Modified Salmonella typhi strains

Abstract

The present invention relates to modified live, attenuated strains of Salmonella enterica serovar Typhi, in which the native, surface-exposed polysaccharide and flagellin antigens have been converted to or augmented by those from other Salmonella strains, including S. enterica serovars Paratyphi, S. enterica serovars Typhimurium, and S. enterica serovars Enteritidis. The present invention also relates to modified S. enterica strains suitable for use as components of vaccines against typhoid fever and salmonellosis.

Description

[Technical field]

[0001] The present invention relates to the engineering of attenuated Salmonella enterica serovar Typhi strains such that their native surface-exposed polysaccharide and flagellin antigens are converted to or augmented by those from other Salmonella strains, including S. enterica serovar Paratyphi, S. enterica serovar Typhimurium, and S. enterica serovar Enteritidis, taking advantage of the long history of safe use of S. enterica strains in humans as typhoid vaccines to deliver the homologous antigens from other Salmonella species as vaccine components against typhoid fever and salmonellosis. [Background technology]

[0002] Typhoid fever is restricted to humans and is caused by two serotypes of Salmonella enterica, Salmonella typhi and Salmonella paratyphi. Salmonella paratyphi consists of serotypes A, B, and C. Typhoid fever caused an estimated 21.7 million cases and 217,000 deaths in 2000, and there are 5.4 million cases of paratyphoid fever annually (Crump et al., 2004, Bull. World Health Organ. 82:346-353). Typhoid fever and paratyphoid fever are very similar infections of the reticuloendothelial system, intestinal lymphoid tissue, and gallbladder that cause an acute febrile illness. Blood cultures and serological tests are required to distinguish between them. Typhoid fever epidemics are common in sub-Saharan Africa and Asia, where S. Paratyphi A is responsible for up to 50% of typhoid fever cases in Asia, and typhoid fever is also endemic in Latin America (Crump and Mintz, 2010, Clin. Infectious Dis. 50:241-246). S. Paratyphi A is the most abundant strain causing paratyphoid fever worldwide, and some reports have suggested it may be responsible for an increase in the total number of typhoid fever cases (Fangtham and Wilde, 2008, Int. J. Travel Med. 15:344-350).

[0003] All licensed injectable typhoid vaccines use the Vi capsular polysaccharide antigen purified from Salmonella typhi and are single-dose with a recommended booster dose every 2-3 years (Martin, 2012, Curr. Opin. Infect. Dis., vol. 25: pp. 489-499). The main adverse event is pain at the injection site. The only live attenuated typhoid vaccine, Salmonella typhi Ty21a (Vivotif®), was developed by chemical mutagenesis of Salmonella typhi Ty2 and is administered orally in 3-4 doses, requiring a booster dose 5-7 years later (Martin, 2012, Curr. Opin. Infect. Dis., vol. 25: pp. 489-499). Ty21a is very safe and well tolerated. A clinical trial comparing the injectable vaccines Typherix® and Vivotif® found that only Vivotif® produced an immune response that mimicked natural infection (Kantele et al., 2013, Plos One, 8:e60583).

[0004] The Vi antigen is not present in S. Paratyphi A or B (but is expressed by S. Paratyphi C), and therefore the injectable Vi vaccine is ineffective against these two most common strains of Paratyphi. Ty21a has been shown in field studies to be cross-reactive with S. Paratyphi B. It has been shown to confer cross-protection (Levine et al., 2007, Clin. Infectious Dis. 45:S24-S28). However, field studies with Ty21a have shown little or no cross-protection against Salmonella paratyphi A despite the generation of cross-reactive antibody responses (Wahid et al., 2012, Clin. & Vaccine Immunol. 19:825-834).

[0005] In an attempt to address the short duration of protection and lack of memory responses of the Vi vaccine, the Vi polysaccharide has been conjugated to carrier proteins, resulting in a new generation of Vi glycoconjugate vaccines. Carrier proteins include Pseudomonas aeruginosa exotoxin, tetanus toxoid, and diphtheria toxoid (Martin, 2012, Curr. Opin. Infect. Dis., 25:489-499). Injectable conjugates of purified O antigens from Salmonella Paratyphi A have also been developed, mainly O2 conjugated to tetanus toxoid (O2-TT), O2 conjugated to diphtheria toxoid (O2-DT), and O2 conjugated to a toxic detoxified mutant of diphtheria toxin (O2-CRM). 197 ) is administered simultaneously with Vi conjugated to the same carrier protein as a typhoid vaccine targeting Salmonella typhi and Salmonella paratyphi A (Martin et al., 2016, Vaccine 34:2900-2902).

[0006] The live attenuated approach to typhoid vaccine development has significant advantages over injectable Vi vaccines, including longer duration of protection, generation of immune memory, closer immunological characteristics to natural infection, and no need for needles. In addition to the approved chemically mutagenized typhoid vaccine strain Ty21a, other specifically mutated live S. typhi vaccine strains have been evaluated in clinical trials: CVD906 and CVD908 (ΔaroC, ΔaroD); CVD906-htrA and CVD908-htrA (ΔaroC, ΔaroD, ΔhtrA); CVD909 (ΔaroC, ΔaroD, ΔhtrA, and constitutive expression of Vi); M 01ZH09 (ΔaroC, ΔssaV); Ty800 (ΔphoP, ΔphoQ); χ3927 (Δcya, Δcrp) (Tennant and Levine, 2015, Vaccine 33:C36-C41), and χ4073 (Δcya, Δcrp, Δcdt) (Paterson and Maskell, 2010, Hum. Vaccines 6:379-384). As in the case of Ty21a, it is reasonable to expect some cross-protection from these specifically mutated S. Typhi strains to S. Paratyphi B.

[0007] Attenuated strains of S. Paratyphi A have also been created, including the ΔphoPQ mutant, which has been preclinical tested (Roland et al., 2010, Vaccine 28:3679-3687), and CVD1902 (ΔguaBA, ΔclpX), which has been evaluated in clinical trials (Tennant and Levine, 2015, Vaccine 33:C36-C41). A combination of CVD909 and CVD1902 is in clinical development as a vaccine targeting S. Typhi and S. Paratyphi A (Martin et al., 2016, Vaccine 34:2900-2902). However, this strategy requires clinical evaluation in S. Paratyphi A, which does not have the long history of safe use that S. Typhi has.

[0008] Nontyphoidal Salmonella (NTS) causes gastroenteritis, with symptoms including diarrhea and fever. An increase in invasive nontyphoidal Salmonella (iNTS) cases is occurring primarily in Africa and represents a significant public health problem. The strains responsible for most iNTS cases are Salmonella typhimurium and Salmonella enteritidis, with multidrug-resistant isolates being of particular concern (MacLennan and Levine, 2013, Expert Rev. Anti Infect. Ther. 11:443-446). iNTS strains cause a much more severe illness, with prolonged symptoms and continued shedding of bacteria for several weeks. Currently, there is no vaccine against NTS approved for human use.

[0009] Advantages of a live attenuated vaccine include the induction of mucosal and cellular immune responses, in addition to systemic antibody responses, and the duration of these responses may be longer than those obtained from injectable subunit vaccines such as those described above for typhoid fever. Attenuated S. typhi strains have been administered to millions of people as experimental and approved vaccines with an excellent safety and immunogenicity record. Also, due to its restriction to humans, this serotype cannot persist in the environmental reservoir, providing improved biosafety. Thus, there are several reasons why it is advantageous to use live attenuated S. typhi as a vehicle to deliver homologous antigens from other serotypes of Salmonella, rather than attenuating wild-type strains where the effects of attenuating mutations may be unpredictable. For example, the Salmonella typhi vaccine candidate ZH9, which carries mutations in the aroC and ssaV genes, has been shown to be safe and well tolerated in multiple clinical trials (Lyon et al., 2010, Vaccine 28:3602-3608), whereas introduction of the same mutations into Salmonella typhimurium resulted in prolonged fecal shedding (Hindle et al., 2002, Infect. Immun. 70:3457-3467).

[0010] The three most important surface antigens of each serotype of Salmonella for inducing protective immunity are the lipopolysaccharide O antigen, the flagellum (H antigen), and Vi. The table below summarizes the antigenic composition of the principle S. typhi and iNTS strains according to the Kauffmann-White-Le Minor classification scheme (Grimont and Weill, 2007, Antigenic formulae of the Salmonella serovars, 9th ed.).

[0011] [Table 1] [ ] denotes antigens specifically found in wild-type strains

[0012] The lipopolysaccharide of Salmonella consists of lipid A linked to the terminus of a conserved core region, KDO (3-deoxy-D-manno-octulosonic acid), which is linked to a variable repeat of the trisaccharide O antigen. In S. Typhi, S. Paratyphi A, S. Paratyphi B, S. Typhimurium, and S. Enteritidis, this O antigen repeat is O12, a triglyceride composed of mannose (Man), rhamnose (Rha), and galactose (Gal). In S. Paratyphi A, a paratose (Par; 3,6-dideoxy-D-ribo-hexose) branch from C-3 of Man confers serotype specificity to O2 (Figure 1). In Salmonella paratyphi B and Salmonella typhimurium, C-3 of Man has a diglyceride of Abequase (3,6-dideoxy-D-xylo-hexose), which is O S. typhi and S. enteritidis have tyvelose (Tyv; 3,6-dideoxy-D-arabino-hexose) at C-3 of Man, conferring O9 specificity. Figure 2 shows the biosynthetic pathway leading to either Abe, Par, or Tyv, illustrating the differences in O antigens between serotypes. S. typhi and S. paratyphi C additionally express the capsular polysaccharide antigen Vi.

