Oligonucleotide compositions and methods thereof

Abstract

The present invention relates to oligonucleotides, compositions and methods. [Solution] Among other things, the present disclosure provides oligonucleotides, compositions, and methods for preventing and / or treating various conditions, disorders, or diseases. In some embodiments, the provided oligonucleotides comprise nucleobase modifications, sugar modifications, internucleotide linkage modifications, and / or patterns thereof, and have improved properties, activity, and / or selectivity. In some embodiments, the present disclosure provides oligonucleotides, compositions, and methods for treating HTT-related conditions, disorders, or diseases, such as Huntington's disease.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 62 / 800,409, filed February 1, 2019, and U.S. Provisional Patent Application No. 62 / 911,335, filed October 6, 2019, each of which is incorporated by reference in its entirety. [Background technology]

[0002] background Oligonucleotides that target specific genes are useful in a variety of applications, including but not limited to, therapeutic, diagnostic and / or research applications, including the treatment of various disorders related to the target gene. Summary of the Invention [Means for solving the problem]

[0003] overview In some embodiments, the present disclosure provides oligonucleotides and compositions thereof with significantly improved properties and / or activity. Among other things, the present disclosure provides techniques for designing, producing, and utilizing such oligonucleotides and compositions. In particular, in some embodiments, the present disclosure provides useful internucleotide linkage patterns (e.g., type, modification, and / or chiral phosphorus position (Rp or Sp), etc.) and / or sugar modification patterns (e.g., type, pattern, etc.) that, when combined with one or more other structural elements described herein, such as base sequence (or portions thereof), nucleobase modifications (and patterns), internucleotide linkage modifications (and patterns), additional chemical moieties, etc., can confer enhanced activity and / or desired properties to oligonucleotides and compositions, including, but not limited to, allele-specific knockdown of mutant alleles of the HTT (huntingtin) gene (the mutant alleles are on the same chromosome as (in phase with) the expanded CAG repeat region associated with Huntington's disease).

[0004] In some embodiments, the target HTT nucleic acid is a mutant that includes both a discriminatory position and a mutation, such as an expanded CAG repeat region (e.g., greater than about 36 CAG) associated with Huntington's disease. In some embodiments, the reference or non-target HTT nucleic acid is wild-type, includes another variant at the discriminatory position, and lacks the expanded CAG repeat region (e.g., the CAG repeat region is less than about 35 CAG, and is not associated with Huntington's disease). In some embodiments, an HTT oligonucleotide (an oligonucleotide targeting an HTT target HTT nucleic acid) is capable of distinguishing between the target HTT nucleic acid and the reference HTT nucleic acid and mediating allele-specific knockdown of the target HTT nucleic acid. In some embodiments, the discriminatory position is a single nucleotide polymorphism (SNP) site, a point mutation, or the like. In some embodiments, the target HTT nucleic acid sequence and the reference HTT nucleic acid sequence include different bases at the SNP site. In some embodiments, a site in the target HTT nucleic acid is While a certain site in the disclosed oligonucleotide is completely complementary, the corresponding site in the reference HTT nucleic acid is not complementary. For example, in some embodiments, the target HTT nucleic acid sequence comprises rs362273, the SNP position of which is A, and its allele comprises an expanded CAG repeat (e.g., 36 or more), which is associated with Huntington's disease; the reference HTT nucleic acid sequence comprises rs362273, the SNP position of which is G, and its allele comprises fewer CAG repeats (e.g., 35 or less), which is less associated with Huntington's disease or not at all. In some embodiments, the sequence of the provided oligonucleotide, for example, GUUGATCTGTAGCAGCAGCT, is complementary to the target HTT nucleic acid sequence at a specific site, for example, the SNP site (e.g., [ka] Regarding [ka] is the SNP rs362273 position [ka] is complementary to

[0005] In some embodiments, the HTT oligonucleotide has a base sequence that is identical between the target mutant HTT nucleic acid and the wild-type HTT nucleic acid. In some embodiments, such oligonucleotides have the ability to knock down the levels, expression, and / or activity of both mutant and wild-type HTT; the oligonucleotides can be designed as pan-specific or non-allele-specific oligonucleotides.

[0006] In some embodiments, the provided oligonucleotides and compositions are useful for the prevention and / or treatment of various conditions, disorders, or diseases, particularly HTT-associated conditions, disorders, or diseases, including Huntington's disease. In some embodiments, the provided oligonucleotides and compositions selectively reduce the levels of HTT transcripts and / or products encoded thereby associated with Huntington's disease. In some embodiments, the provided oligonucleotides and compositions selectively reduce the levels of HTT transcripts and / or products encoded thereby that contain expanded CAG repeats (e.g., 36 or more).

[0007] Among other things, the present disclosure encompasses the recognition that controlling structural elements of HTT oligonucleotides can significantly affect oligonucleotide properties and / or activity, including knockdown (e.g., reducing activity, expression, and / or levels) of HTT target genes (or their products). In some embodiments, Huntington's disease is associated with the presence of a mutant HTT allele containing a CAG expansion (e.g., an increase in the length of a region containing multiple CAG repeats). In some embodiments, knockdown is allele-specific (wherein the mutant allele of HTT is preferentially knocked down compared to the wild-type). In some embodiments, knockdown is pan-specific (wherein both the mutant and wild-type alleles of HTT are significantly knocked down). In some embodiments, knockdown of HTT target genes is mediated by RNase H and / or steric hindrance affecting translation. In some embodiments, knockdown of HTT target genes is mediated by a mechanism involving RNA interference. In some embodiments, controlled structural elements of HTT oligonucleotides include, but are not limited to, base sequence, chemical modifications (e.g., modifications of sugars, bases, and / or internucleotide linkages) or patterns thereof, changes in stereochemistry (e.g., stereochemistry of backbone chiral internucleotide linkages) or patterns thereof, structure of the first or second wings or core and / or conjugation with additional chemical moieties (e.g., carbohydrate moieties, targeting moieties, etc.). In particular, in some embodiments, the present disclosure demonstrates that control of the stereochemistry of backbone chiral centers (stereochemistry of the bound phosphorus), optionally along with control of other aspects of oligonucleotide design and / or incorporation of carbohydrate moieties, can significantly improve the properties and / or activity of HTT oligonucleotides.

[0008] In some embodiments, the present disclosure relates to any HTT oligonucleotide that operates by any mechanism and includes any sequence, structure, or format (or a portion thereof) described herein, and that includes at least one non-naturally occurring modification of the base, sugar, or internucleotide linkage.

[0009] In some embodiments, the present disclosure provides an oligonucleotide composition comprising a plurality of oligonucleotides, the oligonucleotides comprising at least one chiral-controlled internucleotide linkage (the linking phosphorus of which is or has been purified for the Rp or Sp configuration (e.g., 80-100%, 85%-100%, 90%-100%, 95%-100%, or 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more of all oligonucleotides of the same chemical constitution in the composition share the same stereochemistry at the linking phosphorus), and not a random mixture of Rp and Sp internucleotide linkages; such internucleotide linkages are "sterically defined internucleotide linkages"), such as a phosphorothioate linkage in which the linking phosphorus is Rp or Sp. In some embodiments, the number of chiral-controlled internucleotide linkages is 1 to 100, 1 to 50, 1 to 40, 1 to 35, 1 to 30, 1 to 25, 1 to 20, 5 to 100, 5 to 50, 5 to 40, 5 to 35, 5 to 30, 5 to 25, 5 to 20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. In some embodiments, at least one internucleotide linkage is a chiral-controlled internucleotide linkage and is Sp, and / or at least one internucleotide linkage is a chiral-controlled internucleotide linkage and is Rp. In some embodiments, the pattern of backbone chiral centers of an oligonucleotide or a portion thereof (e.g., core) is or includes Rp(Sp). In some embodiments, the pattern of backbone chiral centers of an oligonucleotide or portion thereof (e.g., core) is or includes (Np)t[(Rp)n(Sp)m]y, where each of t, n, m, and y is independently as described herein.

[0010] In some embodiments, the present disclosure demonstrates that oligonucleotides containing a chiral Rp internucleotide linkage at the −1, +1, or +3 position relative to a discriminatory position (a position at which a target mutant HTT nucleic acid can be differentiated from a reference wild-type HTT nucleic acid by the base or its complementary base) can confer increased activity and / or selectivity and, in some embodiments, may be particularly useful for reducing the levels of disease-associated transcripts and / or products encoded thereby. Unless otherwise specified, with respect to the positioning of the Rp internucleotide linkage, "-" refers to counting from the nucleoside at the discriminatory position toward the 5' end of the oligonucleotide, with the internucleotide linkage attached to the 5' carbon of the nucleoside at the discriminatory position being the −1 internucleotide linkage, and "+" refers to counting from the nucleoside at the discriminatory position toward the 3' end of the oligonucleotide, with the internucleotide linkage attached to the 3' carbon of the nucleoside at the discriminatory position being the +1 internucleotide linkage. In some embodiments, an Rp at the −1 position resulted in increased activity and selectivity. In some embodiments, an Rp at position +1 resulted in increased activity and selectivity. In some embodiments, an Rp at position +3 resulted in increased activity. For example, as shown herein, HTT oligonucleotides WV-12281 (a single phosphorothioate Rp configuration at position -1 relative to the SNP position), WV-12282(+1), and WV-12284(+3) can confer high selectivity when used for allele-specific knockdown of mutant alleles.

[0011] In some embodiments, the present disclosure relates to HTT oligonucleotide compositions, wherein the HTT oligonucleotide comprises at least one chiral internucleotide linkage that is not chiral controlled.

[0012] In some embodiments, the oligonucleotide comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) non-negatively charged internucleotide linkages. In some embodiments, the oligonucleotide comprises one or more neutral internucleotide linkages. In some embodiments, the HTT oligonucleotide comprises a non-negatively charged or neutral internucleotide linkage. In some embodiments, the present disclosure provides an oligonucleotide, wherein the base sequence of the oligonucleotide comprises at least 10 contiguous bases that are identical or complementary to the base sequence of an HTT gene or a transcript thereof, the oligonucleotide comprises at least one non-negatively charged internucleotide linkage, and the oligonucleotide has the ability to reduce the level, expression, and / or activity of an HTT target gene or its gene product.

[0013] In some embodiments, the present disclosure encompasses the recognition that a variety of optional additional chemical moieties, such as carbohydrate moieties, targeting moieties, etc., may be incorporated into oligonucleotides to improve one or more properties and / or activities.

[0014] In some embodiments, the additional chemical moiety is selected from GalNAc, glucose, GluNAc (N-acetylamine glucosamine), and anisamide moieties and derivatives thereof, or any additional chemical moiety described herein and / or known in the art. In some embodiments, the oligonucleotide can include two or more additional chemical moieties, where the additional chemical moieties are identical or not identical, or are of the same category (e.g., carbohydrate moiety, sugar moiety, targeting moiety, etc.), or are not of the same category. In some embodiments, certain additional chemical moieties facilitate delivery of the oligonucleotide to desired cells, tissues, and / or organs; and / or facilitate internalization of the oligonucleotide; and / or increase oligonucleotide stability.

[0015] In some embodiments, the present disclosure provides: 1) common base sequence; 2) a common backbone bonding pattern; and 3) Common skeletal chiral center pattern The present invention provides a chiral controlled oligonucleotide composition comprising a plurality of oligonucleotides sharing a common base sequence, a common backbone bond pattern, and a common backbone chiral center pattern, which is a substantially pure preparation of a single oligonucleotide in that the non-random or controlled levels of the oligonucleotides in the composition have a common base sequence, a common backbone bond pattern, and a common backbone chiral center pattern.

[0016] In some embodiments, the oligonucleotide composition is a chiral controlled oligonucleotide composition comprising a plurality of oligonucleotides of a particular oligonucleotide type, which composition is chiral controlled in that the oligonucleotides of the particular oligonucleotide type are highly purified relative to a substantially racemic preparation of oligonucleotides having the same base sequence and chiral internucleotide linkage pattern.

[0017] In some embodiments, the present disclosure provides chirally controlled oligonucleotide compositions comprising a plurality of oligonucleotides capable of inducing HTT knockdown, wherein the oligonucleotides in the plurality are of a particular oligonucleotide type, and the composition is chirally controlled in that the oligonucleotides of the particular oligonucleotide type are highly purified relative to a substantially racemic preparation of oligonucleotides having the same base sequence.

[0018] In some embodiments, provided oligonucleotides comprise one or more blocks. In some embodiments, a block comprises one or more consecutive nucleosides, and / or nucleotides, and / or sugars, or bases, and / or internucleotide linkages that share a common chemistry (e.g., at least one common modification of a sugar, base, or internucleotide linkage, or a combination or pattern thereof, or a stereochemical pattern) that is not present in an adjacent block, or vice versa. In some embodiments, an HTT oligonucleotide comprises three or more blocks, wherein the blocks at both ends are not the same, and thus the oligonucleotide is asymmetric. In some embodiments, a block is a wing or core. In some embodiments, the core is also referred to as a gap.

[0019] In some embodiments, an oligonucleotide comprises at least one wing and at least one core, wherein the wing is structurally distinct from the core in that the wing of the oligonucleotide comprises structure (e.g., stereochemistry or chemical modifications (or patterns thereof) at the sugar, base, or internucleotide linkage) that is not present in the core, or vice versa. In some embodiments, the structure of the oligonucleotide comprises a wing-core-wing structure. In some embodiments, the structure of the oligonucleotide comprises a wing-core, core-wing, or wing-core-wing structure, wherein one wing differs from the other wing and core in structure (e.g., stereochemistry, additional chemical moieties, or chemical modifications (or patterns thereof) at the sugar, base, or internucleotide linkage) (e.g., asymmetric oligonucleotides).

[0020] In some embodiments, the wing comprises a sugar modification or pattern thereof that is not present in the core. In some embodiments, the wing comprises a sugar modification that is not present in the core. In some embodiments, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) sugars of the wing are independently modified. In some embodiments, each wing sugar is independently modified. In some embodiments, each sugar of the wing is the same. In some embodiments, at least one sugar of the wing is different from another sugar of that wing. In some embodiments, one or more sugar modifications and / or sugar modification patterns in a first wing (e.g., the 5'-wing) of the oligonucleotide are different from one or more sugar modifications and / or sugar modification patterns in a second wing (e.g., the 3'-wing) of the oligonucleotide. In some embodiments, the modification is a 2'-OR modification, where R is as described herein. In some embodiments, R is an optionally substituted C 1~4 In some embodiments, the modification is an alkyl. In some embodiments, the modification is a 2'-OMe. In some embodiments, the modification is a 2'-MOE. In some embodiments, the modified sugar is a high affinity sugar, such as a bicyclic sugar (e.g., an LNA sugar), a 2'-MOE, etc. In some embodiments, the sugar of the 3'-wing is a high affinity sugar. In some embodiments, the 3'-wing comprises one or more high affinity sugars. In some embodiments, each sugar of the 3'-wing is independently a high affinity sugar. In some embodiments, the high affinity sugar is a 2'-MOE sugar. In some embodiments, the high affinity sugar is attached to a non-negatively charged internucleotide linkage.

[0021] In some embodiments, the wings comprise one or more non-negatively charged internucleotide linkages. In some embodiments, the non-negatively charged internucleotide linkages are neutral internucleotide linkages. In some embodiments, each non-negatively charged internucleotide linkage is independently a neutral internucleotide linkage. In some embodiments, as demonstrated herein, oligonucleotides comprising wings comprising one or more non-negatively charged internucleotide linkages can provide enhanced activity and / or selectivity. In some embodiments, when describing internucleotide linkages and their patterns (including stereochemical patterns), the internucleotide linkage connecting the wing nucleoside and the core nucleoside is considered to be part of the core. In some embodiments, the non-negatively charged internucleotide linkage is chiral and is Rp or Sp.

[0022] In some embodiments, the core sugar is a naturally occurring DNA sugar that does not contain a substitution at the 2' position (the 2' carbon is two -H). In some embodiments, each core sugar is a naturally occurring DNA sugar that does not contain a substitution at the 2' position (the 2' carbon is two -H).

[0023] In some embodiments, the discriminating position (e.g., a SNP location or other mutation that distinguishes a wild-type target sequence from a disease-associated or mutant sequence) is at position 4, 5, or 6 from the 5' end of the core region. In some embodiments, the 4th, 5th, or 6th nucleobase (from the 5' end of the core) of the core region is sequence-specific and distinguishes one sequence from another (e.g., an SNP). In some embodiments, the discriminating position is at position 4 from the 5' end of the core region. In some embodiments, the discriminating position is at position 5 from the 5' end of the core region. In some embodiments, the discriminating position is at position 6 from the 5' end of the core region. In some embodiments, the discriminating position is at position 9, 10, or 11 from the 5' end of the oligonucleotide. In some embodiments, the discriminating position is at position 9 from the 5' end of the oligonucleotide. In some embodiments, the discriminating position is at position 10 from the 5' end of the oligonucleotide. In some embodiments, the discriminating position is at position 11 from the 5' end of the oligonucleotide.

[0024] In some embodiments, the oligonucleotides or oligonucleotide compositions are useful for the prevention or treatment of a condition, disorder, or disease. In some embodiments, the HTT oligonucleotides or HTT oligonucleotide compositions are useful in methods for treating an HTT-associated condition, disorder, or disease, such as Huntington's disease, in a subject in need thereof.

[0025] In some embodiments, the oligonucleotides or oligonucleotide compositions are useful for the manufacture of a medicament for treating a condition, disorder, or disease, such as Huntington's disease, in a subject in need thereof. In some embodiments, the HTT oligonucleotides or HTT oligonucleotide compositions are useful for the manufacture of a medicament for treating an HTT-associated condition, disorder, or disease, such as Huntington's disease, in a subject in need thereof. [Brief explanation of the drawings]

[0026] BRIEF DESCRIPTION OF THE DRAWINGS [Figure 1A]1 illustrates various formats that can be used in whole or in part for oligonucleotides, such as HTT oligonucleotides. [Figure 1B] 1 illustrates various formats that can be used in whole or in part for oligonucleotides, such as HTT oligonucleotides. [Figure 1C] 1 illustrates various formats that can be used in whole or in part for oligonucleotides, such as HTT oligonucleotides. [Figure 1D] 1 illustrates various formats that can be used in whole or in part for oligonucleotides, such as HTT oligonucleotides. DETAILED DESCRIPTION OF THE INVENTION

[0027] Detailed Description of Specific Embodiments The techniques of the present disclosure may be understood more readily by reference to the following detailed description of specific embodiments.

[0028] definition As used herein, the following definitions shall apply unless otherwise stated. For purposes of this disclosure, chemical elements are identified according to the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75th Ed. In addition, general principles of organic chemistry are described in "Organic Chemistry", Thomas Sorrell, University Science Books, Sausalito: 1999, and "March's Advanced Organic Chemistry", 5th Ed., Ed.: Smith, M. b. and March, J., John Wiley & Sons, New York: 2001.

[0029] As used herein in this disclosure, unless the context clearly indicates otherwise, (i) the terms "a" or "an" may be understood to mean "at least one"; (ii) the term "or" may be understood to mean "and / or"; (iii) the terms "comprising," "including," "including" (whether used in conjunction with "not limited to") and "comprises" (whether used in conjunction with "not limited to") may be understood to encompass the listed element or step, whether presented alone or with one or more additional elements or steps; (iv) the term "another" may be understood to mean at least an additional / second one or more; (v) the terms "about" and "approximately" may be understood to allow for standard deviation as one of ordinary skill in the art would understand; and (vi) when ranges are provided, the endpoints are included.

[0030] Unless otherwise specified, descriptions of oligonucleotides and their components (e.g., base sequence, sugar modifications, internucleotide linkages, bond phosphorus stereochemistry, etc.) are from 5' to 3'. Unless otherwise specified, the oligonucleotides described herein may be provided and / or utilized in salt form, particularly pharmaceutically acceptable salt form. As one of skill in the art will understand upon reading this disclosure, in some embodiments, oligonucleotides may be provided as salts, e.g., sodium salts. As one of skill in the art will understand, in some embodiments, individual oligonucleotides in a composition may be considered to be of the same chemical constitution and / or structure, even though a particular such oligonucleotide may be in one or more different salt forms at a particular moment in such a composition (e.g., a liquid composition) (and may be dissolved, although an oligonucleotide chain may exist in an anionic form, for example, when in a liquid composition). For example, one skilled in the art will understand that at a given pH, an individual internucleotide bond along an oligonucleotide chain may be in the acid (H) form or in one of several possible salt forms (e.g., sodium salt, or salt of another cation, depending on which ions may be present in the formulation or composition), and will understand that to the extent that the acid form (e.g., with all cations, if present, replaced by H) is of the same chemical constitution and / or structure, such individual oligonucleotides may be properly considered to be of the same chemical constitution and / or structure.

[0031] Aliphatic: As used herein, "aliphatic" refers to a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is fully saturated or contains one or more units of unsaturation, or a substituted or unsubstituted monocyclic, bicyclic, or polycyclic hydrocarbon ring that is fully saturated or contains one or more units of unsaturation, but is not aromatic, or a combination thereof. In some embodiments, an aliphatic group contains 1-50 aliphatic carbon atoms. In some embodiments, an aliphatic group contains 1-20 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-10 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-9 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-8 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-7 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-6 aliphatic carbon atoms. In yet other embodiments, an aliphatic group contains 1-5 aliphatic carbon atoms, and in still other embodiments, an aliphatic group contains 1, 2, 3, or 4 aliphatic carbon atoms. Suitable aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl groups, as well as hybrids such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl, or (cycloalkyl)alkenyl.

[0032] Alkenyl: As used herein, the term "alkenyl" refers to an aliphatic group, as defined herein, having one or more double bonds.

[0033] Alkyl: As used herein, the term "alkyl" is given its ordinary meaning in the art and includes saturated aliphatic groups, including straight-chain alkyl groups, branched alkyl groups, cycloalkyl (alicyclic) groups, alkyl-substituted cycloalkyl groups, and cycloalkyl-substituted alkyl groups. In some embodiments, an alkyl has 1-100 carbon atoms. In some embodiments, a straight-chain or branched-chain alkyl has about 1-20 carbon atoms in its backbone (e.g., C1-C for straight chain). 20 , C2 to C in the case of branched chains 20) or about 1-10. In some embodiments, cycloalkyl rings have from about 3-10 carbon atoms in their ring structure (and such rings may be monocyclic, bicyclic or polycyclic) or about 5, 6 or 7 carbons in the ring structure. In some embodiments, alkyl groups may be lower alkyl groups, where the lower alkyl group has from 1-4 carbon atoms (e.g., C1-C4 for a straight chain lower alkyl).

[0034] Alkynyl: As used herein, the term "alkynyl" refers to an aliphatic group, as defined herein, having one or more triple bonds.

[0035] Analog: The term "analog" includes any chemical moiety that is structurally different from a reference chemical moiety or class of chemical moieties, but that is capable of performing at least one function of such reference chemical moiety or class of chemical moieties. As non-limiting examples, a nucleotide analog is structurally different from a nucleotide, but performs at least one function of a nucleotide; a nucleobase analog is structurally different from a nucleobase, but performs at least one function of a nucleobase, etc.

[0036] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to humans at any stage of development. In some embodiments, "animal" refers to non-human animals at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., a rodent, mouse, rat, rabbit, monkey, dog, cat, sheep, cow, primate, and / or pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and / or worms. In some embodiments, the animal may be a transgenic animal, a genetically engineered animal, and / or a clone.

[0037] Antisense: As used herein, the term "antisense" refers to the characteristics of an oligonucleotide or other nucleic acid having a base sequence complementary or substantially complementary to a target HTT nucleic acid to which it can hybridize. In some embodiments, the target HTT nucleic acid is a target gene mRNA. In some embodiments, hybridization is required for or results in a single activity, e.g., a decrease in the level, expression, or activity of the target HTT nucleic acid or its gene product. The term "antisense oligonucleotide" as used herein refers to an oligonucleotide complementary to a target HTT nucleic acid. In some embodiments, an antisense oligonucleotide is capable of inducing a decrease in the level, expression, or activity of the target HTT nucleic acid or its product. In some embodiments, an antisense oligonucleotide is capable of inducing a decrease in the level, expression, or activity of the target HTT nucleic acid or its product through mechanisms involving RNase H, steric hindrance, and / or RNA interference.

[0038] Aryl: As used herein, the term "aryl," whether used alone or as part of a larger moiety, as in "aralkyl," "aralkoxy," or "aryloxyalkyl," refers to a monocyclic, bicyclic, or polycyclic ring system having a total of 5 to 30 ring members, wherein at least one ring in the ring system is aromatic. In some embodiments, an aryl group is a monocyclic, bicyclic, or polycyclic ring system having a total of 5 to 14 ring members, wherein at least one ring in the ring system is aromatic and each ring in the ring system contains 3 to 7 ring members. In some embodiments, an aryl group is a biaryl group. The term "aryl" may also be used interchangeably with the term "aryl ring." In certain embodiments of the present disclosure, "aryl" refers to an aromatic ring system, including, but not limited to, phenyl, biphenyl, naphthyl, binaphthyl, anthracyl, and the like, which may bear one or more substituents. Also included within the scope of the term "aryl," as it is used herein, are groups in which an aromatic ring is fused to one or more non-aromatic rings, such as indanyl, phthalimidyl, naphthoimidyl, phenanthridinyl, or tetrahydronaphthyl.

[0039] Chiral control: As used herein, "chiral control" refers to the control of the stereochemistry of the chiral linking phosphorus at a chiral internucleotide linkage within an oligonucleotide. As used herein, a chiral internucleotide linkage is an internucleotide linkage in which the linking phosphorus is chiral. In some embodiments, the control is achieved through chiral elements absent from the sugar and base moieties of the oligonucleotide; for example, in some embodiments, the control is achieved through one or more chiral auxiliary groups during the oligonucleotide preparation process, as described in this disclosure; this chiral auxiliary is often part of the chiral phosphoramidite used in the oligonucleotide preparation process. In contrast to chiral control, those skilled in the art will understand that conventional oligonucleotide synthesis without a chiral auxiliary cannot control the stereochemistry at the chiral internucleotide linkage when such conventional oligonucleotide synthesis is used to form the chiral internucleotide linkage. In some embodiments, the stereochemistry of each chiral linking phosphorus in each chiral internucleotide linkage within an oligonucleotide is controlled.

[0040] Chirality-controlled oligonucleotide composition: As used herein, the terms "chirality-controlled oligonucleotide composition," "chirality-controlled nucleic acid composition," and the like refer to a composition comprising multiple oligonucleotides (or nucleic acids) that share 1) a common base sequence, 2) a common backbone linkage pattern, and 3) a common backbone phosphorus modification pattern, where the multiple oligonucleotides (or nucleic acids) share the same bond phosphorus stereochemistry at one or more chiral internucleotide linkages (chirality-controlled or stereo-defined internucleotide linkages, in which the chiral bond phosphorus is Rp or Sp ("stereically defined") in the composition, rather than a random Rp and Sp mixture as in non-chirality-controlled internucleotide linkages). The level of multiple oligonucleotides (or nucleic acids) in the chirality-controlled oligonucleotide composition is predetermined / controlled (e.g., through chirality-controlled oligonucleotide preparation to stereoselectively form one or more chiral internucleotide linkages). In some embodiments, about 1% to 100% (e.g., about 5% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 95% to 100%, 50% to 90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of the plurality are oligonucleotides.In some embodiments, about 0.1% to 100% (e.g., 5% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 95% to 100%, 50% to 90%, or about 5%, 1% or less) of all oligonucleotides in a chiral controlled oligonucleotide composition share a common base sequence. 0%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) are a plurality of oligonucleotides. In some embodiments, the level is about 1% to 100% (e.g., about 5% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80 to 100%, 90 to 100%, 95 to 100%, 50% to 90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 50%, ... 95%, 50%, 90%, 95%, 50%, 90%, 95%, 50%, 90%, 95%, 50%, 90%, 95%, 50%, 90%, 95%, 50%, 90%, 95%, 50%, 90%, 95%, 50%, 90%, 95%, 50%, 90%, 95%, 50%, 90%, 95%, 50%, 90%, 95%, 50%, 90%, 95%, 50%, 90%, 95%, 0%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.In some embodiments, the plurality of oligonucleotides have the same stereochemistry at about 1 to 50 (e.g., about 1 to 10, 1 to 20, 5 to 10, 5 to 20, 10 to 15, 10 to 20, 10 to 25, 10 to 30, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) chiral internucleotide linkages. In some embodiments, the plurality of oligonucleotides comprises between about 1% and 100% (e.g., between about 5% and 100%, 10% and 100%, 20% and 100%, 30% and 100%, 40% and 100%, 50% and 100%, 60% and 100%, 70% and 100%, 80% and 100%, 90% and 100%, 95% and 100%, 50% and 90%, or about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% or at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% have the same stereochemistry. In some embodiments, the oligonucleotides (or nucleic acids) in a plurality are of the same chemical constitution.In some embodiments, the level of an oligonucleotide (or nucleic acid) in the plurality is between about 1% and 100% (e.g., between about 5% and 100%, 10% and 100%, 20% and 100%, 30% and 100%, 40% and 100%, 50% and 100%, 60% and 100%, 70% and 100%, 80% and 100%, 90% and 100%) of all oligonucleotides (or nucleic acids) in the composition that share the same chemical makeup as the oligonucleotide (or nucleic acid) in the plurality. , 95-100%, 50%-90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, each chiral internucleotide linkage is a chiral-controlled internucleotide linkage, and the composition is a completely chiral-controlled oligonucleotide composition. In some embodiments, the oligonucleotides (or nucleic acids) in the plurality are structurally identical. In some embodiments, the chiral controlled internucleotide linkage has a diastereomeric purity of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, typically at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%. In some embodiments, the chiral controlled internucleotide linkage has a diastereomeric purity of at least 95%. In some embodiments, the chiral controlled internucleotide linkage has a diastereomeric purity of at least 96%. In some embodiments, the chiral controlled internucleotide linkage has a diastereomeric purity of at least 97%. In some embodiments, the chiral controlled internucleotide linkage has a diastereomeric purity of at least 98%. In some embodiments, the chiral controlled internucleotide linkage has a diastereomeric purity of at least 99%. In some embodiments, the level percentages are (DS).nc Or at least (DS) nc where DS is the diastereomeric purity as described herein (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% or more), and nc is the number of chiral-controlled internucleotide linkages as described herein (e.g., 1 to 50, 1 to 40, 1 to 30, 1 to 25, 1 to 20, 5 to 50, 5 to 40, 5 to 30, 5 to 25, 5 to 20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more). In some embodiments, the percentage level is (DS) nc Or at least (DS) nc where DS is 95% to 100%. For example, if DS is 99% and nc is 10, the percentage is 90% or at least 90% ((99%) 10≈0.90=90%). In some embodiments, the level of multiple oligonucleotides in a composition is expressed as the product of the diastereopurities of each chiral-controlled internucleotide linkage in the oligonucleotide. In some embodiments, the diastereopurity of an internucleotide linkage linking two nucleosides in an oligonucleotide (or nucleic acid) is expressed by the diastereopurity of the internucleotide linkage of a dimer linking the same two nucleosides, where the dimer is prepared using equivalent conditions, in some cases identical synthesis cycle conditions (e.g., for a linkage between Nx and Ny of an oligonucleotide...NxNy..., the dimer is NxNy). In some embodiments, not all chiral internucleotide linkages are chiral-controlled internucleotide linkages, and the composition is a partially chiral-controlled oligonucleotide composition. In some embodiments, the non-chirally controlled internucleotide linkages have a diastereomeric purity of less than about 80%, 75%, 70%, 65%, 60%, 55%, or about 50%, as typically found in stereo-random oligonucleotide compositions (e.g., as understood by those skilled in the art, by conventional oligonucleotide synthesis, e.g., phosphoramidite methods). In some embodiments, the oligonucleotides (or nucleic acids) in the plurality are of the same type. In some embodiments, the chirality-controlled oligonucleotide composition comprises non-random or controlled levels of individual oligonucleotide or nucleic acid types. For example, in some embodiments, the chirality-controlled oligonucleotide composition comprises one or more oligonucleotide types. In some embodiments, the chirality-controlled oligonucleotide composition comprises two or more oligonucleotide types. In some embodiments, the chirality-controlled oligonucleotide composition comprises multiple oligonucleotide types. In some embodiments, the chirality-controlled oligonucleotide composition is a composition of oligonucleotides of a certain oligonucleotide type, and the composition comprises non-random or controlled levels of multiple oligonucleotides of that oligonucleotide type.

[0041] Equivalent: The term "equivalent" is used herein to describe two (or more) sets of conditions or circumstances that are sufficiently similar to one another to permit comparison of the results obtained or the phenomena observed. In some embodiments, equivalent sets of conditions or circumstances are characterized by a plurality of substantially identical characteristics and one or a small number of variable characteristics. One skilled in the art will understand that sets of conditions are equivalent to one another when they are characterized by a sufficient number and type of substantially identical characteristics to warrant a reasonable conclusion that differences in the results obtained or the phenomena observed under different sets of conditions or circumstances are caused by or indicative of differences in those variable characteristics.

