure 32-1] Figures 32A-D show the effect of miRNA expression on miR-attenuated HSV replication. Figures 32A-B show increased intracellular expression of miR-125a and mir-122 after transfection with miR-125a mimics (Figure 32A) or miR-122 mimics (Figure 32B). Figure 32C shows attenuation of replication of oncolytic HSV vectors at the target sequences of their cognate miRs at distinct loci as shown by fluorescence images and quantification of GFP fluorescence (Figure 32D). [Figure 32-2] Figures 32A-D show the effect of miRNA expression on miR-attenuated HSV replication. Figures 32A-B show increased intracellular expression of miR-125a and mir-122 after transfection with miR-125a mimics (Figure 32A) or miR-122 mimics (Figure 32B). Figure 32C shows attenuation of replication of oncolytic HSV vectors at the target sequences of their cognate miRs at distinct loci as shown by fluorescence images and quantification of GFP fluorescence (Figure 32D). [Diagram 33]Schematic diagram of ICP4-TmiRNA attenuated HSV vector for the treatment of cancer or benign hyperproliferative diseases. gB:NT: double mutation in gB gene to facilitate viral entry; BAC: loxP flanked chloramphenicol resistance and lacZ sequences; Δjoint: deletion of the complete internal repeat region including one copy of ICP4 gene; ICP4:TmiRNA: insertion of miRNA target sequence (e.g. let-7, miR-34a, miR-101, miR-125b, miR-145, etc.) into the 3'UTR of the remaining ICP4 gene (can also be placed in the 5'UTR). [Diagram 34] Schematic diagram of ICP27-TmiRNA attenuated HSV vector for the treatment of cancer or benign hyperproliferative diseases. gB:NT: double mutation in gB gene promoting viral entry; BAC: loxP flanked chloramphenicol resistance and lacZ sequences; Δjoint: deletion of the complete internal repeat region including one copy of ICP4 gene; ICP27:TmiRNA: insertion of miRNA target sequence (e.g. let-7, miR-34a, miR-101, miR-125b, miR-145, etc.) in 3'UTR of ICP27 gene (can also be placed in 5'UTR). [Diagram 35] Schematic diagram of UL19-TmiRNA attenuated HSV vector for the treatment of cancer or benign hyperproliferative diseases. gB:NT: double mutation in gB gene to facilitate viral entry; BAC: loxP flanked chloramphenicol resistance and lacZ sequences; Δjoint: deletion of the complete internal repeat region including one copy of ICP4 gene; UL19:TmiRNA: insertion of miRNA target sequence (e.g. let-7, miR-34a, miR-101, miR-125b, miR-145, etc.) in 3'UTR of UL19 gene (can also be placed in 5'UTR). [Diagram 36]Schematic diagram of UL19-TmiRNA and ICP27-TmiRNA attenuated HSV vectors for the treatment of cancer or benign hyperproliferative diseases. gB:NT: double mutation in gB gene promoting viral entry; BAC: loxP flanked chloramphenicol resistance and lacZ sequences; Δjoint: deletion of complete internal repeat region including one copy of ICP4 gene; UL19:TmiRNA and ICP27:TmiRNA: insertion of miRNA target sequence (e.g. let-7, miR-34a, miR-101, miR-125b, miR-145, etc.) in 3'UTR of UL19 and ICP27 genes (can also be placed in 5'UTR). [Figure 37] Schematic diagram of UL19-TmiRNA and ICP4-TmiRNA attenuated HSV vectors for the treatment of cancer or benign hyperproliferative diseases. gB:NT: double mutation in gB gene to facilitate viral entry; BAC: loxP flanked chloramphenicol resistance and lacZ sequences; Δjoint: deletion of complete internal repeat region including one copy of ICP4 gene; UL19:TmiRNA and ICP4:TmiRNA: insertion of miRNA target sequence (e.g. let-7, miR-34a, miR-101, miR-125b, miR-145, etc.) in 3'UTR of UL19 and ICP4 genes (can also be placed in 5'UTR). [Figure 38] Schematic diagram of UL19-TmiRNA, ICP27-TmiRNA, and ICP4-TmiRNA attenuated HSV vectors for the treatment of cancer or benign hyperproliferative diseases. gB:NT: double mutation in gB gene to facilitate viral entry; BAC: loxP flanked chloramphenicol resistance and lacZ sequences; Δjoint: deletion of complete internal repeat region including one copy of ICP4 gene; UL19:TmiRNA, ICP27:TmiRNA, and ICP4:TmiRNA: insertion of miRNA target sequence (e.g., let-7, miR-34a, miR-101, miR-125b, miR-145, etc.) into 3'UTR of UL19, ICP27, and ICP4 genes (can also be placed in 5'UTR). [Figure 39]Schematic diagram of ICP4-TmiRNA attenuated, genome-edited HSV vector for the treatment of cancer. gB:NT: double mutation in gB gene to promote viral entry; BAC: loxP-flanked chloramphenicol resistance and lacZ sequences; ΔJoint: deletion of the complete internal repeat region including one copy of ICP4 gene; ICP4:TmiRNA: insertion of miRNA target sequence (e.g., let-7, miR-34a, miR-101, miR-125b, miR-145) in the 3'UTR of the remaining ICP4 gene (also can be placed in the 5'UTR); Pol II promoters: constitutive (CAG, UbC, EF1a, PGK) or cell-specific (e.g., TRPV1, Nav1.7, hSYN), endonucleases: CRISPR-associated endonucleases (e.g., SpCas9, SaCas9, FnCpf1, FnCas9, etc.), poly(A): polyadenylation signal (e.g., bGH), gRNA: single crRNA-trRNA fusion (DR-crRNA-DR-trRNA), crRNA targeting oncogenic microRNAs (e.g., miR-17, miR-21, miR-155), Pol III promoters: e.g., U6, H1, 7SK. [Diagram 40]Schematic diagram of ICP4-TmiRNA attenuation, genome editing, and microenvironment remodeling HSV vector for the treatment of cancer. gB:NT: double mutation in gB gene to promote viral entry; BAC: loxP-flanked chloramphenicol resistance and lacZ sequences; ΔJoint: deletion of the complete internal repeat region including one copy of ICP4 gene; ICP4:TmiRNA: insertion of miRNA target sequence (e.g., let-7, miR-34a, miR-101, miR-125b, miR-145) in the 3'UTR of the remaining ICP4 gene (also can be placed in the 5'UTR); Pol II promoters: constitutive (CAG, UbC, EF1a, PGK) or cell-specific (e.g., TRPV1, Nav1.7, hSYN), endonucleases: CRISPR-associated endonucleases (e.g., SpCas9, SaCas9, FnCpf1, FnCas9, etc.), poly(A): polyadenylation signal (e.g., bGH), gRNA2: crRNA targeting microenvironment remodeling miRNAs (e.g., miR-143, miR-218) or TIMPs (e.g., TIMP1, TIMP2), Pol III promoters: e.g., U6, H1, 7SK. [Diagram 41] Schematic diagram of ICP4-TmiRNA and ICP27-TmiRNA attenuated HSV vectors for the treatment of pancreatic, lung and colon cancer. gB:NT: double mutation in gB gene promoting viral entry; BAC: loxP flanked chloramphenicol resistance and lacZ sequences; Δjoint: deletion of the complete internal repeat region including one copy of ICP4 gene; ICP4:TmiRNA: insertion of target sequence cassette of miR-124 in 3'UTR of remaining ICP4 gene (can also be placed in 5'UTR); ICP27:TmiRNA: insertion of target sequence cassette of miR-451a, miR-143-3p and miR-559 in 3'UTR of ICP-27 gene (can also be placed in 5'UTR). [Diagram 42]Schematic diagram of ICP4-TmiRNA and ICP27-TmiRNA attenuated HSV vectors for the treatment of multiple cancer types. gB:NT: double mutation in gB gene promoting viral entry, BAC: loxP flanked chloramphenicol resistance and lacZ sequences, Δjoint: deletion of the complete internal repeat region including one copy of ICP4 gene, ICP4:TmiRNA: insertion of target sequence cassette for miR-124 in 3'UTR of remaining ICP4 gene (can also be placed in 5'UTR), ICP27:TmiRNA: insertion of target sequence cassette for miR-451a, miR-145-5p, and miR-559 in 3'UTR of ICP-27 gene (can also be placed in 5'UTR). [Diagram 43] Schematic diagram of ICP4-TmiRNA and ICP27-TmiRNA attenuated HSV vectors for the treatment of schwannoma. gB: NT: double mutation in gB gene promoting viral entry, BAC: loxP flanked chloramphenicol resistance and lacZ sequences, Δjoint: deletion of the complete internal repeat region including one copy of ICP4 gene, ICP4: TmiRNA: insertion of target sequence cassette of miR-124 in 3'UTR of remaining ICP4 gene (can also be placed in 5'UTR), ICP27: TmiRNA: insertion of target sequence cassette of miR-205p, miR-141-5p and miR-31-5p in 3'UTR of ICP-27 gene (can also be placed in 5'UTR). [Diagram 44] A schematic diagram of miR-attenuated HSV viruses is shown, in which multiple copies of miR-122, miR-125a, and / or miR-124 target sites are inserted into ICP27, UL42, and / or ICP4. [Diagram 45] A schematic diagram of the miR-attenuated HSV virus (ONCR-157) is shown, in which miR target site cassettes are inserted into UL8, ICP12, ICP4, and ICP34.5. [Figure 46] A schematic diagram of a miR-attenuated HSV virus (ONCR-159) is shown, in which miR target site cassettes are inserted into UL8, ICP12, ICP4, and ICP34.5. [Figure 47] Figure 47A shows the GFP intensity generated by a reporter virus engineered to express GFP in cells treated with pooled siRNAs against various viral genes, and Figure 47B shows the results of the same assay against individual siRNAs. [Figure 48] Figures 48A and 48B show GFP intensity generated by reporter viruses engineered to express GFP in cells treated with pooled siRNAs against various viral genes using HSV vectors ONCR-003 (left) or ONCR-010 (right). [Figure 49] Western blots to detect viral protein expression in cells infected with HSV vectors and treated with siRNAs against the indicated viral genes are shown. Beta-actin is a positive control for this Western blot. [Figure 50] Figures 50A and 50B show Nanostring assay data for normal brain tissue compared to malignant tissue as miRNA expression ratios (Figure 50A) and normalized counts (Figure 50B). [Figure 51] Figures 51A and 51B show Nanostring assay data for normal cardiac tissue compared to malignant tissue as miRNA expression ratios (Figure 51A) and normalized counts (Figure 51B). [Figure 52] Figure 52A shows the Nanostring assay data of normal spinal cord tissue compared to malignant tissue as miRNA expression ratios. Figures 52A and 52B show the Nanostring assay data of normal nerve or ganglion tissue compared to malignant tissue as miRNA expression ratios (Figure 52A) and normalized counts (Figure 52C). [Figure 53] Figures 53A and 53B show luciferase assay testing of the miR-TS cassettes for Cassette 1 (Figure 53A) or Cassette 2 (Figure 53B). [Figure 54-1]Figures 54A-G show the cytotoxicity of oncolytic HSV viral vectors ONCR-125, ONCR-131, ONCR-142, and ONCR-157 in the cancer cell lines SW837 (Figure 54A), SKMEL28 (Figure 54B), COLO205 (Figure 54C), A375 (Figure 54D), H446 (Figure 54E), BXPC3 (Figure 54F), and BT549 (Figure 54G). [Figure 54-2] Figures 54A-G show the cytotoxicity of oncolytic HSV viral vectors ONCR-125, ONCR-131, ONCR-142, and ONCR-157 in the cancer cell lines SW837 (Figure 54A), SKMEL28 (Figure 54B), COLO205 (Figure 54C), A375 (Figure 54D), H446 (Figure 54E), BXPC3 (Figure 54F), and BT549 (Figure 54G). [Figure 55] The tumor growth inhibitory effect of vehicle compared to virus (as indicated in legend) in mouse xenograft experiments is shown. The increase in tumor volume of injected tumors is compared to the increase in tumor volume of non-injected tumors. ONCR-133 significantly inhibited tumor growth of injected tumors compared to vehicle-treated controls (p<0.0001). ONCR-133 treatment also significantly inhibited tumor growth of non-injected tumors (p<0.005), demonstrating improved long-range efficacy. [Figure 56] The tumor growth inhibitory effect of vehicle compared to virus (as indicated in legend) in mouse xenograft experiments is shown. The increase in tumor volume of injected tumors is compared to the increase in tumor volume of non-injected tumors. Mice treated with ONCR-133+ONCR-007 (HSV construct expressing ULBP3) or ONCR-133+ONCR-002 (HSV construct not expressing additional payload molecules) both showed significant inhibition of tumor growth compared to vehicle-treated controls. [Figure 57]The tumor growth inhibitory effect of vehicle compared to virus (as indicated in legend) in mouse xenograft experiments is shown. The increase in tumor volume of injected tumors is compared to the increase in tumor volume of non-injected tumors. Further expression of CXCL10 in the ONCR-106+ONCR-113 treatment group did not improve tumor growth inhibition in either injected or non-injected tumors compared to mice treated with ONCR-031+ONCR-113. [Figure 58] The tumor growth inhibitory effect of vehicle compared to virus (as indicated in legend) in mouse xenograft experiments is shown. The increase in tumor volume of injected tumors is compared to the increase in tumor volume of non-injected tumors. Further expression of CXCL10 in the ONCR-106+ONCR-113 treatment group did not improve tumor growth inhibition in either injected or non-injected tumors compared to mice treated with ONCR-031+ONCR-113. [Figure 59] Figures 59A-B show that replication of injected virus occurs only in injected tumors and not in non-injected tumors, suggesting that the anti-tumor effects seen in the non-injected tumors are immune-mediated. Data are plotted as raw genome copies per microgram of DNA (Figure 59A) or as normalized expression (Figure 59B). HSV was detected in injected tumors but not in non-injected tumors, indicating that the tumor growth inhibition seen in the non-injected tumors is due to a long-range effect of viral administration and not due to viral spread. [Figure 60] Figures 60A-C show payload expression peaking in injected tumors 24 hours after treatment and then declining. [Figure 61] Figures 61A-C show payload levels in serum of mice treated with ONCR-153, where only CXCL10 expression was observed. [Figure 62]Figure 62A shows the expression levels of interferon gamma in injected and non-injected tumors. Treatment of mice with ONCR-153 induced intratumoral IFNγ responses in both injected and non-injected tumors. Figure 62B shows the expression levels of interferon gamma in the plasma of host animals. [Figure 63] The tumor growth inhibitory effect of vehicle compared to virus (as indicated in legend) in mouse xenograft experiments is shown. The increase in tumor volume of injected tumors is compared to the increase in tumor volume of uninjected tumors. [Figure 64] The tumor growth inhibitory effect of vehicle compared to virus (as indicated in legend) in mouse xenograft experiments is shown. The increase in tumor volume of injected tumors is compared to the increase in tumor volume of uninjected tumors. [Figure 65] The tumor growth inhibitory effect of vehicle compared to virus (as indicated in legend) in mouse xenograft experiments is shown. The increase in tumor volume of injected tumors is compared to the increase in tumor volume of uninjected tumors. [Figure 66] Figure 66A shows the tumor growth suppression effect of vehicle compared to virus (as indicated in legend) in mouse xenograft experiments. Figure 66B shows the reduction in incidence of lung metastasis. Figure 66C shows images of lung tissue from vehicle (PBS) control or vector-treated animals. [Figure 67] The tumor growth inhibitory effect of vehicle is shown compared to virus (as indicated in legend) in mouse xenograft experiments. The increase in tumor volume of injected tumors is compared to the increase in tumor volume of uninjected tumors. Treatment with ONCR-152 and -139 showed improved tumor growth inhibitory effect compared to treatment with ONCR-139 alone. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0030] In some aspects, the invention utilizes differential miR expression profiles to effectively restrict viral vector replication to tumor cells by incorporating miR target sequences into one or more genes required for viral replication. In certain embodiments, the viral vectors described herein contain two, three, four, or more copies of miR target sequences incorporated into one or more viral genes. In some embodiments, the viral vectors described herein also disrupt the expression of specific miRNAs for reduced tumor growth, metastasis, and / or remodeling of the tumor microenvironment to allow enhanced viral spread. In some embodiments, the viral vectors described herein include using surface molecules of the viral vector to facilitate targeting to tumor cells. These aspects can be applied individually or in combination to develop viral vectors that are potentially capable of treating a wide range of cancer types with a single viral vector. Thus, the invention further encompasses recombinant oncolytic viral vectors for use in the treatment and prevention of diseases and disorders (e.g., cancer). In some embodiments, the invention utilizes endogenous microRNA (miR) expression to enable safe and effective recombinant viral vectors suitable for the treatment of a wide range of cancers.

[0031] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents, or portions of documents, cited herein, including but not limited to patents, patent applications, articles, books, and papers, are expressly incorporated herein by reference in their entirety for all purposes. In the event that one or more of the incorporated documents or portions of documents defines a term that contradicts the definition of the term in this application, the definition appearing in this application shall control. However, the mention of any references, articles, publications, patents, patent publications, and patent applications cited herein is not, and should not be construed as, an admission or any implication that they constitute valid prior art or form part of the common general knowledge in any country in the world.

[0032] definition In this description, any concentration range, percentage range, ratio range, or integer range is understood to include any integer value in the recited range and, where appropriate, fractions thereof (e.g., tenths and hundredths of an integer, etc.), unless otherwise specified. As used herein, the terms "a" and "an" are understood to refer to "one or more" recited components, unless otherwise specified. The use of alternatives (e.g., "or") is understood to mean either one, both, or any combination thereof of the alternatives. As used herein, the terms "include" and "comprise" are used synonymously. As used herein, "plurality" can refer to one or more components (e.g., one or more target sequences of miRNAs).

[0033] As used in this application, the terms "about" and "approximately" are used equivalently. Any numbers used in this application, with or without about / approximately, are meant to include any normal variations recognized by those of ordinary skill in the art. In certain embodiments, the term "about" or "approximately" refers to a range of values ​​that falls within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater or less) of the indicated reference value, unless otherwise stated or clear from the context (except where such number exceeds 100% of possible values).

[0034] "Decrease" or "reduce" refers to a decrease or reduction in a particular value of at least 5%, e.g., 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 99, or 100%, as compared to a reference value. A decrease or reduction in a particular value may also be expressed as a fold change in value as compared to the reference value, e.g., a decrease of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 500, 1000-fold or more as compared to the reference value.

[0035] "Increase" refers to an increase in a particular value of at least 5%, e.g., 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 99, 100, 200, 300, 400, 500%, or more, compared to a reference value. An increase in a particular value may also be expressed as a fold change in value compared to the reference value, e.g., an increase of at least 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 200-fold, 500-fold, 1000-fold, or more, compared to the level of the reference value.

[0036] The term "sequence identity" refers to the percentage of bases or amino acids between two polynucleotide or polypeptide sequences that are the same and in the same relative position. Thus, one polynucleotide or polypeptide sequence has a certain percentage of sequence identity compared to another polynucleotide or polypeptide sequence. In sequence comparison, one sequence usually serves as a reference sequence, to which test sequences are compared. The term "reference sequence" refers to the molecule to which test sequences are compared.

[0037] "Complementary" refers to the ability to pair between two sequences containing naturally occurring or non-naturally occurring (e.g., modified as described above) bases (nucleosides) or analogs thereof through base stacking and specific hydrogen bonding. For example, if a base in a nucleic acid at one position is capable of hydrogen bonding with a base at the corresponding position in a target, then these bases are considered to be complementary to each other at that position. Nucleic acids can contain universal bases or inert abasic spacers that do not contribute positively or negatively to hydrogen bonding. Base pairing can include standard Watson-Crick base pairing and non-Watson-Crick base pairing (e.g., wobble base pairing and Hoogsteen base pairing). In the case of complementary base pairing, it is understood that an adenosine-type base (A) is complementary to a thymidine-type base (T) or a uracil-type base (U), a cytosine-type base (C) is complementary to a guanosine-type base (G), and a universal base such as 3-nitropyrrole or 5-nitroindole can hybridize to and be complementary to any A, C, U, or T. et al., Nature, 1994, 369:492-493 and Loakes et al., Nucleic Acids Res., 1994, 22:4039-4043. Inosine (I) is also considered in the art to be a universal base and is considered complementary to any A, C, U, or T. See Watkins and SantaLucia, Nucl. Acids Research, 2005, 33(19):6258-6267.

[0038] "Operably linked" refers to a juxtaposition in which the components so described are in a relationship permitting them to function as intended. For example, a promoter is operably linked to a polynucleotide sequence if the promoter affects the transcription or expression of that polynucleotide sequence.

[0039] The term "subject" includes animals, e.g., mammals. In some embodiments, the mammal is a primate. In some embodiments, the mammal is a human. In some embodiments, the subject is a farm animal, e.g., cattle, sheep, goats, dairy cows, pigs, etc., or is a domesticated animal, e.g., dogs and cats. In some embodiments (e.g., particularly in research settings), the subject is a rodent (e.g., mouse, rat, hamster), rabbit, primate, or pig, e.g., inbred pig, etc. The terms "subject" and "patient" are used interchangeably herein.

[0040] The term "effective amount" refers to the minimum amount of an agent or composition required to produce a particular physiological effect (e.g., the amount required to increase, activate, and / or enhance a particular physiological effect). The effective amount of a particular agent can be expressed in a variety of ways based on the properties of the agent, such as mass / volume, number of cells / volume, particles / volume, (mass of agent) / (mass of subject), number of cells / (mass of subject), or particles / (mass of subject). The effective amount of a particular agent is also referred to as the median effective concentration (EC 50 ), which refers to the concentration of a drug that produces a particular magnitude of physiological response that is halfway between a reference level and a maximal response level.

[0041] The phrase "pharmacologically acceptable" is used herein to refer to compounds, materials, compositions, and / or dosage forms that are suitable, within the scope of sound medical judgment, for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / disadvantage ratio.

[0042] As used herein, "pharmaceutical acceptable carrier, diluent, or excipient" includes, but is not limited to, any adjuvant, carrier, excipient, glidant, sweetener, diluent, preservative, dye / colorant, flavor enhancer, surfactant, wetting agent, dispersing agent, suspending agent, stabilizer, isotonic agent, solvent, surface active agent, and / or emulsifier approved by the U.S. Food and Drug Administration as acceptable for human and / or veterinary use.

[0043] As used herein, the term "oncolytic virus" refers to a virus that has been modified to preferentially infect, or that naturally preferentially infects, cancer cells.

[0044] The terms "microRNA," "miRNA," and "miR" are used interchangeably herein and refer to small, non-coding, endogenous RNAs, approximately 21-25 nucleotides in length, that regulate gene expression by directing their target messenger RNAs (mRNAs) for degradation or translational repression.

[0045] As used herein, "essential viral genes" refers to viral genes required for one or more essential viral functions, such as viral replication, viral packaging, or viral infectivity.

[0046] The term "vector" as used herein refers to a nucleic acid molecule capable of transferring or transporting another nucleic acid molecule. The nucleic acid to be transferred is generally linked to, e.g., inserted into, the nucleic acid molecule of the vector. A vector may contain sequences that direct it to replicate autonomously in a cell, or may contain sequences sufficient to allow integration into the host cell DNA.

[0047] General methods in molecular and cellular biochemistry are described in Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., Harbor Laboratory Press 2001), Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. eds., John Wiley & Sons 1999), Protein Methods (Bollag et al., John Wiley & Sons 1996), Nonviral Vectors for Gene Therapy (Wagner et al. eds., Academic Press 1999), Viral Vectors (Kaplift & Loewy eds., Academic Press 1995), Immunology Methods Manual (I. Lefkovits ed., Academic Press 1997), and Cell and Tissue Culture: Laboratory Procedures in Biotechnology (Doyle & Griffiths, John Wiley & Sons (1998), the disclosures of which are incorporated herein by reference.

[0048] Oncolytic viruses In some embodiments, the present invention provides a recombinant oncolytic virus, wherein one or more copies of one or more microRNA (miRNA) target sequences are inserted into the locus of one or more essential viral genes required for viral replication. Examples of oncolytic viruses are known in the art and include, but are not limited to, herpes simplex virus (HSV), adenovirus, poliovirus, vaccinia virus, measles virus, vesicular stomatitis virus, orthomyxovirus, parvovirus, Maraba virus or coxsackie virus. In some embodiments, the oncolytic virus described herein is referred to as a recombinant viral vector or oncolytic vector.

[0049] In certain embodiments, the oncolytic virus described herein is a herpes virus (e.g., a herpes simplex virus (e.g., HSV-1 or HSV-2)), an adenovirus, a poliovirus, a vaccinia virus, a measles virus, a vesicular stomatitis virus, an orthomyxovirus, a parvovirus, a Maraba virus, or a coxsackie virus. In certain embodiments, the recombinant viral vector is an HSV capable of tumor-selective vector replication as described in International PCT Publication No. WO2015 / 066042, which is incorporated by reference in its entirety.

[0050] HSV-based vectors and methods for their construction are described, for example, in U.S. Pat. Nos. 7,078,029, 6,261,552, 5,998,174, 5,879,934, 5,849,572, 5,849,571, 5,837,532, 5,804,413, and 5,658,724, and International Patent Applications WO91 / 02788, WO96 / 04394, WO98 / 15637, and WO99 / 06583, which are incorporated by reference in their entireties. The sequence of HSV has been published (NCBI Accession No. NC_001806; see also McGoech et al., J. Gen. Virol, 69 (PT 7), 1531-1574 (1988)), which may facilitate the design of HSV-based vectors of the invention. In some cases, the oncolytic virus of the invention is a herpes simplex virus (HSV) and contains a deletion of the internal repeat (joint) region that contains one copy each of the diploid genes ICP0, ICP34.5, LAT, and ICP4 together with the promoter for the ICP47 gene.