[0013] Other than flagella produced by Salmonella Ty21a, flagellin is not a component of any currently approved vaccine against Salmonella infection. Flagellin is a highly immunogenic important pathogen-associated molecular pattern (PAMP) recognized by Toll-like receptor 5 (TLR5) and is an important component of live vaccines against Salmonella. Salmonella flagellar filaments are composed of approximately 20,000 flagellin (FliC or FljB) proteins, with a terminal cap encoded by fliD (Haiko and Westerlund-Wikstrom, 2013, Biology 2:1242-1267). Salmonella Typhi and Salmonella Paratyphi A flagellins are usually monotypic and express only FliC.

[0014] There is a particular need in the art for improved vaccines directed against Salmonella Paratyphi A, Salmonella Paratyphi B, Salmonella Paratyphi C, Salmonella typhimurium, and Salmonella Enteritidis. Summary of the Invention

[0015] In a first aspect, the present invention provides a live attenuated strain of Salmonella typhi, the strain being engineered to express the lipopolysaccharide O2O antigen and flagellar protein of Salmonella paratyphi A.

[0016] In a second aspect, the present invention provides a live attenuated strain of S. typhi, the strain being engineered to express the lipopolysaccharide O4O antigen and flagellar protein of S. paratyphi B and S. typhimurium.

[0017] In a third aspect, the present invention provides a live attenuated strain of Salmonella typhi further modified to contain a functional fepE gene such that a long O-antigen chain is produced, preferably said O-antigen chain having a backbone length of 100 trisaccharide repeat units.

[0018] In a fourth aspect, the present invention provides a live attenuated strain of Salmonella typhi which has been modified to constitutively express the gtrC gene (encoding rhamnose acetyltransferase) or alternatively to express the gtrC gene in trans.

[0019] In a fifth aspect, the present invention provides a live attenuated strain of S. typhi, in which the native fliC gene (SEQ ID NO: 1) has been replaced with the fliC gene of Salmonella Paratyphi A (SEQ ID NO: 2), the fliC gene of Salmonella Paratyphi B (SEQ ID NO: 3), the fliC gene of Salmonella Paratyphi C (SEQ ID NO: 5), the fliC gene of Salmonella typhimurium (SEQ ID NO: 7) or the fliC gene of Salmonella Enteritidis (SEQ ID NO: 9), thereby changing the resulting serotype from Hd serotype to Ha serotype, Hb serotype, Hc serotype, Hi serotype or Hg,m serotype, respectively.

[0020] In a sixth aspect, the present invention provides a live attenuated strain of S. typhi, in which the fljBA locus controlling expression of the S. Paratyphi B fljB gene (SEQ ID NO: 4), the S. Paratyphi C fljB gene (SEQ ID NO: 6) and the S. typhimurium fljB gene (SEQ ID NO: 8) is inserted into the S. typhi chromosome or expressed in trans.

[0021] In a seventh aspect, the present invention provides a live attenuated strain of S. typhi, comprising an attenuated variant of S. paratyphi A, S. paratyphi B, S. paratyphi C, S. typhimurium, and S. enteritidis flagellin. Strains expressing the .alpha.-type variants are provided.

[0022] In an eighth aspect, the present invention provides a live attenuated strain of Salmonella typhi, the strain comprising an inserted second copy of the tviA gene (SEQ ID NO: 10).

[0023] The invention further includes vaccines comprising one or more of the modified strains for use in enhancing immunogenicity against Salmonella Paratyphi A, Salmonella Paratyphi B, Salmonella Paratyphi C, Salmonella typhimurium, and Salmonella Enteritidis. [Brief description of the drawings]

[0024] [Figure 1] Figure 1 illustrates the structure of the S. Paratyphi O-antigen chain linked to the core region (Micoli et al., 2012, Plos One, vol. 7: e47039). Par (α-D-Par) is replaced by Tyv in S. Typhi and S. Enteritidis, and by Abe in S. Paratyphi B and S. Typhimurium. [Diagram 2] Figure 2 shows the biosynthetic pathway of O-antigen-associated CDP-linked saccharides in each Salmonella serovar: S. Typhi and S. Enteritidis (ending with CDP-tyvelose); S. Paratyphi A (ending with CDP-paratose); S. Paratyphi B and S. Typhimurium (ending with CDP-abequose). The enzymes involved in each step are shown. Adapted from Reeves et al., 2013, Plos One, 8:e69306. [Diagram 3] FIG. 3 shows a portion of the wild-type O antigen locus from S. typhi ZH9 modified by mutation of the wild-type rfbE cistron (SEQ ID NO: 12) to create S. typhi ZH9PL2 by deletion of most of the rfbE cistron, or, in S. typhi ZH9W, replacement of the rfbE cistron with spacer DNA containing the wbdR cistron (SEQ ID NO: 13) while maintaining the original reading frame. [Figure 4] FIG. 4 shows micrographs of S. typhi ZH9 and derivative strains ZH9PL2 and ZH9W probed with A. anti-S. typhi LPS mAb, and B. anti-S. Paratyphi A LPS mAb; the images in the left column are phase contrast micrographs, and the images in the right column are immunofluorescence micrographs. [Diagram 5] FIG. 5 is a silver-stained polyacrylamide gel of LPS preparations from S. typhi ZH9 and derived strains ZH9PL2 and ZH9W, showing the short and long O-antigen chains. [Figure 6]FIG. 6 shows a portion of the wild-type O antigen locus from Salmonella typhi ZH9 modified by replacement of the rfbS cistron (SEQ ID NO: 14) and rfbE cistron with rfbJ (SEQ ID NO: 15). [Figure 7] FIG. 7 shows the pBAD2fepE plasmid, which uses the ParaBAD promoter (SEQ ID NO: 17) for expression of the fepE cistron. [Figure 8] FIG. 8 is a silver-stained polyacrylamide gel of LPS preparations from S. typhi ZH9 and ZH9(pBAD2fepE) induced by arabinose addition, showing the short, long, and very long O antigen chains. [Figure 9] FIG. 9 shows micrographs of S. typhi ZH9 and derived strain ZH9PF probed with A. anti-S. typhi flagellin antiserum and B. anti-S. Paratyphi A LPS flagellin antiserum; the images in the left column are phase contrast micrographs and the images in the right column are immunofluorescence micrographs. [Figure 10] FIG. 10 shows phase variation of flagella in Salmonella (Bonifield and Hughes, 2003, J. Bacteriol. 185:567-3574). [Figure 11] FIG. 11 shows the pBRT4tviA plasmid, which uses the PssaG promoter (SEQ ID NO: 16) for expression of the tviA cistron. [Figure 12] FIG. 12 shows micrographs of S. typhi ZH9 derivative strain ZH9PA probed with A. anti-S. typhi LPS mAb and anti-S. Paratyphi A LPS mAb, and B. anti-S. typhi flagellin antisera and anti-S. Paratyphi A flagellin antisera; the left image of each pair is a phase contrast micrograph, and the right image is an immunofluorescence micrograph. [Figure 13]FIG. 13 shows endpoint antibody titers of S. typhi LPS (O:9), S. paratyphi LPS (O:2), S. typhi flagellin (H:d), and S. paratyphi flagellin (H:a) in mouse serum after a single subcutaneous inoculation of mice with ZH9 alone (1×108 cfu / mouse), ZH9PA alone (1×108 cfu / mouse), or a combination of ZH9 and ZH9PA (0.5×108 cfu+0.5×108 cfu ZH9PA / mouse). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0025] The following description is presented to enable any person skilled in the art to make and use the invention. Various modifications to the disclosed embodiments will be readily apparent to those skilled in the art.

[0026] In a first aspect, the present invention provides a live attenuated strain of Salmonella typhi, optionally modified to express the lipopolysaccharide (O2 group) O-antigen and flagellar protein of Salmonella paratyphi A.

[0027] In the present invention, the term "live attenuated strain" refers to the modification of said strain to reduce its pathogenicity and render it harmless to the host while maintaining its viability. This method is widely used in vaccine development because it can induce a very specific immune response while maintaining an acceptable safety profile. The development of live attenuated bacterial vaccines may use several methods, including but not limited to passaging the pathogen under in vitro conditions until it loses pathogenicity, chemical mutagenesis, and genetic engineering techniques.

[0028] It is envisaged that the lipopolysaccharide O9O antigen of Salmonella typhi may be substituted for the O2O antigen of Salmonella paratyphi A.

[0029] The O-antigen biosynthetic pathway of S. Paratyphi A involves the conversion of the precursor CDP-4-keto-3,6-dideoxy-d-glucose to CDP-paratose by the CDP-paratose synthase RfbS. In addition to rfbS (formerly prt), S. Typhi possesses a functional rfbE gene (formerly tyv) encoding a CDP-paratose 2-epimerase, which converts CDP-paratose to CDP-tyvelose (Figure 2).

[0030] The present invention involves the inactivation of chromosomal rfbE in S. typhi (Figure 3). Surprisingly, it was found that as a result of inactivating rfbE, the standard long-chain LPS of S. typhi, known to be highly immunogenic from clinical studies, was altered to have the LPS chemical composition of S. paratyphi A instead. It is a surprising discovery that such biochemical modification results in a microorganism capable of producing long-chain LPS of S. paratyphi type. In one embodiment, the inactivation may be by deletion of rfbE. This deletion may be a partial or complete deletion.

[0031] Blocking the synthesis of tyvelose by inactivating rfbE results in the binding of paratose to mantose (Man), and this alteration of the biochemical pathway leads to the induction of Salmonella Paratyphi A O2O antigen (Figures 1 and 4).

[0032] In a preferred embodiment, the modification to inactivate the rfbE gene retains the non-coding DNA and does not disrupt expression of downstream (non-rfbE) coding sequences.

[0033] In a preferred embodiment, the deletion of the rfbE cistron maintains the correct reading frame. This involves the insertion of a non-coding spacer region for the purpose of:

[0034] The spacer region may be any suitable non-coding DNA sequence that maintains the correct reading frame when inserted. Preferably, the DNA spacer region is a cistron of the wbdR gene of Escherichia coli, which confers production of long chain LPS.