[0042] Alicyclic: The terms "alicyclic," "carbocycle," "carbocyclyl," "carbocyclic group," and "carbocyclic ring" are used interchangeably and, as used herein, refer to a saturated or partially unsaturated, but non-aromatic, cycloaliphatic monocyclic, bicyclic, or polycyclic ring system, as described herein, having 3 to 30 ring members, unless otherwise specified. Alicyclic groups include, without limitation, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, cycloheptenyl, cyclooctyl, cyclooctenyl, norbornyl, adamantyl, and cyclooctadienyl. In some embodiments, an alicyclic group has 3 to 6 carbons. In some embodiments, an alicyclic group is saturated and is a cycloalkyl. The term "alicyclic" can also include an aliphatic ring fused to one or more aromatic or non-aromatic rings, such as decahydronaphthyl or tetrahydronaphthyl. In some embodiments, an alicyclic group is bicyclic. In some embodiments, an alicyclic group is tricyclic. In some embodiments, an alicyclic group is polycyclic. In some embodiments, an "alicyclic" refers to a C3-C6 monocyclic hydrocarbon having a single point of attachment to the rest of the molecule, or a C8-C6 monocyclic hydrocarbon having a single point of attachment to the rest of the molecule, which is fully saturated or contains one or more units of unsaturation, but is not aromatic. 10Bicyclic or polycyclic hydrocarbons, or C9-C, which are fully saturated or contain one or more unsaturated units, but are not aromatic, and have a single point of attachment to the rest of the molecule 16 Refers to polycyclic hydrocarbons.

[0043] Gapmer: As used herein, the term "gapmer" refers to an oligonucleotide characterized by comprising a contiguous core flanked by 5' and 3' wings. In some embodiments, in a gapmer, at least one internucleotide phosphorus linkage of the oligonucleotide is a natural phosphate linkage. In some embodiments, two or more internucleotide phosphorus linkages of an oligonucleotide strand are natural phosphate linkages. In some embodiments, a gapmer is a sugar-modified gapmer, where each wing sugar independently comprises a sugar modification and the core sugar does not comprise a sugar modification found on the wing sugar. In some embodiments, each core sugar is unmodified and 2'-unsubstituted (as in natural DNA). In some embodiments, each wing sugar is independently a 2'-modified sugar. In some embodiments, at least one wing sugar is a bicyclic sugar. In some embodiments, the sugar units in each wing have the same sugar modification (e.g., 2'-OMe (2'-OMe wing), 2'-MOE (2'-MOE wing), etc.). In some embodiments, each wing sugar has the same modification. The core and wings may be of various lengths. In some embodiments, the wings are 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleosides in length (in many embodiments, 3, 4, 5, or 6 or more) and the core is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleosides in length (in many embodiments, 8, 9, 10, 11, 12 or more). In some embodiments, the oligonucleotide comprises or consists of a 2-9-6, 3-9-3, 3-9-4, 3-9-5, 4-7-4, 4-9-4, 4-9-5, 4-10-5, 4-11-4, 4-11-5, 5-7-5, 5-8-6, 5-9-3, 5-9-5, 5-10-4, 5-10-5, 6-7-6, 6-8-5, or 6-9-2 wing-core-wing structure. In some embodiments, the oligonucleotide is a gapmer.

[0044] Heteroaliphatic: As used herein, the term "heteroaliphatic" is given its ordinary meaning in the art and refers to an aliphatic group, as described herein, in which one or more carbon atoms are independently replaced by one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, etc.). In some embodiments, one or more units selected from C, CH, CH, and CH are independently replaced by one or more heteroatoms (including oxidized and / or substituted forms thereof). In some embodiments, a heteroaliphatic group is a heteroalkyl. In some embodiments, a heteroaliphatic group is a heteroalkenyl.

[0045] Heteroalkyl: As used herein, the term "heteroalkyl" is given its ordinary meaning in the art and refers to an alkyl group, as described herein, in which one or more carbon atoms are independently replaced by one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, etc.). Examples of heteroalkyl groups include, but are not limited to, alkoxy, poly(ethylene glycol)-substituted, alkyl-substituted amino, tetrahydrofuranyl, piperidinyl, morpholinyl, and the like.

[0046] Heteroaryl: As used herein, the terms "heteroaryl" and "heteroar-," used alone or as part of a larger moiety, e.g., "heteroaralkyl" or "heteroaralkoxy," refer to a monocyclic, bicyclic, or polycyclic ring system having a total of 5 to 30 ring members, wherein at least one ring in the ring system is aromatic and at least one aromatic ring atom is a heteroatom. In some embodiments, a heteroaryl group is a group having 5 to 10 ring atoms (i.e., monocyclic, bicyclic, or polycyclic), and in some embodiments, 5, 6, 9, or 10 ring atoms. In some embodiments, a heteroaryl group has 6, 10, or 14 pi electrons shared in a cyclic arrangement; and has 1 to 5 heteroatoms in addition to the carbon atoms. Heteroaryl groups include, without limitation, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, and pteridinyl. In some embodiments, a heteroaryl is a heterobiaryl group such as bipyridyl. As used herein, the terms "heteroaryl" and "heteroar-" also include groups in which a heteroaromatic ring is fused to one or more aryl, alicyclic, or heterocyclyl rings, and the bonding group or point of attachment is on the heteroaromatic ring. Non-limiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzthiazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4H-quinolizinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[2,3-b]-1,4-oxazin-3(4H)-one. Heteroaryl groups can be monocyclic, bicyclic, or polycyclic.The term "heteroaryl" may be used interchangeably with the terms "heteroaryl ring," "heteroaryl group," or "heteroaromatic," any of which terms include rings that are optionally substituted. The term "heteroaralkyl" refers to an alkyl group substituted by a heteroaryl group, where the alkyl and heteroaryl portions independently are optionally substituted.

[0047] Heteroatom: The term "heteroatom," as used herein, means an atom that is not carbon or hydrogen. In some embodiments, a heteroatom is selected from the group consisting of boron, oxygen, sulfur, nitrogen, phosphorus, or silicon (any oxidized form of nitrogen, sulfur, phosphorus, or silicon; a quaternized form of any basic or substitutable nitrogen in a heterocyclic ring (e.g., N as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl), or NR + (including as in N-substituted pyrrolidinyl); in some embodiments, the heteroatom is oxygen, sulfur, or nitrogen.

[0048] Heterocycle: As used herein, the terms "heterocycle," "heterocyclyl," "heterocyclic group," and "heterocyclic ring" are used interchangeably and refer to a monocyclic, bicyclic, or polycyclic ring moiety (e.g., a 3- to 30-membered ring) that is saturated or partially unsaturated and has one or more heteroatom ring atoms. In some embodiments, a heterocyclyl group is a stable 5- to 7-membered monocyclic or 7- to 10-membered bicyclic heterocyclic moiety that is either saturated or partially unsaturated and has, in addition to carbon atoms, one or more, preferably 1 to 4, heteroatoms as defined above. When used in reference to a ring atom of a heterocycle, the term "nitrogen" includes substituted nitrogen. By way of example, in a saturated or partially unsaturated ring having 0 to 3 heteroatoms selected from oxygen, sulfur, and nitrogen, the nitrogen can be N (as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl), or . +It can be NR (as in N-substituted pyrrolidinyl). A heterocyclic ring can be attached to its pendant group at any heteroatom or carbon atom that results in a stable structure, and any of the ring atoms can be optionally substituted. Examples of such saturated or partially unsaturated heterocyclic groups include, without limitation, tetrahydrofuranyl, tetrahydrothienyl, pyrrolidinyl, piperidinyl, pyrrolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, and quinuclidinyl. The terms "heterocycle," "heterocyclyl," "heterocyclyl ring," "heterocyclic group," "heterocyclic moiety," and "heterocyclic radical" are used interchangeably herein and include groups in which a heterocyclyl ring is fused to one or more aryl, heteroaryl, or alicyclic rings, such as indolinyl, 3H-indolyl, chromanyl, phenanthridinyl, or tetrahydroquinolinyl. Heterocyclyl groups can be monocyclic, bicyclic, or polycyclic. The term "heterocyclylalkyl" refers to an alkyl group substituted by a heterocyclyl, where the alkyl and heterocyclyl portions independently are optionally substituted.

[0049] Homology: "Homology" or "identity" or "similarity" refers to the sequence similarity between two nucleic acid molecules. Homology and identity can each be determined by comparing positions in each sequence, which can be aligned for comparison purposes. When an equivalent position in the sequences under comparison is occupied by the same base, the molecules are therefore identical at that position; when an equivalent site is occupied by the same or similar nucleic acid residue (e.g., similar steric and / or electronic properties), the molecules can therefore be said to be homologous (similar) at that position. Expression as a percentage of homology / similarity or identity refers to a function of the number of identical or similar nucleic acids at positions shared by the sequences under comparison. In some embodiments, an "unrelated" or "non-homologous" sequence shares less than 40% identity, less than 35% identity, less than 30% identity, or less than 25% identity with a sequence described herein. In comparing two sequences, the absence or presence of residues (amino acids or nucleic acids) also reduces identity and homology / similarity. In some embodiments, polymer molecules (e.g., oligonucleotides, nucleic acids, proteins, etc.) are considered "homologous" to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. In some embodiments, polymer molecules are considered "homologous" to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% similar.

[0050] In some embodiments, the term "homology" refers to a mathematically based comparison of sequence similarity used to identify genes with similar functions or motifs. A search of public databases can be performed using the nucleic acid sequences described herein as a "query sequence" to identify, for example, other family members, related sequences, or homologs. In some embodiments, such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10. In some embodiments, BLAST nucleotide searches can be performed with the NBLAST program, score=100, word length=12, to obtain nucleotide sequences homologous to the nucleic acid molecules of the present disclosure. In some embodiments, gapped BLAST can be utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25(17):3389-3402 to obtain gapped alignments for comparison purposes. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (eg, XBLAST and BLAST) can be used (www.ncbi.nlm.nih.gov).

[0051] Identity: As used herein, the term "identity" refers to the overall relatedness between polymer molecules, e.g., between nucleic acid molecules (e.g., oligonucleotides, DNA, RNA, etc.) and / or between polypeptide molecules. In some embodiments, polymer molecules are considered "substantially identical" to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. For example, calculation of the percent identity of two nucleic acid or polypeptide sequences can be performed by aligning the two sequences for optimal comparison (e.g., gaps can be introduced into one or both of the first and second sequences for optimal alignment, and non-identical sequences can be disregarded for comparison purposes). In certain embodiments, the length of sequences aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of the reference sequence. Nucleotides at corresponding positions are then compared. If a position in the first sequence is occupied by the same residue (e.g., nucleotide or amino acid) as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps needed to be introduced for optimal alignment of the two sequences and the length of each gap. Sequence comparison and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4: 11-17), which is incorporated into the ALIGN program (version 2.0). In some exemplary embodiments, nucleic acid sequence comparisons performed with the ALIGN program use a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4.The percent identity between two nucleotide sequences can alternatively be determined using the NWSgapdna.CMP matrix with the GAP program in the GCG software package.

[0052] Internucleotide linkage: As used herein, the phrase "internucleotide linkage" generally refers to the linkage connecting the nucleoside units of an oligonucleotide or nucleic acid. In some embodiments, the internucleotide linkage is a phosphodiester linkage (a natural phosphate linkage (-OP(=O)(OH)O-), which may exist as a salt form, as will be understood by those of skill in the art) as commonly found in naturally occurring DNA and RNA molecules. In some embodiments, the internucleotide linkage is a modified internucleotide linkage (not a natural phosphate linkage). In some embodiments, the internucleotide linkage is a "modified internucleotide linkage" in which at least one oxygen atom or -OH of the phosphodiester linkage is replaced with a different organic or inorganic moiety. In some embodiments, such organic or inorganic moiety is selected from =S, =Se, =NR', -SR', -SeR', -N(R')2, B(R')3, -S-, -Se-, and -N(R')-, where each R' is independently as defined and described in this disclosure. In some embodiments, the internucleotide linkage is a phosphotriester linkage, a phosphorothioate linkage (or a phosphorothioate diester linkage, -OP(=O)(SH)O-, which may exist as a salt form, as will be understood by those of skill in the art), or a phosphorothioate triester linkage. In some embodiments, the modified internucleotide linkage is a phosphorothioate linkage. In some embodiments, the internucleotide linkage is, for example, one of a PNA (peptide nucleic acid) or a PMO (phosphorodiamidate morpholino oligomer) linkage. In some embodiments, the modified internucleotide linkage is a non-negatively charged internucleotide linkage. In some embodiments, the modified internucleotide linkage is a neutral internucleotide linkage (e.g., n001 in certain provided oligonucleotides). Those of skill in the art will understand that internucleotide linkages may exist as anions or cations at a given pH due to the presence of acidic or basic moieties in the linkage.In some embodiments, the modified internucleotide linkages are modified internucleotide linkages designated s, s1, s2, s3, s4, s5, s6, s7, s8, s9, s10, s11, s12, s13, s14, s15, s16, s17 and s18 as described in WO 2017 / 210647.

[0053] In vitro: As used herein, the term "in vitro" refers to events that occur not within an organism (e.g., an animal, plant, and / or microorganism), but rather in an artificial environment, such as in a test tube or reactor, in cell culture, etc.

[0054] In vivo: As used herein, the term "in vivo" refers to events that take place within an organism (e.g., an animal, a plant, and / or a microorganism).

[0055] Bound phosphorus: As defined herein, the phrase "bound phosphorus" is used to indicate that the particular phosphorus atom being referred to is a phosphorus atom present in an internucleotide linkage, which corresponds to the phosphorus atom of a phosphodiester internucleotide linkage as present in naturally occurring DNA and RNA. In some embodiments, the bound phosphorus atom is in a modified internucleotide linkage, wherein each oxygen atom of the phosphodiester linkage is optionally and independently replaced with an organic or inorganic moiety. In some embodiments, the bound phosphorus atom is P of Formula I, as defined herein. In some embodiments, the bound phosphorus atom is chiral. In some embodiments, the bound phosphorus atom is achiral (e.g., as in a natural phosphate linkage).

[0056] Linker: The terms "linker," "linking moiety," and the like refer to any chemical moiety that links one chemical moiety to another. As one of ordinary skill in the art will understand, linkers can be bivalent, trivalent, or more, depending on the number of chemical moieties to which the linker links. In some embodiments, a linker is a moiety that links one oligonucleotide to another in a multimer. In some embodiments, a linker is a moiety that is optionally located between the terminal nucleoside and a solid support or between the terminal nucleoside and another nucleoside, nucleotide, or nucleic acid. In some embodiments, in an oligonucleotide, a linker links a chemical moiety (e.g., a targeting moiety, a lipid moiety, a carbohydrate moiety, etc.) to the oligonucleotide chain (e.g., at its 5' end, 3' end, nucleobase, sugar, internucleotide bond, etc.).

[0057] Lower alkyl: The term "lower alkyl" refers to a C 1~4 It refers to a straight-chain or branched alkyl group. Exemplary lower alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, and tert-butyl.

[0058] Lower haloalkyl: The term "lower haloalkyl" refers to a C alkyl group substituted with one or more halogen atoms. 1~4 It refers to a straight or branched chain alkyl group.

[0059] Modified nucleobase: The terms "modified nucleobase," "modified base," and the like refer to a chemical moiety that is chemically different from a nucleobase but has the ability to perform at least one function of a nucleobase. In some embodiments, a modified nucleobase is a nucleobase that includes a modification. In some embodiments, a modified nucleobase has the ability to perform at least one function of a nucleobase, for example, the ability to form a moiety in a polymer that has the ability to base pair with a nucleic acid that contains at least a complementary base sequence. In some embodiments, a modified nucleobase is a substituted A, T, C, G, or U, or a substituted tautomer of A, T, C, G, or U. In some embodiments, a modified nucleobase in the context of an oligonucleotide refers to a nucleobase that is not A, T, C, G, or U.

[0060] Modified nucleoside: The term "modified nucleoside" refers to a moiety derived from or chemically similar to a natural nucleoside, but containing a chemical modification that distinguishes it from a natural nucleoside. Non-limiting examples of modified nucleosides include those containing modifications to the base and / or sugar. Non-limiting examples of modified nucleosides include those with 2' modifications to the sugar. Non-limiting examples of modified nucleosides also include abasic nucleosides (which lack a nucleobase). In some embodiments, the modified nucleoside retains the capability of at least one function of a nucleoside, e.g., the ability to form a moiety in a polymer that has base pairing capability with a nucleic acid containing at least a complementary base sequence.

[0061] Modified Nucleotide: The term "modified nucleotide" includes any chemical moiety that is structurally different from a naturally occurring nucleotide but that is capable of performing at least one function of a naturally occurring nucleotide. In some embodiments, a modified nucleotide comprises a modification to the sugar, base, and / or internucleotide linkage. In some embodiments, a modified nucleotide comprises a modified sugar, a modified nucleobase, and / or a modified internucleotide linkage. In some embodiments, a modified nucleotide retains the capability of at least one function of a nucleotide, e.g., the ability to form a subunit in a polymer that has base-pairing capability with a nucleic acid comprising at least a complementary base sequence.

[0062] Modified sugar: The term "modified sugar" refers to a moiety that can replace a sugar. The modified sugar mimics the spatial arrangement, electronic properties, or some other physicochemical property of the sugar. In some embodiments, as described in this disclosure, the modified sugar is a substituted ribose or deoxyribose. In some embodiments, the modified sugar comprises a 2'-modification. Examples of useful 2'-modifications are widely available in the art and are described herein. In some embodiments, the 2'-modification is 2'-OR, where R is an optionally substituted C 1~10It is aliphatic. In some embodiments, the 2'-modification is 2'-OMe. In some embodiments, the 2'-modification is 2'-MOE. In some embodiments, the modified sugar is a bicyclic sugar (e.g., a sugar used in LNA, BNA, etc.). In some embodiments, in the context of oligonucleotides, a modified sugar is a sugar that is not a ribose or deoxyribose as typically found in natural RNA or DNA.

[0063] Nucleic Acid: As used herein, the term "nucleic acid" includes any nucleotide and polymers thereof. The term "polynucleotide" as used herein refers to a polymeric form of nucleotides of any length, whether ribonucleotides (RNA) or deoxyribonucleotides (DNA), or a combination thereof. These terms refer to the primary structure of the molecule and thus include double- and single-stranded DNA and double- and single-stranded RNA. These terms synonymously include analogs of any RNA or DNA, including modified nucleotides and / or modified polynucleotides, such as, but not limited to, methylated, protected, and / or capped nucleotides or polynucleotides. These terms encompass poly- or oligo-ribonucleotides (RNA) and poly- or oligo-deoxyribonucleotides (DNA); RNA or DNA derived from nucleobases and / or N-glycosides or C-glycosides of modified nucleobases; nucleic acids derived from sugars and / or modified sugars; and nucleic acids derived from phosphate bridges and / or modified internucleotide linkages. The term encompasses nucleic acids containing any combination of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges, or modified internucleotide linkages. Examples include, but are not limited to, nucleic acids containing ribose moieties, nucleic acids containing deoxyribose moieties, nucleic acids containing both ribose and deoxyribose moieties, and nucleic acids containing ribose and modified ribose moieties. Unless otherwise specified, the prefix poly- refers to a nucleic acid containing from 2 to about 10,000 nucleotide monomer units, where the prefix oligo- refers to a nucleic acid containing from 2 to about 200 nucleotide monomer units.

[0064] Nucleobase: The term "nucleobase" refers to the part of a nucleic acid that participates in hydrogen bonding, sequence-specifically linking one nucleic acid strand to another complementary strand. The most common naturally occurring nucleobases are adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, a naturally occurring nucleobase is a modified adenine, guanine, uracil, cytosine, or thymine. In some embodiments, a naturally occurring nucleobase is a methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, a nucleobase comprises a heteroaryl ring in which the ring atom is nitrogen, when present in a nucleoside, and which is attached to the sugar moiety. In some embodiments, a nucleobase comprises a heterocyclic ring in which the ring atom is nitrogen, when present in a nucleoside, and which is attached to the sugar moiety. In some embodiments, the nucleobase is a "modified nucleobase," i.e., a nucleobase other than adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, the modified nucleobase is a substituted A, T, C, G, or U. In some embodiments, the modified nucleobase is a substituted tautomer of A, T, C, G, or U. In some embodiments, the modified nucleobase is a methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the modified nucleobase mimics the spatial arrangement, electronic properties, or some other physicochemical property of the nucleobase and retains the hydrogen bonding properties that sequence-specifically bind one nucleic acid strand to another. In some embodiments, the modified nucleobase is capable of pairing with all five naturally occurring bases (uracil, thymine, adenine, cytosine, or guanine) without substantially affecting the melting behavior, recognition by intracellular enzymes, or activity of the oligonucleotide duplex. As used herein, the term "nucleobase" also encompasses structural analogs that are used in place of natural or naturally occurring nucleotides, such as modified nucleobases and nucleobase analogs. In some embodiments, the nucleobase is an optionally substituted A, T, C, G, or U, or an optionally substituted tautomer of A, T, C, G, or U.In some embodiments, "nucleobase" refers to a nucleobase unit in an oligonucleotide or nucleic acid (eg, A, T, C, G, or U as in an oligonucleotide or nucleic acid).

[0065] Nucleoside: The term "nucleoside" refers to a moiety in which a nucleobase or modified nucleobase is covalently linked to a sugar or modified sugar. In some embodiments, the nucleoside is a natural nucleoside, such as adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, or deoxycytidine. In some embodiments, the nucleoside is a modified nucleoside, such as a substituted natural nucleoside selected from adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, and deoxycytidine. In some embodiments, the nucleoside is a modified nucleoside, such as a substituted tautomer of a natural nucleoside selected from adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, and deoxycytidine. In some embodiments, "nucleoside" refers to a nucleoside unit in an oligonucleotide or nucleic acid.

[0066] Nucleoside Analog: The term "nucleoside analog" refers to a chemical moiety that is chemically different from a naturally occurring nucleoside but that retains the ability to perform at least one function of a nucleoside. In some embodiments, a nucleoside analog comprises a sugar analog and / or a nucleobase analog. In some embodiments, a modified nucleoside retains the ability of at least one function of a nucleoside, e.g., the ability to form a moiety in a polymer that has base pairing ability with a nucleic acid containing a complementary base sequence.

[0067] Nucleotide: As used herein, the term "nucleotide" refers to a monomeric unit of a polynucleotide consisting of a nucleobase, a sugar, and one or more internucleotide linkages (e.g., phosphate linkages in natural DNA and RNA). Naturally occurring bases [guanine (G), adenine (A), cytosine (C), thymine (T), and uracil (U)] are derivatives of purines or pyrimidines, although it should be understood that naturally occurring and non-naturally occurring base analogs are also included. Naturally occurring sugars are the pentose (five-carbon sugar) deoxyribose (which forms DNA) or ribose (which forms RNA), although it should be understood that naturally occurring and non-naturally occurring sugar analogs are also included. Nucleotides are linked by internucleotide linkages to form nucleic acids, or polynucleotides. Numerous internucleotide linkages are known in the art (including, but not limited to, phosphate, phosphorothioate, boranophosphate, etc.). Artificial nucleic acids include PNA (peptide nucleic acid), phosphotriester, phosphorothioic acid, H-phosphonic acid, phosphoramidic acid, boranophosphate, methylphosphonic acid, phosphonoacetic acid, thiophosphonoacetic acid, and other variants of the phosphate backbone of natural nucleic acids, such as those described herein. In some embodiments, natural nucleotides contain naturally occurring bases, sugars, and internucleotide linkages. As used herein, the term "nucleotide" also encompasses structural analogs that are used in place of natural or naturally occurring nucleotides, such as modified nucleotides and nucleotide analogs. In some embodiments, "nucleotide" refers to a nucleotide unit in an oligonucleotide or nucleic acid.

[0068] Oligonucleotide: The term "oligonucleotide" refers to a polymer or oligomer of nucleotides, which may contain any combination of natural and unnatural nucleobases, sugars, and internucleotide linkages.

[0069] Oligonucleotides can be single-stranded or double-stranded. Single-stranded oligonucleotides can have a double-stranded region (formed by two portions of the single-stranded oligonucleotide), and double-stranded oligonucleotides containing two oligonucleotide strands can have a single-stranded region, for example, in the region where the two oligonucleotide strands are not complementary to each other. Exemplary oligonucleotides include, but are not limited to, structural genes, genes including regulatory and termination regions, self-replicating systems such as viral DNA or plasmid DNA, single-stranded and double-stranded RNAi agents and other RNA interference reagents (RNAi agents or iRNA agents), shRNA, antisense oligonucleotides, ribozymes, microRNAs, microRNA mimics, supermirs, aptamers, antimirs, antagomirs, Ul adapters, triplex-forming oligonucleotides, G-quadruplex oligonucleotides, RNA activators, immunostimulatory oligonucleotides, and decoy oligonucleotides.

[0070] Oligonucleotides of the present disclosure can be of various lengths. In specific embodiments, oligonucleotides can range from about 2 to about 200 nucleosides in length. In various related embodiments, single-stranded, double-stranded, or triple-stranded oligonucleotides can range in length from about 4 to about 10 nucleosides, about 10 to about 50 nucleosides, about 20 to about 50 nucleosides, about 15 to about 30 nucleosides, or about 20 to about 30 nucleosides. In some embodiments, oligonucleotides are about 9 to about 39 nucleosides in length. In some embodiments, oligonucleotides are at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleosides in length. In some embodiments, oligonucleotides are at least 4 nucleosides in length. In some embodiments, oligonucleotides are at least 5 nucleosides in length. In some embodiments, the oligonucleotide is at least 6 nucleosides in length. In some embodiments, the oligonucleotide is at least 7 nucleosides in length. In some embodiments, the oligonucleotide is at least 8 nucleosides in length. In some embodiments, the oligonucleotide is at least 9 nucleosides in length. In some embodiments, the oligonucleotide is at least 10 nucleosides in length. In some embodiments, the oligonucleotide is at least 11 nucleosides in length. In some embodiments, the oligonucleotide is at least 12 nucleosides in length. In some embodiments, the oligonucleotide is at least 15 nucleosides in length. In some embodiments, the oligonucleotide is at least 15 nucleosides in length. In some embodiments, the oligonucleotide is at least 16 nucleosides in length. In some embodiments, the oligonucleotide is at least 17 nucleosides in length. In some embodiments, the oligonucleotide is at least 18 nucleosides in length. In some embodiments, the oligonucleotide is at least 19 nucleosides in length. In some embodiments, the oligonucleotide is at least 20 nucleosides in length.In some embodiments, the oligonucleotide is at least 25 nucleosides in length. In some embodiments, the oligonucleotide is at least 30 nucleosides in length. In some embodiments, the oligonucleotide is a duplex of complementary strands at least 18 nucleosides in length. In some embodiments, the oligonucleotide is a duplex of complementary strands at least 21 nucleosides in length. In some embodiments, each nucleoside counting in the length of the oligonucleotide independently comprises A, T, C, G, or U, or an optionally substituted A, T, C, G, or U, or an optionally substituted tautomer of A, T, C, G, or U.

[0071] Oligonucleotide Type: As used herein, the phrase "oligonucleotide type" refers to an oligonucleotide having a particular base sequence, a pattern of backbone linkages (i.e., a pattern of internucleotide linkage types, e.g., phosphate, phosphorothioate, phosphorothioate triester, etc.), a pattern of backbone chiral centers [i.e., a pattern of bond phosphorus stereochemistry (Rp / Sp)], and a pattern of backbone phosphorus modifications (e.g., a pattern of "-XLR" in Formula I as defined herein). 1 " " group pattern). In some embodiments, oligonucleotides of a common designated "type" are structurally identical to one another.

[0072] Those skilled in the art will appreciate that the synthetic methods of the present disclosure provide a degree of control during oligonucleotide chain synthesis, such that each nucleotide unit of the oligonucleotide chain can be pre-designed and / or pre-selected to have a specific stereochemistry at the linking phosphorus and / or a specific modification at the linking phosphorus, and / or a specific base and / or a specific sugar. In some embodiments, the oligonucleotide chain is pre-designed and / or pre-selected to have a specific combination of stereocenters at the linking phosphorus. In some embodiments, the oligonucleotide chain is designed and / or pre-determined to have a specific combination of modifications at the linking phosphorus. In some embodiments, the oligonucleotide chain is designed and / or pre-selected to have a specific combination of bases. In some embodiments, the oligonucleotide chain is designed and / or pre-selected to have a specific combination of one or more of the above structural features. In some embodiments, the present disclosure provides compositions (e.g., chiral controlled oligonucleotide compositions) comprising or consisting of a plurality of oligonucleotide molecules. In some embodiments, such molecules are all of the same type (i.e., structurally identical to one another). However, in some embodiments, the provided compositions comprise a plurality of oligonucleotides of different types, typically in predetermined relative amounts.

[0073] Optionally substituted: As described herein, compounds of the present disclosure, e.g., oligonucleotides, may contain optionally substituted and / or substituted moieties. In general, the term "substituted," whether preceded by the term "optionally," means that one or more hydrogens of the indicated moiety have been replaced with a suitable substituent. Unless otherwise indicated, an "optionally substituted" group may have a suitable substituent at each substitutable position of the group, and when more than one position in any given structure may be substituted with more than one substituent selected from a specified group, the substituents may be the same or different at each position. In some embodiments, an optionally substituted group is unsubstituted. Combinations of substituents envisioned by the present disclosure are preferably those that result in the formation of stable or chemically feasible compounds. The term "stable," as used herein, refers to a compound that remains substantially unchanged when subjected to conditions that allow for its production, detection, and, in certain embodiments, its recovery, purification, and use for one or more of the purposes disclosed herein. Specific substituents are described below.

[0074] Suitable monovalent substituents on substitutable atoms, e.g., suitable carbon atoms, are independently halogen; -(CH) 0~4 R 〇 ;-(CH2) 0~4 OR 〇 ;-O(CH2) 0~4 R o , -O-(CH2) 0~4 C(O)OR 〇 ;-(CH2) 0~4 CH(OR 〇 )2;R 〇 may be substituted with -(CH2) 0~4 Ph;R 〇 may be substituted with -(CH2) 0~4 O(CH2) 0~1 Ph;R 〇 -CH=CHPh; R 〇 may be substituted with -(CH2) 0~4 O(CH2) 0~1 -pyridyl; -NO2; -CN; -N3; ​​-(CH2)0~4 N(R 〇 )2;-(CH2) 0~4 N(R 〇 )C(O)R 〇 ;-N(R 〇 )C(S)R 〇 ;-(CH2) 0~4 N(R 〇 )C(O)NR 〇 2;-N(R 〇 )C(S)NR 〇 2;-(CH2) 0~4 N(R 〇 )C(O)OR 〇 ;-N(R 〇 )N(R 〇 )C(O)R 〇 ;-N(R 〇 )N(R 〇 )C(O)NR 〇 2;-N(R 〇 )N(R 〇 )C(O)OR 〇 ;-(CH2) 0~4 C(O)R 〇 ;-C(S)R 〇 ;-(CH2) 0~4 C(O)OR 〇 ;-(CH2) 0~4 C(O)SR 〇 ;-(CH2) 0~4 C(O)OSiR 〇 3;-(CH2) 0~4 OC(O)R 〇 ;-OC(O)(CH2) 0~4 SR 〇 、-SC(S)SR 〇 ;-(CH2) 0~4 SC(O)R 〇 ;-(CH2) 0~4 C(O)NR 〇 2;-C(S)NR 〇 2;-C(S)SR 〇 ;-(CH2) 0~4 OC(O)NR 〇 2;-C(O)N(OR 〇 )R 〇 ;-C(O)C(O)R 〇 ;-C(O)CH2C(O)R 〇 ;-C(NOR 〇 )R〇 ;-(CH2) 0~4 SSR 〇 ;-(CH2) 0~4 S(O)2R 〇 ;-(CH2) 0~4 S(O)2OR 〇 ;-(CH2) 0~4 OS(O)2R 〇 ;-S(O)2NR 〇 2;-(CH2) 0~4 S(O)R 〇 ;-N(R 〇 )S(O)2NR 〇 2;-N(R 〇 )S(O)2R 〇 ;-N(OR 〇 )R 〇 ;-C(NH)NR 〇 2;-Si(R 〇 )3;-OSi(R 〇 )3;-B(R 〇 )2;-OB(R 〇 )2;-OB(OR 〇 )2;-P(R 〇 )2;-P(OR 〇 )2;-P(R 〇 )(OR 〇 );-OP(R 〇 )2;-OP(OR 〇 )2;-OP(R 〇 )(OR 〇 );-P(O)(R 〇 )2;-P(O)(OR 〇 )2;-OP(O)(R 〇 )2;-OP(O)(OR 〇 )2;-OP(O)(OR 〇 )(SR 〇 );-SP(O)(R 〇 )2;-SP(O)(OR 〇 )2;-N(R 〇 )P(O)(R 〇 )2;-N(R 〇 )P(O)(OR 〇 )2;-P(R 〇 )2[B(R 〇 )3];-P(OR 〇 )2[B(R 〇 )3];-OP(R 〇 )2[B(R〇 )3];-OP(OR 〇 )2[B(R 〇 )3];-(C 1~4 Linear or branched alkylene)ON(R 〇 )2; or -(C 1~4 Linear or branched alkylene)C(O)ON(R 〇 )2, wherein each R 〇 may be substituted as defined herein and independently represent hydrogen, C 1~20 Aliphatic, C having 1 to 5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon, and phosphorus 1~20 Heteroaliphatic, -CH2-(C 6~14 aryl), -O(CH2) 0~1 (C 6~14 aryl), -CH2- (5- to 14-membered heteroaryl ring), a 5- to 20-membered monocyclic, bicyclic, or polycyclic saturated, partially unsaturated, or aryl ring having 0-5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon, and phosphorus, or, notwithstanding the above definitions, R 〇 two independent occurrences of, taken together with their one or more intervening atoms, form a 5-20 membered monocyclic, bicyclic, or polycyclic saturated, partially unsaturated, or aryl ring having 0-5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon, and phosphorus, which may be substituted as defined below.