[0051] In certain embodiments, the recombinant viral vector of the invention is an HSV that exhibits enhanced entry into cells via either direct infection and / or lateral spread. In one aspect, the HSV vector of the invention can directly infect cells via interaction with cellular proteins other than normal mediators of HSV infection (e.g., other than nectin-1, HVEM, or heparan sulfate / chondroitin sulfate proteoglycans). In certain embodiments, the recombinant viral vector of the invention is an HSV and further comprises a mutation in the gB or gH gene that facilitates vector entry via a non-canonical receptor. In another aspect, the invention provides an HSV vector that further comprises a mutant gH glycoprotein that exhibits lateral spread in cells normally resistant to lateral spread of HSV, e.g., cells lacking the gD receptor. In some embodiments, the HSV vector of the invention comprises one or more mutant gB or gH proteins described in U.S. Patent Publication No. 2013 / 0096186, which is incorporated herein by reference in its entirety. In certain aspects, the mutant entry protein in the HSV vector is a glycoprotein involved in viral entry, e.g., gB, gH, and the mutant HSV vector can include both mutants. However, the mutant entry protein can be any protein that causes the entry of the HSV vector into a cell. In certain embodiments, the mutant entry protein is other than gD, but the HSV vector can further include a mutant gD, e.g., including a ligand or other desired mutation. Non-limiting mutations in the gB or gH glycoproteins used in the HSV vectors of the present invention occur at one or more of the following residues: gB:D285, gB:A549, gB:S668, gH:N753, and gH:A778. In some embodiments, the HSV vectors of the present invention include mutations at both gB:D285 and gB:A549, both gH:N753 and gH:A778, and / or at each of gB:S668, gH:N753, and gH:A778. In certain embodiments, the HSV vector comprises two or more such mutations (eg, three or more, four or more), and the HSV vector can comprise mutations at all five of these residues.In one embodiment, the HSV vector has mutations at gB:285, gB;549, gH:753, and gH:778, which are referred to herein with respect to the codon (amino acid) numbering of the gD, gB, and gH genes of the KOS derivative of HSV-1 strain K26GFP. The gB and gH sequences of K26GFP differ from the gB sequence (#AF311740, incorporated herein by reference) and gH sequence (GenBank#X03896, incorporated herein by reference) disclosed in GenBank, as reflected in Table 9 below. [Table 9]

[0052] However, K26GFP may contain additional differences in the region of the gene corresponding to nucleotides 2,079-2,102 of GenBank X03896. Thus, it will be understood that the sequence of either KOS derivative K26GFP or GenBank Accession No. AF311740 can serve as a reference sequence for the gB mutations discussed herein. Similarly, the sequence of either KOS derivative K26GFP or GenBank Accession No. X03896 can serve as a reference sequence for the gH mutations discussed herein. However, the HSV vectors of the present invention may contain the same mutations in gB and gH of any HSV strain.

[0053] In some aspects, the mutation of the entry protein for inclusion in the HSV vector is a substitution mutation, although the mutation is not limited to a substitution mutant. In certain embodiments, the mutant gB or gH glycoprotein for use in the HSV vector is selected from the group of substitution mutations consisting of gB:D285N, gB:A549T, gB:S668N, gH:N753K, gH:A778V. In certain aspects, the HSV vector comprises a combination of these substitutions (e.g., two or more such substitutions (e.g., three or more, four or more, or all)), with the gB:D285N / gB:A549T double mutant, the gH:N753K / gH:A778V double mutant, and the gB:S668N / gH:N753K / gH:A778V triple mutant being exemplary embodiments. In one embodiment, the HSV vector comprises gB:D285N / gB:A549T / gH:N753K / gH:A778V.

[0054] In certain aspects, the HSV vector comprises a mutated gB and / or mutated gH glycoprotein, wherein the mutations in the glycoprotein are substitution mutations at at least two residues, wherein when the vector is HSV-1 K26GFP, the at least two residues are selected from the group consisting of gB:D285, gB:A549, gB:S668, gH:N753, and gH:A778, or when the vector is a homologous HSV, the at least two residues are selected from amino acids correlated with gB:D285, gB:A549, gB:S668, gH:N753, and gH:A778, wherein the gB:D285 residue is VYPYXEFVL ( the gB:A549 residue correlates to X of KLNPNXIAS (SEQ ID NO:839), the gB:S668 residue correlates to X of ITTVXTFID (SEQ ID NO:840), the gH:N753 residue correlates to X of VDTDXTQQQ (SEQ ID NO:841), the gH:A778 residue correlates to X of VPSTXLLLF (SEQ ID NO:842), and the HSV vector is an HSV-1 or HSV-2 vector.

[0055] In some embodiments, the oncolytic HSV viruses described herein contain one or more mutations in the UL37 gene that reduce HSV infection of neuronal cells, such as those described in International PCT Publication No. WO2016 / 141320 and Richard et al., Plos Pathogens, 2017, 13(12), e1006741.

[0056] miRNA-attenuated oncolytic viruses miRs are differentially expressed in a wide range of disease states, including multiple cancer types. Importantly, miRNAs are differentially expressed in cancer tissues compared to normal tissues, allowing them to function as targeting mechanisms in a wide range of cancers. miRNAs that are associated (positively or negatively) with carcinogenesis, malignant transformation, or metastasis are known as "oncomiRs."

[0057] In some aspects, the expression level of a particular oncomiR is positively associated with the development or maintenance of a particular cancer. Such miRs are referred to herein as "oncogenic miRs." In some embodiments, the expression of an oncogenic miR is increased in a cancerous cell or tissue compared to the expression level found in a non-cancerous control cell (i.e., a normal or healthy control) or compared to the expression level found in a cancerous cell from a different cancer type. In some embodiments, the expression of an oncogenic miR is increased by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 300%, 400%, 500%, 1000% or more compared to the expression of the oncogenic miR in a non-cancerous control cell or a cancerous cell from a different cancer type. In some embodiments, cancerous cells or tissues may express oncogenic miRs that are not expressed in non-cancerous control cells or tissues. Examples of oncogenic miRNAs that are often overexpressed in cancer tissues include, but are not limited to, miR-21, miR-155, and miR-17-92. Further examples of oncogenic miRs are listed in Table 4.

[0058] In some embodiments, expression of a particular oncomiR is negatively associated with the development or maintenance and / or metastasis of a particular cancer. Such oncomiRs are referred to herein as "tumor-suppressor miRs" or "tumor-suppressive miRs" because their expression prevents or suppresses the development of cancer. In some embodiments, expression of a tumor-suppressing miRNA is decreased in a cancerous cell or tissue compared to the expression level observed in a non-cancerous control cell (i.e., a normal or healthy control) or compared to the expression level of the tumor-suppressing miRNA observed in a cancerous cell from a different cancer type. For example, expression of a tumor-suppressing miRNA in a cancerous cell may be decreased by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, or 100% compared to the expression of the tumor-suppressing miRNA in a non-cancerous control cell or a cancerous cell from a different cancer type. In some embodiments, the non-cancerous control cells may express tumor suppressing miRNAs that are not expressed in the cancerous cells. Examples of tumor suppressing miRNAs include miR-122, miR-184, miR-34a, let7a, miR-145-5p, miR-199a-5p, miR-451a, miR-125a, miR-125a-5p, miR-126-3p, miR-233-3p, miR-143-3p, miR-1-3p, miR-133a-3p, miR Examples of tumor suppressor miRs include, but are not limited to, -127a-3p, miR-133b, miR-134-3p, miR-124, miR-101, miR-125b, miR-145, miR-559, miR-213, miR-31-5p, miR-205p, miR-15a, miR-16-1, miR-34, and miRNAs of the let-7 family. Further examples of tumor suppressor miRs are listed in Tables 3 and 8.

[0059] Cancer development is a heterogeneous and multigenic process. Thus, activation of certain pathways and expression of certain genes may lead to cancer development in some circumstances and may lead to different or opposite outcomes when activated or expressed in different circumstances. Thus, characterizing a particular gene or miR as an "oncogene" or "oncogenic miR" or as a "tumor suppressor" or "tumor suppressor miR" is not a two-way distinction, but rather varies by cancer type. For example, expression of a certain miRNA may be increased in a particular cancer and associated with the development of that cancer, while expression of the same miRNA may be decreased in a different cancer and associated with the suppression of the development of that cancer. However, some miRNAs can function as oncogenic miRNAs independent of cancer type. For example, some miRNAs target the mRNA transcripts of tumor suppressor genes for degradation, thus reducing the expression of the tumor suppressor protein. For example, miR-152b functions as an oncogenic miR in the majority of hematological malignancies, but as a tumor suppressor miR in many solid tumors. Moreover, certain miRs can be highly expressed in both cancerous and non-cancerous cells. For example, miR-155 is highly expressed in normal cells, plays a necessary role in macrophage polarization, and is also highly expressed in cancer cells. Thus, the development of miR attenuation, genome editing, and microenvironment remodeling oncolytic viruses described herein is based on the differential expression of a certain miR or group of miRs in one cell population or tissue compared to another cell population or tissue. Those skilled in the art will understand that the term tumor suppressor miR generally refers to the miR that is highly expressed in non-cancerous cells or tissues compared to cancerous cells or tissues, and the term oncogenic miR generally refers to the miR that is highly expressed in cancerous cells or tissues compared to non-cancerous cells or tissues. Those of skill in the art will further understand that a miR characterized as a tumor suppressor miR in one cancer type may or may not function as a tumor suppressor miR in a different cancer type, and that a miR characterized as an oncogenic miR in one cancer type may or may not function as an oncogenic miR in a different cancer type.

[0060] Table 1 shows the relationship between 12 selected oncomiRs (9 tumor suppressors and 3 oncogenic miRNAs) and a number of cancers. A list of the relationships between 3,410 oncomiRs and cancer is shown in Table 2. miRNAs regulate the transcripts of many of the proteins involved in the control of cell proliferation and apoptosis. Regulated proteins include traditional proto-oncoproteins as well as tumor suppressors such as Ras, Myc, Bcl2, PTEN and p53. Aberrant expression of miRNAs is therefore often involved in the development of cancer and can be therapeutically corrected by either suppressing oncogenic miRNAs or replacing depleted tumor suppressor miRNAs. Furthermore, differential expression of certain oncomiRs in cancerous and non-cancerous cells can be exploited as a means to specifically target cancer therapy to cancer cells. Thus, in some embodiments, the oncolytic viral vectors described herein can include the following properties, individually or in combination: insertion of a miRNA target sequence into the viral genome to restrict viral vector replication to cancer or tumor cells, one or more polynucleotides whose product(s) interfere with the function of oncogenic miRNAs, modulate the extracellular matrix of cancer, and / or enhance or activate anti-cancer immune responses, are incorporated into the viral genome, and / or a protease-activating antibody is incorporated into the viral particle to selectively target the vector to cancer and / or tumor cells.

[0061] One aspect of the present invention includes recombinant oncolytic viruses (or viral vectors) that contain multiple copies of one or more miRNA target sequences inserted into the locus of one or more essential viral genes. In certain embodiments, the recombinant oncolytic viruses may contain at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten miRNA target sequences inserted into the locus of essential viral genes. The miRNAs expressed in normal (non-cancerous) cells can bind to such target sequences and suppress the expression of viral genes that contain the miRNA target sequences, thereby limiting viral replication in healthy non-cancerous cells. Such recombinant oncolytic viruses are referred to herein as "miR-attenuated" or "replication-restricted" because they show reduced or attenuated viral replication in cells that express one or more miRNAs that can bind to the target sequences of the incorporated miRs, compared to cells that do not express or have reduced expression of the miRs. By incorporating the target sequence of a miRNA into a key gene required for viral replication, viral replication can be conditionally suppressed in normal diploid cells expressing the miRNA and can proceed normally in cells that do not express the miRNA. In such an embodiment, healthy non-cancerous cells are protected from normal cells from the lytic effects of infection by the recombinant viral vector.

[0062] In certain embodiments, the target sequences of the one or more miRNAs are integrated into the 5' untranslated region (UTR) and / or 3' UTR of one or more essential viral genes. In some embodiments, the oncolytic virus is a herpes simplex virus (HSV), and the viral genes required for viral replication are UL1, UL5, UL6, UL7, UL8, UL9, UL11, UL12, UL14, UL15, UL17, UL18, UL19, UL20, UL22, UL25, UL26, UL26.5, UL27, UL28, UL29, UL30, UL31, UL US32, UL33, UL34, UL35, UL36, UL37, UL38, UL39, UL40, UL42, UL48, UL49, UL52, UL53, UL54, ICP0, ICP4, ICP22, ICP27, ICP34.5, ICP47, gamma-34.5, US3, US4, US5, US6, US7, US8, US9, US10, US11, and / or US12. In certain embodiments, the oncolytic virus is HSV and comprises one or more miRNA target sequences integrated into the 5' or 3' UTR of one or more essential viral genes. In some embodiments, the oncolytic virus is HSV and the one or more miRNA target sequences integrated into one or more of ICP4, ICP27, UL8, UL42, UL19, and ICP34.5. In some embodiments, the oncolytic virus is HSV and the target sequences of the one or more miRNAs are integrated into the 5' or 3' UTR of one or more of ICP4, ICP27, UL8, UL42, UL19, and ICP34.5.

[0063] miRNA target sequence cassette In animals, genes for miRNAs are transcribed into primary miRNAs (pri-miRNAs), which are then processed in the nucleus by Drosha, a class 2 RNase III enzyme, to form precursor miRNA (pre-miRNA) hairpins. The pre-miRNA hairpins are transported to the cytoplasm where they are cleaved by the RNase III enzyme Dicer. This endoribonuclease interacts with the 5' and 3' ends of the hairpin and cleaves the loop connecting the 3' and 5' arms, generating a double-stranded RNA molecule approximately 22 nucleotides long. Although either strand of the duplex can potentially act as a functional miRNA, typically one strand of the miRNA is degraded and only one strand is loaded into Argonaute (Ago) proteins to generate the effector RNA-induced silencing complex (RISC) where the miRNA and its mRNA target interact (Wahid et al., 2003). et al., 1803:11, 2010, 1231-1243).

[0064] Herein, genes encoding specific miRNAs are referred to as "MIR" followed by the miRNA number. Intermediate hairpin pre-miRNA molecules are referred to as "mir" followed by the miRNA number, and mature single-stranded miRNA molecules are referred to as "miR-" followed by the miRNA number. For example, "MIR122" refers to a gene encoding a hairpin mir-122 pre-miRNA molecule that is subsequently processed into a mature miR-122 molecule. Due to the hairpin structure of the pre-miRNA, it is conceivable that two mature microRNAs may be derived from opposing arms of the same pre-miRNA. In some cases, expression data clearly identifies one strand as the predominantly expressed miRNA and the other as the minor product. In such cases, the mature miRNA sequence may be designated as miR-## (major product) and miR-## * (minor product from opposite arms of the precursor) are assigned names based on their form. For example, the major and minor products of mir-56 are miR-56 and miR-56, respectively. *When the existing data is insufficient to determine which sequence is predominant, or when they are found in approximately equal amounts, the two mature miRNA products are designated as miR-##-5p (derived from the 5' arm of the pre-miRNA hairpin) and miR-##-3p (derived from the 3' arm of the pre-miRNA hairpin). For example, the two mature miRNA products of mir-142 are designated as miR-142-5p and miR-142-3p. Because they are derived from opposite ends of the pre-miRNA hairpin, the -3p and -5p products of a particular miRNA contain different RNA sequences and therefore recognize different target sequences.

[0065] As used herein, the miRNA target sequence is inserted into the locus of one or more essential viral genes in the form of a "miR target sequence cassette" or "miR-TS cassette." A miR-TS cassette refers to a polynucleotide sequence that contains one or more miRNA target sequences and can be inserted into a specific locus of a viral gene. When transcribed, the mRNA transcript of the viral gene that contains the miR-TS cassette contains one or more miRNA target sequences. In some embodiments, the miR-TS cassette described herein contains at least one miRNA target sequence. In some embodiments, the miR-TS cassette described herein contains multiple miRNA target sequences. For example, in some embodiments, the miR-TS cassette described herein contains 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more miRNA target sequences. In such embodiments in which the miR-TS cassette comprises target sequences of two or more miRNAs, the two or more target sequences are arranged such that the total length (m) of the miR-TS cassette is equal to or less than the average length (n) of the miRNA target sequences multiplied by the total number (y) of the miRNA target sequences in the cassette plus the average length (l) of the linker sequences multiplied by the total number of the miRNA target sequences in the cassette plus 1 (y+1). Thus, the length (m) of a miR-TS cassette can be expressed by the formula: m≦(n*y)+(l*(y+1)), where n=average length of the miRNA target sequences, l=average length of the linker sequences, and y=total number of the target sequences in the miR-TS cassette. As an illustrative example, if a miR-TS cassette contains target sequences of four (y) miRNAs with an average length of 21 nt (n) and the average length of the linker sequences is 4-25 nt (l), then the length (m) of the miR-TS cassette is from about 104 nt to about 205 nt.

[0066] As used herein, the "length" of a miR-TS cassette is defined as the total number of nucleotides (base pairs in a double-stranded polynucleotide) from the 5' nucleotide of the first miR-TS to the 3' nucleotide of the last miR-TS of the polynucleotide, including any intervening sequences. In the case of non-overlapping miR-TSs, the minimum length of a miR-TS cassette is the sum of the lengths of the miR-TSs. Spacers extend the length. The choice of spacer length determines the number of additional nucleotides in the cassette. A longer spacer extends the length of the cassette more than a shorter spacer. By recognizing that a shorter spacer (0, 1, 2, 3, 4, 5, or 6 nt) can be used in the case of alternating miR-TSs where the miR-TSs are interleaved (minimizing the number of mi-TSs for the same miRNA adjacent to each other), i.e., where the alternating miR-TSs serve to increase the space between other miR-TSs, the inventors have determined that it is possible to generate a shorter miR-TS cassette than is possible in a miR-TS cassette where the miR-TSs for the same miRNA are arranged in tandem, for example, four of one type followed by four of the next type. In some embodiments, the length of the miR-TS cassette is less than 1000 nt. In some embodiments, the length of the miR-TS cassette is less than 900 nt, less than 800 nt, less than 700 nt, less than 600 nt, less than 500 nt, less than 400 nt, less than 300 nt, less than 200 nt, less than 100 nt, or less than 50 nt. In some embodiments, the length of the miR-TS cassette is less than 26, 27, 28, 29, or 30 nt x the number of miR-TS sites, less than about 30 nt x the number of miR-TS sites, less than about 35 nt x the number of miR-TS sites, or less than about 40 nt x the number of miR-TS sites.

[0067] In some embodiments, the miR-TS cassette comprises a plurality of miRNA target sequences, and the target sequences of each miRNA in the plurality are the target sequences of the same miRNA. For example, the miR-TS cassette may comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of the same miR target sequence. In some embodiments, the miR-TS cassette comprises 2 to 6 copies of the same miR target sequence. In some embodiments, the miR-TS cassette comprises 3 copies of the same miR target sequence. In some embodiments, the miR-TS cassette comprises 4 copies of the same miR target sequence.

[0068] In some embodiments, the miR-TS cassette described herein comprises a plurality of miRNA target sequences, the plurality comprising at least two different miRNA target sequences. In some embodiments, the miR-TS cassette described herein comprises 2, 3, 4, 5, 6, 7, 8, 9, or 10 different miRNA target sequences. For example, in some embodiments, the miR-TS cassette may comprise one or more copies of a first miRNA target sequence and one or more copies of a second miRNA target sequence. In some embodiments, the miR-TS cassette comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of a first miR target sequence and at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of a second miR target sequence. In some embodiments, the miR-TS cassette comprises three or four copies of a first miR target sequence and three or four copies of a second miR target sequence. In some embodiments, the target sequences of the multiple miRNAs comprise target sequences of at least three different miRNAs. For example, in some embodiments, the miR-TS cassette comprises one or more copies of the target sequence of the first miR, one or more copies of the target sequence of the second miR, and one or more copies of the target sequence of the third miR. In some embodiments, the miR-TS cassette comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of the target sequence of the first miR, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of the target sequence of the second miR, and at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of the target sequence of the third miR. In some embodiments, the miR-TS cassette comprises three or four copies of the target sequence of the first miR, three or four copies of the target sequence of the second miR, and three or four copies of the target sequence of the third miR. In some embodiments, the target sequences of the multiple miRNAs comprise target sequences of at least four different miRNAs.For example, in some embodiments, the miR-TS cassette comprises one or more copies of a target sequence of a first miR, one or more copies of a target sequence of a second miR, one or more copies of a target sequence of a third miR, and one or more copies of a target sequence of a fourth miR. In some embodiments, the miR-TS cassette comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of a target sequence of a first miR, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of a target sequence of a second miR, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of a target sequence of a third miR, and at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of a target sequence of a fourth miR. In some embodiments, the miR-TS cassette comprises three or four copies of the target sequence of a first miR, three or four copies of the target sequence of a second miR, three or four copies of the target sequence of a third miR, and three or four copies of the target sequence of a fourth miR. In some embodiments, the miR-TS cassettes described herein comprise target sequences for multiple miRNAs.

[0069] In some aspects where the miR-TS cassette comprises target sequences of multiple miRNAs, the target sequences of the multiple miRNAs may be arranged in tandem without an intervening nucleic acid sequence. In some aspects, the target sequences of the multiple miRNAs may be separated by a linker sequence. In some embodiments, the linker sequence comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or more nucleotides. In some embodiments, the linker sequence comprises about 4 to about 20 nucleotides. In further embodiments, the linker sequence comprises about 4 to about 16 nucleotides. As an illustrative embodiment, the miR-TS cassette may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more of the following subunits: (a) a target sequence of a first miRNA-linker-a target sequence of a second miRNA, where adjacent subunits are separated by an additional linker sequence. In some embodiments, the target sequences of the first and second miRNAs are targets of the same miRNA. In some embodiments, the target sequences of the first and second miRNAs are targets of different miRNAs.

[0070] In some embodiments, the miR-TS cassettes described herein comprise a miRNA target sequence that is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the reverse complement of a sequence selected from SEQ ID NOs: 1-803. In some embodiments, the miR-TS cassettes described herein comprise a miRNA target sequence that comprises or consists of the reverse complement of a sequence selected from SEQ ID NOs: 1-803.

[0071] In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four target sequences of miR-122-5p. In some embodiments, the miR-122-5p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:804. In some embodiments, the miR-122-5p target sequence comprises or consists of SEQ ID NO:804. In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four target sequences of miR-124-3p. In some embodiments, the miR-124-3p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:805. In some embodiments, the miR-124-3p target sequence comprises or consists of SEQ ID NO:805. In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four miR-125a-5p target sequences. In some embodiments, the miR-125a-5p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:806. In some embodiments, the miR-125a-5p target sequence comprises or consists of SEQ ID NO:806.

[0072] In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four miR-126-3p target sequences. In some embodiments, the miR-126-3p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:807 or SEQ ID NO:808. In some embodiments, the miR-126-3p target sequence comprises or consists of SEQ ID NO:807 or SEQ ID NO:808. In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four miR-127a-3p target sequences. In some embodiments, the miR-127a-3p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:809. In some embodiments, the target sequence of miR-127a-3p comprises or consists of SEQ ID NO:809.

[0073] In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four miR-128-3p target sequences. In some embodiments, the miR-128-3p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:810 or SEQ ID NO:811. In some embodiments, the miR-128-3p target sequence comprises or consists of SEQ ID NO:810 or SEQ ID NO:811. In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four miR-129-3p target sequences. In some embodiments, the miR-129-3p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:812. In some embodiments, the target sequence of miR-129-3p comprises or consists of SEQ ID NO:812.

[0074] In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four miR-129-5p target sequences. In some embodiments, the miR-129-5p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:813. In some embodiments, the miR-129-5p target sequence comprises or consists of SEQ ID NO:813. In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four miR-130b-3p target sequences. In some embodiments, the miR-130b-3p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:814. In some embodiments, the miR-130b-3p target sequence comprises or consists of SEQ ID NO:814. In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four miR-130b-5p target sequences. In some embodiments, the miR-130b-5p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:815. In some embodiments, the miR-130b-5p target sequence comprises or consists of SEQ ID NO:815.

[0075] In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four miR-133a-3p target sequences. In some embodiments, the miR-133a-3p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:816. In some embodiments, the miR-133a-3p target sequence comprises or consists of SEQ ID NO:816. In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four miR-133b-3p target sequences. In some embodiments, the miR-133b-3p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:817. In some embodiments, the miR-133b-3p target sequence comprises or consists of SEQ ID NO:817. In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four miR-134-3p target sequences. In some embodiments, the miR-134-3p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:818. In some embodiments, the miR-134-3p target sequence comprises or consists of SEQ ID NO:818.

[0076] In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four miR-137-3p target sequences. In some embodiments, the miR-137-3p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:819. In some embodiments, the miR-137-3p target sequence comprises or consists of SEQ ID NO:819. In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four miR-1-3p target sequences. In some embodiments, the miR-1-3p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:820. In some embodiments, the miR-1-3p target sequence comprises or consists of SEQ ID NO:820. In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four miR-143-3p target sequences. In some embodiments, the miR-143-3p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:821. In some embodiments, the miR-143-3p target sequence comprises or consists of SEQ ID NO:821.

[0077] In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four target sequences of miR-145-3p. In some embodiments, the target sequence of miR-145-3p is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:822. In some embodiments, the target sequence of miR-145-3p comprises or consists of SEQ ID NO:822. In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four target sequences of miR-145-5p. In some embodiments, the target sequence of miR-145-5p is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:823. In some embodiments, the target sequence of miR-145-5p comprises or consists of SEQ ID NO:823. In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four miR-184-3p target sequences. In some embodiments, the miR-184-3p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:824. In some embodiments, the miR-184-3p target sequence comprises or consists of SEQ ID NO:824.

[0078] In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four miR-199a-3p target sequences. In some embodiments, the miR-199a-3p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:825. In some embodiments, the miR-199a-3p target sequence comprises or consists of SEQ ID NO:825. In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four miR-199a-5p target sequences. In some embodiments, the miR-199a-5p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:826. In some embodiments, the miR-199a-5p target sequence comprises or consists of SEQ ID NO: 826. In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four miR-204-5p target sequences. In some embodiments, the miR-204-5p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 827. In some embodiments, the miR-204-5p target sequence comprises or consists of SEQ ID NO: 827.

[0079] In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four miR-208b-3p target sequences. In some embodiments, the miR-208b-3p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:828. In some embodiments, the miR-208b-3p target sequence comprises or consists of SEQ ID NO:828. In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four miR-214-3p target sequences. In some embodiments, the miR-214-3p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:829. In some embodiments, the miR-214-3p target sequence comprises or consists of SEQ ID NO: 829. In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four miR-217-5p target sequences. In some embodiments, the miR-217-5p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 830. In some embodiments, the miR-217-5p target sequence comprises or consists of SEQ ID NO: 830.

