Methods and materials for cloning functional T cell receptors from single T cells

Abstract

Methods and materials are provided for cloning functional TCRs from single T cells. [Solution] Methods and materials for obtaining nucleic acid encoding a TCR from a single T cell and arranging the nucleic acid to form a nucleic acid vector successfully designed to express a TCR, kits for obtaining nucleic acid encoding a TCR from a single T cell and arranging the nucleic acid to form a nucleic acid vector successfully designed to express a TCR, methods for making such kits, collections of nucleic acid primers designed to amplify the entire coding sequence of both variable regions for each expressed V-segment of a functional αβ or γδ TCR of a particular mammalian species, methods for cloning a functional TCR from a single T cell using such a collection of nucleic acid primers, and kits containing such a collection of nucleic acid primers for cloning a functional TCR from a single T cell are provided.

Description

[Technical field]

[0001] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with Government support under Grant AR044077 awarded by the National Institutes of Health. The Government has certain rights in this invention.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Application No. 62 / 427,335, filed November 29, 2016. The disclosure of the prior application is considered part of the disclosure of this application and is incorporated herein in its entirety.

[0003] background 1.Technical Field This document relates to methods and materials involved in cloning a functional T cell receptor (TCR) from a single T cell. For example, this document relates to methods and materials involved in obtaining nucleic acid encoding a TCR from a single T cell using an efficient and streamlined combination of amplification steps, cloning steps, and reagents, and arranging that nucleic acid to form a nucleic acid vector successfully designed to express a TCR (e.g., a fully intact TCR) with the variable chain combination (e.g., an α / β variable chain combination or a γ / δ variable chain combination) present in that single T cell. [Background technology]

[0004] 2.Background The TCR is found on the surface of T cells and contains two distinct polypeptide chains. In humans, about 95 percent of T cells have a TCR that contains an alpha (α) chain and a beta (β) chain, and about 5 percent of T cells have a TCR that contains a gamma (γ) chain and a delta (δ) chain. Such T cells can be referred to as αβ or γδ T cells, respectively.

[0005] Each chain (e.g., α, β, γ, and δ chains) comprises a variable (V) region and a constant (C) region. The V region of the α chain is formed from the recombination of the V and J segments of the α gene. Similarly, the V region of the γ chain is formed from the recombination of the V and J segments of the γ gene. However, the V region of the β chain is formed from the recombination of the V, D, and J segments of the β gene, and the V region of the δ chain is formed from the recombination of the V, D, and J segments of the δ gene. Thus, there are several factors that contribute to the tremendous variability observed in mammalian (e.g., human) T cell repertoires. For example, the specificity of one particular αβTCR is determined, among other things, by (a) the particular combination of VJ segments of the α chain, (b) the particular combination of VDJ segments of the β chain, and (c) the particular pairing of those two chains (the α chain and the β chain) that together form that particular αβTCR. In addition, the joining of VJ and VDJ exons to coding sequences is a particularly imprecise process, with nucleotides being lost from the ends of the gene segments and additional bases being added (Matsuzaki et al., Eur. J. Immunol., 23(12):3345-9 (1993); Cabaniols et al., J. Exp. Med., 194(9):1385-1390 (1991)). Summary of the Invention

[0006] This document provides methods and materials involved in cloning a functional TCR from a single T cell. For example, this document provides methods and materials for obtaining nucleic acid encoding a TCR from a single T cell and arranging the nucleic acid to form a nucleic acid vector successfully designed to express a TCR (e.g., a fully intact TCR, e.g., a fully intact TCR with the combination of variable chains present in the single T cell), kits for obtaining nucleic acid encoding a TCR from a single T cell and arranging the nucleic acid to form a nucleic acid vector successfully designed to express a TCR (e.g., a fully intact TCR, e.g., a fully intact TCR with the combination of variable chains present in the single T cell), and methods for making such kits. The cloned αβTCR with the combination of variable chains present in the single T cell used to clone the TCR can include the combination of VJα segments present in the single T cell, the combination of VDJβ segments present in the single T cell, the nucleotide sequence of the entire α variable region present in the single T cell, and the nucleotide sequence of the entire β variable region present in the single T cell. Similarly, a cloned γδ TCR having a combination of variable chains present in a single T cell used to clone the TCR may comprise the combination of VJγ segments present in that single T cell, the combination of VDJδ segments present in that single T cell, the nucleotide sequence of the entire gamma variable region present in that single T cell, and the nucleotide sequence of the entire δ variable region present in that single T cell.

[0007] This document also provides a collection of nucleic acid primers designed to amplify the entire coding sequence of both variable regions (e.g., α and β variable regions, or γ and δ variable regions) for each expressed V segment (e.g., each expressed α and β V segment, or each expressed γ and δ V segment) for a functional αβ or γδ TCR of a particular mammalian species (e.g., mouse or human), methods for cloning functional TCRs from single T cells using such a collection of nucleic acid primers, and kits containing such a collection of nucleic acid primers for cloning functional TCRs from single T cells.

[0008] In general, the methods and materials provided herein can enable one to perform highly multiplexed reactions to clone many different TCRs (e.g., hundreds to thousands or more different TCRs) directly from a single T cell, rapidly (e.g., in some cases simultaneously) and in a manner that misses few, if any, α / β variable chain combinations (or γ / δ variable chain combinations). For example, the methods and materials provided herein can be practiced to clone many different αβTCRs (e.g., hundreds to thousands or more different αβTCRs) directly from a single αβT-cell in a manner that misses less than 10 percent (e.g., less than 9 percent, less than 8 percent, less than 7 percent, less than 6 percent, less than 5 percent, less than 4 percent, less than 3 percent, less than 2 percent, or less than 1 percent) of the α variable chains and less than 10 percent (e.g., less than 9 percent, less than 8 percent, less than 7 percent, less than 6 percent, less than 5 percent, less than 4 percent, less than 3 percent, less than 2 percent, or less than 1 percent) of the possible α / β variable chain combinations of a species (e.g., a mouse or human species). Similarly, the methods and materials provided herein can be practiced to clone many different γδ TCRs (e.g., hundreds to thousands or more different γδ TCRs) directly from a single γδ T cell in a manner that misses less than 10 percent (e.g., less than 9 percent, less than 8 percent, less than 7 percent, less than 6 percent, less than 5 percent, less than 4 percent, less than 3 percent, less than 2 percent, or less than 1 percent) of the possible γ variable chains and less than 10 percent (e.g., less than 9 percent, less than 8 percent, less than 7 percent, less than 6 percent, less than 5 percent, less than 4 percent, less than 3 percent, less than 2 percent, or less than 1 percent) of the possible γ / δ variable chain combinations of a species (e.g., mouse or human species). In some cases, the methods and materials provided herein include (a) obtaining a sample of T cells, (b) sorting those T cells into isolated locations (e.g., wells) such that most, if not all, of the isolated locations (e.g., each well) contain a single T cell, (c) sorting the T cells into separate isolated locations (e.g.,(d) performing (e.g., simultaneously) reverse transcription using the released RNA as a template, appropriate primers for cDNA synthesis from the RNA, and a reverse transcriptase to produce cDNA within each isolated location (e.g., each well), the cDNA representing the RNA expressed by the single T cell that was located in that isolated location (e.g., well); (e) performing (e.g., simultaneously) a first round amplification reaction (e.g., a first round polymerase chain reaction (PCR)) of a nested amplification method (e.g., nested PCR method) using a first round primer collection (e.g., a first round PCR primer collection) and a polymerase (e.g., Taq polymerase) for each isolated location, using the produced cDNA as a template, to generate an amplification product containing a nucleic acid sequence of the α variable chain (or γ variable chain) of the TCR of the single T cell in the isolated location. (f) for each isolated location, performing (e.g., simultaneously) a second round of amplification reactions (e.g., second round of PCR) using a second round of primer collection (e.g., a second round of PCR primer collection) and a polymerase (e.g., Taq polymerase) as a template, to produce at least a first amplification product containing the nucleic acid sequence of the α variable chain (or γ variable chain) of the TCR of the single T cell at the isolated location, and a second amplification product containing the nucleic acid sequence of the β variable chain (or δ variable chain) of the TCR of the same single T cell at the isolated location; and (g) for each isolated location, filtering the first and second amplification products by combining the α / β or γ / δ variable chain combinations (or portions thereof, e.g.,This may include cloning the V segments of the α / β or γ / δ variable chain combinations into an expression vector designed to express a functional TCR.

[0009] The resulting expression vector can be introduced into cells such that those cells express the cloned TCR. Such cells and / or the TCRs they express from the expression vectors into which they have been introduced can be screened to identify TCRs with the desired capabilities. For example, cells expressing a cloned TCR that recognizes a particular antigen (e.g., a peptide derived from a tumor polypeptide) can be identified, and those cells, the TCR expression vectors they contain, or the cloned TCR constructs can be used for further analysis or for therapeutic applications.

[0010] In some cases, expression on the surface of the cloned TCR and expression of a functional TCR can be assessed by introducing an expression vector provided herein into a TCR-negative reporter cell designed to express a measurable marker signal or marker polypeptide upon engagement of the signaling machinery of the functional TCR. In these cases, an antibody designed to non-specifically activate the TCR (e.g., an anti-CD3 antibody) can be used to screen for functional TCRs. In some cases, the cloned TCRs provided herein can be screened for antigen specificity. For example, reporter cells expressing the cloned TCRs can be screened for recognition of a particular antigen (e.g., a peptide derived from a tumor polypeptide). In some cases, primary T cells (e.g., human primary T cells) can be transfected with an expression vector provided herein and screened for antigen specificity via a T cell proliferation assay.

[0011] The methods and materials provided herein can enable clinicians, health care workers, laboratory personnel, and researchers to use a collection of T cells with different TCRs to generate a collection of expression vectors expressing functional versions of those different TCRs with the same variable chain combinations or portions thereof (e.g., the same α / β variable chain combination or the same γ / δ variable chain combination) present in the original T cells used to generate the collection. Such a collection of expression vectors can be obtained quickly, efficiently, inexpensively, and effectively. For example, in some cases, the methods and materials provided herein can be used to generate a collection of expression vectors expressing functional versions of many different TCRs with authentic variable chain combinations found in T cells obtained from a mammal (e.g., human) in less than 12 days (e.g., 4-11 days, 5-11 days, 6-11 days, 7-11 days, 8-11 days, 4-10 days, 5-10 days, 6-10 days, 7-10 days, 8-11 days, 8-11 days, 8-10 days, 8-10 days, 9-10 days, 10 ... , 8-10 days, 4-9 days, 5-9 days, 6-9 days, 7-9 days, 4-8 days, 5-8 days, 6-8 days, or 7-8 days), using fewer than 12 steps (e.g., 5-11 steps, 6-11 steps, 7-11 steps, 8-11 steps, 5-10 steps, 6-10 steps, 7-10 steps, 8-10 steps, 5-9 steps, 6-9 steps, 7-9 steps, or 8-9 steps), for less than about $10 per TCR, and with greater than about 80 percent (e.g., greater than about 85, 90, or 95 percent) efficiency. In some cases, the methods and materials provided herein can be performed without performing nucleic acid sequencing, without performing a restriction enzyme cleavage step, without performing other steps or techniques described herein, and / or without using certain reagents or materials described herein.

[0012] The methods and materials provided herein can also allow the user to successfully capture most, but not all, functional TCRs from a sorted T cell population. For example, in some cases, the methods and materials provided herein can include a nested amplification method (e.g., nested PCR method) that includes a primer collection designed to amplify all known functional V segments of the two variable chains of a particular TCR of a mammal (e.g., human) (e.g., any of the known functional V segments of the alpha and beta variable chains of a particular alpha beta TCR, or any of the known functional V segments of the gamma and delta variable chains of a particular gamma delta TCR). Having the ability to clone most, but not all, functional TCRs from a sorted T cell population can allow the user to identify specific TCRs, including rare TCRs, that may otherwise be missed. It is these rare TCRs that may be missed that can provide a rich source of new cloned TCRs for effective therapies, such as cancer therapies, including the delivery of effective T cells.

[0013] In some cases, the methods and materials provided herein may allow the user to obtain further information about the single T cells from which functional TCR clones are generated. In some cases, the flow cytometry techniques used for single cell sorting described herein may be used to distinguish activated and experienced cells from naive T cells by staining them for activation markers. When applying the methods and materials provided herein in methods for treating certain diseases (e.g., cancer), T cells that have already been activated and expanded within the patient may be isolated from the patient. Once these T cells are isolated and cDNA is generated from single cell RNA, further levels of selection may be applied. For example, in addition to using cDNA produced from the RNA of a single T cell to amplify and clone the variable chain (or a portion thereof) of the TCR of that T cell, the cDNA may also be used to evaluate RNA expression and / or RNA expression levels within that T cell.

[0014] CD8 + In the case of T cells, TCRs associated with polyfunctional (e.g., multiple cytokine-producing) effector cells or TCRs associated with resting or exhausted long-lived memory cells can be identified by examining relative mRNA levels for expression of transcription factors such as eomesodermin and T-bet (McLane et al., J. Immunol., 190(7):3207-3215 (2013); and Buggert et al., PLoS Pathog., 10(7):e1004251 (2014)).

[0015] In some cases, T cells can be stimulated (e.g., stimulated in vitro) prior to sorting, and then RNA expression can be assessed (e.g., via qPCR) to determine which T cells responded to the stimulation. Any suitable type of stimulation can be used, including, but not limited to, non-specific stimulation, such as with concanavalin A, phytohemagglutinin P, phorbol ester + ionomycin, phorbol myristate acetate + calcium ionophore, or an antibody capable of cross-linking the TCR (e.g., anti-CD3 antibody + anti-CD28 antibody, or anti-TCRβ antibody), or antigen-specific stimulation, such as with one or more specific antigens described elsewhere (Downward et al., Nature, 346:719-23 (1990); and Dasgupta et al., Proc. Natl. Acad. Sci. USA, 84:1094-8 (1987)). In some cases, cytokine expression levels, such as TNF-α, IFN-γ, IL-2, IL-4, IL-5, IL-10, IL-13, or IL-17 expression levels, can be determined and compared to unstimulated populations. Once single T cells have been sorted, the methods provided herein can be used to determine which T cells were making specific cytokines in response to stimulation (e.g., in response to the peptide antigen used to stimulate the T cells). In these cases, antigen-specific T cells can be determined without the laborious method of expanding reactive T cells or the destructive method of paraformaldehyde fixation and intracellular cytokine staining, which may reduce the ability to effectively clone TCRs. In such cases, specific TCRs generated from active, antigen-specific T cells, as opposed to inactive bystanders, can be rapidly identified.

[0016] In some cases, cytokine expression levels, e.g., TNF-α, IFN-γ, IL-2, IL-4, IL-5, IL-10, IL-13, or IL-17 expression levels, can be determined for a single T cell used to clone a functional TCR, thereby allowing a particular TCR to be identified based on the particular phenotype (e.g., elevated IFN-γ expression) of the T cell that bore the variable chain (or portion thereof) of that particular TCR. In such cases, a particular TCR generated from an active T cell, as opposed to an inactive T cell, can be rapidly identified. In some cases, a particular TCR generated from an inactive T cell, as opposed to an active T cell, can be rapidly identified.

[0017] In some cases, the absence of cytokine production by T cells does not necessarily reflect the absence of TCR specificity. Signals to cells initiated from the TCR can be lost and / or suppressed by a number of inhibitory co-receptors (Sheppard et al., FEBS Lett., 574(1-3):37-41 (2004); and Yokosuka et al., J. Exp. Med., 209(6):1201-1217 (2012)). In some cases, TCRs can be obtained using T cell resistance to stimulation, and the specificity of the cloned TCRs can be tested or screened in cells in which canonical TCR signaling is not suppressed.

[0018] In some cases, MHC-peptide complexes (or HLA-peptide complexes) can be used to identify cloned TCRs that recognize such complexes. In these cases, it is possible that clonal exclusion and / or lack of antigen priming during the immune response may result in a TCR with this specificity not being present in the activated and / or expanded TCR pool. In such cases, naive or inactivated TCRs that recognize such complexes can be cloned using the methods and materials provided herein, which in some cases only require that a single T cell be present. In some cases, a pool of naive T cells can be stained with MHC-peptide tetramers (or HLA-peptide tetramers) and any MHC-peptide (or HLA-peptide)-reactive TCRs in the naive T cells can be used to clone those TCRs using the methods and materials provided herein.

[0019] In general, one embodiment of this document features a method of obtaining a plurality of nucleic acid vectors containing a nucleic acid encoding a functional T cell receptor. The method comprises, or consists essentially of, (a) obtaining a device including a plurality of separate locations, each of the separate locations containing cDNA generated from RNA obtained from a single T cell sorted at the separate location, (b) performing a nested amplification method using the cDNA of each of the plurality of separate locations as a template to obtain a first amplification product and a second amplification product for each of the cDNA of the plurality of separate locations, the first amplification product comprising a nucleic acid encoding a Vα or Vγ segment, and the second amplification product comprising a nucleic acid encoding a Vβ or Vδ segment, and (c) assembling the first amplification product and the second amplification product for each of the cDNA of the plurality of separate locations into a nucleic acid vector to obtain an assembled nucleic acid vector for each of the cDNA of the plurality of separate locations, the assembled nucleic acid vector for each of the cDNA of the plurality of separate locations comprising a nucleic acid encoding a functional T cell receptor. The plurality can be greater than 50. The plurality can be greater than 500. The plurality can be greater than 5000. The plurality of nucleic acid vectors can be a plurality of nucleic acid expression vectors. The device can include a multi-well plate. The multi-well plate can be a 96-well plate, a 384-well plate, or a 1536-well plate. The cDNA generated from RNA obtained from a single T cell can include cDNA generated from RNA obtained from a single human T cell. The first amplification product can include a nucleic acid encoding an L sequence of a Vα or Vγ segment. The first amplification product can include a nucleic acid encoding a Jα or Jγ segment. The first amplification product can include a nucleic acid encoding a 5' portion of a Cα or Cγ region. The first amplification product can include a nucleic acid encoding an L sequence of a Vα or Vγ segment, a Jα or Jγ segment, and a 5' portion of a Cα or Cγ region. The second amplification product can include a nucleic acid encoding an L sequence of a Vβ or Vδ segment. The second amplification product can include a nucleic acid encoding a Dβ or Dδ segment. The second amplification product can include nucleic acid encoding a Jβ or Jδ segment.The second amplification product may include a nucleic acid encoding a 5' portion of a Cβ or Cδ region. The second amplification product may include a nucleic acid encoding an L sequence of a Vβ or Vδ segment, a Dβ or Dδ segment, a Jβ or Jδ segment, and a 5' portion of a Cβ or Cδ region. The first amplification product may include an adapter sequence added to the amplified template sequence of a cDNA via a second round of amplification in a nested amplification method. The second amplification product may include an adapter sequence added to the amplified template sequence of a cDNA via a second round of amplification in a nested amplification method. The first amplification product may include a first adapter sequence added to the amplified template sequence of a cDNA via a second round of amplification in a nested amplification method, and the second amplification product may include a second adapter sequence added to the amplified template sequence of a cDNA via a second round of amplification in a nested amplification method, where the first and second adapter sequences are different. The functional T cell receptor of each assembled nucleic acid vector may comprise a Vα / Vβ combination or a Vγ / Vδ combination present in the single T cell from which the RNA originates. The functional T cell receptor of each assembled nucleic acid vector may comprise (a) a full-length α variable region and a full-length β variable region or (b) a full-length γ variable region and a full-length δ variable region. The functional T cell receptor of each assembled nucleic acid vector may comprise (a) a full-length α variable region and a full-length β variable region present in the single T cell from which the RNA originates or (b) a full-length γ variable region and a full-length δ variable region present in the single T cell from which the RNA originates. The functional T cell receptor of each assembled nucleic acid vector may comprise (a) a full-length α constant region and a full-length β constant region or (b) a full-length γ constant region and a full-length δ constant region. Each assembled nucleic acid vector may comprise a nucleic acid sequence encoding a self-cleaving peptide or an internal ribosome entry site (IRES). The method may comprise sorting the single T cells into separate locations. The method may include a step of performing a reverse transcription reaction to obtain cDNA. The step of assembling may include seamless cloning. Each of the assembled nucleic acid vectors may be obtained without performing nucleic acid sequencing. Each of the assembled nucleic acid vectors may be obtained without performing a restriction enzyme digestion reaction.