[0035] It is a surprising discovery that the modifications disclosed herein result in long chain LPS with S. Paratyphi A O2O antigenic properties. This is beneficial in vaccine production, allowing the production of live attenuated strains of S. Typhi and / or derivatives thereof, providing additional protection against S. Paratyphi A. Thus, this vaccine has advantages over conventional vaccines that only protect against S. Typhi.

[0036] The term "DNA spacer region" in the present invention refers to a non-coding DNA region located between genes. The term "cistron" refers to a DNA section that codes for a specific polypeptide in protein synthesis. Insertion of the DNA spacer region may involve transformation of a plasmid for electroporation that contains the replacement cassette. See Example 1 for further details.

[0037] When the methods described herein involve the use of a plasmid, the plasmid will ideally have an origin of replication selected from pMB1, ColEI, p15A, pSC101, and RK2. The plasmid may contain an antibiotic resistance gene selected from β-lactamase (bla), kanamycin phosphotransferase (kan), tetracycline efflux protein (tetA), or chloramphenicol acetyltransferase (cat). Ideally, the antibiotic resistance gene will be excised before or immediately after transformation into the vector strain, for example by a mechanism such as "X-mark" (Cranenburgh and Leckenby, 2012, WO 2012 / 001352). A plasmid maintenance system may be required to prevent loss of the plasmid. These may include mechanisms for placing native chromosomal genes under heterologous promoters, such as the "Operator-Repressor Titration for Vaccines" system (ORT-VAC; Garmory et al., 2005, Infect. Immun. 73:2005-2011) or the "oriSELECT" system (Cranenburgh, 2005, WO 2005 / 052167), both of which do not require an additional selectable marker gene to be present on the plasmid. Alternatively, a selectable marker gene that is not an antibiotic resistance gene will be used, such as a gene to complement a host cell mutation (Degryse, 1991, Mol. Gen. Genet. 227:49-51).

[0038] The DNA spacer region is preferably a cistron of the wbdR gene of E. coli. For this purpose, other non-functional genes of Salmonella typhi of approximately the same length as the rfbE cistron may be used. The selected spacer DNA used for this purpose is preferably approximately 50-2000 base pairs in length and does not contain a transcription termination sequence. By using this spacer region, rfbE is inactivated without causing downstream effects (SEQ ID NO: 20), and Salmonella typhi LPS is efficiently converted to Salmonella paratyphi A LPS.

[0039] The inventors have shown that deletion of rfbE while maintaining the original reading frame (through the use of a DNA spacer region) is a critical requirement for this process.

[0040] The resulting lipopolysaccharide O2O antigen of Salmonella Paratyphi A is preferably at least equal in length to the lipopolysaccharide O9O antigen of Salmonella Typhi. The resulting lipopolysaccharide contains 16 to 35 O antigen residues. It is preferred that the repeating units be in the range of lengths that constitute "long" lipopolysaccharide species. As will be appreciated by those skilled in the art, the presence of O-antigen repeating units is desirable in triggering an immunogenic response.

[0041] It is contemplated that the present invention may also encompass a live attenuated strain as described above, in which the native fliC gene is replaced with the fliC gene of Salmonella Paratyphi A, thereby changing the resulting serotype from Hd to Ha, where "serotype" refers to distinct variations within a bacterial species.

[0042] The first phase flagellum of S. typhi is essential for motility and invasion and confers the serotype Hd. The filament consists of the flagellar protein FliC and the FliD cap. We found that by replacing fliC on the S. typhi chromosome with fliC from S. paratyphi A, the functional flagellar serotype was converted from Hd to Ha.

[0043] Chromosomal replacement may be used to achieve the above replacement. The replacement may be complete or partial. In partial replacement, it is preferred that amino acid substitutions at positions 176-414 are made. Partial replacement may involve transformation of an electroporation plasmid containing the replacement cassette. See Example 2 for further details. Alternatively, the replaced fliC gene may be expressed in trans from a plasmid or an additional chromosomal location.

[0044] A further embodiment of the invention is a live attenuated strain as described above, which may be further modified to contain a functional fepE gene such that long O-antigen chains are produced, preferably with a backbone length of 100 trisaccharide repeat units.

[0045] The fepE gene encodes a factor that controls the length of very long O-antigen chains, where "very long" is taken to mean a backbone length of more than 100 trisaccharide repeat units. S. typhi does not have these long O-antigen chains due to a mutation that introduces a stop codon into the gene (SEQ ID NO:21). S. typhi can be engineered to express these long O-antigen chains in several ways. The native promoter of fepE can be expressed by P araBAD or a chromosomal mutation of fepE in S. typhi may be repaired, or a functional copy of fepE (SEQ ID NO: 11) may be inserted somewhere in the S. typhi chromosome. For vaccine applications, in vivo inducible or constitutive promoters can be utilized, examples of such promoters include P pagC , P nirB , P ssaG , P sifA , P sifB , P sseA , P sseG , P sseJ、 P lac , P tac , P trc、 and λP L / P R Examples include:

[0046] A "promoter" refers to a DNA regulatory region capable of binding RNA polymerase and initiating transcription of downstream (3' direction) coding or non-coding sequences. A promoter may also be a regulatory DNA sequence that influences the binding of RNA polymerase at a transcription start site. For purposes of defining the present invention, a promoter sequence includes a transcription start site at its 3' end and a minimum number of bases or elements extending upstream (5' direction) required to initiate transcription at a level detectable above background. Within the promoter sequence, a transcription start site may be present, and further, a protein binding domain involved in the binding of RNA polymerase may be present.

[0047] A promoter can be a constitutively active (where "active" means that transcription is "on") promoter, a spatially restricted promoter, or an inducible promoter. As used herein, "spatially restricted" refers to a promoter that is active only in a specific subset of cells or cell compartments of a multicellular organism. As such, spatially restricted promoters can be used to activate expression of a nucleic acid in specific tissue or cell types in a multicellular organism.

[0048] As used herein, an "inducible promoter" refers to a promoter that allows for temporal and / or spatial activation of transcription in response to an external physical or environmental stimulus. Inducible promoters include those that are activated by the presence of certain small molecules that relieve transcriptional repression. For example, transcription from such inducible promoters may be controlled by "repressor proteins." As used herein, an "repressor protein" refers to a polypeptide that binds to and occupies an inducible promoter, thereby preventing transcription initiation. When bound to a promoter, the repressor protein may prevent transcriptional activation by preventing the binding or recruitment of RNA polymerase or associated cofactors to the transcription start site. However, when bound to an appropriate small molecule or when an appropriate physical or environmental stimulus is encountered, the repressor protein is unable to bind to the promoter sequence, thereby relieving transcriptional repression. If the above example includes an in vivo inducible promoter for expression of a cistron encoding an enzyme involved in O-antigen biosynthesis, or for expression of another fliC cistron or TviA, such a promoter may include the P pagC , P nirB , P ssaG , P sifA , P sifB , P sseA , P sseG , and P sseJ (Dunstan et al., 1999, Infect. Immun. 67:5133-5141; Xu et al., 2010, Infect. Immun. 78:4828-4838; Kroger et al., 2013, Cell Host & Microbe 14:683-695). Other useful promoters include the temperature-inducible λ repressor cI, including the thermolabile mutant repressor cI857, λP L and P R (Love et al., 1996, Gene 176:49-53; SEQ ID NOs:24 and 25), and P lac , P tac , and P trcConstitutive promoters in Salmonella in the absence of the LacI repressor (Terpe, 2006, Appl. Microbiol. Biotechnol. 72:211-222). In some embodiments, functional variants include P pagC , P nirB , P ssaG , P sifA , P sifB , P sseA , P sseG , P sseJ , and λ L / P R and have similar or substantially identical promoter activity, particularly with respect to the ability to induce expression in vivo, as the wild-type promoter from which the variant is derived. Examples of similar modified sequences include P pagC , P nirB , P ssaG , P sifA , P sifB , P sseA , P sseG , P sseJ , and λ L / P R Examples of such sequences include those that have at least about 70%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to any of the wild-type sequences.

[0049] Introduction of these long O antigen chains is preferred as they may be beneficial in inducing LPS-specific immune responses, and there may be additional advantages if the LPS is naturally in the very long form, such as from expression of fepE.

[0050] It is further envisioned that the above live attenuated strains may be modified to constitutively express gtrC or may be modified to express gtrC in trans.

[0051] Certain Salmonella serotypes have rhamnose acetylation on the O antigen, a feature that has been shown to be important for O2O antigen specificity in Salmonella Paratyphi A. The family 2 gtr operon (SEQ ID NO: 22) encodes the rhamnose acetyltransferase GtrC in Salmonella Typhi and Salmonella Paratyphi A. To achieve greater and more consistent levels of rhamnose acetylation, it may be desirable to express gtrC constitutively, such as on a plasmid or from an additional chromosomal locus. Alternatively, The native family 2 gtr operon promoter, which is involved in phase variation, can be replaced with a constitutive promoter or one that is conditionally expressed in vivo.

[0052] It is further envisioned that the above live attenuated strains may be further modified to contain additional copies of the tviA gene under the control of a phagosome-inducible promoter.

[0053] The Vi capsular polysaccharide antigen contributes to the virulence of S. Typhi but is naturally downregulated after liver and spleen invasion (Janis et al., 2011, Infect. Immun. 79:2481-2488). Control of Vi expression is mediated by the positive transcription factor TviA.