[0075] R 〇 (or R 〇 Suitable monovalent substituents on the ring formed by two independent occurrences of -(CH) taken together with their intervening atoms are independently halogen, -(CH) 0~2 R ● ,-(Halo R ● ), -(CH2) 0~2 OH, -(CH2) 0~2 OR ● , -(CH2) 0~2 CH(OR ● )2;-O(HaloR ● ), -CN, -N3, -(CH2) 0~2 C(O)R ● , -(CH2) 0~2 C(O)OH, -(CH2)0~2 C(O)OR ● , -(CH2) 0~2 SR ● , -(CH2) 0~2 SH, -(CH2) 0~2 NH2, -(CH2) 0~2 NHR ● , -(CH2) 0~2 NR ● 2, -NO2, -SiR ● 3. -OSiR ● 3. -C(O)SR ● , -(C 1~4 Linear or branched alkylene)C(O)OR ● , or -SSR ● where each R ● is unsubstituted or, when preceded by "halo", is substituted only with one or more halogens, and independently, C 1~4 Aliphatic, -CH2Ph, -O(CH2) 0~1 R is selected from Ph and a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. 〇 Suitable divalent substituents on a saturated carbon atom of include ═O and ═S.

[0076] For example, suitable divalent substituents on suitable carbon atoms are, independently, the following: =O, =S, =NNR * 2, =NNHC(O)R * , =NNHC(O)OR * , =NNHS(O)2R * , =NR * , =NOR * , -O(C(R * 2)) 2~3 O- or -S(C(R * 2)) 2~3 S-, where R * Each independent occurrence of is hydrogen, C which may be substituted as defined below 1~6Aliphatic and unsubstituted 5-6 membered saturated, partially unsaturated, or aryl rings having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Suitable divalent substituents attached to a vicinal substitutable carbon of an "optionally substituted" group include -O(CR * 2) 2~3 O-, wherein R * Each independent occurrence of is hydrogen, C which may be substituted as defined below 1~6 It is selected from aliphatic and unsubstituted 5-6 membered saturated, partially unsaturated, and aryl rings having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0077] R * Suitable substituents on the aliphatic groups are independently halogen, -R ● ,-(Halo R ● ), -OH, -OR ● , -O(HaloR ● ), -CN, -C(O)OH, -C(O)OR ● , -NH2, -NHR ● , -NR ● 2, or -NO2, where each R ● is unsubstituted or, when preceded by "halo", is substituted only with one or more halogens, and independently, C 1~4 Aliphatic, -CH2Ph, -O(CH2) 0~1 Ph, or a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0078] In some embodiments, suitable substituents on a substitutable nitrogen are independently -R † , -NR † 2. -C(O)R † , -C(O)OR † , -C(O)C(O)R † , -C(O)CHC(O)R † , -S(O)2R † , -S(O)NR † 2. -C(S)NR † 2. -C(NH)NR † 2, or -N(R† )S(O)2R † wherein each R † are independently hydrogen, C which may be substituted as defined below 1~6 an aliphatic, unsubstituted -OPh, or unsubstituted 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur; or, notwithstanding the above definitions, R † two independent occurrences of, taken together with their one or more intervening atoms, form an unsubstituted 3-12 membered saturated, partially unsaturated, or aryl monocyclic or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0079] R † Suitable substituents on the aliphatic groups are independently halogen, -R ● ,-(Halo R ● ), -OH, -OR ● , -O(HaloR ● ), -CN, -C(O)OH, -C(O)OR ● , -NH2, -NHR ● , -NR ● 2, or -NO2, where each R ● is unsubstituted or, when preceded by "halo", is substituted only with one or more halogens, and independently, C 1~4 Aliphatic, -CH2Ph, -O(CH2) 0~1 Ph, or a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0080] Oral: The phrases "oral administration" and "orally administered" as used herein have their art-understood meaning to refer to administration of a compound or composition by mouth.

[0081] P modification: As used herein, the term "P modification" refers to any modification other than a stereochemical modification at the bound phosphorus. In some embodiments, a P modification includes the addition, substitution, or removal of a pendant moiety covalently attached to the bound phosphorus. In some embodiments, a "P modification" is -XLR 1 wherein X, L and R 1 are each independently as defined and described in this disclosure.

[0082] Parenteral: The phrases "parenteral administration" and "parenterally administered," as used herein, have their art-recognized meaning and refer to modes of administration other than enteral and topical administration, usually by injection, and include, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, and intrasternal injection and infusion.

[0083] Partially unsaturated: As used herein, the term "partially unsaturated" refers to a ring moiety that includes at least one double or triple bond. The term "partially unsaturated" is intended to encompass rings with multiple sites of unsaturation, but is not intended to include aryl or heteroaryl moieties, as defined herein.

[0084] Pharmaceutical composition: As used herein, the term "pharmaceutical composition" refers to an active agent formulated with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in a unit dose amount suitable for administration in a treatment regimen that exhibits a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population. In some embodiments, the pharmaceutical composition may be specially formulated for administration in solid or liquid form, including: oral administration, e.g., drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., buccal, sublingual, and those targeted for systemic absorption, boluses, powders, granules, pastes for application to the tongue; parenteral administration, e.g., by subcutaneous, intramuscular, intravenous, or epidural injection, e.g., as a sterile solution or suspension, or sustained-release formulation; topical application, e.g., as a cream, ointment, or controlled-release patch or spray applied to the skin, lungs, or oral cavity; intravaginal or rectal administration, e.g., as a pessary, cream, or foam; sublingual; intraocular; transdermal; or those adapted for the nasal, pulmonary, and other mucosal surfaces.

[0085] Pharmaceutically acceptable: As used herein, the phrase "pharmaceutically acceptable" refers to compounds, materials, compositions and / or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication commensurate with a reasonable benefit-to-risk ratio.

[0086] Pharmaceutically acceptable carrier: As used herein, the term "pharmaceutically acceptable carrier" means a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent, that encapsulates a material, involved in the transport or delivery of a compound of interest from one organ or part of the body to another. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials that can serve as pharmaceutically acceptable carriers include sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; polyols such as glycerin, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; pH buffer solutions; polyesters, polycarbonates, and / or polyanhydrides; and other non-toxic, compatible substances used in pharmaceutical formulations.

[0087] Pharmaceutically acceptable salts: As used herein, the term "pharmaceutically acceptable salts" refers to salts of such compounds that are suitable for use in a pharmaceutical context, i.e., salts that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response, etc., and that are commensurate with a reasonable risk-to-benefit ratio. Pharmaceutically acceptable salts are well known in the art. For example, SM Berge, et al., describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66: 1-19 (1977). In some embodiments, pharmaceutically acceptable salts include, but are not limited to, non-toxic acid addition salts of amino groups formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid, or with organic acids such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or formed by other methods used in the art, such as ion exchange. In some embodiments, pharmaceutically acceptable salts include, but are not limited to, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy- Examples of salts include ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, and valerate.In some embodiments, provided compounds contain one or more acidic groups, e.g., oligonucleotides, and pharmaceutically acceptable salts are alkali salts, alkaline earth metal salts, or ammonium salts (e.g., ammonium salts of N(R)3, where each R is independently as defined and described in this disclosure). Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. In some embodiments, the pharmaceutically acceptable salt is a sodium salt. In some embodiments, the pharmaceutically acceptable salt is a potassium salt. In some embodiments, the pharmaceutically acceptable salt is a calcium salt. In some embodiments, pharmaceutically acceptable salts include, where appropriate, non-toxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, alkyls having 1 to 6 carbon atoms, sulfonates, and arylsulfonates. In some embodiments, provided compounds contain two or more acidic groups, e.g., oligonucleotides may contain two or more acidic groups (e.g., at natural phosphate linkages and / or modified internucleotide linkages). In some embodiments, pharmaceutically acceptable salts, or salts in general, of such compounds contain two or more cations, which can be the same or different. In some embodiments, in pharmaceutically acceptable salts (or salts in general), all ionizable hydrogens in acidic groups (e.g., pKa of about 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 or less; in some embodiments, about 7 or less; in some embodiments, about 6 or less; in some embodiments, about 5 or less; in some embodiments, about 4 or less; in some embodiments, about 3 or less in aqueous solution) are replaced with cations. In some embodiments, each phosphorothioate and phosphate group is independently present in its salt form (e.g., in the case of a sodium salt, -OP(O)(SNa)-O- and -OP(O)(ONa)-O-, respectively).In some embodiments, each phosphorothioate and phosphate internucleotide linkage is independently present in its salt form (e.g., in the case of sodium salts, -OP(O)(SNa)-O- and -OP(O)(ONa)-O-, respectively). In some embodiments, the pharmaceutically acceptable salt is a sodium salt of an oligonucleotide. In some embodiments, the pharmaceutically acceptable salt is a sodium salt of an oligonucleotide, wherein each acidic phosphate group and modified phosphate group (e.g., phosphorothioate, phosphate, etc.), if present, is present as a salt form (all sodium salts).

[0088] Protecting Group: The term "protecting group" as used herein is well known in the art and is described in Protecting Groups in Organic Synthesis, TW Greene and PGM Wuts, 3 rd edition, John Wiley & Sons, 1999, which is incorporated herein by reference in its entirety. Also included are protecting groups specifically adapted for nucleoside and nucleotide chemistry, as described in Current Protocols in Nucleic Acid Chemistry, edited by Serge L. Beaucage et al. 06 / 2012, Chapter 2 of which is incorporated herein by reference in its entirety. Suitable amino protecting groups include, but are not limited to, those described herein and / or in WO 2018 / 022473, WO 2018 / 098264, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, and / or WO 2019 / 075357 (the description of protecting groups for each of which is independently incorporated herein by reference).

[0089] Subject: As used herein, the term "subject" or "test subject," in this disclosure, refers to any organism to which a provided compound (e.g., a provided oligonucleotide) or composition is administered, for example, for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans; insects; worms, etc.) and plants. In some embodiments, the subject is a human. In some embodiments, the subject may be suffering from and / or susceptible to a disease, disorder, and / or condition.

[0090] Substantially: As used herein, the term "substantially" refers to the qualitative condition of exhibiting the full or nearly full extent or degree of a desired characteristic or property. A base sequence that is substantially complementary to a second sequence is not identical to the second sequence, but is roughly or nearly identical to the second sequence. Additionally, those skilled in the art of biology will understand that biological and chemical phenomena rarely, if ever, proceed to completion and / or perfection or achieve or avoid absolute results. Thus, the term "substantially" is used herein to capture the potential lack of perfection inherent in many biological and / or chemical phenomena.

[0091] Sugar: The term "sugar" refers to closed-chain and / or open-chain monosaccharides or polysaccharides. In some embodiments, a sugar is a monosaccharide. In some embodiments, a sugar is a polysaccharide. Sugars include, but are not limited to, ribose, deoxyribose, pentofuranose, pentopyranose, and hexopyranose moieties. As used herein, the term "sugar" also encompasses structural analogs used in place of traditional sugar molecules, such as glycols, whose polymers form the backbone of nucleic acid analogs, glycol nucleic acids ("GNAs"), etc. As used herein, the term "sugar" also encompasses structural analogs used in place of natural or naturally occurring nucleotides, such as modified sugars and nucleotide sugars. In some embodiments, a sugar is an RNA or DNA sugar (ribose or deoxyribose). In some embodiments, a sugar is a modified ribose or deoxyribose sugar, e.g., 2'-modified, 5'-modified, etc. As described herein, in some embodiments, modified sugars, when used in oligonucleotides and / or nucleic acids, can provide one or more desired properties, activities, etc. In some embodiments, the sugar is an optionally substituted ribose or deoxyribose. In some embodiments, "sugar" refers to a sugar unit in an oligonucleotide or nucleic acid.

[0092] Susceptible to: An individual who is "susceptible to" a disease, disorder, and / or condition is an individual who has an increased risk of developing the disease, disorder, and / or condition compared to a member of the public. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition has a predisposition to that disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not have been diagnosed with the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will develop the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition does not go on to develop the disease, disorder, and / or condition.

[0093] Therapeutic Agent: As used herein, the term "therapeutic agent" generally refers to any agent that produces a desired effect (e.g., a desired biological, clinical, or pharmacological effect) when administered to a subject. In some embodiments, an agent is considered a therapeutic agent if it demonstrates a statistically significant effect in an appropriate population. In some embodiments, the appropriate population is a population of subjects suffering from and / or susceptible to a disease, disorder, or condition. In some embodiments, the appropriate population is a population of model organisms. In some embodiments, the appropriate population may be defined by one or more criteria, such as age group, sex, genetic background, pre-existing clinical conditions, history of exposure to therapy, etc. In some embodiments, a therapeutic agent is a substance that, when administered to a subject in an effective amount, alleviates, ameliorate, relieves, inhibits, prevents, delays the onset of, reduces the severity of, and / or reduces the incidence of one or more symptoms or characteristics of the subject's disease, disorder, and / or condition. In some embodiments, a "therapeutic agent" is an agent that has or is required to be approved by a government agency before it can be marketed for administration to humans. In some embodiments, a "therapeutic agent" is an agent that requires a physician's prescription for administration to humans. In some embodiments, a therapeutic agent is a provided compound, e.g., a provided oligonucleotide.

[0094] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" refers to an amount of a substance (e.g., a therapeutic agent, composition, and / or formulation) that elicits a desired biological response when administered as part of a treatment regimen. In some embodiments, a therapeutically effective amount of a substance is an amount that, when administered to a subject suffering from or susceptible to a disease, disorder, and / or condition, is sufficient to treat, diagnose, prevent, and / or delay the onset of the disease, disorder, and / or condition. As one of ordinary skill in the art would understand, the effective amount of a substance can vary depending on factors such as the desired biological endpoint, the substance to be delivered, the target cell or tissue, and the like. For example, an effective amount of a compound in a formulation for treating a disease, disorder, and / or condition is an amount that alleviates, ameliorates, relieves, inhibits, prevents, delays the onset of, reduces the severity of, and / or reduces the incidence of one or more symptoms or characteristics of the disease, disorder, and / or condition. In some embodiments, a therapeutically effective amount is administered in a single dose; in some embodiments, multiple unit doses are required to deliver a therapeutically effective amount.

[0095] Treat: As used herein, the terms "treat," "treatment," or "treating" refer to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or characteristics of a disease, disorder, and / or condition. Treatment may be administered to a subject who does not exhibit signs of the disease, disorder, and / or condition. In some embodiments, treatment may be administered to a subject who exhibits only early signs of a disease, disorder, and / or condition, for example, to reduce the risk of developing a pathology associated with the disease, disorder, and / or condition.

[0096] Unsaturated: The term "unsaturated," as used herein, means that a moiety has one or more units of unsaturation.

[0097] Wild-type: As used herein, the term "wild-type" has its art-understood meaning of referring to an entity having structure and / or activity as found in a naturally "normal" (as opposed to mutant, diseased, altered, etc.) state or context. Those of skill in the art will understand that wild-type genes and polypeptides often exist in multiple alternative forms (e.g., alleles).

[0098] For purposes of this disclosure, chemical elements are identified according to the CAS Periodic Table of the Elements, inside cover of Handbook of Chemistry and Physics, 67th Ed., 1986-87.

[0099] As one of skill in the art will appreciate, the methods and compositions described herein with respect to provided compounds (e.g., oligonucleotides) also apply to pharmaceutically acceptable salts of such compounds.

[0100] Description of Specific Embodiments Oligonucleotides provide useful tools for a wide variety of applications. For example, HTT oligonucleotides are useful in therapeutic, diagnostic, and research applications, including the treatment of various HTT-related conditions, disorders, and diseases, including Huntington's disease. The use of naturally occurring nucleic acids (e.g., unmodified DNA or RNA) is limited, for example, by their vulnerability to endonucleases and exonucleases. Therefore, various synthetic counterparts have been developed to circumvent these drawbacks and / or improve various properties and activities. This includes synthetic oligonucleotides containing chemical modifications, such as base modifications, sugar modifications, backbone modifications, etc., that, among other things, render such molecules less susceptible to degradation and improve other properties and / or activities. From a structural standpoint, modifications to internucleotide linkages can introduce chirality, and certain properties can be affected by the configuration of the oligonucleotide's bound phosphorus atom. For example, binding affinity, sequence-specific binding to complementary RNA, stability against nucleases, cleavage of target HTT nucleic acids, delivery, pharmacokinetics, etc., can be affected, among other things, by the chirality of the backbone-bound phosphorus atom. Among other things, the present disclosure provides techniques to control and / or utilize various structural elements in oligonucleotides, such as sugar modifications and their patterns, nucleobase modifications and their patterns, modified internucleotide linkages and their patterns, linked phosphorus stereochemistry and their patterns, additional chemical moieties (typically not present in the oligonucleotide chain) and their patterns, etc., as well as various combinations of one or more or all of such structural elements.

[0101] In some embodiments, provided oligonucleotides are oligonucleotides that target HTT and are capable of reducing levels of mutant HTT transcripts and / or one or more products encoded thereby, and such oligonucleotides are particularly useful for the prevention and / or treatment of HTT-related conditions, disorders and / or diseases, including Huntington's disease.

[0102] In some embodiments, an HTT oligonucleotide comprises a sequence that is completely or substantially identical to, or completely or substantially complementary to, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, typically 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more contiguous bases of the HTT genomic sequence or a transcript therefrom (e.g., pre-mRNA, mRNA, etc.). One of skill in the art will understand that an "HTT oligonucleotide" can have a nucleotide sequence that is identical (or substantially identical) or complementary (or substantially complementary) to an HTT nucleotide sequence (e.g., genomic sequence, transcript sequence, mRNA sequence, etc.) or a portion thereof.

[0103] In some embodiments, the present disclosure provides HTT oligonucleotides as disclosed herein, e.g., in the Tables, or HTT oligonucleotides having a base sequence comprising at least 10 contiguous bases of an oligonucleotide disclosed herein.

[0104] In some embodiments, the present disclosure provides HTT oligonucleotides having a base sequence disclosed herein, for example in a Table, or a portion thereof comprising at least 10 contiguous bases, wherein the HTT oligonucleotide is sterically random or not chirally controlled.

[0105] In some embodiments, the internucleotide linkages of the oligonucleotide comprise or consist of 1 to 5, 1 to 10, 1 to 15, 1 to 20, 1 to 25, 1 to 30, 1 to 40, 1 to 50, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more chiral-controlled internucleotide linkages. In some embodiments, the oligonucleotide compositions of the present disclosure comprise oligonucleotides of the same chemical makeup, wherein one or more internucleotide linkages are chiral-controlled and one or more internucleotide linkages are sterically random (chiral-uncontrolled). In some embodiments, the present disclosure provides HTT oligonucleotide compositions wherein the HTT oligonucleotide comprises at least one chiral-controlled internucleotide linkage. In some embodiments, the present disclosure provides HTT oligonucleotide compositions wherein the HTT oligonucleotide is sterically random or chiral-uncontrolled. In some embodiments, in the HTT oligonucleotide, at least one internucleotide linkage is sterically random and at least one internucleotide linkage is chiral controlled.

[0106] In some embodiments, the internucleotide linkages of the oligonucleotide comprise or consist of one or more negatively charged internucleotide linkages (e.g., phosphorothioate internucleotide linkages, natural phosphate linkages, etc.). In some embodiments, the internucleotide linkages of the oligonucleotide comprise or consist of one or more negatively charged chiral internucleotide linkages (e.g., phosphorothioate internucleotide linkages). In some embodiments, the internucleotide linkages of the oligonucleotide comprise or consist of one or more non-negatively charged internucleotide linkages. In some embodiments, the internucleotide linkages of the oligonucleotide comprise or consist of one or more neutral chiral internucleotide linkages. In some embodiments, the present disclosure relates to HTT oligonucleotides comprising at least one neutral or non-negatively charged internucleotide linkage as described herein.

[0107] HTT In some embodiments, HTT refers to a gene or its gene product (including, but not limited to, a nucleic acid, including, but not limited to, DNA or RNA, or a wild-type or mutant protein encoded thereby) from any species, including HTT, HD, IT15, Huntingtin, Huntingtin, or LOMARS; External IDs: OMIM:613004, MGI:96067, HomoloGene:1593, GeneCards:HTT; Species: Human: Entrez:3064; Ensembl:ENSG0000019738 6; UniProt:P42858; RefSeq(mRNA):NM_002111; RefSeq(protein):NP_002102; Localization(UCSC):Chr4:3.04-3.24 Mb; Species:Mouse; Entrez:15194; Ensembl:ENSMUSG00000029104; UniProt:P42859; RefSeq(mRNA):NM_010414; RefSeq(protein):NP_034544; Localization(UCSC):Chr5:34.76-34.91 Mb. Additional HTT sequences, including variants thereof, from human, mouse, rat, monkey, etc., are readily available to those of skill in the art. In some embodiments, the HTT is wild-type or mutant human or mouse HTT.

[0108] In some embodiments, the HTT protein is unmodified or modified, hi some embodiments, the HTT protein has any one or more of the following modifications: 9 N6-acetyllysine; 176 N6-acetyllysine; 234 N6-acetyllysine; 343 N6-acetyllysine; 411 phosphoserine; 417 phosphoserine; 419 phosphoserine; 432 phosphoserine; 442 N6-acetyllysine; 640 phosphoserine; 643 phosphoserine; 1179 phosphoserine; 1199 phosphoserine; 1870 phosphoserine; or 1874 phosphoserine.

[0109] Without wishing to be bound by any particular theory, the present disclosure notes that mutations in HTT (e.g., CAG repeat expansions) are reportedly a key contributing factor in diseases and disorders such as Huntington's disease.

[0110] In some embodiments, mutant HTT is designated mHTT, muHTT, m HTT, mu HTT, MU HTT, etc., where m or mu indicates mutant. In some embodiments, wild-type HTT is designated wild-type HTT, wtHTT, wt HTT, WT HTT, WTHTT, etc., where wt indicates wild-type. In some embodiments, mutant HTT comprises an expanded CAG repeat region (e.g., 36-121, 36-250, 37-121, 40-121 repeats, or more). In some embodiments, mutant HTT comprises mutant alleles of one or more SNPs (alleles on the same DNA strand or chromosome as the expanded CAG repeat). In some embodiments, mutant HTT comprises both an expanded CAG repeat region and mutant alleles of a particular SNP on the same chromosomal strand.

[0111] In some embodiments, human HTT is referred to as hHTT. In some embodiments, mutant HTT is referred to as mHTT. In some embodiments, when a mouse is utilized, mouse HTT may be referred to as mHTT, as will be understood by those skilled in the art.

[0112] In some embodiments, the HTT oligonucleotide is complementary to a portion of an HTT nucleic acid sequence, e.g., the HTT gene sequence, the HTT mRNA sequence, etc. In some embodiments, the base sequence of such a portion is characteristic of HTT in that no other genomic or transcript sequence has the same sequence as that portion. In some embodiments, the portion of the gene to which the oligonucleotide is complementary is referred to as the target sequence of the oligonucleotide.

[0113] In some embodiments, the HTT gene sequence (or a portion thereof, e.g., complementary to an HTT oligonucleotide) is an HTT gene sequence (or a portion thereof) known in the art or reported in the literature. The specific nucleotide and amino acid sequence of human HTT can be found in public sources, e.g., one or more public databases, e.g., GenBank, UniProt, OMEVI, etc. Those skilled in the art will understand that, for example, where the nucleic acid sequence described may be or may comprise a genomic sequence, transcripts, splicing products, and / or encoded proteins, etc., can be readily determined from such a genomic sequence.

[0114] In some embodiments, the HTT gene (or a portion thereof having a sequence complementary to the HTT oligonucleotide) contains a single nucleotide polymorphism or SNP. Numerous HTT SNPs have been reported and can be found, for example, in NCBI dbSNP (see, for example, www.ncbi.nlm.nih.gov / snp). Non-limiting examples of SNPs within the HTT gene can be found by NCBI dbSNP accession number and include, for example, those described herein. In some embodiments, the HTT oligonucleotide targets a SNP allele that is on the same chromosome as (e.g., in phase with) the CAG repeat expansion and that is not present in the wild-type allele (which does not contain the CAG repeat expansion).

[0115] Huntington's disease (HD) is a neurodegenerative disorder reportedly caused by mutations in the HTT (huntingtin) gene. This single, widely expressed gene alteration reportedly results in a progressive neurodegenerative disorder with numerous characteristic symptoms. In some embodiments, the HD-associated mutation is an expansion of a CAG repeat region in the HTT gene, with larger expansions reportedly associated with increased disease severity and earlier age of onset. This mutation reportedly results in a variety of motor, emotional, and cognitive symptoms, and leads to the formation of huntingtin aggregates in the brain.

[0116] CAG expansion reportedly results in a polyglutamine tract expansion in the 350-kDa protein huntingtin (Huntington Disease Collaborative Research Group, 1993, Cell. 72:971-83). Normal and expanded HD allele sizes have reportedly been found to be, for example, CAG6-37 and CAG35-121 repeats or greater, respectively. Longer sequences are reportedly associated with earlier disease onset. Individuals lacking one copy of huntingtin reportedly lack the HD phenotype, and individuals homozygous for the expansion exhibit increased disease severity, suggesting that the mutation does not result in loss of function (Trottier et al., 1995, Nature Med., 10:104-110). Transcriptional deregulation and loss of function of transcriptional coactivator proteins have reportedly been implicated in HD pathogenesis. Mutant huntingtin has been reported to disrupt activator-dependent transcription, particularly early in the pathogenesis of HD (Dunah et al., 2002. Science 296:2238-2243).

[0117] In one report, gene profiling of human blood identified 322 mRNAs that showed significant changes in expression in HD blood samples compared with normal or presymptomatic individuals. Similarly, postmortem brain samples from the caudate nucleus of HD also showed substantial changes in the expression of marker genes, suggesting that the upregulation of genes in blood samples reflects disease mechanisms observed in the brain. Monitoring gene expression may provide a sensitive and quantitative method for monitoring disease progression, especially in the early stages of disease, in both animal models and human patients (Borovecki et al., 2005, Proc. Natl. Acad. Sci. USA 102:11023-11028).

[0118] Huntington's disease is reported to be an autosomal dominant disorder, with onset typically occurring in middle age, although cases ranging from childhood onset to cases occurring after age 70 have been documented. Early age of onset is reportedly associated with paternal inheritance, with 70% of younger cases inherited from the father.

[0119] In some embodiments, symptoms of Huntington's disease include affective, motor, and cognitive components. One symptom, chorea, is a distinctive feature of movement disorders and is defined as randomly distributed, sudden, and excessive spontaneous movements that occur at irregular times. This can range from barely noticeable to severe. Other frequently observed symptoms or abnormalities include dystonia, rigidity, bradykinesia, oculomotor dysfunction, and tremor. Symptoms of voluntary movement disorders include fine motor incoordination, dysarthria, and dysphagia. Affective disorders or symptoms generally include depression and irritability, and cognitive components include subcortical dementia (Mangiarini et al. 1996. Cell 87:493-506). Changes in the HD brain are widespread and have been reported to include neuronal loss and gliosis, particularly in the cortex and striatum (Vonsattel and DiFiglia. 1998. J. Neuropathol. Exp. Neurol. 57:369-384).

[0120] For certain information regarding HTT and HTT-related conditions, disorders, or diseases, see, e.g., Kremer et al. 1994. NEJ Med. 330: 1401; Kordasiewicz et al. 2012 Neuron 74: 1031-1044; Carroll et al. 2011 Mol. Ther. 19: 2178-2185; Warby et al. 2009 Am. J. Hum. Genet. 84: 351-366; Pfister et al. 2009 Current Biol. 19: 774-778; Kay et al. 2015 Mol. Ther. 23: 1759-1771; Kay et al. 2014 Clin. Genet. 86: 29-36; Lee et al. 2015 Am. J. Hum. Genet. 97: 435-444; Skotte et al. 2014. PLOS ONE 9: e107434; Southwell et al. 2014. Mol. Ther. 22: 2093-2106; Australian Patent Application Publication Nos. 2017276286 and 2007210038; European Patent Application Publication Nos. 3277814 and 3210633; International Patent Application Publication No. 2018145009; and US Patent Application Publication No. 20180273945.

[0121] In some embodiments, HTT oligonucleotides capable of decreasing the level, activity and / or expression of the HTT gene are useful in methods of preventing or treating an HTT-associated condition, disorder or disease, such as Huntington's disease, and / or delaying the onset and / or severity of one or more symptoms of Huntington's disease.

[0122] In some embodiments, the present disclosure provides methods for preventing or treating an HTT-associated condition, disorder, or disease by administering to a subject suffering from or susceptible to such a condition, disorder, or disease a therapeutically effective amount of a provided HTT oligonucleotide or composition thereof. In some embodiments, the composition is a chiral-controlled oligonucleotide composition.

[0123] HTT oligonucleotide In particular, the present disclosure provides oligonucleotides of various designs, including various nucleobases and their patterns, sugars and their patterns, internucleotide linkages and their patterns, and / or additional chemical moieties and their patterns, as described herein. In some embodiments, the provided oligonucleotides are HTT oligonucleotides. In some embodiments, the provided HTT oligonucleotides can lead to a decrease in the expression, level, and / or activity of one or more of the HTT gene and / or its products (e.g., transcripts, mRNA, proteins, etc.). In some embodiments, the provided HTT oligonucleotides can lead to a decrease in the expression, level, and / or activity of one or more of the HTT gene and / or its products in any cell of a subject or patient. In some embodiments, the cell is any cell that normally expresses HTT or produces HTT protein. In some embodiments, the provided HTT oligonucleotides are capable of directing a decrease in the expression, level and / or activity of an HTT target gene or gene product and have a base sequence consisting of, comprising, or comprising a portion (e.g., a span of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or more contiguous bases) of the base sequence of an HTT oligonucleotide disclosed herein, which oligonucleotides contain at least one non-naturally occurring modification of the base, sugar and / or internucleotide linkage.

[0124] In some embodiments, the HTT oligonucleotide comprises one or more carbohydrate moieties. In some embodiments, the HTT oligonucleotide comprises one or more lipid moieties. In some embodiments, the HTT oligonucleotide comprises one or more targeting moieties. Non-limiting examples of such additional chemical moieties that can be conjugated to the oligonucleotide chain are described herein.

[0125] In some embodiments, the provided oligonucleotides can induce a decrease in the expression, level, and / or activity of a target gene, such as an HTT target gene, or its product. In some embodiments, the provided oligonucleotides can induce a decrease in the expression, level, and / or activity of an HTT target gene or its product by RNase H-mediated knockdown. In some embodiments, the provided oligonucleotides can induce a decrease in the expression, level, and / or activity of an HTT target gene or its product by sterically blocking translation after binding to the HTT target gene mRNA and / or by altering or interfering with mRNA splicing. Nevertheless, the present disclosure is not limited to any particular mechanism. In some embodiments, the present disclosure provides oligonucleotides, compositions, methods, etc. that are capable of functioning by double-stranded RNA interference, single-stranded RNA interference, RNase H-mediated knockdown, steric hindrance of translation, or a combination of two or more such mechanisms.

[0126] In some embodiments, the HTT oligonucleotide is an antisense oligonucleotide (ASO) in that it is an oligonucleotide having a base sequence antisense to (e.g., complementary to) a target HTT sequence. In some embodiments, the HTT oligonucleotide is a double-stranded siRNA. In some embodiments, the HTT oligonucleotide is a single-stranded siRNA. The provided oligonucleotides and compositions thereof can be utilized for numerous purposes. For example, the provided HTT oligonucleotides can be co-administered with or used as part of a treatment regimen for one or more treatments for Huntington's disease or a symptom thereof, including, but not limited to, aptamers, lncRNAs, lncRNA inhibitors, antibodies, peptides, small molecules, other oligonucleotides against HTT or other targets, and / or other agents capable of inhibiting expression of HTT transcripts, reducing the level and / or activity of HTT gene products, and / or inhibiting expression of genes or reducing gene products that increase the expression, activity, and / or level of HTT transcripts or HTT gene products, or genes or gene products associated with HTT-related disorders.

[0127] In some embodiments, the oligonucleotide, e.g., HTT oligonucleotide, comprises a structural element or a portion thereof described herein, e.g., in a Table. In some embodiments, the oligonucleotide, e.g., HTT oligonucleotide, comprises a base sequence (or a portion thereof), chemical modification or chemical modification pattern (or a portion thereof), and / or format or a portion thereof described herein. In some embodiments, the oligonucleotide, e.g., HTT oligonucleotide, comprises an oligonucleotide base sequence (or a portion thereof), chemical modification pattern (or a portion thereof), and / or format disclosed herein, e.g., in Table 1 or a Figure, or otherwise disclosed herein. In some embodiments, such oligonucleotide, e.g., HTT oligonucleotide, reduces the expression, level, and / or activity of a gene, e.g., the HTT gene, or its gene product.

[0128] In particular, the provided oligonucleotides can hybridize to their target HTT nucleic acid (e.g., pre-mRNA, mature mRNA, etc.). For example, in some embodiments, HTT oligonucleotides can hybridize to HTT nucleic acid derived from a DNA strand (either strand of the HTT gene). In some embodiments, HTT oligonucleotides can hybridize to HTT transcripts. In some embodiments, HTT oligonucleotides can hybridize to HTT nucleic acid at any stage of RNA processing, including, but not limited to, pre-mRNA or mature mRNA. In some embodiments, HTT oligonucleotides can hybridize to any element of an HTT nucleic acid or its complement, including, but not limited to, a promoter region, an enhancer region, a transcription termination region, a translation initiation signal, a translation stop codon, a coding region, a non-coding region, an exon, an intron, an intron / exon or exon / intron junction, a 5'UTR, or a 3'UTR.