[0020] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs. Methods and materials similar or equivalent to those described herein can be used to carry out the present invention, and suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are only illustrative and are not intended to be limiting.

[0021] The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims. [Brief description of the drawings]

[0022] [Figure 1] FIG. 1 is a schematic comprehensive overview of the TCR cloning method, going from single T cells to expression vectors, according to one embodiment. [Figure 2A] Schematic diagram of a nested PCR method involving the use of two separate pools of forward Vα primers to generate an amplification product containing a 5'-added adapter sequence (AS) followed by the leader (L) sequence of the Vα segment, a Vα segment, a Jα segment, and a portion of the 5' end of Cα, according to one embodiment. In this embodiment, a primer from the pool of forward Vα primers for the second round of PCR adds an adapter sequence that can be used to clone the generated amplification product into an expression vector. [Figure 2B]Schematic diagram of a nested PCR method that includes the use of two separate pools of forward Vβ primers to generate amplification products that contain a 5'-added adapter sequence (AS) followed by the leader (L) sequence of the Vβ segment, a Vβ segment, a Dβ segment, a Jβ segment, and a portion of the 5' end of the Cβ, according to one embodiment. In this embodiment, primers from the pool of forward Vβ primers for the second round of PCR add an adapter sequence that can be used to clone the generated amplification products into an expression vector. [Figure 3A] Schematic diagram of a nested PCR method involving the use of one pool of forward Vα primers and a primer to the adapter sequence to produce an amplification product containing an adapter sequence (AS) added at the 5' followed by the leader (L) sequence of the Vα segment, a Vα segment, a Jα segment, and a portion of the 5' end of Cα, according to one embodiment. In this embodiment, a primer from the pool of forward Vα primers used in the first round of PCR adds an adapter sequence that can be used both as a primer target sequence for the second round and for cloning the generated amplification product into an expression vector. [Figure 3B] Schematic diagram of a nested PCR method including the use of one pool of forward Vβ primers and a primer to the adapter sequence to generate an amplification product containing an adapter sequence (AS) added to the 5' end followed by the leader (L) sequence of the Vβ segment, a Vβ segment, a Dβ segment, a Jβ segment, and a portion of the 5' end of a Cβ, according to one embodiment. In this embodiment, a primer from the pool of forward Vβ primers used in the first round of PCR adds an adapter sequence that can be used both as a primer target sequence for the second round and for cloning the generated amplification product into an expression vector. [Figure 4]1 is a flow chart of two exemplary screening methods that can be performed using the methods and materials described herein to rapidly obtain a desired TCR clone using the methods and materials provided herein. In some cases, these screening methods can be performed from the step of sorting the original T cells into single-sorted T cells prior to TCR cloning to the step of isolating a specific TCR clone with the desired antigen specificity from antigen screening without nucleic acid sequencing, without a restriction enzyme cleavage step, or without either a nucleic acid sequencing or a restriction enzyme cleavage step. [Diagram 5] FIG. 1 shows an example of an alignment used to select and design primers capable of amplifying more than one variant. Primer sequences with homology between different variants were selected in the region upstream of or overlapping with the ATG start codon. This strategy significantly reduces the number of individual primers included in the multiplex PCR reaction, allowing most, if not all, TCR variants to be amplified. This example depicts the sequences for all 13 variants of the mouse TRAV13 variant group and their homology upstream of the ATG start codon. In this particular example, all 13 group members were amplified using only one forward primer (i.e., mTRAV13_F, which has the following sequence 5'-GGCTGGTTACTTGCTTCTGTCT-3', SEQ ID NO: 99). The position of this sequence, 20 nucleotides upstream of the ATG start codon, is highlighted with a dashed box and an arrow. Below the sequence logo, one-letter codes for positions with more than one nucleotide are provided. The IUPA-IUB tables contain codes for these mixed bases. [Figure 6A]Figure 6 shows the results for RNA extraction, cDNA conversion, and detection of TCR chains down to the single cell level using the hybridoma T cell line 1B9, and also the results of sorting single cells into 384-well PCR plates. Figure 6A provides the amplification efficiency of GAPDH from serial cell dilutions (10 to 0.08 cells / well) using SYBR green real-time PCR. [Figure 6B] Figure 6B shows the results of RNA extraction, cDNA conversion, and detection of TCR chains down to the single cell level using the hybridoma T cell line 1B9, and also sorting of single cells into a 384-well PCR plate. Figure 6B shows the conditions for RNA extraction and cDNA conversion are capable of detecting mouse TCR beta chain TRBV17 expressed in the 1B9 hybridoma cell line down to the single cell level using two-fold serial dilutions (10 to 0.08 cells / well), forward primer mTRBV17 (SEQ ID NO: 251), and reverse primer mTRBCn (SEQ ID NO: 273). [Figure 6C] Figure 6 shows the results of RNA extraction, cDNA conversion, and TCR chain detection down to single cell level using hybridoma T cell line 1B9, and also the results of single cell sorting into 384-well PCR plate. Figure 6C shows further confirmation of detection at single cell level using glass pipette and micromanipulator controlled under microscope. Single cells were seeded into 384-well PCR plate, and mTRBV17 was detected in 22 wells out of 24 wells. [Figure 6D] Figure 6B shows the results for RNA extraction, cDNA conversion, and detection of TCR chains down to the single cell level using the hybridoma T cell line 1B9, and also the results of sorting single cells into 384-well PCR plates. Figure 6C shows the results of the condition where single cells are seeded into 384-well PCR plates using a BD FACSaria sorter. Again, 22 out of 24 wells tested positive for detection of mTRBV17 mouse TCR β chain. [Figure 7]Figure 1 shows the amplification efficiency of human primers listed in Table 1 for amplifying the corresponding human TCR alpha variants (top panel) and the amplification efficiency of human primers listed in Table 2 for amplifying the corresponding TCR beta variants (bottom panel). Human peripheral blood mononuclear cells (PBMCs) were isolated from healthy donors using density gradient centrifugation. RNA was isolated using the RNAeasy Qiagen kit and converted to cDNA using Superscript IV for reverse transcription. For the hTRAV primers listed in Table 1, hTRACf (SEQ ID NO: 265) was used as the reverse primer. For the hTRBV primers listed in Table 2, hTRBCf (SEQ ID NO: 268) was used as the reverse primer. [Figure 8] Figure 1 shows the amplification efficiency of mouse primers listed in Table 3 for amplifying the corresponding mouse TCR alpha variants (top panel) and the amplification efficiency of mouse primers listed in Table 2 for amplifying the corresponding mouse TCR beta variants (bottom panel). Lymphocytes were isolated from the thymus of young C57 / BL6 mice and RNA was isolated using the RNAeasy kit. RNA was converted to cDNA using Superscript IV for reverse transcription. For the mTRAV primers listed in Table 3, mTRAC (SEQ ID NO: 266) was used as the reverse primer. For the mTRBV primers listed in Table 4, mTRBC (SEQ ID NO: 269) was used as the reverse primer. [Figure 9A]Figure 9A shows the amplification efficiency of the resulting amplification products for subsequent cloning and sequence identification for the α and β chains of the entire mouse T cell receptor repertoire. Figure 9A shows the FACS staining and gating used for the isolation of LIVE / CD8 positive T cells isolated from the spleens of C57 / BL6 mice. The gates were arranged sequentially such that the leftmost panel is the first empty gate and the panel immediately to the right is the population defined by the previous gate. The defined CD8+CD4- events in the rightmost panel were sorted as single cells into two 384-well PCR plates using a FACSaria sorter. For both 384-well PCR plates, RNA was extracted and converted to cDNA in each individual well that contained a single cell. The first round of amplification for mouse mTRAV and mTRBV sequences was performed in one mixed PCR reaction combining all primers listed in Tables 3 and 4 plus reverse primers mTRAC (SEQ ID NO: 266) and mTRBC (SEQ ID NO: 269). After the first round of amplification, two separate nested PCR reactions were performed. The first was for amplification of mTRAV using all primers listed in Table 7 + reverse primer mTRACn (SEQ ID NO: 271), and the second was for amplification of mTRBV using all primers listed in Table 8 + reverse primer mTRBCn (SEQ ID NO: 273). The first 24 wells from each of the two plates were analyzed by ethidium bromide gel electrophoresis (Figure 9B). mTRAV amplification is shown at the top and mTRBV amplification is shown at the bottom for each individual single cell in wells A1-A8, B1-B8, and C1-C8 for both plates. The mTRAV and mTRBV DNA amplification products show different sizes because they are derived from polyclonal T cell populations, representing variants derived from the entire T cell repertoire. [Figure 9B] Continued from Figure 9A. [Figure 10]Figure 1 is a graph plotting IL-2 expression for single T cells. CD4+ human T cells were isolated by positive selection from PBMCs using BD iMag streptavidin beads and biotinylated human anti-CD4 antibody. Cells were cultured for 5 days and activated with anti-CD3 / anti-CD28 DYNA beads for 16 hours to mimic T cell activation with antigen presenting cells (APCs) or unstimulated control cells. After 16 hours of incubation, CD4+ cells were sorted as one cell per well in a 384-well PCR plate. RNA extraction and cDNA conversion were completed. One-fifth of the cDNA (2 μL) was used for gene expression analysis of human IL-2 and compared to the expression of RLP13A, which was used as a reference gene for normalization using real-time PCR. qPCR was performed on a fraction of the cDNA generated from single cells, and activated cells were identified based on their IL-2 levels, which ranged from a two-fold increase to a several hundred-fold increase compared to unstimulated control single cells. [Figure 11A]Wild-type female C57Bl / 6 mice were vaccinated with H60 peptide (LTFNYRNL; SEQ ID NO: 278) or OVA peptide (SINFEKL; SEQ ID NO: 279) conjugated to anti-DEC205 antibody as described elsewhere (Li et al., Blood, 118:5965-76 (2011)). (A) Splenocytes from one H60-vaccinated mouse stained with H60-MHC1 tetramer. Plots were gated on live, CD8+, TCR+, and CD4- cells. Single CD44hi tetramer+ cells (defined by gates drawn on the plots) were sorted into individual wells of a 384-well plate and α and β TCR chains were amplified via nested PCR. The first round of amplification was carried out using all primers in Tables 3 and 4 in combination with reverse primers directed to TCR alpha and TCR beta (SEQ ID NO: 266 and SEQ ID NO: 269, respectively). For the second round, a portion of the PCR products from the first round was used to amplify the TCR alpha or TCR beta chain in two separate reactions using all primers included in Table 7 plus the reverse primer (SEQ ID NO: 271) in one reaction, and all primers listed in Table 8 plus the reverse primer (SEQ ID NO: 273) in the other reaction. [Figure 11B]Wild-type female C57Bl / 6 mice were vaccinated with H60 peptide (LTFNYRNL; SEQ ID NO: 278) or OVA peptide (SINFEKL; SEQ ID NO: 279) conjugated to anti-DEC205 antibody as described elsewhere (Li et al., Blood, 118:5965-76 (2011)). (B) Splenocytes from one OVA-vaccinated mouse stained with tetramer for OVA-MHC1. Plots were gated on live cells, CD8+ cells, and TCR+ cells. Single CD44hi tetramer+ cells (defined by the gate drawn on the plot) were sorted into individual wells of a 384-well plate and α and β TCR chains were amplified via nested PCR. The first round of amplification was performed using all primers in Tables 3 and 4 in combination with reverse primers directed against TCRα and TCRβ (SEQ ID NO: 266 and SEQ ID NO: 269, respectively). For the second round, a portion of the PCR products from the first round was used to amplify the TCR alpha or TCR beta chain in two separate reactions using all primers included in Table 7 plus a reverse primer (SEQ ID NO: 271) in one reaction, and all primers listed in Table 8 plus a reverse primer (SEQ ID NO: 273) in the other reaction. [Figure 11C]Wild-type female C57Bl / 6 mice were vaccinated with H60 peptide (LTFNYRNL; SEQ ID NO: 278) or OVA peptide (SINFEKL; SEQ ID NO: 279) conjugated to anti-DEC205 antibody as described elsewhere (Li et al., Blood, 118:5965-76 (2011)). (C) To verify whether the method can identify clonally distinct populations, alpha (data not shown) and beta chains from individual wells were sequenced using Sanger sequencing. For H60-vaccinated mice, 198 TCR+ wells were sequenced, representing cells from two mice. For OVA-vaccinated mice, 54 TCR+ wells were sequenced, representing cloned TCRs from four mice. The use of TRBV alone indicates that these methods can be used to isolate clonally distinct populations. Based on the sequencing results, five unique TCR pairs were selected from the amplification of H60-specific TCR pairs. These TCR pairs were cloned into retroviral vectors using seamless cloning technology, and the ability of these vectors to express TCR on the surface of cells was evaluated using 58- / -TCR- / - hybridomas. The TCR viral vectors used were constructed using TRBV2 and TRAV13D-2 sequences cloned from single T cells. After infection with the virus expressing the TCR, cells were stained with anti-Vβ4 (the gene product of TRBV2) and evaluated by flow cytometry. [Figure 11D] Wild-type female C57Bl / 6 mice were vaccinated with H60 peptide (LTFNYRNL; SEQ ID NO: 278) or OVA peptide (SINFEKL; SEQ ID NO: 279) conjugated to anti-DEC205 antibody as described elsewhere (Li et al., Blood, 118:5965-76 (2011)). (D) Uninfected 58- / - TCR- / - hybridomas stained with anti-Vβ4 and assessed for expression of the Tdtomato gene. [Figure 11E]Wild-type female C57Bl / 6 mice were vaccinated with H60 peptide (LTFNYRNL; SEQ ID NO: 278) or OVA peptide (SINFEKL; SEQ ID NO: 279) conjugated to anti-DEC205 antibody as described elsewhere (Li et al., Blood, 118:5965-76 (2011)). (E) Cells infected with virus expressing TRBV15, stained with anti-Vβ4, and assessed for expression of the Tdtomato gene. [Figure 11F] Wild-type female C57Bl / 6 mice were vaccinated with H60 peptide (LTFNYRNL; SEQ ID NO: 278) or OVA peptide (SINFEKL; SEQ ID NO: 279) conjugated to anti-DEC205 antibody as described elsewhere (Li et al., Blood, 118:5965-76 (2011)). (F) Cells infected with virus expressing TRBV2, stained with anti-Vβ4, and assessed for expression of the Tdtomato gene. [Figure 12] The TCR- / -4G4 hybridoma cell line is a cell line transfected with an NFAT-RE luciferase plasmid (Clipstone et al., Nature, 357:695-7 (1992)). (A) Viral constructs expressing TCRαβ and eGFP were assembled using seamless cloning technology, and retroviruses were generated using PLAT-E cells. 4G4 cells were infected with TCR retroviruses, and 24 hours later, TCRβ and eGFP expression was assessed by flow cytometry. Uninfected cells (left panel) did not express GFP and did not stain for TCRβ. Infected cultures contained cells expressing both TCRβ and eGFP (upper right quadrant of right panel). (B) Infected or uninfected cell cultures were placed in culture on plates bound with anti-CD3 antibody for 3.5 hours. The relative light units (RLU) produced by TCR expressing cultures (infected) were compared to the RLU of non-infected (uninfected) cells. [Figure 13] FIG. 13 is a schematic diagram showing the appearance of one embodiment described in Example 7. [Figure 14]Schematic diagram of pMIGII retroviral vector-based acceptor vector. A synthesized DNA fragment containing a 27-nucleotide linker containing restriction enzyme recognition sites for PmeI and RsrII and the constant region of the TCR β chain was assembled into the pMIGII retroviral vector using the Gibson assembly cloning method. The resulting vector is 6.95 kb in length. [Figure 15] Schematic diagram showing linearized acceptor vector assembled with fragment b and nested α and β PCR products. The acceptor vector linearized with restriction enzymes PmeI and RsrII was assembled in one Gibson reaction with fragment b, which contains the TCR α constant region and 2a element, and the αVJ and βVDJ nested PCR products of an unknown TCR. The size of the resulting retroviral vector (approximately 8.1 kb) varies slightly according to the length of the assembled α and β chains. [Figure 16] FIG. 1 illustrates two different cloning strategies downstream of Gibson Assembly (GA). The flow chart on the left depicts a medium throughput strategy (Strategy 1), while on the right is a high throughput strategy (Strategy 2). [Figure 17]FIG. 7 is a diagram of the PCR strategy described in Example 7 for amplifying any VαJα and VβDβJβ from rearranged cDNA. RT-PCR of either single T cell-derived RNA or clonal T cell RNA is performed using a pool of forward primers that bind to the leader sequences of multiple Vα and Vβ gene segments and two reverse primers that bind to either Cα or Cβ. All Vα primers have a 20 nt common sequence at their 5′ ends that overlaps with the 5′ end of linearized pMIGII, and all Vβ primers contain a 20 nt common sequence at their 5′ ends that overlaps with the 3′ end of fragment b. A second PCR, called “nested PCR,” is performed with a forward primer that binds to the last 18 nt of either the Vα or Vβ consensus sequence, and a reverse primer that binds to the first 20 nt of either Cα or Cβ. Both the Vα and Vβ amplicons contain an 18 nt overlap with either the vector or fragment b, VαJα and VβDβJβ with intact leader sequences, and the first 20 nt of either Cα or Cβ, respectively. [Figure 18] Figure 1 shows the ClaI restriction enzyme digestion for screening of positive assembled vectors after Gibson assembly in Example 7. The expected band sizes after digestion are approximately 6700 nt and 1400 nt. The gel shows approximately 50% efficiency for cloning the TCRs of 13C2 and 1B9 T cell hybridomas. [Figure 19-1] Figure 3. TCR expression and T cell function. 4G4 cells were transduced with three assembled retroviral vectors of 13C2 or 1B9 TCR, respectively. 13C2 (A) and 1B9 (B) TCR expression on the membrane of 4G4 cells was assessed by flow cytometry. Double positive staining for GFP (contained in the RV vector) and the respective Vβ indicates the percentage of cells expressing the TCR. (C) IL-2 secretion of 4G4 stimulated with AM14Vk8R B cells transduced with either 1B9 or 13C2, capable of presenting PL2-3 antigen, and PL2-3 (black bars) or irrelevant anti-IgM (white bars). Stimulation with three transductions is shown for each TCR. [Figure 19-2] Continued from Figure 19-1. [Figure 20] FIG. 1 is a gel showing Gibson assembly. Two runs of Gibson assembly using different DNA concentrations and DO11.10TCR are shown. Arrows indicate the correct ClaI digestion pattern and correctly assembled pMIGII vector and DO11.10TCR. [Figure 21] FIG. 1 is a schematic illustrating the P2A nucleotide and amino acid sequences. The approximate regions of homology (overlap) to the first forward Vβ primer(s) are indicated. [Figure 22] FIG. 1 is a schematic illustrating the fragment b nucleotide sequence. Approximate areas of homology (overlap) to the amplicon are indicated. [Figure 23] FIG. 1 is a schematic diagram illustrating the Cβ nucleotide sequence in the acceptor vector pMIGII. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0023] This document provides methods and materials involved in cloning a functional TCR from a single T cell. For example, this document provides methods and materials for obtaining nucleic acid encoding a TCR from a single T cell and arranging the nucleic acid to form a nucleic acid vector successfully designed to express a TCR (e.g., a fully intact TCR, e.g., a fully intact TCR with the combination of variable chains present in the single T cell). In general, a method for cloning a functional TCR from a single T cell can include sorting the T cells into separate locations, lysing the single T cells to release RNA, performing reverse transcription to produce cDNA from the released RNA, performing a nested amplification reaction to generate a first amplification product for the Vα (or Vγ) of each single T cell and a second amplification product for the Vβ (or Vδ) of each single T cell in the same nested amplification reaction mixture for each single cell, and cloning the first and second amplification products into an expression vector (Figure 1). In some cases, a portion of the cDNA from the reverse transcription step can be used to perform an amplification reaction (e.g., PCR or quantitative PCR (qPCR)) to detect the presence, absence, or amount of expression of other genes (e.g., IFNγ) by single T cells (Figure 1).