[0054] Insertion of a second copy of the tviA gene into S. typhi may induce an immune response against Vi and enhance the anti-flagellin response. This second copy may be inserted into S. typhi in trans, either on a plasmid (Figure 11) or integrated into the S. typhi chromosome, so that it is under the control of a phagosome-inducible promoter. Examples of suitable phagosome-inducible promoters include P pagC , P nirB , P ssaG、 P sifA , P sifB , P sseA , P sseG , P sseJ Examples include:

[0055] A further embodiment of the present invention can be a vaccine comprising the live attenuated strains disclosed herein for use in immunogenicity enhancement against Haemophilus Paratyphi A and for use in the treatment or prevention of typhoid fever and salmonellosis. The vaccine can comprise a single live attenuated strain or can combine two or more live attenuated strains, for example, the vaccine can comprise ZH9 and / or one of its derivatives ZH9PA, ZH9PL2, ZH9W, or ZH9PF. For example, combinations can include ZH9+ZH9PL2, ZH9+ZH9W, ZH9+ZH9PF, preferably the combination is ZH9+ZH9PA.

[0056] The term "immunogenicity" refers to the ability of a particular substance to elicit an immune response.

[0057] The term "vaccine" may be considered to include several additional elements in addition to the live attenuated strain of the present disclosure. The live attenuated strain may be present in the composition together with any other suitable adjuvants, diluents, or excipients. Examples of suitable adjuvants, diluents, or excipients include, but are not limited to, disodium hydrogen phosphate, soya peptone, potassium dihydrogen phosphate, ammonium chloride, sodium chloride, magnesium sulfate, calcium chloride, sucrose, sterile saline, and sterile water.

[0058] The vaccine may be administered by any suitable route, preferably by oral or intranasal route, with oral being the more preferred route of administration. One or more of the vaccine strains are preferentially lyophilized by a process such as freeze-drying, stored in the form of sachets, and later reconstituted in water and administered orally to young children. Alternatively, they may be dispensed into enteric-coated capsules for oral administration to older children and adults. In capsules, the lyophilized Salmonella is ideally mixed with a bile-adsorbing resin such as cholestyramine to enhance survival upon release from the capsule into the small intestine (Edwards and Slater, 2009, Vaccine, 27:3897-3903).

[0059] The vaccine contains the live attenuated strains of Salmonella enterica serovar Typhi (e.g., ZH9 and ZH9PA) for 10 8 , 10 9 , 10 10 , 10 11 , or 10 12 Including density of colony forming units / dose It will be appreciated by those skilled in the art that the dosing regime may involve a single dose or multiple doses, and ideally the vaccine will be administered in 1-3 doses.

[0060] In a second aspect, the present invention provides a live attenuated strain of S. typhi, the strain being engineered to express the lipopolysaccharide O4O antigen and flagellar protein of S. paratyphi B and S. typhimurium.

[0061] To achieve the above modification, the rfbJ gene (formerly abe), encoding the CDP-abecose synthase from S. Paratyphi B or S. Typhimurium, can be inserted to replace rfbS with or without the simultaneous replacement of rfbE, since RfbJ exists as CDP-paratose synthase in the corresponding step of the biosynthetic pathway in S. Typhi / S. Paratyphi A, allowing the conversion of CDP-4-keto-3,6-dideoxy-D-glucose to CDP-abecose (Figure 2). As a result, the O-antigen repeat contains Abe instead of tyvelose, resulting in the O4 specificity of S. Paratyphi B and S. Typhimurium. It is preferable to inactivate rfbS by mutation to partially or completely delete the cistron, for example using Xer-cise to inactivate the rfbS cistron using a λ-Red-mediated recombination approach, followed by removal of the selection marker gene by Xer recombination.

[0062] As an alternative to the above replacement method, rfbJ may be expressed in trans from a plasmid or another chromosomal locus to obtain a mixture of O4O and O9O antigens designed to induce antibody responses against S. typhi, S. paratyphi B, and S. typhimurium.

[0063] It is a further contemplated by the present invention that the live attenuated strain according to the second aspect of the present invention may have its native fliC gene replaced with the fliC gene of Salmonella Paratyphi B and / or Salmonella enterica serovar Typhimurium, thereby changing the resulting serotype from Hd to Hb and Hi serotypes, respectively.

[0064] It is further envisaged that the live attenuated strain according to the second aspect of the invention may comprise the fljBA loci of Salmonella Paratyphi B and Salmonella typhimurium inserted into the S. typhi chromosome or expressed in trans.

[0065] Several serotypes of Salmonella (including S. Paratyphi B, S. Paratyphi C, and S. Typhimurium) contain an additional antigenically distinct flagellin gene, fljB, which undergoes phase variation to produce flagella composed of either FliC or FljB (Figure 10). Co-transcription of fljB results in the production of flagella composed of either FliC or FljB, a flagellum-specific sigma factor, fljA, which represses the fliC gene (Bonifield and Hughes, 2003, J. Bacteriol. 185:567-3574). The fljBA promoter is flanked by the Hin recombinase recognition sites hixL and hixR. Together with the enhancer proteins Fis and HU, Hin mediates a reversible DNA inversion between the hix sites such that in one orientation, the fljBA promoter transcribes the fljBA operon (SEQ ID NO: 23), producing FljB flagellin and repressing fliC expression via FljA, resulting in flagellar filaments composed of FljB. In the opposite orientation, expression of the fljBA operon is abrogated, allowing the production of flagellin composed of fliC. Salmonella typhi lacks fljB and hin and therefore does not express phase 2 flagella and has only flagella composed of FliC (McClelland et al., 2004, Nature Genetics, 36:1268-1274).

[0066] It is envisioned that the fljBA loci of S. Paratyphi B, S. Paratyphi C, or S. Typhimurium may be inserted into the S. Typhi chromosome or expressed in trans from a plasmid to induce a phase-variable flagellar phenotype of the desired serotype. Alternatively, one or both of the hix sites flanking the native promoter of the fljBA operon, or the hin recombinase gene, may be mutated to prevent DNA inversion, resulting in constitutive expression such that the flagellar filament is composed only of FljB. The latter approach may be combined with the modification of S. Typhi fliC described above.

[0067] It is further envisaged that the live attenuated strain according to the second aspect of the invention may be further modified to additionally comprise the above mentioned modifications relating to expression of fepE, gtrC and tviA.

[0068] A further contemplated application of the present invention is a vaccine comprising the live attenuated strain according to the second aspect of the invention for use in enhancing immunogenicity against Salmonella Paratyphi B and / or Salmonella typhimurium.

[0069] In a third aspect, the present invention provides a live attenuated strain of Salmonella typhi, which has been further modified to contain a functional fepE gene such that a long O-antigen chain is produced, preferably said O-antigen chain having a backbone length of 100 trisaccharide repeat units. How this effect can be achieved and further details regarding this aspect of the invention are described on pages 12 and 13 of the present application.

[0070] In a fourth aspect, the present invention provides a live attenuated strain of Salmonella typhi which has been modified to constitutively express the gtrC gene or to express the gtrC gene in trans. How this effect can be achieved and further details regarding this aspect of the invention are described on pages 14 and 15 of the present application.

[0071] In a fifth aspect, the present invention provides a live attenuated strain of S. typhi, in which the native fliC gene has been replaced with the S. Paratyphi A fliC gene, the S. Paratyphi B fliC gene, the S. Paratyphi C fliC gene, the S. typhimurium fliC gene or the S. Enteritidis fliC gene, thereby changing the resulting serotype from Hd to Ha, Hb, Hc, Hi or Hg,m serotype, respectively. How this effect can be achieved and further details regarding this aspect of the invention are described on pages 12 and 17 of the present application.

[0072] In a sixth aspect, the present invention provides a live attenuated strain of S. typhi, in which the fljB genes of S. paratyphi B, S. paratyphi C and S. typhimurium are inserted into the S. typhi chromosome or expressed in trans. How this effect can be achieved and further details regarding this aspect of the invention are described on pages 17 and 18 of the present application.

[0073] In a seventh aspect, the present invention provides live attenuated strains of S. typhi, the strains expressing Salmonella Paratyphi A, Salmonella Paratyphi B, Salmonella Paratyphi C, Salmonella typhimurium, and Salmonella Enteritidis flagellin variants.

[0074] Isolates of S. typhi show phase variation. One such isolate expresses a variant of FljB, designated Hz66, from a linear plasmid designated pBSSB1 (Baker et al., 2007, Plos Pathogens 3:e59), and another flagellar variant, Hj, which contains a 261-bp in-frame deletion in the central region of the Hd fliC gene. It has a deletion (Frankel et al., 1989, EMBO J. 8:3149-3152).

[0075] For Hz66, this can be achieved by including the pBSSB1 plasmid in the vaccine strain derived from Salmonella typhi. z66 Alternatively, Hj may be expressed from a chromosomal location, which may be the location of the deleted fljB gene, the native chromosomal location of fliC (thereby replacing the variant), or on a plasmid under its native promoter or P ssaG The amino acid sequences of Hz66 and Hj are described in Schreiber et al., 2015, Nature, 5:7947.

[0076] In an eighth aspect, the present invention provides a live attenuated strain of Salmonella typhi, the strain having a second copy of the tviA gene inserted therein. How this effect can be achieved and further details regarding this aspect of the invention are described on page 15 of this application.

[0077] It is contemplated that the live attenuated strains of the present disclosure, alone or in combination (e.g., ZH9 and ZH9PA), may be administered in the form of a vaccine to provide a subject with broad-spectrum protection against various Salmonella serotypes, particularly Salmonella Paratyphi A, Salmonella Paratyphi B, and Salmonella Typhimurium.

[0078] The table lists S. typhi ZH9 and its LPS- and flagellin-modified derivatives.

[0079] [Table 2]

[0080] The invention will now be described in the following examples with reference to the accompanying drawings.