[0080] In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four miR-219a-5p target sequences. In some embodiments, the miR-219a-5p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:831. In some embodiments, the miR-219a-5p target sequence comprises or consists of SEQ ID NO:831. In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four miR-223-3p target sequences. In some embodiments, the miR-223-3p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:832. In some embodiments, the miR-223-3p target sequence comprises or consists of SEQ ID NO: 832. In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four miR-34a-5p target sequences. In some embodiments, the miR-34a-5p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 833. In some embodiments, the miR-34a-5p target sequence comprises or consists of SEQ ID NO: 833.

[0081] In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four miR-451a target sequences. In some embodiments, the miR-451a target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:834. In some embodiments, the miR-451a target sequence comprises or consists of SEQ ID NO:834. In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four miR-559-5p target sequences. In some embodiments, the miR-559-5p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:835. In some embodiments, the miR-559-5p target sequence comprises or consists of SEQ ID NO:835. In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four target sequences of miR-Let-7a-5p. In some embodiments, the miR-Let-7a-5p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:836. In some embodiments, the miR-Let-7a-5p target sequence comprises or consists of SEQ ID NO:836. In some embodiments, the miR-TS cassette described herein comprises at least one, at least two, at least three, or at least four target sequences of miR-9-5p. In some embodiments, the miR-9-5p target sequence is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:837. In some embodiments, the miR-9-5p target sequence comprises or consists of SEQ ID NO:837.

[0082] Table 10 below provides exemplary miRNA sequences that can bind to the miRNA target sequences of the oncolytic viruses described herein. Additional miRNA sequences are provided in SEQ ID NOs: 33-803. [Table 10]

[0083] In some embodiments, the miR-TS cassette comprises one or more additional polynucleotide sequences that allow the cassette to be inserted into the locus of a viral gene.For example, the miR-TS cassette may further comprise short polynucleotide sequences at the 5' and 3' ends that are complementary to the nucleic acid sequences at the desired location of the viral genome.Such sequences are referred to herein as "homology arms" and facilitate the insertion of the miR-TS cassette into a specific location of the viral genome.

[0084] In some embodiments, the miR-TS cassette of the present disclosure comprises two or more miR-TSs, each corresponding to a different miRNA, selected to protect various cell types or organs from oncolytic viruses. In some embodiments, the miR-TSs are staggered rather than tandem with each other. In some embodiments, the miR-TS cassette has a short (e.g., 4-15 nt long) spacer, resulting in a more compact cassette. In some embodiments, the miR-TS cassette does not contain (or has few) RNA secondary structures that inhibit the activity of the miR-TS. In some embodiments, the miR-TS cassette does not contain (or has few) seed sequences of miRNAs associated with carcinogenesis, malignant transformation, or metastasis (i.e., "oncomiRs"). In some embodiments, the miR-TS cassette does not contain (or has few) polyadenylation sites.

[0085] Oncolytic virus containing a miR-TS cassette In some embodiments, the recombinant oncolytic virus may comprise a miR-TS cassette integrated into the locus of an essential viral gene, where the miR-TS cassette comprises target sequences for multiple miRNAs, such that the recombinant oncolytic virus comprises target sequences for multiple miRNAs integrated into the locus of an essential viral gene. In some aspects, the miR-TS cassette may comprise target sequences for multiple miRNAs, where the target sequences for each miRNA in the plurality are targets of the same miRNA, such that the recombinant oncolytic virus comprises multiple (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) copies of the same miRNA target sequence integrated into the locus of an essential viral gene. For example, in some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising two, three, four, five, six, or more target sequences inserted into one of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39 / 40, or UL42. In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising two, three, four, or more target sequences inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39 / 40, or UL42. In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising two, three, four, five, six, or more target sequences inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9.

[0086] In some aspects, the target sequences of the multiple miRNAs include target sequences of at least two different miRNAs, target sequences of at least three different miRNAs, or target sequences of at least four different miRNAs, such that the recombinant oncolytic virus includes one or more copies of target sequences of at least two, three, or four different miRNAs integrated into an essential viral gene locus. For example, in some embodiments, the recombinant oncolytic HSV may include a miR-TS cassette including one or more target sequences of miR-122-5p, miR-34a-5p, and miR-Let-7a-5p inserted into one of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39 / 40, or UL42. In some embodiments, the recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences of miR-122-5p, miR-34a-5p, and miR-Let-7a-5p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39 / 40, or UL42. In some embodiments, the recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences of miR-122-5p, miR-34a-5p, and miR-Let-7a-5p inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9. In some embodiments, the recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences of miR-122-5p, miR-184-3p, and miR-Let-7a-5p inserted into one of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39 / 40, or UL42. In some embodiments, the recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences of miR-122-5p, miR-184-3p, and miR-Let-7a-5p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39 / 40, or UL42.In some embodiments, the recombinant oncolytic HSV may comprise a miR-TS cassette containing one or more target sequences of miR-122-5p, miR-184-3p, and miR-Let-7a-5p inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9.

[0087] In some embodiments, the recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences of miR-122-5p and miR-Let-7a-5p inserted into one of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39 / 40, or UL42. In some embodiments, the recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences of miR-122-5p and miR-Let-7a-5p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39 / 40, or UL42. In some embodiments, the recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences of miR-122-5p and miR-Let-7a-5p inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9. In some embodiments, the recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences of miR-145-5p, miR-199a-5p, and miR-599-5p inserted into one of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39 / 40, or UL42. In some embodiments, the recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences of miR-145-5p, miR-199a-5p, and miR-599-5p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39 / 40, or UL42. In some embodiments, the recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences of miR-145-5p, miR-199a-5p, and miR-599-5p inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9.

[0088] In some embodiments, the recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences of miR-124-3p, miR-1-3p, and miR-124-3p inserted into one of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39 / 40, or UL42. In some embodiments, the recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences of miR-124-3p, miR-1-3p, and miR-124-3p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39 / 40, or UL42. In some embodiments, the recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences of miR-124-3p, miR-1-3p, and miR-124-3p inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9. In some embodiments, the recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences of miR-219a-5p, miR-122-5p, and miR-128-3p inserted into one of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39 / 40, or UL42. In some embodiments, the recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences of miR-219a-5p, miR-122-5p, and miR-128-3p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39 / 40, or UL42. In some embodiments, the recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences of miR-219a-5p, miR-122-5p, and miR-128-3p inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9.

[0089] In some embodiments, the recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences of miR-137-3p, miR-208b-3p, and miR-126-3p inserted into one of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39 / 40, or UL42. In some embodiments, the recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences of miR-137-3p, miR-208b-3p, and miR-126-3p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39 / 40, or UL42. In some embodiments, the recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences of miR-137-3p, miR-208b-3p, and miR-126-3p inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9. In some embodiments, the recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences of miR-137-3p, miR-217-3p, and miR-126-3p inserted into one of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39 / 40, or UL42. In some embodiments, the recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences of miR-137-3p, miR-217-3p, and miR-126-3p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39 / 40, or UL42. In some embodiments, the recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences of miR-137-3p, miR-217-3p, and miR-126-3p inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9.

[0090] In some embodiments, the recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences of miR-128-3p, miR-204-5p, and miR-219-5p inserted into one of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39 / 40, or UL42. In some embodiments, the recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences of miR-128-3p, miR-204-5p, and miR-219-5p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39 / 40, or UL42. In some embodiments, the recombinant oncolytic HSV may comprise a miR-TS cassette containing one or more target sequences of miR-128-3p, miR-204-5p, and miR-219-5p inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9.

[0091] In some embodiments, a recombinant oncolytic virus may comprise one miR-TS cassette integrated into the 3' or 5' untranslated region (UTR) of the viral genome. In such embodiments, the miR-TS cassette may comprise one copy of a target sequence of a miRNA, such that the recombinant oncolytic virus comprises one copy of a target sequence of a miRNA integrated into the 3' or 5' UTR of the viral genome. For example, in some embodiments, a recombinant poliovirus, SVV, or coxsackievirus may comprise a miR-TS cassette comprising a target sequence of a miRNA shown in Table 10, inserted into the 3' or 5' UTR of the viral genome. In some embodiments, a recombinant oncolytic virus may comprise an miR-TS cassette integrated into the 3' or 5' UTR of the viral genome, wherein the miR-TS cassette comprises target sequences of multiple miRNAs as shown in Table 10, such that the recombinant oncolytic virus comprises target sequences of multiple miRNAs integrated into the 3' or 5' UTR of the viral genome.

[0092] In some aspects, the target sequences of the multiple miRNAs comprise target sequences of at least two different miRNAs, target sequences of at least three different miRNAs, or target sequences of at least four different miRNAs, such that the recombinant oncolytic virus comprises one or more copies of target sequences of at least two, three, or four different miRNAs integrated into the 3' or 5' UTR of the viral genome. For example, in some embodiments, a recombinant poliovirus, SVV, or coxsackievirus may comprise a miR-TS cassette comprising one or more copies of target sequences of at least two, three, or four different miRNAs selected from Table 10, inserted into the 3' or 5' UTR of the viral genome.

[0093] In some embodiments, the recombinant oncolytic virus may comprise a miR-TS cassette integrated into the locus of two or more essential viral genes. In some embodiments, the recombinant oncolytic virus is an HSV virus, and the two or more essential viral genes are selected from the group consisting of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39 / 40, or UL42. In some embodiments, the recombinant oncolytic virus is an HSV virus, and the two or more essential viral genes are selected from the group consisting of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39 / 40, or UL42. In some embodiments, the recombinant oncolytic virus is an HSV virus, and the two or more essential viral genes are selected from the group consisting of ICP4, ICP27, ICP34.5, UL8, or UL9. In some embodiments, the recombinant oncolytic virus is an HSV virus and the two or more essential viral genes are selected from the group consisting of ICP27, ICP4, ICP34.5, UL8, and UL42.

[0094] In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette comprising multiple miRNA target sequences inserted into the ICP4 locus and a second miR-TS cassette comprising multiple miRNA target sequences in the ICP27 locus. In some embodiments, the first miR-TS cassette is inserted into the ICP4 locus and comprises one, two, three, or four copies of the miR-124 target sequence. In some embodiments, the first miR-TS cassette is inserted into the ICP4 locus and comprises one, two, three, or four copies of the miR-124 target sequence, one, two, three, or four copies of the miR-1-3p target sequence, and one, two, three, or four copies of the miR-143-3p target sequence. In some embodiments, the target sequences of the multiple miRNAs in the first miR-TS cassette are arranged as follows: (a)(124-3p)-(124-3p)-(124-3p)-(124-3p), (b)(124-3p)-(124-3p)-(124-3p)-(124-3p)-(1-3p)-(143-3p)-(1-3p)-(143-3p)-(1-3p)-(143-3p)-(1-3p)-(143-3p).

[0095] In some embodiments, the second miR-TS cassette is inserted into the ICP27 locus and comprises one, two, three, or four copies of the target sequence of miR-1-3p, one, two, three, or four copies of the target sequence of miR-145-5p, one, two, three, or four copies of the target sequence of miR-199-5p, and one, two, three, or four copies of the target sequence of miR-559. In some embodiments, the second miR-TS cassette is inserted into the ICP27 locus and comprises one, two, three, or four copies of the target sequence of miR-219a-5p, one, two, three, or four copies of the target sequence of miR-122-5p, and one, two, three, or four copies of the target sequence of miR-128.

[0096] In some embodiments, the first miR-TS cassette comprises four copies of the target sequence of miR-124, and the second miR-TS cassette comprises two, three, or more copies of each of the target sequences 1-3p, 145-5p, 199a-5p, and 559. In some embodiments, the first miR-TS cassette comprises four copies of the target sequence of miR-124, and the second miR-TS cassette comprises four copies of each of the target sequences 219a-5p, 122-5p, and 128T.

[0097] In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into the ICP4 locus, the first miR-TS cassette comprising target sequences of multiple miRNAs, and (ii) a second miR-TS cassette inserted into the UL42 locus, the second miR-TS cassette comprising target sequences of multiple miRNAs. In some embodiments, the first miR-TS cassette is inserted into the ICP4 locus and comprises one, two, three, or four copies of the miR-124 target sequence. In some embodiments, the target sequences of the multiple miRNAs in the second miR-TS cassette are arranged as follows: (a)(124-3p)-(124-3p)-(124-3p)-(124-3p).

[0098] In some embodiments, the second miR-TS cassette is inserted into the UL42 locus and contains one, two, three, or four copies of the target sequence of miR-122-5p. In some embodiments, the target sequences of the multiple miRNAs in the second miR-TS cassette are arranged as follows: (a)(122-5p)-(122-5p)-(122-5p).

[0099] In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette comprising four copies of a miR-124 target sequence inserted into the ICP4 locus, and (ii) a second miR-TS cassette comprising three copies of a miR-122-5p target sequence inserted into the UL42 locus.

[0100] In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette containing target sequences of multiple miRNAs inserted into the ICP4 locus, (ii) a second miR-TS cassette containing target sequences of multiple miRNAs inserted into the ICP27 locus, and (iii) a third miR-TS cassette containing target sequences of multiple miRNAs inserted into the UL42 locus. In some embodiments, the first miR-TS cassette is inserted into the ICP4 locus and comprises one, two, three, or four copies of the target sequence of miR-124. In some embodiments, the target sequences of the multiple miRNAs in the second miR-TS cassette are arranged as follows: (a)(124-3p)-(124-3p)-(124-3p)-(124-3p).

[0101] In some embodiments, the second miR-TS cassette is inserted into the ICP27 locus and contains one, two, three, or four copies of the target sequence of miR-122. In some embodiments, the target sequences of the multiple miRNAs in the second miR-TS cassette are arranged according to one of the following: (a)(122-5p), (b)(122-5p)-(122-5p)-(122-5p)-(122-5p), (c)(122-5p)-(122-5p)-(122-5p).

[0102] In some embodiments, the third miR-TS cassette is inserted into the UL42 locus and contains one, two, three, or four copies of the target sequence of miR-125-5p. In some embodiments, the target sequences of the multiple miRNAs in the third miR-TS cassette are arranged according to one of the following: (a)(122-5p), (b)(122-5p)-(122-5p)-(122-5p)-(122-5p), (c)(122-5p)-(122-5p)-(122-5p).

[0103] In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into the ICP4 locus and comprising four copies of the miR-124-3p target sequence, (ii) a second miR-TS cassette inserted into the ICP27 locus and comprising one, two, three, or four copies of the miR-122-5p target sequence, and (iii) a third miR-TS cassette inserted into the UL42 locus and comprising four copies of the miR-125-5p target sequence. In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into the ICP4 locus and comprising four copies of the miR-124 target sequence, (ii) a second miR-TS cassette inserted into the ICP27 locus and comprising four copies of the miR-122 target sequence, and (iii) a third miR-TS cassette inserted into the UL42 locus and comprising one, two, three, or four copies of the miR-125-5p target sequence. In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into the ICP4 locus and comprising four copies of a miRNA-124 target sequence, (ii) a second miR-TS cassette inserted into the ICP27 locus and comprising four copies of a miR-122-3p target sequence, and (iii) a third miR-TS cassette inserted into the UL42 locus and comprising four copies of a miR-125-5p target sequence. In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into the ICP4 locus and comprising four copies of the miR-124-3p target sequence, (ii) a second miR-TS cassette inserted into the ICP27 locus and comprising three copies of the miR-122-3p target sequence, and (iii) a third miR-TS cassette inserted into the UL42 locus and comprising four copies of the miR-125-5p target sequence.

[0104] In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette containing target sequences of multiple miRNAs inserted into the ICP4 locus, and (ii) a second miR-TS cassette containing target sequences of multiple miRNAs inserted into the UL8 locus. In some embodiments, the first miR-TS cassette is inserted into the ICP4 locus and comprises one, two, three, or four copies of the target sequence of miR-124. In some embodiments, the target sequences of multiple miRNAs in the second miR-TS cassette are arranged as follows: (a)(124-3p)-(124-3p)-(124-3p)-(124-3p).

[0105] In some embodiments, the second miR-TS cassette is inserted into the UL8 locus and contains one, two, three, or four copies of each of the target sequences of miR-137, miR-208b-3p, and miR-126. In some embodiments, the target sequences of the multiple miRNAs in the second miR-TS cassette are arranged as follows: (a)(208b-3p)-(126-3p)-(137-3p)-(208b-3p)-(137-3p)-(126-3p)-(208b-3p)-(137-3p)-(126-3p)-(137-3p)-(126-3p)-(208b-3p).

[0106] In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into the ICP4 locus and comprising four copies of a miR-124 target sequence, and (ii) a second miR-TS cassette inserted into the UL8 locus and comprising four copies of a miR-137 target sequence, four copies of a miR-208b-3p target sequence, and four copies of a miR-126-3p target sequence.

[0107] In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette containing target sequences of multiple miRNAs inserted into the ICP4 locus, (ii) a second miR-TS cassette containing target sequences of multiple miRNAs inserted into the ICP27 locus, and (iii) a third miR-TS cassette containing target sequences of multiple miRNAs inserted into the UL8 locus. In some embodiments, the first miR-TS cassette is inserted into the ICP4 locus and comprises one, two, three, or four copies of each of the target sequences of miR-124, miR-1-3p, and miR-143-3p. In some embodiments, the target sequences of the multiple miRNAs in the first miR-TS cassette are arranged as follows: (a)(124-3p)-(124-3p)-(124-3p)-(124-3p)-(1-3p)-(143-3p)-(1-3p)-(143-3p)-(1-3p)-(143-3p)-(1-3p)-(143-3p).

[0108] In some embodiments, the second miR-TS cassette is inserted into the ICP27 locus and contains one, two, three, or four copies of each of the target sequences of miR-219a-5p, miR-122-5p, and miR-128. In some embodiments, the target sequences of the multiple miRNAs in the second miR-TS cassette are arranged as follows: (a)(219a-5p)-(122-5p)-(128-3p)-(122-5p)-(219a-5p)-(128-3p)-(122-5p)-(128-3p)-(219a-5p)-(128-3p)-(122-5p)-(219a-5p).

[0109] In some embodiments, the third miR-TS cassette is inserted into the UL8 locus and contains one, two, three, or four copies of each of the target sequences of miR-137, miR-208a, and miR-126. In some embodiments, the target sequences of the multiple miRNAs in the third miR-TS cassette are arranged as follows: (a)(208b-3p)-(126-3p)-(137-3p)-(208b-3p)-(137-3p)-(126-3p)-(208b-3p)-(137-3p)-(126-3p)-(137-3p)-(126-3p)-(208b-3p).

[0110] In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into the ICP4 locus and comprising four copies of each of the target sequences of miR-124, miR-1-3p, and miR-143-3p, (ii) a second miR-TS cassette inserted into the ICP27 locus and comprising four copies of the target sequence of miR-219a-5p, four copies of the target sequence of miR-122-5p, and four copies of the target sequence of miR-128, and (iii) a third miR-TS cassette inserted into the UL8 locus and comprising four copies of the target sequence of miR-137, four copies of the target sequence of miR-208a, and four copies of the target sequence of miR-126.

[0111] In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette containing target sequences of multiple miRNAs inserted into the ICP4 locus, (ii) a second miR-TS cassette containing target sequences of multiple miRNAs inserted into the ICP27 locus, (iii) a third miR-TS cassette containing target sequences of multiple miRNAs inserted into the UL8 locus, and (iv) a fourth miR-TS cassette containing target sequences of multiple miRNAs inserted into the ICP34.5 locus. In some embodiments, the first miR-TS cassette is inserted into the ICP4 locus and comprises one, two, three, or four copies of each of the target sequences of miR-124, miR-1-3p, and miR-143-3p. In some embodiments, the target sequences of the multiple miRNAs in the first miR-TS cassette are arranged as follows: (a)(124-3p)-(124-3p)-(124-3p)-(124-3p)-(1-3p)-(143-3p)-(1-3p)-(143-3p)-(1-3p)-(143-3p)-(1-3p)-(143-3p).

[0112] In some embodiments, the second miR-TS cassette is inserted into the ICP27 locus and contains one, two, three, or four copies of the target sequence of each of miRNA 219a-5p, miRNA 122-5p, and miRNA 128. In some embodiments, the target sequences of the multiple miRNAs in the second miR-TS cassette are arranged as follows: (a)(219a-5p)-(122-5p)-(128-3p)-(122-5p)-(219a-5p)-(128-3p)-(122-5p)-(128-3p)-(219a-5p)-(128-3p)-(122-5p)-(219a-5p).

[0113] In some embodiments, the third miR-TS cassette is inserted into the UL8 locus and contains one, two, three, or four copies of each of the target sequences of miR-137, miR-208a, and miR-126. In some embodiments, the target sequences of the multiple miRNAs in the third miR-TS cassette are arranged as follows: (a)(208b-3p)-(126-3p)-(137-3p)-(208b-3p)-(137-3p)-(126-3p)-(208b-3p)-(137-3p)-(126-3p)-(137-3p)-(126-3p)-(208b-3p).

[0114] In some embodiments, the third miR-TS cassette is inserted into the UL8 locus and contains one, two, three, or four copies of each of the target sequences of miR137, miR-217-5p, and miR-126. In some embodiments, the target sequences of the multiple miRNAs in the third miR-TS cassette are arranged as follows: (a)(137-3p)-(126-3p)-(217-5p)-(126-3p)-(217-5p)-(137-3p)-(217-5p)-(126-3p)-(137-3p)-(126-3p)-(217-5p)-(137-3p).

[0115] In some embodiments, the third miR-TS cassette is inserted into the UL8 locus and contains one, two, three, or four copies of each of the target sequences of miR-137, miR-217-5p, and miR-127. In some embodiments, the target sequences of the multiple miRNAs in the third miR-TS cassette are arranged as follows: (a)(137-3p)-(127-3p)-(217-5p)-(127-3p)-(217-5p)-(137-3p)-(217-5p)-(127-3p)-(137-3p)-(127-3p)-(217-5p)-(137-3p).

[0116] In some embodiments, the third miR-TS cassette is inserted into the UL8 locus and contains one, two, three, or four copies of each of the target sequences of miR-137, miR-217-5p, and miR-128. In some embodiments, the target sequences of the multiple miRNAs in the third miR-TS cassette are arranged as follows: (a)(137-3p)-(128-3p)-(217-5p)-(128-3p)-(217-5p)-(137-3p)-(217-5p)-(128-3p)-(137-3p)-(128-3p)-(217-5p)-(137-3p).

[0117] In some embodiments, the third miR-TS cassette is inserted into the UL8 locus and contains one, two, three, or four copies of each of the target sequences of miR-137, miR-217-5p, and miR-129. In some embodiments, the target sequences of the multiple miRNAs in the third miR-TS cassette are arranged as follows: (a)(137-3p)-(129-3p)-(217-5p)-(129-3p)-(217-5p)-(137-3p)-(217-5p)-(129-3p)-(137-3p)-(129-3p)-(219-5p)-(137-3p).

[0118] In some embodiments, the third miR-TS cassette is inserted into the UL8 locus and contains one, two, three, or four copies of each of the target sequences of miR-137, miR-217-5p, and miR-130. In some embodiments, the target sequences of the multiple miRNAs in the third miR-TS cassette are arranged as follows: (a)(137-3p)-(130-3p)-(217-5p)-(130-3p)-(217-5p)-(130-3p)-(217-5p)-(127-3p)-(137-3p)-(130-3p)-(217-5p)-(137-3p).

[0119] In some embodiments, the fourth miR-TS cassette is inserted into the ICP34.5 locus and comprises one, two, three, or four copies of each of the target sequences of miRNA 128M, miRNA 204, and miRNA 219-3p. In some embodiments, the target sequences of the multiple miRNAs in the fourth miR-TS cassette are arranged as follows: (a)(128-3p)-(219a-5p)-(204-5p)-(128-3p)-(219a-5p)-(204-5p)-(128-3p)-(219a-5p)-(204-5p)-(128-3p)-(219a-5p)-(204-5p).

[0120] In some embodiments, the recombinant oncolytic virus comprises (i) a first miR-TS cassette inserted into the ICP4 locus and comprising four copies of each of the target sequences of miR-124, miR-1-3p, and miR-14; (ii) a second miR-TS cassette inserted into the ICP27 locus and comprising four copies of each of the target sequences of miR-219a-5p, miR-122-5p, and miR-128; (iii) a second miR-TS cassette inserted into the ICP27 locus and comprising four copies of each of the target sequences of miR-219a-5p, miR-122-5p, and miR-128; ) a third miR-TS cassette inserted into the UL8 locus and containing four target sequences of each of miR-137, miR-208b-3p, and miR-126, and (iv) a fourth miR-TS cassette inserted into the ICP34.5 locus and containing four target sequences of miR-128, four copies of the target sequence of miR-204, and four copies of the target sequence of miR-219-3p. In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into the ICP4 locus and comprising four copies of each of the target sequences of miR-124, miR-1-3p, and miR-14, (ii) a second miR-TS cassette inserted into the ICP27 locus and comprising four copies of each of the target sequences of miR-219a-5p, miR-122-5p, and miR-128, and (iii) a third miR-TS cassette inserted into the UL8 locus and comprising four copies of each of the target sequences of miR-137, miR-208a, and miR-126.

[0121] In some embodiments, the recombinant oncolytic virus comprises (i) a first miR-TS cassette inserted into the ICP4 locus and comprising four copies of each of the target sequences of miR-124, miR-1-3p, and miR-14; (ii) a second miR-TS cassette inserted into the ICP27 locus and comprising four copies of each of the target sequences of miR-219a-5p, miR-122-5p, and miR-128; (iii) a second miR-TS cassette inserted into the UL8 locus and comprising four copies of each of the target sequences of miR-219a-5p, miR-122-5p, and miR-128; and (iv) a third miR-TS cassette inserted into the ICP34.5 locus and containing four of the miR-137-3p target sequences, four of the miR-217-5p target sequences, and four of the miR-126-3p target sequences; and (iv) a fourth miR-TS cassette inserted into the ICP34.5 locus and containing four of the miR-128 target sequences, four copies of the miR-204 target sequence, and four copies of the miR-219-3p target sequence.