[0024] Any type of T cell can be obtained and used as described herein to generate expression vectors designed to express a functional TCR. For example, cytotoxic T lymphocytes (CTLs), regulatory T cells (T reg), helper T cells, tumor infiltrating T lymphocytes (TILs), naive T cells, activated T cells, memory T cells, T cells with known antigen specificity, T cells with unknown antigen specificity, an expanded population of MHC class I-restricted T cells, an expanded population of MHC class II-restricted T cells, or combinations thereof can be obtained and used as described herein to generate expression vectors designed to express functional TCRs. In some cases, a sample containing a mixture of different types of T cells (e.g., a mixture of MHC class I-restricted T cells and MHC class II-restricted T cells) can be obtained and used as described herein to generate expression vectors designed to express functional TCRs.

[0025] In addition, any suitable sample containing live T cells can be used to obtain T cells that can be used as described herein. Examples of samples containing T cells that can be used as described herein to generate expression vectors designed to express functional TCRs include, but are not limited to, blood samples, peripheral blood mononuclear cells (PBMC) samples, isolated lymphocyte samples, tissue samples (e.g., skin, lymph node samples, mucosal tissues, viral lesions in skin or mucosal tissues, or tumor samples), cell culture samples (e.g., cell culture samples of T cell lines, e.g., Jurkat cells, 1301 cells, or T cell leukemia lines), samples of T cells expanded ex vivo against a specific antigen or vaccine, and samples from tissues of recently deceased mice or human cadavers. Examples of tissue samples that can be used as a source of T cells for the methods described herein include, but are not limited to, lymph node samples, tumor samples, thymus samples, bone marrow samples, intestinal biopsy samples, lung biopsy samples, kidney biopsy samples, and organ graft biopsy samples. Any suitable type of tumor sample can be used as a source of T cells for the methods described herein, including, but not limited to, breast tumor samples, prostate tumor samples, colon cancer samples, lung cancer samples, melanoma samples, and pancreatic cancer samples. In some cases, the sample containing T cells can be obtained from a site of inflammation, a site of tissue rejection, a site of infection, a site of disease, a site of immune response, a site of autoimmune infiltration, a site of allergic reaction, a site of tumor, or a site of transplantation reaction. When using a tissue sample, such as a tumor sample, the tissue sample (e.g., tumor sample) can be obtained from a mammal (e.g., human) and disrupted or digested to form a cell suspension containing T cells. In some cases, the tissue sample (e.g., tumor sample) can be obtained from a mammal (e.g., human) that has been treated with a therapeutic vaccine, with or without being subjected to immunomodulatory drug therapy, to obtain a population of antigen-specific T cells from the tissue sample (e.g., from the tumor sample).

[0026] In some cases, to obtain TILs, tissue from resected solid tumors and / or tumor biopsies can be digested to form a single cell suspension. The single cell suspension can be stained for T cell specific markers and / or tumor associated cell characteristics to distinguish T cells from tumor cells. Tumor specific surface markers can be selected based on tumor subtype (e.g., surface protein Met-72 can be used for certain melanomas). In some cases, Vybrant® DyeCycle™ reagents for determining cell cycle and / or dyes, such as 7AAD staining for cellular DNA content, propidium iodide staining, and / or Hoechst staining for DNA content, can be used (Loken, Cytometry, 1(2):136-142 (1980); and Schmid and Sakamoto, Curr. Protoc. Cytom., Chapter 7:7 Unit 16 (2001)). In some cases, tumor cells can be identified by the absence of immune cell-associated surface proteins, such as CD45, CD4, CD8, TCRβ, CD11b, CD19, or combinations thereof. Differentiated T cells and tumor cells can be sorted and TCRs can be cloned from the T cells as described herein. In some cases, sorted tumor cells can be isolated and further analyzed (e.g., sequenced). This double sorting system can allow one to simultaneously obtain genetic information from both tumor cells and associated TILs.

[0027] In some cases, microdissection techniques, such as laser microbeam microdissection (LMM), laser pressure catapulting (LPC), membrane mounted tissue microdissection (MOMeNT), or laser capture microdissection (LCM), can be used to separate T cells from other cells (e.g., tumor cells or diseased tissue), as described elsewhere (Pinzani et al., Mol. Aspects Med., 27:140-59 (2006); and Tjernlund et al., PloS One, 11:e0149907 (2016)).

[0028] In some cases, a sample containing T cells for use in the methods provided herein can be a sample of freshly isolated T cells that have not been expanded to generate clones of T cells.

[0029] T cells used as described herein to generate expression vectors designed to express a functional TCR can be from any suitable mammal. For example, T cells from humans, monkeys, horses, bovine species, pigs, dogs, cats, rats, or mice can be used as described herein to generate expression vectors designed to express a functional TCR.

[0030] Once the T cells are obtained, they can be sorted into separate locations of a container, e.g., a multi-well plate, in a manner that places single T cells in one location (e.g., one T cell / well). Any suitable cell sorting method can be used to sort single T cells into separate locations. For example, a population of T cells can be stained with a specific fluorescent agent that binds to a specific marker and sorted into single cells into separate wells of a multi-well plate using a cell sorter. In some cases, fluorescent agents, e.g., carboxyfluorescein succinimidyl ester (CFSE), fluorescently labeled antibodies (e.g., fluorescently labeled anti-CD3 antibody, fluorescently labeled anti-CD4 antibody, fluorescently labeled anti-CD8 antibody, fluorescently labeled anti-CD69 antibody, fluorescently labeled anti-CD40L antibody, fluorescently labeled anti-CD44 antibody, or fluorescently labeled anti-CD62L antibody), fluorescently labeled peptide-tetramer complexes (e.g., fluorescently labeled tumor antigen-tetramer complexes), or combinations thereof, can be used to stain the T cells for cell sorting. For example, a single CD8 + To allow sorting of T cells into separate locations, fluorescently labeled anti-CD3 antibodies (e.g., fluorescein labeled anti-CD3 antibodies, e.g., FITC-OKT3) and fluorescently labeled anti-CD8 antibodies (e.g., phycoerythrin labeled anti-CD8 antibodies, e.g., PE-SK1) are used to identify CD8 T cells. +T cells can be stained. Examples of fluorescent labels that can be used during cell sorting include, but are not limited to, fluorescein, phycoerythrin, Cy3, Cy5, rhodamine, Alexa 488, and Brilliant Violet.

[0031] In some cases, T cells (e.g., CD3 + T cells) or a specific type of T cell (e.g., CD4 + or CD8 + One or more fluorescent agents (e.g., fluorescently labeled antibodies) other than those designed and used to help identify and sort the T cells (e.g., T cells) may be included in the sorting process to provide further information about the phenotype of the sorted T cells, although the fluorescent signals from those fluorescent agents may or may not be used to sort the T cells. For example, fluorescent agents that bind to surface proteins or markers, such as PD-1, TIM3, LAG3, CD28, CD152, CD44, CD69, CD107a, CD11b, CD62L, CD127, CD30, CD27, or CD45RA / CDR45O, can be used to capture expression information about those surface proteins or markers by each sorted T cell. Since the specific location of each single sorted T cell is known, then the level of each fluorescent signal for each of those specific sorted T cells is also known and can be associated with the T cell that produced them. For example, during a cell sorting process using fluorescently labeled anti-CD3, fluorescently labeled anti-CD8, fluorescently labeled anti-CD28, and fluorescently labeled anti-CD152 antibodies, the fluorescent signals from all four antibodies are captured and the cells are sorted into CD3 and CD8 T cells so that they can be sorted into specific, separate locations in a vessel. + / CD8 +The fluorescence levels of all four markers can be assigned to the T cells that produced those signals, including the signals from the anti-CD3 and anti-CD8 antibodies that are used to identify them as T cells. In this case, the fluorescence levels of all four markers can be assigned to the T cells that produced those signals, even though two (i.e., the CD28 and CD152 markers) were not used for the actual sorting.

[0032] This expression information obtained when sorting T cells into separate locations (e.g., wells) can provide important information about single sorted T cells. For example, this information can reveal the expression of, for example, CD28 + The expression vector expressing the TCR generated as described herein from a T cell can be, for example, a CD28 + Even if expression is not used as a selection criterion (e.g., CD28 + and CD28 - Both T cells were sorted into single cells during the sorting process) and can be selected after construction based on the fluorescent signal from a fluorescently labeled anti-CD28 antibody during the earlier sorting process. In some cases, CD45RO can be used as a marker to identify naive T cells, and CD45RA can be used as a marker to identify stimulated T cells (e.g., stimulated human T cells).

[0033] In some cases, the presence (or absence) of staining from any particular fluorescent agent can be used as a criterion for sorting, in which case each of the expression vectors expressing a TCR generated from those sorted single T cells is derived from a T cell that is positive (or negative) for that fluorescent agent marker. For example, CD28 + When the presence of staining was used as the selection criterion, each of the expression vectors expressing a TCR expressed a single CD28 + In such cases, the specific degree of staining (e.g., CD28 +Information about the degree of staining (even if that marker was used as the selection criterion) can be associated with each single T cell that is selected and used. This information is useful when assessing the functional properties of the cloned TCRs.

[0034] Any suitable container can be used when sorting T cells during the methods described herein. For example, a multi-well plate, such as a 96-well plate, a 384-well plate, a 1536-well plate, or a microtube can be used. In some cases, the container can be designed to hold individual droplets that are spatially separated from one another, thereby forming separate locations where each droplet contains a single T cell (e.g., one T cell / droplet). For example, single T cells can be sorted into individual droplets on a surface (e.g., a flat surface) as described elsewhere (Kanz et al., Cytometry, 7:491-4 (1986)).

[0035] In some cases, individual TCR cloning methods can be performed as described herein using one or more multi-well plates. For example, two or more (e.g., 5, 10, 15, 20, 25, 30, 35, 40, 45, 50 or more) 384-well or 1536-well plates can be used to clone TCRs from a single T cell obtained from a single source (e.g., from one human) using the methods described herein. Although less desirable, in some cases, sorting a single T cell into separate locations can result in several separate locations (e.g., several separate wells) with two or more T cells. Locations with potentially more than a single T cell can remain in the cloning process, since about 25 percent of the products derived from two cells can reconstitute the authentic TCR of at least one starting cell and can be identified in the subsequent screening process.

[0036] Any suitable cell sorter can be used to sort T cells during the methods described herein. Examples of cell sorters that can be used include, but are not limited to, BD FACSAria II sorter, BD FACSAria III sorter, MOFLO XDP sorter, MOFLO Astrios EQ sorter, Sony iCyt SY3200 cell sorter, and Sony SH800S cell sorter. When sorting T cells, the volume of the aerosolized droplets containing the sorted T cells can be about 1 nL to about 4 nL, and the droplets containing the sorted T cells can be collected in a volume of liquid ranging from about 0.1 μL to about 5 μL (e.g., about 0.5 μL to about 5 μL, about 1 μL to about 5 μL, about 2 μL to about 5 μL, about 0.5 μL to about 4 μL, about 0.5 μL to about 3 μL, about 0.5 μL to about 2 μL, or about 0.5 μL to about 1 μL).

[0037] Once the T cells are sorted (e.g., 1 T cell / well), the single T cells can be lysed to release the RNA of each T cell. Any suitable method can be used to lyse the single T cells sorted into separate locations. For example, sonication, one or more freeze / thaw cycles, treatment with one or more cell lysing agents, heating, osmotic stress, enzymatic digestion, or a combination thereof can be used to lyse the single T cells to release the RNA.

[0038] After releasing the RNA for a single T cell, reverse transcription can be performed to generate cDNA from the released RNA. Any suitable set of primers can be used with the RNA as a template to generate cDNA from the released RNA. In some cases, random oligomers can be used to generate cDNA from the RNA released from a single T cell. Examples of random oligomers that can be used as primers to generate cDNA from the released RNA include, but are not limited to, random hexamer primers, random 9-mer primers, random 10-mer primers, or random pentadecamer primers. In some cases, poly-T primers (e.g., oligo(dT) 18In some cases, a primer specific for the RNA encoding the TCR can be used, alone or together with a primer specific for an RNA encoding another polypeptide, to generate cDNA from the released RNA. For example, a primer specific for the RNA encoding the TCR can be used together with a primer specific for an RNA encoding any of the other polypeptides whose expression or expression levels are being evaluated (e.g., TNF-α, IFN-γ, IL-2, IL-4, IL-5, IL-10, IL-13, or IL-17).

[0039] Any suitable reverse transcriptase can be used to perform reverse transcription to generate cDNA from the released RNA. Examples of reverse transcriptases that can be used as described herein include, but are not limited to, avian myeloblastosis virus (AMV) reverse transcriptase (commercially available from Promega) and Moloney murine leukemia virus (MMLV) reverse transcriptase, such as Superscript III, Superscript IV (both commercially available from ThermoFisher Scientific), iScript (commercially available from Biorad), and Accuscript HiFi (commercially available from Agilent). Other components for performing reverse transcription can include, but are not limited to, dNTPs, non-denaturing detergents (e.g., IGEPAL CA-630), RNase inhibitors, such as RNasin (commercially available from Promega), and RNase OUT (commercially available from ThermoScientific).

[0040] The reverse transcription reaction provided herein can include an optional step of heating the RNA to a temperature of about 55°C to about 75°C (e.g., about 60°C to about 70°C, about 62°C to about 68°C, or about 64°C to about 66°C) for a period of about 2 minutes to about 10 minutes (e.g., about 2 minutes to about 8 minutes, about 3 minutes to about 7 minutes, or about 4 minutes to about 6 minutes). In some cases, the reverse transcription reaction can include a step of heating the RNA to about 65°C for about 5 minutes. This heating step can be performed using the RNA in the presence of one or more components involved in the reverse transcription reaction (e.g., primers, dNTPs, non-denaturing surfactants, or combinations thereof). In some cases, the heating step can be performed with all required components involved in the reverse transcription reaction except for the reverse transcriptase. After performing the optional heating step, the sample can be placed on ice for primer binding.

[0041] The reverse transcription reaction provided herein can be carried out by contacting RNA with a reverse transcriptase in the presence of a primer, dNTPs, and an optional surfactant (e.g., a non-denaturing surfactant) at a temperature of about 30° C. to about 55° C. (e.g., about 35° C. to about 50° C., about 37° C. to about 47° C., or about 40° C. to about 45° C.) for a period of about 20 minutes to about 90 minutes (e.g., about 25 minutes to about 80 minutes, about 30 minutes to about 60 minutes, or about 35 minutes to about 45 minutes). In some cases, the reverse transcription reaction can be carried out at about 42° C. for about 40 minutes.

[0042] In some cases, high quality cDNA can be generated from RNA obtained from single T cells in a high throughput and efficient manner using the methods and materials described herein. For example, in one embodiment, high quality cDNA can be generated from RNA obtained from single T cells in a high throughput and efficient manner by rapidly lysing each single T cell and performing a reverse transcription reaction as described herein. In some cases, the resulting cDNA generated from a single T cell may be of such high quality that a portion (e.g., about 75 percent or less, about 50 percent or less, about 25 percent or less, about 10 percent or less, about 75 percent to about 10 percent, about 75 percent to about 25 percent, about 75 percent to about 50 percent, about 60 percent to about 40 percent, about 50 percent to about 10 percent, or about 50 percent of the final total cDNA reaction mixture) can be used to continue with nested amplification and cloning steps to successfully obtain an expression vector expressing a functional TCR having the combination of variable chains (or a combination of at least a Vα segment and a Vβ segment, or a combination of at least a Vγ segment and a Vδ segment) present in the single T cell.