[0081] Example 1 To generate S. typhi ZH9 expressing S. paratyphi A LPS, the rfbE gene was deleted in two different ways. In one deletion method, a spacer cistron wbdR was synthesized, flanked by approximately 700 bp of DNA homologous to the upstream gene rfbS and the downstream gene rfbX of rfbE, to generate a deletion cassette. The spacer cistron contained a NotI restriction site at the 3' end for cloning the dif-flanked antibiotic resistance marker gene cat gene amplified using primers. The cat gene was amplified from the synthetically generated pBRT1N plasmid using 5NotIdifcat and 3NotIdifcat primers designed using the dif sequence. E. coli TOP10 cells were used for the cloning procedure to generate the pUCpW_difCAT plasmid. Chromosomal replacement of the rfbE gene with the spacer gene was performed as described by Bloor and Cranenburgh, 2006 (Appl. Environ. Microbiol. 72:2520-2525). Briefly, Salmonella typhi ZH9 was first transformed with the pLGBEK plasmid encoding the λRed gene function for linear DNA integration. Next, ZH9(pLGBEK) for electroporation was transformed with the above deletion cassette (SEQ ID NO:26) linearized with the restriction enzymes SalI and SacI, and the selection of transformants was performed on LB-aro (LB medium containing aromatic amino acids and precursors for aromatic amino acid biosynthesis) agar plates supplemented with 20 μg / ml chloramphenicol. Single colonies were isolated and cultured overnight in LB-aro broth without antibiotics. The cat gene was deleted by Xer recombination to generate chloramphenicol-sensitive colonies of ZH9W.

[0082] In the other deletion method, the dif-flanked antibiotic resistance gene cat was amplified using rfbEdelF and rfbEdelR primers designed with the homologous sequences of rfbS and rfbX genes, respectively. The difCAT cassette was amplified from the synthetic pMKtetORTDAP plasmid to generate the PL deletion cassette (SEQ ID NO: 27). ZH9(pLGBEK) for electroporation was then transformed with the amplified DNA sequence, and transformants were selected on LB-aro agar plates supplemented with 20 μg / ml chloramphenicol. Single colonies were isolated and grown overnight in LB-aro broth without antibiotics. The cat gene was deleted by Xer recombination to generate chloramphenicol-sensitive colonies of ZH9PL2.

[0083] Example 2 To generate S. Paratyphi A flagellin expressing S. Paratyphi A ZH9, the native fliC gene was replaced with S. Paratyphi A fliC. The replacement cassette was synthesized by flanking S. Paratyphi A fliC with approximately 700 bp of DNA homologous to the fliD gene upstream of fliC and a pseudogene downstream of fliC. A NotI restriction site was included at the 3' end of S. Paratyphi A fliC to allow cloning of the dif-flanked antibiotic resistance marker gene cat gene, which was amplified using primers designed with NotI restriction sites. The cat gene was amplified from the synthetically generated pBRT1N plasmid with 5NotIdifcat and 3NotIdifcat primers designed with the dif sequence. TOP10 E. coli cells were used in the cloning procedure to generate the pUCpF_difCAT plasmid. Chromosomal replacement of the Salmonella typhi FliC gene with Salmonella paratyphi A FliC was performed as described in Example 1. ZH9(pLGBEK) for electroporation was transformed with the pUCpF_difCAT replacement cassette (SEQ ID NO: 28) excised with the restriction enzymes SalI and SacI, and transformants were selected on LB-aro agar plates supplemented with 20 μg / ml chloramphenicol. Single colonies were isolated and cultured overnight in LB-aro mixed broth without antibiotics. The cat gene was deleted by Xer recombination to generate chloramphenicol-sensitive colonies of ZH9PF.

[0084] To generate S. typhi ZH9 expressing both LPS and flagellin of S. paratyphi A, ZH9PF(pLGBEK) for electroporation was then constructed from the pUCpW_difCAT cassette excised with the restriction enzymes SalI and SacI. The ZH9PA clone was transformed with the replacement cassette and selection of transformants was performed on LB-aro agar plates supplemented with 20 μg / ml chloramphenicol. Single colonies were isolated and grown overnight in LB-aro broth without antibiotics. The cat gene was deleted by Xer recombination, generating chloramphenicol-sensitive ZH9PA colonies.

[0085] Example 3 To construct the medium copy number expression plasmid pBRT4tviA (Figure 11; SEQ ID NO: 29), the tviA gene of S. typhi ZH9 was amplified from chromosomal DNA using 5tviANdeI and 3tviASalI primers. The PCR product and the expression plasmid pBRT4c were digested with NdeI and SalI and ligated to generate the precursor plasmid pBRT4tviAc. The cloning procedure used an E. coli pepA mutant. The pBRT4tviAc plasmid was transformed into S. typhi ZH9 and transformants were selected on LB-aro agar plates supplemented with 20 μg / ml chloramphenicol. Single colonies were isolated and grown overnight in LB-aro mixed broth without antibiotics. The cat gene was deleted by Xer recombination to generate chloramphenicol-sensitive colonies of ZH9 (pBRT4tviA). pBRT4tviA is a phagosome-inducible SPI-2 promoter P ssaG The promoter is not active in nutrient broths such as LB or TB. ssaG This induced.

[0086] Example 4 To construct the medium copy number expression plasmid pBAD2fepE (SEQ ID NO: 30), the fepE gene (aroC, ssaV) of S. typhimurium WT05 was amplified from chromosomal DNA using the primers fepE5_pBAD and fepE3_pBAD_pSC. The PCR product and the expression plasmid pBAD2 were digested with NdeI and SalI and ligated to generate the plasmid pBAD2fepE. pBAD2fepE has fepE under the control of the arabinose promoter, which is not active in nutrient broth such as LB or TB and requires the addition of 0.02% arabinose to induce the expression of the very long (VL) O antigen chain length regulator. E. coli NEB5-α was used for the cloning procedure. The pBAD2fepE plasmid was transformed into S. typhi ZH9 and the selection of transformants was performed on LB-aro agar plates supplemented with 50 μg / ml kanamycin. A single colony of ZH9(pBAD2fepE) was isolated and cultured overnight in LB-aro broth supplemented with 50 μg / ml kanamycin and 1:1000 20% arabinose to induce expression of LPS bearing very long (VL) O antigen chains.

[0087] Example 5 For immunofluorescence microscopy, S. typhi ZH9 and its derivatives ZH9W, ZH9PL, ZH9PF, and ZH9PA were cultured in LB-aro broth at 37°C and 200 rpm for 18 hours. An amount of each culture corresponding to an optical density of A600=1 was collected and washed with PBS. The pellet was resuspended in 10 μl of PBS containing 1 μl of primary antibody and incubated for 10 minutes at ambient temperature. LPS analysis was performed by staining ZH9, ZH9W, ZH9PL, and ZH9PA with one of the following primary antibodies: anti-S. typhi LPS monoclonal antibody B348M (Genetex), anti-S. paratyphi A LPS monoclonal antibody (Bio-rad), 0:9 antiserum (SSI), and O:2 antiserum (SSI). Flagellin analysis was performed by staining ZH9, ZH9PF, and ZH9PA with the following primary antibodies, H:d antiserum (SSI) and H:a antiserum (SSI). After primary staining, the bacterial cells were washed with PBS, and the pellet was then transferred to a PBS containing 1 μl of Dylight488 fluorescent dye-conjugated secondary antibody. Cells were resuspended in 10 μl of PBS. After incubation at room temperature for 10 min, cells were washed with PBS, a small aliquot was applied onto a microscope slide, and visualized using a fluorescence microscope (Zeiss Axiophot) equipped with a Zeiss Axiocam camera. Fluorescence imaging showed that the LPS serotype was converted from O9 to O2 in ZH9W and ZH9PL (Figure 4), the flagellin serotype was converted from Hd to Ha in ZH9PF (Figure 9), and both modifications were introduced into ZH9PA (Figure 12).

[0088] To analyze the length of the O antigen in LPS, ZH9 and ZH9(pBAD2fepE) precultures were used to inoculate LB-aro broth and grown at 37°C and 200 rpm, with ZH9(pBAD2fepE) supplemented with 50 μg / ml kanamycin and induced with 0.02% arabinose. Upon reaching logarithmic phase, LPS was prepared by lysing 4 mL of each culture using an LPS extraction kit (Intron Biotechnology). LPS samples were run on an SDS-PAGE gel and silver stained. Figure 5 shows that replacement of the rfbE gene with the spacer gene wbdR is necessary to express LPS with long O antigen chains. ZH9(pBAD2fepE) expressed LPS with very long O antigen chains, which were not found in ZH9 (Figure 8).

[0089] Example 6 To evaluate the immunogenicity of the ZH9PA strain and to determine whether the immunogenicity of both ZH9 and ZH9PA strains is maintained when administered simultaneously, an immunogenicity study was performed in mice. Balb / c animals were administered ZH9 alone (1 × 10 8 cfu / mouse), ZH9PA alone (1 × 10 8 cfu / mouse), or a combination of the two, ZH9+ZH9PA (0.5 × 10 8 cfuZH9+0.5×10 8 cfuZH9PA / mouse) was immunized subcutaneously once. Pre-immune serum samples were collected before immunization, and terminal serum samples were collected 35 days after immunization. All samples were centrifuged for serum separation, and serum was diluted with -80 o Saved in C.

[0090] These sera were used to perform in-house standardized ELISA assays aimed at evaluating antibody titers specific for LPS (O:9) and flagellin (H:d) of S. typhi and LPS (O:2) and flagellin (H:a) of S. paratyphi A. Briefly, half areas of ELISA plates (Corning) were coated with the following specific antigens (all from The Native Antigen Company) diluted in 50 mM carbonate / bicarbonate buffer (pH 9.6):

[0091] [Table 3]

[0092] The plate was incubated overnight (about 16 hours) at 4°C. The next day, the plate was washed with PBS + 0.05% Tween-20, and then blocked with Pierce™ Protein-Free (PBS) Blocking Buffer at 37°C for 1 hour. After washing the plate as described above, mouse serum obtained in the oral immunogenicity test was added and incubated for 37 hours. The plate was then left at room temperature for an additional hour. A standard curve was prepared for each antigen by using the following serotype-specific reagents.