[0122] In some embodiments, the recombinant oncolytic virus comprises (i) a first miR-TS cassette inserted into the ICP4 locus and comprising four copies of each of the target sequences of miR-124, miR-1-3p, and miR-14; (ii) a second miR-TS cassette inserted into the ICP27 locus and comprising four copies of each of the target sequences of miR-219a-5p, miR-122-5p, and miR-128; (iii) a second miR-TS cassette inserted into the UL8 locus and comprising four copies of each of the target sequences of miR-219a-5p, miR-122-5p, and miR-128; a third miR-TS cassette inserted into the ICP34.5 locus and containing four of the target sequences of miR-137-3p, four of the target sequences of miR-217-5p, and four of the target sequences of miR-127; and (iv) a fourth miR-TS cassette inserted into the ICP34.5 locus and containing four of the target sequences of miR-128, three copies of the target sequence of miR-204, and three copies of the target sequence of miR-219-5p.

[0123] In some embodiments, the recombinant oncolytic virus comprises (i) a first miR-TS cassette inserted into the ICP4 locus and comprising four copies of each of the target sequences of miR-124, miR-1-3p, and miR-14; (ii) a second miR-TS cassette inserted into the ICP27 locus and comprising four copies of each of the target sequences of miR-219a-5p, miR-122-5p, and miR-128; (iii) a second miR-TS cassette inserted into the UL8 locus and comprising four copies of each of the target sequences of miR-219a-5p, miR-122-5p, and miR-128; a third miR-TS cassette inserted into the ICP34.5 locus and containing four of the miR-137-3p target sequences, four of the miR-217-5p target sequences, and four of the miR-128 target sequences; and (iv) a fourth miR-TS cassette inserted into the ICP34.5 locus and containing four of the miR-128 target sequences, three copies of the miR-204 target sequence, and three copies of the miR-219-5p target sequence. In some embodiments, the recombinant oncolytic virus comprises (i) a first miR-TS cassette inserted into the ICP4 locus and comprising four copies of each of the target sequences of miR-124, miR-1-3p, and miR-14; (ii) a second miR-TS cassette inserted into the ICP27 locus and comprising four copies of each of the target sequences of miR-219a-5p, miR-122-5p, and miR-128; (iii) a second miR-TS cassette inserted into the UL8 locus and comprising four copies of each of the target sequences of miR-219a-5p, miR-122-5p, and miR-128; a third miR-TS cassette inserted into the ICP34.5 locus and containing four of the miR-137-3p target sequences, four of the miR-217-5p target sequences, and four of the miR-129 target sequences; and (iv) a fourth miR-TS cassette inserted into the ICP34.5 locus and containing four of the miR-128 target sequences, three copies of the miR-204 target sequence, and three copies of the miR-219-5p target sequence.In some embodiments, the recombinant oncolytic virus comprises (i) a first miR-TS cassette inserted into the ICP4 locus and comprising four copies of each of the target sequences of miR-124, miR-1-3p, and miR-14; (ii) a second miR-TS cassette inserted into the ICP27 locus and comprising four copies of each of the target sequences of miR-219a-5p, miR-122-5p, and miR-128; (iii) a second miR-TS cassette inserted into the UL8 locus and comprising four copies of each of the target sequences of miR-219a-5p, miR-122-5p, and miR-128; a third miR-TS cassette inserted into the ICP34.5 locus and containing four of the target sequences of miR-137-3p, four of the target sequences of miR-217-5p, and four of the target sequences of miR-130; and (iv) a fourth miR-TS cassette inserted into the ICP34.5 locus and containing four of the target sequences of miR-128, three copies of the target sequence of miR-204, and three copies of the target sequence of miR-219-5p.

[0124] In some embodiments, the viral vectors described herein comprise a copy of the miR-125a target sequence integrated into an essential viral gene. In some embodiments, the viral vectors described herein comprise a copy of the miR-125a target sequence integrated into the UL42 locus. In some embodiments, the viral vectors described herein comprise a copy of the miR-122 target sequence integrated into an essential viral gene. In some embodiments, the viral vectors described herein comprise a copy of the miR-122 target sequence integrated into the ICP27 locus (e.g., ONCR-036).

[0125] In further embodiments, the viral vectors described herein comprise three copies of the miR-125a target sequence integrated into a viral gene required for viral replication. In further embodiments, the viral vectors described herein may comprise three copies of the miR-125a target sequence integrated into the UL42 locus. In some embodiments, four copies of the miR target sequence are integrated into the 3'UTR of an essential viral gene. In further embodiments, the viral vectors described herein may comprise four copies of the miR-125a target sequence integrated into an essential viral gene. In further embodiments, the viral vectors described herein may comprise four copies of the miR-125a target sequence integrated into the UL42 locus. In some embodiments, the viral vectors described herein may comprise four copies of the miR-122 target sequence integrated into an essential viral gene. In further embodiments, the viral vectors described herein may contain four copies of the miR-122 target sequence integrated into the ICP27 locus (eg, ONCR-063).

[0126] In some embodiments, one copy of the target sequence of miR-122 is integrated into the 3'UTR of a first essential viral gene, and one copy of the target sequence of miR-125a is integrated into the 3'UTR of a second essential viral gene. In some embodiments, one copy of the target sequence of miR-122 is integrated into the 3'UTR of the ICP27 locus, and one copy of the target sequence of miR-125a is integrated into the 3'UTR of the UL42 locus (e.g., ONCR-094).

[0127] In some embodiments, one copy of the target sequence of miR-122 is integrated into the 3'UTR of a first essential viral gene, and three copies of the target sequence of miR-125a are integrated into the 3'UTR of a second essential viral gene. In some embodiments, one copy of the target sequence of miR-122 is integrated into the 3'UTR of the ICP27 locus, and three copies of the target sequence of miR-125a are integrated into the 3'UTR of the UL42 locus (e.g., ONCR-095).

[0128] In some embodiments, four copies of the target sequence of the first miR are integrated into the 3'UTR of the first essential viral gene, and one copy of the target sequence of the second miR is integrated into the 3'UTR of the second essential viral gene.In some embodiments, four copies of the target sequence of miR-122 are integrated into the 3'UTR of the first essential viral gene, and one copy of the target sequence of miR-125a is integrated into the 3'UTR of the second essential viral gene.In some embodiments, four copies of the target sequence of miR-122 are integrated into the 3'UTR of the ICP27 locus, and one copy of the target sequence of miR-125a is integrated into the 3'UTR of the UL42 locus (e.g., ONCR-093).

[0129] In some embodiments, four copies of the target sequence of the first miR are integrated into the 3'UTR of the first essential viral gene, and four copies of the target sequence of the second miR are integrated into the 3'UTR of the second essential viral gene.In some embodiments, four copies of the target sequence of miR-122 are integrated into the 3'UTR of the first essential viral gene, and four copies of the target sequence of miR-125a are integrated into the 3'UTR of the second essential viral gene.In some embodiments, four copies of the target sequence of miR-122 are integrated into the 3'UTR of the ICP27 locus, and four copies of the target sequence of miR-125a are integrated into the 3'UTR of the UL42 locus (e.g., ONCR-096).

[0130] In some embodiments, the miR-attenuated oncolytic viruses described herein reduce viral replication in cells expressing miRs capable of binding to one or more of the target sequences of the incorporated miR. "Viral replication" refers to the total number of cycles of viral replication occurring in a particular cell or cell population within a period of time. In some embodiments, viral replication can be measured directly by assessing the total viral titer over the period of time, or by assessing the copy number of the viral genome (e.g., by sequencing). In some embodiments, the viral vector can further comprise a detectable label, such as a fluorescent reporter. In such embodiments, viral replication can be evaluated by measuring the fluorescence intensity of the reporter, or the number of cells expressing the reporter. In some embodiments, viral replication can be measured indirectly by assessing the number of viable cells over the period of time. For example, the level of viral replication is expected to be inversely correlated with the number of viable cells over time.

[0131] As used herein, "reduced viral replication" refers to a lower level of viral replication in a first cell or a first cell population compared to a second cell or a second cell population. In some embodiments, the level of viral replication in the first cell or a first cell population is at least 5% lower compared to the level of viral replication in the second cell or a cell population. In some embodiments, the level of viral replication in the first cell or a first cell population is at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90% or more lower compared to the level of viral replication in the second cell or a cell population. In some embodiments, the viral replication in the first cell or a first cell population is completely suppressed compared to the viral replication in the second cell or a cell population.

[0132] In some embodiments, the reduction in viral replication in the first cell or first cell population is correlated with the expression of a miR that can bind to the target sequence of one or more miRs integrated into one or more viral genes required for replication. In some embodiments, the expression of a miR that corresponds to the target sequence of the integrated miR thus inhibits or reduces the expression of replication genes, thereby inhibiting or reducing viral replication. In some embodiments, the second cell or second cell population does not express or has a reduced expression level of tmiR. In some embodiments, the lack or reduction of expression of a miR that corresponds to the target sequence of the integrated miR (e.g., in cancer cells) allows viral replication to proceed. In some embodiments, the expression level of a miR in the second cell or cell population is at least 5% lower than the expression level of a miR in the first cell or population. In some embodiments, the expression level of the miR in the second cell or cell population is at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90% or more lower than the expression level of the miR in the first cell or population. In some embodiments, the second cell does not express the miR. In certain embodiments, the first cell is a non-cancerous cell and the second cell is a cancerous cell.

[0133] In some embodiments, the replication-restricted viral vector (e.g., miR-attenuated viral vector) comprises at least one target sequence of let-7 and is used to treat lung cancer. In some embodiments, the replication-restricted viral vector comprises at least one target sequence of miR-15a and / or at least one target sequence of miR-16A and is used to treat B-cell chronic lymphocytic leukemia. In some embodiments, the replication-restricted viral vector comprises at least one target sequence of miR-125b, at least one miR-145, at least one miR-21, and / or at least one miR-155 and is used to treat breast cancer. In other embodiments, the replication-restricted viral vector comprises at least one target sequence of miR-143 and / or at least one miR-145 and is used to treat colorectal cancer. In certain embodiments, the replication-restricted viral vector contains at least one miR-181a, at least one miR-181b, and / or at least one miR-181c target sequence and is used to treat glioblastoma. In some embodiments, the replication-restricted viral vector contains at least one miR-199a * , at least one miR-195, at least one miR-199a, at least one miR-200a, and / or at least one miR-125a target sequence, and are used to treat liver cancer (e.g., hepatocellular carcinoma).

[0134] In certain embodiments, the replication-restricted viral vector comprises at least one target sequence of miR-451a, at least one target sequence of miR-143-3p, at least one target sequence of miR-559, and at least one target sequence of miR-124, and is used to treat pancreatic cancer, lung cancer, and / or colon cancer. In such embodiments, the target sequences of miR-451a, miR-143-3p, miR-559, and miR-124 are integrated into two or more genes required for viral replication (e.g., ICP4 and ICP27). In further specific embodiments, the replication-restricted viral vector comprises at least one target sequence of miR-451a, at least one target sequence of miR-145-5p, at least one target sequence of miR-559, and at least one target sequence of miR-124, and is used to treat any cancer type described herein. In this embodiment, the target sequence of miR-451a, miR-145-5p, miR-559 and miR-124 is integrated into two or more genes (e.g., ICP4 and ICP27) that are required for viral replication. In a further specific embodiment, the replication-restricted viral vector comprises at least one target sequence of miR-205p, at least one target sequence of miR-141-5p, at least one target sequence of miR-31-5p and at least one target sequence of miR-124, and is used for treating schwannoma. In this embodiment, the target sequence of miR-205p, miR-141-5p, miR-31-5p and miR-124 is integrated into two or more genes (e.g., ICP4 and ICP27) that are required for viral replication.

[0135] In some embodiments, the recombinant oncolytic virus is capable of expressing any of the following: miR-136-3p, miR-432-5p, miR-1-3p, miR-127-3p, miR-379-5p, miR-493-5p, miR-223-5p, miR-223-5p, miR-136-5p, miR-451a, miR-487b-3p, miR-370-3p, miR-410-3p, miR-431-3 p, miR-4485-3p, miR-4485-5p, miR-127-5p, miR-409-3p, miR-338-3p, miR-559, miR-411-5p, miR-133a-5 p, miR-143-3p, miR-376b-3p, miR-758-3p, miR-1, miR-101, miR-1180, miR-1236, miR-124-3p, miR-125b, m iR-126, miR-1280, miR-133a, miR-133b, miR-141, miR-143, miR-144, miR-145, miR-155, miR-16, miR-18a , miR-192, miR-195, miR-200a, miR-200b, miR-200c, miR-203, miR-205, miR-214, miR-218, miR-23b, miR- The oncolytic virus comprises multiple copies of target sequences of one or more of miRNAs, miR-26a, miR-29c, miR-320c, miR-34a, miR-370, miR-409-3p, miR-429, miR-451, miR-490-5p, miR-493, miR-576-3p, and / or miR-99a, inserted into the 5'UTR or 3'UTR of one or more viral genes required for viral replication. This oncolytic virus can be used in methods and compositions for treating bladder cancer.

[0136] In some embodiments, the recombinant oncolytic virus is miR-1251-5p, miR-219a-5p, miR-219a-2-3p, miR-124-3p, miR-448, miR-138-2-3p, miR-490-5p, miR-129-1-3p, miR-1264, miR-3943, miR-490-3p, miR-383-5p, miR-133b, miR-129-2-3p, miR-128-2-5p, miR-133a-3p, miR-129-5p, miR-1-3p, miR-885-3p, miR-124-5p, miR-759, miR-7158-3p, miR-770-5p, miR-135a-5p, miR-885-5p, let-7g-5p, miR-100, miR-101, miR-106a, miR-124, miR-124a, miR-125a, miR-125a-5p, miR-125b, miR-127-3p, miR-128, miR-129, miR-136, miR-137, miR-139-5p, miR-142-3p, miR-143, miR-145, miR-146b-5p, miR-149, miR-152, miR-153, miR-195, miR-21, miR-212-3p, miR-219-5p, miR-222, miR-29b, miR-31, miR-3189-3p, miR-320, miR-320a, miR-326, miR-330, miR-331-3p, miR-340, miR-342, miR-34a, miR-376a, miR-449a, miR-483-5p, miR-503, miR-577, miR-663, miR-7, miR-7-5p, miR-873, let-7a, let-7f, miR-107, miR-122, miR-124-5p, miR-139, miR-146a, miR-146b, miR-15b, miR-16, miR-181a, miR-181a-1, miR-181a-2, miR-181b, miR-181b-1, miR-181b-2, miR-181c, miR-181d, miR-184, miR-185, miR-199a-3p, miR-200a, miR-200b, miR-203, miR-204, miR-205, miR-218, miR-23b, miR-26b, miR-27a, miR-29c, miR-328,The oncolytic virus comprises multiple copies of one or more miRNA target sequences, including miR-34c-3p, miR-34c-5p, miR-375, miR-383, miR-451, miR-452, miR-495, miR-584, miR-622, miR-656, miR-98, miR-124-3p, miR-181b-5p, miR-200b, and / or miR-3189-3p, inserted into the 5'UTR or 3'UTR of one or more viral genes required for viral replication. The oncolytic virus can be used in methods and compositions for treating brain cancer. In certain embodiments, the brain cancer is astrocytoma, glioblastoma, or glioma.

[0137] In some embodiments, the recombinant oncolytic virus is miR-10b-5p, miR-126-3p, miR-145-3p, miR-451a, miR-199b-5p, miR-5683, miR-3195, miR-3182, miR-1271-5p, miR-204-5p, miR-409-5p, miR-136-5p, miR-514a-5p, miR-559, miR-483-3p, miR-1-3p, miR-6080, miR-144-3p, miR-10b-3p, miR-6130, miR-6089, miR-203b-5p, miR-4266, miR-4327, miR-5694, miR-193b, let-7a, let-7a-1, let-7a-2, let-7a-3, let-7b, let-7c, let-7d, let-7e, let-7f-1, let-7f-2, let-7g, let-7i, miR-100, miR-107, miR-10a, miR-10b, miR-122, miR-124, miR-1258, miR-125a-5p, miR-125b, miR-126, miR-127, miR-129, miR-130a, miR-132, miR-133a, miR-143, miR-145, miR-146a, miR-146b, miR-147, miR-148a, miR-149, miR-152, miR-153, miR-15a, miR-16, miR-17-5p, miR-181a, miR-1826, miR-183, miR-185, miR-191, miR-193a-3p, miR-195, miR-199b-5p, miR-19a-3p, miR-200a, miR-200b, miR-200c, miR-205, miR-206, miR-211, miR-216b, miR-218, miR-22, miR-26a, miR-26b, miR-300, miR-30a, miR-31, miR-335, miR-339-5p, miR-33b, miR-34a, miR-34b, miR-34c, miR-374a, miR-379, miR-381, miR-383, miR-425, miR-429, miR-450b-3p, miR-494, miR-495, miR-497, miR-502-5p, miR-517a, miR-574-3p, miR-638, miR-7, miR-720,The oncolytic virus contains multiple copies of target sequences of one or more miRNAs, miR-873, miR-874, miR-92a, miR-98, miR-99a, mmu-miR-290-3p, and / or mmu-miR-290-5p, inserted into the 5'UTR or 3'UTR of one or more viral genes required for viral replication. This oncolytic virus can be used in methods and compositions for treating breast cancer.

[0138] In some embodiments, the recombinant oncolytic virus comprises multiple copies of target sequences of one or more miRNAs, miR-143, miR-145, miR-17-5p, miR-203, miR-214, miR-218, miR-335, miR-342-3p, miR-372, miR-424, miR-491-5p, miR-497, miR-7, miR-99a, miR-99b, miR-100, miR-101, miR-15a, miR-16, miR-34a, miR-886-5p, miR-106a, miR-124, miR-148a, miR-29a, and / or miR-375, inserted into the 5'UTR or 3'UTR of one or more viral genes required for viral replication. This oncolytic virus can be used in methods and compositions for treating cervical cancer.

[0139] In some embodiments, the recombinant oncolytic virus is miR-133a-5p, miR-490-5p, miR-124-3p, miR-137, miR-655-3p, miR-376c-3p, miR-369-5p, miR-490-3p, miR-432-5p, miR-487b-3p, miR-342-3p, miR-223-3p, miR-136-3p, miR-136-3p, miR-143-5p, miR-1-3p, miR-214-3p, miR-143-3p, miR-199a-3p, miR-199b-3p, miR-451a, miR-127-3p, miR-133a-3p, miR-145-5p, miR-145-3p, miR-199a-5p, let-7a-1, let-7a-2, let-7a-3, let-7b, let-7c, let-7d, let-7e, let-7f-1, let-7f-2, let-7g, let-7i, miR-100, miR-101, miR-126, miR-142-3p, miR-143, miR-145, miR-192, miR-200c, miR-21, miR-214, miR-215, miR-22, miR-25, miR-302a, miR-320, miR-320a, miR-34a, miR-34c, miR-365, miR-373, miR-424, miR-429, miR-455, miR-484, miR-502, miR-503, miR-93, miR-98, miR-186, miR-30a-5p, miR-627, let-7a, miR-1, miR-124, miR-125a, miR-129, miR-1295b-3p, miR-1307, miR-130b, miR-132, miR-133a, miR-133b, miR-137, miR-138, miR-139, miR-139-5p, miR-140-5p, miR-148a, miR-148b, miR-149, miR-150-5p, miR-154, miR-15a, miR-15b, miR-16, miR-18a, miR-191, miR-193a-5p, miR-194, miR-195, miR-196a, miR-198, miR-199a-5p, miR-203, miR-204-5p, miR-206, miR-212, miR-218, miR-224, miR-24-3p,miR-26b, miR-27a, miR-28-3p, miR-28-5p, miR-29b, miR-30a-3p, miR-30b, miR-328, miR-338-3p, miR-342, miR- 345, miR-34a-5p, miR-361-5p, miR-375, miR-378, miR-378a-3p, miR-378a-5p, miR-409-3p, miR-422a, miR-4487, The oncolytic virus contains multiple copies of one or more miRNA target sequences, miR-483, miR-497, miR-498, miR-518a-3p, miR-551a, miR-574-5p, miR-625, miR-638, miR-7, miR-96-5p, miR-202-3p, miR-30a, and / or miR-451, inserted into the 5'UTR or 3'UTR of one or more viral genes required for viral replication. This oncolytic virus can be used in methods and compositions for treating colon or colorectal cancer.

[0140] In some embodiments, the recombinant oncolytic virus comprises multiple copies of target sequences of one or more miRNAs, miR-101, miR-130a, miR-130b, miR-134, miR-143, miR-145, miR-152, miR-205, miR-223, miR-301a, miR-301b, miR-30c, miR-34a, miR-34c, miR-424, miR-449a, miR-543, and / or miR-34b, inserted into the 5'UTR or 3'UTR of one or more viral genes required for viral replication. This oncolytic virus can be used in methods and compositions for treating endometrial cancer.

[0141] In some embodiments, the recombinant oncolytic virus is selected from the group consisting of miR-125b, miR-138, miR-15a, miR-15b, miR-16, miR-16-1, miR-16-1-3p, miR-16-2, miR-181a, miR-181b, miR-195, miR-223, miR-29b, miR-34b, miR-34c, miR-424, miR-10a, miR-146a, miR-150, miR-151, miR-155, miR-2278, miR-26a, miR-30e, miR-31, miR-326, miR-564, miR-27 The oncolytic virus comprises multiple copies of target sequences of one or more miRNAs, including miR-1, miR-2, miR-3, miR-4, miR-5, miR-6, miR-7, miR-8, miR-9, miR-10, miR-11, miR-12, miR-13, miR-14, miR-15, miR-16, miR-17, miR-20, miR-29, miR-30, miR-720, miR-107, miR-342, miR-34, miR-202, miR-142-5p, miR-29, miR-145, miR-193b, miR-199, miR-214, miR-22, miR-137, and / or miR-197, inserted into the 5'UTR or 3'UTR of one or more viral genes required for viral replication. The oncolytic virus can be used in methods and compositions for treating hematological cancer. In some embodiments, the hematological cancer is leukemia, lymphoma, or myeloma.

[0142] In some embodiments, the recombinant oncolytic virus is capable of inhibiting or inhibiting any of the following: miR-1, miR-145, miR-1826, miR-199a, miR-199a-3p, miR-203, miR-205, miR-497, miR-508-3p, miR-509-3p, let-7a, let-7d, miR-106a *, miR-126, miR-1285, miR-129-3p, miR-1291, miR-133a, miR-135a, miR-138, miR-141, miR-143, m iR-182-5p, miR-200a, miR-218, miR-28-5p, miR-30a, miR-30c, miR-30d, miR-34a, miR-378, miR- The oncolytic virus contains multiple copies of target sequences of one or more of the following miRNAs inserted into the 5'UTR or 3'UTR of one or more viral genes required for viral replication: miR-429, miR-509-5p, miR-646, miR-133b, let-7b, let-7c, miR-200c, miR-204, miR-335, miR-377, and / or miR-506. This oncolytic virus can be used in methods and compositions for treating kidney cancer.

[0143] Let- 7a-1、let-7a-2、let-7a-3、let-7b、l et-7c、let-7d、let-7e、let-7f、let-7f-1、let-7f-2、let-7g、let-7i、miR -1, miR-100, miR-101, miR-105, miR-122, miR-122a, miR-1236, miR-124, miR-125b, miR-126, miR-127, miR-1271, miR-128-3p, miR-129-5p, and miR-130 miR-130b, miR-133a, miR-134, miR-137, miR-138, miR-139, miR-139-5p, miR-140-5p, miR-141, miR-142-3p, miR-143, miR-144, miR-145, and miR-146 a, miR-148a, miR-148b, miR-150-5p, miR-15b, miR-16, miR-181a-5p, miR-185, miR-188-5p, miR-193b, miR-195, miR-195-5p, miR-197, miR-198, miR -199a, miR-199a-5p, miR-199b, miR-199b-5p, miR-200a, miR-200b, miR-200c, miR-202, miR-203, miR-204-3p, miR-205, miR-206, miR-20a, and miR-21 miR-21-3p, miR-211, miR-212, miR-214, miR-217, miR-218, miR-219-5p, miR-22, miR-223, miR-26a, miR-26b, miR-29a, miR-29b-1, miR-29b-2, miR- 29c, miR-302b, miR-302c, miR-30a, miR-30a-3p, miR-335, miR-338-3p, miR-33a, miR-34a, miR-34b, miR-365, miR-370, miR-372, miR-375, and miR-376a miR-377, miR-422a, miR-424, miR-424-5p, miR-433, miR-4458, miR-448, miR-450a, miR-451, miR-485-5p, miR-486-5p, miR-497, miR-503, miR-506The oncolytic virus comprises multiple copies of one or more miRNA target sequences, including miR-519d, miR-520a, miR-520b, miR-520c-3p, miR-582-5p, miR-590-5p, miR-610, miR-612, miR-625, miR-637, miR-675, miR-7, miR-877, miR-940, miR-941, miR-98, miR-99a, miR-132, and / or miR-31, inserted into the 5'UTR or 3'UTR of one or more viral genes required for viral replication. The oncolytic virus can be used in methods and compositions for treating liver cancer. In some embodiments, the liver cancer is hepatocellular carcinoma.