[0043] In some cases, one or more of the components used to perform the nested amplification reaction described herein may be added to the reaction mixture for the reverse transcription reaction before, during, or after the reverse transcription reaction is performed. For example, the reverse transcription reaction may be performed as described herein in the presence of a primer collection for a first round nested amplification reaction described herein, in the presence of a primer collection for a second round nested amplification reaction described herein, in the presence of a polymerase enzyme designed for thermocycling (e.g., Taq polymerase), or in the presence of a combination thereof.

[0044] In some cases, the reverse transcription reaction can be carried out to completion as described herein in the absence of one or more components used to carry out the nested amplification reaction described herein. For example, the reverse transcription reaction can be carried out to completion as described herein in the absence of a primer collection for a first round nested amplification reaction described herein, in the absence of a primer collection for a second round nested amplification reaction described herein, in the absence of a polymerase enzyme designed for thermocycling (e.g., Taq polymerase), or in the absence of a combination thereof.

[0045] When only a portion of the generated cDNA is used to continue the nested amplification and cloning steps to obtain an expression vector expressing a functional TCR having a combination of variable chains (or at least a combination of Vα and Vβ segments or at least a combination of Vγ and Vδ segments) present in a single T cell as described herein, the remaining cDNA (or a portion of the remaining cDNA) generated from the RNA obtained from the single T cell can be used to obtain other important information about the phenotype of the single T cell through techniques such as PCR to detect the presence or absence of gene expression, or techniques such as qPCR to detect the level of gene expression. For example, a portion of the cDNA generated from the single T cell (e.g., about 75 percent or less, about 50 percent or less, about 25 percent or less, about 10 percent or less, about 75 percent to about 10 percent, about 75 percent to about 25 percent, about 75 percent to about 50 percent, about 60 percent to about 40 percent, about 50 percent to about 10 percent, or about 50 percent of the final total cDNA reaction mixture) can be used to detect the presence, absence, or amount of RNA expression exhibited by the single cell sorted T cells. Expression (or lack thereof) for any particular RNA can be assessed as described herein for single cell sorted T cells.For example, polypeptides, such as cytokines (e.g., TGF-β, TNF-α, IFN-γ, EBI3, p40, p35, IL-2, IL-4, IL-5, IL-6, IL-10, IL-13, or IL-17), receptors (e.g., CD3, CD25, CD27, CD28, CD30, CD40L, CD122, CXCR3, CXCR6, CCR5, CCR6, CCR7, FASL, LFA-1, ICOS, CTLA-4, PD-1, LAG3, Tim-3, or The presence, absence, or amount of RNA encoding an RNA encoding a T cell (e.g., VLA-4), a transcription factor (e.g., RORγT, FOXP3, FOXO1, RUNX1, T-bet, Eomesdermin, Gata-3, Bcl-2, Bcl-6, BIM, Blimp-1, or p53), an enzyme (e.g., Granzyme A, Granzyme B, DNA methyltransferase, or histone / protein deacetylase (HDAC), e.g., HDAC1 or HDAC9), an inhibitor of cytokine signaling (e.g., SOCS1 or SOCS9), an inhibitor of kappa B kinase, or a chemokine (e.g., CCL2 / MCP-1, CCL3 / MIP-1α, CCL4, CCL5 / RANTES, CCL6, CXCL12, or CXCL16) can be determined for a single T cell. In some cases, the presence, absence, or amount of a microRNA (e.g., miRNA-17, miRNA-31, miRNA-139, or miRNA-150) can be determined for a single T cell, as described herein. In some cases, the presence, absence, or amount of RNA expression assessed for a single T cell, as described herein, can be used to identify a particular single T cell as having a desired phenotype. For example, a single T cell can be identified as being activated by detecting the presence or amount of IL-2 or IFN-γ RNA expression.

[0046] Any suitable technique can be used to detect the presence or absence of RNA expression for a particular RNA using cDNA generated from a single T cell as described herein. For example, PCR, real-time PCR, or PCR including the use of fluorescent probes (e.g., SYBR Green) or Taqman probes can be used to detect the presence or absence of RNA expression for a particular RNA. Similarly, any suitable technique can be used to detect the amount of RNA expression for a particular RNA using cDNA generated from a single T cell as described herein. For example, qPCR can be used to detect the amount of RNA expression for a particular RNA.

[0047] Some targets can be pre-amplified directly from cDNA or amplified and analyzed simultaneously using specific primer pairs and / or Taqman probes labeled with fluorescent dyes such as FAM, TET, HEX, JOE, Cy3, TAMRA, Rox, LCRed, Texas Red, LC640, or Cy5 and quenchers such as BHQ1, BHQ2, BHQ3, TAMARA, DABCYL, or Iowa Black FQ. In some cases, quantification of the expression level of target mRNA can be normalized to one or more reference nucleic acids. Examples of reference nucleic acids that can be used for normalization include, but are not limited to, ACTB, ALAS1, B2M, GAPDH, HBB, HMBS, HPRT1, IPO8, PGK1, PPIA, RPLP0, RPL13A, SDHA, TBP, TFRC, YWHAZ, and 18S. Software such as NormFinder can be used to identify stable nucleic acids that can be used for normalization.

[0048] All or a portion (e.g., about one-quarter, about one-third, about one-half, about two-thirds, or about three-quarters) of the cDNA generated from RNA obtained from a single T cell can be used to perform a nested amplification reaction (e.g., nested PCR) designed to generate at least two amplification products in a single reaction mixture (Figure 1). The first amplification product can include a V segment of the α chain (Vα) or a V segment of the γ chain (Vγ) for a single αβ or γδ T cell, respectively, and the second amplification product can include a V segment of the β chain (Vβ) or a V segment of the δ chain (Vδ) for that same single αβ or γδ T cell. In some cases, the first and second amplification products can encode full-length V segments, since full-length V segments were present in the single T cell that provided the source RNA. For example, human αβ T cells with TCRs including Vα1.2 and Vβ11.3 segments can be sorted into separate wells and lysed to release the RNA of the T cells. The RNA can be used to generate cDNA via reverse transcription, and the generated cDNA can be used as a template in a nested amplification reaction to generate a first amplification product comprising a nucleic acid sequence encoding the full-length Vα1.2 segment present in the human αβ T cells, and a second amplification product comprising a nucleic acid sequence encoding the full-length Vβ11.3 segment present in the human αβ T cells.

[0049] In some cases, the first amplification product of the nested amplification reaction provided herein can include a V and J segment of the α chain (VαJα or VJα) or a V and J segment of the γ chain (VγJγ or VJγ) for a single αβ or γδ T cell, respectively. For example, the first amplification product can encode full-length Vα and Jα segments because full-length Vα and Jα segments were present in the single αβ T cell that provided the source RNA, or the first amplification product can encode full-length Vγ and Jγ segments because full-length Vγ and Jγ segments were present in the single γδ T cell that provided the source RNA. In some cases, the first amplification product of the nested amplification reaction provided herein can include a leader (L) sequence and a V and J segment of the α chain (L-VαJα or L-VJα) or a L sequence and a V and J segment of the γ chain (L-VγJγ or L-VJγ) for a single αβ or γδ T cell, respectively. For example, the first amplification product can encode the full-length L sequence and full-length Vα and Jα segments because the full-length L sequence and full-length Vα and Jα segments were present in the single αβ T cell that provided the source RNA, or the first amplification product can encode the full-length L sequence and full-length Vγ and Jγ segments because the full-length L sequence and full-length Vγ and Jγ segments were present in the single γδ T cell that provided the source RNA.

[0050] In some cases, the first amplification product of the nested amplification reaction provided herein can comprise at least a portion of the V and J segments of the α chain and the constant (C) region (VαJαCα or VJCα) or at least a portion of the V and J segments of the γ chain and the C region (VγJγCγ or VJCγ) for a single αβ or γδ T cell, respectively. For example, the first amplification product can encode full-length Vα and Jα segments and at least a portion of Cα because full-length Vα and Jα segments and at least a portion of Cα were present in the single αβ T cell that provided the source RNA, or the first amplification product can encode full-length Vγ and Jγ segments and at least a portion of Cγ because full-length Vγ and Jγ segments and at least a portion of Cγ were present in the single γδ T cell that provided the source RNA.

[0051] In some cases, the first amplification product of the nested amplification reaction provided herein can comprise the L sequence, the V and J segments of the α chain, and at least a portion of the C region (L-VαJαCα or L-VJCα) or the L sequence, the V and J segments of the γ chain, and at least a portion of the C region (L-VγJγCγ or L-VJCγ) for a single αβ or γδ T cell, respectively. For example, the first amplification product can encode the full-length L sequence, the full-length Vα and Jα segments, and at least a portion of Cα, since the full-length L sequence, the full-length Vγ and Jγ segments, and at least a portion of Cα were present in the single αβ T cell that provided the source RNA, or the first amplification product can encode the full-length L sequence, the full-length Vγ and Jγ segments, and at least a portion of Cγ, since the full-length L sequence, the full-length Vγ and Jγ segments, and at least a portion of Cγ were present in the single γδ T cell that provided the source RNA. Examples of first amplification products encoding the full-length L sequence, full-length Vα and Jα segments, and at least a portion of Cα are shown in the lower panels of Figures 2A and 3A.

[0052] In some cases, the second amplification product of the nested amplification reaction provided herein can include V and D segments of the β chain (VβDβ or VDβ) or V and D segments of the δ chain (VδDδ or VDδ) for a single αβ or γδ T cell, respectively. For example, the second amplification product can encode full-length Vβ and Dβ segments because full-length Vβ and Dβ segments were present in the single αβ T cell that provided the source RNA, or the second amplification product can encode full-length Vδ and Dδ segments because full-length Vδ and Dδ segments were present in the single γδ T cell that provided the source RNA. In some cases, the second amplification product of the nested amplification reaction provided herein can include V, D, and J segments of the β chain (VβDβJβ or VDJβ) or V, D, and J segments of the δ chain (VδDδJδ or VDJδ) for a single αβ or γδ T cell, respectively. For example, the second amplification product can encode full-length Vβ, Dβ, and Jβ segments because full-length Vβ, Dβ, and Jβ segments were present in the single αβ T cell that provided the source RNA, or the second amplification product can encode full-length Vδ, Dδ, and Jδ segments because full-length Vδ, Dδ, and Jδ segments were present in the single γδ T cell that provided the source RNA. In some cases, the second amplification product of the nested amplification reaction provided herein can include an L sequence and a V, D, and J segment of a β chain (L-VβDβJβ or L-VDJβ) or an L sequence and a V, D, and J segment of a δ chain (L-VδDδJδ or L-VDJδ) for a single αβ or γδ T cell, respectively. For example, the full length L sequence and full length Vβ, Dβ, and Jβ segments were present in the single αβ T cell that provided the source RNA, and therefore the second amplification product can encode the full length L sequence and full length Vβ, Dβ, and Jβ segments, or the full length L sequence and full length Vδ, Dδ, and Jδ segments were present in the single γδ T cell that provided the source RNA, and therefore the second amplification product can encode the full length L sequence and full length Vδ, Dδ, and Jδ segments.

[0053] In some cases, the second amplification product of the nested amplification reaction provided herein can comprise at least a portion of the V, D, and J segments of the β chain and the C region (VβDβJβCβ or VDJCβ) or at least a portion of the V, D, and J segments of the δ chain and the C region (VδDδJδCδ or VDJCδ) for a single αβ or γδ T cell, respectively. For example, the second amplification product can encode full-length Vβ, Dβ, and Jβ segments and at least a portion of Cβ, since full-length Vβ, Dβ, and Jβ segments and at least a portion of Cβ were present in the single αβ T cell that provided the source RNA, or the second amplification product can encode full-length Vδ, Dδ, and Jδ segments and at least a portion of Cδ, since full-length Vδ, Dδ, and Jδ segments and at least a portion of Cδ were present in the single γδ T cell that provided the source RNA.

[0054] In some cases, the second amplification product of the nested amplification reaction provided herein can comprise, for a single αβ or γδ T cell, an L sequence, a V, D and J segment of the β chain, and at least a portion of the C region (L-VβDβJβCβ or L-VDJCβ) or an L sequence, a V, D and J segment of the δ chain, and at least a portion of the C region (L-VδDδJδCδ or L-VDJCδ), respectively. For example, the second amplification product can encode the full-length L sequence, full-length Vβ, Dβ, and Jβ segments, and at least a portion of Cβ, since the full-length L sequence, full-length Vβ, Dβ, and Jβ segments, and at least a portion of Cβ were present in the single αβ T cell that provided the source RNA, or the second amplification product can encode the full-length L sequence, full-length Vδ, Dδ, and Jδ segments, and at least a portion of Cδ, since the full-length L sequence, full-length Vδ, Dδ, and Jδ segments, and at least a portion of Cδ were present in the single γδ T cell that provided the source RNA. Examples of second amplification products encoding the full-length L sequence, full-length Vβ, Dβ, and Jβ segments, and at least a portion of Cβ are shown in the lower panels of Figures 2B and 3B.

[0055] In some cases, the first and / or second amplification products of the nested amplification reactions provided herein begin at the ATG start site of the L sequence and proceed downstream into the L sequence. An example of this is shown in the bottom panels of Figures 2A and 2B.

[0056] In some cases, the first and / or second amplification products of the nested amplification reaction provided herein can include a portion of the 5' untranslated region located upstream of the L sequence, because that portion was present in the single T cell that provided the source RNA. An example of this is shown in the lower panel of Figures 3A and 3B. When including a portion of the 5' untranslated region located upstream of the L sequence in the first and / or second amplification products of the nested amplification reaction provided herein, any suitable length of 5' untranslated region can be included that starts at the nucleotide preceding the ATG start site of the L sequence and acts upstream. For example, 0 nucleotides to about 100 or more nucleotides (e.g., 0 nucleotides to 100 nucleotides, 0 nucleotides to 50 nucleotides, 0 nucleotides to 25 nucleotides, 0 nucleotides to 10 nucleotides, 0 nucleotides to 5 nucleotides, 0 nucleotides to 3 nucleotides, 3 nucleotides to 100 nucleotides, 3 nucleotides to 50 nucleotides, 3 nucleotides to 25 nucleotides, 3 nucleotides to 10 nucleotides, 3 nucleotides to 5 nucleotides, 5 nucleotides to 100 nucleotides, 5 nucleotides to 50 nucleotides, 5 nucleotides to 25 nucleotides, or 5 nucleotides to 10 nucleotides) of the 5' untranslated region may be included in the first and / or second amplification product.In some cases, the first amplification product of the nested amplification reactions provided herein comprises from 0 to about 100 or more nucleotides (e.g., 0 nucleotides to 100 nucleotides, 0 nucleotides to 50 nucleotides, 0 nucleotides to 25 nucleotides, 0 nucleotides to 10 nucleotides, 0 nucleotides to 5 nucleotides, 0 nucleotides to 3 nucleotides, 3 nucleotides to 100 nucleotides, 3 nucleotides to 50 nucleotides, 3 nucleotides to 25 nucleotides, 3 nucleotides to 10 nucleotides, 3 nucleotides to 5 nucleotides, 5 nucleotides to 100 nucleotides, 5 nucleotides to 50 nucleotides, 5 nucleotides to 25 nucleotides, or 5 nucleotides to 10 nucleotides) of the 5' untranslated region of the α or γ chain. nucleotides), and the second amplification product of the nested amplification reactions provided herein can contain from 0 to about 100 or more nucleotides of a β or δ strand (e.g., 0 nucleotides to 100 nucleotides, 0 nucleotides to 50 nucleotides, 0 nucleotides to 25 nucleotides, 0 nucleotides to 10 nucleotides, 0 nucleotides to 5 nucleotides, 0 nucleotides to 3 nucleotides, 3 nucleotides to 100 nucleotides, 3 nucleotides to 50 nucleotides, 3 nucleotides to 25 nucleotides, 3 nucleotides to 10 nucleotides, 3 nucleotides to 5 nucleotides, 5 nucleotides to 100 nucleotides, 5 nucleotides to 50 nucleotides, 5 nucleotides to 25 nucleotides, or 5 nucleotides to 10 nucleotides).

[0057] In one embodiment, the first and second amplification products can encode full-length VJ and VDJ segments because they were present in the single T cell that provided the source RNA. For example, human αβ T cells with a TCR that includes Vα1.2, Jα32, Vβ11.3, Dβ2, and Jβ1-5 segments can be sorted into separate wells and lysed to release the RNA of the T cells. The RNA can be used to generate cDNA via reverse transcription, and the generated cDNA can be used as a template in a nested amplification reaction to generate a first amplification product that includes a nucleic acid sequence encoding the full-length Vα1.2 and Jα32 segments present in the human αβ T cells, and a second amplification product that includes a nucleic acid sequence encoding the full-length Vβ11.3, Dβ2, and Jβ1-5 segments present in the human αβ T cells.

[0058] As another example, the first and second amplification products can encode a full-length VJ segment comprising the L sequence, a full-length VDJ segment comprising the L sequence, and at least a portion of each of the C regions, because the full-length VJ segment comprising the L sequence, a full-length VDJ segment comprising the L sequence, and at least a portion of each of the C regions were present in the single T cell that provided the source RNA. For example, human αβ T cells having a TCR comprising a Vα1.2 segment comprising the L sequence, a Jα32 segment, a Cα region, a Vβ11.3 segment comprising the L sequence, a Dβ2 segment, a Jβ1.5 segment, and a Cβ region can be sorted into separate wells and lysed to release the RNA of the T cells. The RNA can be used to generate cDNA via reverse transcription, and the generated cDNA can be used as a template in a nested amplification reaction to generate a first amplification product comprising a nucleic acid sequence encoding the full-length Vα1.2 and Jα32 segments containing the L sequence present in the human αβT cells, and at least a portion of the 5' end of Cα, and a second amplification product comprising a nucleic acid sequence encoding the full-length Vβ11.3, Dβ2, and Jβ1-5 segments containing the L sequence present in the human αβT cells, and at least a portion of the 5' end of Cβ.