[0093] [Table 4]

[0094] Reactive sera and standard curves for S. Typhi LPS and S. Paratyphi A LPS were detected using a horseradish peroxidase (HRP)-directly conjugated goat anti-mouse secondary antibody, and for S. Typhi flagellin and S. Paratyphi A flagellin standard curves, a goat anti-rabbit antibody conjugated to HRP was used. After washing the plates as above, secondary antibodies were added at a 1:2000 dilution in Pierce™ Protein-Free (PBS) Blocking Buffer and incubated for 1 hour at room temperature. Positive sera were revealed using 3,3',5,5'-tetramethylbenzidine (TMB) substrate and measured at 450 nM using a spectrophotometer. After plotting the optical density (OD) using a four-parameter logistic curve of the positive control; the endpoint titer was determined as the logarithm of the dilution value at which the serial dilution curve of each mouse serum met OD=1.

[0095] Figure 13 shows that the endpoint titers of antibodies specific for S. typhi LPS (O:9), S. paratyphi LPS (O:2), S. typhi flagellin (H:d), and S. paratyphi A flagellin (H:a) were not significantly different after immunization with ZH9 / ZH9PA alone or in combination with the two, indicating that the immunogenicity of the strains is retained when administered simultaneously.

[0096] Sequences used throughout the specification and forming part of the description: SEQ ID NO:1 (Salmonella typhi fliC cistron) atggcacaagtcattaatacaaacagcctgtcgctgttgacccagaataacctgaacaaatcccagtccgcactgggcactgctatcgagcgtttgtcttccggtctgcgtatcaacagcgcgaaagacgatgcggcaggacaggcgattgctaaccgttttaccgcgaacatcaaaggtctgactcaggcttcccgtaacgctaacgacggtatctccattgcgcagaccactgaaggcgcgctgaacgaaatcaacaacaacctgcagcgtgtgcgtgaactggcggttcagtctgcgaatggtactaactcccagtctgacctcgactccatccaggctgaaatcacccagcgcctgaacgaaatcgaccgtgtatccggccagactcagttcaacggcgtgaaagtcctggcgcaggacaacaccctgaccatccaggttggtgccaacgacggtgaaactatcgatattgatttaaaagaaatcagctctaaaacactgggacttgataagcttaatgtccaagatgcctacaccccgaaagaaactgctgtaaccgttgataaaactacctataaaaatggtacagatcctattacagcccagagcaatactgatatccaaactgcaattggcggtggtgcaacgggggttactggggctgatatcaaatttaa agatggtcaatactatttagatgttaaaggcggtgcttctgctggtgtttataaagccacttatgatgaaactacaaagaaagttaatattgatacgactgataaaactccgttggcaactgcggaagctacagctattcggggaacggccactataacccacaaccaaattgctgaagtaacaaaagagggtgttgatacgaccacagttgcggctcaacttgctgcagcaggggttactggcgccgataaggacaatactagccttgtaaaactatcgtttgaggataaaaacggtaaggttattgatggtggctatgcagtgaaaatgggcgacgatttctatgccgctacatatgatgagaaaacaggtgcaattactgctaaaaccactacttatacagatggtactggcgttgctcaaactggagctgtgaaatttggtggcgcaaatggtaaatctgaagttgttactgctaccgatggtaagacttacttagcaagcgaccttgacaaacataacttcagaacaggcggtgagcttaaagaggttaatacagataagactgaaaacccactgcagaaaattgatgctgccttggcacaggttgatacacttcgttctgacctgggtgcggttcagaaccgtttcaactccgctatcaccaacctgggcaataccgtaaataacctgtcttctgcccgtagccgtatcgaagattccgactacgcaaccgaagtctccaacatgtctcgcgcgcagattctgcagcaggccggtacctccgttctggcgcaggcgaaccaggttccgcaaaacgtcctctctttactgcgttaa Sequence number 2 (Salmonella paratyphi A fliC cistron) ctaaaccaactgggtggcgcagacggtaaaactgaagttgtttctatcgacggtaaaacctacaatgccagcaaagccgctggtcacaactttaaagcacagccagagctggctgaagcggctgctgcaaccaccgaaaacccgctggctaaaattgatgccgcgctggcgcaggttgatgcgctgcgttctgacttgggtgcggttcagaaccgtttcaactccgctatcaccaacctgggcaataccgtaaataacctgtcttctgcccgtagccgtatcgaagattccgactacgcgaccgaagtttccaacatgtctcgcgcgcagatcctgcagcaggccggtacctccgttctggcgcaggcgaaccaggttccgcaaaacgtcctctctttactgcgttaa SEQ ID NO: 3 (Salmonella paratyphi B fliC cistron) SEQ ID NO: 4 (Salmonella Paratyphi fljB cistron) Accession number 5 (Salmonella paratyphi C fliC cistron) atggcacaagtcattaatacaaacagcctgtcgctgttgacccagaataacctgaacaaatcccagtctgctctgggtaccgctatcgagcgtctgtcttccggtctgcgtatcaacagcgcgaaagacgatgcggcaggtcaggcgattgctaaccgtttcaccgcgaacatcaaaggtctgactcaggcttcccgtaacgctaacgacggtatctccattgcgcagaccactgaaggcgcgctgaacgaaatcaacaacaacctgcagcgtgtgcgtgaactggcggttcagtctgctaacagcaccaactcccagtctgacctcgactccatccaggctgaaatcacccagcgtctg Array number 6 (Salmonella paratyphi C bacterium fljB cistron) atggcacaagtaatcaacactaacagtctgtcgctgctgacccagaataacctgaacaaatcccagtccgcactgggcaccgctatcgagcgtctgtcttccggtctgcgtatcaacagcgcgaaagacgatgcggcaggtcaggcgattgctaaccgttttaccgcgaacatcaaaggtctgactcaggcttcccgtaacgctaacgacggtatttctattgcgcagaccactgaaggcgcgctgaacgaaatcaacaacaacctgcagcgtgtgcgtgaactggcggttcagtctgctaacagcactaactcacagtctgacctcgactctatccaggctgaaatcacccagcgtctgaacgaaatcgaccgtgtatccggtcagactcagttcaacggcgtgaaagtcctggcgcaggacaacaccctgaccatccaggttggtgccaacgacggtgaaactatcgatatcgatctgaagcagatcaactctcagaccctgggtctggactcactgaacgtgcagaaagcgtatgatgtgaaagatacagcagtaacaacgaaagcttatgccaataatggtactacactggatgtatcgggtcttgatgatacagctatcaaagcggctataggtggtacgactggtacggctgctgtaaccggtagtgcggttaaatttgacgcagataataacaagtactttgttactattggtggctttactggtgctgatgccgccaaaaatggcgattatgaagttaacgttgctactgacggtacagtaacccttgcggc tggcgcaactaaaaccacaatgcctgctggtgcgacaactaaaacagaagtacaggagttaaaagatacaccggcagttgtttcagcagatgctaaaaatgccttaattgctggcggcgttgacgctaccgatgctaatggcgctgagttggtcaaaatgtcttataccgataaaaatggtaagacaattgaaggcggttatgcgcttaaagctggcgataagtattacgccgcagattacgatgaagcgacaggagcaattaaagctaaaaccacaagttatactgctgctgacggcactaccaaaacagcagctaaccaactgggtggcgtagacggtaaaaccgaagtcgttactatcgacggtaaaacctacaatgccagcaaagccgctggtcatgatttcaaagcacaaccagagctggcggaagcagccgctaaaaccaccgaaaacccgctgcagaaaattgatgccgcgctggcgcaggtggatgcgctgcgctctgatctgggtgcggtacaaaaccgtttcaactccgctatcaccaacctgggcaataccgtaaacaacctgtctgaagcgcgtagccgtatcgaagattccgactacgcgaccgaagtttccaacatgtctcgcgcgcagattctgcagcaggccggtacttccgttctggcgcaggctaaccaggtcccgcagaacgtgctgtctctgttacgttaa SEQ ID NO: 7 (Salmonella typhimurium fliC cistron) gctgctacaaccaccgaaaacccgctgcagaaaattgatgctgctttggcacaggttgacacgttacgttctgacctgggtgcggtacagaaccgtttcaactccgctattaccaacctgggcaacaccgtaaacaacctgacttctgcccgtagccgtatcgaagattccgactacgcgaccgaagtttccaacatgtctcgcgcgcagattctgcagcaggccggtacctccgttctggcgcaggcgaaccaggttccgcaaaacgtcctctctttactgcgttaa Sequence number 8 (Salmonella typhimurium fljB cistron) SEQ ID NO:9 (Salicornia Enteritidis fliC cistron) atggcacaagtcattaatacaaacagcctgtcgctgttga SEQ ID NO:10 (Salmonella typhi tviA cistron) Atgaggtttcatcatttctggcctccgaatgatatctatttcggggttggagctgctggcattattgaagaagtgtcactgataacaaatgacagaaattatttgtttgtgaacctaaat cgctacagcctgttaaatgccctgaattttttcacgcgaatgagtgatattaataaaataatcgttatcatttcaagttcgcgactaatgccccttgcacgtttttggttgacagagtgc aaaaatgttattgctgttttcgatgcggcaacatcagtccaggatattatcagaaatgtcagtcaacaccaaagtggtgaaaagatcttgacggagcagagagattatcgtttcagaatt aaccgtaaggatatagtaaagatgaaatatttcctttcggaaagtggtatggaagagcttcaggatagatttatgaactcatcatcgactatgtatcgctggagaaaagaattggcagta aaatttggagtacgtgagccgcgctatctgttattgccggattcagttactttactgtaa SEQ ID NO:11 (Salmonella typhimurium fepE) Accession No. 12 (Salmonella typhi rfbE cistron) Atgaagcttttaattaccggtggatgtggcttccttgggagtaatcttgcctcctttgctttaagtcaagggattgatttaattgtattcgataatctatcacgtaaaggtgcaacagataatttacattggttatcctccttaggaaactttgagtttgtacatggtgatattcgcaacaaaaatgatgttacaagattaataactaagtatatgcctgatagctgttttcatcttgcaggtcaagtggcaatgactacatctattgacaatccttgtatggattttgaaattaatgtaggtggaactttaaatttacttgaggcagtacggcagtataattcaaattgtaatataatttattcatcaacaaataaagtatacggcgatcttgagcaatataaatacaatgaaacagaaactagatacacttgtgtagataagcctaatggatatgatgagagcacacaattagatttccactcaccatatggttgttcaaaaggtgctgcagaccaatacatgcttgattatgcaaggatttttggtttgaatacagtggtgttcaggcattcatcaatgtatggtgggagacagtttgctacttatgatcaaggctgggtaggttggttttgtcaaaaagcggttgaaattaaaaatggtattaataaacccttcac tatttctggtaatggtaagcaagttagggatgttttgcatgctgaagatatgatttcgttatatttcactgccttggcaaatgtatcaaaaattagggggaacgcttttaatattggtggtaccattgtcaacagcctatcattacttgaattattcaaattgcttgaagattattgcaacatagatatgaggttcactaatttacctgtaagggaaagtgatcagcgtgtttttgttgcagatattaaaaaaatcactaatgcaattgactggagcccgaaagtctcggcaaaagatggtgtccagaaaatgtatgattggactagttctatatga Sequence number 13 (E. coli O157:H7 wbdR cistron) Atgaatttgtatggtatttttggtgctggaagttatggtagagaaacaatacccattctaaatcaacaaataaagcaagaatgtggttctgactatgctctggtttttgtggatgatgttttggcaggaaagaaagttaatggttttgaagtgctttcaaccaactgctttctaaaagccccttatttaaaaaagtattttaatgttgctattgctaatgataagatacgacagagagtgtctgagtcaatattattacacggggttgaaccaataactataaaacatccaaatagcgttgtttatgatcatactatgataggtagtggcgctattatttctccctttgttacaatatctactaatactcatatagggaggttttttcatgcaaacatatactcatacgttgcacatgattgtcaaataggagactatgttacatttgctcctggggctaaatgtaatggatatgttgttattgaagacaatgcatatataggctcgggtgcagtaattaagcagggtgttcctaatcgcccacttattattggcgcgggagccattataggtatgggggctgttgtcactaaaagtgttcctgccggtataactgtgtgcggaaatccagcaagagaaatgaaaagatcgccaacatctatttaa Sequence number 14 (Salmonella typhi rfbS cistron) Atgaaaattctaataatgggagcgtttgggttccttggatcacgacttacatcctacttcgaaagtcgacatactgtgattggcttagcaaggaagaggaacaatgaagctaccataaataatattatttacacgacagaaaataattggatcgaaaaaatactagaatttgaaccgaatattattattaacactattgcttgctatggaagacataacgaacctgcaacagctttaatagaaagcaatattcttatgcctatcagagtattagaatctatctcatcacttgatgcagtattcataaattgtggaacatcactgccaccaaatacgagtttatatgcatatactaaacaaaaagcaaatgaactcgccgccgccattatagataaagtttgcggtaaatatatagagttaaaattggagcatttctatggagcttttgatggagacgataagtttaccagtatggttattagacgttgtttaagtaaccagccagtaaagttaacatctggtttgcaacagagagatttcttgtatataaaagatctactaacagcgttcgattgtattataagtaatgttaataatttccccaaatttcatagtattgaagttggtagtggagaggcgatatcaattcgtgaatatgtagatactgttaaaaatatcacaaaaagcaattctataattgaatttggcgtggtcaaagaaagagtaaatgaattgatgtatagttgtgctgatatagcagaacttgaaaaaataggatggaaaagagagttctctcttgttgatgcattaactgaaataattgaagaggaagggaaatga