[0129] In some embodiments, the oligonucleotide hybridizes to two or more variants of transcripts derived from sense strand.In some embodiments, the HTT oligonucleotide hybridizes to two or more variants of HTT derived from sense strand.In some embodiments, the HTT oligonucleotide hybridizes to all variants of HTT derived from sense strand.In some embodiments, the HTT oligonucleotide hybridizes to two or more variants of HTT derived from antisense strand.In some embodiments, the HTT oligonucleotide hybridizes to all variants of HTT derived from antisense strand.

[0130] In some embodiments, the HTT target of the HTT oligonucleotide is HTT RNA, which is not mRNA.

[0131] In some embodiments, the HTT oligonucleotide contains an increased level of one or more isotopes. In some embodiments, the provided oligonucleotide is, for example, labeled with one or more isotopes of one or more elements, such as hydrogen, carbon, nitrogen, etc. In some embodiments, the provided oligonucleotide in the provided composition, for example, the oligonucleotide in a plurality of compositions, comprises a base modification, a sugar modification, and / or an internucleotide linkage modification, wherein the oligonucleotide contains an enhanced level of deuterium. In some embodiments, the provided oligonucleotide is deuterium-labeled at one or more positions (- 1 H- 2 In some embodiments, one or more of the oligonucleotide strands or any moieties conjugated to the oligonucleotide strands (e.g., targeting moieties, etc.) are labeled. 1 H 2 is substituted with H. Such oligonucleotides can be used in any of the compositions and methods described herein.

[0132] In some embodiments, the present disclosure provides: 1) have a common base sequence complementary to a target sequence (e.g., an HTT target sequence) in the transcript; and 2) Providing an oligonucleotide composition comprising a plurality of oligonucleotides comprising one or more modified sugar moieties and / or modified internucleotide linkages.

[0133] In some embodiments, oligonucleotides sharing a common base sequence, e.g., HTT oligonucleotides, may have the same pattern of nucleoside modifications, e.g., sugar modifications, base modifications, etc. In some embodiments, the nucleoside modification pattern may be represented by a combination of position and modification. In some embodiments, the backbone linkage pattern includes the position and type (e.g., phosphate, phosphorothioate, substituted phosphorothioate, etc.) of each internucleotide linkage.

[0134] In some embodiments, the modified internucleotide linkage has the structure of Formula I. In some embodiments, the modified internucleotide linkage has the structure of Formula Ia. In some embodiments, the internucleotide linkage has the structure of Formula I, Formula Ia, Formula Ib, Formula Ic, Formula In-1, Formula In-2, Formula In-3, Formula In-4, Formula II, Formula II-a-1, Formula II-a-2, Formula II-b-1, Formula II-b-2, Formula II-c-1, Formula II-c-2, Formula II-d-1, or Formula II-d-2, or a salt form thereof.

[0135] In some embodiments, the HTT oligonucleotide comprises one or more internucleotide linkages, each of which independently has the structure of Formula I, Formula Ia, Formula Ib, Formula Ic, Formula In-1, Formula In-2, Formula In-3, Formula In-4, Formula II, Formula II-a-1, Formula II-a-2, Formula II-b-1, Formula II-b-2, Formula II-c-1, Formula II-c-2, Formula II-d-1, or Formula II-d-2.

[0136] In some embodiments, for example in the provided compositions, the oligonucleotides in the plurality are of the same oligonucleotide type. In some embodiments, the oligonucleotides of an oligonucleotide type have a common sugar modification pattern. In some embodiments, the oligonucleotides of an oligonucleotide type have a common base modification pattern. In some embodiments, the oligonucleotides of an oligonucleotide type have a common nucleoside modification pattern. In some embodiments, the oligonucleotides of an oligonucleotide type have the same chemical constitution. In some embodiments, the oligonucleotides of an oligonucleotide type are identical. In some embodiments, the oligonucleotides in the plurality are identical. In some embodiments, the oligonucleotides in the plurality share the same chemical constitution.

[0137] In some embodiments, as exemplified herein, oligonucleotides, such as HTT oligonucleotides, contain one or more chirality-controlled internucleotide bonds to be chiral controlled.In some embodiments, the provided oligonucleotides are stereochemically pure.In some embodiments, the provided oligonucleotides are substantially separated from other stereoisomers.

[0138] In some embodiments, an oligonucleotide, eg, an HTT oligonucleotide, comprises one or more modified nucleobases, one or more modified sugars, and / or one or more modified internucleotide linkages.

[0139] In some embodiments, oligonucleotides, such as HTT oligonucleotides, contain one or more modified sugars. In some embodiments, oligonucleotides of the present disclosure contain one or more modified nucleobases. Various modifications can be introduced into the sugars and / or nucleobases of the present disclosure. For example, in some embodiments, the modifications are those described in U.S. Patent No. 9,006,198. In some embodiments, the modification is a modification described in U.S. Patent No. 9,394,333, U.S. Patent No. 9,744,183, U.S. Patent No. 9,605,019, U.S. Patent No. 9,982,257, U.S. Patent Application Publication No. 20170037399, U.S. Patent Application Publication No. 20180216108, U.S. Patent Application Publication No. 20180216107, U.S. Patent No. 9,598,458, WO 2017 / 062862, WO 2018 / 067973, WO 2017 / 160741, WO 2017 / 192679, WO 2017 / 210647, or WO 2018 / 098264 (each of which sugar, base, and internucleotide linkage modifications are independently incorporated herein by reference).

[0140] As used in this disclosure, in some embodiments, one or more is 1. In some embodiments, one or more is 2. In some embodiments, one or more is 3. In some embodiments, one or more is 4. In some embodiments, one or more is 5. In some embodiments, one or more is 6. In some embodiments, one or more is 7. In some embodiments, one or more is 8. In some embodiments, one or more is 9. In some embodiments, one or more is 10. In some embodiments, one or more is at least 1. In some embodiments, one or more is at least 2. In some embodiments, one or more is at least 3. In some embodiments, one or more is at least 4. In some embodiments, one or more is at least 5. In some embodiments, one or more is at least 6. In some embodiments, one or more is at least 7. In some embodiments, one or more is at least 8. In some embodiments, one or more is at least 9. In some embodiments, one or more is at least 10.

[0141] In some embodiments, the HTT oligonucleotide is or comprises an HTT oligonucleotide described in a table or figure.

[0142] As demonstrated in the present disclosure, in some embodiments, a provided oligonucleotide (e.g., an HTT oligonucleotide) is characterized by enhanced knockdown of its target (e.g., an HTT transcript of an HTT oligonucleotide, a mutant HTT transcript containing an expanded CAG repeat, etc.) when contacted with a transcript in a knockdown system relative to the knockdown observed under reference conditions (e.g., selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof). In some embodiments, knockdown is 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or a 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 fold or more increase.

[0143] In some embodiments, the oligonucleotide is provided in a salt form. In some embodiments, the oligonucleotide is provided as a salt containing a negatively charged internucleotide linkage (e.g., a phosphorothioate internucleotide linkage, a natural phosphate linkage, etc.) present in its salt form. In some embodiments, the oligonucleotide is provided as a pharmaceutically acceptable salt. In some embodiments, the oligonucleotide is provided as a metal salt. In some embodiments, the oligonucleotide is provided as a sodium salt. In some embodiments, the oligonucleotide is provided as a metal salt, e.g., a sodium salt, where each negatively charged internucleotide linkage is independently in salt form (e.g., for a sodium salt, -OP(O)(SNa)-O- for a phosphorothioate internucleotide linkage, -OP(O)(ONa)-O- for a natural phosphate linkage, etc.).

[0144] In some embodiments, the HTT oligonucleotide or HTT oligonucleotide composition is chiral controlled (eg, stereochemically pure).

[0145] In some embodiments, the HTT oligonucleotide or oligonucleotides are sterically random.

[0146] In some embodiments, the HTT oligonucleotide targets HTT SNPs rs362272, rs362273, rs362273, rs362307, rs362331, or rs363099.

[0147] In some embodiments, the HTT oligonucleotide targets SNP rs362272 and has a base sequence including ACATAGAGGACGCCGTGCAG, AGAGGACGCCGTGCAGGGCT, ATAGAGGACGCCGTGCAGGG, CACATAGAGGACGCCGTGCA, CATAGAGGACGCCGTGCAGG, GCACATAGAGGACGCCGTGC, or TAGAGGACGCCGTGCAGGGC (wherein each T can independently be replaced with U, or vice versa).

[0148] In some embodiments, the HTT oligonucleotide targets SNP rs362273 and has a base sequence including AGCTGCTGCTACAGATCAAC, AGCTGCTGCTGCAGATCAAC, GGTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, or TTGATCTGTAGCAGCAGCT (wherein each T can independently be replaced with U, or vice versa).

[0149] In some embodiments, the HTT oligonucleotide targets SNP rs362273 and has a base sequence comprising GTTGATCTGTAGCAGCAGCT, where each T can independently be replaced with a U, or vice versa.

[0150] In some embodiments, the HTT oligonucleotide targets SNP rs362307 and has a base sequence including CACAAGGGCACAGACTTCCA, GGCACAAGGGCACAGAC, GGCACAAGGGCACAGACT, GGCACAAGGGCACAGACTT, or GGCACAAGGGCACAGACTTC (wherein each T can independently be replaced with a U, or vice versa).

[0151] In some embodiments, the HTT oligonucleotide targets SNP rs362331 and has a base sequence including AGTGCACACAGTAGATGAGG, GTGCACACAGTAGATGAGGG, or TGCACACAGTAGATGAGGGA (wherein each T can independently be replaced with a U, or vice versa).

[0152] In some embodiments, the HTT oligonucleotide targets SNP rs363099 and has a base sequence including: AAGGCTGAGCGGGAGAAACCC, AGGCTGAGCGGAGAAACCCT, CAAGGCTGAGCGGAGAAACC, CTGAGCGGAGAAACCCTCCA, GCTGAGCGGAGAAACCCTCC, GGCTGAGCGGAGAAACCCTC, or TGAGCGGAGAAAACCCTCCAA (wherein each T can independently be replaced with U, or vice versa).

[0153] In some embodiments, the HTT oligonucleotide targets SNP rs362272 and has a base sequence that is ACATAGAGGACGCCGTGCAG, AGAGGACGCCGTGCAGGGCT, ATAGAGGACGCCGTGCAGGG, CACATAGAGGACGCCGTGCA, CATAGAGGACGCCGTGCAGG, GCACATAGAGGACGCCGTGC, or TAGAGGACGCCGTGCAGGGC (wherein each T can independently be replaced with U, or vice versa).

[0154] In some embodiments, the HTT oligonucleotide targets SNP rs362273 and has a base sequence that is AGCTGCTGCTACAGATCAAC, AGCTGCTGCTGCAGATCAAC, GGTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, or TTGATCTGTAGCAGCAGCT (wherein each T can independently be replaced with U, or vice versa).

[0155] In some embodiments, the HTT oligonucleotide targets SNP rs362273 and has the base sequence GTTGATCTGTAGCAGCAGCT, where each T can independently be replaced with a U, or vice versa.

[0156] In some embodiments, the HTT oligonucleotide targets SNP rs362307 and has a base sequence that is CACAAGGGCACAGACTTCCA, GGCACAAGGGCACAGAC, GGCACAAGGGCACAGACT, GGCACAAGGGCACAGACTT, or GGCACAAGGGCACAGACTTC (wherein each T can independently be replaced with a U, or vice versa).

[0157] In some embodiments, the HTT oligonucleotide targets SNP rs362331 and has a base sequence that is AGTGCACACAGTAGATGAGG, GTGCACACAGTAGATGAGGG, or TGCACACAGTAGATGAGGGA (wherein each T can independently be replaced with a U, or vice versa).

[0158] In some embodiments, the HTT oligonucleotide targets SNP rs363099 and has a base sequence that is AAGGCTGAGCGGGAGAAACCC, AGGCTGAGCGGAGAAACCCT, CAAGGCTGAGCGGAGAAACC, CTGAGCGGAGAAACCCTCCA, GCTGAGCGGAGAAACCCTCC, GGCTGAGCGGAGAAACCCTC, or TGAGCGGAGAAAACCCTCCAA (wherein each T can independently be replaced with U, or vice versa).

[0159] In some embodiments, the HTT oligonucleotide targets SNP rs362272 and has a base sequence comprising at least 15 contiguous bases that include the position of the SNP: ACATAGAGGACGCCGTGCAG, AGAGGACGCCGTGCAGGGCT, ATAGAGGACGCCGTGCAGGG, CACATAGAGGACGCCGTGCA, CATAGAGGACGCCGTGCAGG, GCACATAGAGGACGCCGTGC, or TAGAGGACGCCGTGCAGGGC (wherein each T can independently be replaced with U, or vice versa).

[0160] In some embodiments, the HTT oligonucleotide targets SNP rs362273 and has a base sequence comprising at least 15 contiguous bases that include the position of the SNP: AGCTGCTGCTACAGATCAAC, AGCTGCTGCTGCAGATCAAC, GGTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, or TTGATCTGTAGCAGCAGCT (wherein each T can independently be replaced with U, or vice versa).

[0161] In some embodiments, the HTT oligonucleotide targets SNP rs362273 and has a base sequence of at least 15 contiguous bases that includes the position of the SNP: GTTGATCTGTAGCAGCAGCT (where each T can independently be replaced with U, or vice versa).

[0162] In some embodiments, the HTT oligonucleotide targets SNP rs362307 and has a base sequence comprising at least 15 contiguous bases that include the position of the SNP: CACAAGGGCACAGACTTCCA, GGCACAAGGGCACAGAC, GGCACAAGGGCACAGACT, GGCACAAGGGCACAGACTT, or GGCACAAGGGCACAGACTTC (wherein each T can be independently replaced with U, or vice versa).

[0163] In some embodiments, the HTT oligonucleotide targets SNP rs362331 and has a base sequence comprising at least 15 contiguous bases that include the position of the SNP: AGTGCACACAGTAGATGAGG, GTGCACACAGTAGATGAGGG, or TGCACACAGTAGATGAGGGA (wherein each T can independently be replaced with U, or vice versa).

[0164] In some embodiments, the HTT oligonucleotide targets SNP rs363099 and has a base sequence comprising at least 15 contiguous bases that include the position of the SNP: AAGGCTGAGCGGGAGAAACCC, AGGCTGAGCGGAGAAACCCT, CAAGGCTGAGCGGAGAAACC, CTGAGCGGAGAAACCCTCCA, GCTGAGCGGAGAAACCCTCC, GGCTGAGCGGAGAAACCCTC, or TGAGCGGAGAAAACCCTCCAA (wherein each T can be independently replaced with U, or vice versa).

[0165] In some embodiments, the HTT oligonucleotide targets SNP rs362272 and has a base sequence comprising at least 10 contiguous bases that include the position of the SNP: ACATAGAGGACGCCGTGCAG, AGAGGACGCCGTGCAGGGCT, ATAGAGGACGCCGTGCAGGG, CACATAGAGGACGCCGTGCA, CATAGAGGACGCCGTGCAGG, GCACATAGAGGACGCCGTGC, or TAGAGGACGCCGTGCAGGGC (wherein each T can independently be replaced with U, or vice versa).

[0166] In some embodiments, the HTT oligonucleotide targets SNP rs362273 and has a base sequence comprising at least 10 contiguous bases that include the position of the SNP: AGCTGCTGCTACAGATCAAC, AGCTGCTGCTGCAGATCAAC, GGTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, or TTGATCTGTAGCAGCAGCT (wherein each T can independently be replaced with U, or vice versa).

[0167] In some embodiments, the HTT oligonucleotide targets SNP rs362273 and has a base sequence of at least 10 contiguous bases that includes the position of the SNP: GTTGATCTGTAGCAGCAGCT (where each T can independently be replaced with U, or vice versa).

[0168] In some embodiments, the HTT oligonucleotide targets SNP rs362307 and has a base sequence comprising at least 10 contiguous bases that include the position of the SNP: CACAAGGGCACAGACTTCCA, GGCACAAGGGCACAGAC, GGCACAAGGGCACAGACT, GGCACAAGGGCACAGACTT, or GGCACAAGGGCACAGACTTC (wherein each T can be independently replaced with U, or vice versa).

[0169] In some embodiments, the HTT oligonucleotide targets SNP rs362331 and has a base sequence comprising at least 10 contiguous bases that include the position of the SNP: AGTGCACACAGTAGATGAGG, GTGCACACAGTAGATGAGGG, or TGCACACAGTAGATGAGGGA (wherein each T can independently be replaced with U, or vice versa).

[0170] In some embodiments, the HTT oligonucleotide targets SNP rs363099 and has a base sequence comprising at least 10 contiguous bases that include the position of the SNP: AAGGCTGAGCGGGAGAAACCC, AGGCTGAGCGGAGAAACCCT, CAAGGCTGAGCGGAGAAACC, CTGAGCGGAGAAACCCTCCA, GCTGAGCGGAGAAACCCTCC, GGCTGAGCGGAGAAACCCTC, or TGAGCGGAGAAAACCCTCCAA (wherein each T can be independently replaced with U, or vice versa).

[0171] In some embodiments, the HTT oligonucleotide does not target a SNP (where each U can independently be replaced with a T, or vice versa).

[0172] In some embodiments, the HTT oligonucleotide does not target a SNP and is pan-specific (where each U can independently be replaced with a T, or vice versa).

[0173] In some embodiments, the HTT oligonucleotide does not target a SNP, is pan-specific, and has a base sequence that comprises, is, comprises at least 15 contiguous bases of, or comprises at least 10 contiguous bases of, ACCGCCATCCCCGCCGTAGC, CCGCCATCCCCGCCGTAGCC, CGCCATCCCCGCCGTAGCCT, CTCAGTAACATTGACACCAC, GCCATCCCCGCCGTAGCCTG, GGCTCTGGGTTGCTGGGTCA, GGTGTCCCTCATGGGCTCTG, or GTTACCGCCATCCCCGCCGT (where each U can be independently replaced with a T or vice versa).

[0174] In some embodiments, the HTT oligonucleotide has a base sequence comprising the sequence ACCGCCATCCCCGCCGTAGC, CCGCCATCCCCGCCGTAGCC, CGCCATCCCCGCCGTAGCCT, CTCAGTAACATTGACACCAC, GCCATCCCCGCCGTAGCCTG, GGCTCTGGGTTGCTGGGTCA, GGTGTCCCTCATGGGCTCTG, or GTTACCGCCATCCCCGCCGT (where each U can independently be replaced with a T, or vice versa).

[0175] In some embodiments, the HTT oligonucleotide has a base sequence that is the sequence of ACCGCCATCCCCGCCGTAGC, CCGCCATCCCCGCCGTAGCC, CGCCATCCCCGCCGTAGCCT, CTCAGTAACATTGACACCAC, GCCATCCCCGCCGTAGCCTG, GGCTCTGGGTTGCTGGGTCA, GGTGTCCCTCATGGGCTCTG, or GTTACCGCCATCCCCGCCGT, (where each U can independently be replaced with a T or vice versa).

[0176] In some embodiments, the HTT oligonucleotide has a base sequence comprising at least 15 contiguous bases of the sequence ACCGCCATCCCCGCCGTAGC, CCGCCATCCCCGCCGTAGCC, CGCCATCCCCGCCGTAGCCT, CTCAGTAACATTGACACCAC, GCCATCCCCGCCGTAGCCTG, GGCTCTGGGTTGCTGGGTCA, GGTGTCCCTCATGGGCTCTG, or GTTACCGCCATCCCCGCCGT (where each U can be independently replaced with a T, or vice versa).

[0177] In some embodiments, the HTT oligonucleotide has a base sequence comprising at least 10 contiguous bases of the sequence ACCGCCATCCCCGCCGTAGC, CCGCCATCCCCGCCGTAGCC, CGCCATCCCCGCCGTAGCCT, CTCAGTAACATTGACACCAC, GCCATCCCCGCCGTAGCCTG, GGCTCTGGGTTGCTGGGTCA, GGTGTCCCTCATGGGCTCTG, or GTTACCGCCATCCCCGCCGT (where each U can independently be replaced with a T, or vice versa).

[0178] In some embodiments, the HTT oligonucleotide is any HTT oligonucleotide disclosed herein, or a salt thereof.

[0179] In some embodiments, the HTT oligonucleotide is selected from the group consisting of WV-10786, WV-10787, WV-10790, WV-10791, WV-10806, WV-10810, WV-10811, WV-12282, WV-12283, WV-12284, WV-14914, WV-15078, WV-15080, WV-15091, WV-15092, WV-15093, WV-15094, WV-15095, WV-15096, WV-15097, WV-15098, WV-15099, WV-15090, WV-15091, WV-15092, WV-15093, WV-15 V-17782, WV-19824, WV-19825, WV-19840, WV-19841, WV-21178, WV-21179, WV-21180, W V-21181, WV-21267, WV-21271, WV-21274, WV-21403, WV-21404, WV-21405, WV-21406, W V-21409, WV-21410, WV-21412, WV-21447, WV-21448, WV-23689, WV-23690, WV-23691, W V-23692, WV-28152, WV-28153, WV-28154, WV-28155, WV-28156, WV-28157, WV-28158, W WV-28159, WV-28160, WV-28161, WV-28162, WV-28163, WV-28164, WV-28165, WV-28166, WV-28167, WV-28168, or WV-9679, or a salt thereof (wherein each U can independently be replaced with T, or vice versa).

[0180] In some embodiments, the HTT oligonucleotide is selected from the group consisting of WV-10786, WV-10787, WV-10790, WV-10791, WV-10806, WV-10810, WV-10811, WV-12282, WV-12283, WV-12284, WV-14914, WV-15078, WV-15080, WV-17782, WV -19824, WV-19825, WV-19840, WV-19841, WV-21178, WV-21179, WV-21180, WV-21181, WV-2126 7, WV-21271, WV-21274, WV-21403, WV-21404, WV-21405, WV-21406, WV-21409, WV-21410, WV-2 1412, WV-21447, WV-21448, WV-23689, WV-23690, WV-23691, WV-23692, WV-28152, WV-28153, WV-28154, WV-28155, WV-28156, WV-28157, WV-28158, WV-28159, WV-28160, WV-28161, WV-281 62, WV-28163, WV-28164, WV-28165, WV-28166, WV-28167, WV-28168, or WV-9679, or a salt thereof (wherein each U can be independently replaced with T, or vice versa).

[0181] In some embodiments, the HTT oligonucleotide is selected from the group consisting of WV-10786, WV-10787, WV-10790, WV-10791, WV-10806, WV-10810, WV-10811, WV-12282, WV-12283, WV-12284, WV-14914, WV-15078, WV-15080, WV-17782, WV- 19824, WV-19825, WV-19840, WV-19841, WV-21178, WV-21179, WV-21180, WV-21181, WV-21267 , WV-21271, WV-21274, WV-21403, WV-21404, WV-21405, WV-21406, WV-21409, WV-21410, WV-21 412, WV-21447, WV-21448, WV-23689, WV-23690, WV-23691, WV-23692, WV-28152, WV-28153, W V-28154, WV-28155, WV-28156, WV-28157, WV-28158, WV-28159, WV-28160, WV-28161, WV-2816 2, WV-28163, WV-28164, WV-28165, WV-28166, WV-28167, WV-28168, or WV-9679, or a salt thereof (wherein each U can be independently replaced with T, or vice versa).

[0182] In some embodiments, the HTT oligonucleotide is selected from the group consisting of WV-10786, WV-10787, WV-10790, WV-10791, WV-10806, WV-10810, WV-10811, WV-12282, WV-12283, WV-12284, WV-14914, WV-15078, WV-15080, WV-17782, WV-19824 , WV-19825, WV-19840, WV-19841, WV-21178, WV-21179, WV-21180, WV-21181, WV-21267, WV-2127 1, WV-21274, WV-21403, WV-21404, WV-21405, WV-21406, WV-21409, WV-21410, WV-21412, WV-214 47, WV-21448, WV-23689, WV-23690, WV-23691, WV-23692, WV-28152, WV-28153, WV-28154, WV-28 155, WV-28156, WV-28157, WV-28158, WV-28159, WV-28160, WV-28161, WV-28162, WV-28163, WV-2 or a salt thereof (wherein each U can be independently replaced with T, or vice versa).

[0183] In some embodiments, the HTT oligonucleotide is selected from the group consisting of WV-10786, WV-10787, WV-10790, WV-10791, WV-10806, WV-10810, WV-10811, WV-12282, WV-12283, WV-12284, WV-14914, WV-15078, WV-15080, WV-17782, WV-19824, WV -19825, WV-19840, WV-19841, WV-21178, WV-21179, WV-21180, WV-21181, WV-21267, WV-21271, WV- 21274, WV-21403, WV-21404, WV-21405, WV-21406, WV-21409, WV-21410, WV-21412, WV-21447, WV-2 1448, WV-23689, WV-23690, WV-23691, WV-23692, WV-28152, WV-28153, WV-28154, WV-28155, WV-28 156, WV-28157, WV-28158, WV-28159, WV-28160, WV-28161, WV-28162, WV-28163, WV-28164, WV-281 65, WV-28166, WV-28167, WV-28168, or WV-9679, or a salt thereof (wherein each U can be independently replaced with T, or vice versa).

[0184] In some embodiments, the present disclosure relates to a composition comprising an HTT oligonucleotide and a pharmaceutical carrier.

[0185] In some embodiments, the present disclosure relates to methods of using HTT oligonucleotides in the treatment and / or prevention of Huntington's disease.

[0186] In some embodiments, the present disclosure relates to methods of using HTT oligonucleotides to treat, prevent, delay the onset of, and / or reduce the severity of at least one symptom of Huntington's disease.

[0187] In some embodiments, the present disclosure relates to methods of making medicaments comprising HTT oligonucleotides.

[0188] In some embodiments, the HTT oligonucleotide is any individual HTT oligonucleotide or genus of HTT oligonucleotides described herein.

[0189] Nucleotide sequence In some embodiments, the oligonucleotide, e.g., HTT oligonucleotide, comprises a base sequence described herein or a portion thereof (e.g., 5-50, 5-40, 5-30, 5-20, or 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or at least 10, at least 15 contiguous nucleobases) comprising 0-5 (e.g., 0, 1, 2, 3, 4, or 5) mismatches. In some embodiments, the oligonucleotide, e.g., HTT oligonucleotide, comprises a base sequence described herein, or a portion thereof, wherein the portion is a span of at least 10 contiguous nucleobases comprising 1-5 mismatches, or a span of at least 15 contiguous nucleobases. In some embodiments, provided oligonucleotides comprise a base sequence described herein, or a portion thereof, wherein the portion is a span of at least 10 contiguous nucleobases comprising 1-5 mismatches, or a span of at least 10 contiguous nucleobases comprising 1-5 mismatches. In some embodiments, the base sequence of the oligonucleotide comprises or consists of 10 to 50 (e.g., about or at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45; in some embodiments, at least 15; in some embodiments, at least 16; in some embodiments, at least 17; in some embodiments, at least 18; in some embodiments, at least 19; in some embodiments, at least 20; in some embodiments, at least 21; in some embodiments, at least 22; in some embodiments, at least 23; in some embodiments, at least 24; in some embodiments, at least 25) contiguous bases of a base sequence identical to or complementary to a base sequence of the HTT gene or a transcript (e.g., mRNA) thereof.

[0190] As will be understood by those skilled in the art, the base sequence of the provided oligonucleotides typically has sufficient length and complementarity to its target, such as an RNA transcript (e.g., pre-mRNA, mature mRNA, etc.), to mediate target-specific knockdown. In some embodiments, the base sequence of the HTT oligonucleotide has sufficient length and identity to the HTT transcript target to mediate target-specific knockdown. In some embodiments, the HTT oligonucleotide is complementary to a portion of the HTT transcript (HTT transcript target sequence). In some embodiments, the base sequence of the HTT oligonucleotide has 90% or more identity to the base sequence of an oligonucleotide disclosed in a table. In some embodiments, the base sequence of the HTT oligonucleotide has 95% or more identity to the base sequence of an oligonucleotide disclosed in a table. In some embodiments, the base sequence of the HTT oligonucleotide comprises a contiguous span of 15 or more bases of an oligonucleotide disclosed in a table, except where one or more bases within the span are abasic (e.g., the nucleotide has no nucleobase). In some embodiments, the base sequence of the HTT oligonucleotide comprises a contiguous span of 19 or more bases of an HTT oligonucleotide disclosed herein, except where one or more bases within the span are abasic (e.g., the nucleotide has no nucleobase present). In some embodiments, the base sequence of the HTT oligonucleotide comprises a contiguous span of 19 or more bases of an oligonucleotide disclosed herein, except where one or two base differences occur at the 5' and / or 3' ends of the base sequence.

[0191] In some embodiments, the base sequence of the oligonucleotide is, comprises, or comprises 10 to 20, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous bases of TCTCCATTCT ATCTTATGTT (where each T can independently be replaced by U).

[0192] In some embodiments, the base sequence of the oligonucleotide is, comprises, or comprises 10 to 20, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous bases of GTTGATCTGTAGTAGCAGCT or GTTGATCTGTAGCAGCAGCT (where each T may independently be replaced by U).

[0193] In some embodiments, the base sequence of the oligonucleotide is, comprises, or comprises 10 to 20, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous bases of GTGCACACAG TAGATGAGGG (wherein each T may independently be replaced by U).

[0194] In some embodiments, the base sequence of the oligonucleotide is, comprises, or comprises 10 to 20, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous bases of GTGCAACACA GTAGATGAGGG (where each T can independently be replaced by U).

[0195] In some embodiments, the base sequence of the oligonucleotide is, comprises, or comprises 10 to 20, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous bases of GGCACAAGGG CACAGACTTC (where each T may independently be replaced by U).

[0196] In some embodiments, the base sequence of the oligonucleotide is, comprises, or comprises 10 to 20, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous bases of GGCACAAAGG GCACAGACTTC (where each T may independently be replaced by U).

[0197] In some embodiments, the base sequence of the oligonucleotide is, comprises, or comprises 10 to 20, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous bases of CAAGGGCACA GACTTC (wherein each T may independently be replaced by U).

[0198] In some embodiments, the base sequence of the oligonucleotide is, comprises, or comprises 10 to 20, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous bases of AAGGGCACAG ACTTC (wherein each T may independently be replaced by U).

[0199] In some embodiments, the base sequence of the HTT oligonucleotide is complementary to the base sequence of an HTT transcript or a portion thereof.

[0200] In some embodiments, the HTT target gene is an allele of the HTT gene. In some embodiments, the HTT oligonucleotide is allele-specific and designed to target a specific allele of HTT (e.g., an allele associated with an HTT-related condition, disorder, or disease). In some embodiments, the base sequence of the oligonucleotide is fully complementary to the sequence (or a portion thereof) of the HTT transcript from an allele associated with a condition, disorder, or disease, but is not fully complementary to the sequence (or a portion thereof) of the HTT transcript that is less or not associated with the condition, disorder, or disease. In some embodiments, the disorder-associated allele of HTT contains a SNP, mutation, or other sequence variation, and the HTT oligonucleotide is designed to be complementary to this sequence. In some embodiments, the base sequence of the oligonucleotide is complementary to one allele of the SNP but not the other. In some embodiments, the base sequence of the oligonucleotide is complementary to one allele of the SNP, which is on the same DNA strand as the expanded CAG repeat. In some embodiments, the base sequence of the oligonucleotide is fully complementary to the sequence (or a portion thereof) of the HTT transcript from an allele containing an expanded CAG repeat, but is not fully complementary to the sequence (or a portion thereof) of the HTT transcript from an allele containing a normal CAG repeat. In some embodiments, the HTT oligonucleotide is pan-specific and designed to target all alleles of HTT (e.g., all or most known alleles of HTT contain the same sequence or a sequence complementary to it within the span of bases recognized by the HTT oligonucleotide). In some embodiments, the oligonucleotide reduces the expression, level, and / or activity of both wild-type and mutant HTT, and / or their transcripts and / or products.

[0201] In some embodiments, the HTT oligonucleotide comprises a base sequence or a portion thereof set forth in the Tables, a sugar, nucleobase, and / or internucleotide linkage modification described herein, and / or an additional chemical moiety described herein (e.g., a targeting moiety, lipid moiety, carbohydrate moiety, etc., in addition to the oligonucleotide chain).