[0059] When including a portion of a C region in the first and / or second amplification products of the nested amplification reactions provided herein, any suitable length of a C region starting from the 5' end of the C region may be included. For example, about 15 nucleotides to about 550 or more nucleotides of the C region (e.g., about 15 nucleotides to about 550 nucleotides, about 15 nucleotides to about 450 nucleotides, about 15 nucleotides to about 400 nucleotides, about 15 nucleotides to about 300 nucleotides, about 15 nucleotides to about 200 nucleotides, about 15 nucleotides to about 100 nucleotides, about 15 nucleotides to about 50 nucleotides, about 20 nucleotides to about 550 nucleotides, about 20 nucleotides to about 450 nucleotides, about 20 nucleotides to about 400 nucleotides, about 20 nucleotides to about 300 nucleotides, about 20 nucleotides to about 200 nucleotides, about 20 nucleotides to about 100 nucleotides, or about 20 nucleotides to about 50 nucleotides) may be contained in the first and / or second amplification products. In some cases, a first amplification product of a nested amplification reaction provided herein can include the first 15 to about 450 nucleotides of the Cα or Cγ region, and a second amplification product of a nested amplification reaction provided herein can include the first 15 to about 550 nucleotides of the Cβ or Cδ region.

[0060] As described herein, the methods and materials provided herein can allow the user to successfully capture most, if not all, functional TCRs from a sorted T cell population. For example, the nested amplification (e.g., nested PCR) method provided herein can include using a primer collection designed to amplify all known functional V segments of the two variable chains of a particular TCR of a mammal (e.g., human) (e.g., any of the known functional V segments of the alpha and beta variable chains of a particular alpha beta TCR, or any of the known functional V segments of the gamma and delta variable chains of a particular gamma delta TCR). For humans, the nested amplification method provided herein can include a primer collection designed to amplify all 45 V segments of the alpha chain currently known to be functional, and all 48 V segments of the beta chain currently known to be functional. When referring to the TCR V segments of the alpha chain herein, the shortened abbreviation TRAV can be used. Similarly, when referring to the TCR V segments of the beta chain herein, the shortened abbreviation TRBV can be used. The same is true for the TCR V-segments of the gamma and delta chains, which can be referred to as TRGV and TRDV, respectively. The 45 TRAVs currently known to be functional in humans are listed in column 2 of Table 1, while the 48 TRBVs currently known to be functional in humans are listed in column 2 of Table 2.

[0061] [Table 1] JPEG0007661377000002.jpg41160

[0062] [Table 2] JPEG0007661377000004.jpg80164

[0063] In some cases, when using a primer set containing the primers of Table 1 described herein, the hTRAV38_2DV8_F primer listed in Table 1 can be replaced with GGACCTGTGAGCATGGCATG (SEQ ID NO: 283), GTTCAGATCAGAAGAGGAGGCTTC (SEQ ID NO: 284), or CTCAAGGTTCAGATCAGAAGAGGAG (SEQ ID NO: 285).

[0064] In some cases, when using a primer set containing the primers of Table 1 described herein, the hTRAV39_F primer listed in Table 1 can be replaced with ATCTGAGTTTTCAGTGAACTGGACAG (SEQ ID NO: 286), CTCCTAAATCTGAGTTTTCAGTGAACT (SEQ ID NO: 287), or CAAGGCTCCTAAATCTGAGTTTTCAGTG (SEQ ID NO: 288).

[0065] In some cases, when using a primer set containing the primers of Table 2 described herein, the hTRBV13_F primer listed in Table 2 can be replaced with CACCCCAGGAGACCAGCAAC (SEQ ID NO: 289), GGAGCAAAAGCCCTGCTTTCT (SEQ ID NO: 290), or AAACGGTGAGGAGGAGCAAAAG (SEQ ID NO: 291).

[0066] In some cases, when using a primer set containing the primers of Table 2 described herein, the hTRBV14_F primer listed in Table 2 can be replaced with CTTGTAAGCTCCTTCTTCATCTGGAAATG (SEQ ID NO: 292), CAGATTTGCTTTCCTTTTTCTCATAC (SEQ ID NO: 293), or TTACAGGGCCAAGAGACAGATTTG (SEQ ID NO: 294).

[0067] For mice, the nested amplification method provided herein can include a primer collection designed to amplify all 104 V segments of the α chain currently known to be functional and all 22 V segments of the β chain currently known to be functional. The 104 TRAVs currently known to be functional in mice are listed in column 2 of Table 3, while the 22 TRBVs currently known to be functional in mice are listed in column 2 of Table 4.

[0068] [Table 3] JPEG0007661377000006.jpg219161JPEG0007661377000007.jpg211162

[0069] [Table 4]

[0070] Any suitable primer collection can be used during the first round of amplification of the nested amplification reaction provided herein to amplify nucleic acids comprising α and β chains or γ and δ chains nucleic acids. In some cases, the primer collection can include at least one forward primer designed to amplify at least one TRAV (or at least one TRGV) and at least one forward primer designed to amplify at least one TRBV (or at least one TRGV). For humans, generally, this means that the forward primer collection can be designed to include at least 45 forward TRAV-specific primers (one for each of the 45 TRAVs in humans) and at least 48 forward TRBV-specific primers (one for each of the 48 TRBVs in humans), and for mice, this means that the forward primer collection can be designed to include at least 104 forward TRAV-specific primers (one for each of the 104 TRAVs in mice) and at least 22 forward TRBV-specific primers (one for each of the 22 TRBVs in mice). For example, for humans, for a total of at least 93 forward TRAV and TRBV primers, for the alpha chain potential, a first forward TRAV primer can be designed to amplify TRAV1-1, a second forward TRAV primer can be designed to amplify TRAV1-2, a third forward TRAV primer can be designed to amplify TRAV2, a fourth forward TRAV primer can be designed to amplify TRAV3, a fifth forward TRAV primer can be designed to amplify TRAV4, etc. (see, e.g., the target TRAVs listed in Table 1), and for the beta chain potential, a first forward TRBV primer can be designed to amplify TRBV2, a second forward TRBV primer can be designed to amplify TRBV3, a third forward TRBV primer can be designed to amplify TRBV4-1, a fourth forward TRBV primer can be designed to amplify TRBV4-2, a fifth forward TRBV primer can be designed to amplify TRBV4-3, a fifth forward TRBV primer can be designed to amplify TRBV4-4, etc. A third forward TRBV primer can be designed to amplify TRBV-2, a fifth forward TRBV primer can be designed to amplify TRBV4-3, etc. (see, e.g., the target TRBVs listed in Table 2).

[0071] In some cases, when there is an opportunity during the first round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein to amplify possible combinations of α and β chains (or possible combinations of γ and δ chains) using at least one forward primer designed to amplify at least one TRAV (or at least one TRGV) and at least one forward primer designed to amplify at least one TRBV (or at least one TRDV), multiple primers can be synthesized and each combined into a single first round of amplification reaction. For example, when there is an opportunity during the first round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein to amplify possible combinations of human α and β chains (e.g., all TRAV and TRBVs listed in Tables 1 and 2) using at least 93 different forward TRAV and TRBV primers in the case of humans, multiple primers (i.e., in this case, at least 93) can be synthesized and each combined into a single first round of amplification reaction. In some cases, the number of forward primers can be reduced without losing the ability to amplify all possible combinations of α and β chains (or all possible combinations of γ and δ chains) present in single cell sorted T cells (e.g., all TRAVs and TRBVs listed in Tables 1 and 2) during the first round of amplification of the nested amplification reaction (e.g., nested PCR) provided herein. For example, a single forward TRAV primer can be designed to have the ability to amplify more than one different TRAV. An example of such a primer for humans is the hTRAV1_12_F primer (primer number 1 in Table 1), which is designed to amplify both TRAV1-2 and TRAV1-2. In some cases, a single forward TRBV primer can be designed to have the ability to amplify more than one different TRBV.Examples of such primers for humans include, but are not limited to, the hTRBV4_123_F primer (primer number 3 in Table 2), which is designed to amplify TRBV4-1, TRBV4-2, and TRBV4-3, the hTRBV6_23_F primer (primer number 8 in Table 2), which is designed to amplify both TRBV6-2 and TRBV6-3, the hTRBV10_12_F primer (primer number 14 in Table 2), which is designed to amplify both TRBV10-1 and TRBV10-2, and the hTRBV12_34_F primer (primer number 18 in Table 2), which is designed to amplify both TRBV12-3 and TRBV12-4.

[0072] In some cases, when the hTRAV1_12_F primer, the hTRBV4_123_F primer, the hTRBV6_23_F primer, the hTRBV10_12_F primer, and the hTRBV12_34_F primer are used in combination with other primers for each of the human TRAVs and TRBVs not targeted by these five primers, the number of forward primers for amplifying all human TRAVs and TRBVs listed in Tables 1 and 2 during the first round of amplification of the nested amplification reaction (e.g., nested PCR) provided herein can be reduced from 93 forward primers to 81. Similarly, as shown in Tables 3 and 4, when a single primer is used to target multiple TRAVs or TRBVs listed in Tables 3 and 4, the number of forward primers for amplifying all mouse TRAVs and TRBVs listed in Tables 3 and 4 during the first round of amplification of the nested amplification reaction (e.g., nested PCR) provided herein can be reduced from 126 forward primers to 64.

[0073] Sequence alignment of multiple TRAV sequences (or multiple TRBV, TRGV, or TRDV sequences) can be used to select a single forward TRAV primer (or a single forward TRBV, TRGV, or TRDV primer) capable of amplifying more than one different TRAV (or more than one different TRBV, TRGV, or TRDV). For example, referring to FIG. 5, the nucleotide sequences of the portion of the 5' untranslated region upstream of the ATG start site, the ATG start site, and the portion of the translated region downstream of the ATG start site for multiple TRAVs (e.g., mouse TRAV13-1, TRAV13D-1, TRAV13N-1, TRAV13-2, TRAV13D-2, TRAV13N-2, TRAV13-3, TRAV13D-3, TRAV13N-3, TRAV13-4, TRAV13D-4, TRAV13N-4, and TRAV13-5) can be aligned. Once aligned, the primer sequence may be selected, for example, the sequence highlighted in a box in FIG. 5 for mTRAV13_F (SEQ ID NO: 99). In some cases, a primer sequence lacking mismatches with respect to any of the aligned TRAV sequences (or aligned TRBV, TRGV, or TRDV sequences) may be selected. As shown in FIG. 5, in some cases, a primer sequence having several mismatches (e.g., one or two mismatches) with respect to the aligned TRAV sequences (or aligned TRBV, TRGV, or TRDV sequences) may be selected. For example, the mTRAV13_F primer (SEQ ID NO: 99) shown in FIG. 5 was selected, which has one mismatch with each of TRAV13D-1, TRAV13-2, TRAV13D-2, TRAV13-3, TRAV13-4, TRAV13D-4, TRAV13N-4, and TRAV13-5, and no mismatches with the other five TRAVs. For those primers designed to target TRAV, TRBV, TRGV, or TRDV sequences with only a few mismatches (e.g., one or two mismatches), the ability of the designed primer to amplify the target with mismatches can be confirmed via PCR testing using the designed primer, reverse primer, and target.Successful production of an amplified target nucleic acid can confirm the ability of the designed primers to amplify the target, even if it contains a mismatch.

[0074] In some cases, a reduction in the number of primer preparations for amplifying all possible combinations of human α and β chains (or all possible combinations of γ and δ chains) present in single cell sorted T cells (e.g., all TRAV and TRBVs listed in Tables 1 and 2) can be achieved. For example, a single primer preparation can be synthesized in a manner designed to contain a mixture of two or more sequences, each targeting a different TRAV or TRBV. For example, the hTRAV8_246_F primer in Table 1 can be synthesized with the 5'-CCWCTGCTCAGCCATGCTC-3' (SEQ ID NO: 10) sequence, resulting in primer preparations with separate sequences targeting TRAV8-2, TRAV8-4, and TRAV8-6.Other examples include the hTRAV12_123_F primer of Table 1, which may be synthesized using the 5'-CCAGGGCAGARAAGAATGATG-3' (SEQ ID NO: 14) sequence to provide a primer preparation with separate sequences targeting TRAV12-1, TRAV12-2, and TRAV12-3; the hTRBV5_468_F primer of Table 2, which may be synthesized using the 5'-CAGAAYTCACTCGGCTCTTC-3' (SEQ ID NO: 44) sequence to provide a primer preparation with separate sequences targeting TRBV5-4, TRBV5-6, and TRBV5-8; the hTRBV6_1689_F primer of Table 2, which may be synthesized using the 5'-CYYCCTTGAGAGTCCTGTTC-3' (SEQ ID NO: 47) sequence to provide a primer preparation with separate sequences targeting TRBV6-1, TRBV6-6, TRBV6-8, and TRBV6-9; These primers include, but are not limited to, the hTRBV7_24_F primer in Table 2, which can be synthesized using the 5'-CCTCTGCTCCTGCTCAYAGTGA-3' (SEQ ID NO: 51) sequence to provide a primer preparation having separate sequences targeting TRBV7-2 and TRBV7-4, the hTRBV7_36789_F primer in Table 2, which can be synthesized using the 5'-CAGTGACMCTGATCTGGTAAAG-3' (SEQ ID NO: 52) sequence to provide a primer preparation having separate sequences targeting TRBV7-3, TRBV7-6, TRBV7-7, TRBV7-8, and TRBV7-9, and the hTRBV11_13_F primer in Table 2, which can be synthesized using the 5'-TCCCACYTCCTCTGC-TCCTG-3' (SEQ ID NO: 56) sequence to provide a primer preparation having separate sequences targeting TRBV11-1 and TRBV11-3.

[0075] In some cases, for humans, a primer collection for a first round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein can include the TRAV and TRBV primers set forth in Tables 1 and 2, or a subset of the TRAV and TRBV primers set forth in Tables 1 and 2. For example, a primer collection for a first round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein can include 1, 5, 10, 20, 30, 35 or more of the TRAV primers set forth in Table 1, or can include 1, 5, 10, 20, 30 or more of the TRBV primers set forth in Table 2, or can include 1, 5, 10, 20, 30, 40, 50, 60, 70 or more of the TRAV and TRBV primers set forth in Tables 1 and 2. In some cases, for humans, the primer collection for the first round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein includes the TRAV and TRBV primers listed in Tables 1 and 2, and may not include other primers having sequences of Vα or Vβ segments, L sequences of Vα or Vβ segments, or sequences of the 5' untranslated region upstream of a Vα or Vβ segment. In some cases, using a reduced set of forward primer preparations, such as the 72 listed in Tables 1 and 2, during the first round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein, having the opportunity to amplify possible combinations of human α and β chains present in single cell sorted T cells (e.g., all TRAV and TRBV listed in Tables 1 and 2) may result in efficient amplification across many different separate locations (e.g., across many different wells), and efficient downstream cloning (e.g., greater than 80, 85, 90, or 95 percent success based on the number of separate locations containing single T cells).

[0076] In some cases, the primer collection for the first round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein can be divided into two or more subsets, including each subset used to perform the first round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein using a portion of a cDNA obtained from a single T cell as a template. In some cases, for a human, for example, the primer collection for the first round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein can be divided into two or more subsets (e.g., a first subset including only the TRAV primers listed in Table 1, and a second subset including only the TRBV primers listed in Table 2, or a first subset of TRAV and TRBV primers listed in Tables 1 and 2 and a second subset of TRAV and TRBV primers listed in Tables 1 and 2), including each subset used to perform the first round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein using a portion of a cDNA obtained from a single T cell as a template. For example, a first round amplification reaction for TRAV using the primers listed in Table 1 together with one or more reverse primers using a portion of the cDNA obtained from a single T cell can be performed separately from a first round amplification reaction for TRBV with the primers listed in Table 2 together with one or more reverse primers. These separate first round amplification reactions can be followed by separate second round amplifications of nested amplification (e.g., nested PCR). For example, for TRAV, the primers listed in Table 5 together with one or more reverse primers can be used, and for TRBV, the primers listed in Table 6 together with one or more reverse primers can be used. In some cases, separate first round amplification reactions for the same single cell can be pooled, and the pooled mixture can be used as a template for the second round amplification of nested amplification (e.g., nested PCR).For example, using a portion of the cDNA obtained from a single T cell, a first round amplification reaction for TRAV using the primers listed in Table 1 together with one or more reverse primers can be performed separately from a first round amplification reaction for TRBV with the primers listed in Table 2 together with one or more reverse primers, followed by one mixed nested amplification reaction (e.g., nested PCR) for both TRAV and TRBV using the primers listed in Tables 5 and 6 together with reverse primers.

[0077] In some cases, when a specific TCR is identified with a unique TRAV and TRBV combination, variants in the CDR3 region can be identified using a first round of amplification reaction with one forward primer specific for that particular TRAV (e.g., one of the forward primers listed in Table 1) together with one or more reverse primers and one forward primer specific for that particular TRBV (e.g., one of the forward primers listed in Table 2) together with one or more reverse primers. For example, forward primer hTRAV8-246_F (SEQ ID NO: 10) listed in Table 1 together with one or more reverse primers and forward primer hTRBV12-34_F (SEQ ID NO: 58) listed in Table 2 together with one or more reverse primers can be used.

[0078] In some cases, when a combination of a set of TRAV and a set of TRBV are being amplified, only some of the primers listed in Tables 1 and 2 that are specific for those TRAV and TRBV may be used.

[0079] In one embodiment, a first subset of TRAV primers listed in Table 1 (e.g., forward primer numbers 1 to 36 and 39 to 40 in Table 1), a second subset of TRAV primers listed in Table 1 (e.g., forward primer numbers 37 to 38 in Table 1), a first subset of TRBV primers listed in Table 2 (e.g., forward primer numbers 1 to 19 and 22 to 32 in Table 2), and a second subset of TRBV primers listed in Table 2 (e.g., forward primer numbers 1 to 36 and 39 to 40 in Table 1). 21-22) can be used with one or more reverse primers for TRAV and one or more reverse primers for TRBV in four different combinations (e.g., first TRAV subset + first TRBV subset, second TRAV subset + first TRBV subset, first TRAV subset + second TRBV subset, and second TRAV subset + second TRBV subset) of the first round amplification of the nested amplification reaction (e.g., nested PCR) provided herein. In these cases, the resulting first round reaction mixtures can be used separately or after pooling for the second round amplification of the nested amplification method. Similar techniques can be used with the mouse primers of Tables 3 and 4 and / or for the second round amplification described herein.