Sequence No. 15 (Salmonella typhimurium rfbJ cistron) Atgacctttttgaaagaatatgtaattgtcagtggggcttccggctttattggtaagcatttactcgaagcgctaaaaaaatcggggatttcagttgtcgcaatcactcgagatgtaataaaaaataatagtaatgcattagctaatgttagatggtgcagttgggataatatcgaattattagtcgaggagttatcaattgattctgcattaattggtatcattcatttggcaacagaatatgggcataaaacatcatctctcataaatattgaagatgcaaatgttataaaaccattaaagcttcttgatttggcaataaaatatcgggcggatatctttttaaatacagatagtttttttgccaagaaagattttaattatcaacatatgcggccttatataattactaaaagacactttgatgaaattgggcattattatgctaatatgcatgacatttcatttgtaaacatgcgattagagcatgtatatgggcctggggatggtgaaaataaatttattccatacattatcgactgcttaaataaaaaacagagttgcgtgaaatgtacaacaggcgaacagataagagactttatttttgtagatgatgtggtaaatgcttatttaactatattagaaaatagaaaagaagtaccttcatatactgagtatcaagttggaactggtgctggggtaagtttgaaagattttctggtttatttgcaaaatactatgatgccaggttcatcgagtatatttgaatttggtgcgatagagcaaagagataatgaaataatgttctctgtagcaaataataaaaatttaaaagcaatgggctggaaaccaaatttcgattataaaaaaggaattgaagaactactgaaacggttatga SEQ ID NO: 16 (Promoter region of Salmonella typhimurium P ssaG ) Tattgccatcgcggatgtcgcctgtcttatctaccatcataaacatcatttgcctatggctcacgacagtataggcaatgccgttttttatattgctaattgtttcgccaatcaac gcaaaagtatggcgattgctaaagccgtctccctgggcggtagattagccttaaccgcgacggtaatgactcattcatactggagtggtagtttgggactacagcctcatttattag agcgtcttaatgatattacctatggactaatgagttttactcgcttcggtatggatgggatggcaatgaccggtatgcaggtcagcagcccattatatcgtttgctggctcaggta acgccagaacaacgtgcgccggagtaatcgttttcaggtatataccggatgttcattgctttctaaattttgctatgttgccagtatccttacgatgtatttattttaaggaaaagc SEQ ID NO:17 (E. coli araC repressor and P araBAD promoter) ttatgacaacttgacggctacatcattcactttttcttcacaaccggcacggaactcgctcgggctggccccggtgcattttttaaatacccgcgagaaatagagttgatcgtcaaaaccaacattgcgaccgacggtggcgataggcatccgggtggtgctcaaaagcagcttcgcctggctgatacgttggtcctcgcgccagcttaagacgctaatccctaactgctggcggaaaagatgtgacagacgcgacggcgacaagcaaacatgctgtgcgacgctggcgatatcaaaattgctgtctgccaggtgatcgctgatgtactgacaagcctcgcgtacccgattatccatcggtggatggagcgactcgttaatcgcttccatgcgccgcagtaacaattgctcaagcagatttatcgccagcagctccgaatagcgcccttccccttgcccggcgttaatgatttgcccaaacaggtcgctgaaatgcggctggtgcgcttcatccgggcga aagaaccccgtattggcaaatattgacggccagttaagccattcatgccagtaggcgcgcggacgaaagtaaacccactggtgataccattcgcgagcctccggatgacgaccgtagtgatgaatctctcctggcgggaacagcaaaatatcacccggtcggcaaacaaattctcgtccctgatttttcaccaccccctgaccgcgaatggtgagattgagaatataacctttcattcccagcggtcggtcgataaaaaaatcgagataaccgttggcctcaatcggcgttaaacccgccaccagatgggcattaaacgagtatcccggcagcaggggatcattttgcgcttcagccatacttttcatactcccgccattcagagaagaaaccaattgtccatattgcatcagacattgccgtcactgcgtcttttactggctcttctcgctaaccaaaccggtaaccccgcttattaaaagcattctgtaacaaagcgggaccaaagccatgacaaaaacgcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccatacccgtttttttgggctagcgaattgaggaggagatataca SEQ ID NO: 18 (Salmonella paratyphi A rfbE pseudogene) SEQ ID NO: 19 (Salmonella typhi rfbE locus with partial deletion of rfbE) tcacgacttacatcctacttcgaaagtcgacatactgtgattggcttagcaaggaagaggaacaatgaagctaccataaataatattatttacacgacagaaaataattggatcgaaaaaatactagaatttgaaccgaatattattattaacactattg SEQ ID NO: 20 (S. typhi rfbE locus with rfbE disrupted by wbdR) aggcttgactacagagcatttagattatgtagttagcaagtttgaagagttctttggtttgaatttctaattttgaggggggggggattcccctctatgatttcatgaaaattctaataat gggagcgtttgggttccttggatcacgacttacatcctacttcgaaagtcgacatactgtgattggcttagcaaggaagaggaacaatgaagctaccataaataatattatttacacgac ttatcttttaggttttttagatgtagttgcgatccattatttaatgccagattcgagtattaccttcgctttagtagcattgtatgctccggtagcaatactgcccattatatatatatcgtttcggtatatatatgttcttaaagcgaaagtaaactttaacacctataaattattactatcacgttcatcagggtttctgattttttcgtccttatcgataatagttttacaaactgattatattgtgatgtctcagaaattatctgctgcagatattataaaatatactgtaacgatgaaaatatttggtttaatgttttttatttatactgcggtattacaagcattatggccagtatgtgctgaattacgagtgaaaatgcagtggagaaagctgcatagaatcattttcctaaatattattggtggggtattttttattggtcttggtacgttatttatttatgttttaaaggattatatctatagcataattgctaacggtatagattataatattagtggggttgtttttgttttactggctgtgtattttagtataagagtttggtgtgatacatttgctatgttacttcaaagtatgaaccaattaaaaattctttggctcatagttccgtgtcaggcattaattggtggtgtgactcaatggtattttgcagagcattatggaatagttggtattttatacggactaattttatcgttctcgctaactgttttttggggattgccagtgtattatatgtataagagtaaaaggctagcataatatgaaggtatcattttgtatcccaacgtataatcgagtaaaattcattgaagaccttcttgaaagtattaataatcaatcttctcactccttaattgtagaagtatgt SEQ ID NO: 21 (Salmonella typhi fepE pseudogene) tggcggtatgatggcctgcggcggcgtattactgcgtcacgcgatggtctcgcgtaaaatggaaaacgcgctggcgatagatgaacggttagtctga SEQ ID NO:22 (Salmonella typhi family 2 gtr operon) SEQ ID NO:23 (Salmonella typhimurium hin-fljBA locus) tgttgtaatttttattttaattcattcgtttttttatgcggcttgccggaaaatatctgtataaggtagatacgccaataccaaaaataatagctagttg ctgccgaggatggcctttctctaatagccgactaatctgttcctgttcatgtttgttgatcgcccgaggcgccctcccagtcgtccttgcgctctggcg gcagccagtccggcaagggttcgctcgacaattaattctcgctccatctcggccagtgctgacattacatgaaaaaagaatcgcccatcgcgctactgg tatcaatactatcggttaaagaatggaagtgagctccacgttcatgtaattctgatattaacgccaccaggtttttcacgctgcggcccagtctgtctaa aatgcccggataatcacaggctacattgcgaagtttaatccgaaggaaaatttgattctggcttcggataaacctaaaggaaataagcgcattgaagttaaactagagtctctggcaattcttgaagaattatcaggtaatgacgcttttaatctttcgctggtgccggctgacggatttaatcttcagcaatatactccatcaagaagagattatttctcgatttgcaataagtgctataaacagggagtcggtatcaaaatctatatgaagtatggacaggttttgactggcaaaacgacaggcgtaaatgcgtgtcaggttggtgtgaggacatccaatggcaatcatatgcaagttatgtttgactgggtgagcaggatcacgtcttcggactacgctgaataacgcctacggtaataaaaaattccgtgagaaaagtaaaacttagggggctaccggaggggacctaatgaacggaggtcatggaaggtattcatcgtgccagactcttgctcttgtcagaagaaggtaaaagta SEQ ID NO: 24 (Bacteriophage λ tandem P R ·P L promoter) Acgttaaatctatcaccgcaagggataaatatctaacaccgtgcgtgttgactattttacctctggcggtgataatggttgcatgtactaaggaggttgtatggaacaacgcataaccctgaaagattatgcaatgcgctttgggcaaaccaagacagctaaagatctctcacctaccaaacaatgcccccctgcaaaaaataaattcatataaaaaacatacagataaccatctgcggtgataaattatctctggcggtgttgacataaataccactggcggtgatactgagcacatcagcaggacgcactgaccaccatgaaggtgacgctcttaaaaattaagccctgaagaagggcagcattcaaagcagaaggctttggggtgtgtgatacgaaacgaagcattgggatctatcgatgcatgccatggtacccgggagctcgaattaattctagaaataattttgtttaactttaagaaggagatata Accession No. 25 (Bacteriophage λ heat-labile repressor cI857 cistron) Atgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctaagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggctaa Sequence number 26 (pUCpW_difCAT rfbE deletion cassette) tcgacatactgtgattggcttagcaaggaagaggaacaatgaagctaccataaataatattatttacacgacagaaaata Array number 27 (PL rfbE deletion cassette) aataggatggaaaagagagttctctcttgttgatgcattaactgaaataattgaagaggaagggaaatgaaaagcttggtaccgagctcggatccactagtaacggccgccagtgtgctggaattcgccctttaagcggccgcatttaacataatatacattatgcgcaccatccgcttattatcacttattcaggcgtagcaccaggcgtttaagggcaccaataactgccttaaaaaaattacgccccgccctgccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgt cgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacggaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattcgaagacgaaagggatgcaggagtcgcataagggatttaacataatatacattatgcgcaccgcggccgcggaaagggcgaattctgcagatatccatcacactggcggccgctcgagcatgcatctagagtgaggaaactgaggttggttagaattccaagacatcttattattgccgcttcctcttggctttcaaa Sequence number 28 (pUCpF_difCAT fliC replacement cassette) cattccctgaggggcgtcggttacggtattgctctgacgctcaatgtcgatgccgtttacgttcagcttcgcgttttctgctttcaccagctcttgcatattgccggtattggtggtgctgtcataagcgagtagatcgttaagttttgtatcgccttccaccgtgatcttcatcgtattgtcggtaccgctattggcggtaagcaccaactggaattcgttctctttgaccttaacgatactggcggcgataccgctgtcggcgtcattaatggcgtcacggatcgcctccatggaggtgtcgcctttatccagcttaatttccagcggctctttacgtcccggctgttcaattttaattgtccgggatgtgaccgacgtatcgcccaactgctctttggtggttgcgaaggtggtttttgtcgccagcgactgcgcggcggcaagctgggttacgctaatcttataagtccctgcggcagcgcctgcggtagtactgactttgaggtcctctgtcgtgctggacgccacggtagacttaaataaatccgctttatttaacgcggtatttgccgtctggaatttttctaatgcgcttttcaatgtgccataggcggttagctttgccgaattcgcgctctgctgtttggtaattggcgttaagcgtcctttttcgttctttgtcaggtctgtcaacaactggtctaacggtaagtttgatcccacacctaatgatgaaattgaagccatgccttcttcctttttgattgcaaacagtagttaagcgcgttatcggcaatctggaggcaaagtttaatgataattttgcaaaaataatgcgcggaataatgatgcataaagcggctatttcgccgcctaagaaaaagatcgggggaagtgaaaaattttctaaagttcgaaattcaggtgccgatacaagggttacggtgagaaaccgtgggcaacagcccaataacatcaagttgtaattgataaggaa。 SEQ ID NO: 29 (tviA expression plasmid pBRT4tviA) aacatcgatattgccatcgcggatgtcgcctgtcttatct cctttgagtgagctgataccgctttttcgtgacattcagttcgctgcgctcacggctctggcagtgaatgggggtaaatggcactacaggcgccttttatggattcatgcaaggaaactacccataatacaagaaaagcccgtcacgggcttctcagggcgttttatggcgggtctgctatgtggtgctatctgactttttgctgttcagcagttcctgccctctgattttccagtctgaccacttcggattatcccgtgacaggtcattcagactggctaatgcacccagtaaggcagcggtatcatcaacaggcttacccgtcttactgtcaaccagacccgccaggataagcaatccggcagactggtacagagcatggtcacgggctttacgggcggctctggcttcggctcgcttttctgcctgtatcaggttcatgagcggccgcggcgcgccagcttatcattgataagcttcttgaactctttatcactgataaagacgcgtcatagacagcctgaaacaggcgatgctgcttatcgaatcaaagctgccgacaacacgggagccagtgacgcctcccgtggggaaaaaatcatggcaattctggaagaaatagcgctttcagccggcaaaccggctgaagccggatctgcgattctgataacaaactagcaacaccagaacagcccgtttgcgggcagcaaaacccgtacttttggacgttccggcggttttttgtggcgagtggtgttcgggcggtgcgcgcaagatccattatgttaaacgggcgagtttacatctcaaaaccgcccgcttaacaccattcatgagcggccgccagtgtgctggaattcggcttcatgattttttattcaacgaagagtt SEQ ID NO: 30 (fepE expression plasmid pBAD2fepE) ttcgataagcagcatcgcctgtttcaggctgtctatgacatgttctttcctgcgttatccccaattgtgagcgctcacaatttgctgcggtaagtcgcataaaaaccattcttcataattcaatccatttactatgttatgttctgag