[0202] In some embodiments, the terms "complementary," "fully complementary," and "substantially complementary" may be used in reference to base matching between an oligonucleotide (e.g., an HTT oligonucleotide) and a target sequence (e.g., an HTT target sequence), as one of skill in the art would understand from the context of their use. As a non-limiting example, if a target sequence has the base sequence 5'-GCAUAGCGAGCGAGGGAAAAC-3', then an oligonucleotide having the base sequence 5'GUUUUCCCUCGCUCGCUAUGC-3' is complementary (fully complementary) to such a target sequence. It is noted that substitution of U for T, or vice versa, generally does not change the degree of complementarity. As used herein, an oligonucleotide that is "substantially complementary" to a target sequence is generally or nearly complementary, but not 100% complementary. In some embodiments, a substantially complementary sequence (e.g., an HTT oligonucleotide) has 1, 2, 3, 4, or 5 mismatches when aligned with its target sequence. In some embodiments, the HTT oligonucleotide has a base sequence that is substantially complementary to an HTT target sequence. In some embodiments, the HTT oligonucleotide has a base sequence that is substantially complementary to the complement of the sequence of an HTT oligonucleotide disclosed herein. As one of skill in the art will appreciate, in some embodiments, the sequence of an oligonucleotide need not be 100% complementary to its target for the oligonucleotide to perform its function (e.g., knockdown of a target HTT nucleic acid). In some embodiments, the homology, sequence identity, or complementarity is between 60% and 100%, e.g., about or at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, provided oligonucleotides have 75% to 100% (e.g., about or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence complementarity to a target region (e.g., target sequence) within its target HTT nucleic acid. In some embodiments, the percentage is about 80% or greater.In some embodiments, the percentage is about 85% or more, or about 90% or more. In some embodiments, the percentage is about 95% or more. For example, if a provided oligonucleotide is 20 nucleobases long, and 18 of the 20 nucleobases are complementary, it will have 90% complementarity. Typically, when determining complementarity, A and T (or U) are complementary nucleobases, and C and G are complementary nucleobases.

[0203] In some embodiments, the present disclosure provides HTT oligonucleotides comprising a sequence found in an oligonucleotide listed in a table. In some embodiments, the present disclosure provides HTT oligonucleotides comprising a sequence found in an oligonucleotide listed in a table, wherein one or more U's are independently and optionally replaced by T's, or vice versa. In some embodiments, the HTT oligonucleotides can comprise at least one T and / or at least one U. In some embodiments, the present disclosure provides HTT oligonucleotides comprising a sequence found in an oligonucleotide listed in a table, wherein the sequence has more than 50% identity to the sequence of the oligonucleotide listed in the table. In some embodiments, the present disclosure provides HTT oligonucleotides comprising a sequence found in an oligonucleotide listed in a table. In some embodiments, the present disclosure provides HTT oligonucleotides whose base sequence is the sequence of an oligonucleotide listed in a table. In some embodiments, the present disclosure provides HTT oligonucleotides comprising a sequence found in an oligonucleotide in a table, wherein the oligonucleotide has a backbone bonding pattern, backbone chiral center pattern, and / or backbone phosphorus modification pattern of the same or another oligonucleotide in a table herein.

[0204] In particular, the present disclosure provides a variety of oligonucleotides, each having a base sequence as defined in Table 1 and elsewhere. In some embodiments, the present disclosure provides oligonucleotides that are, include, or comprise a portion of the base sequence of an oligonucleotide disclosed herein, e.g., in a Table, e.g., Table 1 herein. In some embodiments, the present disclosure provides oligonucleotides that have a base sequence that is, includes, or comprises a portion of the base sequence of an oligonucleotide disclosed herein, e.g., in a Table, where the oligonucleotide further comprises a chemical modification, stereochemistry, format, additional chemical moiety (e.g., targeting moiety, lipid moiety, carbohydrate moiety, etc.) and / or another structural feature as described herein.

[0205] In some embodiments, a "portion" (e.g., a portion of a base sequence or modification pattern) is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 monomer units in length (e.g., at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 bases in length for a base sequence). In some embodiments, a "portion" of a base sequence is at least 5 bases in length. In some embodiments, a "portion" of a base sequence is at least 10 bases in length. In some embodiments, a "portion" of a base sequence is at least 15 bases in length. In some embodiments, a "portion" of a base sequence is at least 20 bases in length. In some embodiments, a portion of a base sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or more contiguous (consecutive) bases. In some embodiments, the portion of the base sequence is 15 or more contiguous (consecutive) bases.

[0206] In some embodiments, the present disclosure provides oligonucleotides (e.g., HTT oligonucleotides) whose base sequence is the base sequence of an oligonucleotide in the table or a portion thereof. In some embodiments, the present disclosure provides HTT oligonucleotides of the sequence of an oligonucleotide in the table, wherein the oligonucleotide has the ability to induce a decrease in the expression, level, and / or activity of the HTT gene or its gene product. As will be understood by those skilled in the art, in the base sequences provided, each U can optionally and independently be replaced by T or vice versa, and the sequence can include a mixture of U and T. In some embodiments, C can optionally and independently be replaced by 5mC.

[0207] In some embodiments, the portion is a span of at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 total nucleotides. In some embodiments, the portion is a span of at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 total nucleotides that contains 0-3 mismatches. In some embodiments, the portion is a span of at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 total nucleotides that contains 0-3 mismatches, where a span with 0 mismatches is complementary and a span with one or more mismatches is a non-limiting example of substantial complementarity. In some embodiments, the bases include a portion that is characteristic of a nucleic acid (e.g., a gene) in that the portion is identical to or complementary to a portion of the nucleic acid or its transcript, and is not identical to or complementary to a portion of any other nucleic acid (e.g., a gene) or its transcript in the same genome. In some embodiments, the portion is characteristic of human HTT. In some embodiments, the portion is characteristic of human mHTT.

[0208] In some embodiments, the HTT oligonucleotides, as described herein, are about 49, 45, 40, 30, 35, 25, or 23 or less total nucleotides in length. In some embodiments, if the 5' end of a sequence described herein begins with a U or T, the U can be deleted and / or replaced with another base. In some embodiments, the oligonucleotides have a base sequence that is, includes, or includes a portion of the base sequence of an oligonucleotide in a table, with a format or portion of a format disclosed herein.

[0209] In some embodiments, the oligonucleotide, e.g., HTT oligonucleotide, is sterically random. In some embodiments, the oligonucleotide, e.g., HTT oligonucleotide, is chirally controlled. In some embodiments, the oligonucleotide, e.g., HTT oligonucleotide, is chirally pure (or "stereomerically pure," "stereochemically pure"), where the oligonucleotide exists as a single stereoisomeric form (often as a single diastereoisomeric (or "diastereomer") form, since multiple chiral centers may exist in the oligonucleotide, e.g., at the phosphorus bond, sugar carbon, etc.). As one skilled in the art will understand, chirally pure oligonucleotides are separated from other stereoisomeric forms (with the possible exception of some impurities, since chemical and biological processes, selectivity and / or purification, etc., are rarely, if ever, achieved to absolute perfection). In chirally pure oligonucleotides, each chiral center is independently defined with respect to its configuration (sterically defined or chirally controlled, e.g., Rp or Sp for the chiral linking phosphorus of a chiral internucleotide linkage (such internucleotide linkage is a stereodefined internucleotide linkage or a chirally controlled internucleotide linkage)). In contrast to chirally controlled and chirally pure oligonucleotides containing a stereodefined linking phosphorus, racemic (or "sterically random," "non-chirally controlled") oligonucleotides containing a chiral linking phosphorus, e.g., by conventional phosphoramidite oligonucleotide synthesis without stereochemical control during the coupling step in combination with conventional sulfurization (which creates stereorandom phosphorothioate internucleotide linkages), refer to a random mixture of various stereoisomers (typically diastereoisomers (or "diastereomers"), since an oligonucleotide has multiple chiral centers). For example, A * A * A [in the formula, * is a phosphorothioate internucleotide linkage (which contains a chiral linking phosphorus), the racemic oligonucleotide formulations are available in four diastereomers [22 = 4, considering that there are two chiral bonded phosphorus, each of which can exist in either of two configurations (Sp or Rp): A * SA * S.A., A. * SA * R.A., A. * RA * SA, and A * RA * RA [in the formula, * S represents an Sp phosphorothioate internucleotide linkage; * R represents an Rp phosphorothioate internucleotide linkage. Chirally pure oligonucleotides, e.g., A * SA * For SA, it exists in a single stereoisomeric form and does not contain other stereoisomers (e.g., diastereomer A * SA * R.A., A. * RA * SA, and A * RA * In some embodiments, the Rp phosphorothioate is * S or * In some embodiments, the Rp phosphorothioate is represented as: * R or * It is represented as R.

[0210] In some embodiments, an oligonucleotide, e.g., an HTT oligonucleotide, contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more sterically random internucleotide linkages (e.g., a mixture of Rp- and Sp-linked phosphorus at the internucleotide linkages from conventional, non-chiral oligonucleotide synthesis). In some embodiments, an oligonucleotide, e.g., an HTT oligonucleotide, contains one or more (e.g., 1-50, 1-40, 1-30, 1-25, 1-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more) chiral-controlled internucleotide linkages (e.g., Rp- or Sp-linked phosphorus at the internucleotide linkages from chiral-controlled oligonucleotide synthesis). In some embodiments, the internucleotide linkages are phosphorothioate internucleotide linkages. In some embodiments, the internucleotide linkages are sterically random phosphorothioate internucleotide linkages. In some embodiments, the internucleotide linkages are chiral controlled phosphorothioate internucleotide linkages.

[0211] In particular, the present disclosure provides techniques for preparing chiral controlled (and in some embodiments, stereochemically pure) oligonucleotides. In some embodiments, the oligonucleotides are stereochemically pure. In some embodiments, the oligonucleotides of the present disclosure have a chirality of about 5% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 95% to 100%, 50% to 90%, or about 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 90%, 95%, 50 ... %, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% pure. In some embodiments, the internucleotide linkages of the oligonucleotide are one or more (e.g., 1-50, 1-40, 1-30, 1-25, 1-20, 5-50, 5-40, 5-30, 5-25, 5-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more) ), each of which independently has a diastereomeric purity of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, typically at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%. In some embodiments, the oligonucleotides of the disclosure, e.g., HTT oligonucleotides, comprise or consist of chiral internucleotide linkages of the formula (DS) CILwhere DS is the diastereomeric purity as described herein (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% or more) and CIL is the number of chiral controlled internucleotide linkages (e.g., 1 to 50, 1 to 40, 1 to 30, 1 to 25, 1 to 20, 5 to 50, 5 to 40, 5 to 30, 5 to 25, 5 to 20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more). In some embodiments, DS is 95% to 100%. In some embodiments, each internucleotide linkage is independently chiral controlled, and CIL is the number of chiral controlled internucleotide linkages.

[0212] A variety of HTT oligonucleotides are described and / or referenced herein.

[0213] The base sequences and structures of various HTT oligonucleotides include, but are not limited to, ONT-450, ONT-451, ONT-452, ONT-453, ONT-454, WV-902, WV-903, WV-904, WV-905, WV-906, WV-907, WV-908, WV-909, WV-910, WV-911, WV-912, WV-913, WV-914, WV-915, WV-916, WV-917, WV-918, WV-919, WV-920, WV-921, WV-922, WV-923, WV-924, WV-925, WV-926, WV-927, WV-928, WV-929, WV-930, WV-931, WV-932, WV-933, WV-934, WV-935, WV-936, WV-937, WV-938, WV-939, WV-940, WV-941, WV-944, WV-945, WV-948, WV-949, WV-950, WV-951, WV-952, WV-953, WV-954, WV-955, WV-956, WV-957, WV-958, WV-959, WV-960, WV-961, WV-962, WV-963, WV-964, WV-965, WV-973, WV-974, WV-975, WV-982, WV-983, WV-984, WV-985, WV-986, WV-987, WV-1001, WV-1002, WV-1003, WV-1004, WV-1005, WV-1006, WV-1007, WV-1008, WV-1009, WV-1010, WV-1011, WV-1012, WV-1013, WV-1014, WV-1015, WV-1016, WV-1017, WV-1018, WV-1019, WV-1020, WV-1021, WV-1022, WV-1023, WV-1024, WV-1025, WV-1026, WV-1027, WV-1028, WV-1029, WV-1030, WV-1031, WV-1032, WV-1033, WV-1034, WV-1035, WV-1036, WV-1037, WV-1038, WV-1039, WV-1040, WV-1041, WV-1042, WV-1043, WV-1044, WV-1045, WV-1046, WV-1047, WV-1048, WV-1049, WV-1050, WV-1051, WV-1052, WV-1053, WV-1054, WV-1055,WV-1056, WV-1057, WV-1058, WV-1059, WV-1060, WV-1061, WV-1062, WV-1063, WV-1064, WV-1065, WV-1066, WV-1067, WV-1068, WV-1069, WV-1070, WV-10 71, WV-1072, WV-1073, WV-1074, WV-1075, WV-1076, WV-1077, WV-1078, WV-1079, WV-1080, WV-1081, WV-1082, WV-1083, WV-1084, WV-1085, WV-1086, WV -1087, WV-1088, WV-1089, WV-1090, WV-1091, WV-1092, WV-1234, WV-1235, WV-1497, WV-1508, WV-1509, WV-1510, WV-1511, WV-1654, WV-1655, WV-1788 WV-1789, WV-1790, WV-1799, WV-2022, WV-2023, WV-2024, WV-2025, WV-2026, WV-2027, WV-2028, WV-2029, WV-2030, WV-2031, WV-2032, WV-2033, WV-2 034, WV-2035, WV-2036, WV-2037, WV-2038, WV-2039, WV-2040, WV-2041, WV-2042, WV-2043, WV-2044, WV-2045, WV-2046, WV-2047, WV-2048, WV-2049, W V-2050, WV-2051, WV-2052, WV-2053, WV-2054, WV-2055, WV-2056, WV-2057, WV-2058, WV-2059, WV-2060, WV-2061, WV-2062, WV-2063, WV-2064, WV-206 5, WV-2066, WV-2067, WV-2068, WV-2069, WV-2070, WV-2071, WV-2072, WV-2073, WV-2074, WV-2075, WV-2076, WV-2077, WV-2078, WV-2079, WV-2080, WV- 2081, WV-2082, WV-2083, WV-2084, WV-2085, WV-2086, WV-2087, WV-2088, WV-2089, WV-2090, WV-2163, WV-2164, WV-2269, WV-2270, WV-2271, WV-2272WV-2374, WV-2375, WV-2376, WV-2377, WV-2378, WV-2379, WV-2380, WV-2416, WV-2417, WV-2418, W V-2419, WV-2431, WV-2589, WV-2590, WV-2591, WV-2592, WV-2593, WV-2594, WV-2595, WV-2596, WV -2597, WV-2598, WV-2599, WV-2600, WV-2601, WV-2602, WV-2603, WV-2604, WV-2605, WV-2606, WV- 2607, WV-2608, WV-2609, WV-2610, WV-2611, WV-2612, WV-2613, WV-2614, WV-2615, WV-2616, WV-2 617, WV-2618, WV-2619, WV-2620, WV-2623, WV-2638, WV-2639, WV-2640, WV-2641, WV-2642, WV-26 43, WV-2659, WV-2671, WV-2672, WV-2673, WV-2674, WV-2675, WV-2676, WV-2682, WV-2683, WV-268 4, WV-2685, WV-2686, WV-2687, WV-2688, WV-2689, WV-2690, WV-2691, WV-2692, and WV-2732, are described in WO 2017 / 015555 and WO 2017 / 192664 (the disclosures of which are incorporated by reference). Additional HTT oligonucleotides are described herein.

[0214] By way of example, certain HTT oligonucleotides containing specific exemplary base sequences, nucleobase modifications and patterns thereof, sugar modifications and patterns thereof, internucleotide linkages and patterns thereof, linked phosphorus stereochemistry and patterns thereof, linkers, and / or additional chemical moieties are provided below in Table 1. Among other things, these oligonucleotides can be utilized to target HTT transcripts, e.g., to reduce levels of HTT transcripts and / or their products.

[0215] [Table 1]

[0216] Table 2

[0217] Table 3

[0218] Table 4

[0219] Table 5

[0220] Table 6

[0221] Table 7

[0222] Table 8

[0223] Table 9

[0224] Table 10

[0225] Table 11

[0226] Table 12

[0227] Table 13

[0228] Table 14

[0229] Table 15

[0230] Table 16

[0231] Table 17

[0232] Table 18

[0233] Table 19

[0234] Table 20

[0235] Table 21

[0236] Table 22

[0237] Table 23

[0238] Table 24

[0239] Table 25

[0240] Table 26

[0241] Table 27

[0242] Table 28

[0243] Table 29

[0244] Table 30

[0245] Table 31

[0246] Table 32

[0247] Table 33

[0248] Table 34

[0249] Table 35

[0250] Table 36

[0251] Table 37

[0252] Table 38

[0253] Table 39

[0254] Table 40

[0255] Table 41

[0256] Table 42

[0257] Table 43

[0258] Table 44

[0259] Table 45

[0260] Table 46

[0261] Table 47

[0262] Table 48

[0263] Table 49

[0264] Table 50

[0265] Table 51

[0266] Table 52

[0267] Table 53

[0268] Table 54

[0269] Table 55

[0270] Table 56

[0271] Table 57

[0272] Table 58

[0273] Table 59

[0274] Table 60

[0275] Table 61

[0276] Table 62

[0277] Table 63

[0278] Table 64

[0279] Table 65

[0280] Table 66

[0281] Table 67

[0282] Table 68

[0283] Table 69

[0284] Table 70

[0285] Table 71

[0286] Table 72

[0287] Table 73

[0288] Table 74

[0289] Table 75

[0290] Table 76

[0291] Table 77

[0292] Table 78

[0293] Table 79

[0294] Table 80

[0295] Table 81

[0296] Table 82

[0297] Table 83

[0298] Table 84

[0299] Table 85

[0300] Table 86

[0301] Table 87

[0302] Table 88

[0303] Table 89

[0304] Table 90

[0305] Table 91

[0306] Table 92

[0307] Table 93

[0308] Table 94

[0309] Table 95

[0310] Table 96

[0311] Table 97

[0312] Table 98

[0313] Table 99

[0314] Table 100

[0315] Table 101

[0316] Table 102

[0317] Table 103

[0318] Table 104

[0319] Table 105

[0320] Table 106

[0321] Table 107

[0322] Table 108

[0323] Table 109

[0324] Table 110

[0325] Table 111

[0326] Table 112

[0327] Table 113

[0328] Table 114

[0329] Table 115

[0330] Table 116

[0331] Table 117

[0332] Table 118

[0333] Table 119

[0334] Table 120

[0335] Table 121

[0336] Table 122

[0337] Table 123

[0338] Table 124

[0339] Table 125

[0340] [Table 126]

[0341] [Table 127]

[0342] [Table 128]

[0343] [Table 129]

[0344] [Table 130]

[0345] [Table 131]

[0346] [Table 132]

[0347] m:2'-OMe; m5: methyl at position 5 of C (nucleobase is 5-methylcytosine); m5Ceo: 5-methyl 2'-O-methoxyethyl C; m5mC: 5-methyl 2'-OMe C; m5lC: methyl at position 5 of C (nucleobase is 5-methylcytosine) and sugar is an LNA sugar; eo:2'-MOE(2'-OCH2CH2OCH3); f:2′-F; r:2'-OH; O,PO: phosphodiester (phosphate). This can be a terminal group or a bond, e.g., a bond between a linker and an oligonucleotide chain, an internucleotide bond (a natural phosphate bond), etc. A phosphodiester is typically designated with "O" in the stereochemistry / bonding column and typically not marked in the description column (if it is a terminal group, e.g., the 5'-terminal group, it is designated in the description column and typically not designated in the stereochemistry / bonding column); if a bond is not designated in the description column, it is typically a phosphodiester unless otherwise indicated. Note that the phosphate bond between a linker (e.g., L001) and an oligonucleotide chain may not be marked in the description column and may not be designated with "O" in the stereochemistry / bonding column. For example, in the description of WV-10631 (Mod012L001mG*SmUmGmCmA...), the phosphodiester bond between L001 and the oligonucleotide chain (starting with mG*SmUmGmCmA...) is not marked; this internucleotide bond is indicated in the stereochemistry / bonding column by the first "O" in OSOOO....

[0348] *, PS: phosphorothioate. This can be a terminal group (if it is a terminal group, e.g., the 5'-terminal group, the legend will indicate this and the stereochemistry / bonding typically will not), or it can be a bond, e.g., a bond between a linker (e.g., L001) and an oligonucleotide chain, an internucleotide bond (phosphorothioate internucleotide bond), etc.

[0349] R,Rp: phosphorothioate in Rp conformation. Note that *R in the description indicates a single phosphorothioate bond in Rp conformation; S,Sp: phosphorothioate in Sp conformation. Note that *S in the description indicates a single phosphorothioate bond in Sp conformation; X: sterically random phosphorothioate; l:LNA sugar; n001: [ka] nX or Xn: sterically random n001; n001R or nR:Rp configuration of n001; n001S or nS:Sp configuration of n001; L001: -NH-(CH2)6- linker (also known as C6 linker, C6 amine linker, or C6 amino linker), when present, is linked to Mod by -NH- and, as indicated by the -CH2- linkage, is linked to the 5'- or 3'-end of the oligonucleotide chain by either a phosphate bond (-OP(O)(OH)-O-, which may exist in salt form and be designated O or PO) or a phosphorothioate bond (-OP(O)(SH)-O-, which may exist in salt form and be designated * if the phosphorothioate is not chirally controlled; or *S, S, or Sp if the phosphorothioate is chirally controlled and has the Sp configuration, or *R, R, or Rp if the phosphorothioate is chirally controlled and has the Rp configuration). If Mod is not present, L001 is linked to -H by -NH-; L004: A linker having the structure -NH(CH2)4CH(CH2OH)CH2-, wherein -NH- is linked to Mod (by -C(O)-) or -H, and the -CH2- linkage moiety is linked to an oligonucleotide chain (e.g., at the 3'-end) by a bond such as a phosphodiester (-OP(O)(OH)-O-, which may exist in salt form and may be designated O or PO), phosphorothioate (-OP(O)(SH)-O-, which may exist in salt form and may be designated * if the phosphorothioate is not chiral controlled; or *S, S, or Sp if the phosphorothioate is chiral controlled and has the Sp configuration, or *R, R, or Rp if the phosphorothioate is chiral controlled and has the Rp configuration), or phosphorodithioate (-OP(S)(SH)-O-, which may exist in salt form and may be designated PS2 or : or D) bond. For example, an asterisk immediately preceding L004 (e.g., *L004) indicates that the linkage is a phosphorothioate linkage, while the absence of an asterisk immediately preceding L004 indicates that the linkage is a phosphodiester linkage. For example, in an oligonucleotide ending in ...mAL004, the linker L004 is linked by a phosphodiester bond (at the -CH2- site) to the 3' position of the 3'-terminal sugar (which is 2'-OMe modified and linked to nucleobase A), and the L004 linker is linked by -NH- to -H. Similarly, in one or more oligonucleotides, the L004 linker is linked by a phosphodiester bond (at the -CH2- site) to the 3' position of the 3'-terminal sugar, and L004 is linked by -NH- to, e.g., Mod012, Mod085, Mod086, etc.; Mod012 (with -C(O)- linked to the -NH- of a linker such as L001 or L004): [ka] Mod039 (with -C(O)- linked to the -NH- of a linker such as L001 or L004): [ka] Mod062 (having -NH- linked to the -C(O)- of a linker such as L008): [ka] L008: Linkers having the structure -C(O)-(CH2)9-, where -C(O)- is linked to Mod (with -NH-) or -OH (if Mod is not specified), and the -CH2- linking site is a bond, such as a phosphodiester (-OP(O)(OH)-O-, which may exist in salt form and may be designated O or PO), phosphorothioate (-OP(O)(SH)-O-, which may exist in salt form and may be designated as a chiral phosphorothioate). or if the phosphorothioate is chiral and has the Sp configuration, it may be designated *S, S, or Sp; or if the phosphorothioate is chiral and has the Rp configuration, it may be designated *R, R, or Rp), or is linked to the oligonucleotide chain (e.g., at the 5'-end) by a phosphorodithioate (-OP(S)(SH)-O-, which may exist as a salt form and may be designated PS2 or : or D) linkage. For example, in WV-11571, L008 is linked to -OH by a -C(O)- and is linked to the 5'-end of the oligonucleotide chain by a phosphate linkage (designated "O" in "Stereochemistry / Linkage"); in WV-11569, L008 is linked to Mod062 by a -C(O)- and is linked to the 5'-end of the oligonucleotide chain by a phosphate linkage (designated "O" in "Stereochemistry / Linkage"); Mod001 (having -C(O)- linked to the -NH- of a linker such as L001): [ka] Mod085 (with -C(O)- linked to the -NH- of a linker such as L001 or L004): [ka] Mod086 (with -C(O)- linked to the -NH- of a linker such as L001 or L004): [ka] In Mod094 (WV-11570), it is attached to the 3'-end of the oligonucleotide chain (the 3'-carbon of the 3'-terminal sugar) via a phosphate group (which is not shown below, and which may exist as a salt; and which is designated as "O" in "Stereochemistry / Bonding" (...XXXXO)): [ka] BrdU: nucleoside unit, where the nucleobase is BrU [ka] where the sugar is 2-deoxyribose (as commonly found in natural DNA; 2'-deoxy(d)) [ka] is; tgal mc6T: a modified thymine containing a modified thymine and having the following structure: [ka] d2AP: nucleoside unit, where the nucleobase is 2-aminopurine [ka] and the sugar is 2-deoxyribose (as commonly found in natural DNA; 2'-deoxy(d)) [ka] is; dDAP: nucleoside unit, where the nucleobase is 2,6-diaminopurine [ka] and the sugar is 2-deoxyribose (as commonly found in natural DNA; 2'-deoxy(d)) [ka] is; dmtr: DMTR, 4,4'-dimethoxytrityl, attached to the 5'-O- of the sugar, unless otherwise indicated. For example, in dmtrmA, [ka] .

[0350] Additional structural elements of HTT oligonucleotides are described, for example, in WO 2018 / 022473, WO 2018 / 098264, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, and / or WO 2019 / 075357 (the structural elements of these oligonucleotides are hereby incorporated by reference).

[0351] length As those skilled in the art will appreciate, oligonucleotides can be of various lengths to provide desired properties and / or activities for various uses. Many techniques for evaluating, selecting, and / or optimizing oligonucleotide length are available in the art and can be utilized in the present disclosure. As demonstrated herein, in many embodiments, the provided oligonucleotides are of a length suitable for hybridizing with their targets and reducing the levels of the targets and / or their encoded products. In some embodiments, the oligonucleotides are of sufficient length to recognize the target HTT nucleic acid (e.g., HTT mRNA). In some embodiments, the oligonucleotides are of sufficient length to distinguish the target HTT nucleic acid from other nucleic acids (e.g., nucleic acids having non-HTT base sequences) and reduce off-target effects. In some embodiments, the oligonucleotides, e.g., HTT oligonucleotides, are short enough to reduce manufacturing or production complexity and product costs.

[0352] In some embodiments, the base sequence of the oligonucleotide is about 10 to 500 nucleobases in length. In some embodiments, the base sequence is about 10 to 500 nucleobases in length. In some embodiments, the base sequence is about 10 to 50 nucleobases in length. In some embodiments, the base sequence is about 15 to 50 nucleobases in length. In some embodiments, the base sequence is about 15 to about 30 nucleobases in length. In some embodiments, the base sequence is about 10 to about 25 nucleobases in length. In some embodiments, the base sequence is about 15 to about 22 nucleobases in length. In some embodiments, the base sequence is about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobases in length.

[0353] In some embodiments, each nucleobase independently comprises an optionally substituted monocyclic, bicyclic, or polycyclic ring, wherein at least one ring atom is nitrogen. In some embodiments, each nucleobase independently is an optionally substituted adenine, cytosine, guanosine, thymine, or uracil, or an optionally substituted tautomer of adenine, cytosine, guanosine, thymine, or uracil.

[0354] HTT oligonucleotide regions, wings and core In some embodiments, an oligonucleotide, e.g., an HTT oligonucleotide, comprises several regions, each independently comprising one or more consecutive nucleosides and, optionally, one or more internucleotide linkages. In some embodiments, a region differs from one or more neighboring regions in that it possesses one or more structural features that differ from the corresponding structural features of the neighboring region or regions. Exemplary structural features include nucleobase modifications and their patterns, sugar modifications and their patterns, internucleotide linkages and their patterns (which can be internucleotide linkage types (e.g., phosphate, phosphorothioate, phosphorothioate triester, neutral internucleotide linkages, etc.) and their patterns), linked phosphorus modifications (backbone phosphorus modifications) and their patterns (e.g., -XLR when the internucleotide linkage has the structure of Formula I), and the like. 1 (pattern of ), backbone chiral center (linked phosphorus) stereochemistry and its pattern (e.g., chiral controlled internucleotide linkage Rp and / or Sp combinations (ordered 5' to 3'), optionally with non-chiral controlled internucleotide linkages and / or natural phosphate linkages, if present (e.g., OSOOO RSSRS SSSRS SOOOS in Table 1)). In some embodiments, a region contains a chemical modification (e.g., sugar modification, base modification, internucleotide linkage, or internucleotide linkage stereochemistry) that is not present in one or more neighboring regions. In some embodiments, a region lacks a chemical modification present in one or more neighboring regions.

[0355] In some embodiments, an oligonucleotide, such as an HTT oligonucleotide, comprises or consists of two or more regions. In some embodiments, an oligonucleotide comprises or consists of three or more regions. In some embodiments, an oligonucleotide comprises or consists of two adjacent regions, where one region is referred to as the wing region and the other as the core region. The structure of such an oligonucleotide comprises or consists of a wing-core or core-wing structure. In some embodiments, an oligonucleotide comprises or consists of three adjacent regions, where one region is flanked by two adjacent regions. In some embodiments, the central region is referred to as the core region, and each of the flanking regions is referred to as a wing region (5'-wing if attached to the 5' end of the core, and 3'-wing if attached to the 3' end of the core). The structure of such an oligonucleotide comprises or consists of a wing-core-wing structure.

[0356] In some embodiments, a first region (e.g., wing) differs from a second region (e.g., core) in that the first region includes one or more sugar modifications or patterns thereof that are not present in the second region. In some embodiments, the first (e.g., wing) region includes a sugar modification that is not present in the second (e.g., core) region. In some embodiments, the sugar modification is a 2'-modification. In some embodiments, the 2'-modification is 2'-OR, where R is an optionally substituted C 1~6 In some embodiments, the 2'-modification is 2'-OR, where R is an optionally substituted C 1~6In some embodiments, the 2'-modification is alkyl. In some embodiments, the 2'-modification is 2'-MOE. In some embodiments, the 2'-modification is 2'-OMe. In some embodiments, the modified sugar is a bicyclic sugar, e.g., an LNA sugar. In some embodiments, each sugar in a region is independently modified. In some embodiments, each sugar in a region (e.g., a wing) independently comprises a modification, which can be the same or different from one another. In some embodiments, each sugar in a region (e.g., a wing) comprises the same modification, e.g., a 2'-modification as described in this disclosure. In some embodiments, the sugars in a region (e.g., a core) are unmodified. In some embodiments, each sugar in a region (e.g., a core) is an unmodified DNA sugar (two -H at the 2' position). In some embodiments, the structure of the provided oligonucleotides comprises or consists of a wing-core, core-wing, or wing-core-wing structure, where each wing independently comprises one or more sugar modifications and each sugar in the core is a natural DNA sugar (two -H at the 2' position).

[0357] Additionally or alternatively, a first region (e.g., a wing) can contain one or more internucleotide linkages or a pattern thereof that differs from another region (e.g., a core or another wing). In some embodiments, a region (e.g., a wing) contains two or more consecutive natural phosphate linkages. In some embodiments, a region (e.g., a core) does not contain any consecutive natural phosphate linkages. In some embodiments, the structure of the provided oligonucleotides comprises or consists of a wing-core, core-wing, or wing-core-wing structure, wherein at least one wing independently contains two or more consecutive natural phosphate linkages and the core does not contain any consecutive natural phosphate linkages. In some embodiments, in a wing-core-wing structure, each wing independently contains two or more consecutive internucleotide linkages. Unless otherwise noted, for purposes of the stereochemistry of a wing-core-wing structure, the internucleotide linkage connecting the core to the wing is included in the core (see, e.g., above).

[0358] In some embodiments, the region is a 5'-wing, a 3'-wing, or a core. In some embodiments, the 5'-wing is located at the 5' end of the oligonucleotide, the 3'-wing is located at the 3' end of the oligonucleotide, and the core is located between the 5'-wing and the 3'-wing, and the oligonucleotide comprises or consists of a wing-core-wing structure or format. In some embodiments, the core comprises a span of contiguous natural DNA sugars (2'-deoxyribose). In some embodiments, the core comprises a span of at least five contiguous natural DNA sugars (2'-deoxyribose). In some embodiments, the core comprises a span of at least 10 contiguous natural DNA sugars (2'-deoxyribose). In some embodiments, the core is referred to as a gap. In some embodiments, oligonucleotides comprising or consisting of a wing-core-wing structure are described as gapmers. In some embodiments, the structure of provided oligonucleotides comprises or consists of a wing-core structure. In some embodiments, the structure of provided oligonucleotides comprises or consists of a core-wing structure. Non-limiting examples of oligonucleotides having a core-wing structure include WV-2023 and WV-2025. In some embodiments, the structure of the oligonucleotide comprises or consists of an oligonucleotide chain comprising or consisting of wing-core-wing, wing-core, or wing-core, where the oligonucleotide chain is optionally conjugated to an additional chemical moiety via a linker as described in the present disclosure. In some embodiments, the present disclosure provides an oligonucleotide targeting HTT, which has a structure comprising one or two wings and a core, and comprises or consists of a wing-core-wing, core-wing, or wing-core structure.