[0080] In some cases, for example, for a mouse, a primer collection for a first round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein can include TRAV and TRBV primers set forth in Tables 3 and 4, or a subset of the TRAV and TRBV primers set forth in Tables 3 and 4. For example, a primer collection for a first round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein can include 1, 5, 10, 20, 30, 35 or more of the TRAV primers set forth in Table 3, or can include 1, 5, 10, 20, 30 or more of the TRBV primers set forth in Table 4, or can include 1, 5, 10, 20, 30, 40, 50, 60, 70 or more of the TRAV and TRBV primers set forth in Tables 3 and 4. In some cases, for mice, the primer collection for the first round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein includes the TRAV and TRBV primers listed in Tables 3 and 4, and may not include other primers having sequences of Vα or Vβ segments, L sequences of Vα or Vβ segments, or sequences of the 5' untranslated region upstream of a Vα or Vβ segment. In some cases, using a reduced set of forward primer preparations such as the 53 listed in Tables 3 and 4 during the first round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein to have the opportunity to amplify possible combinations of mouse α and β chains present in single cell sorted T cells (e.g., all TRAV and TRBV listed in Tables 3 and 4) can result in efficient amplification across many different separate locations (e.g., across many different wells) and efficient downstream cloning (e.g., greater than 80, 85, 90, or 95 percent success based on the number of separate locations containing single T cells).

[0081] In some cases, some or all of the forward primers in the primer collection for the first round of amplification of the nested amplification reaction (e.g., nested PCR) provided herein can be entirely composed of sequences that anneal to the nucleic acid of the cDNA encoding the TCR with 1, 2, or 3 or less mismatches (e.g., with 1 or less mismatches, with 2 or less mismatches, or with 3 or less mismatches). For example, the entire nucleic acid sequence of some or all of the forward primers in the primer collection for the first round of amplification of the nested amplification reaction (e.g., nested PCR) provided herein can be derived from the V segment, the L sequence of the V segment, or the 5' untranslated region found upstream of the V segment. In such cases, the forward primers can lack exogenous nucleic acid sequences, such as primer barcode sequences or primer adapter sequences. An example of a forward Vα primer collection for the first round of the nested amplification reaction described herein, in which the sequence of each primer is entirely composed of sequences that anneal to the nucleic acid of the cDNA encoding the TCR, is shown diagrammatically in the top panel of FIG. 2A. The same for the forward Vβ primer collection for the first round of the nested amplification reaction described herein is shown in the top panel of Figure 2B. When using the forward primers of the primer collection for the first round of amplification of the nested amplification reaction (e.g., nested PCR) provided herein that lack exogenous nucleic acid sequences, highly efficient amplification of nucleic acid encoding the variable chain of the TCR from a single T cell can be achieved.

[0082] In some cases, each forward primer of the primer collection for the first round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein may consist of a sequence having a majority of its nucleotides designed to anneal to the 5' untranslated region found upstream of the V segment of a cDNA encoding a TCR. In some cases, all of the sequences of each forward primer of the primer collection for the first round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein may be designed to anneal to the 5' untranslated region, the 5' untranslated region + ATG start site, or the 5' untranslated region + ATG start site + 5 or less nucleotides downstream of the ATG start site. The primer collection listed in Table 1 is an example of a forward Vα primer collection for the first round of the nested amplification reaction described herein, where each primer anneals to the 5' untranslated region, the 5' untranslated region + ATG start site, or the 5' untranslated region + ATG start site + 5 or less nucleotides downstream of the ATG start site, and the primer collection in Table 2 is an example of a forward Vβ primer collection for the first round of the nested amplification reaction described herein, where each primer anneals to the 5' untranslated region, the 5' untranslated region + ATG start site, or the 5' untranslated region + ATG start site + 5 or less nucleotides downstream of the ATG start site.

[0083] In some cases, some or all of the forward primers of the primer collection for the first round of amplification of the nested amplification reaction (e.g., nested PCR) provided herein may include a primer barcode sequence and / or a primer adapter sequence (see, e.g., the top panel of Figures 3A and 3B). For example, all of the forward primers of the primer collection for the first round of amplification of the nested amplification reaction (e.g., nested PCR) provided herein may have a 5' primer adapter sequence followed by a primer sequence targeting the V segment, the L sequence of the V segment, and / or the 5' untranslated region found upstream of the V segment (see, e.g., Figures 3A and 3B). In these cases, the second round of amplification of the nested amplification reaction using the amplification products from the first round as templates may use a single forward primer specific to the adapter sequence added to all the amplification products during the first round (see, e.g., the middle panel of Figures 3A and 3B). In some cases, the added 5' adapter sequence from the forward primer for the first round of the nested amplification reaction provided herein may be used to aid in cloning the first and second amplification products into an expression vector.

[0084] As used herein, the term "primer barcode sequence" refers to an identifiable nucleotide sequence that is at least about 15 nucleotides in length (e.g., about 15 to about 50 nucleotides, about 15 to about 40 nucleotides, about 15 to about 30 nucleotides, about 20 to about 50 nucleotides, about 20 to about 40 nucleotides, or about 20 to about 30 nucleotides) and that is added to a primer (e.g., a PCR primer) sequence designed to anneal to a template sequence such that the amplification product produced contains both the amplified template sequence and the added identifiable nucleotide sequence. When performing multiple amplification reactions in multiple formats, at least one primer used in each unique location (e.g., in each reaction mixture) can contain a unique primer barcode sequence that allows the user to match the amplification product to that particular reaction mixture based on the sequence of the primer barcode sequence. For example, the forward primer of a primer pair designed to amplify a Vα segment may contain a 5'-AAAA-3' sequence added to the 5' end of the primer specific for that Vα segment for the primer pair used at location number 1 (e.g., well number 1), while the forward primer of a primer pair designed to amplify the same Vα segment may contain a 5'-TTTT-3' sequence added to the 5' end of the same primer specific for that Vα segment for the primer pair used at location number 2 (e.g., well number 2), the forward primer of a primer pair designed to amplify the same Vα segment may contain a 5'-GGGG-3' sequence added to the 5' end of the same primer specific for that Vα segment for the primer pair used at location number 3 (e.g., well number 3), etc. In this case, any amplification product of that Vα segment that contains AAAA in the appropriate region of the amplification product based on the primer sequence may be identified as originating from location number 1.As described herein, in some cases, the TCR cloning methods provided herein may be performed using a nested amplification method (e.g., a nested PCR method) that involves using primers designed to amplify variable region sequences without including a primer barcode sequence.

[0085] As used herein, the term "primer adapter sequence" refers to a known nucleotide sequence that is at least about 15 nucleotides in length (e.g., about 15 to about 50 nucleotides, about 15 to about 40 nucleotides, about 15 to about 30 nucleotides, about 20 to about 50 nucleotides, about 20 to about 40 nucleotides, or about 20 to about 30 nucleotides) and that is added to a primer (e.g., a PCR primer) sequence designed to anneal to a template sequence such that the amplification product produced contains both the amplified template sequence and the added known nucleotide sequence. When performing a nested amplification reaction, at least one primer used during an initial amplification round of a nested amplification method (e.g., the first round of a nested PCR method) may contain a fixed primer adapter sequence that allows a primer for a subsequent round of a nested amplification method (e.g., the second round of a nested PCR method) to be designed to anneal to its added primer adapter sequence from the first round. This allows the user to take advantage of the fixed primer adapter sequence added to the amplified template via a primer having the primer adapter sequence, by designing a primer to the added primer adapter sequence for a subsequent step or method. As described herein, in some cases, the TCR cloning methods provided herein may be performed using a first round of nested amplification (e.g., PCR) methods that include using primers designed to amplify the variable region sequence without including the primer adapter sequence.

[0086] When these 5' primer adapter sequences on the forward primers of the first round of amplification of the nested amplification reaction (e.g., nested PCR) provided herein are not used (as shown diagrammatically in the top panel of Figures 2A and 2B), then the primer collection for the second round of the nested amplification reaction (e.g., nested PCR) provided herein can be designed to include a set of forward primers specific to each variable chain of the TCR (e.g., each TRAV and TRAB or each TRGV and TRDV) in a manner similar to that of the forward primers for the first round (see, e.g., the middle panel of Figures 2A and 2B). For example, when the forward primers of the first round are designed to generate amplification products from various possible variable chains without adding extra 5' sequences to the amplification products that are not found in the original cDNA used as a template, then the forward primers for the second round can be designed to target the 5' portions of those amplification products generated during the first round.

[0087] In some cases, the second round forward primer of the nested amplification reaction (e.g., nested PCR) provided herein can be designed to target a sequence of the first round amplification product that includes or is upstream of the ATG start site of the L sequence of the V segment, such that the first and second amplification products of the nested amplification reaction used to clone a functional TCR include the ATG start site. In some cases, for humans, the primer collection for the second round of amplification of the nested amplification reaction (e.g., nested PCR) provided herein can include the TRAV and TRBV primers set forth in Tables 5 and 6, or a subset of the TRAV and TRBV primers set forth in Tables 5 and 6. For example, a primer collection for a second round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein can include 1, 5, 10, 20, 30, 35 or more of the TRAV primers set forth in Table 5, or can include 1, 5, 10, 20, 30 or more of the TRBV primers set forth in Table 6, or can include 1, 5, 10, 20, 30, 40, 50, 60, 70 or more of the TRAV and TRBV primers set forth in Tables 5 and 6. In some cases, for humans, a primer collection for a second round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein can include the TRAV and TRBV primers set forth in Tables 5 and 6, and can not include other primers having sequences of a Vα or Vβ segment, L sequences of a Vα or Vβ segment, or sequences of the 5' untranslated region upstream of a Vα or Vβ segment.

[0088] [Table 5] JPEG0007661377000010.jpg239150JPEG0007661377000011.jpg240151JPEG0007661377000012.jpg201149

[0089] [Table 6] JPEG0007661377000014.jpg248160

[0090] In some cases, for mice, the primer collection for the second round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein can include the TRAV and TRBV primers set forth in Tables 7 and 8, or a subset of the TRAV and TRBV primer sets set forth in Tables 7 and 8. For example, the primer collection for the second round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein can include 5, 10, 20, 30, 35 or more of the TRAV primers set forth in Table 7, or can include 5, 10, 20, 30 or more of the TRBV primers set forth in Table 8, or can include 5, 10, 20, 30, 40, 50, 60, 70 or more of the TRAV and TRBV primers set forth in Tables 7 and 8. In some cases, for mice, the primer collection for the second round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein includes the TRAV and TRBV primers set forth in Tables 7 and 8, and may not include other primers having sequences of a Vα or Vβ segment, an L sequence of a Vα or Vβ segment, or a sequence of the 5' untranslated region upstream of a Vα or Vβ segment.

[0091] [Table 7] JPEG0007661377000016.jpg234159JPEG0007661377000017.jpg250160JPEG0007661377000018.jpg235164

[0092] [Table 8] JPEG0007661377000020.jpg36149

[0093] In some cases, the primer collection for the second round of amplification of the nested amplification reaction (e.g., nested PCR) provided herein can be divided into two or more subsets, each of which is used to perform the second round of amplification of the nested amplification reaction (e.g., nested PCR) provided herein using a portion of the amplification reaction resulting from the first round of amplification as a template. In some cases, for humans, for example, the primer collection for the second round of amplification of the nested amplification reaction (e.g., nested PCR) provided herein can be divided into two or more subsets (e.g., a first subset of TRAV and TRBV primers listed in Tables 5 and 6, and a second subset of TRAV and TRBV primers listed in Tables 5 and 6), each of which is used to perform the second round of amplification of the nested amplification reaction (e.g., nested PCR) provided herein using a portion of the amplification reaction resulting from the first round of amplification as a template. In some cases, for a mouse, the primer collection for the second round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein can be divided into two or more subsets (e.g., a first subset of TRAV and TRBV primers set forth in Tables 7 and 8 and a second subset of TRAV and TRBV primer sets set forth in Tables 7 and 8), with each subset being used to perform a second round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein using a portion of the amplification reaction resulting from the first round of amplification as a template. The results of these separate second round amplifications of nested amplification reactions (e.g., nested PCR) for cDNA obtained from the same single T cell can be combined, and the combination can be used to assemble an expression vector, as described herein.

[0094] In some cases, forward primers for the second round of nested amplification reactions provided herein can be designed to include a primer barcode sequence and / or a primer adapter sequence (see, e.g., the middle panels of Figures 2A and 2B). For example, all forward primers in a primer collection for the second round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein can have a 5' primer adapter sequence followed by a primer sequence targeting a V segment, an L sequence of a V segment, and / or a 5' untranslated region found upstream of a V segment (see, e.g., Figures 2A and 2B). In some cases, the added 5' adapter sequence from a forward primer for the second round of nested amplification reactions provided herein can be used to aid in cloning the first and second amplification products into an expression vector. In some cases, any one or more of the primer sequences listed in Tables 5-8 can be designed to include a primer adapter sequence at the 5' end of the sequence shown to create a forward primer for the second round of nested amplification reactions provided herein, for example, as shown in Figures 2A and 2B. For example, all of the primer sequences listed in Tables 5 and 6 can be designed to include a primer adapter sequence at the 5' end of the indicated sequence.

[0095] Any suitable primer adapter sequence can be added to a primer, e.g., a first round primer, in which case the primer adapter sequence can serve as a target for the second round forward primer of the nested amplification methods described herein, as well as an overlapping sequence to aid in cloning of the first and second amplification products into an expression vector, or a second round primer, in which case the primer adapter sequence can serve as an overlapping sequence to aid in cloning of the first and second amplification products into an expression vector. In some cases, the primer adapter sequence can be about 15 to about 50 nucleotides in length (e.g., about 15 to about 45 nucleotides, about 15 to about 40 nucleotides, about 15 to about 30 nucleotides, about 20 to about 50 nucleotides, about 20 to about 40 nucleotides, or about 20 to about 30 nucleotides). Examples of primer adapter sequences that can be used as described herein include, but are not limited to, TTCAGGTGTCGTGAGGATCTATTTCCGGTG (SEQ ID NO:260); GTGGAAGAAAACCCCGGTCCC (SEQ ID NO:261); TCTCTAGGCGCCGG-AATTCA (SEQ ID NO:262); and TGGAAGAAAACCCCGGTCCC (SEQ ID NO:263).

[0096] As described herein, a primer collection for the first round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein can include a pool of forward primers for targeting TRAV (or TRGV) and a pool of forward primers for targeting TRBV (or TRDV). Such a primer collection can include at least one reverse primer for each pool of forward primers. For example, a primer collection for the first round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein for αβTCR (or γδTCR) may include a set of forward TRAV primers (or forward TRGV primers) described herein and one or more reverse primers designed to pair with one or more of those forward TRAV primers (or those forward TRGV primers) to generate an amplification product having the sequence of TRAV (or TRGV), and a set of forward TRBV primers (or forward TRDV primers) described herein and one or more reverse primers designed to pair with one or more of those forward TRBV primers (or those forward TRDV primers) to generate an amplification product having the sequence of TRBV (or TRDV). In general, for αβTCR (or γδTCR), a reverse primer designed to pair with one or more forward TRAV primers (or forward TRGV primers) in the primer collection for the first round of amplification of the nested amplification reaction provided herein may be designed to be specific to the sequence of the C region of the α chain (or the sequence of the C region of the γ chain). In some cases, one Cα (or Cγ) reverse primer or more than one Cα (or Cγ) reverse primer (e.g., 2, 3, 4, 5 or more Cα (or Cγ) reverse primers) may be used for the first round of amplification of the nested amplification reaction provided herein for αβTCR (or γδTCR).Similarly, for αβTCR (or γδTCR), a reverse primer designed to pair with one or more forward TRBV primers (or forward TRDV primers) in the primer collection for the first round of amplification of the nested amplification reaction provided herein may be designed to be specific to the sequence of the C region of the β chain (or the sequence of the C region of the δ chain). In some cases, one Cβ (or Cδ) reverse primer or more than one Cβ (or Cδ) reverse primer (e.g., 2, 3, 4, 5 or more Cβ (or Cδ) reverse primers) may be used for the first round of amplification of the nested amplification reaction provided herein for αβTCR (or γδTCR).

[0097] In some cases, the primer collection for the first round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein for αβTCR (or γδTCR) may include a set of forward TRAV primers (or forward TRGV primers) described herein and a single reverse primer designed to pair with each of those forward TRAV primers (or those forward TRGV primers) to generate an amplification product having the sequence of TRAV (or TRGV), and a set of forward TRBV primers (or forward TRDV primers) described herein and a single reverse primer designed to pair with each of those forward TRBV primers (or those forward TRDV primers) to generate an amplification product having the sequence of TRBV (or TRDV).

[0098] In general, reverse primers for the primer collection for the first round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein can be designed to be specific for a C region that is about 15 nucleotides to about 550 nucleotides (e.g., about 15 nucleotides to about 500 nucleotides, about 15 nucleotides to about 450 nucleotides, about 15 nucleotides to about 400 nucleotides, about 15 nucleotides to about 300 nucleotides, about 15 nucleotides to about 200 nucleotides, about 15 nucleotides to about 100 nucleotides, about 15 nucleotides to about 50 nucleotides, about 20 nucleotides to about 550 nucleotides, about 20 nucleotides to about 450 nucleotides, about 20 nucleotides to about 400 nucleotides, about 20 nucleotides to about 300 nucleotides, about 20 nucleotides to about 200 nucleotides, about 20 nucleotides to about 100 nucleotides, or about 20 nucleotides to about 50 nucleotides) from the 5'-most nucleotide of the targeted C region. For example, a Cα reverse primer can be designed to be specific for a nucleotide sequence that is from about nucleotide 15 to about nucleotide 450 of the Cα region. For humans and mice, examples of such Cα reverse primers include, but are not limited to, the Cα reverse primers set forth in Table 9. A Cβ reverse primer can be designed to be specific for a nucleotide sequence that is from about nucleotide 15 to about nucleotide 550 of the Cβ region. For humans and mice, examples of such Cβ reverse primers include, but are not limited to, the Cβ reverse primers set forth in Table 10.

[0099] [Table 9]

[0100] [Table 10]

[0101] As described herein, a primer collection for a second round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein can include, for example, a pool of forward primers for targeting TRAV (or TRGV) and a pool of forward primers for targeting TRBV (or TRDV) when a primer adapter sequence is not used during the first round, e.g., as shown in Figures 2A and 2B. Such a primer collection can include at least one reverse primer for each pool of forward primers. For example, a primer collection for a second round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein for αβTCR (or γδTCR) may include a set of forward TRAV primers (or forward TRGV primers) described herein and one or more reverse primers designed to pair with one or more of those forward TRAV primers (or those forward TRGV primers) to generate a first amplification product having the sequence of TRAV (or TRGV), and a set of forward TRBV primers (or forward TRDV primers) described herein and one or more reverse primers designed to pair with one or more of those forward TRBV primers (or those forward TRDV primers) to generate a second amplification product having the sequence of TRBV (or TRDV). Generally, for an αβ TCR (or γδ TCR), a reverse primer designed to pair with one or more forward TRAV primers (or forward TRGV primers) in the primer collection for the second round of amplification of the nested amplification reaction provided herein may be designed to be specific for a sequence of the C region of the α chain (or a sequence of the C region of the γ chain).In some cases, one Cα (or Cγ) reverse primer or more than one Cα (or Cγ) reverse primer (e.g., 2, 3, 4, 5 or more Cα (or Cγ) reverse primers) may be used for the second round of amplification of the nested amplification reaction provided herein for αβTCR (or γδTCR). Similarly, the reverse primer designed to pair with one or more forward TRBV primers (or forward TRDV primers) in the primer collection for the second round of amplification of the nested amplification reaction provided herein for αβTCR (or γδTCR) may be designed to be specific to the sequence of the C region of the β chain (or the sequence of the C region of the δ chain). In some cases, one Cβ (or Cδ) reverse primer or more than one Cβ (or Cδ) reverse primer (e.g., 2, 3, 4, 5 or more Cβ (or Cδ) reverse primers) may be used for the second round of amplification of the nested amplification reaction provided herein for αβTCR (or γδTCR).