Claims

1. 1. A live attenuated strain of Salmonella enterica serovar Typhi modified to express the lipopolysaccharide O2O antigen and fliC protein of Salmonella enterica serovar Paratyphi A, wherein modification of the strain comprises: (i) inactivation of the native rfbE gene by replacement with a DNA spacer region, the DNA spacer region maintaining the original reading frame of the native rfbE gene; and (ii) replacement of the native fliC gene of S. typhi with the fliC gene of S. paratyphi A, thereby changing the resulting serotype from Hd to Ha.

2. 2. The attenuated live strain of claim 1, wherein the DNA spacer region is a cistron of the wbdR gene of Escherichia coli.

3. The attenuated live strain described in claim 1 or 2, wherein the DNA spacer region is 50 to 2000 base pairs in length and does not contain a transcription termination sequence.

4. The live attenuated strain according to any one of claims 1 to 3, wherein the resulting lipopolysaccharide O2O antigen is at least equal in length to the lipopolysaccharide O9O antigen of Salmonella typhi.

5. The live attenuated strain according to any one of claims 1 to 4, which has been modified to contain a functional fepE gene such that long type O antigen chains are produced.

6. The live attenuated strain of claim 1, further modified to constitutively express gtrC or wherein the gtrC gene is expressed in trans.

7. The live attenuated strain of any one of claims 1 to 6, further modified to contain an additional copy of the tviA gene under the control of a phagosome-inducible promoter.

8. 6. The live attenuated strain of claim 5, wherein the O antigen chain has a backbone length of 100 trisaccharide repeating units.

9. A vaccine comprising the live attenuated strain according to any one of claims 1 to 8 for use in enhancing immunogenicity against Haemophilus Paratyphi A and for use in the treatment or prevention of typhoid fever and salmonellosis.

10. The vaccine of claim 9, wherein the vaccine comprises a single live attenuated strain.

11. 11. The vaccine of claim 10, wherein the strain is ZH9 or a strain of claim 1 modified from ZH9.

12. The vaccine of claim 9, wherein the vaccine comprises two or more live attenuated strains.

13. 13. The vaccine of claim 12, wherein the vaccine comprises the strain of claim 1 modified from ZH9 and an additional live attenuated Salmonella strain.

14. The vaccine of claim 12, wherein the additional live attenuated Salmonella strain is ZH9.

Images