[0359] Ribonuclease H (RNase H, e.g., RNase H1, RNase H2, etc.) reportedly recognizes structures (e.g., heteroduplexes) comprising RNA and DNA hybrids and cleaves the RNA. In some embodiments, oligonucleotides comprising a span of contiguous natural DNA sugars (e.g., 2'-deoxyribose in the core region) are capable of annealing to RNA, such as mRNA, to form a heteroduplex; and this heteroduplex structure is capable of being recognized by RNase H, resulting in cleavage of the RNA by RNase H. In some embodiments, the core of the provided oligonucleotides comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more contiguous natural DNA sugars, the core is capable of specifically annealing to a target transcript (e.g., an HTT transcript (e.g., pre-mRNA, mature mRNA, etc.)); and the structure formed is capable of being recognized by RNase H, resulting in cleavage of the transcript by RNase H. In some embodiments, the core of the provided oligonucleotides comprises five or more contiguous DNA sugars.

[0360] Regions, e.g., wings, cores, etc., can be of various suitable lengths. In some embodiments, a region (e.g., wings, cores, etc.) comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more nucleobases. As described in this disclosure, in some embodiments, each nucleobase independently comprises an optionally substituted monocyclic, bicyclic, or polycyclic ring having at least one nitrogen ring atom; in some embodiments, each nucleobase independently is optionally substituted A, T, C, G, or U, or a substituted tautomer of A, T, C, G, or U. In some embodiments, this number is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 for a wing. In some embodiments, each wing of the wing-core-wing structure is independently a length as described herein. In some embodiments, the two wings have the same length. In some embodiments, the two wings are different lengths. In some embodiments, the number is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more for the core.

[0361] In some embodiments, the wings comprise one or more sugar modifications. In some embodiments, the two wings of the wing-core-wing structure comprise different sugar modifications (and the oligonucleotide has or comprises an "asymmetric" format). In some embodiments, the sugar modifications provide improved stability and / or annealing properties compared to the absence of the sugar modifications.

[0362] In some embodiments, certain sugar modifications, such as 2'-MOE, confer greater stability under certain conditions than other sugar modifications, such as 2'-OMe. In some embodiments, a wing comprises a 2'-MOE modification. In some embodiments, each nucleoside unit of a wing comprising a pyrimidine base (e.g., C, U, T, etc.) comprises a 2'-MOE modification. In some embodiments, each sugar unit of a wing comprises a 2'-MOE modification. In some embodiments, each nucleoside unit of a wing comprising a purine base (e.g., A, G, etc.) does not comprise a 2'-MOE modification (e.g., each such nucleoside unit comprises a 2'-OMe or does not comprise a 2'-modification, etc.). In some embodiments, each nucleoside unit of a wing comprising a purine base comprises a 2'-OMe modification. In some embodiments, each internucleotide linkage at the 3' position of a sugar unit comprising a 2'-MOE modification is a natural phosphate linkage.

[0363] In some embodiments, the wings do not include 2'-MOE modifications. In some embodiments, the wings include 2'-OMe modifications. In some embodiments, each nucleoside unit of the wings independently includes a 2'-OMe modification.

[0364] In some embodiments, the structure of the oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, wherein one wing comprises a 2'-OMe sugar modification and the other wing comprises a bicyclic sugar; wherein one wing comprises a 2'-OMe and the other wing comprises a bicyclic sugar, and the majority of sugars in the core are natural DNA sugars (no substitutions at the 2' position); wherein the majority of sugars in one wing comprise a 2'-OMe and the majority of sugars in the other wing are, independently, bicyclic sugars; wherein a majority of sugars in one wing comprise 2'-OMe, a majority of sugars in the other wing are, independently, bicyclic sugars, and a majority of sugars in the core are natural DNA sugars; wherein a majority of sugars in one wing comprise 2'-OMe, and in the other wing, at least one sugar is a bicyclic sugar and at least one sugar comprises 2'-OMe; wherein a majority of sugars in one wing comprise 2'-OMe, and in the other wing, at least one sugar is a bicyclic sugar and at least one sugar comprises 2'-OMe, and a majority of sugars in the core are natural DNA sugars. A sugars; wherein a majority of the sugars in one wing are bicyclic sugars and in the other wing, at least one sugar is a bicyclic sugar and at least one sugar comprises 2'-OMe; wherein a majority of the sugars in one wing are independently bicyclic sugars and in the other wing, at least one sugar is a bicyclic sugar and at least one sugar comprises 2'-OMe, and a majority of sugars in the core are native DNA sugars; wherein each sugar in one wing comprises 2'-OMe and each sugar in the other wing is independently a bicyclic sugar; wherein each sugar in one wing comprises a 2'-OMe, each sugar in the other wing is independently a bicyclic sugar, and the majority of sugars in the core are naturally occurring DNA sugars; wherein each sugar in one wing is independently a bicyclic sugar, each sugar in the other wing comprises a 2'-OMe, and each sugar in the core is a naturally occurring DNA sugar; wherein one wing comprises a bicyclic sugar and the other wing comprises a 2'-MOE; wherein one wing comprises a bicyclic sugar, the other wing comprises a 2'-MOE, and the majority of sugars in the core are naturally occurring DNA sugars;wherein a majority of the sugars in one wing are independently bicyclic sugars and a majority of the sugars in the other wing comprise 2'-MOE; wherein a majority of the sugars in one wing are independently bicyclic sugars and a majority of the sugars in the other wing comprise 2'-MOE, and a majority of the sugars in the core are natural DNA sugars; wherein a majority of the sugars in one wing are independently bicyclic sugars and in the other wing at least one sugar comprises 2'-MOE and at least one sugar is a bicyclic sugar; wherein a majority of the sugars in one wing are independently bicyclic sugars and in the other wing at least one sugar comprises 2'-MOE and at least one sugar is a bicyclic sugar, and a majority of the sugars in the core are natural DNA sugars; wherein the majority of sugars in one wing comprise 2'-MOE and in the other wing, at least one sugar comprises 2'-MOE and at least one sugar is a bicyclic sugar; wherein the majority of sugars in one wing comprise 2'-MOE and in the other wing, at least one sugar comprises 2'-MOE and at least one sugar is a bicyclic sugar, and the majority of sugars in the core are natural DNA sugars; wherein each sugar in one wing is independently a bicyclic sugar and each sugar in the other wing independently comprises 2'-MOE; and / or wherein each sugar in one wing of the oligonucleotide is independently a bicyclic sugar and each sugar in the other wing comprises 2'-MOE, and the majority of sugars in the core are natural DNA sugars;

[0365] In some embodiments, the structure of the oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, in which each sugar in one wing comprises a 2'-MOE, each sugar in the other wing is independently a bicyclic sugar, and each sugar in the core is a native DNA sugar.

[0366] In some embodiments, the bicyclic sugar is an LNA, cEt, or BNA sugar.

[0367] In some embodiments, the structure of the oligonucleotide, e.g., HTT oligonucleotide, comprises a wing-core-wing structure, where one wing comprises 2'-OMe and the other wing comprises 2'-F. In some embodiments, the structure of the oligonucleotide, e.g., HTT oligonucleotide, comprises a wing-core-wing structure, where one wing comprises 2'-OMe and the other wing comprises 2'-F, and the majority of the sugars in the core are natural DNA sugars.

[0368] In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, where the majority of sugars in one wing comprise 2'-OMe and the majority of sugars in the other wing comprise 2'-F. In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, where the majority of sugars in one wing comprise 2'-OMe, the majority of sugars in the other wing comprise 2'-F, and the majority of sugars in the core are natural DNA sugars.

[0369] In some embodiments, the structure of the oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, where the majority of sugars in one wing comprise 2'-OMe, and in the other wing, at least one sugar comprises 2'-F and at least one sugar comprises 2'-OMe. In some embodiments, the structure of the oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, where the majority of sugars in one wing comprise 2'-OMe, and in the other wing, at least one sugar is 2'-F and at least one sugar comprises 2'-OMe, and the majority of sugars in the core are DNA sugars.

[0370] In some embodiments, the structure of the oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, where the majority of sugars in one wing comprise 2'-F, and in the other wing, at least two sugars comprise 2'-F and at least two sugars comprise 2'-OMe. In some embodiments, the structure of the oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, where the majority of sugars in one wing comprise 2'-F, and in the other wing, at least two sugars comprise 2'-F and at least two sugars comprise 2'-OMe, and the majority of sugars in the core are natural DNA sugars.

[0371] In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, where each sugar in one wing of the oligonucleotide comprises 2'-OMe and each sugar in the other wing of a provided oligonucleotide comprises 2'-F. In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, where each sugar in one wing of the oligonucleotide comprises 2'-OMe and each sugar in the other wing of the oligonucleotide comprises 2'-F, and the majority of the sugars in the core are natural DNA sugars.

[0372] In some embodiments, the structure of the oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, where each sugar in one wing comprises a 2'-F, each sugar in the other wing comprises a 2'-OMe, and each sugar in the core is a DNA sugar.

[0373] In some embodiments, the structure of the oligonucleotide, e.g., HTT oligonucleotide, comprises a wing-core-wing structure, where one wing comprises 2'-F and the other wing comprises 2'-MOE. In some embodiments, the structure of the oligonucleotide, e.g., HTT oligonucleotide, comprises a wing-core-wing structure, where one wing comprises 2'-F, the other wing comprises 2'-MOE, and the majority of the sugars in the core comprise 2'-deoxy.

[0374] In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, where the majority of sugars in one wing comprise 2'-F and the majority of sugars in the other wing comprise 2'-MOE. In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, where the majority of sugars in one wing comprise 2'-F and the majority of sugars in the other wing comprise 2'-MOE, and the majority of sugars in the core are natural DNA sugars.

[0375] In some embodiments, the structure of the oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, where the majority of sugars in one wing comprise 2'-F, and in the other wing, at least one sugar comprises 2'-MOE and at least one sugar comprises 2'-F. In some embodiments, the structure of the oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, where the majority of sugars in one wing comprise 2'-F, and in the other wing, at least one sugar comprises 2'-MOE and at least one sugar comprises 2'-F, and the majority of sugars in the core are natural DNA sugars.

[0376] In some embodiments, the structure of the oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, where the majority of sugars in one wing comprise 2'-MOE, and in the other wing, at least one sugar comprises 2'-MOE and at least one sugar comprises 2'-F. In some embodiments, the structure of the oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, where the majority of sugars in one wing comprise 2'-MOE, and in the other wing, at least one sugar comprises 2'-MOE and at least one sugar comprises 2'-F, and the majority of sugars in the core are natural DNA sugars.

[0377] In some embodiments, the structure of the oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, in which each sugar in one wing of the oligonucleotide comprises a 2'-MOE, each sugar in the other wing comprises a 2'-F, and each sugar in the core is a natural DNA sugar.

[0378] In some embodiments, the oligonucleotide, e.g., an HTT oligonucleotide, has a wing-core-wing structure. In some embodiments, the core comprises one or more naturally occurring DNA sugars. In some embodiments, the core comprises five or more contiguous naturally occurring DNA sugars. In some embodiments, the core comprises 5-10, 5-15, 5-20, 5-25, 5-30, or 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more, optionally contiguous, naturally occurring DNA sugars. In some embodiments, the core comprises 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more, contiguous naturally occurring DNA sugars. In some embodiments, the core comprises 10 or more contiguous naturally occurring DNA sugars. In some embodiments, the core is capable of hybridizing to a target mRNA, forming a duplex structure that can be recognized by RNase H, allowing RNase H to cleave the mRNA.

[0379] In some embodiments, the oligonucleotide, eg, the HTT oligonucleotide, has a wing-core-wing structure and has an asymmetric format.

[0380] In some embodiments, in oligonucleotides having an asymmetric format, one wing differs from the other in sugar modification or pattern, backbone internucleotide linkage or pattern, or backbone chiral center or pattern. In some embodiments, an oligonucleotide, e.g., an HTT oligonucleotide, has an asymmetric format in that one wing contains a different sugar modification than the other wing. In some embodiments, an oligonucleotide, e.g., an HTT oligonucleotide, has an asymmetric format in that one wing contains a different sugar modification pattern than the other wing.

[0381] In some embodiments, the HTT oligonucleotide (or wings, core, blocks, or any portion thereof) is selected from the group consisting of those disclosed in WO 2017015555; WO 2017192664; WO 201200366; WO 2011 / 034072; WO 2014 / 010718; WO 2015 / 108046; WO 2015 / 108047; WO 2015 / 108048; WO 2011 / 005761; WO 2011 / 108682; WO 2012 / 039448; WO 2018 / 067973; WO 2005 / 028494; WO 2005 / 092909; WO 2010 / 064146; WO 2012 / 073857; WO 2013 / 012758; WO 2014 / 010250; WO 2014 / 012081; WO 2015 / 1074 The nucleic acid sequence may include any modification, any modification pattern, any internucleotide linkage, any internucleotide linkage pattern, any chiral center pattern, or any format (including but not limited to asymmetric formats) described in any of WO 2017 / 015555; WO 2017 / 015575; WO 2017 / 062862; WO 2017 / 160741; WO 2017 / 192664; WO 2017 / 192679; WO 2017 / 210647; WO 2018 / 022473; or WO 2018 / 098264 (each modification, any modification pattern, any internucleotide linkage, any internucleotide linkage pattern, or any format (including but not limited to asymmetric formats) described therein is incorporated by reference).

[0382] In some embodiments, the structure of the oligonucleotide, e.g., the HTT oligonucleotide, comprises or consists of an asymmetric format. In some embodiments, the structure of the oligonucleotide, e.g., the HTT oligonucleotide, comprises or consists of a symmetric format.

[0383] In some embodiments, the structure of the oligonucleotide, e.g., an HTT oligonucleotide, is or comprises an asymmetric format, wherein the structure of the oligonucleotide is a wing-core-wing structure, wherein the format of the first wing is different from the format of the second wing. In some embodiments, the structure of the oligonucleotide, e.g., an HTT oligonucleotide, is or comprises an asymmetric format, wherein the structure of the oligonucleotide is a wing-core-wing structure, wherein the first and second wings differ in sugar modification (or combination or pattern thereof) and / or internucleotide linkage (or combination or pattern thereof). In some embodiments, the structure of the oligonucleotide, e.g., an HTT oligonucleotide, is or comprises an asymmetric format, wherein the structure of the oligonucleotide is a wing-core-wing structure, wherein the first and second wings differ in sugar modification (or combination or pattern thereof).

[0384] In some embodiments, the core region comprises a sequence complementary to one allele at a differential position, e.g., the SNP location. In some embodiments, the core region comprises a sequence complementary to one allele of the SNP (e.g., which is on the same strand / chromosome as a disease-associated or causative sequence (e.g., an expanded CAG repeat of the HTT gene)), but not complementary to the other allele of the SNP (e.g., which is on the same strand / chromosome as a sequence unlikely or not at all to be associated with or cause the disease (e.g., a normal or shorter CAG repeat of the HTT gene)). In some embodiments, for an SNP, such a sequence is a single nucleobase. In some embodiments, the core region comprises a nucleobase complementary to an allele of the SNP on the same strand / chromosome as the expanded CAG repeat of the HTT gene. Among other things, the present disclosure demonstrates that the properties and / or activity of an oligonucleotide can be modulated by the positioning of such nucleobases. In some embodiments, the position of the nucleobase is 4, 5, 6, 7, or 8, counting from the 5' end of the core region (the first nucleoside from the 5' end of the core region is position 1). In some embodiments, the position is 4 from the 5' end of the core region. In some embodiments, the position is 5 from the 5' end of the core region. In some embodiments, the position is 6 from the 5' end of the core region. In some embodiments, the position is 7 from the 5' end of the core region. In some embodiments, the position is 8 from the 5' end of the core region. In some embodiments, the position of the nucleobase is 7, 8, 9, 10, 11, or 12, counting from the 5' end of the oligonucleotide (the first nucleoside from the 5' end of the oligonucleotide is position 1). In some embodiments, the position is 7 from the 5' end of the oligonucleotide. In some embodiments, the position is 8 from the 5' end of the oligonucleotide. In some embodiments, the position is 9 from the 5' end of the oligonucleotide. In some embodiments, the position is 10 from the 5' end of the oligonucleotide. In some embodiments, the position is position 11 from the 5' end of the oligonucleotide.In some embodiments, the oligonucleotide comprises a 5'-terminal wing that comprises 5 and only 5 nucleosides. In some embodiments, each wing sugar is 2'-modified. In some embodiments, each wing sugar is 2'-OMe-modified. In some embodiments, each core sugar independently does not comprise a 2'-OR modification, where R is as described herein. In some embodiments, each core sugar independently is an unmodified DNA sugar.

[0385] In some embodiments, the oligonucleotide, eg, an HTT oligonucleotide, can include any first wing, core, and / or second wing as described herein or known in the art.

[0386] In some embodiments, an oligonucleotide having a base sequence that is, comprises, or spans an HTT oligonucleotide sequence disclosed herein can comprise a first wing, a core, and / or a second wing as described herein or known in the art.

[0387] RNAi drugs The oligonucleotides of the present disclosure can perform one or more functions through various biological mechanisms and / or pathways. In some embodiments, the present disclosure provides oligonucleotides that can partially, primarily, or entirely reduce the level, expression, and / or activity of a gene or its product through RNA interference. As will be understood by those skilled in the art, such oligonucleotides can be single-stranded or double-stranded. In some embodiments, the single-stranded or double-stranded oligonucleotides have the ability to reduce the level, expression, and / or activity of a target gene (e.g., HTT) or its gene product through a mechanism involving RNA interference.

[0388] In some embodiments, the present disclosure relates to an oligonucleotide, e.g., an HTT oligonucleotide, having a base sequence that includes, is, or includes a span of 15 or more contiguous bases (optionally with 1-3 mismatches) from the base sequence of an oligonucleotide in Table 1, wherein the oligonucleotide is capable of mediating RNA interference.

[0389] In some embodiments, the present disclosure relates to an HTT oligonucleotide having a base sequence comprising, being, or comprising a span of 15 or more contiguous bases (optionally with 1-3 mismatches) from the base sequence of an oligonucleotide in Table 1, wherein the HTT oligonucleotide is capable of mediating single-stranded RNA interference.

[0390] In some embodiments, the present disclosure relates to an HTT oligonucleotide having a base sequence comprising, being, or comprising a span of 15 or more contiguous bases (optionally with 1-3 mismatches) from the base sequence of an oligonucleotide in Table 1, wherein the HTT oligonucleotide is capable of mediating single-stranded RNA interference.

[0391] In some embodiments, the RNAi agent is an agent capable of mediating RNA interference (e.g., a nucleic acid, including but not limited to, a single-stranded or double-stranded nucleic acid). In some embodiments, the present disclosure provides an RNAi agent that targets HTT.

[0392] In some embodiments, the disclosure relates to single-stranded RNAi agents whose base sequence is or includes a sequence that is or is complementary to a span of 15 to 30 (e.g., at least 15, 16, 17, 18, 19, 20, or 21) contiguous bases of HTT or a transcript thereof. In some embodiments, the disclosure relates to single-stranded RNAi agents having a base sequence that is, includes, or includes a span of at least 15 contiguous bases of any of the HTT oligonucleotides in Table 1. In some embodiments, such a span of contiguous bases is characteristic of HTT and is not identical to or complementary to any other sequence in the genome or transcriptome.

[0393] In some embodiments, the disclosure relates to double-stranded RNAi agents comprising a sense and an antisense strand, wherein the base sequence of the antisense strand is or comprises a sequence complementary to a span of 15 to 30 (e.g., at least 15, 16, 17, 18, 19, 20, or 21) contiguous bases of HTT or a transcript thereof. In some embodiments, the disclosure relates to double-stranded RNAi agents comprising a sense and an antisense strand, wherein the antisense strand has a base sequence that is, comprises, or comprises a span of at least 15 contiguous bases of any HTT oligonucleotide listed in Table 1. In some embodiments, the disclosure relates to double-stranded RNAi agents comprising a sense and an antisense strand, wherein the antisense strand has a base sequence that is, comprises, or comprises a span of at least 10 contiguous bases of any HTT oligonucleotide listed in Table 1. In some embodiments, such a span of contiguous bases is characteristic of HTT, and it is not identical to or complementary to any other sequence in the genome or transcriptome.

[0394] In some embodiments, the RNAi agent, e.g., HTT RNAi agent, can be double-stranded or single-stranded, and can be any format of RNAi agent described herein or known in the art. Various formats of double-stranded RNAi agents are known in the art, for example, Elbashir et al. 2001 Gen. Dev. 15: 188; Elbashir et al. 2001 Nature 411: 494; Elbashir et al. 2001 EMBO J. 20: 6877-6888; Sun et al. Nat. Biotech. 26: 1379; Chiu et al. 2003 RNA 9: 1034-1048; Kim et al. (2005) Nat. Biotech 23:222-226; U.S. Patent No. 8,084,600; U.S. Patent No. 9,175,289; U.S. Patent No. 8,329,888; U.S. Patent No. 8,090,542; U.S. Patent No. 7,507,811; U.S. Patent No. 8,828,956; U.S. Patent Application Publication No. 20130035368; U.S. Patent Application Publication No. 20050255487; U.S. Patent Application Publication No. 20080242851; International Publication No. 2015051366; and European Patent No. 3,052,464, and may be used in the present disclosure. Various formats of single-stranded RNAi agents are described in the art, for example, European Patent No. 1,520,022, U.S. Patent No. 8,729,036, U.S. Patent No. 9,476,044, U.S. Patent No. 9,243,246, International Publication No. 2004 / 007718, etc., and may be used in the present disclosure.

[0395] In some embodiments, the strand of a single-stranded RNAi agent or the antisense strand of a double-stranded RNAi agent comprises, in 5' to 3' order, a 5' terminal region, a seed region, a post-seed region, and a 3' terminal. In some embodiments, the seed region comprises nucleotides from about 2 to about 7 or about 8, counting from the 5' terminal, of the strand. In some embodiments, the 5' terminal region comprises a portion of the strand 5' from the seed region. In some embodiments, the 3' terminal region comprises either a terminal dinucleotide at the 3' end (e.g., TT or UU) or a moiety that functionally replaces the terminal dinucleotide (e.g., a 3' terminal cap). 3' terminal caps are described, for example, in U.S. Pat. No. 8,084,600 and WO 2015 / 051366. In some embodiments, the post-seed region comprises a portion of the strand between the seed region and the 3' terminal region.

[0396] In some embodiments, the 5'-terminal region comprises a phosphate group or an analog thereof. In some embodiments, an additional chemical moiety as described herein is conjugated to the 5'-terminal region, for example, directly or indirectly. In some embodiments, an additional chemical moiety, such as a GalNAc or a derivative thereof capable of binding to ASPGR, is conjugated to the 5'-terminal region, for example, directly or indirectly.

[0397] In some embodiments, the seed region is particularly important for recognizing and complementing the target region, and in some embodiments, the seed region is less suitable for mismatching with the target than the 5' or post-seed region.

[0398] In some embodiments, a single-stranded RNAi agent, such as a single-stranded HTT RNAi reagent, includes a chemical moiety at its 5' end that includes phosphorus. In some embodiments, a single-stranded RNAi agent has a phosphorus-containing group at its 5' end. In some embodiments, a single-stranded RNAi agent has a phosphate group or an analog thereof at its 5' end.

[0399] In some embodiments, an ASPGR ligand is attached to the single-stranded RNAi agent or to either or both strands of the double-stranded RNAi agent, hi some embodiments, the ASGPR ligand is GalNAc or a derivative thereof capable of binding to ASPGR.

[0400] Non-limiting examples of oligonucleotides that can be used as single-stranded RNAi agents include WV-5153, WV-5154, WV-5155, WV-5156, WV-5157, WV-5158, WV-5159, WV-5160, WV-5161, WV-5162, WV-5163, WV-5164, WV-5165, WV-5166, WV-5167, WV-5168, WV-5169, WV-5170, WV-5171, WV-5172, WV-5173, WV-5174, WV-5175, WV-5176, WV-5177, WV-5178, WV-5179, WV-5180, WV-5181, WV-5182, WV-5183, WV-5184, WV-5185, WV-5186, WV-5187, WV-5188, WV-5189, WV-5190, WV-5191, WV-5192, WV-5193, WV-5194, WV-5195, WV-5196, WV-5197, WV-5198, WV-5199, WV-5200, WV-5201, WV-5202, WV-5203, WV-5204, WV-5205, WV-5206, WV-5207, WV-5208, WV-5209, WV-5210, WV-5211, WV-5212, WV-5213, WV-5214, WV-5215, WV-5216, WV-5217, WV-5218, WV-5219, WV-5220, WV-5221, WV-5222, WV-5223, WV-5224, WV-5225, WV-5226, WV-5227, WV-5228, WV-5229, WV-5230, WV-5231, WV-5232, WV-5233, WV-5234, WV-5235, WV-5236, WV-5237, WV-5238, WV-5239, WV-�240, WV-5241, WV-5242, WV-5243, WV-5244, WV-5245, WV-5246, WV-5247, WV-5248, WV-5249, WV-5250, WV-5251, WV-5252, WV-5253, WV-5254, WV-5255, WV-5256, WV-5257, WV-5258, WV-5259, WV-5260, WV-5261, WV-5262, WV-5263, WV-5264, WV-5265, WV-5266, WV-5267, WV-5268, WV-5269, WV-5270, WV-5271, WV-5272,WV-5273, WV-5274, WV-5275, WV-5276, WV-5277, WV-5278, WV-5279, WV-5 280, WV-5281, WV-5282, WV-5283, WV-5284, WV-5285, WV-5286, WV-10107 , WV-10108, WV-10109, WV-10110, WV-10111, WV-10112, WV-10113, WV-10 114, WV-10115, WV-10116, WV-10117, WV-10118, WV-10119, WV-10120, WV -10121, WV-10122, WV-10123, WV-10124, WV-10125, WV-10126, WV-10127 , WV-10128, WV-10129, WV-10130, WV-10131, WV-10132, WV-10133, WV-10 134, WV-10135, WV-10136, WV-10137, WV-10138, WV-10139, WV-10140, WV -10141, WV-10142, WV-10143, WV-10144, WV-10145, and WV-10146. ,

[0401] In some embodiments, the present disclosure relates to a double-stranded RNAi agent comprising a strand of a single-stranded RNAi agent annealed to a second strand.In some embodiments, the present disclosure relates to a double-stranded HTT RNAi agent comprising a strand of a single-stranded HTT RNAi agent described herein annealed to a second strand.

[0402] In some embodiments, oligonucleotides, such as double-stranded or single-stranded HTT RNAi agents, comprise internucleotide linkages and / or patterns thereof, nucleobases and patterns thereof, sugars and patterns thereof, backbone chiral center patterns, and / or additional chemical moieties described herein. In some embodiments, useful structural elements, such as nucleobases, sugars, internucleotide linkages, linked phosphorus stereochemistry, 5'-end groups (e.g., phosphate and analogs / derivatives thereof), additional chemical moieties, linkers, and useful patterns and / or combinations thereof, are described in WO 2018 / 223056 and are incorporated herein by reference.

[0403] Internucleotide bond In some embodiments, HTT oligonucleotides include base modifications, sugar modifications, and / or internucleotide linkage modifications. In the present disclosure, various internucleotide linkages may be utilized to link nucleobase-containing units, e.g., nucleosides. In some embodiments, provided oligonucleotides include both one or more modified internucleotide linkages and one or more natural phosphate linkages. As is well known to those skilled in the art, natural phosphate linkages are widely found in natural DNA and RNA molecules; they have the structure -OP(O)(OH)O-, link sugars in DNA and RNA nucleosides, and can exist in various salt forms at physiological pH (about 7.4). Natural phosphate linkages are primarily -OP(O)(O - )O-. A modified internucleotide linkage, or non-natural phosphate linkage, is an internucleotide linkage that is not a natural phosphate linkage or its salt form. A modified internucleotide linkage may also be in its salt form, depending on its structure. For example, as will be understood by those skilled in the art, a phosphorothioate internucleotide linkage having the structure -OP(O)(SH)O- will be in its salt form, e.g., at physiological pH (about 7.4), -OP(O)(S - It can be in the form of various salts with the anion being )O-.

[0404] In some embodiments, the HTT oligonucleotide comprises a modified internucleotide linkage, for example, an internucleotide linkage that is phosphorothioate, phosphorodithioate, methylphosphonate, phosphoramidate, thiophosphate, 3'-thiophosphate, or 5'-thiophosphate.

[0405] In some embodiments, the modified internucleotide linkage is a chiral internucleotide linkage comprising a chiral linked phosphorus. In some embodiments, the chiral internucleotide linkage is a phosphorothioate linkage. In some embodiments, the chiral internucleotide linkage is a phosphorothioate linkage of the Rp or Sp configuration (referred to herein as Rp or Sp, respectively).* R or * (denoted as S).

[0406] In some embodiments, the chiral internucleotide linkage is a non-negatively charged internucleotide linkage. In some embodiments, the chiral internucleotide linkage is a neutral internucleotide linkage. In some embodiments, the chiral internucleotide linkage is chiral controlled with respect to its chiral linking phosphorus. In some embodiments, the chiral internucleotide linkage is stereochemically pure with respect to its chiral linking phosphorus. In some embodiments, the chiral internucleotide linkage is not chiral controlled. In some embodiments, the pattern of backbone chiral centers comprises or consists of the position of chiral controlled internucleotide linkages and linking phosphorus configurations (Rp or Sp) and the position of achiral internucleotide linkages (e.g., natural phosphate linkages).

[0407] In some embodiments, the internucleotide linkage comprises a P modification, where the P modification is a modification at the linked phosphorus. In some embodiments, the modified internucleotide linkage is a moiety that does not contain phosphorus but serves to join two moieties that independently contain two sugars or nucleobases, such as in peptide nucleic acids (PNAs).

[0408] In some embodiments, the oligonucleotide comprises a modified internucleotide linkage, e.g., one having a structure of Formula I, Formula Ia, Formula Ib, or Formula Ic, and those described herein and / or in WO 2018 / 022473, WO 2018 / 098264, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, and / or WO 2019 / 075357 (each of which internucleotide linkages (e.g., of Formula I, Formula Ia, Formula Ib, Formula Ic, etc.) are independently incorporated herein by reference).

[0409] In some embodiments, the modified internucleotide linkage is a non-negatively charged internucleotide linkage. In some embodiments, the provided oligonucleotide comprises one or more non-negatively charged internucleotide linkages. In some embodiments, the non-negatively charged internucleotide linkage is a positively charged internucleotide linkage. In some embodiments, the non-negatively charged internucleotide linkage is a neutral internucleotide linkage. In some embodiments, the present disclosure provides an oligonucleotide comprising one or more neutral internucleotide linkages. In some embodiments, the non-negatively charged internucleotide linkage is a non-negatively charged internucleotide linkage as described herein and / or in U.S. Patent No. 9,394,333, U.S. Patent No. 9,744,183, U.S. Patent No. 9,605,019, U.S. Patent No. 9,982,257, U.S. Patent Application Publication No. 20170037399, U.S. Patent Application Publication No. 20180216108, U.S. Patent Application Publication No. 20180216107, U.S. Patent No. 9,598,458, WO 2018 / ... 017 / 062862, WO 2018 / 067973, WO 2017 / 160741, WO 2017 / 192679, WO 2017 / 210647, WO 2018 / 098264, WO 2018 / 022473, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 201 and / or WO 2019 / 075357, each of which includes a non-negatively charged internucleotide linkage (e.g., Formula In-1, Formula In-2, Formula In-3, Formula In-4, Formula II, Formula II-a-1, Formula II-a-2, Formula II-b-1, Formula II-b-2, Formula II-c- In-1, Formula II-c-2, Formula II-d-1, Formula II-d-2, etc., or a suitable salt form thereof) independently have a structure of Formula In-1, Formula In-2, Formula In-3, Formula In-4, Formula II, Formula II-a-1, Formula II-a-2, Formula II-b-1, Formula II-b-2, Formula II-c-1, Formula II-c-2, Formula II-d-1, Formula II-d-2, etc., as set forth in (which are incorporated herein by reference), or a salt form thereof.

[0410] Non-limiting examples of oligonucleotides containing non-negatively charged internucleotide linkages include WV-19823, WV-19824, WV-19825, WV-19826, WV-19827, WV-19828, WV-19829, WV-19830, WV-19831, WV-19832, WV-19833, WV-19834, WV-19835, WV-19836, WV-19837, WV-19841, WV-19842, WV-19843, WV-19844, WV-19845, WV -19846, WV-19847, WV-19848, WV-19849, WV-19850, WV-19851, WV-19852, WV-19853, WV-19854, WV-16214, WV-16215, WV-16216, WV-19 844, WV-19845, WV-19846, WV-19847, WV-19848, WV-19849, WV-19850, WV-19851, WV-19852, WV-19853, WV-19854, and WV-19855.

[0411] In some embodiments, non-negatively charged internucleotide linkages can enhance the delivery and / or activity of HTT oligonucleotides (e.g., the ability to decrease the level, activity and / or expression of the HTT gene or its gene product).

[0412] In some embodiments, the modified internucleotide linkage (e.g., a non-negatively charged internucleotide linkage) comprises an optionally substituted triazolyl. In some embodiments, the modified internucleotide linkage (e.g., a non-negatively charged internucleotide linkage) comprises an optionally substituted alkynyl. In some embodiments, the modified internucleotide linkage comprises a triazole or alkyne moiety. In some embodiments, the triazole moiety, e.g., a triazolyl group, is optionally substituted. In some embodiments, the triazole moiety, e.g., a triazolyl group, is substituted. In some embodiments, the triazole moiety is unsubstituted. In some embodiments, the modified internucleotide linkage comprises an optionally substituted cyclic guanidine moiety. In some embodiments, the modified internucleotide linkage comprises an optionally substituted cyclic guanidine moiety, [ka] wherein W is O or S. In some embodiments, W is O. In some embodiments, W is S. In some embodiments, the non-negatively charged internucleotide linkage is stereochemically controlled.