[0144] In some embodiments, the recombinant oncolytic virus is miR-143-3p, miR-126-3p, miR-126-5p, miR-1266-3p, miR-6130, miR-6080, miR-511-5p, miR-143-5p, miR-223-5p, miR-199b-5p, miR-199a-3p, miR-199b-3p, miR-451a, miR-142-5p, miR-144, miR-150-5p, miR-142-3p, miR-214-3p, miR-214-5p, miR-199a-5p, miR-145-3p, miR-145-5p, miR-1297, miR-141, miR-145, miR-16, miR-200a, miR-200b, miR-200c, miR-29b, miR-381, miR-409-3p, miR-429, miR-451, miR-511, miR-99a, let-7a-1, let-7a-2, let-7a-3, let-7b, let-7c, let-7d, let-7e, let-7f-1, let-7f-2, let-7g, let-7i, miR-1, miR-101, miR-133b, miR-138, miR-142-5p, miR-144, miR-1469, miR-146a, miR-153, miR-15a, miR-15b, miR-16-1, miR-16-2, miR-182, miR-192, miR-193a-3p, miR-194, miR-195, miR-198, miR-203, miR-217, miR-218, miR-22, miR-223, miR-26a, miR-26b, miR-29c, miR-33a, miR-34a, miR-34b, miR-34c, miR-365, miR-449a, miR-449b, miR-486-5p, miR-545, miR-610, miR-614, miR-630, miR-660, miR-7515, miR-9500, miR-98, miR-99b, miR-133a, let-7a, miR-100, miR-106a, miR-107, miR-124, miR-125a-3p, miR-125a-5p, miR-126, miR-126 *, miR-129, miR-137, miR-140, miR-143, miR-146b, miR-148a, miR-148b, miR-149, miR-152, miR-154, miR-155, miR-17-5p, miR-181a-1, miR -181a-2, miR-181b, miR-181b-1, miR-181b-2, miR-181c, miR-181d, miR-184, miR-186, miR-193b, miR-199a, miR-204, miR-212, miR-221, m iR-224, miR-27a, miR-27b, miR-29a, miR-30a, miR-30b, miR-30c, miR-30d, miR-30d-5p, miR-30e-5p, miR-32, miR-335, miR-338-3p, miR-3 40, miR-342-3p, miR-361-3p, miR-373, miR-375, miR-4500, miR-4782-3p, miR-497, miR-503, miR-512-3p, miR-520a-3p, miR-526b, miR-625 * and / or multiple copies of one or more miRNA target sequences of miR-96 inserted into the 5'UTR or 3'UTR of one or more viral genes required for viral replication. This oncolytic virus can be used in methods and compositions for treating lung cancer.

[0145] In some embodiments, the recombinant oncolytic virus is capable of expressing let-7b, miR-101, miR-125b, miR-1280, miR-143, miR-146a, miR-146b, miR-155, miR-17, miR-184, miR-185, miR-18b, miR-193b, miR-200c, miR-203, miR-204, miR-205, miR-206, miR-207, miR-209, miR-300, miR-301, miR-302, miR-303, miR-304, miR-305, miR-306, miR-307, miR-308, miR-309, miR-409, miR-410, miR-411, miR-412, miR-413, miR-414, miR-415, miR-416, miR-417, miR-418, miR-419, miR-420, miR-421, miR-422, miR-423, miR-424, miR-425, miR-426, miR-427, miR-428, miR-429, miR-430, miR-431, miR-432, miR-433, miR-434, miR-435, miR-436, miR-437, miR-438, miR-439, miR-440, miR-441, miR-442, miR-443, miR-444, miR-445, miR-446, miR-447, miR-448, miR- The oncolytic virus comprises multiple copies of target sequences of one or more miRNAs, miR-0a, miR-211, miR-218, miR-26a, miR-31, miR-33a, miR-34a, miR-34c, miR-376a, miR-376c, miR-573, miR-7-5p, miR-9, and / or miR-98, inserted into the 5'UTR or 3'UTR of one or more viral genes required for viral replication. This oncolytic virus can be used in methods and compositions for treating melanoma.

[0146] In some embodiments, the recombinant oncolytic virus is capable of expressing let-7d, miR-218, miR-34a, miR-375, miR-494, miR-100, miR-124, miR-1250, miR-125b, miR-126, miR-1271, miR-136, miR-138, miR-145, miR-147, miR-148a, miR-181a, miR-206, miR-220a, miR-26a, miR-26b, miR-29a, The oncolytic virus comprises multiple copies of target sequences of one or more miRNAs, miR-32, miR-323-5p, miR-329, miR-338, miR-370, miR-410, miR-429, miR-433, miR-499a-5p, miR-503, miR-506, miR-632, miR-646, miR-668, miR-877, and / or miR-9, inserted into the 5'UTR or 3'UTR of one or more viral genes required for viral replication. This oncolytic virus can be used in methods and compositions for treating oral cancer.

[0147] In some embodiments, the recombinant oncolytic virus is capable of expressing let-7i, miR-100, miR-124, miR-125b, miR-129-5p, miR-130b, miR-133a, miR-137, miR-138, miR-141, miR-145, miR-148a, miR-152, miR-153, miR-155, miR-199a, miR-200a, miR-200b, miR-200c, miR-212, miR-335, miR-34a, miR-34b, miR-34c, miR-34d, miR-34e, miR-34f, miR-34g, miR-34h, miR-34i, miR-34j ... The oncolytic virus comprises multiple copies of target sequences of one or more of the following miRNAs inserted into the 5'UTR or 3'UTR of one or more viral genes required for viral replication: miR-4c, miR-409-3p, miR-411, miR-429, miR-432, miR-449a, miR-494, miR-497, miR-498, miR-519d, miR-655, miR-9, miR-98, miR-101, miR-532-5p, miR-124a, miR-192, miR-193a, and / or miR-7. The oncolytic virus may be used in methods and compositions for treating ovarian cancer.

[0148] In some embodiments, the recombinant oncolytic virus is capable of expressing any of the following: miR-216a-5p, miR-802, miR-217, miR-145-3p, miR-143-3p, miR-451a, miR-375, miR-214-3p, miR-216b-3p, miR-432-5p, miR-216a-3p, miR-199b-5p, miR-199a-5p, miR-136-3p, miR-216b-5p, miR-136-5p, miR-145-5p, miR-127-3p, miR-199a-3p, miR-199b-3p, miR-559, miR-129-2-3p, miR-4507, miR-1-3p, miR-148a-3p, miR-101, miR-1181, mi R-124, miR-1247, miR-133a, miR-141, miR-145, miR-146a, miR-148a, miR-148b, miR-150*, miR-150-5p, miR-152, miR-15a, mi R-198, miR-203, miR-214, miR-216a, miR-29c, miR-335, miR-34a, miR-34b, miR-34c, miR-373, miR-375, miR-410, miR-497, mi R-615-5p, miR-630, miR-96, miR-132, let-7a, let-7a-1, let-7a-2, let-7a-3, let-7b, let-7c, let-7d, let-7e, let-7f-1, le The oncolytic virus comprises multiple copies of target sequences of one or more miRNAs, t-7f-2, let-7g, let-7i, miR-126, miR-135a, miR-143, miR-144, miR-150, miR-16, miR-200a, miR-200b, miR-200c, miR-217, miR-218, miR-337, miR-494, and / or miR-98, inserted into the 5'UTR or 3'UTR of one or more viral genes required for viral replication.The oncolytic virus can be used in methods and compositions for treating pancreatic cancer.

[0149] In some embodiments, the recombinant oncolytic virus is capable of expressing any one of the following: let-7a-3p, let-7c, miR-100, miR-101, miR-105, miR-124, miR-128, miR-1296, miR-130b, miR-133a-1, miR-133a-2, miR-133b, miR-135a, miR-143, miR-145, miR-146a, miR-154, miR-15a, miR-187, miR-188-5p, miR-199b, miR-200b, miR-203, miR-205, miR-212, miR-218, miR-221, miR-224, miR-23a, miR-23b, miR-23c, miR-23d, miR-23e, miR-23f ... 5, miR-26a, miR-26b, miR-29b, miR-302a, miR-30a, miR-30b, miR-30c-1, miR-30c-2, miR-30d, miR-30e, miR-31, miR-330, miR-331-3p, miR-34a, miR-34b, miR-34c, miR-374b, miR-449a, miR-4723-5p, miR-497, miR-628-5p, miR-642a-5p, miR-765, and / or miR-940, inserted into the 5'UTR or 3'UTR of one or more viral genes required for viral replication. This oncolytic virus can be used in methods and compositions for treating prostate cancer.

[0150] In some embodiments, the recombinant oncolytic virus comprises multiple copies of target sequences of one or more miRNAs, miR-101, miR-183, miR-204, miR-34a, miR-365b-3p, miR-486-3p, and / or miR-532-5p, inserted into the 5'UTR or 3'UTR of one or more viral genes required for viral replication. This oncolytic virus can be used in methods and compositions for treating retinoblastoma.

[0151] In some embodiments, the oncolytic virus described herein is a herpes simplex virus and one or more viral genes necessary for viral replication are selected from the group consisting of UL1, UL5, UL6, UL7, UL8, UL9, UL11, UL12, UL14, UL15, UL17, UL18, UL19, UL20, UL22, UL25, UL26, UL26.5, UL27, UL28, UL29, UL30, UL31, UL32, UL33, UL34, UL35, UL36, UL37, UL38, UL39, UL40, UL42, UL48, UL49, UL52, UL53, UL54, ICP0, ICP4, ICP22, ICP27, ICP47, gamma-34.5, US3, US4, US5, US6, US7, US8, US9, US10, US11, and US12.

[0152] Payload molecules In some embodiments, the oncolytic viruses described herein include a nucleic acid sequence encoding a payload molecule. As used herein, "payload molecule" refers to a molecule that can further enhance the therapeutic effect of the virus. Payload molecules suitable for use in the present disclosure include antigen-binding molecules, such as antibodies or antigen-binding fragments thereof, cytokines, chemokines, soluble receptors, cell surface receptor ligands, bipartite peptides, enzymes, and nucleic acids (e.g., shRNA, siRNA, antisense RNA, antagomirs, ribozymes, apatamers, decoy oligonucleotides, or antagomirs). The nature of the payload molecule depends on the type of disease and the desired therapeutic outcome. In some embodiments, the target sequence of one or more miRNAs is incorporated into the 3' or 5' UTR of the polynucleotide sequence encoding the payload molecule. In such embodiments, translation and subsequent expression of the payload is eliminated or substantially reduced in cells expressing the corresponding miRNA. In some embodiments, the target sequence of one or more miRNAs is inserted into the 3' and / or 5' UTR of the polynucleotide sequence encoding a therapeutic polypeptide.

[0153] In some embodiments, the recombinant oncolytic viruses described herein comprise at least one polynucleotide encoding a payload molecule that reduces the expression or inhibits the function of an endogenous miRNA, gene, or tissue inhibitor of metalloproteinase (TIMP). Such recombinant oncolytic viruses are referred to herein as "genome editing" or "microenvironment remodeling" viruses or vectors. The encoded protein or oligonucleotide may reduce the expression or inhibit the function of a miRNA, gene, or TIMP in a number of ways, including targeting the protein (e.g., TIMP) for degradation (e.g., by ubiquitination and targeting for proteosomal or lysosomal degradation), blocking interaction with a cognate receptor (e.g., blocking an antibody or antigen-binding fragment thereof or a peptide inhibitor), degrading a messenger RNA transcript (e.g., a small interfering RNA or a small hairpin RNA), and / or altering the genomic DNA sequence that encodes the particular miRNA, gene, or protein (e.g., by an endonuclease).

[0154] In certain embodiments, the protein or oligonucleotide reduces the expression of a miR or gene (e.g., an oncogenic miR or an oncogene) involved in carcinogenesis or metastasis. In some embodiments, the recombinant oncolytic virus comprises at least one polynucleotide encoding a payload molecule that reduces the expression or function of a miRNA that is an oncogenic miRNA (e.g., one or more of the miRNAs listed in Table 4). In some embodiments, the recombinant oncolytic virus comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more polynucleotides encoding a protein or oligonucleotide that reduces the expression or function of an oncogenic miRNA. In some embodiments, the recombinant oncolytic virus comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more polynucleotides encoding multiple proteins or oligonucleotides that reduce the expression or function of multiple oncogenic miRNAs. In some embodiments, the protein or oligonucleotide reduces the expression of miR-17-92 and is used to treat lung cancer (e.g., small cell lung cancer). In other embodiments, the protein or oligonucleotide reduces the expression of miR-221 and / or miR-21 and is used to treat glioblastoma. In certain embodiments, the protein or oligonucleotide reduces the expression of miR-155 and / or miR-17-92 and is used to treat lymphoma (e.g., Burkitt's lymphoma, diffuse large B-cell lymphoma, marginal zone lymphoma, or chronic lymphocytic leukemia). In some embodiments, the protein or oligonucleotide reduces the expression of miR-221, miR-222, and / or miR-146 and is used to treat thyroid cancer. In some embodiments, the protein or oligonucleotide reduces the expression of miR-372 and / or miR-373 and is used to treat testicular cancer (e.g., testicular germ cell tumor). In some embodiments, the protein or oligonucleotide reduces the expression of miR-18 and / or miR-224 and is used to treat liver cancer (e.g., hepatocellular carcinoma).

[0155] In some embodiments, the recombinant viral vectors described herein comprise a polynucleotide encoding a payload molecule that degrades the tumor extracellular matrix (ECM), which in some aspects enhances viral spread. Matrix metalloproteinases (MMPs) are zinc-dependent proteases classified into collagenases, gelatinases, stromelysins, and matrilysins based on their activity. These proteases are generally secreted as enzyme precursors (zymogens) and are activated by proteolytic removal of the prodomain of the propeptide. The main role that MMPs play in cancer is in the degradation of ECM, which promotes tumor invasion and metastasis. MMPs are also involved in tumor progression, epithelial to mesenchymal transition (EMT), and angiogenesis. MMPs are regulated by TIMPs as well as miRs, which include a family of four protease inhibitors (TIMP1, TIMP2, TIMP3, and TIMP4). By disrupting miRNAs or TIMPs that negatively regulate the MMP family with the recombinant viral vectors of the present invention, a wide range of tumor microenvironment can be degraded. Examples of miR / MMP interactions are shown in Table 5. Many of these interactions indicate that multiple MMPs are regulated by a single miRNA. For example, let-7 regulates MMP-2, MMP-9, and MMP-14; miR-143 regulates MMP-2, MMP-9, and MMP-13; miR-218 regulates MMP-2, MMP-7, and MMP-9. Furthermore, the majority of MMPs can be regulated by a single TIMP master switch. For example, TIMP1 inhibits most of the known MMPs and is also known to promote cell proliferation in a wide range of cell types, and TIMP2 interacts with MMP-14 and MMP-2.

[0156] In some embodiments, the recombinant oncolytic virus described herein comprises at least one polynucleotide encoding a protein or oligonucleotide that reduces the expression or function of a miRNA (e.g., one or more of the miRNAs listed in Table 5) that can modify the extracellular matrix or regulate a pathway that modifies the extracellular matrix, particularly in the tumor microenvironment. As used herein, microenvironment remodeling miR refers to a miR. In some embodiments, the protein or oligonucleotide reduces the expression or function of one microenvironment remodeling miR. In some embodiments, the protein or oligonucleotide reduces the expression or function of at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more microenvironment remodeling miRs. In some embodiments, the recombinant oncolytic virus comprises multiple polynucleotides encoding multiple proteins or oligonucleotides that reduce the expression or function of multiple microenvironment remodeling miRs. In some embodiments, the methods described herein can be used to knock down or disrupt the expression or function of miRs or TIMPs that negatively regulate MMPs by the recombinant viral vector of the present invention. In some embodiments, the recombinant oncolytic virus reduces expression of a TIMP selected from TIMP1, TIMP2, TIMP3, and TIMP4.

[0157] In some embodiments, the recombinant oncolytic viruses described herein comprise at least one polynucleotide encoding a protein or oligonucleotide that reduces the expression or function of a gene in the host cell genome. In some aspects, the gene is an oncogenic gene (e.g., a gene selected from the genes listed in Table 7). In some aspects, the gene encodes an oncogenic miR (e.g., a miRNA listed in Table 4), a microenvironment remodeling miR (e.g., a miRNA listed in Table 5), or a negative regulator of ECM degradation (e.g., a TIMP). The reduction in gene expression and / or function can be achieved at the transcriptional level (e.g., by mutating, deleting, or silencing a genomic DNA sequence) or at the translational level (e.g., by suppressing the production of a gene product via degradation of the mRNA). In some embodiments, the recombinant oncolytic viruses described herein comprise one or more polynucleotides encoding a nuclease that reduces the expression or function of a gene by allowing the mutation, deletion, or transcriptional suppression of the gene sequence. In certain embodiments, the nuclease is selected from a clustered regularly interspaced short palindromic repeats (CRISPR) associated endonuclease, a zinc finger nuclease (ZFN) or a transcription activator-like effector nuclease (TALEN). In non-limiting examples, the CRISPR associated endonuclease is SpCas9, SpCas9-HF1, SpCas9-HF2, SpCas9-HF3, SpCas9-HF4, SaCas9, FnCpf, FnCas9, eSpCas9, C2C1, C2C3, Cpf1, Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csx12). ), Cas10, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, Csx10, Csx16, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, and Csf4.

[0158] The recombinant viral vectors of the present invention may utilize the CRISPR (clustered regularly interspaced short palindromic repeats) / Cas (CRISPR-associated) nuclease system, which is an engineered nuclease system based on a bacterial system that can be used for mammalian genome engineering. In general, the system includes a Cas nuclease and a guide RNA (gRNA). The gRNA consists of two parts: a crispr-RNA (crRNA) that is specific for the target genomic DNA sequence, and a tracrRNA (trRNA) that facilitates Cas binding. The crRNA and trRNA may be present as separate RNA oligonucleotides or may be present in the same RNA oligonucleotide, referred to as a single guide RNA (sgRNA). As used herein, the term "guide RNA" or "gRNA" refers to either the combination of individual trRNA and individual crRNA or the sgRNA. See, e.g., Jinek et al. (2012) Science 337:816-821, Cong et al. (2013) Science 339:819-823, Mali et al. (2013) Science 339:823-826, Qi (2013) Cell 152:1173-1183, Jinek et al. al.(2013), eLife 2:e00471, David Segal(2013)eLife 2:e00563, Ran et al.(2013)Nature Protocols 8(11):2281-2308, Zetsche et al. (2015)Cell 163(3):759-771, PCT Publication No. WO2007 / 025097, No. WO2008 / 021207, No. WO2010 / 011961, No. WO2010 / 054108, No. WO2010 / No. 054154, No. WO2012 / 054726, No. WO2012 / 149470, No. WO2012 / 164565, No. WO2013 / 098244, No. WO2013 / 126794, No. WO2 See WO2013 / 141680, and WO2013 / 142578, U.S. Patent Publication Nos. 2010-0093617, 2013-0011828, 2010-0257638, 2010-0076057, 2011-0217739, 2011-0300538, 2013-0288251, and 2012-0277120, and U.S. Patent No. 8,546,553.

[0159] Several class 1 CRISPR-Cas systems, including type I and type III systems, have been identified and functionally characterized in detail, revealing the complex structure and dynamics of their effector complexes (Brouns et al., 2008, Marraffini et al., 2010). In addition, several class 2-type II RNA-guided endonucleases of the Cas9 family have been identified that employ cognate RNA-guided endonucleases as effectors. CRISPR-Cas systems have also been identified and experimentally characterized (Barrangou et al., 2007, Garneau et al., 2010, Deltcheva et al., 2011, Sapranauskas et al., 2011, Jinek et al., 2012, Gasiunas et al., 2012). A second, putative class 2-type V CRISPR-Cas system has recently been identified in several bacterial genomes. The putative type V CRISPR-Cas system contains a large, approximately 1,300 amino acid protein called Cpf1 (CRISPR from Prevotella and Francisella 1).

[0160] In some embodiments, the oncolytic virus described herein further comprises at least one polynucleotide encoding a trRNA and a crRNA that target the miRNA or the TIMP. In some cases, the at least one polynucleotide encoding a trRNA and a crRNA is inserted into a locus of the viral genome. In some embodiments, the polynucleotide is an insulated sequence that includes a synthetic insulator or a natural viral (e.g., HSV) insulator. In certain embodiments, the oncolytic virus is a herpes simplex virus, and the at least one polynucleotide encoding an RNA binding site is an internal repeat joint region (including one copy each of the diploid genes ICP0, ICP34.5, LAT, ICP4, and ICP47 promoters), ICP0, LAT, UL1, UL5, UL6, UL7, UL8, UL9, UL11, UL12, UL14, UL15, UL17, UL18, UL19, UL20, UL22, UL25, UL26, UL27, UL28, UL29, UL30, UL31, UL32, UL33, UL34, UL35, UL36, UL37, UL38, UL39, UL40, UL41, UL42, UL43, UL44, UL45, UL46, UL47, UL48, UL49, UL50, UL51, UL52, UL53, UL54, UL55, UL56, UL57, UL58, UL59, UL60, UL61, UL62, UL63, UL64, UL65, UL66, UL67, UL68, UL69, UL70, UL71, UL72, UL73, UL74, UL75, UL76, The at least one polynucleotide encoding an RNA binding site is inserted into or between one or more loci including UL26, UL26.5, UL27, UL28, UL29, UL30, UL31, UL32, UL33, UL34, UL35, UL36, UL37, UL38, UL39, UL40, UL42, UL48, UL49, UL52, UL53, UL54, ICP0, ICP4, ICP22, ICP27, ICP47, gamma-34.5, US3, US4, US5, US6, US7, US8, US9, US10, US11, and US12. In one embodiment, the oncolytic virus is a herpes simplex virus (HSV), and the at least one polynucleotide encoding an RNA binding site is inserted into a locus between the UL3 and UL4 open reading frames (e.g., Figures 39 and 40).

[0161] In some embodiments, the recombinant oncolytic virus comprises at least one polynucleotide encoding a payload molecule that activates or enhances an anti-tumor immune response. In some embodiments, the payload molecule is a cytokine, a chemokine, an antibody or an antigen-binding fragment thereof, or a bispecific T cell inducer (BiTE). For example, in some embodiments, the payload molecule is an antibody or an antigen-binding fragment thereof that binds to and inhibits immune checkpoint receptors (e.g., CTLA4, LAG3, PD1, PDL1, etc.). In some embodiments, the payload molecule is an anti-PD1 antibody or an antigen-binding fragment thereof, an anti-PDL1 antibody or an antigen-binding fragment thereof, or an anti-CTLA4 antibody or an antigen-binding fragment thereof.

[0162] In some embodiments, the payload molecule is a protein that binds to and activates a cell surface receptor. For example, in some embodiments, the payload molecule comprises an endogenous cell surface ligand, such as the extracellular domain of 41BBL, the extracellular domain of CD40L, or FLT3L. In some embodiments, the payload molecule is a cytokine (e.g., IFNγ, IFNα, IFNβ, TNFα, IL-12, IL-2, IL-6, IL-8, IL-15, GM-CSF, IL-21, IL-35, TGFβ, etc.) or a chemokine (e.g., CCL4, CXCL10, CCL5, CXCL13, or XCL1).

[0163] In some embodiments, the payload molecule is a protein that binds to and activates an activating receptor (e.g., FcγRI, FcγIIa, FcγIIIa, costimulatory receptors, etc.) In certain embodiments, the protein is selected from EpCAM, folate, A2A, anti-FGF2, anti-FGFR / FGFR2b, anti-SEMA4D, CD137, CD200, CD38, CD44, CSF-1R, endothelin B receptor, ISRE7, LFA-1, NG2 (also known as SPEG4), SMADs, STING, and VCAM1.

[0164] In certain embodiments, a polynucleotide encoding a protein or oligonucleotide targeted to reduce the expression of miRNA, gene, or TIMP is inserted into a locus of the viral genome of a recombinant oncolytic virus. In some embodiments, the polynucleotide is an insulated sequence, including a synthetic insulator or a natural viral (e.g., HSV) insulator. In certain embodiments, the oncolytic virus is a herpes simplex virus, and the at least one polynucleotide encoding an RNA binding site is an internal repeat joint region (including one copy each of the diploid genes ICP0, ICP34.5, LAT, ICP4, and ICP47 promoters), ICP0, LAT, UL1, UL5, UL6, UL7, UL8, UL9, UL11, UL12, UL14, UL15, UL17, UL18, UL19, UL20, UL22, UL25, UL26, UL27, UL28, UL29, UL30, UL31, UL32, UL33, UL34, UL35, UL36, UL37, UL38, UL39, UL40, UL41, UL42, UL43, UL44, UL45, UL46, UL47, UL48, UL49, UL50, UL51, UL52, UL53, UL54, UL55, UL56, UL57, UL58, UL59, UL60, UL61, UL62, UL63, UL64, UL65, UL66, UL67, UL68, UL69, UL70, UL71, UL72, UL73, UL74, UL75, UL76, UL77, UL78, UL79, UL80, The at least one polynucleotide is inserted at or between one or more loci including UL26, UL26.5, UL27, UL28, UL29, UL30, UL31, UL32, UL33, UL34, UL35, UL36, UL37, UL38, UL39, UL40, UL42, UL48, UL49, UL52, UL53, UL54, ICP0, ICP4, ICP22, ICP27, ICP47, gamma-34.5, US3, US4, US5, US6, US7, US8, US9, US10, US11, and US12. In one embodiment, the virus is a herpes simplex virus (HSV) and the at least one polynucleotide is inserted at a locus between the UL3 and UL4 open reading frames (see, e.g., Figures 39 and 40).

[0165] In some embodiments, the recombinant oncolytic virus comprises at least one protease-activating antibody. Protease-activating antibodies, such as those described by Metz et al. (Protein Eng Des Sel,25(10):571-80, 2012), are activated after protease cleavage of the protective cap and only bind to the target. In some cases, the tumor microenvironment has many proteases that are well differentiated from the surrounding healthy tissue. For example, the protease cathepsin B is overexpressed in many cancers, including breast cancer, cervical cancer, colon cancer, colorectal cancer, gastric cancer, head and neck cancer, liver cancer, lung cancer, melanoma, ovarian cancer, pancreatic cancer, prostate cancer, and thyroid cancer. The human degradome, which consists of the complete list of proteases synthesized by human cells, consists of at least 569 proteases, grouped into five broad classes (in order from most to least numerous): metalloproteinases (MMPs), serine, cysteine, threonine, and aspartic acid proteases (Lopez-Otin et al., Nat Rev Cancer, 7(10):800-8, 2007). Notably, since MMPs are found in the extracellular and pericellular regions of cells, protease antibodies that are specifically cleaved by MMPs may serve as an excellent means of targeting the recombinant viral vectors described herein to the tumor microenvironment. Table 6 summarizes proteases that are overexpressed in cancer and can be utilized to enable specific binding of recombinant viral vectors pseudotyped with protease-activating antibodies.