[0102] In some cases, the primer collection for the second round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein for αβTCR (or γδTCR) may include a set of forward TRAV primers (or forward TRGV primers) described herein and a single reverse primer designed to pair with each of those forward TRAV primers (or those forward TRGV primers) to generate a first amplification product having the sequence of TRAV (or TRGV), and a set of forward TRBV primers (or forward TRDV primers) described herein and a single reverse primer designed to pair with each of those forward TRBV primers (or those forward TRDV primers) to generate a second amplification product having the sequence of TRBV (or TRDV).

[0103] In general, the reverse primer for the primer collection for the second round amplification of the nested amplification reaction (e.g., nested PCR) provided herein can be designed to be specific for a C region that is about 15 nucleotides to about 550 nucleotides (e.g., about 15 nucleotides to about 500 nucleotides, about 15 nucleotides to about 450 nucleotides, about 15 nucleotides to about 400 nucleotides, about 15 nucleotides to about 300 nucleotides, about 15 nucleotides to about 200 nucleotides, about 15 nucleotides to about 100 nucleotides, about 15 nucleotides to about 50 nucleotides, about 20 nucleotides to about 550 nucleotides, about 20 nucleotides to about 450 nucleotides, about 20 nucleotides to about 400 nucleotides, about 20 nucleotides to about 300 nucleotides, about 20 nucleotides to about 200 nucleotides, about 20 nucleotides to about 100 nucleotides, or about 20 nucleotides to about 50 nucleotides) from the 5'-most nucleotide of the targeted C region, provided that it is within the site of the reverse primer used for the first round when a fully nested amplification method is used. In some cases, the nested amplification methods described herein may be semi-nested, in which case one or more of the reverse primers for the first and second rounds of amplification may be the same. For example, a Cα reverse primer may be designed to be specific to a nucleotide sequence from about nucleotide 1 to about nucleotide 30 of the Cα region when the reverse primer used for the first round is designed to be specific to a sequence from about nucleotide 40 to about nucleotide 70 of the Cα region in a fully nested amplification method. For humans and mice, examples of such Cα reverse primers include, but are not limited to, the Cα reverse primers listed in Table 11. A Cβ reverse primer may be designed to be specific to a nucleotide sequence from about nucleotide 1 to about nucleotide 549 of the Cβ region, provided that the site is within the site of the reverse primer used during the first round in a fully nested amplification method. For humans and mice, examples of such Cβ reverse primers include, but are not limited to, the Cβ reverse primers listed in Table 12.

[0104] [Table 11]

[0105] [Table 12]

[0106] As also described herein, a primer collection for a second round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein can include: (a) one or more forward primers designed to target primer adapter sequences added to the TRAV (or TRGV) amplification product during the first round when a primer adapter sequence is used during the first round, e.g., as shown in FIG. 3A; (b) one or more reverse primers for pairing with the one or more forward primers of (a); (c) one or more forward primers designed to target primer adapter sequences added to the TRBV (or TRDV) amplification product during the first round when a primer adapter sequence is used during the first round, e.g., as shown in FIG. 3B; and (d) one or more reverse primers for pairing with the one or more forward primers of (c).

[0107] In one embodiment, a first round of amplification of a nested amplification reaction (e.g., nested PCR) provided herein can be performed using a primer collection comprising primers described in Tables 1 and 2 together with hTRAC primers of Table 9 as reverse primers to pair with forward primers of Table 1, and hTRBC primers of Table 10 as reverse primers to pair with forward primers of Table 2 (see, e.g., the top panels of Figures 2A and 2B). The amplification products of this first round can be used as templates in a second round of amplification. A second round can be performed using a primer collection comprising primers described in Table 5 (with a primer adapter sequence added at the 5' end), primers found in Table 6 (with a primer adapter sequence added at the 5' end that is different from the adapter sequence used with the primers of Table 5), hTRACn primers of Table 11 as reverse primers to pair with forward primers of Table 5, and hTRBCn primers of Table 12 as reverse primers to pair with forward primers of Table 6 (see, e.g., the middle panels of Figures 2A and 2B). This second round of amplification can result in a first amplification product that includes an adapter sequence, the entire L sequence of the Vα segment, a Vα segment, a Jα segment, and a 5' portion of the Cα region, and a second amplification product that includes a different adapter sequence, the entire L sequence of the Vβ segment, a Vβ segment, a Dβ segment, a Jβ segment, and a 5' portion of the Cβ region (see, e.g., bottom panels of Figures 2A and 2B). The first and second amplification products can be used as described herein to assemble an expression vector capable of expressing a functional TCR cloned from a single T cell.

[0108] Any suitable polymerase enzyme (e.g., a thermostable polymerase enzyme) can be used to carry out the first and / or second round of the nested amplification reaction provided herein. Examples of polymerase enzymes that can be used as described herein include, but are not limited to, Taq DNA polymerase (commercially available from ThermoFisher Scientific), Phusion DNA polymerase (commercially available from ThermoFisher Scientific), Pfu Turbo DNA polymerase (commercially available from Agilent), Q5 High Fidelity DNA polymerase (commercially available from New England Biolabs), and MyFi DNA polymerase (commercially available from Bioline). Other components for carrying out the first and / or second round of the nested amplification reaction provided herein can include, but are not limited to, a suitable polymerase buffer, MgCl2, DMSO, and dNTPs.

[0109] The first and / or second round of the nested amplification reactions provided herein can be performed by contacting the template with a thermostable polymerase (e.g., Taq polymerase) in the presence of a primer collection described herein, dNTPs, and optionally a detergent (e.g., a non-denaturing detergent), and subjecting the reaction mixture to thermal cycling conditions, e.g., 40 cycles of 98°C for 1 minute, 53°C for 30 seconds, and 72°C for 40 seconds.

[0110] In some cases, the first and / or second round forward primers of the nested amplification reactions (e.g., nested PCR) provided herein can be designed to target the V segment amplicons without amplifying the L sequences of those V segments. In such cases, heterologous leader sequences can be used in place of the L sequences of those V segments to facilitate expression of the cloned TCRs on the surface of cells. Such heterologous leader sequences can be provided during the amplification method and / or during assembly of the expression vector. Examples of heterologous leader sequences that can be used as described herein include, but are not limited to, leader sequences encoding the MLTASLLRAVIASICVVSSM (SEQ ID NO: 317) sequence for mouse TRAV, the MSTRLLCWMALCLLGALS (SEQ ID NO: 318) sequence for mouse TRBV, the MLQMWGFVLYLFLMVGAA (SEQ ID NO: 319) sequence for human TRAV, and the MWQFCILCLCVLMASVAT (SEQ ID NO: 320) sequence for human TRBV.

[0111] Once a first amplification product containing a Vα segment (or a Vγ segment), e.g., a first amplification product containing the entire L sequence of a Vα segment, a Vα segment, a Jα segment, and a 5' portion of the Cα region, and a second amplification product containing a Vβ segment (or a Vδ segment), e.g., a second amplification product containing the entire L sequence of a Vβ segment, a Vβ segment, a Dβ segment, a Jβ segment, and a 5' portion of the Cβ region (see, e.g., the lower panel of Figures 2A, 2B, 3A or 3B), are generated, they can be cloned into an expression vector in a manner such that a functional TCR having a combination of α and β variable regions (or a combination of γ and δ variable regions) present in a single T cell source is expressed.

[0112] Any suitable cloning technique can be used to assemble an expression vector designed to express a cloned functional TCR from a single T cell. In some cases, the cloning steps can be performed without the use of restriction enzymes, from the point of obtaining the first and second amplification products to the point of obtaining an assembled expression vector capable of expressing a functional TCR once cloned from a single T cell. In such cases, the cloning technique can be referred to herein as a "seamless" cloning technique. Examples of seamless cloning techniques that can be used to place a first amplification product into a complete α (or γ) chain (e.g., a full-length L sequence, a full-length Vα segment, a full-length Jα segment, and a full-length Cα region) and a second amplification product into a complete β (or δ) chain (e.g., a full-length L sequence, a full-length Vβ segment, a full-length Dβ segment, a full-length Jβ segment, and a full-length Cβ region) in a manner that creates an expression vector designed to express a cloned functional TCR from a single T cell include, but are not limited to, exonuclease-based cloning techniques, such as the Gibson assembly technique, the High-5 assembly technique, and ligation-independent cloning (LIC) and exonuclease-independent cloning techniques, such as the Golden Gate assembly technique and the univector plasmid fusion assembly technique.

[0113] With reference to FIG. 1, the Gibson assembly technique can be performed using the first and second amplification products from the nested amplification reaction provided herein, a separate cloning fragment, and an expression vector designed to receive the first and second amplification products. In some cases, the first amplification product can be designed to have a 5' sequence that overlaps with a portion of the expression vector prepared to receive the first amplification product. This 5' overlapping sequence can be added to the first amplification product via a primer adapter sequence, as described herein. The first amplification product can also be designed to have a 3' sequence that overlaps with the 5' portion of the separate cloning fragment. For example, the 3' portion of the Cα (or Cγ) of the first amplification product can overlap with the 5' portion of the Cα (or Cγ) of the separate cloning fragment. In some cases, as shown in FIG. 1, for example, this separate cloning fragment can be designed to provide any 3' portion of the full-length α chain (or γ chain) that is missing in the first amplification product. In the case of FIG. 1, the separate cloning fragment provides the remainder of the Cα region.

[0114] The second amplification product can be designed to have a 5' sequence that overlaps with the 3' sequence of the separate cloning fragment so that the second amplification fragment can bind to the separate cloning fragment. This 5' overlapping sequence of the second amplification product can be added to the second amplification product via a primer adapter sequence as described herein. The second amplification product can also be designed to have a 3' sequence that overlaps with a portion of an expression vector prepared to receive the second amplification product. As shown in FIG. 1, this portion of the expression vector can be designed to provide any 3' portion of the full-length β chain (or δ chain) that is missing in the second amplification product. In the case of FIG. 1, the expression vector for receiving the second amplification product provides the remainder of the Cβ region.

[0115] For example, as shown in FIG. 1, when a first and second amplification product from a nested amplification reaction provided herein, a separate cloning fragment, and an expression vector prepared to receive the first and second amplification products, each having overlapping sequences, are incubated with a 5' exonuclease enzyme, a DNA polymerase enzyme, and a DNA ligase enzyme to perform Gibson assembly, an assembled expression vector can be produced having the separate cloning fragments followed by the first amplification product, followed by the second amplification product, and then vector sequences.

[0116] In some cases, the vector sequence upstream of the first amplification product may be a promoter sequence designed to drive expression of the assembled nucleic acid encoding the α chain (or γ chain) of the TCR. Any type of promoter sequence may be used. Examples of promoter sequences that may be used include, but are not limited to, a CMV promoter sequence for high expression, an MCSV promoter sequence for high expression, an E1Fa promoter sequence for medium expression, a PGK promoter sequence for medium expression, and a UbC promoter sequence for low expression.

[0117] In some cases, the separate cloning fragments can be designed to encode a self-cleaving peptide, e.g., a 2A peptide, such that they are located between the nucleic acid encoding the alpha (or gamma) chain and the nucleic acid encoding the beta (or delta) chain in the assembled vector. In these cases, only one promoter is required to drive expression of both the alpha and beta chains (or gamma and delta chains). Examples of 2A peptides that can be used as described herein include, but are not limited to, the 2A peptide of foot and mouth disease virus, the 2A peptide of equine rhinitis A virus, the 2A peptide of Thosea asigna virus, and the 2A peptide of porcine teschovirus-1. The amino acid sequences of exemplary 2A polypeptides are provided in Table 13. Examples of separate cloning fragments that can be used in the Gibson assembly techniques provided herein to obtain expression vectors expressing cloned human or mouse TCRs include, but are not limited to, those set forth in Table 14. In some cases, a linker sequence can be included upstream of the sequence encoding the self-cleaving peptide (e.g., the sequence encoding the 2A peptide). Such a linker sequence may have a length that maintains the reading frame of the sequence encoding the self-cleaving peptide, for example, the linker may be about 3 to about 45 nucleotides (e.g., 27 nucleotides) in length.

[0118] [Table 13]

[0119] [Table 14]

[0120] When a self-cleaving peptide, such as a 2A peptide, is used, the expression vector can result in the transcription of a transcript encoding an α chain (or γ chain), followed by the self-cleaving peptide (e.g., the 2A peptide), followed by the β chain (or δ chain). During translation of these transcripts, the growing polypeptide can be cleaved at the 2A peptide while translation continues towards the β chain (or δ chain). When designing an expression vector that expresses α and β chains (or γ and δ chains) as a multicistronic unit, the nucleic acids encoding the two TCR chains and the self-cleaving peptide (e.g., the 2A peptide) can be designed such that they are in translation frame with each other.

[0121] In some cases, an internal ribosome entry site (IRES) can be used instead of a self-cleaving peptide. Examples of IRES sequences include, but are not limited to, the encephalomyocarditis virus (EMCV) IRES (e.g., IRES2), the Hepatitis C virus (HCV) IRES, picornavirus IRES, and the pestivirus IRES.

[0122] In some cases, separate promoter sequences may be used in place of a self-cleaving peptide or an IRES. In these cases, one promoter sequence may drive expression of the alpha chain (or gamma chain) and another may drive expression of the beta chain (or delta chain). These two promoter sequences may be the same or different.

[0123] Any suitable 5' exonuclease enzyme, DNA polymerase enzyme, and DNA ligase enzyme can be used to perform the Gibson assembly technique provided herein. An example of a 5' exonuclease enzyme that can be used as described herein includes, but is not limited to, T5 exonuclease (commercially available from New England Biolabs). An example of a DNA polymerase enzyme that can be used as described herein includes, but is not limited to, Phusion DNA polymerase (commercially available from ThermoFisher Scientific), Pfu Turbo DNA polymerase (commercially available from Agilent), and Q5 High Fidelity DNA polymerase (commercially available from New England Biolabs). Examples of DNA ligase enzymes that can be used as described herein include, but are not limited to, T4 DNA ligase (commercially available from ThermoFischer Scientific), T3 DNA ligase (commercially available from New England Biolabs), T7 DNA ligase (commercially available from New England Biolabs), and HiFi Taq DNA ligase (commercially available from New England Biolabs). Other components for carrying out the Gibson assembly technique provided herein can include, but are not limited to, dNTPS, MgCl2, DTT, PEG-8000, and NAD.

[0124] In general, the Gibson assembly technique can be used to ligate any suitable double-stranded DNA fragments with overlapping sequences. Briefly, an enzyme with 5' exonuclease activity chews back the 5' end. When the overlapping sequences anneal, DNA polymerase fills in the sequence extending from the 3' end, and DNA ligase seals the nick, thereby joining the two overlapping fragments.

[0125] The Gibson assembly technique provided herein can be performed by contacting a prepared vector (e.g., a vector opened to receive an insert) having the first and second amplification products, the separate cloning fragments, and their overlapping sequences, each as described herein, with an enzyme having 5' exonuclease activity, DNA polymerase activity, and DNA ligase activity in the presence of a reaction mixture containing dNTPS, MgCl2, DTT, PEG-8000, and NAD, and incubating the reaction mixture isothermally at about 40 to about 60°C (e.g., at about 45 to about 55°C, about 48 to about 52°C, or about 50°C) for about 10 to about 120 minutes (e.g., about 10 to about 90 minutes, about 10 to about 60 minutes, about 10 to about 45 minutes, about 15 to about 90 minutes, about 15 to about 60 minutes, or about 15 to about 45 minutes).

[0126] In some cases, restriction enzyme cloning can be used to place a first amplification product into an entire α (or γ) chain (e.g., full length L sequence, full length Vα segment, full length Jα segment, and full length Cα region) and a second amplification product into an entire β (or δ) chain (e.g., full length L sequence, full length Vβ segment, full length Dβ segment, full length Jβ segment, and full length Cβ region) into an expression vector in such a manner that both are expressed. For example, restriction enzyme cloning can be used to assemble an expression vector having a promoter sequence followed by a nucleic acid encoding an α chain (or γ chain) followed by a nucleic acid encoding a self-cleaving peptide (or IRES), or a second promoter sequence followed by a nucleic acid encoding a β chain (or δ chain).

[0127] When describing the expression vectors provided herein and the arrangement of the components (e.g., first and second amplification products) used to assemble those expression vectors, the alpha chain (or gamma chain) is described as being upstream of the beta chain (or delta chain). This is not a requirement, as expression vectors can be designed to express the alpha and beta chains (or gamma and delta chains) in either order. For example, expression vectors can be constructed using the methods and materials provided herein such that a promoter sequence drives expression of a transcript beginning with a nucleic acid encoding a beta chain (or delta chain), followed by a nucleic acid encoding a self-cleaving peptide (or IRES), or a second promoter sequence, followed by a nucleic acid encoding an alpha chain (or gamma chain).

[0128] Any suitable vector designed to drive polypeptide expression can be used to assemble the expression vector provided herein. For example, lentiviral vectors can be used to generate expression vectors capable of expressing functional TCR cloned from single T cells as described herein. Other vectors that can be used to generate expression vectors described herein include, but are not limited to, virus-based vectors, such as herpes virus vectors, adenovirus vectors, adeno-associated virus vectors, or retrovirus vectors, or other DNA or RNA cell expression vectors that can be introduced into target cells. In some cases, lentiviral vectors, such as pLVX-IRES (commercially available from Clontech) or retroviral vectors, such as pMIG II (commercially available from Addgene), can be used to assemble expression vectors capable of expressing functional TCR cloned from single T cells as described herein.