[0413] In some embodiments, the non-negatively charged internucleotide linkage or the neutral internucleotide linkage is an internucleotide linkage comprising a triazole moiety. In some embodiments, the non-negatively charged internucleotide linkage or the non-negatively charged internucleotide linkage comprises an optionally substituted triazolyl group. In some embodiments, the internucleotide linkage comprising a triazole moiety (e.g., an optionally substituted triazolyl group) is [ka] In some embodiments, the internucleotide linkage comprising a triazole moiety has the structure: [ka] In some embodiments, the internucleotide linkage, e.g., a non-negatively charged internucleotide linkage, a neutral internucleotide linkage, comprises a cyclic guanidine moiety. In some embodiments, the internucleotide linkage comprising a cyclic guanidine moiety has the structure: [ka] In some embodiments, the non-negatively charged internucleotide linkage or neutral internucleotide linkage has the structure: [ka] wherein W is O or S.

[0414] In some embodiments, the internucleotide linkage is [ka] In some embodiments, the internucleotide linkage comprises a Tmg group, [ka] ("Tmg internucleotide linkage"). In some embodiments, the neutral internucleotide linkages include PNA and PMO internucleotide linkages and Tmg internucleotide linkages.

[0415] In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 3- to 20-membered heterocyclyl or heteroaryl group having 1-10 heteroatoms. In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 3- to 20-membered heterocyclyl or heteroaryl group having 1-10 heteroatoms, where at least one heteroatom is nitrogen. In some embodiments, the heterocyclyl or heteroaryl group is a 5-membered ring. In some embodiments, the heterocyclyl or heteroaryl group is a 6-membered ring.

[0416] In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 5-20-membered heteroaryl group having 1-10 heteroatoms. In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 5-20-membered heteroaryl group having 1-10 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 5-6-membered heteroaryl group having 1-4 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 5-membered heteroaryl group having 1-4 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 5-membered heteroaryl group having 1-4 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, the heteroaryl group is directly attached to the phosphorus linkage. In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted triazolyl group. In some embodiments, the non-negatively charged internucleotide linkage comprises an unsubstituted triazolyl group, e.g., [ka] In some embodiments, the non-negatively charged internucleotide linkage comprises a substituted triazolyl group, e.g., [ka] Includes.

[0417] In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 5- to 20-membered heterocyclyl group having 1 to 10 heteroatoms. In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 5- to 20-membered heterocyclyl group having 1 to 10 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 5- to 6-membered heterocyclyl group having 1 to 4 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 5-membered heterocyclyl group having 1 to 4 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, at least two heteroatoms are nitrogen. In some embodiments, the heterocyclyl group is directly attached to the phosphorus linkage. In some embodiments, the heterocyclyl group is attached to the phosphorus bond via a linker, for example, via =N- when the heterocyclyl group is part of a guanidine moiety that is directly attached to the phosphorus bond at its =N-. In some embodiments, the non-negatively charged internucleotide linkage is optionally substituted. [ka] In some embodiments, the non-negatively charged internucleotide linkage comprises a substituted [ka] In some embodiments, the non-negatively charged internucleotide linkage comprises a group: [ka] In some embodiments, each R 1 are independently optionally substituted C 1~6In some embodiments, each R 1 is independently methyl.

[0418] In some embodiments, the modified internucleotide linkage, e.g., the non-negatively charged internucleotide linkage, comprises a triazole or alkyne moiety, each of which is optionally substituted. In some embodiments, the modified internucleotide linkage comprises a triazole moiety. In some embodiments, the modified internucleotide linkage comprises an unsubstituted triazole moiety. In some embodiments, the modified internucleotide linkage comprises a substituted triazole moiety. In some embodiments, the modified internucleotide linkage comprises an alkyl moiety. In some embodiments, the modified internucleotide linkage comprises an optionally substituted alkynyl group. In some embodiments, the modified internucleotide linkage comprises an unsubstituted alkynyl group. In some embodiments, the modified internucleotide linkage comprises a substituted alkynyl group. In some embodiments, the alkynyl group is directly attached to the linking phosphorus.

[0419] In some embodiments, the HTT oligonucleotide comprises different types of internucleotide phosphorus linkages. In some embodiments, the chiral controlled oligonucleotide comprises at least one natural phosphate linkage and at least one modified (non-natural) internucleotide linkage. In some embodiments, the HTT oligonucleotide comprises at least one natural phosphate linkage and at least one phosphorothioate. In some embodiments, the HTT oligonucleotide comprises at least one non-negatively charged internucleotide linkage.

[0420] In some embodiments, the neutral or non-negatively charged internucleotide linkage is selected from the group consisting of U.S. Pat. Nos. 9,394,333, 9,744,183, 9,605,019, 9,982,257, U.S. Patent Application Publication No. 20170037399, U.S. Patent Application Publication No. 20180216108, U.S. Patent Application Publication No. 20180216107, U.S. Pat. No. 9,598,458, WO 2017 / 062862, WO 2018 / 067973, WO 2017 / 160741, WO 2017 / 192679, WO 2017 / 210647, WO 2018 / 098264, WO 2018 / 022473 ...7 / 062862, WO and / or WO 2019 / 075357,2607, WO 2019 / 032612, WO 2019 / 055951, and / or WO 2019 / 075357,2607, WO 2019 / 032612, WO 2019 / 055951, and / or WO 2019 / 075357 (each neutral or non-negatively charged internucleotide linkage in each of which is hereby incorporated by reference).

[0421] In some embodiments, the neutral internucleotide linkage has the structure of formula II-d-2. In some embodiments, each R' is independently an optionally substituted C 1~6 In some embodiments, each R' is independently an optionally substituted C 1~6 In some embodiments, each R' is independently -CH3. In some embodiments, each R s is -H.

[0422] In some embodiments, the non-negatively charged internucleotide linkage is [ka] In some embodiments, W is O. In some embodiments, W is S. In some embodiments, the neutral internucleotide linkage is a non-negatively charged internucleotide linkage as described above.

[0423] In some embodiments, provided oligonucleotides comprise one or more non-negatively charged internucleotide linkages and / or one or more internucleotide linkages of Formula I, Formula Ia, Formula Ib, Formula Ic, Formula In-1, Formula In-2, Formula In-3, Formula In-4, Formula II, Formula II-a-1, Formula II-a-2, Formula II-b-1, Formula II-b-2, Formula II-c-1, Formula II-c-2, Formula II-d-1, or Formula II-d-2.

[0424] In some embodiments, the HTT oligonucleotides comprise neutral internucleotide linkages and chiral-controlled internucleotide linkages. In some embodiments, the HTT oligonucleotides comprise neutral internucleotide linkages and chiral-controlled internucleotide linkages that are not neutral internucleotide linkages. In some embodiments, the HTT oligonucleotides comprise neutral internucleotide linkages and chiral-controlled phosphorothioate internucleotide linkages.

[0425] Without wishing to be bound by any particular theory, the present disclosure notes that neutral internucleotide linkages can be more hydrophobic than phosphorothioate internucleotide linkages (PS), which can be more hydrophobic than natural phosphate linkages (PO). Typically, unlike PS or PO, neutral internucleotide linkages carry a low charge. Without wishing to be bound by any particular theory, the present disclosure notes that incorporation of one or more neutral internucleotide linkages into an HTT oligonucleotide can increase the ability of the oligonucleotide to be taken up by cells and / or escape from endosomes. Without wishing to be bound by any particular theory, the present disclosure notes that incorporation of one or more neutral internucleotide linkages can be used to modulate the melting temperature of a duplex formed between an HTT oligonucleotide and its target nucleic acid.

[0426] Without wishing to be bound by any particular theory, the present disclosure notes that incorporating one or more non-negatively charged internucleotide linkages, e.g., neutral internucleotide linkages, into an HTT oligonucleotide may increase the ability of the oligonucleotide to mediate a function such as gene knockdown. In some embodiments, an HTT oligonucleotide, e.g., an HTT oligonucleotide capable of mediating knockdown of the level of a nucleic acid or a product encoded thereby, comprises one or more non-negatively charged internucleotide linkages. In some embodiments, an HTT oligonucleotide, e.g., an HTT oligonucleotide capable of mediating knockdown of the expression of an HTT gene, comprises one or more non-negatively charged internucleotide linkages.

[0427] In some embodiments, a typical linkage as found in natural DNA and RNA is one in which an internucleotide linkage forms bonds between two sugars (which may be unmodified or modified as described herein). In many embodiments, as exemplified herein, the internucleotide linkage forms a bond at its oxygen atom with one optionally modified ribose or deoxyribose at its 5' carbon and a bond at its 3' carbon with another optionally modified ribose or deoxyribose. In some embodiments, each nucleoside unit linked by an internucleotide linkage independently comprises a nucleobase that is optionally substituted A, T, C, G, or U, or a substituted tautomer of A, T, C, G, or U.

[0428] In some embodiments, the HTT oligonucleotide comprises an internucleotide linkage in which the negatively charged non-bridging oxygen of the canonical phosphodiester bond is replaced by an uncharged alkyl substituent, such as a methyl (Met) group or an ethyl (Et) group, as in P-alkylphosphonate nucleic acids (phNAs), such as P-methyl or P-ethyl phNAs. See, for example, Micklefield et al. 2001 Curr. Med. Chem. 8, 1157-1179; and Arangundy-Franklin et al. 2019 Nat. Chem. 11, 533-542.

[0429] In some embodiments, the HTT oligonucleotide is a phosphonomethyl-threosyl nucleic acid (tPhoNA) and / or contains a phosphonomethyl-threosyl internucleotide linkage. Liu et al. 2018 J. Am. Chem. Soc. 140, 6690-6699.

[0430] As one of skill in the art will appreciate, the present disclosure contemplates many other types of internucleotide linkages, e.g., U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,177,195; 5,023,243; 5,034,506; 5,166,315; 5,185,444; 5,188,897; 5,214,134; 5,216,141; 5,235,033; 5,264,423; 5,264,564; 5,276,019; 5,278,897. ,302;No.5,286,717;No.5,321,131;No.5,399,676;No.5,405,938;No.5, 405,939; 5,434,257; 5,453,496; 5,455,233; 5,466,677; No. 5,466,677; No. 5,470,967; No. 5,476,925; No. 5,489,677; No. 5,519,126 No. 5,536,821; No. 5,541,307; No. 5,541,316; No. 5,550,111; No. 5,561,2 No. 25; No. 5,563,253; No. 5,571,799; No. 5,587,361; No. 5,596,086; No. 5,60 No. 2,240; No. 5,608,046; No. 5,610,289; No. 5,618,704; No. 5,623,070; No. 5 , 625,050; 5,633,360; 5,64,562; 5,663,312; 5,677,437; No. 5,677,439; No. 6,160,109; No. 6,239,265; No. 6,028,188; No. 6,124,445 ;6,169,170;6,172,209;6,277,603;6,326,199;6,346,614;6,444,423;6,531,590;6,534,639;6,608,035;6,683,167;6,858,715;6,867,294;6,878,805;7,015,315;7,041,816;7,273,933;7,321,029; or those described in RE39464 may be used.In some embodiments, the modified internucleotide linkages are those described in U.S. Patent No. 9,982,257, U.S. Patent Application Publication No. 20170037399, U.S. Patent Application Publication No. 20180216108, WO 2017192664, WO 2017015575, WO 2017062862, WO 2018067973, WO 2017160741, WO 201719267 9, WO 2017210647, WO 2018098264, PCT / US18 / 35687, PCT / US18 / 38835, or PCT / US18 / 51398 (the nucleobases, sugars, internucleotide linkages, chiral auxiliaries / reagents, and oligonucleotide synthesis techniques (reagents, conditions, cycles, etc.) of each of which are independently incorporated herein by reference).

[0431] In some embodiments, each internucleotide linkage in the HTT oligonucleotide is independently selected from a natural phosphate linkage, a phosphorothioate linkage, and a non-negatively charged internucleotide linkage (e.g., n001). In some embodiments, each internucleotide linkage in the HTT oligonucleotide is independently selected from a natural phosphate linkage, a phosphorothioate linkage, and a neutral internucleotide linkage (e.g., n001).

[0432] In some embodiments, the HTT oligonucleotide comprises one or more nucleotides that independently comprise phosphorus modifications that tend to "self-release" under certain conditions. That is, certain phosphorus modifications are designed so that under certain conditions, they self-cleave from the oligonucleotide, for example, to provide a native phosphate bond. For specific examples of such phosphorus-modifying groups, see U.S. Pat. No. 9,982,257. In some embodiments, the self-releasing group comprises a morpholino group. In some embodiments, the self-releasing group is characterized by its ability to deliver a drug to the internucleotide linker, where the drug promotes further modification of the phosphorus atom, for example, desulfurization. In some embodiments, the drug is water, and the further modification is the formation of a native phosphate bond by hydrolysis.

[0433] In some embodiments, the HTT oligonucleotide comprises one or more internucleotide bonds, which improve one or more pharmaceutical properties and / or activity of the oligonucleotide.It is well documented in the art that some oligonucleotides are easily degraded by nucleases and exhibit poor cellular uptake through the cytoplasmic membrane (Poijarvi-Virta et al., Curr. Med. Chem. (2006), 13(28);3441-65;Wagner et al., Med. Res. Rev. (2000), 20(6):417-51;Peyrottes et al., Mini Rev. Med. Chem. (2004), 4(4):395-408;Gosselin et al., (1996), 43(1):196-208;Bologna et al., (2002), Antisense & Nucleic Acid Drug Development 12:33-41). Vives et al. (Nucleic Acids Research (1999), 27(20):4071-76) reported that tert-butyl SATE prooligonucleotides exhibited significantly increased cell permeability compared to the parent oligonucleotide under certain conditions.

[0434] In some embodiments, the present disclosure demonstrates that, at least in some cases, Sp internucleotide linkages, particularly at the 5' and / or 3' ends, can improve oligonucleotide stability. In some embodiments, the present disclosure demonstrates that, inter alia, natural phosphate linkages and / or Rp internucleotide linkages can improve oligonucleotide clearance from a system. As one of skill in the art will appreciate, various assays known in the art can be used to assess such properties according to the present disclosure.

[0435] Various internucleotide linkages may be utilized in combination with other structural elements, such as sugars, to achieve desired oligonucleotide properties and / or activity. For example, the present disclosure routinely utilizes modified internucleotide linkages and modified sugars, optionally along with natural phosphate linkages and natural sugars, in oligonucleotide design. In some embodiments, the present disclosure provides HTT oligonucleotides comprising one or more modified sugars.

[0436] In some embodiments, the present disclosure provides HTT oligonucleotides comprising one or more modified sugars and one or more modified internucleotide linkages, one or more of which may be chiral controlled.

[0437] In some embodiments, chiral controlled internucleotide linkages can occur in specific patterns in HTT oligonucleotides, which can affect one or more activities and / or properties of the oligonucleotide.

[0438] HTT Oligonucleotide Composition and Stereochemistry In particular, the present disclosure provides various HTT oligonucleotide compositions.In some embodiments, the present disclosure provides the oligonucleotide composition of the oligonucleotide described herein.In some embodiments, the HTT oligonucleotide composition, for example, the HTT oligonucleotide composition, comprises a plurality of HTT oligonucleotides described in the present disclosure.In some embodiments, the HTT oligonucleotide composition, for example, the HTT oligonucleotide composition, is chiral controlled.In some embodiments, the HTT oligonucleotide composition, for example, the HTT oligonucleotide composition, is not chiral controlled (sterically random).

[0439] The linking phosphorus of a natural phosphate linkage is achiral. The linking phosphorus of many modified internucleotide linkages, such as phosphorothioate internucleotide linkages, is chiral. In some embodiments, during the preparation of oligonucleotide compositions (e.g., in conventional phosphoramidite oligonucleotide synthesis), the configuration of the chiral linking phosphorus is not intentionally designed or controlled, resulting in chiral-uncontrolled (sterically random) oligonucleotide compositions (substantially racemic preparations) that are random complex mixtures of various stereoisomers (diastereoisomers) - for oligonucleotides with n chiral internucleotide linkages (the linking phosphorus is chiral), typically 2 n (For example, when n is 10, 2 10 = 1,032; when n is 20, 2 20 These stereoisomers have the same chemical constitution but differ in terms of the stereochemical pattern of their bound phosphorus.

[0440] In some embodiments, sterically random oligonucleotide compositions have properties and / or activities that are sufficient for a particular purpose and / or application, and in some embodiments, sterically random oligonucleotide compositions may be cheaper, easier, and / or simpler to produce than chirally controlled oligonucleotide compositions.

[0441] However, in some embodiments, stereoisomers in a stereorandomized composition may have different properties, activities, and / or toxicities, which may result in inconsistent therapeutic effects and / or unintended side effects from the stereorandomized composition, particularly when compared to certain chiral controlled oligonucleotide compositions of oligonucleotides of the same chemical makeup.

[0442] In some embodiments, the present disclosure encompasses techniques for the design and preparation of chiral-controlled HTT oligonucleotide compositions. In some embodiments, the present disclosure provides chiral-controlled oligonucleotide compositions, e.g., a number of oligonucleotides containing S and / or R in their stereochemistry / linkages in Table 1. In some embodiments, the chiral-controlled oligonucleotide compositions comprise a controlled / predetermined (not random, as in a stereo-random composition) level of multiple oligonucleotides, where these oligonucleotides share the same bond phosphorus stereochemistry at one or more chiral internucleotide linkages (chiral-controlled internucleotide linkages). In some embodiments, the oligonucleotides share the same backbone chiral center pattern (bond phosphorus stereochemistry). In some embodiments, the backbone chiral center pattern is as described in this disclosure. In some embodiments, the oligonucleotides are structurally identical.

[0443] In some embodiments, the diastereomeric purity level of multiple oligonucleotides in a composition can be determined as the product of the diastereomeric purity of each chiral internucleotide bond in the oligonucleotide. In some embodiments, the diastereomeric purity of the internucleotide bond linking two nucleosides in an HTT oligonucleotide (or nucleic acid) is represented by the diastereomeric purity of the internucleotide bond of a dimer linking the same two nucleosides, where the dimer is prepared under equivalent conditions, in some cases, the same synthetic cycle conditions.

[0444] In some embodiments, all of the chiral internucleotide linkages are chiral controlled, and the composition is a fully chiral controlled oligonucleotide composition. In some embodiments, not all of the chiral internucleotide linkages are chiral controlled internucleotide linkages, and the composition is a partially chiral controlled oligonucleotide composition.

[0445] Oligonucleotides can contain or consist of various backbone chiral center patterns (stereochemical patterns of chiral bonded phosphorus). Specific useful backbone chiral center patterns are described in the present disclosure. In some embodiments, multiple oligonucleotides share a common backbone chiral center pattern, which is or includes a pattern described in the present disclosure (e.g., "Bound phosphorus stereochemistry and its patterns," the backbone chiral center patterns of chiral-controlled oligonucleotides in Table 1, etc.).

[0446] In some embodiments, a chiral controlled oligonucleotide composition is a chirally pure (or stereochemically pure) oligonucleotide composition, wherein the oligonucleotide composition comprises a plurality of oligonucleotides, wherein the oligonucleotides are identical (including each chiral element of the oligonucleotide, including each chiral linker phosphorus, is independently defined (stereically defined)), and the composition is free of other stereoisomers. A chirally pure (or stereochemically pure) oligonucleotide composition of an HTT oligonucleotide stereoisomer is free of other stereoisomers (as one of skill in the art will understand, one or more unintended stereoisomers may be present as impurities—exemplary purities are described in this disclosure).

[0447] Chirality-controlled oligonucleotide compositions can demonstrate several advantages over stereorandom oligonucleotide compositions. In particular, chirality-controlled oligonucleotide compositions are more uniform in terms of oligonucleotide structure than corresponding stereorandom oligonucleotide compositions. Stereochemistry control allows for the preparation and evaluation of individual stereoisomers, thereby enabling the development of stereoisomeric chirality-controlled oligonucleotide compositions with desired properties and / or activity. In some embodiments, chirality-controlled oligonucleotide compositions provide, for example, better delivery, stability, clearance, activity, selectivity, and / or toxicity profiles compared to corresponding stereorandom oligonucleotide compositions. In some embodiments, chirality-controlled oligonucleotide compositions provide better efficacy, fewer side effects, and / or more convenient and effective dosage regimens. In particular, the backbone chiral center patterns as described herein can be utilized to provide controlled cleavage of oligonucleotide targets (e.g., transcripts such as pre-mRNA and mature mRNA; control of cleavage sites, rate and / or extent of cleavage at cleavage sites, and / or overall rate and extent of cleavage, etc.) and significantly increased HTT target selectivity.

[0448] In some embodiments, HTT oligonucleotide compositions comprise one or more sterically controlled (chirally controlled; in some embodiments, sterically pure) internucleotide linkages and one or more sterically random internucleotide linkages. In some embodiments, HTT oligonucleotide compositions comprise one or more sterically controlled (chirally controlled; in some embodiments, sterically pure) internucleotide linkages and one or more sterically random internucleotide linkages.

[0449] In some embodiments, HTT oligonucleotide compositions contain one or more stereo-controlled (e.g., chiral or stereo-pure) internucleotide linkages and one or more stereo-random internucleotide linkages. Such oligonucleotides can target a variety of targets, have a variety of base sequences, and be capable of functioning through one or more of a variety of modalities (e.g., RNase H mechanisms, steric hindrance, double- or single-stranded RNA interference, exon skipping regulation, CRISPR, aptamers, etc.).

[0450] Non-limiting examples of sterically random oligonucleotide compositions, e.g., sterically random HTT oligonucleotide compositions, include, but are not limited to, WV-1027, WV-1028, WV-1029, WV-1030, WV-1031, WV-1032, WV-1033, WV-1034, WV-1035, WV-1036, WV-1037, WV-1038, WV-1039, WV-1040, WV-1041, WV-1042, WV-1043, WV-1044, WV-1045, WV-1046, WV-1047, WV-1048, WV-10 49, WV-1050, WV-1051, WV-1052, WV-1053, WV-1054, WV-1055, WV-1056, WV- 1057, WV-1058, WV-1059, WV-1060, WV-1061, WV-1062, WV-1063, WV-1064, W V-1065, WV-1066, WV-1067, WV-1068, WV-1069, WV-1070, WV-1071, WV-1072 , WV-2023, WV-2024, WV-2025, WV-2026, WV-2027, WV-2028, WV-2029, WV-203 0, WV-2031, WV-2032, WV-2033, WV-2034, WV-2035, WV-2036, WV-2037, WV-2 038, WV-2039, WV-2040, WV-2041, WV-2042, WV-2043, WV-2044, WV-2045, WV -2046, WV-2047, WV-2048, WV-2049, WV-2050, WV-2051, WV-2052, WV-2053, WV-2054, WV-2055, WV-2056, WV-2057, WV-2058, WV-2059, WV-2060, WV-2061 , WV-2062, WV-2063, WV-2064, WV-2065, WV-2066, WV-2067, WV-2068, WV-20 69, WV-2070, WV-2071, WV-2072, WV-2073, WV-2074, WV-2075, WV-2076, WV- 2077, WV-2078, WV-2079, WV-2080, WV-2081, WV-2082, WV-2083, WV-2084, W V-2085, WV-2086, WV-2087, WV-2088, WV-2089, WV-2090, WV-2605, WV-2606,WV-2607, WV-2608, WV-2609, WV-2610, WV-2611, WV-2612, WV-2613, WV-2614, WV-2615, WV-2616, WV-2617, WV-2618, WV-2619, WV-2620, WV-13625, WV-13626, WV-13627, WV-13628, WV-13629, WV-13630, WV-13631, WV-13632, WV-13633, WV-13634, WV-13635, WV-13646, WV-13647, WV-13648, WV-13649, WV-13650, WV-13651, WV-13652, WV-13653, WV-13654, WV-13655, WV-13656, and WV-13667 are described herein.,

[0451] Non-limiting examples of stereochemically pure (or chiral controlled) oligonucleotide compositions, e.g., stereochemically pure (or chiral controlled) HTT oligonucleotide compositions, include, but are not limited to, WV-2269, WV-2270, WV-2271, WV-2272, WV-2374, WV-2375, WV-2380, WV-2416, WV-2417, WV-2418, WV-2419, WV-2431, WV-2589, WV-2590, WV-2591, WV-2592, WV-2593, WV-2594, WV-2595, WV-2596, WV-2597, WV-2598, WV-2599, WV-2600, WV-2601, WV-2602, WV-2603, WV-260 4, WV-2659, WV-2671, WV-2672, WV-2673, WV-2674, WV-2675, WV-2676, WV-2 682, WV-2683, WV-2684, WV-2685, WV-2686, WV-2687, WV-2688, WV-2689, WV -2690, WV-2691, WV-2692, WV-2732, WV-13952, WV-13953, WV-13954, WV-13 955, WV-13956, WV-13957, WV-13958, WV-13959, WV-13960, WV-13961, WV-1 3962, WV-14059, WV-14060, WV-14061, WV-14062, WV-14063, WV-14064, WV- 14065, WV-14066, WV-14067, WV-14068, WV-14069, WV-14070, WV-14071, WV -14072, WV-14073, WV-14074, WV-14075, WV-14076, WV-14077, WV-14078, W WV-14079, WV-14080, WV-14081, WV-14082, WV-14083, WV-14084, WV-14085, WV-14086, WV-14092, WV-14093, WV-14094, WV-14095, WV-14096, WV-14097, WV-14098, WV-14099, WV-14100, WV-14101, WV-14133, WV-14134, WV-14135, WV-14136, WV-14137, WV-14138, WV-14139, and WV-14140.

[0452] Non-limiting examples of oligonucleotide compositions, e.g., HTT oligonucleotide compositions, comprising one or more stereo-controlled (e.g., chiral-controlled or stereo-pure) internucleotide linkages and one or more stereo-random internucleotide linkages include, but are not limited to, WV-13636, WV-13637, WV-13638, WV-13639, WV-13640, WV-13641, WV-13642, WV-13643, WV-13644, WV-13645, WV-13657, WV-13658, WV-13659, WV-13660, WV-13661, WV-13662, WV-13663, WV-13664, WV-13665, and WV-13666.

[0453] In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions, e.g., chirality-controlled HTT oligonucleotide compositions. In some embodiments, the provided chirality-controlled oligonucleotide compositions comprise multiple HTT oligonucleotides of the same chemical constitution and have one or more internucleotide linkages. In some embodiments, for example, the multiple oligonucleotides in the chirality-controlled oligonucleotide composition are multiple HTT oligonucleotides selected from Table 1, wherein the oligonucleotides comprise at least one Rp or Sp-linked phosphorus in the chirality-controlled internucleotide linkage. In some embodiments, for example, the multiple oligonucleotides in the chirality-controlled oligonucleotide composition are multiple HTT oligonucleotides selected from Table 1, wherein each phosphorothioate internucleotide linkage in the oligonucleotide is independently chirality-controlled (each phosphorothioate internucleotide linkage is independently Rp or Sp). In some embodiments, the HTT oligonucleotide compositions, e.g., HTT oligonucleotide compositions, are substantially pure preparations of a single oligonucleotide, in that any oligonucleotides present in the composition that are not the single oligonucleotide are impurities from the preparation process of the single oligonucleotide, optionally after certain purification procedures. In some embodiments, the single oligonucleotide is an HTT oligonucleotide of Table 1, wherein each chiral internucleotide linkage of the oligonucleotide is chiral controlled (e.g., designated S or R rather than X in "Stereochemistry / Linkage").

[0454] In some embodiments, chirality-controlled oligonucleotide compositions may exhibit increased activity and / or stability, increased delivery, and / or decreased ability to cause adverse effects such as complement or TLR9 activation, etc., compared to corresponding sterically random oligonucleotide compositions. In some embodiments, sterically random (non-chirality-controlled) oligonucleotide compositions differ from chirality-controlled oligonucleotide compositions in that the corresponding plurality of oligonucleotides do not contain any chirality-controlled internucleotide linkages, but the sterically random oligonucleotide compositions are otherwise identical to the chirality-controlled oligonucleotide compositions.

[0455] In some embodiments, the present disclosure relates to chiral controlled HTT oligonucleotide compositions that have the ability to decrease the level, activity or expression of the HTT gene or its gene product.

[0456] In some embodiments, the present disclosure provides chirality-controlled HTT oligonucleotide compositions comprising a plurality of oligonucleotides that have the ability to reduce the level, activity, or expression of the HTT gene or its gene product, and that share a common base sequence that is, comprises, or comprises a span (e.g., at least 10 or 15 contiguous bases) of a base sequence disclosed herein (e.g., in Table 1, where each T may be independently replaced by U, or vice versa). In some embodiments, the present disclosure provides chirality-controlled HTT oligonucleotide compositions comprising a plurality of oligonucleotides that have the ability to reduce the level, activity, or expression of the HTT gene or its gene product, and that share a common base sequence that is, comprises, or comprises a span (e.g., at least 10 or 15 contiguous bases) of a base sequence disclosed herein (e.g., in Table 1, where each T may be independently replaced by U, or vice versa). In some embodiments, the present disclosure provides chirality-controlled HTT oligonucleotide compositions comprising a plurality of oligonucleotides that have the ability to reduce the level, activity, or expression of the HTT gene or its gene product, and that share a common base sequence that is, comprises, or comprises a base sequence disclosed herein (e.g., in Table 1, where each T may be independently replaced by U, or vice versa).

[0457] In some embodiments, the chiral controlled oligonucleotide compositions provided are chiral controlled HTT oligonucleotide compositions comprising a plurality of HTT oligonucleotides. In some embodiments, the chiral controlled oligonucleotide compositions are chirally pure (or "stereochemically pure") oligonucleotide compositions. In some embodiments, the present disclosure provides chirally pure oligonucleotide compositions of the HTT oligonucleotides in Table 1, wherein each chiral internucleotide linkage of the oligonucleotide is independently chiral controlled (Rp or Sp can be determined, for example, from being R or S, rather than X, in "stereochemistry / bonding"). As one skilled in the art will understand, it is rare, if not impossible, for chemical selectivity to be perfect (absolute 100%). In some embodiments, a chirally pure oligonucleotide composition comprises a plurality of oligonucleotides, wherein the oligonucleotides in the plurality are structurally identical and all have the same structure (the same stereoisomeric form; in the context of an oligonucleotide, typically the same diastereomeric form, since HTT oligonucleotides typically have multiple chiral centers), and the chirally pure oligonucleotide composition does not include any other stereoisomers (in the context of an oligonucleotide, typically diastereomers, since HTT oligonucleotides typically have multiple chiral centers; e.g., to the extent achievable by stereoselective preparation). As one of skill in the art will appreciate, a stereochemically random (or "racemic," "non-chiral controlled") oligonucleotide composition will contain many stereoisomers (e.g., 2 n diastereoisomers (where n is the number of chiral linking phosphorus for oligonucleotides in which other chiral centers (e.g., sugar carbon chiral centers) are chiral controlled and each independently exist in one configuration, and only the chiral linking phosphorus center is not chiral controlled).

[0458] Specific data demonstrating that chiral controlled oligonucleotide compositions, e.g., chiral controlled HTT oligonucleotide compositions, have properties and / or activity in reducing the level, activity and / or expression of the HTT gene or its gene product are presented, for example, in the Examples section of this document.

[0459] In some embodiments, the present disclosure provides an HTT oligonucleotide composition comprising an oligonucleotide comprising at least one chiral linking phosphorus.In some embodiments, the present disclosure provides an HTT oligonucleotide composition comprising an HTT oligonucleotide comprising at least one chiral linking phosphorus.In some embodiments, the present disclosure provides an HTT oligonucleotide composition wherein the HTT oligonucleotide comprises a chiral-controlled phosphorothioate internucleotide linkage, wherein the linking phosphorus has an Rp configuration.In some embodiments, the present disclosure provides an HTT oligonucleotide composition wherein the HTT oligonucleotide comprises a chiral-controlled phosphorothioate internucleotide linkage, wherein the linking phosphorus has an Sp configuration.

[0460] In some embodiments, the provided chiral-controlled oligonucleotide compositions (e.g., chiral-controlled HTT oligonucleotide compositions) are surprisingly effective when compared to a reference oligonucleotide composition. In some embodiments, the desired biological effect (e.g., as measured by reduced levels of mRNA, protein, etc., targeted for reduction) can be enhanced by more than 5, 10, 15, 20, 25, 30, 40, 50, or 100-fold (e.g., as measured by remaining levels of mRNA, protein, etc.). In some embodiments, the change is measured by a decrease in undesired mRNA levels compared to a reference condition. In some embodiments, the change is measured by an increase in desired mRNA levels compared to a reference condition. In some embodiments, the change is measured by a decrease in undesired mRNA levels compared to a reference condition. In some embodiments, the reference condition is, for example, the absence of treatment with the chiral-controlled oligonucleotide composition. In some embodiments, the reference condition is a corresponding stereo-random composition of oligonucleotides having the same chemical makeup.