[0166] In certain embodiments, the protease-activating antibody is incorporated into the glycoprotein envelope of the virus. The protease-activating antibody can be incorporated into the glycoprotein envelope of the recombinant viral vector of the present invention (e.g., HSV vector) to improve the therapeutic index and reduce off-target infection. For HSV vectors, in some embodiments, the glycoprotein can be gC or gD. In some embodiments, the recombinant oncolytic virus described herein comprises at least one polynucleotide encoding a protease-activating antibody. In certain embodiments, the protease-activating antibody is activated by a protease selected from cysteine ​​cathepsin, aspartic cathepsin, kallikrein (hK), serine protease, caspase, matrix metalloproteinase (MMP), and a disintegrin and metalloproteinase (ADAM). In some embodiments, the protease is selected from cathepsin K, cathepsin B, cathepsin L, cathepsin E, cathepsin D, hK1, PSA (hK3), hK10, hK15, uPA, uPAR, MMP-1, MMP-2, MMP-3, MMP-7, MMP-8, MMP-9, MMP-10, MMP-11, MMP-12, MMP-13, MMP-14, MMP-15, MMP-16, MMP-17, MMP-18, MMP-19, MMP-20, MMP-21, MMP-23A, MMP-23B, MMP-24, MMP-25, MMP-26, MMP-27, MMP-28, or a protease listed in Table 6.

[0167] In some embodiments, the protease-activated antibody binds to a protein that is more highly expressed in cancer cells or cancer microenvironments than in non-cancer cells or non-cancer cell microenvironments. In certain aspects, the protease-activated antibody binds to NKG2D, c-met, HGFR, CD8, heparan sulfate, VSPG4 (also known as NG2), EGFR, EGFRvIII, CD133, CXCR4, carcinoembryonic antigen (CEA), CLC-3, annexin II, human transferrin receptor, or EpCAM. In certain examples, multiple protease-activated antibodies may be incorporated into a single viral vector particle to allow for targeting of multiple tumor tissue types. For example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more protease-activated antibodies may be incorporated into the glycoprotein envelope of the virus. In some embodiments, the recombinant oncolytic virus comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more polynucleotides encoding at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more protease-activating antibodies. In some embodiments, the oncolytic virus comprises a first protease-activating antibody that binds to a first protein that is more highly expressed by cancer cells or in the cancer microenvironment than by non-cancer cells or in the non-cancer microenvironment, and a second protease-activating antibody that binds to a second protein that is more highly expressed by cancer cells or in the cancer microenvironment than by non-cancer cells or in the non-cancer microenvironment. In further embodiments, the oncolytic virus comprises multiple protease-activating antibodies that bind to multiple proteins that are more highly expressed by cancer cells or in the cancer microenvironment than by non-cancer cells or in the non-cancer microenvironment. The oncolytic virus comprises a protease-activating antibody that is, for example, a human antibody, a humanized antibody, or a chimeric antibody. In some embodiments, the oncolytic virus comprises an antibody that is a full-length immunoglobulin, an scFv, a Fab, a Fab', a F(ab')2, an Fv, a diabody, a triabody, a minibody, a single domain antibody, or a multispecific antibody.

[0168] In some embodiments, the recombinant oncolytic virus comprises one or more of the following: one or more microRNA (miR) target sequences inserted into the locus of one or more viral genes required for viral replication, one or more polynucleotides encoding one or more proteins or oligonucleotides, where the proteins or oligonucleotides reduce expression or inhibit function of miRs, genes, or TIMPs, at least one protease-activating antibody, and / or a polynucleotide encoding at least one protease-activating antibody. In some embodiments, the recombinant oncolytic virus comprises multiple copies of one or more miRNA target sequences inserted into the locus of a viral gene required for viral replication in a non-cancerous cell, and / or a first polynucleotide encoding a protein or oligonucleotide targeted to reduce expression of an oncogenic miRNA or oncogenic gene, and / or a second polynucleotide encoding a protein or oligonucleotide targeted to reduce expression of a microenvironment remodeling miRNA or TIMP. In some embodiments, the recombinant oncolytic virus comprises multiple copies of target sequences of one or more miRNAs inserted into the locus of a viral gene required for viral replication in a non-cancerous cell, and / or a polynucleotide encoding a protein or oligonucleotide targeted to reduce expression of an oncogenic miRNA or oncogenic gene, and / or at least one protease-activating antibody. In further embodiments, the recombinant oncolytic virus comprises multiple copies of target sequences of one or more miRNAs inserted into the locus of a viral gene required for viral replication in a non-cancerous cell, and / or a polynucleotide encoding a protein or oligonucleotide targeted to reduce expression of a microenvironment remodeling miRNA or TIMP, and / or at least one protease-activating antibody.In one embodiment, the recombinant oncolytic virus comprises multiple copies of target sequences of one or more miRNAs inserted into the locus of a viral gene required for viral replication in a non-cancerous cell, and / or a first polynucleotide encoding a protein or oligonucleotide targeted to reduce expression of an oncogenic miRNA or oncogenic gene, and / or a second polynucleotide encoding a protein or oligonucleotide targeted to reduce expression of a microenvironment remodeling miRNA or TIMP, and / or at least one protease-activating antibody. In some specific embodiments, the oncolytic virus described in this paragraph is a herpes simplex virus, and the viral genes required for viral replication in a non-cancerous cell are UL1, UL5, UL6, UL7, UL8, UL9, UL11, UL12, UL14, UL15, UL17, UL18, UL19, UL20, UL22, UL25, UL26, UL26.5, UL27, UL28, UL30, UL31, UL32, UL33, UL34, UL35, UL36, UL37, UL38, UL39, UL40, UL41, UL42, UL43, UL44, UL45, UL46, UL47, UL48, UL49, UL50, UL51, UL52, UL53, UL54, UL55, UL56, UL57, UL58, UL59, UL60, UL61, UL62, UL63, UL64, UL65, UL66, UL67, UL68, UL69, UL70, UL71, UL72, UL73, UL74, UL75, UL76, UL77, UL78, UL79, UL8 UL29, UL30, UL31, UL32, UL33, UL34, UL35, UL36, UL37, UL38, UL39, UL40, UL42, UL48, UL49, UL52, UL53, UL54, ICP0, ICP4, ICP22, ICP27, ICP47, gamma-34.5, US3, US4, US5, US6, US7, US8, US9, US10, US11, and US12.

[0169] In certain aspects, the present invention relates to a recombinant oncolytic virus comprising a first polynucleotide encoding a protein or oligonucleotide targeted to reduce the expression of an oncogenic miRNA or oncogene, and a second polynucleotide encoding a protein or oligonucleotide targeted to reduce the expression of a microenvironment remodeling miRNA or TIMP. In other embodiments, the recombinant oncolytic virus comprises a polynucleotide encoding a protein or oligonucleotide targeted to reduce the expression of an oncogenic miRNA or oncogene, and at least one protease-activating antibody. In some embodiments, the recombinant oncolytic virus comprises a polynucleotide encoding a protein or oligonucleotide targeted to reduce the expression of a microenvironment remodeling miRNA or TIMP, and at least one protease-activating antibody. In one embodiment, the recombinant oncolytic virus comprises a first polynucleotide encoding a protein or oligonucleotide targeted to reduce the expression of an oncogenic miRNA or oncogene, and / or a second polynucleotide encoding a protein or oligonucleotide targeted to reduce the expression of a microenvironment remodeling miRNA or TIMP, and / or at least one protease-activating antibody.

[0170] In some embodiments, the oncolytic virus is an HSV virus comprising a first miR-TS cassette inserted into the 3'UTR of ICP4, the first miR-TS cassette comprising four target sequences for each of miR-124-3p, miR-1-3p, and miR-143-3p, a second miR-TS cassette inserted into the 3'UTR of ICP27, the second miR-TS cassette comprising four target sequences for each of miR-219a-5p, miR-122-5p, and miR128-3p, and a third miR-TS cassette inserted into the 3'UTR of UL8, the third miR-TS cassette comprising four target sequences for each of miR-137-3p, miR-208b-3p, and miR-126-3p. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and MMP9. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10 and MMP9. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and XCL1. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and CCL4. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and FLT-3L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and 41BBL. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CD40L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding 41BBL and CD40L.In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-CTLA4 antibody or an antigen-binding fragment thereof. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-PD1 or anti-PDL1 antibody or an antigen-binding fragment thereof. In some embodiments, the oncolytic virus comprises a nucleic acid sequence at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 843, 844, 847, or 848. In some embodiments, the oncolytic virus comprises or consists of the nucleic acid sequence of one of SEQ ID NOs: 843, 844, 847, or 848.

[0171] In some embodiments, the oncolytic virus is an HSV virus comprising a first miR-TS cassette inserted into the 3'UTR of ICP4, the first miR-TS cassette comprising four target sequences for each of miR-124-3p, miR-1-3p, and miR-143-3p, a second miR-TS cassette inserted into the 3'UTR of ICP27, the second miR-TS cassette comprising four target sequences for each of miR-219a-5p, miR-122-5p, and miR128-3p, and a third miR-TS cassette inserted into the 3'UTR of UL8, the third miR-TS cassette comprising four target sequences for each of miR-137-3p, miR-208b-3p, and miR-126-3p. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and MMP9. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10 and MMP9. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and XCL1. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and CCL4. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and FLT-3L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and 41BBL. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CD40L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding 41BBL and CD40L.In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-CTLA4 antibody or an antigen-binding fragment thereof. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-PD1 or anti-PDL1 antibody or an antigen-binding fragment thereof. In some embodiments, the oncolytic virus comprises a nucleic acid sequence at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 845 or 846. In some embodiments, the oncolytic virus comprises or consists of the nucleic acid sequence of one of SEQ ID NO: 845 or 846.

[0172] In some embodiments, the oncolytic virus comprises a first miR-TS cassette inserted into the 3'UTR of ICP4, the first miR-TS cassette comprising four target sequences for each of miR-124-3p, miR-1-3p, and miR-143-3p, a second miR-TS cassette inserted into the 3'UTR of ICP27, the second miR-TS cassette comprising four target sequences for each of miR-219a-5p, miR-122-5p, and miR128-3p, and a third miR-TS cassette inserted into the 3'UTR of ICP27. a third miR-TS cassette inserted into the 3'UTR of UL8, the third miR-TS cassette containing four target sequences for each of miR-137-3p, miR-208b-3p, and miR-126-3p, and a fourth miR-TS cassette inserted into the 3'UTR of ICP34.5, the fourth miR-TS cassette containing four target sequences for each of miR-128-3p, miR-204-5p, and miR-219a-5p. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and MMP9. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10 and MMP9. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and XCL1. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and CCL4. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and FLT-3L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and 41BBL.In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CD40L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding 41BBL and CD40L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-CTLA4 antibody or an antigen-binding fragment thereof. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-PD1 or anti-PDL1 antibody or an antigen-binding fragment thereof. In some embodiments, the oncolytic virus comprises a nucleic acid sequence at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:850. In some embodiments, the oncolytic virus comprises or consists of the nucleic acid sequence of SEQ ID NO:850.

[0173] In some embodiments, the oncolytic virus comprises a first miR-TS cassette inserted into the 3'UTR of ICP4, the first miR-TS cassette comprising four target sequences for each of miR-124-3p, miR-1-3p, and miR-143-3p, a second miR-TS cassette inserted into the 3'UTR of ICP27, the second miR-TS cassette comprising four target sequences for each of miR-219a-5p, miR-122-5p, and miR128-3p, and a third miR-TS cassette inserted into the 3'UTR of ICP27. a third miR-TS cassette inserted into the 3'UTR of UL8, the third miR-TS cassette containing four target sequences for each of miR-137-3p, miR-217-5p, and miR-126-3p, and a fourth miR-TS cassette inserted into the 3'UTR of ICP34.5, the fourth miR-TS cassette containing four target sequences for each of miR-128-3p, miR-204-5p, and miR-219a-5p. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and MMP9. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10 and MMP9. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and XCL1. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and CCL4. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and FLT-3L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and 41BBL.In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CD40L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding 41BBL and CD40L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-CTLA4 antibody or an antigen-binding fragment thereof. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-PD1 or anti-PDL1 antibody or an antigen-binding fragment thereof. In some embodiments, the oncolytic virus comprises a nucleic acid sequence at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:849. In some embodiments, the oncolytic virus comprises or consists of the nucleic acid sequence of SEQ ID NO:849.

[0174] In some embodiments, the oncolytic virus comprises a first miR-TS cassette inserted into the 3'UTR of ICP4, the first miR-TS cassette comprising four target sequences for each of miR-124-3p, miR-1-3p, and miR-143-3p, a second miR-TS cassette inserted into the 3'UTR of ICP27, the second miR-TS cassette comprising four target sequences for each of miR-219a-5p, miR-122-5p, and miR128-3p, and a third miR-TS cassette inserted into the 3'UTR of ICP27. a third miR-TS cassette inserted into the 3'UTR of UL8, the third miR-TS cassette containing four target sequences for each of miR-137-3p, miR-217-5p, and miR-126-3p, and a fourth miR-TS cassette inserted into the 3'UTR of ICP34.5, the fourth miR-TS cassette containing four target sequences for each of miR-128-3p, miR-204-5p, and miR-219a-5p. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and MMP9. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10 and MMP9. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and XCL1. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and CCL4. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and FLT-3L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and 41BBL.In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CD40L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding 41BBL and CD40L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-CTLA4 antibody or an antigen-binding fragment thereof. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-PD1 or anti-PDL1 antibody or an antigen-binding fragment thereof. In some embodiments, the oncolytic virus comprises a nucleic acid sequence at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:851. In some embodiments, the oncolytic virus comprises or consists of the nucleic acid sequence of SEQ ID NO:851.

[0175] The present invention also includes nucleic acid molecules that encode the oncolytic viruses described herein.

[0176] Compositions and Methods of Use Certain aspects of the invention relate to stocks and compositions comprising the oncolytic viruses described herein. In some aspects, the invention relates to viral stocks comprising the oncolytic viruses described herein. In some embodiments, the viral stocks are homogenous stocks. Preparation and analysis of viral stocks is well known in the art. For example, viral stocks can be produced in roller bottles containing cells transduced with the viral vector. The viral stocks can then be purified on a continuous Nycodenz gradient, aliquoted, and stored until needed. Viral stocks vary considerably in titer, and are highly dependent on the viral genotype and the protocols and cell lines used to prepare them.

[0177] In certain embodiments, the titer of a viral stock contemplated herein (e.g., a viral stock of an HSV-based vector) is at least about 10 5 Plaque forming units (pfu), e.g., at least about 106 pfu or even more preferably at least about 10 7 In certain embodiments, the titer is at least about 10 8 pfu, or at least about 10 9 pfu and at least about 10 10 pfu or at least about 10 11 High titer stocks of pfu are most preferred.

[0178] The present invention further contemplates compositions comprising an oncolytic virus or nucleic acid molecule as described herein and a pharma- ceutically acceptable carrier. The term "pharmaceutical acceptable" refers to molecular entities and compositions that do not cause allergic or similar adverse reactions when administered to a subject (e.g., a human). As used herein, the term "composition" refers to a formulation of one or more oncolytic viruses or nucleic acid molecules as described herein that can be administered or delivered to a subject and / or cell. Typically, the formulation includes any physiologically acceptable composition, including derivatives and / or prodrugs, solvates, stereoisomers, racemates, or tautomers thereof, and any physiologically acceptable carriers, diluents, and / or excipients. A "therapeutic composition" or "pharmaceutical composition" (used interchangeably herein) is a composition of one or more agents that can be administered or delivered to a patient and / or subject and / or cell for the treatment of a particular disease or disorder.

[0179] The compositions disclosed herein may be formulated in neutral or salt form. "Pharmaceutically acceptable salts" include both acid addition salts and base addition salts. Pharmaceutically acceptable salts include acid addition salts (formed with free amino groups of proteins), which include inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like, and organic acids such as, but not limited to, acetic acid, 2,2-dichloroacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetamidobenzoic acid, camphoric acid, camphor-10-sulfonic acid, capric acid, caproic acid, caprylic acid, carbonic acid, cinnamic acid, citric acid, cyclamic acid, dodecylsulfuric acid, ethane-1,2-disulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, formic acid, fumaric acid, galactaric acid, gentisic acid, glucoheptan-1,2-disulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, formic acid, fumaric acid, galactaric acid, gentisic acid, glucoheptan-1,2-disulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, ... It is formed from carboxylic acid, gluconic acid, glucuronic acid, glutamic acid, glutaric acid, 2-oxoglutaric acid, glycerophosphoric acid, glycolic acid, hippuric acid, isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, mucic acid, naphthalene-1,5-disulfonic acid, naphthalene-2-sulfonic acid, 1-hydroxy-2-naphthoic acid, nicotinic acid, oleic acid, orotic acid, oxalic acid, palmitic acid, pamoic acid, propionic acid, pyroglutamic acid, pyruvic acid, salicylic acid, 4-aminosalicylic acid, sebacic acid, stearic acid, succinic acid, tartaric acid, thiocyanic acid, p-toluenesulfonic acid, trifluoroacetic acid, undecylenic acid, etc. Salts formed with the free carboxyl groups can also be derived from inorganic bases, such as, for example, the sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts and the like.Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins, such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, diethanolamine, ethanolamine, deanol, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, benethamine, benzathine, ethylenediamine, glucosamine, methylglucamine, theobromine, triethanolamine, tromethamine, purine, piperazine, piperidine, N-ethylpiperidine, polyamine resins, and the like. Particularly preferred organic bases are isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine. After formulation, the solution is administered in a manner compatible with the dosage formulation and in a therapeutically effective amount. The formulations are easily administered in a variety of dosage forms such as injectable solutions, drug release capsules, etc.

[0180] As used herein, "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, etc. The use of such vehicles and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional vehicle or agent is incompatible with the active ingredient, its use in the therapeutic composition is contemplated. Supplementary active ingredients may also be incorporated into the composition.

[0181] As used herein, "pharmacologically acceptable carriers" include, but are not limited to, any physiologically compatible adjuvants, carriers, excipients, glidants, sweeteners, diluents, preservatives, dyes / colorants, flavor enhancers, surfactants, wetting agents, dispersing agents, suspending agents, stabilizers, isotonic agents, solvents, surfactants, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, including pharmaceutical acceptable cell culture media and / or emulsifying agents approved by the U.S. Food and Drug Administration as acceptable for human and / or veterinary use. Exemplary pharma- ceutically acceptable carriers include, but are not limited to, sugars such as lactose, glucose and sucrose, starches such as corn starch and potato starch, cellulose and its derivatives such as sodium carboxymethylcellulose, ethylcellulose and cellulose acetate, tragacanth, malt, gelatin, talc, cocoa butter, waxes, animal and vegetable fats, paraffin, silicones, bentonite, silicic acid, zinc oxide, oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil, glycols such as propylene glycol, polyols such as glycerin, sorbitol, mannitol and polyethylene glycol, esters such as ethyl oleate and ethyl laurate, agar, buffers such as magnesium hydroxide and aluminum hydroxide, alginic acid, pyrogen-free water, isotonic saline, Ringer's solution, ethyl alcohol, phosphate buffers, and any other compatible substances used in pharmaceutical formulations. Except insofar as any conventional media and / or agent is incompatible with the agents of the present disclosure, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.

[0182] Wetting agents, emulsifying agents and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be included in the composition.

[0183] Examples of pharma- ceutically acceptable antioxidants include: (1) water-soluble antioxidants, such as ascorbic acid, cysteine ​​hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite, and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal chelating agents, such as citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.

[0184] In one embodiment, the composition containing the carrier is suitable for parenteral administration, for example, intravascular (intravenous or intraarterial), intraperitoneal or intramuscular administration. Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. The use of such media and agents for pharmacoactive substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the viral vector or nucleic acid molecule, its use in the pharmaceutical composition of the present invention is contemplated.

[0185] The compositions of the present invention may comprise one or more of the polypeptides, polynucleotides, vectors containing them, infected cells, etc. described herein, formulated in a pharma- ceutically or physiologically acceptable solution for administration to a cell or animal, either alone or in combination with one or more other therapeutic modalities. It will also be understood that the compositions of the present invention may be administered in combination with other agents, as well, such as, for example, cytokines, growth factors, hormones, small molecules, or various pharma- ceutical active agents, if desired. There is virtually no limit to the other components that may also be included in the composition, so long as the additional agents do not adversely affect the ability of the composition to deliver the intended therapeutic.

[0186] In the pharmaceutical compositions of the present invention, the formulation of pharma- ceutically acceptable excipient and carrier solutions is well known to those skilled in the art, as is the development of appropriate administration and treatment regimens for the use of the particular compositions described herein in various treatment regimens. Once formulated, the solution is administered in a manner compatible with the dosage formulation and in a therapeutically effective amount that results in the improvement or treatment of the condition. The formulations are easily administered in a variety of dosage forms, such as ingestible solutions, drug release capsules, and the like. Some variation in administration may occur depending on the condition of the subject being treated. The person responsible for administration can, in any event, determine the appropriate dose for the individual subject. Additionally, for administration to humans, the formulations meet the sterility, general safety, and purity standards required by the standards of the Center for Biologics Evaluation and Research of the FDA. The route of administration will, of course, vary with the location and nature of the disease being treated, and may include, for example, intradermal, transdermal, subdermal, parenteral, nasal, intravenous, intramuscular, intranasal, subcutaneous, percutaneous, intratracheal, intraperitoneal, intratumor, perfusion, lavage, direct injection, and oral administration.

[0187] In certain circumstances, it may be desirable to deliver the compositions, recombinant viral vectors, and nucleic acid molecules disclosed herein parenterally, intravenously, intramuscularly, or even intraperitoneally, as described, for example, in U.S. Pat. No. 5,543,158, U.S. Pat. No. 5,641,515, and U.S. Pat. No. 5,399,363 (each of which is expressly incorporated herein by reference in its entirety). A solution of the active compound as a free base or a pharmacologically acceptable salt may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, as well as in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

[0188] Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (U.S. Pat. No. 5,466,468, expressly incorporated herein by reference in its entirety). In all cases, the form should be sterile and fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be, for example, a solvent or dispersion medium containing water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, etc.), suitable mixtures thereof, and / or vegetable oils. Proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of the action of microorganisms can be enhanced by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it is preferable to include an isotonic agent, such as sugar or sodium chloride. Prolonged absorption of the injectable composition can be achieved by using an agent that delays absorption, such as aluminum monostearate and gelatin, in the composition. Preparation of aqueous compositions that contain proteins as active ingredients is well understood in the art. Typically, such compositions are prepared as injectables, either as liquid solutions or suspensions, and solid forms suitable for solution or suspension in liquid prior to injection can also be prepared. The preparation can also be emulsified.

[0189] For parenteral administration in aqueous solution, for example, the solution should be appropriately buffered if necessary, and the liquid diluent should first be rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this regard, the sterile aqueous medium that can be employed will be known to those skilled in the art in light of this disclosure. For example, a single dose can be dissolved in 1 ml of isotonic NaCl solution and added to 1000 ml of subcutaneous injection fluid or injected into the proposed injection site (see, for example, Remington: The Science and Practice of Pharmacy, 20th Edition. Baltimore, MD: Lippincott Williams & Wilkins, 2000). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Furthermore, for human administration, the formulation should meet the sterility, pyrogenicity, and general safety and purity standards required by the standards of the Office of Biological Products of the FDA.

[0190] Sterile injectable solution can be prepared by incorporating the required amount of the active compound into a suitable solvent together with various other components as listed above as necessary, followed by sterilization by filtration.Generally, dispersion is prepared by incorporating various sterilized active components into a sterile medium that contains a basic dispersion medium and other components as listed above.For the preparation of sterile powder for sterile injectable solution, the preferred preparation method is vacuum drying and freeze-drying technology, which allows the powder of the active component plus any additional desired components to be obtained from the solution that has been previously sterilized and filtered.

[0191] In certain embodiments, the composition may be delivered by intranasal spray, inhalation, and / or other aerosol delivery vehicles. Methods for delivering polynucleotide and peptide compositions directly to the lungs via nasal aerosol sprays are described, for example, in U.S. Patent No. 5,756,353 and U.S. Patent No. 5,804,212 (each of which is expressly incorporated herein by reference in its entirety). Similarly, drug delivery using intranasal microparticle resins (Takenaga et al., 1998) and lysophosphatidyl-glycerol compounds (U.S. Patent No. 5,725,871, which is expressly incorporated herein by reference in its entirety) are also well known in the pharmaceutical arts. Similarly, transmucosal drug delivery in the form of a polytetrafluoroethylene support matrix is ​​described in U.S. Patent No. 5,780,045 (which is expressly incorporated herein by reference in its entirety).

[0192] In certain embodiments, the delivery may be achieved by using liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, optionally in admixture with CPP polypeptides, etc., to introduce the compositions of the invention into suitable host cells. In particular, the compositions of the invention may be formulated for delivery encapsulated in either lipid particles, liposomes, vesicles, nanospheres, nanoparticles, etc. The formulation and use of such delivery vehicles may be performed using known conventional techniques. The formulations and compositions of the invention may include one or more of the polypeptides, polynucleotides, and small molecules described herein, formulated in a pharma- ceutically or physiologically acceptable solution (e.g., medium) for administration to cells or animals, alone or in combination with one or more other therapies. It will also be understood that, if desired, the compositions of the invention may be administered in combination with other agents, such as, for example, cells, other proteins or polypeptides, or various pharma- ceutically active agents, as well as other agents.

[0193] In certain embodiments, formulations or compositions of the present invention comprise cells contacted with a combination of various polynucleotides or viral vectors contemplated herein.

[0194] In certain aspects, the present invention provides formulations or compositions suitable for delivery of viral vector systems.

[0195] Exemplary formulations for ex vivo delivery may also include the use of various transfection agents known in the art, such as calcium phosphate, electroporation, heat shock, and various liposome formulations (i.e., lipid-mediated transfection). Liposomes are lipid bilayers that encapsulate a fraction of aqueous fluid. DNA spontaneously binds to the outer surface of cationic liposomes (due to their charge), and these liposomes interact with cell membranes.

[0196] Certain embodiments of the present invention may include other formulations, such as those well known in the pharmaceutical art, e.g., those described in Remington: The Science and Practice of Pharmacy, 20th Edition. Baltimore, MD: Lippincott Williams & Wilkins, 2000.