[0461] In some embodiments, the present disclosure provides chiral controlled oligonucleotide compositions, e.g., chiral controlled HTT oligonucleotide compositions, wherein the linking phosphorus of at least one chiral controlled internucleotide linkage is Sp. In some embodiments, the present disclosure provides chiral controlled oligonucleotide compositions, e.g., chiral controlled HTT oligonucleotide compositions, wherein the linking phosphorus of the majority of chiral controlled internucleotide linkages is Sp. In some embodiments, about 50% to 100%, 55% to 100%, 60% to 100%, 65% to 100%, 70% to 100%, 75% to 100%, 80% to 100%, 85% to 100%, 90% to 100%, 55% to 95%, 60% to 95%, 65% to 95%, or about 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or more of all chiral-controlled internucleotide linkages (or of all chiral internucleotide linkages, or of all internucleotide linkages) are Sp. In some embodiments, the present disclosure provides chiral-controlled oligonucleotide compositions, e.g., chiral-controlled HTT oligonucleotide compositions, wherein a majority of the chiral internucleotide linkages are chiral-controlled and the linking phosphorus thereof is Sp. In some embodiments, the present disclosure provides chiral controlled oligonucleotide compositions, e.g., chiral controlled HTT oligonucleotide compositions, wherein each chiral internucleotide linkage is chiral controlled and each chiral binding phosphorus is Sp. In some embodiments, the present disclosure provides chiral controlled oligonucleotide compositions, e.g., chiral controlled HTT oligonucleotide compositions, wherein at least one chiral controlled internucleotide linkage has an Rp binding phosphorus. In some embodiments, the present disclosure provides chiral controlled oligonucleotide compositions, e.g., chiral controlled HTT oligonucleotide compositions, wherein at least one chiral controlled internucleotide linkage includes an Rp binding phosphorus and at least one chiral controlled internucleotide linkage includes an Sp binding phosphorus.

[0462] In some embodiments, the present disclosure provides chiral controlled oligonucleotide compositions, wherein at least two chiral controlled internucleotide linkages have different linkage phosphorus stereochemistry and / or different P modifications, where the P modifications are modifications of the linkage phosphorus. In some embodiments, the present disclosure provides chiral controlled oligonucleotide compositions, wherein at least two chiral controlled internucleotide linkages have different stereochemistry from each other, and the pattern of backbone chiral centers of the oligonucleotide is characterized by a repeating pattern of alternating stereochemistry.

[0463] In certain embodiments, the present disclosure provides a chiral controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein within each of the oligonucleotides, at least two individual internucleotide linkages have different P modifications from each other. In certain embodiments, the present disclosure provides a chiral controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein within each of the oligonucleotides, at least two individual internucleotide linkages have different P modifications from each other, and each of the oligonucleotides comprises a natural phosphate linkage. In certain embodiments, the present disclosure provides a chiral controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein within each of the oligonucleotides, at least two individual internucleotide linkages have different P modifications from each other, and each of the oligonucleotides comprises a phosphorothioate internucleotide linkage. In certain embodiments, the present disclosure provides a chiral controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein within each of the oligonucleotides, at least two individual internucleotide linkages have different P modifications from each other, and each of the oligonucleotides comprises a natural phosphate linkage and a phosphorothioate internucleotide linkage. In certain embodiments, the present disclosure provides chiral controlled oligonucleotide compositions comprising a plurality of oligonucleotides, wherein within each of the oligonucleotides at least two distinct internucleotide linkages have a P modification that differs from one another, and each of the oligonucleotides comprises a phosphorothioate triester internucleotide linkage. In certain embodiments, the present disclosure provides chiral controlled oligonucleotide compositions comprising a plurality of oligonucleotides, wherein within each of the oligonucleotides at least two distinct internucleotide linkages have a P modification that differs from one another, and each of the oligonucleotides comprises a natural phosphate linkage and a phosphorothioate triester internucleotide linkage.In certain embodiments, the present disclosure provides chiral controlled oligonucleotide compositions comprising a plurality of oligonucleotides, wherein within each of the oligonucleotides, at least two individual internucleotide linkages have P modifications that differ from each other, and each of the oligonucleotides comprises a phosphorothioate internucleotide linkage and a phosphorothioate triester internucleotide linkage.

[0464] In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions, e.g., chirality-controlled HTT oligonucleotide compositions, comprising multiple oligonucleotides sharing a common base sequence that is the base sequence of an HTT oligonucleotide disclosed herein, wherein at least one internucleotide linkage is chirality-controlled.

[0465] Stereochemistry and patterns of skeletal chiral centers In contrast to natural phosphate linkages, the linking phosphorus of chiral modified internucleotide linkages, e.g., phosphorothioate internucleotide linkages, is chiral. In particular, the present disclosure provides technologies (e.g., oligonucleotides, compositions, methods, etc.) that involve controlling the stereochemistry of the chiral linking phosphorus in a chiral internucleotide linkage. In some embodiments, as demonstrated herein, controlling the stereochemistry can result in improved properties and / or activity, including desired stability, reduced toxicity, improved HTT nucleic acid reduction, etc. In some embodiments, the present disclosure provides backbone chiral center patterns useful in oligonucleotides and / or regions thereof, which are combinations of, from 5' to 3', the stereochemistry (Rp or Sp) of each chiral linking phosphorus in the chiral linking phosphorus, the designation of each achiral linking phosphorus (Op, if present), etc. In some embodiments, the backbone chiral center pattern can control the cleavage pattern of an HTT nucleic acid when contacted with a provided oligonucleotide or composition thereof in a cleavage system (e.g., in vitro assay, cell, tissue, organ, organism, subject, etc.). In some embodiments, the pattern of backbone chiral centers improves the efficiency and / or selectivity of cleavage of an HTT nucleic acid when contacted with an oligonucleotide or composition thereof provided in a cleavage system.

[0466] In some embodiments, the HTT oligonucleotide (or wings, core, blocks, or any portion thereof) is selected from the group consisting of those disclosed in WO 2017015555; WO 2017192664; WO 201200366; WO 2011 / 034072; WO 2014 / 010718; WO 2015 / 108046; WO 2016 / 010901; WO 2015 / 010901; WO 2015 / 010902; WO 2015 / 010903; WO 2015 / 010904; WO 2015 / 010905; WO 2015 / 010906; WO 2015 / 010907; WO 2015 / 010908; WO 2015 / 0109 ... Publication No. 2015 / 108047; International Publication No. 2015 / 108048; International Publication No. 2011 / 005761; International Publication No. 2011 / 108682; International Publication No. 2012 / 039448; International Publication No. 2018 / 067973; International Publication No. 2005 / 028494; International Publication No. 2005 / 092909; International Publication No. 2010 / 064146 No.;WO 2012 / 073857;WO 2013 / 012758;WO 2014 / 010250;WO 2014 / 012081;WO 2015 / 107425;WO 2017 / 015555;WO 2017 / 015575;WO 2017 / 062862;WO 2017 / 16 0741; WO 2017 / 192664; WO 2017 / 192679; WO 2017 / 210647; WO 2018 / 022473; or WO 2018 / 098264 (these chiral center patterns are incorporated by reference).

[0467] In some embodiments, the oligonucleotides in the chiral controlled oligonucleotide composition each comprise at least two internucleotide linkages that have different stereochemistry and / or different P modifications from each other. In some embodiments, at least two internucleotide linkages have different stereochemistry from each other, and the oligonucleotides each comprise a backbone chiral center pattern that includes alternating bond phosphorus stereochemistry.

[0468] In some embodiments, the phosphorothioate triester linkage contains a chiral auxiliary, which is used, for example, to control the stereoselectivity of reactions, such as coupling reactions, in the HTT oligonucleotide synthesis cycle. In some embodiments, the phosphorothioate triester linkage does not contain a chiral auxiliary. In some embodiments, the phosphorothioate triester linkage is intentionally maintained until and / or during administration of the oligonucleotide composition to a subject.

[0469] In some embodiments, the oligonucleotide is attached to a solid support. In some embodiments, the solid support is a support for oligonucleotide synthesis. In some embodiments, the solid support comprises glass. In some embodiments, the solid support is controlled pore glass (CPG). In some embodiments, the solid support is a polymer. In some embodiments, the solid support is polystyrene. In some embodiments, the solid support is high cross-linked polystyrene (HCP). In some embodiments, the solid support is a hybrid support of controlled pore glass (CPG) and high cross-linked polystyrene (HCP). In some embodiments, the solid support is a metal foam. In some embodiments, the solid support is a resin. In some embodiments, the oligonucleotide is cleaved from the solid support.

[0470] In some embodiments, the purity, particularly the stereochemical purity, and particularly the diastereomeric purity, of many oligonucleotides and compositions thereof in which all other chiral centers in the oligonucleotide except for the chiral linking phosphorus center are stereodefined (e.g., a carbon chiral center in the sugar, which is defined, for example, in a phosphoramidite for oligonucleotide synthesis) can be controlled by the stereoselectivity at the chiral linking phosphorus (as those skilled in the art will understand, diastereoselectivity is often the case in oligonucleotide synthesis where the oligonucleotide contains more than one chiral center) during the coupling step when forming the chiral internucleotide bond. In some embodiments, the coupling step has 60% stereoselectivity at the linking phosphorus (or diastereoselectivity if other chiral centers are present). After such a coupling step, the new internucleotide bond formed can be said to have 60% stereochemical purity (typically diastereomeric purity for oligonucleotides, taking into account the presence of other chiral centers). In some embodiments, each coupling step independently has at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% stereoselectivity, hi some embodiments, each coupling step independently has essentially 100% stereoselectivity.

[0471] In some embodiments, the coupling step has virtually 100% stereoselectivity, in that each detectable product from the coupling step, analyzed by analytical methods (e.g., NMR, HPLC, etc.), has the intended stereoselectivity. In some embodiments, the chiral-controlled internucleotide linkage is typically formed with at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99.5%, or virtually 100% (in some embodiments, at least 90%; in some embodiments, at least 95%; in some embodiments, at least 96%; in some embodiments, at least 97%; in some embodiments, at least 98%; in some embodiments, at least 99%) stereoselectivity. In some embodiments, each chiral controlled internucleotide linkage independently has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99.5% or virtually 100% (in some embodiments, at least 90%; in some embodiments, at least 95%; in some embodiments, at least 96%; in some embodiments, at least 97%; in some embodiments, at least 98%; in some embodiments, at least 99%) stereochemical purity (typically diastereomeric purity for oligonucleotides with multiple chiral centers) at its chiral linkage phosphorus.

[0472] In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 couplings of monomers (which, as one of skill in the art will appreciate, in many embodiments are phosphoramidites for oligonucleotide synthesis) independently have a stereoselectivity (for oligonucleotide synthesis, typically diastereoselectivity about one or more of the linked phosphorus chiral centers formed) of less than about 60%, 70%, 80%, 85%, or 90%.

[0473] In some embodiments, the stereochemical purity, eg, diastereomeric purity, is about 60% to 100%.

[0474] In some embodiments, compounds of the present disclosure (e.g., oligonucleotides, chiral auxiliaries, etc.) contain multiple chiral elements (e.g., multiple carbon and / or phosphorus (e.g., the linking phosphorus of a chiral internucleotide linkage) chiral centers). In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or more chiral elements of a provided compound (e.g., an HTT oligonucleotide) each independently have a diastereomeric purity as described herein.

[0475] As one of skill in the art will appreciate, in some embodiments, the diastereoselectivity of coupling or the diastereomeric purity of the chiral linked phosphorus center can be assessed by the diastereoselectivity of dimer formation or the diastereomeric purity of a dimer prepared under the same or equivalent conditions, where the dimer has the same 5′- and 3′-nucleoside and internucleotide linkages.

[0476] A variety of techniques are available for identifying or confirming the stereochemistry of chiral elements (e.g., the configuration of chiral bond phosphorus) and / or backbone chiral center patterns, and / or assessing the stereoselectivity (e.g., the diastereoselectivity of a coupling step in an oligonucleotide synthesis) and / or stereochemical purity (e.g., the diastereomeric purity of an internucleotide bond, a compound (e.g., an oligonucleotide), etc.). Exemplary techniques include NMR [e.g., 1D (one-dimensional) and / or 2D (two-dimensional) 1 H- 31These include P HETCOR (heteronuclear correlation spectroscopy), HPLC, RP-HPLC, mass spectrometry, LC-MS, and cleavage of internucleotide bonds by stereospecific nucleases, which can be utilized individually or in combination. Useful exemplary nucleases include benzonase, micrococcal nuclease, and svPDE (snake venom phosphodiesterase), which are specific for particular internucleotide linkages having an Rp-binding phosphorus (e.g., an Rp phosphorothioate linkage); and nuclease P1, mung bean nuclease, and nuclease S1, which are specific for internucleotide linkages having an Sp-binding phosphorus (e.g., an Sp phosphorothioate linkage). While not wishing to be bound by any particular theory, the present disclosure notes that, at least in some cases, cleavage of oligonucleotides by certain nucleases can be influenced by structural elements, such as chemical modifications (e.g., 2'-modifications of the sugar), base sequence, or stereochemical context. For example, in some cases it was observed that benzonase and micrococcal nuclease, which are specific for internucleotide linkages with Rp-binding phosphorus, were unable to cleave an isolated Rp phosphorothioate internucleotide linkage flanked by an Sp phosphorothioate internucleotide linkage.

[0477] In some embodiments, multiple HTT oligonucleotides share the same chemical structure. In some embodiments, multiple HTT oligonucleotides are identical (same stereoisomer). In some embodiments, chiral controlled oligonucleotide compositions, such as chiral controlled HTT oligonucleotide compositions, are stereochemically pure oligonucleotide compositions in which multiple oligonucleotides are identical (same stereoisomer), and this composition does not contain any other stereoisomers. Those skilled in the art will understand that because processing, selection, purification, etc., do not achieve perfection, one or more other stereoisomers may exist as impurities.

[0478] In some embodiments, the provided compositions are characterized in that, when contacted with an HTT nucleic acid (e.g., an HTT transcript (e.g., a pre-mRNA, mature mRNA, other type of RNA, etc. that hybridizes to an oligonucleotide of the composition), the level of the HTT nucleic acid and / or the product (e.g., protein) encoded thereby is reduced compared to that observed under reference conditions. In some embodiments, the reference condition is selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof. In some embodiments, the reference condition is the absence of the composition. In some embodiments, the reference condition is the presence of a reference composition. In some embodiments, the reference composition is a composition in which the oligonucleotide does not hybridize to an HTT nucleic acid. In some embodiments, the reference composition is a composition in which the oligonucleotide does not contain a sequence sufficiently complementary to an HTT nucleic acid. In some embodiments, the provided compositions are chirality-controlled oligonucleotide compositions, and the reference composition is an otherwise identical but non-chirality-controlled oligonucleotide composition (e.g., a racemic preparation of oligonucleotides of the same chemical makeup as the oligonucleotides (e.g., multiple ones, of a particular oligonucleotide type, etc.) in the chirality-controlled oligonucleotide composition).

[0479] As noted above and understood in the art, in some embodiments, the base sequence of an HTT oligonucleotide may refer to the identity and / or modification state of the nucleoside residues in the oligonucleotide (e.g., of the sugar and / or base moieties, as compared to standard naturally occurring nucleotides such as adenine, cytosine, guanosine, thymine, and uracil), and / or the hybridization properties of such residues (i.e., their ability to hybridize with specific complementary residues).

[0480] As demonstrated herein, oligonucleotide structural elements (e.g., patterns of sugar modifications, backbone linkages, backbone chiral centers, backbone phosphorus modifications, etc.) and combinations thereof can unexpectedly result in improved properties and / or biological activity.

[0481] In some embodiments, the oligonucleotide compositions have the ability to reduce the expression, level, and / or activity of the HTT gene or its gene product. In some embodiments, the oligonucleotide compositions have the ability to reduce the expression, level, and / or activity of the HTT gene or its gene product by sterically blocking translation through cleavage of the HTT mRNA (e.g., pre-mRNA or mature mRNA) after annealing to the HTT mRNA. In some embodiments, the provided HTT oligonucleotide compositions have the ability to reduce the expression, level, and / or activity of the HTT gene or its gene product. In some embodiments, the provided HTT oligonucleotide compositions have the ability to reduce the expression, level, and / or activity of the HTT gene or its gene product after annealing to the HTT mRNA by sterically blocking translation through cleavage of the HTT mRNA (pre-mRNA or mature mRNA) and / or by altering or interfering with mRNA splicing.

[0482] In some embodiments, the HTT oligonucleotide composition, e.g., the HTT oligonucleotide composition, is a substantially pure preparation of a single oligonucleotide stereoisomer, e.g., an HTT oligonucleotide stereoisomer, in that any oligonucleotides present in the composition that are not that oligonucleotide stereoisomer are impurities from the preparation process of the oligonucleotide stereoisomer, optionally after certain purification procedures.

[0483] In some embodiments, the present disclosure provides chiral-controlled, and in some embodiments, stereochemically pure, oligonucleotides and oligonucleotide compositions. For example, in some embodiments, the provided compositions contain one or more individual oligonucleotide types at non-random or controlled levels. In some embodiments, oligonucleotides of the same oligonucleotide type are identical.

[0484] sugar The present disclosure makes use of a variety of sugars, including modified sugars. In some embodiments, the present disclosure provides sugar modifications and patterns thereof, optionally in combination with other structural elements (e.g., internucleotide linkage modifications and patterns thereof, patterns of backbone chiral centers thereof, etc.) that, when incorporated into an oligonucleotide, may confer improved properties and / or activity.

[0485] The most common naturally occurring nucleosides comprise a ribose sugar (e.g., in RNA) or a deoxyribose sugar (e.g., in DNA) linked to the nucleobases adenosine (A), cytosine (C), guanine (G), thymine (T), or uracil (U). In some embodiments, the sugars, e.g., the various sugars in many of the oligonucleotides in Table 1 (unless otherwise noted), are naturally occurring DNA sugars (those found in DNA nucleic acids or oligonucleotides, having the structure [ka] wherein the nucleobase is attached at the 1' position, and the 3' and 5' positions are linked by an internucleotide bond (as will be understood by those skilled in the art, if at the 5' end of the HTT oligonucleotide, the 5' position can be linked to a 5'-terminal group (e.g., -OH), and if at the 3' end of the HTT oligonucleotide, the 3' position can be linked to a 3'-terminal group (e.g., -OH). In some embodiments, the sugar is a natural RNA sugar (as found in an RNA nucleic acid or oligonucleotide, having the structure [ka] wherein the nucleobase is attached at the 1' position and the 3' and 5' positions are linked by an internucleotide bond (as one of skill in the art will understand, if at the 5' end of the HTT oligonucleotide, the 5' position can be linked to a 5'-terminal group (e.g., -OH), and if at the 3' end of the HTT oligonucleotide, the 3' position can be linked to a 3'-terminal group (e.g., -OH). In some embodiments, the sugar is a modified sugar in that it is not a natural DNA or RNA sugar. Among other things, modified sugars can provide improved stability. In some embodiments, modified sugars can be utilized to alter and / or optimize one or more hybridization properties. In some embodiments, modified sugars can be utilized to alter and / or optimize HTT nucleic acid recognition. In some embodiments, modified sugars can be utilized to optimize Tm. In some embodiments, modified sugars can be utilized to improve oligonucleotide activity.

[0486] The sugar can be linked to the internucleotide linkage at various positions. By way of non-limiting example, the internucleotide linkage can be at the 2', 3', 4', or 5' position of the sugar. In some embodiments, as most commonly found in naturally occurring nucleic acids, the internucleotide linkage connects one sugar at the 5' position and another sugar at the 3' position.

[0487] In some embodiments, the sugar is a naturally occurring DNA or RNA sugar, optionally substituted. In some embodiments, the substituents, sugars, modified sugars and / or sugar modifications are selected from the group consisting of those disclosed in U.S. Patent Nos. 9,394,333, 9,744,183, 9,605,019, 9,982,257, U.S. Patent Application Publication No. 20170037399, U.S. Patent Application Publication No. 20180216108, U.S. Patent Application Publication No. 20180216107, U.S. Patent No. 9,598,458, WO 2017 / 062862, WO 2018 / 067973, WO 2017 / 160741, WO 2017 / 192679, WO 2017

[0023] In Table 1, various such sugars are utilized.

[0488] In some embodiments, the sugar is a bicyclic sugar. In some embodiments, the sugar is selected from an LNA sugar, a BNA sugar, a cEt sugar, and the like.

[0489] In some embodiments, the sugar is a 2'-OMe, 2'-MOE, 2'-F, LNA (locked nucleic acid), ENA (ethylene-bridged nucleic acid), BNA(NMe) (methylamino-bridged nucleic acid), 2'-F ANA (2'-F arabinose), α-DNA (α-D-ribose), 2' / 5' ODN (e.g., a 2' / 5' linked oligonucleotide), Inv (an inverted sugar, e.g., an inverted deoxyribose), AmR (amino ribose), ThioR (thioribose), HNA (hexose nucleic acid), CeNA (cyclohexene nucleic acid), or MOR (morpholino) sugar.

[0490] In some embodiments, provided oligonucleotides comprise one or more modified sugars. In some embodiments, provided oligonucleotides comprise one or more modified sugars and one or more natural sugars.

[0491] Examples of bicyclic sugars include α-L-methyleneoxy (4'-CH2-O-2') LNA, β-D-methyleneoxy (4'-CH2-O-2') LNA, ethyleneoxy (4'-(CH2)2-O-2') LNA, aminooxy (4'-CH2-ON(R)-2') LNA, and oxyamino (4'-CH2-N(R)-O-2') LNA. In some embodiments, the bicyclic sugar, e.g., an LNA or BNA sugar, is a sugar having at least one bridge between the two sugar carbons. In some embodiments, the bicyclic sugar in a nucleoside can have an α-L-ribofuranose or β-D-ribofuranose stereochemical configuration. In some embodiments, the sugar is a sugar described in WO 1999014226. In some embodiments, a 4'-2' bicyclic sugar or a 4'→2' bicyclic sugar is a bicyclic sugar comprising a furanose ring containing a bridge connecting the 2' and 4' carbon atoms of the sugar ring. In some embodiments, a bicyclic sugar, e.g., an LNA or BNA sugar, comprises at least one bridge between the two pentofuranosyl sugar carbons. In some embodiments, an LNA or BNA sugar comprises at least one bridge between the 4' and 2' pentofuranosyl sugar carbons.

[0492] In some embodiments, the bicyclic sugar may be further defined by its isomeric configuration.

[0493] Certain modified sugars (e.g., bicyclic sugars with a 4'→2' bridging group, such as 4'-CH2-O-2' and 4'-CH2-S-2'), their preparation, and / or use have been described, for example, in Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; WO 1999014226. 2'-Amino-BNAs, which may potentially confer conformational constraints and high affinity, have been described, for example, in Singh et al., J. Org. Chem., 1998, 63, 10035-10039. In addition, the thermal stability of 2'-amino- and 2'-methylamino-BNA sugars and their duplexes with complementary RNA and DNA strands has been previously reported.

[0494] In some embodiments, the sugar is a bicyclic sugar having a hydrocarbon bridge, e.g., a 4'-(CH)-2' bridge, a 4'-CH=CH-CH-2' bridge, etc. (e.g., Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443; Albaek et al., J. Org. Chem., 2006, 71, 7731-7740, etc.). Exemplary preparations of such bicyclic sugars and nucleosides, along with their oligomerization and biochemical studies, are reported, for example, in Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379.

[0495] In some embodiments, the bicyclic sugar is selected from the group consisting of α-L-methyleneoxy (4'-CH2-O-2') BNA, β-D-methyleneoxy (4'-CH2-O-2') BNA, ethyleneoxy (4'-(CH2)2-O-2') BNA, aminooxy (4'-CH2-ON(R)-2') BNA, oxyamino (4'-CH2-N(R)-O-2') BNA, methyl (methylene oxy)(4'-CH(CH3)-O-2') BNA (also called constrained ethyl or cEt), methylenethio (4'-CH2-S-2') BNA, methyleneamino (4'-CH2-N(R)-2') BNA, methyl carbocyclic (4'-CH2-CH(CH3)-2') BNA, propylene carbocyclic (4'-(CH2)3-2') BNA, or vinyl BNA sugar.

[0496] In some embodiments, the sugar modification is a modification described in U.S. Patent No. 9,006,198. In some embodiments, the modified sugar is a modification described in U.S. Patent No. 9,006,198. In some embodiments, the sugar modification is a modification described in U.S. Patent No. 9,394,333, U.S. Patent No. 9,744,183, U.S. Patent No. 9,605,019, U.S. Patent No. 9,982,257, U.S. Patent Application Publication No. 20170037399, U.S. Patent Application Publication No. 20180216108, U.S. Patent Application Publication No. 20180216107, U.S. Patent No. 9,598,458, WO 2017 / 062862, WO 2018 / 067973, WO 2017 / 160741, WO 2017 / 192679, WO 2017 / 210 647, WO 2018 / 098264, WO 2018 / 022473, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 032612, WO 2019 / 055951, and / or WO 2019 / 075357 (each of which sugar modifications and modified sugars are independently incorporated herein by reference).

[0497] In some embodiments, the modified sugars are those disclosed in U.S. Patent Nos. 5,658,873, 5,118,800, 5,393,878, 5,514,785, 5,627,053, 7,034,133; 7,084,125, 7,399,845, 5,319,080, 5,591,722, 5,597,909, 5,466,786, 6,268,490, 6,525,191, 5,519,134, 5,576,427, 6,794,499, 6,998,484, 7,053,207, 4,981,957, 5,359,044, Nos. 6,770,748, 7,427,672, 5,446,137, 6,670,461, 7,569,686, 7,741,457, 8,022,193, 8,030,467, 8,278,425, 5,610,300, 5,646,265, 8,278,426, 5,567,811, 5,700,920, 8,278,283, 5,639,873, 5,670,633, 8,314,227, U.S. Patent Application Publication No. 2008 / 0039618, or U.S. Patent Application Publication No. 2009 / 0012281.

[0498] In some embodiments, the sugar modification is 2'-OMe, 2'-MOE, 2'-LNA, 2'-F, 5'-vinyl, or S-cEt. In some embodiments, the modified sugar is an FRNA, FANA, or morpholino sugar. In some embodiments, t...

Claims

1. An oligonucleotide comprising mG*SmUn001RmUmGn001RmA*ST*SC*ST*SG*ST*RA*SG*SC*SA*SG*Rm5Ceon001RAeoGeon001Rm5Ceo*STeo, or a salt thereof; m is 2'-OMe; eo is 2'-MOE (2'-OCH ２ CH ２ OCH ３ ) and m5 is a methyl at the 5 position of C (the nucleobase is 5-methylcytosine); m5Ceo is 5-methyl 2'-O-methoxyethyl C n001 is, 【Chemistry 1】 and *R indicates a single phosphorothioate bond in the Rp conformation; *S indicates a single phosphorothioate bond in the Sp conformation; n001R is n001 in the Rp conformation; Oligonucleotides.

2. An oligonucleotide comprising mG*SmUn001RmU*SmGmA*ST*SC*ST*SG*ST*RA*SG*SC*SA*SG*Rm5Ceon001RAeoGeon001Rm5Ceo*STeo, or a salt thereof; m is 2'-OMe; eo is 2'-MOE (2'-OCH ２ CH ２ OCH ３ ) and m5 is a methyl at the 5 position of C (the nucleobase is 5-methylcytosine); m5Ceo is 5-methyl 2'-O-methoxyethyl C n001 is, 【Chemistry 2】 and *R indicates a single phosphorothioate bond in the Rp conformation; *S indicates a single phosphorothioate bond in the Sp conformation; n001R is n001 in the Rp conformation; Oligonucleotides.

3. An oligonucleotide comprising mG*SmUn001RmU*SmGn001RmA*ST*SC*ST*SG*ST*RA*SG*SC*SA*SG*Rm5Ceon001RAeoGeon001Rm5Ceo*STeo, or a salt thereof; m is 2'-OMe; eo is 2'-MOE (2'-OCH ２ CH ２ OCH ３ ) and m5 is a methyl at the 5 position of C (the nucleobase is 5-methylcytosine); m5Ceo is 5-methyl 2'-O-methoxyethyl C n001 is, 【Chemistry 3】 and *R indicates a single phosphorothioate bond in the Rp conformation; *S indicates a single phosphorothioate bond in the Sp conformation; n001R is n001 in the Rp conformation; Oligonucleotides.

4. An oligonucleotide comprising mG*SmUn001RmUmGn001RmA*ST*SC*ST*SG*ST*RA*SG*SC*SA*SG*Rm5CeoAeoGeon001Rm5Ceo*STeo or a salt thereof; m is 2'-OMe; eo is 2'-MOE (2'-OCH2CH2OCH3), m5 is a methyl at the 5 position of C (the nucleobase is 5-methylcytosine); m5Ceo is 5-methyl 2'-O-methoxyethyl C n001 is, 【Chemistry 4】 and *R indicates a single phosphorothioate bond in the Rp conformation; *S indicates a single phosphorothioate bond in the Sp conformation; n001R is n001 in the Rp conformation; Oligonucleotides.

5. The oligonucleotide according to any one of claims 1 to 4, in the form of a pharma- ceutically acceptable salt.

6. The oligonucleotide of any one of claims 1 to 5, in the form of a sodium salt.

7. The oligonucleotide of any one of claims 1 to 6, which is at least 50% diastereomeric pure.

8. A chiral controlled oligonucleotide composition of the oligonucleotide according to any one of claims 1 to 7.

9. The composition of claim 8, wherein each chiral bonded phosphorus independently has a diastereomeric purity of at least 95%.

10. 9. The composition of claim 8, wherein at least 50% of the oligonucleotides in the composition that share the same base sequence GUUGATCTGTAGCAGCAGCT are each independently the oligonucleotide of claim 1.

11. 9. The composition of claim 8, wherein at least 50% of the oligonucleotides in the composition that share the same base sequence GUUGATCTGTAGCAGCAGCT are each independently the oligonucleotide of claim 2.

12. 9. The composition of claim 8, wherein at least 50% of the oligonucleotides in the composition that share the same base sequence GUUGATCTGTAGCAGCAGCT are each independently the oligonucleotide of claim 3.

13. The composition of claim 8, wherein at least 50% of the oligonucleotides in the composition that share the same base sequence GUUGATCTGTAGCAGCAGCT are each independently an oligonucleotide as described in claim 4.

14. A pharmaceutical composition comprising a therapeutically effective amount of an oligonucleotide and a pharma- ceutically acceptable inactive ingredient, said oligonucleotide being an oligonucleotide according to any one of claims 1 to 7.

15. A pharmaceutical composition comprising a therapeutically effective amount of an oligonucleotide and a pharma- ceutically acceptable buffer, wherein the oligonucleotide is an oligonucleotide according to any one of claims 1 to 7.

16. The composition of claim 14, wherein each chiral bonded phosphorus independently has a diastereomeric purity of at least 95%.

17. 15. The composition of claim 14, wherein at least 50% of the oligonucleotides in the composition that share the same base sequence GUUGATCTGTAGCAGCAGCT are each independently the oligonucleotide of claim 1.

18. 15. The composition of claim 14, wherein at least 50% of the oligonucleotides in the composition that share the same base sequence GUUGATCTGTAGCAGCAGCT are each independently the oligonucleotide of claim 2.

19. 15. The composition of claim 14, wherein at least 50% of the oligonucleotides in the composition that share the same base sequence GUUGATCTGTAGCAGCAGCT are each independently the oligonucleotide of claim 3.

20. The composition of claim 14, wherein at least 50% of the oligonucleotides in the composition that share the same base sequence GUUGATCTGTAGCAGCAGCT are each independently an oligonucleotide as described in claim 4.

21. The composition of any one of claims 8 to 20, wherein the oligonucleotide is in the form of a pharma- ceutically acceptable salt.

22. The composition of any one of claims 8 to 20, wherein the oligonucleotide is in sodium salt form.

23. A pharmaceutical composition for treating Huntington's disease in a subject, comprising an oligonucleotide according to any one of claims 1 to 7 or a composition according to any one of claims 8 to 22, The subject expresses an HTT nucleic acid having an A at SNP rs362273 position and containing 36 or more CAG repeats. Pharmaceutical compositions.

24. A pharmaceutical composition for use in the prevention of Huntington's disease in a subject, comprising an oligonucleotide according to any one of claims 1 to 7 or a composition according to any one of claims 8 to 22, The subject expresses an HTT nucleic acid containing an A at SNP rs362273 position and 36 or more CAG repeats. Pharmaceutical compositions.

25. A pharmaceutical composition for delaying the onset of Huntington's disease in a subject, comprising an oligonucleotide according to any one of claims 1 to 7 or a composition according to any one of claims 8 to 22, The subject expresses an HTT nucleic acid containing an A at SNP rs362273 position and 36 or more CAG repeats. Pharmaceutical compositions.

26. A pharmaceutical composition for reducing the severity of at least one symptom of Huntington's disease in a subject, comprising an oligonucleotide according to any one of claims 1 to 7 or a composition according to any one of claims 8 to 22, The subject expresses an HTT nucleic acid containing an A at SNP rs362273 position and 36 or more CAG repeats. Pharmaceutical compositions.

27. The pharmaceutical composition according to any one of claims 23 to 26, wherein the oligonucleotide is an oligonucleotide according to claim 1, or the composition is a composition according to claim 10 or 17.

28. The pharmaceutical composition according to any one of claims 23 to 26, wherein the oligonucleotide is an oligonucleotide according to claim 2, or the composition is a composition according to claim 11 or 18.

29. The pharmaceutical composition according to any one of claims 23 to 26, wherein the oligonucleotide or composition is an oligonucleotide according to claim 3, or the composition is a composition according to claim 12 or 19.

30. A pharmaceutical composition described in any one of claims 23 to 26, wherein the oligonucleotide or composition is an oligonucleotide described in claim 4, or the composition is a composition described in claim 13 or 20.

31. 30. The pharmaceutical composition of any one of claims 23 to 29, wherein the subject expresses an HTT nucleic acid in which SNP rs362273 position is G and which contains up to 35 CAG repeats.

Images