[0197] In certain aspects, the present invention provides pharma- ceutical acceptable compositions comprising a therapeutically effective amount of one or more viral vectors or polynucleotides described herein, formulated with one or more pharma- ceutical acceptable carriers (additives) and / or diluents (e.g., pharma- ceutical acceptable cell culture media). As used herein, a "therapeutically effective amount" refers to the amount of a composition or recombinant virus described herein required to achieve a desired physiological and / or biological result. A "therapeutically effective amount" of a virus, viral stock, or composition may vary depending on factors such as the disease state, age, sex, and weight of an individual, and the ability of stem and progenitor cells in the individual to elicit a desired response. A therapeutically effective amount is also one in which any toxic or deleterious effects of the virus or transduced therapeutic cells are outweighed by therapeutically beneficial effects. The term "therapeutically effective amount" includes an amount effective to "treat" a subject (e.g., a patient). A therapeutically effective amount is defined as an amount of plaque forming units (pfu) (e.g., at least 1 e 1~At least 1e 20 , specifically, about 1e 4 ~ approx. 1e 15 , more specifically, about 1e 6 ~ approx. 1e 12 pfu), or viral genome count (e.g., at least 1e 1 ~At least 1e 20 , specifically, about 1e 4 ~ approx. 1e 15 , more specifically, about 1e 6 ~ approx. 1e 12 The therapeutically effective amount can be quantified by the amount of the virus administered (e.g., 100 viral genomes). One skilled in the art will appreciate that the therapeutically effective amount will vary based on the type of virus administered, the nature of the formulation, the route of administration, the nature and / or severity of the disease being treated, and / or the general condition and health of the subject.

[0198] Some aspects of the present invention include a method for killing cancerous cells, which comprises exposing the cancerous cells to an oncolytic virus or a composition thereof described herein under conditions sufficient for the oncolytic virus to infect and replicate in the cancerous cells, and the replication of the oncolytic virus in the cancerous cells results in cell death.In certain embodiments, the cancerous cells have reduced expression of miR compared to non-cancerous cells.In some embodiments, the cancerous cells killed by the method are in vivo.In certain embodiments, the cancerous cells killed by the method are in tumors.

[0199] The present invention relates to a method of treating cancer in a subject in need thereof, which comprises administering to the subject a prophylactically or therapeutically effective amount of an oncolytic virus, virus stock, or composition described herein. As used herein, "subject" includes any animal that exhibits symptoms of a disease, disorder, or condition that can be treated with the recombinant viral vectors, compositions, and methods disclosed herein. Suitable subjects (e.g., patients) include laboratory animals (such as mice, rats, rabbits, or guinea pigs), farm animals (such as horses or cows), and domestic animals or pets (such as cats or dogs). Non-human primates and preferably human patients are included.

[0200] "Administration," as used herein, refers to introducing an oncolytic virus, virus stock, or composition thereof into a subject or contacting a cell and / or tissue with an oncolytic virus, virus stock, or composition thereof. Administration can be by injection, irrigation, inhalation, ingestion, electroosmosis, hemodialysis, iontophoresis, and other methods known in the art. The route of administration will of course vary with the location and the nature of the disease to be treated and may be, for example, auricular, buccal, conjunctival, cutaneous, dental, intracervical, intrasinus, intratracheal, enteral, epidural, interstitial, intra-articular, intra-arterial, intraperitoneal, intraauricular, intrabiliary, intrabronchial, intracapsular, intracavity, intracerebral, intracisternal, intracorneal, intracranial, intracoronary, intracranial, intradermal, intradiscal, intraductal, intraduodenal, intraduodenal, intradural, intrapericardial, intraepidermal, intraesophageal, intragastric, intragingival, intrahepatic, intraileal, intralesional, intralingual, intracavity, intralymphatic, intramammary, intramedullary, intrameningeal, intramuscular, intranasal, intranodal, intraocular, intraocular, intraocular, intraovarian, intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intraluminal, intraantral, These may include intraspinal, intrasynovial, intratendinous, intratesticular, intratracheal, intrathecal, intrathoracic, intraductal, intratumoral, intratympanic, intrauterine, intraperitoneal, intravascular, intraventricular, intravesical, intravestibular, intravenous, intravitreal, laryngeal, nasal, nasogastric, oral, ophthalmic, oropharyngeal, parenteral, percutaneous, periarticular, epidural, perineural, periodontal, respiratory, post-vascular, rectal, spinal, subarachnoid, subconjunctival, subcutaneous, subdermal, subgingival, sublingual, submucosal, subretinal, topical, transdermal, transendocardial, transmucosal, transplacental, transtracheal, transtympanic, ureteral, urethral, ​​and / or vaginal irrigation, lavage, direct injection, and oral administration.

[0201] As used herein, the terms "treating" and "treatment" refer to administering to a subject a therapeutically effective amount of a recombinant virus or composition thereof described herein such that the subject improves the disease or condition or symptoms of the disease or condition. The improvement is any improvement or treatment of the disease or condition or symptoms of the disease or condition. The improvement may be a visible or measurable improvement or an improvement in the subject's overall sense of well-being. Thus, those skilled in the art will understand that treatment may improve a condition but may not cure the disease. A "prophylactically effective amount" refers to an amount of a virus, virus stock, or composition effective to achieve a desired prophylactic result. As used herein, "prevention" can mean completely preventing symptoms of a disease, delaying the onset of symptoms of a disease, or reducing the severity of later manifestations of the disease. Usually, but not necessarily, the prophylactically effective amount is less than the therapeutically effective amount, since a prophylactic dose is used in a subject before or at an early stage of a disease.

[0202] As used herein, "cancer" refers to or describes a mammalian physiological condition that is typically characterized by unregulated cell growth. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma (including liposarcoma, osteosarcoma, angiosarcoma, endothelial sarcoma, leiomyosarcoma, chordoma, lymphangiosarcoma, lymphangioendothelial sarcoma, rhabdomyosarcoma, fibrosarcoma, myxosarcoma, chondrosarcoma), neuroendocrine tumor, mesothelioma, meningioma, schwannoma, meningioma, adenocarcinoma, melanoma, and leukemia or lymphatic tumor. More specific examples of such cancers include squamous cell carcinoma (e.g., epithelial squamous cell carcinoma), lung cancer including small-cell lung cancer, non-small cell lung cancer, lung adenocarcinoma and lung squamous cell carcinoma, small cell lung carcinoma, peritoneal cancer, hepatocellular carcinoma, gastric cancer including gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, breast cancer, colon cancer, rectal cancer, colorectal cancer, endometrial or uterine cancer, salivary gland cancer, kidney cancer, and renal cancer. cancer), prostate cancer, vulvar cancer, thyroid cancer, liver cancer, anal cancer, penile cancer, testicular cancer, esophageal cancer, biliary tract tumors, Ewing's tumor, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchogenic lung carcinoma, renal cell carcinoma, hepatoma, cholangiocarcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, testicular tumor, lung carcinoma, bladder cancer, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, retinoblastoma, leukemia, lymphoma, multiple myeloma, Waldenstrom's macroglobulinemia, myelodysplastic disease, heavy chain disease, neuroendocrine tumors, schwannoma, and other carcinomas, as well as head and neck cancer.

[0203] In certain embodiments, the oncolytic virus (e.g., HSV), virus stock, or composition described herein is used to treat a cancer selected from lung cancer (e.g., small cell lung cancer or non-small cell lung cancer), breast cancer, ovarian cancer, cervical cancer, prostate cancer, testicular cancer, colorectal cancer, colon cancer, pancreatic cancer, liver cancer (e.g., hepatocellular carcinoma (HCC)), gastric cancer, head and neck cancer, thyroid cancer, malignant glioma, glioblastoma, melanoma, B-cell chronic lymphocytic leukemia, diffuse large B-cell lymphoma (DLBCL), and marginal zone lymphoma (MZL).

[0204] In certain aspects, the invention relates to an oncolytic viral vector as shown in any one of the figures or embodiments disclosed herein. EXAMPLES

[0205] The following examples are for the purpose of illustrating various embodiments of the present invention and are not intended to limit the invention in any manner. The examples, together with the methods described herein, are exemplary and are not intended to limit the scope of the invention. Alterations, modifications, and other variations to the described embodiments that fall within the spirit of the invention as defined by the claims are expressly contemplated.

[0206] Example 1 - miR sequence analysis of normal and malignant cells Differential miR expression is a hallmark of many cancers (Lu et al, Nature, 2005). Experiments were performed to identify miRs that were primarily highly differentially expressed in eight different cancer cell lines. Differential expression was identified by comparison with non-cancerous control tissues. A total of 108 samples were sequenced. Sample details are shown in Table 11. [Table 11]

[0207] To facilitate the identification of suitable miRNA target sequences for HSV attenuation in selected cell types, we performed miRNA sequence profiling of cancer lines and non-cancer control tissues. Sequencing libraries of Dicer-processed RNA were generated for cancer and non-cancer cells, including bladder, colon, breast, pancreas, lung, head and neck, schwannoma, glioblastoma, brain, liver, and bone marrow. These miRNA sequencing libraries were normalized to total RNA and sequenced using the HiSeq 2500 ultra-high-throughput screening system and HiSeq Using V4 chemistry, sequencing reads up to 3e 8 Mitochondrial sequences were sequenced at 100 reads / run (Illumina). FASTQ files from sequencing runs were analyzed using the miRNA analysis tool in Basespace (Illumina). Ranking was performed by calculating the mean of normal, mean of cancer, and sorting the normal / cancer ratio from high to low. Heatmaps were generated with natural logarithm values ​​scaled to zero for zero and negative values ​​(scale: black is high expression, white is low expression). Normalized data across samples was expressed as normalized miRNA read counts in a given sample. Normalization relates to the sum of the number of reads in a given sample relative to the other samples in the comparison.

[0208] FIG. 1 shows an example of a heat map of miRNA expression profiles in non-cancerous and cancerous brain tissues for 25 miRNAs. Further examples of heat maps of miRNA expression profiles are shown for non-cancerous and cancerous bladder (FIG. 2), breast (FIG. 3), colon (FIG. 4), brain (FIG. 5), head and neck (FIG. 6), lung (FIG. 7), pancreas (FIG. 8), and schwannoma (FIG. 9) tissues corresponding to 25 miRNAs in each example. Table 12 shows an overview of the expression levels of certain miRs between cancerous and non-cancerous tissues. As shown, the levels of miR-451a are downregulated in all tumor types compared to non-cancerous tissues, representing a potential pan-tumor suppressor miRNA. miR-1-3p is downregulated in all tumor types examined, is present at moderate levels in non-cancerous tissues, and is present at high levels in head and neck tissues. miR-559 was downregulated in all tumor types examined, was generally present at low levels in noncancerous tissues, and was present at high levels in noncancerous lung tissues. miR-145-5p was downregulated in all tumor types examined, and was generally present at high levels in the majority of noncancerous tissues examined. miR-143-3p was downregulated in colon, lung, and pancreatic tumors, and was present at high levels in all normal tissue types and some breast tumor lines. Analysis of the miRNA data revealed that at least 11 miRNAs represent novel and unexpected miRNA expression profiles not previously identified in the literature. [Table 12]

[0209] Many of these identified miRNAs are pan- or multi-tumor specific. For example, expression of miR-451a, miR-559, miR-1-3p, miR-145-3p, and miR143-3p was generally downregulated across all cancer cell lines examined compared to control tissues. This was particularly notable for miR-451a, which was highly expressed in all normal tissue types and substantially downregulated in all cancer types, thus representing a pan-specific tumor suppressor miRNA. Expression of miR-559 was low in normal tissue types except for normal lung tissue, and expression of miR-1-3p and mir-145-3p in normal tissues was variable. Despite the magnitude of difference and variability in absolute expression levels, the average expression of each miR in cancer cell lines was substantially lower compared to the levels in the corresponding normal tissues. These miRNAs are candidates for generating pan-tumor HSV virions that can broadly treat a variety of cancer types. Although the average expression of miR-451a, miR-559, miR-1-3p, miR-145-3p, and miR143-3p was lower in cancer cell lines compared to normal controls, the decrease in expression was not well-prevalent across all cancer cell lines. For example, 2 / 3 of normal bladder samples examined showed increased expression of miR-145-3p, while expression in the remaining samples was substantially similar to the average observed in these cancer cell lines. Similar results were observed in breast cancer cell lines. The average read count for all breast cancer samples was 106, but 5 / 12 samples had normalized read counts >1000 counts, two of which had normalized read counts >40,000 counts.

[0210] These data indicate the possibility of generating a single miR-attenuated oncolytic virus that can target a wide range of tumor types. For example, constructs containing target sequences for miR-124, miR-451a, miR-559, miR-1, and miR-145-3p can be used to treat all tumor types examined (e.g., bladder, colon, breast, pancreas, lung, head and neck, schwannoma, glioblastoma). The variability of miR expression levels in different cancer types indicates the potential need to stratify patients by miR expression or through the use of additional biomarkers.

[0211] Further miRNA profiling between cancerous and non-cancerous tissues was performed using a quantitative expression assay of Nanostring. Results of these experiments are shown for brain samples (Figure 50). The results show the identification of additional miRNAs that show differential expression in cancerous and non-cancerous brain tissues not previously identified in the previous studies outlined above, namely miR-9-5p, miR-128-3p, miR-137, miR-129-2-3p, and miR-487b-3p. Further results are shown for heart samples (Figure 51), showing differential expression of miR-208b-3p, miR-1-3p, miR-208a-3p, miR133-3p, miR-4284, and miR-499a-5p between cancerous and non-cancerous heart tissues. Further results are shown for peripheral nervous system samples (Figures 52A-B), showing differential expression of miR-204-5p, miR-1-3p, miR-206, miR-9-5p, miR-199b-5p, miR-145-5p, miR-100-5p, miR-574-3p. In particular, miR-219a-2-3p, miR-9-5, miR-219a-5p, and miR-204-5p are differentially expressed in the spinal cord.

[0212] Example 2 - Identification of viral genes involved in miR-T attenuation To investigate attenuated phenotype HSV genes, siRNA screening was performed. siRNA screening is an ideal method to investigate RISC attenuation phenotype of immediate early genes and select early genes. siRNAs targeting HSV genes ICP27, ICP4, ICP0, UL5, UL8, UL9, ICP8, ULC39 / 40, ICP22, UL30, UL42, and VP19 were transfected individually and in pools into A253 cells. 24 hours after siRNA transfection, cells were infected with ONCR-003 or ONCR-010 (listed in Table 13 below), each of which contains a GFP cassette. Viral spread was measured by quantifying GFP intensity 48 hours after infection. HSV genes identified as potential hits were confirmed by Western blot, viral titration, and RT-PCR.

[0213] The results of these screens are shown in Figures 47A and 47B. Individual siRNAs that mediated >75% knockdown of the corresponding HSV genes are indicated by arrows in Figure 47A, and the GFP intensity of a selected subset of siRNAs is shown in Figure 47B. As shown in Figure 48, siRNA-mediated knockdown of ICP4, UL5, UL8, ICP8, ICP22, and UL30 substantially reduced ONCR-003 viral replication, as indicated by reduced GFP intensity. Furthermore, siRNA-mediated knockdown of ICP27, ICP4, UL5, UL8, UL9, ICP8, ICP22, and ICP30 substantially reduced ONCR-010 viral replication, as indicated by reduced GFP intensity. ONCR-010-infected cells were further analyzed for the expression of specific viral proteins by Western blot. As shown in Figure 49, a significant reduction in these HSV genes was also observed at the protein level.

[0214] Example 3 - Construction and use of a reporter system to rapidly assay miRNA-based gene attenuation A reporter system was developed to assess miRNA-based gene attenuation using the target sequence of virtually any miRNA and its cognate miRNA. In this system (shown in Figure 10), the target sequence recognized by the miRNA (i.e., hsa-miR-122) was inserted into the 3'UTR of destabilized green fluorescent protein (dsGFP). The cognate miRNA was then expressed via a tetracycline (tet)-inducible promoter, with mCherry used as a control for miRNA expression. All expression vectors were cloned into the tet-repressed vector pcDNA5 Frt / To, which also expresses mCherry (pTF002). All miRNAs for expression, generated by gene synthesis from human genomic DNA, were cloned into pTF002. To generate the attenuation reporter vector, dsGFP was cloned into cDNA3.1+, generating the vector pTF004. The attenuation vector contains four tandem repeats of the reverse complement of the miRNA sequence of interest, separated by 8-16 nucleotides. Plasmids were constructed by inserting synthetically generated oligonucleotides into the 3'UTR of the dsGFP gene in pTF004 using standard molecular biology techniques. On day 1, HEK293TetR cells were transfected with miRNA attenuation and reporter expression plasmids (0.15 μg each, a total of 0.3 μg of CMV promoter-containing plasmid) using Lipofectamine 2000 with the manufacturer's protocol (Invitrogen). On day 2, cells were treated with 5 ng / ml tetracycline and incubated for up to 72 h. After incubation, GFP and mCherry fluorescent signals were detected daily using a SpectraMax® i3x Minimax multimode microplate reader (Molecular Devices) and analyzed using Softmax Pro or Metamorph imaging software (Molecular Devices). Phase images were acquired with exposures of 5–6 ms. Fluorescence images were acquired with 10 ms exposure for GFP (541 nm channel) and 200–1500 ms for mCherry (713 nm channel).

[0215] Figure 11 shows miR-122-mediated attenuation of GFP expression 24 hours after tet-mediated induction of miR-122 expression. Control miRNA mimics, miR-184, miR-34a, and Let7a, do not attenuate GFP levels, and no attenuation of GFP is observed in the absence of tet. Figure 12 shows the effect of miR-122, miR-184, miR-34a, and Let7a mimics on attenuation of GFP cassettes with miR-TS cassettes containing the target sequence of each miR individually and in combination with the cassettes miR-122 / Let7a, miR-122 / Let7a / miR-34a, or miR-122 / Let7a / miR-184. Reduction of GFP is only observed when the appropriate miR and cognate target sequence are present together (circled wells). Figure 13 serves as a non-attenuated control and shows mCherry expression as a measure of expression of miR-122, miR-184, miR-34a, and Let7a mimics. Figure 14 shows the effect of miR-122, miR-124, miR-145, miR-199, and miR-451 mimics expression on an attenuated GFP cassette with a miR-TS cassette containing the target sequence of each miR individually (circled wells). The non-attenuated control is shown in Figure 15, showing the expression of miR-122, miR-124, miR-145, miR-199, and miR-451 as well as mCherry expression using each target sequence individually.

[0216] The ability of additional combinations of miR target sequences to attenuate GFP expression in the presence of the cognate miR mimic is shown in Figures 16-26. In each figure, GFP fluorescence is measured 72 hours after transfection. In each case, insertion of the indicated miR target sequence attenuated GFP expression when the cognate miR was also expressed. Target sequences of miR-122 and miR-184 (Figure 16), miR-34a and miR-184 (Figure 17), Let-7a and miR-184 (Figure 18), miR-124 and miR-184 (Figure 19), miR-145 and miR-184 (Figure 20), miR-199 and miR-451 target sequences (Figure 21), the effect of insertion of target sequences of miR-125 and miR-451 (Figure 22), target sequences of miR-126 and miR-451 (Figure 23), target sequences of miR-127 and miR-451 (Figure 24), target sequences of miR-133 and miR-451 (Figure 25), and target sequences of miR-223 and miR-451 (Figure 26), respectively.

[0217] Thus, these data indicate that expression of miRs can result in specific attenuation of genes that express target sequences of the cognate miR.

[0218] Example 4 - Generation of miRNA-attenuated HSV After miRNA target sequences and reporter gene-based validation of the cognate miRNA pairs, we generated an HSV-based virus containing the miR-TS cassette. The product was a bacterial artificial chromosome (BAC), i.e., a full-length genomic clone of the KOS strain of HSV-1 on a BAC as described (Mazzacurati et al., Mol Ther., 2015). BACdeleted the internal repeat (joint) region containing one copy each of the diploid genes ICP0, ICP34.5, LAT, and ICP4, and the promoter of the ICP47 gene. This deletion facilitates the engineering of the remaining copies of these four deleted genes and provides ample space for the potential integration of transgenes that enhance the oncolytic activity of this virus, enhance tumor specificity by reducing the expression of the neurovirulence factor ICP34.5, and ablation of ICP47 expression aids in immune recognition of infected cancer cells by virus-specific T cells. KG BAC also contains an open reading frame (ORF) for GFP fused to the glycoprotein C (gC) ORF via a 2A peptide sequence, allowing for the observation of late (post-replication) viral gene expression. BAC contains a pair of mutations in the gB gene that have been shown to enhance HSV entry via non-canonical receptors (see, e.g., International PCT Publication No. WO2011 / 130749). A miR-TS cassette containing four repeats of the target sequence of miR-124-3p was recombined into the 3'UTR of ICP4 to generate the 2A5B vector (see, e.g., International PCT Publication No. WO2015 / 066042), and an expression cassette for MMP9 was inserted into the intergenic region between the UL3 and UL4 genes to generate the 2A5B-MMP9 vector (ONCR-003). Target sequence cassettes for additional miRNAs were recombined into the 3'UTR of the ICP4, ICP27, UL8, UL42, and / or ICP34.5 genes of ONCR-003 to generate the constructs shown in Table 13 below. All BAC constructs were converted into viral particles by transfection of Vero-Cre cells with simultaneous removal of the BAC sequences located between the loxP sites. After plaque purification, viral stocks were prepared and titered on Vero cells. [Table 13-1] [Table 13-2] [Table 13-3] # miR-451a is non-canonically processed by Ago2 and does not have -3p and -5p arms

[0219] Example 5 - Viral infectivity assay using miRNA-attenuated HSV particles To assay viral infectivity and replication in normal and cancerous cells, miRNA-attenuated HSV particles were examined in the following in vitro assays. On day 1, each infected cell type was transfected with HSV particles to achieve a multiplicity of infection (moi) of 0.01. On days 2 to 5, viral infectivity was assayed by GFP detection using a SpectraMax® i3x Minimax multimode microplate reader (Molecular Devices) and analyzed using Softmax Pro or Metamorph imaging software (Molecular Devices). Phase images were acquired with an exposure of 5-6 ms. Fluorescence images were acquired with a GFP (541 nm channel) exposure of 10 ms and mCherry (713 nm channel) exposure of 200-1500 ms to assess any potential nonspecific autofluorescence signal.

[0220] Replication of ONCR-011 was significantly attenuated in postmitotic lung tissues due to the presence of the miR-T125 cassette in the ICP27 gene and the high levels of miR-125a in these cells (3000 counts, Table 14 below), as shown in Figure 27A (readout by GFP-positive cell quantification) and Figure 27C (readout by quantitative PCR). Although ONCR-011 and its control virus, ONCR-003, contain the target sequence of miR-124 in the ICP4 gene, miR-124 is present at low levels (<100 counts, Table 14 below) that are insufficient to attenuate viral replication (Figures 27B and 27D). Both ONCR-011 and ONCR-003 replicated freely in head and neck cancer cells (A253), because these cells contain low levels of both miR-125a and miR-124 (<100 counts) (Table 14). [Table 14]

[0221] Figure 28 shows the replication of miR-145 attenuation construct, ONCR-013, in HCC1395 and A253 cells. As shown in Figure 28A (readout by GFP positive cell quantification) and Figure 28B (readout by quantitative PCR), the replication of ONCR-013 was significantly attenuated in HCC1395 cells, but not in A253 cells due to the high expression of miR-145 in A253 and its absence in HCC1395 cells (Table 15). [Table 15]

[0222] Figure 29 shows the attenuation of miR-143-3p attenuation construct (ONCR-012) and miR-199a-5p attenuation construct (ONCR-014) in normal BEAS-2B lung cells. As shown, the replication of ONCR-014 is significantly attenuated in non-cancerous lung tissues (Figure 29A, readout by GFP-positive cell quantification, and Figure 29B, readout by quantitative PCR), indicating that the target sequence of miR-199a-5p can attenuate viral replication in normal lung cells.

[0223] Example 6 - Attenuation of oHSV replication containing multiple miRNA target sequences at multiple loci Viral infectivity and replication of constructs containing miR-TS cassettes at multiple loci were evaluated in A253, Hep3B, and Huh7 cells. Results are provided herein for the miR-attenuated HSV constructs of ONCR-036, ONCR-063, ONCR-093, ONCR-094, ONCR-095, and ONCR-096. Each of these viruses contained one or more miR-124 target sequences, one or more miR-122 target sequences, and / or one or more miR-125a target sequences inserted into the ICP4, ICP27, and / or UL42 loci. Expression of miR-122 and miR-125a in each cell line was evaluated by TaqMan assay. Briefly, total RNA, including the small RNA fraction, was isolated from grown cells on miRNeasy columns. This RNA was then used as a substrate for miR-122 and miR-125 specific TaqMan assays, and parallel TaqMan assays for U6 snRNA were performed to normalize expression levels per cell type by the ΔΔCT method. These data are presented as fold change relative to the lowest cell line of interest in each assay (A253 cells, FIG. 30A; Hep3B, FIG. 30B). As shown, A253 cells do not express miR-122 or miR-125a. Hep3B cells express high levels of miR-125 and low levels of miR-122, and Huh7 cells express miR-125a and high levels of miR-122.

[0224] Viral infectivity and replication were assessed in in vitro assays. Briefly, cells were seeded at 45,000 cells / well in 48-well dishes and cultured overnight. On day 1, HSV particles were introduced into each cell type to achieve a multiplicity of infection (moi) of 0.01. 48 hours after infection, viral infectivity was assessed by fluorescence microscopy. The results of this experiment are shown in Figure 30C, where viral replication is shown by eGFP levels. These data show that attenuation of viral replication in cells expressing both miR-122 and miR-125a at intermediate to high levels (Huh7 cells) was improved compared to the attenuation observed in cells expressing only one of the cognate miRs (Hep3B, which express high levels of miR-125a) or compared to cells expressing neither of the cognate miRs (A253 cells, which express neither miR-125a nor miR-122).

[0225] Viral spread and protein expression were also evaluated. Briefly, cell lysates were harvested 72 hours after infection and subjected to PAGE and Western blot analysis. Anti-HSV1 capsid (VP5) antibody was used to observe viral spread / protein expression, and B-actin antibody was used as a loading control. In A253 cells, which do not express miR-125a or miR-122, high viral replication levels were observed for all miR-attenuated viruses (Figure 31, lanes 3-6) compared to the non-attenuated control (Figure 31, ONCR-003 as non-attenuated control). However, viral replication was reduced in Huh7 cells expressing both cognate miRNAs, especially high levels of miR-122. These data provide a good example of viral attenuation by specific miRs versus control viruses.

[0226] To further confirm that the reduction in viral replication of miR-attenuated HSV viruses was mediated by the expression of specific miRs, miR-122 and miR-125a mimics were transfected into A253 cells, which do not express endogenous miR-122 or miR-125a. Briefly, A253 cells were seeded at 35,000 cells / well in 48-well dishes and cultured overnight. These cells were then transfected with Ambion miRNA mimics at 2.5 pM / well using Lipofectamine RNAiMAX. Total RNA, including the small RNA fraction, was isolated from grown cells using miRNeasy columns. These RNA samples were used as substrates for miR-122 and miR-125 specific TaqMan assays, and parallel TaqMan assays against U6 snRNA were performed to normalize expression levels per cell type using the ΔΔCT method. These results are shown in Figure 32. As shown in Figures 32A and 32B, miR-122 and miR-125 mimics specifically increased intracellular miR-122 and miR-125 expression levels by several orders of magnitude in A253 cells.

[0227] The next day, cells were counted individually and infected with miR-attenuated HSV particles of ONCR-036, ONCR-063, ONCR-093, ONCR-094, ONCR-095, or ONCR-096 and the non-attenuated control of ONCR-003 at an MOI of 0.01. Each of these oHSV viruses was added in 50 μL for 1 hour, followed by complete medium. eGFP expressed by productive virus infection was assessed by fluorescent microscopy images taken 48 hours after infection. All images were exposed and processed similarly. The results of this experiment are shown in Figure 32C and were quantified by GFP detection using a SpectraMax® i3x Minimax multimode microplate reader (Molecular Devices) and analyzed using Softmax Pro in Figure 32D. These data illustrate the attenuation of viral replication in the presence of miR-122 mimics for all viruses except ONCR-003 (WT). Furthermore, the level of attenuation was proportional to the copy number of the miR target sequence present in the HSV construct, with the greatest reduction in GFP in ONCR-063, ONCR-093, and ONCR-096, each of which contains four miR-122 target sequence repeats in the ICP27 gene. Furthermore, these data illustrate the attenuation of viral replication in the presence of the miR-125a mimics ONCR-093, -094, -095, and -096 compared to ONCR-003 (WT) and ONCR-036 / ONCR-063 (each of which contains only miR-122 target sequences).

[0228] Similar experiments were performed to evaluate viral replication of additional constructs containing multiple miR-TS cassettes in two or more viral genes (e.g., ONCR-129, ONCR-131, ONCR-125, ONCR-126, ONCR-128, ONCR-130). In each case, expression of one or more miRNAs was able to attenuate viral replication of the particular construct containing the target sequence corresponding to the expressed miRNA (data not shown).

[0229] Example 7 - Computational methods for generating miR-TS cassettes Based on the data described in the previous examples, miR-targeting sequence (miR-TS) cassettes were generated for insertion into specific HSV genes. Targeting sequences of miRs that show differential expression between cancerous and non-cancerous cells of different tissue types were selected to generate cassettes that can attenuate viral replication in a wide range of healthy cells while allowing viral replication in cancerous cells with low expression of the same miR.

[0230] This example shows a method for generating candidate miR-TS cassettes and the preferred candidates selected from the list. The method is shown in FIG. 1, which is implemented by the computer language Python. The input of the method includes a list of seeds to be excluded, i.e., in this example, the seed sequences of miRNAs expressed in cancer are excluded, and a list of miR-TSs to be included in the cassette. The included miR-TSs used in this example are provided in Table 10, along with the sequences of the parent miRNAs and their respective nucleotide (nt) lengths. It will be understood that the cassettes can be made from incomplete miR-TSs, since miR-TSs allow for imperfect correspondence between microRNAs and miR-TSs. The miR-TS cassettes can be made from other miR-TSs and can include miR-TSs based on any microRNA known or previously discovered in the art.

[0231] In this example, we designed four miR-TS cassettes, one for each of the four essential viral genes: ICP4, ICP27, ICP34.5, and UL8, as shown in Table 16. In principle, however, these cassettes could be used with other viral (or non-viral) genes. These viral genes are in a reverse-complementary orientation in our preferred vectors, so we used the reverse-complementary sequence in each case. The abbreviation "miR-126m" refers to a mutant version of the miR-126 site to improve this site by removing the seed match to the oncomiR miR-155. The abbreviation "miR-128m" refers to a mutant version of the miR-128 site to improve this site by removing the seed match to the oncomiR miR-27a-3p. [Table 16-1] [Table 16-2]

[0232] A cassette designed against ICP4 can be used to downregulate any gene to which it is operably linked in smooth muscle (due to the target site of miR-143) and striated muscle (due to the target site of miR-1). A cassette designed against ICP27 can be used to downregulate any gene to which it is operably linked in healthy tissues due to the target sites of miR-128m (expressed in cortical neurons), miR-122 (expressed in liver), and miR-219 (expressed in brain, spinal column, and nerves). A cassette designed against ICP27 can be used to downregulate any gene to which it is operably linked in healthy tissues due to the target sites of miR-128m, miR-204, and miR-219. A cassette designed against UL8 can be used to downregulate any gene to which it is operably linked in non-tumor tissues due to the target sites of mRNA: miR-217, miR-137, and miR-126m.

[0233] This program was run and output 10,000-100,000 cassettes for each combination that matched the criteria (each of which is optional) used in the following list of examples: (1) four copies of each miR-TS site arranged in any order (in reverse-complementary orientation), (2) except that the same miR-TS cannot be repeated adjacent to itself, (3) separated by a 4-nucleotide spacer with random sequence, (4) does not contain any seeds from the list of seeds to exclude, and (4) does not contain a polyadenylation sequence (AATAAA). The program can also optionally add 5' arm (CATGGACGAGCTGTACAAGTAAAGC) and 3' arm (GCGACCGGCTAGCGTACTAGCTTAG) sequences for Gibson assembly cloning (Nat Methods 2009, 6(5):343-5).

[0234] The program then calculated the folding delta-G of the candidate sequences using the "fold" subroutine of the ViennaRNA package in a sliding window of 40 nt (Lorenz et al. Algorithms for Molecular Biology, 6:1 26, 2011, available at https: / / www.tbi.univie.ac.at / RNA / ). The sliding window calculations were saved as a list for each candidate sequence, and the candidate sequences were sorted by the maximum absolute value of all delta-G values ​​in the list (i.e., by the folding energy of the strongest secondary structure element of the RNA). The sequences were further manually reviewed to eliminate candidate sequences with multiple low energy minima. Whenever possible, candidate sequences without minima were selected. In this way, candidate sequences without strong RNA secondary structure (low maximum absolute value of delta-G) and without or with few minima in the folding energy of the predicted secondary structure were identified.

[0235] Finally, a microRNA target scanning algorithm (miranda v3.3a) was run on each candidate sequence to ensure that the desired miR-TS was present and that the program had not inserted any undesired miR-TS.

[0236] Examples of sequences generated by this method are provided in Table 17. The length of the cassette is defined as the number of nucleotides from the first miR-TS to the last miR-TS, including the first and last miR-TS. The length of the cassette is the length of the sequence output by this program minus 8 nt (=2*4 nt first and last spacers) because this program adds a 4 nt 5' first spacer and a 3' last space in addition to the length definition used herein. [Table 17-1] [Table 17-2]

[0237] The ability of the miR-TS cassettes listed in Table 17 to attenuate viral replication is shown in Figures 53A-B.

[0238] Additional constructs containing miR-TS cassettes designed in this manner were constructed, as shown in Table 18. [Table 18-1] [Table 18-2]

[0239] Example 8 - Cytotoxicity of miR-attenuated HSV constructs Experiments were performed to evaluate the in vitro cytotoxicity of selected miR-attenuated HSV constructs, ONCR-125, ONCR-131, ONCR-142, and ONCR-157. Various cancer cell lines were infected with the indicated constructs at MOIs of 30, 10, 3.33, 1.11, 0.37, 0.12, 0.04, 0.13, 0.0045, and 0.0015, and cell viability was assessed 72 hours post-infection. Cell lines used included colorectal adenocarcinoma cell lines SW837 and COLO205, melanoma cell lines SKMEL28 and A375, small cell lung cancer cell line H446, pancreatic adenocarcinoma cell line BXPC3, and breast cancer cell line BT549. The IC50 for each construct was calculated and is shown in Table 19 below. The results of each of these experiments are shown in Figures 54A-E. [Table 19]

[0240] Example 9 - IL-12 enhances the long-distance transmission of HSV Experiments were performed to evaluate the effect of IL-12 on the long-distance effect of oncolytic HSV. Briefly, ONCR-133 constructs containing an ICP4 miR-TS cassette containing four repeats of miR-124-3p and an expression cassette encoding mouse IL-12 were administered to mice in an MC38 tumor model. As shown in Figure 55, ONCR-133 significantly inhibited tumor growth of injected tumors compared to vehicle-treated controls (p<0.0001). ONCR-133 treatment also significantly inhibited tumor growth of non-injected tumors (p<0.005), indicating improved long-distance effect.

[0241] Unexpectedly, expression of an additional immune activating payload, ULBP3, did not further enhance the tumor growth suppression effect of HSV expressing IL-12. As shown in FIG. 56, mice treated with ONCR-133+ONCR-007 (HSV construct expressing ULBP3) or ONCR-133+ONCR-002 (HSV construct not expressing additional payload molecules) both showed significant suppression of tumor growth compared to vehicle-treated controls. However, there was no additional benefit of expression of ULBP3 in suppressing the growth of injected or non-injected tumors. In fact, as shown in the table in FIG. 56, expression of additional ULBP3 slightly reduced the tumor growth suppression observed with expression of IL-12 alone.

[0242] Similarly, the expression of additional CXCL10 did not further enhance the antitumor effect of HSV expressing IL-12. Mice were treated with ONCR-113 (HSV construct expressing IL-12 and MMP9) + ONCR-106 (HSV construct expressing CXCL10 and MMP9) or ONCR-113 + ONCR-031 (HSV construct expressing MMP9). As shown in Figure 57, the expression of additional CXCL10 in the ONCR-106 + ONCR-113 treatment group did not improve the inhibition of tumor growth in either injected or non-injected tumors compared to mice treated with ONCR-031 + ONCR-113. In fact, as shown in the table in Figure 57, the expression of additional CXCL10 slightly reduced the tumor growth inhibition in both injected and non-injected tumors.

[0243] Example 10 - Expression of CCL4 further enhances the long-distance spread of HSV An experiment was performed to evaluate the effect of CCL4 in tumor growth inhibition in the MC38 model described in Example F. The results of this experiment are shown in Figure 58 and Table 20 below. Mice were treated with one of four constructs: ONCR-133 (expressing IL-12), ONCR-151 (expressing IL-12, CXCL10, and XCL1), ONCR-152 (expressing IL-12, CXCL10, and FLT3 ligand), or ONCR-153 (expressing IL-12, CXCL10, and CCL4). As shown in Figure 58, treatment with all of ONCR-133, -151, -152, and -153 significantly inhibited tumor growth of injected and non-injected tumors compared to vehicle controls. However, mice treated with ONCR-153 showed increased tumor growth inhibition compared to treatment with ONCR-133 in both injected and non-injected tumors, while ONCR-151 or -152 showed a slight decrease in efficacy compared to ONCR-133 treatment. These results indicate that expression of CCL4 can increase the tumor growth inhibition and long-range effects of oncolytic HSV beyond those seen with expression of IL-12 alone. [Table 20-1] [Table 20-2]

[0244] Tumors from mice treated with ONCR-153 were harvested and assessed for the presence of HSV by RT-PCR analysis of the gD gene. As shown in Figures 59A and 59B, HSV was detected in the injected tumors but not in the non-injected tumors, indicating that the suppression of tumor growth observed in the non-injected tumors was due to a long-range effect of viral administration and not due to viral spread. Tumors were also assessed for the presence of the three payloads, IL-12, CXCL10, and CCL4. As shown in Figures 60A-60C, expression of the payloads was maximal in the injected tumors 24 hours after treatment and decreased thereafter. Levels of these payloads were also assessed in the serum of mice treated with ONCR-153 (Figures 61A-61C), and only expression of CXCL10 was observed. However, as shown in Figure 62, treatment of mice with ONCR-153 induced an intratumoral IFNγ response in both injected and non-injected tumors (left panel). Similarly, increased expression of IFNγ was observed in the serum of ONCR-153-treated mice. These data further indicate that the combined expression of IL-12 and CCL4 by HSV induces a local immune response that may contribute to the long-range effects observed with ONCR-153.

[0245] Example 11 - Expression of FLT3 further enhances the long-distance spread of HSV An experiment was performed to evaluate the effect of FLT3 in tumor growth inhibition in the MC38 model described in Example F. The results of this experiment are shown in Figure 63 and Table 21 below. Mice were treated with one of three combinations of constructs expressing different payloads as outlined in Table 21. As shown in Figure 63, treatment with a combination of ONCR-152 and ONCR-140 enhanced tumor growth inhibition in non-injected tumors, indicating that expression of FLT3L can enhance long-range effects beyond those seen with IL-12, CXCL10, and CCL4. [Table 21]

[0246] Example 13 - Expression of CD40L enhances the long-distance spread of HSV An experiment was performed to evaluate the effect of CD40L in tumor growth inhibition in the MC38 model described in Example F. The results of this experiment are shown in Figure 64 and Table 22 below. Mice were treated with constructs expressing different payloads as outlined in Table 22. As shown in Figure 64, treatment with a combination of ONCR-153 and ONCR-147 enhanced tumor growth inhibition in non-injected tumors, indicating that expression of CD40L can enhance long-range effects beyond those seen with IL-12, CXCL10, and CCL4. [Table 22]

[0247] Example 12 - Expression of anti-CTLA4 enhances the long-distance spread of HSV An experiment was performed to evaluate the effect of CTLA4 in tumor growth inhibition in the MC38 model described in Example F. The results of this experiment are shown in Figures 64A-66C and Table 23 below. Mice were treated with constructs expressing different payloads as outlined in Table 23. As shown in Figures 66A-66C, treatment with a combination of ONCR-149 and ONCR-139 enhanced tumor growth inhibition in injected and non-injected tumors compared to treatment with ONCR-149 alone, indicating that expression of anti-CTLA4 can enhance anti-tumor and long-range effects beyond those seen with IL-12. [Table 23]

[0248] Similar experiments were performed to evaluate the effect of anti-CTLA4 on the expression of IL-12, CXCL10, FLT3L, and CCL4 in the 4T1-luc model. 6 Balb / c mice were subcutaneously injected with 100 μL of DPBS containing 4T1-luc cells into the right flank. Tumors with an average volume of 100 mm 3 When the 100-fold increase was reached, mice were infected with HSV-1 for 3e 6PFU / injection. Dosing was repeated twice every 3 days for a total of 3 doses (Q3Dx3). Tumor growth and body weight were monitored twice weekly. The experiment was terminated on day 22, when the first clinical signs of metastatic disease were observed. Lung metastases were visualized ex vivo using an IVIS Lumina LT system and analyzed with Living Image software. Mice were treated with combinations of constructs as shown in Table 24. The results of this experiment are shown in Figure 67. As shown, treatment with ONCR-152 and -139 showed improved efficacy in tumor growth inhibition compared to treatment with ONCR-139 alone. [Table 24]

[0249] Example 13 - Treatment with anti-PD1 expression further enhances the efficacy of HSV An experiment was performed to evaluate the effect of anti-PD1 treatment on HSV-mediated tumor growth inhibition in the MC38 model described in Example F. The results of this experiment are shown in Figure 68 and Table 25 below. Mice were treated with constructs expressing different payloads as outlined in Table 25. As shown in Figure 68, treatment with a combination of ONCR-153 and anti-PD1 enhanced tumor growth inhibition of injected tumors compared to that seen with ONCR-152 or anti-PD1 alone. [Table 25]

[0250] Example 14 - Treatment of patients with pancreatic, lung, or colon cancer Patients with pancreatic, lung, or colon cancer are treated using the compositions and methods disclosed herein. HSV-based viral stocks can be generated that are attenuated by incorporating one or more miRNA target sequences into UL19, ICP4, ICP27, or UL42 (or other viral genes), as shown in Figures 39-50. In some cases, genome editing capabilities for tumor destruction and / or microenvironment remodeling are incorporated into the virus in addition to the miRNA target sequences, as shown in Figures 45-46. In a particular embodiment, an HSV-based stock is used that includes miR-124, miR-451a, miR-143-3p, and miR-559 attenuation cassettes integrated into ICP4 and ICP27. In another embodiment, an HSV-based stock includes an attenuation cassette with one or more copies of miR-122 and miR-125a target sequences integrated into ICP27 and / or UL42 genes. For any of these compositions, the HSV-based stocks are generated according to the methods described in Example 3. The cassette of the miRNA target sequence is introduced into the 3'UTR of ICP4, ICP27UL19, and / or UL42 genes. The BAC construct is converted into viral particles by transfection of Vero-Cre cells with simultaneous removal of the BAC sequence located between the loxP sites. After plaque purification, the viral stock is further purified, buffer exchanged, and titered in Vero cells. For in vivo administration to patients with pancreatic, lung, or colon cancer, the HSV particles are prepared in phosphate buffered saline (PBS) with a pharma- ceutical acceptable stabilizer. On the day of treatment, 10 9 The vector genomes are administered by intratumoral injection in a volume of 1.0 mL in a pharma- ceutical acceptable carrier. Patients are monitored for tumor regression using standard therapeutic treatments at appropriate time intervals based on the patient's individual prognosis.

[0251] Example 15 - Treating Patients with Brain, Bladder, Breast, or Head and Neck Cancer Patients with brain cancer, bladder cancer, breast cancer, or head and neck cancer are treated using the compositions and methods disclosed herein. HSV-based virus stocks are generated according to the methods described in Example 3, including miR-124, miR-451a, miR-145-3p, and miR-559 attenuation cassettes. Cassettes of the target sequences of these miRNAs are introduced into the 3'UTR of ICP4 (miR-124) and ICP27 (miR-451a, miR-145-3p, and miR-559) genes, as shown in Figure 48. The BAC constructs are converted into virus particles by transfection of Vero-Cre cells with simultaneous removal of the BAC sequences located between the loxP sites. After plaque purification, the virus stocks are further purified, buffer exchanged, and titered on Vero cells. For in vivo administration to patients with brain, bladder, breast, or head and neck cancer, HSV particles are prepared in phosphate buffered saline (PBS) with a pharma- ceutically acceptable stabilizer. On the day of treatment, 10 9 The vector genome is administered by intratumoral injection in a volume of 1.0 mL in a pharma- ceutical acceptable carrier. Patients are observed with standard therapeutic treatments for appropriate time intervals based on the individual prognosis of the patient. Potential outcomes of these studies include partial or complete inhibition of tumor growth, inhibition of tumor metastasis, long-term remission, and / or lower recurrence rates compared to standard treatments.

[0252] Example 16 - Treatment of patients with Schwannoma Schwannoma patients are treated using the compositions and methods disclosed herein. HSV-based virus stocks are generated according to the methods described in Example 3, including miR-124-3p, miR-205-5p, miR-141-5p, and miR-31-5p attenuation cassettes. These miRNA target sequence cassettes are recombined into the 3'UTR of ICP4 (miR-124) and ICP27 (miR-205-5p, miR-141-5p, miR-31-5p) genes, as shown in FIG. 49. The BAC constructs are converted into virus particles by transfection of Vero-Cre cells with simultaneous removal of the BAC sequences located between the loxP sites. After plaque purification, the virus stocks are further purified, buffer exchanged, and titered in Vero cells. For in vivo administration to Schwannoma patients, HSV particles are prepared in phosphate buffered saline (PBS) with pharma- ceutical acceptable stabilizers. On the day of treatment, 10 9 The vector genome is administered by intratumoral injection in a volume of 1.0 mL in a pharma- ceutical acceptable carrier. Patients are observed with standard therapeutic treatments for appropriate time intervals based on the individual prognosis of the patient. Potential outcomes of these studies include parti...

Claims

1. 1. A recombinant oncolytic herpes simplex virus (HSV), comprising: (i) a first microRNA (miRNA) target sequence cassette (miR-TS cassette) inserted into the ICP4 gene, the cassette comprising at least two target sequences for each of miR-124, miR-1, and miR-143; (ii) a second miR-TS cassette inserted into the ICP27 gene, the cassette comprising at least two target sequences for each of miR-128, miR-219a, and miR-122; and (iii) a third miR-TS cassette inserted into the ICP34.5 gene, the cassette comprising at least two target sequences for each of miR-219a, miR-204, and miR-128. The recombinant HSV comprising:

2. The recombinant HSV of claim 1, wherein each of the miR-TS cassettes comprises four target sequences for each of the miRNAs, respectively.

3. 2. The recombinant HSV of claim 1, wherein each of the miR-TS cassettes is inserted within the 5' untranslated region (UTR) or 3' UTR of ICP4, ICP27, or ICP34.

5.

4. The first miR-TS cassette comprises: comprising a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 852, or comprising the nucleic acid sequence of SEQ ID NO: 852; Consisting of the nucleic acid of SEQ ID NO: 852; The recombinant HSV of claim 1.

5. The second miR-TS cassette comprises: comprising a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 853, or comprising the nucleic acid sequence of SEQ ID NO: 853; Consisting of the nucleic acid of SEQ ID NO: 853; The recombinant HSV of claim 1.

6. the third miR-TS cassette comprising a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 854, or comprising the nucleic acid sequence of SEQ ID NO: 854; Consisting of the nucleic acid of SEQ ID NO: 854; The recombinant HSV of claim 1.

7. The recombinant HSV of any one of claims 1 to 6, further comprising a heterologous polynucleotide sequence encoding one or more payload molecules.

8. The heterologous polynucleotide sequence is 8. The recombinant HSV of claim 7, encoding one or more payloads selected from the group consisting of IL-12, CCL4, FLT3L, an anti-PD1 antibody or an antigen-binding fragment thereof, an anti-CTLA4 antibody or an antigen-binding fragment thereof, an anti-FAP / anti-CD3 bispecific T cell engaging antibody, an anti-PD1-Fc-41BBL protein, and CXCL10.

9. (i) one or more proteins or oligonucleotides that reduce the expression or inhibit the function of a miR, gene, or tissue inhibitor of metalloproteinase (TIMP); or (ii) Protease-activated antibodies The recombinant HSV of any one of claims 1 to 6, comprising one or more polynucleotides encoding:

10. 10. The recombinant HSV of claim 9, wherein the one or more polynucleotides are inserted into a locus in the viral genome or between two loci in the viral genome.

11. The viral locus is an internal repeat joint region, ICP0, LAT, UL1, UL3, UL4, UL5, UL6, UL7, UL8, UL9, UL11, UL12, UL14, UL15, UL17, UL18, UL19, UL20, UL22, UL25, UL26, UL26.5, UL27, UL28, UL29, UL30, UL31, UL32, UL33, UL34, UL35, UL36, UL37, UL38, UL39, UL40, UL42, 11. The recombinant HSV of claim 10, selected from the group consisting of UL48, UL49, UL52, UL53, UL54, ICP0, ICP4, ICP22, ICP27, ICP47, gamma-34.5, US3, US4, US5, US6, US7, US8, US9, US10, US11, and US12, wherein the internal repeat joint region comprises one copy each of the diploid gene ICP0, ICP34.5, LAT, ICP4, and ICP47 promoters.

12. A nucleic acid molecule encoding a recombinant HSV according to any one of claims 1 to 11.

13. A composition comprising the recombinant HSV of any one of claims 1 to 11 and a pharma- ceutically acceptable carrier.

14. 14. A composition comprising a recombinant HSV according to any one of claims 1 to 11 for killing a cancerous cell, or the composition according to claim 13, wherein the cancerous cell is exposed to the composition under conditions sufficient for the oncolytic virus to infect and replicate within the cancerous cell, and replication of the oncolytic virus within the cancerous cell results in cell death.

15. The composition of claim 14, wherein the cancerous cells have reduced expression of a miR capable of binding to a target sequence of one or more miRs compared to expression of the miR in a non-cancerous cell.

16. The composition of claim 15 , wherein the expression level of the miR in the cancerous cell is at least 5% lower than the expression level of the miR in the non-cancerous cell.

17. The composition of claim 14, wherein replication of the oncolytic virus is increased or maintained in cancerous cells having reduced expression of the miR capable of binding to a target sequence of the one or more miRs.

18. 18. The composition of claim 17, wherein the viral replication is at least 5% higher in the cancerous cells compared to the viral replication in the non-cancerous cells.

19. Use of a recombinant HSV according to any one of claims 1 to 11, or a composition according to claim 13, in the preparation of a medicament for treating cancer in a subject in need thereof.

20. 20. The use according to claim 19, wherein the oncolytic virus or the composition is administered intravenously, subcutaneously, intratumorally, intramuscularly or intranasally.

21. the cancer is selected from lung cancer, breast cancer, ovarian cancer, cervical cancer, prostate cancer, testicular cancer, colorectal cancer, colon cancer, pancreatic cancer, liver cancer, gastric cancer, head and neck cancer, thyroid cancer, malignant glioma, glioblastoma, melanoma, B-cell chronic lymphocytic leukemia, diffuse large B-cell lymphoma (DLBCL), and marginal zone lymphoma (MZL); 20. The use according to claim 19, wherein the lung cancer is small cell lung cancer or non-small cell lung cancer, or the liver cancer is hepatocellular carcinoma (HCC).

22. Use of a recombinant HSV according to any one of claims 1 to 11 or a composition according to claim 13 in the preparation of a medicament for killing cancerous cells.

23. A composition comprising a recombinant HSV according to any one of claims 1 to 11 or a composition according to claim 13 for treating cancer in a subject in need thereof.

24. 24. The composition of claim 23, wherein the composition is administered intravenously, subcutaneously, intratumorally, intramuscularly, or intranasally.

25. the cancer is selected from lung cancer, breast cancer, ovarian cancer, cervical cancer, prostate cancer, testicular cancer, colorectal cancer, colon cancer, pancreatic cancer, liver cancer, gastric cancer, head and neck cancer, thyroid cancer, malignant glioma, glioblastoma, melanoma, B-cell chronic lymphocytic leukemia, diffuse large B-cell lymphoma (DLBCL), and marginal zone lymphoma (MZL); 25. The composition of claim 24, wherein the lung cancer is small cell lung cancer or non-small cell lung cancer, or the liver cancer is hepatocellular carcinoma (HCC).

Images