[0129] As described herein, once an expression vector is assembled to contain the sequence for the TCR cloned from a single T cell, the vector can be used to make additional copies of itself.For example, bacteria can be transformed to replicate the assembled expression vector.In such a case, the expression vector can be designed to contain a bacterial origin of replication.

[0130] Using the assembled expression vectors provided herein, any suitable method can be used to screen the cloned TCRs for the TCR of interest. For example, the method shown in Figure 4 can be performed to screen the cloned TCRs provided herein.

[0131] In some cases, each assembled expression vector can be individually expanded such that each nucleic acid preparation of the expression vector is for a single T cell. In these cases, any particular TCR identified as being of interest, e.g., based on downstream TCR screening and analysis, can be traced back to the nucleic acid preparation for that TCR.

[0132] In some cases, two or more (e.g., tens, hundreds, thousands or more) assembled expression vectors can be pooled and expanded as a pool. In these cases, the pooled nucleic acid can be used for downstream screening and analysis of the pool of cells expressing any of the cloned TCRs. Those cells identified as expressing a particular TCR of interest can be isolated and the particular expression vector (or all or part of the nucleic acid encoding the TCR) contained within the cells can be recovered. For example, in one embodiment, a pool of different expression vectors provided herein, each encoding a particular TCR cloned from a single T cell, can be delivered to a population of cells (e.g., cells lacking a native TCR) to transfect each cell to express the TCR provided to it by the expression vector it receives. The pool of cells expressing the different cloned TCRs can then be evaluated to identify cells expressing the TCR of interest. Those cells expressing the TCR of interest can be isolated. Once isolated, the cells can be evaluated to determine the identity of the TCR. For example, nucleic acid sequencing can be performed to identify the TCR. In some cases, nucleic acid encoding a TCR can be isolated from the isolated cells, e.g., one or more amplification reactions (e.g., PCR) can be performed to obtain one or more amplification products that include nucleic acid encoding all or a portion of a TCR.

[0133] The methods and materials provided herein are described with a focus on obtaining an expression vector capable of expressing a cloned TCR obtained from a single T cell. In some cases, the methods and materials provided herein can be performed in a manner designed to produce a vector encoding a TCR described herein, except that the vector need not be an expression vector. For example, a cloning vector, e.g., pUC19 or PCR TOPO vector, can be used to assemble a nucleic acid construct encoding an alpha chain (or gamma chain), a beta chain (or delta chain), and optionally a self-cleaving peptide (or IRES) and / or a promoter sequence, as described herein. In such cases, if expression is subsequently desired, the assembled construct can be transferred from the cloning vector to an expression vector. If expression is not desired, then the vector containing the assembled construct can be used as is. For example, nucleic acid sequencing can be performed using such a vector to obtain sequence information for the paired alpha and beta chains (or gamma and delta chains) obtained from a single T cell. In some cases, nucleic acid sequencing can be performed using the first and / or second amplification products described herein to obtain sequence information for the α and / or β chains (or γ and / or δ chains) obtained from a single T cell.

[0134] The methods and materials provided herein are described with a focus on obtaining an expression vector capable of expressing a cloned TCR containing α and β (or γ and δ) C regions. In some cases, the methods and materials provided herein can be performed in a manner designed to produce a vector (e.g., an expression vector) encoding a TCR as described herein, except that a different signaling domain or domain that results in a soluble TCR being expressed is added. In some cases, the methods and materials provided herein can be performed in a manner designed to produce a vector (e.g., an expression vector) encoding a TCR as described herein, except that all or a portion of the α and / or β (or γ and / or δ) C region is replaced with a different signaling domain or domain that results in a soluble TCR being expressed. For example, a vector (e.g., an expression vector) provided herein can be assembled such that a nucleic acid encoding a signaling domain (e.g., a CD3-zeta signaling domain) replaces the stop codon of the α or β (or γ or δ) C region of the TCR that has been cloned and added in frame with the constant region.Examples of signaling domains that may be added to, or used in place of, all or a portion of the α and / or β (or γ and / or δ) C regions of the cloned TCRs provided herein include the CD3-zeta signaling domain (Ohno et al., The EMBO Journal, 12:4357-66 (1993); Exley et al., Journal Biol. Chem., 269:15140-6 (1994); and Maher et al., Nat. Biotechnol., 20:70-5 (2002)), the CD28 signaling domain (Maher et al., Nat. Biotechnol., 20:70-5 (2002); and Tian et al., Proc. Natl. Acad. Sci. USA 112:E1594-603 (2015)), costimulatory TNFR family signaling domains (e.g., OX-40, 4-1BB, CD30, CD27, and GITR signaling domains; Arch et al., Mol. Cell. Biol. 18:558-65 (1998); Croft, Cytok. Growth Factor Rev. 14:265-73 (2003); and Watts, Ann. Rev. Immunol. 23:23-68 (2005)), CD278 signaling domain (Bertram et al., Eur. J. Immunol. 32:3376-85 (2002); and Gigoux et al., Proc. Natl. Acad. Sci. USA 106:20371-6 (2009)), and combinations thereof.Examples of domains and / or mutations that, individually or in combination, have the ability to result in an expressed soluble TCR and that may be used to replace the α and / or β (or γ and / or δ) C regions (or portions thereof) of a cloned TCR or that may be added to the C regions of a cloned TCR include biotinylation target motifs placed in the α and / or β (or γ and / or δ) C regions (Laugel et al., J. Biol. Chem., 280:1882-92 (2005)), one or more Ig domains in place of one or both of the C regions, mutations in the C region sequence such that additional cysteine ​​residues are expressed in both the α and β (or γ and δ) C regions (Laugel et al., J. Biol. Chem., 280:1882-92 (2005)), deletion of one or both transmembrane and intracellular domains of the constant regions, Jun-zipper domains added to the α and β C regions, and Fos-zipper domains added to the γ and δ C regions (Willcox et al., Protein Sci., 8:2418-23 (1999)). In some cases, a FLAG tag or His tag can be added to one or both of the C regions to facilitate protein purification. In some cases, the internal cytoplasmic tail of one or both C regions can be removed to facilitate cell-free expression of the TCR chains (Walseng et al., PloS One, 10:e0119559 (2015)).

[0135] Once the assembled expression vector described herein or a pool of different expression vectors described herein is prepared, it can be introduced into a cell so that the cell expresses the resulting TCR. Any suitable cell can be used. In some cases, the expression vector described herein can be introduced into a cell (e.g., a T cell) that does not express an endogenous TCR. For example, the expression vector provided herein can be introduced into a T cell (e.g., a human T cell) that has been engineered to lack expression of the endogenous α chain (or γ chain) of the TCR, to lack expression of the endogenous β chain (or δ chain) of the TCR, or to lack expression of both endogenous α and β chains (or both endogenous γ and δ chains) of the TCR. Any suitable method can be used to generate T cells that lack expression of one or both chains of the endogenous TCR. For example, gene editing techniques, including those involving the use of clustered regularly interspaced short palindromic repeats (CRISPR) technology or transcription activator-like effector nuclease (TALEN) technology, may be used to interfere with the expression of one or both chains of the endogenous TCR.

[0136] In some cases, natural killer (NK) cells can be used. For example, the expression vectors described herein can be introduced into NK cells engineered to express the CD3 chains of the TCR complex (e.g., CD3ε, CD3γ, CD3ζ, and optionally CD3δ). In such cases, an exogenously provided TCR can be expressed on the surface of the NK cell in combination with an exogenously provided CD3 complex.

[0137] In some cases, the expression vectors provided herein can be introduced into a T cell (e.g., a human T cell) that expresses an endogenous TCR. In such cases, the portion of the TCR present on the surface of such a T cell can be an endogenous TCR, the portion of the TCR present on the surface of such a T cell can be an exogenously provided TCR (e.g., a TCR generated from two TCR chains encoded by an introduced expression vector), and the portion of the TCR present on the surface of such a T cell can have one endogenously provided TCR chain and one exogenously provided TCR chain.

[0138] In some cases, the constant regions of the α and β chains (or γ and δ chains) encoded by the expression vectors provided herein can be engineered to include sequences encoding one or more cysteine ​​residues to increase pairing of the chains with each other when expressed in a cell (e.g., a cell expressing an endogenous TCR). For example, TCR sequences obtained from single cell sorted T cells described herein can be assembled into an expression vector such that each encoded constant region of the expression vector includes an introduced cysteine ​​residue that increases pairing of the chains with each other when expressed in a cell (e.g., a cell expressing an endogenous TCR). Examples of such cysteine ​​residues include, but are not limited to, those described elsewhere (Kuball et al., Blood, 109:2331-2338 (2007)).

[0139] In some cases, the expression vectors provided herein can be introduced into T cells from a species different from the species used to clone the TCR sequence of the expression vector. For example, an expression vector provided herein expressing a TCR having a variable region obtained from a mouse T cell can be introduced into a T cell from a species other than the mouse species (e.g., a human T cell).

[0140] In some cases, the expression vectors provided herein can be engineered to express a chimeric TCR having a variable region from one species (e.g., human) and a constant region from a different species (e.g., mouse). In such cases, the expression vector can be introduced into a T cell from a species different from that of the constant region. For example, an expression vector engineered to express a chimeric TCR having a human variable region and a mouse constant region can be introduced into a human T cell (e.g., a human T cell expressing an endogenous TCR). In such cases, an exogenously provided human / mouse chimeric TCR can be expressed and assembled into a functional TCR on the surface of a human T cell, as described elsewhere (Cohen et al., Cancer Res., 66(17):8878-8886, (2006)).

[0141] In some cases, an expression vector provided herein expressing a cloned TCR having an αβ constant region can be introduced into a γδ T cell having an endogenous γδ TCR. In these cases, the two chains of the exogenous TCR can be precisely paired through the αβ constant region with little or no interference from the endogenous γ and δ TCR chains. In some cases, an expression vector provided herein expressing a cloned TCR having a γδ constant region can be introduced into an αβ T cell having an endogenous αβ TCR. In these cases, the two chains of the exogenous TCR can be precisely paired through the γδ constant region with little or no interference from the endogenous α and β TCR chains.

[0142] In some cases, the expression vectors provided herein can be engineered to express TCRs with γδ variable regions and αβ constant regions derived from a single γδ T-cell. In such cases, the expression vectors can be introduced into γδ T-cells that have an endogenous γδ TCR. In these cases, the two chains of the exogenous TCR can pair correctly through the αβ constant region even though those TCRs contain γδ variable regions.

[0143] In some cases, the expression vectors provided herein can be engineered to express TCRs with αβ variable regions and γδ constant regions derived from a single αβ T cell. In such cases, the expression vectors can be introduced into αβ T cells that have endogenous αβ TCRs. In these cases, the two chains of the foreign TCR can pair correctly through the γδ constant region even though those TCRs contain αβ variable regions. This correct pairing can occur with little or no interference from the endogenous α and β TCR chains.

[0144] In some cases, the expression vectors provided herein can be engineered to express TCRs with γδ variable regions and αβ constant regions derived from a single γδ T-cell. In such cases, the expression vectors can be introduced into γδ T-cells that have an endogenous γδ TCR. In these cases, the two chains of the exogenous TCR can pair correctly through the αβ constant region even though those TCRs contain γδ variable regions.

[0145] Once an assembled expression vector or a pool of different expression vectors is prepared as described herein, it can be introduced into cells so that the cells express the resulting TCR. Any suitable cells can be used. For example, the expression vectors provided herein can be introduced into immortal human T cell lines, such as Jurkat cells, Molt cell lines, or cell lines derived from these sources. In some cases, sublines of Jurkat or Molt cell lines that do not express endogenous positioned TCRs can be used (Minowada et al., Haematol. Blood Transfus., 32:233-236 (1989); Zhang et al., PLoS Pathog., 6(7):e1001018 (2010)). In some cases, mouse cell lines can be used to express human or mouse TCRs. In some cases, cell lines engineered to express exogenous CD3 nucleic acid can be used, e.g., the 4G4 cell line, the BW5147 cell line, or the 58 hybridoma cell lines transformed to express the CD3 gene.

[0146] Selection of TCRs relevant to a particular patient or disease being treated can be identified before and after TCR cloning. Detection of suitable TCRs can begin with the selection process. For example, prior to selection, screening can be performed by culturing the cells for a period of time (e.g., 4 hours) with antigen-presenting cells (APCs) that have been pulsed with one or more antigens (e.g., antigens from a vaccine, e.g., a prostate tumor vaccine, a non-major histocompatibility antigen vaccine, or an antiviral vaccine, e.g., an influenza vaccine). Examples of APCs that can be used include, but are not limited to, immortal cell lines known to express MHC1 and / or 2, and peripheral blood monocytes differentiated into professional APCs, expanded by stimulation with TLR ligands, and cultured with IL-4 and GM-CSF. After stimulation, peripheral blood can be stained to identify T cells. Within that population of T cells, activated T cells can be identified based on expression of markers, e.g., CD62L, CD127, CD69, CD44, and CD45RA / RO.

[0147] Once the cells exposed to one or more antigens are sorted into single T cells as described herein, the cDNA generated, up to about 80 percent of the cDNA generated from single T cells, can be used for qPCR without interfering with the efficiency of TCR cloning. In some cases, stimulated T cells can be screened directly after stimulation for upregulation of effector molecules such as IFN-γ, IL-2, TNF-α, and other molecules known to be expressed. At the single cell level, wells containing single T cells with TCRs specific for the antigen used to stimulate the T cell population can be identified by normalizing the expression of these cells to one or more housekeeping genes. In some cases, the cloning process can continue with those TCRs obtained from T cells identified as having TCRs specific for the antigen used to stimulate the T cell population.

[0148] Once expression vectors are assembled, the TCRs they are designed to express can be tested for functionality and antigen specificity. Functionality and antigen specificity can be confirmed by expressing the assembled TCRs in either cell lines or primary cells. In some cases, cells expressing cloned TCRs can be screened using any suitable method to identify the cloned TCR of interest. For example, a complex of a specific antigen peptide-tetramer can be used to stain cells expressing TCRs capable of binding to the complex. In some cases, the assembled expression vectors provided herein can be introduced into reporter cells engineered to provide an identifiable signal upon successful activation of the cloned and functional TCR.

[0149] In some cases, cell lines can be engineered to express a marker polypeptide (e.g., luciferase) under the control of an NFAT response element that can be used to identify functional TCRs. NFAT is a transcription factor that is sequestered in the nucleus until a signal such as TCR ligation leads to its dephosphorylation and subsequent transport to the nucleus (Crabtree et al., Cell, 109(Suppl):S67-79 (2002)). NFAT then binds to the NFAT response element, leading to the expression of a marker polypeptide encoded by a nucleic acid sequence downstream of the NFAT response element. In some cases, commercially available immortal T cell lines, such as the Jurkat cell line (Promega; Catalog No. J1621), which contains an NFAT response element upstream of the nucleic acid encoding luciferase, can be used to identify functional TCRs. Upon TCR ligation of a functional TCR, these cells can express luciferase. As described herein, 4G4 NFAT-RE cells can be transfected with retroviral vectors expressing cloned TCRs as described herein, and the cells can be stimulated in 384-well plates coated with anti-CD3 antibodies. In these cases, stimulated cells can express luciferase, which can be detected within 4 hours of stimulation. This system can allow rapid screening of more than 360 viral vectors per 384-well plate for expression of functional TCRs. In such cases, 24 wells can be used for positive and negative assay controls.

[0150] In some cases, assays can be performed to confirm the antigen specificity of the cloned TCR. For example, cells can be cultured with APCs pulsed with antigen peptides, or infected with a viral vector expressing a target gene, or transfected with a plasmid expressing the suspected target gene. Examples of target genes include, but are not limited to, tumor-associated antigens, vaccine-associated antigens, and pathogen virus-associated antigens. Similar to the assessment of TCR functionality, specificity can be assessed using an NFAT response element luciferase assay, except that a specific antigen within an appropriate MHC molecule is used to stimulate the TCR being tested instead of an anti-CD3 antibody. MHC molecules expressed by the cell lines described herein can be loaded with specific peptides, either by placing the peptides directly into the culture, or by transfecting MHC-expressing cells with a vector (e.g., a plasmid) expressing one or more peptides of interest. In some cases, peptides (or antigen-expressing vectors) can be titrated against controls for different TCR affinities and different peptide / MHC affinities.

[0151] In some cases, TCR expression, functionality, and / or specificity can be simultaneously evaluated by flow cytometry. By replacing the luciferase protein of the NFAT response element reporter system with a fluorescent protein (e.g., eGFP or tdTomato), the cloned TCR expressed from the expression vector provided herein can be evaluated for correct expression, functionality, and / or specificity in transfected cells. Briefly, a cell line containing the NFAT response element reporter system that controls the expression of a fluorescent protein can be transfected with an expression vector provided herein that expresses the cloned TCR. The cell line can then be incubated with an APC or APC cell line that has been pulsed with an antigen. The cells can then be evaluated by flow cytometry for expression of a fluorescent marker. The presence of the fluorescent protein after stimulation can indicate that the introduced TCR is expressed, functional, and specific to the antigen used to stimulate the cells. In some cases, the expression vector provided herein that expresses the cloned TCR can include a nucleic acid that encodes a marker polypeptide that can be used as an indicator to track which cells receive the expression vector. The expression vector and cell line may be selected such that the reporter polypeptide expressed by the cell line and the indicator expressed by the expression vector do not interfere with each other.

[0152] In some cases, these flow cytometric evaluations can be combined with another round of single cell sorting. For example, antigen-responsive cells (e.g., those expressing a fluorescent marker in response to stimulation with a specific antigen + MCH) can be sorted into 384-well plates and an amplification reaction (e.g., PCR) can be performed to amplify the TCR constructs introduced into these cells.

[0153] This sorting method can be used to screen multiple expression vectors simultaneously. Briefly, reporter cells can be transfected with the expression vectors provided herein to express the cloned TCR. The reporter cells can be transfected with a single expression vector, but multiple cultures can be infected (each with a different expression vector). These cultures can be combined and then incubated with APCs bearing the desired antigen(s) for about 4-12 hours. After this time, the cultures can be evaluated by flow cytometry and cells expressing a fluorescent marker via an NFAT response element can be sorted into a single well. Those cells can be cloned and used as therapeutic TCR vectors. In some cases, this process can be used to simultaneously screen hundreds of expression vectors designed to express the cloned TCR.

[0154] In some cases, primary T cells can be used to screen the specificity of the cloned TCR encoded by the expression vector provided herein. In some cases, primary T cells can be screened for the ability to kill target T cells (e.g., specific cancer cells). For example, cloned MHC class I-restricted TCRs can be introduced into cytotoxic lymphocytes (either primary cells differentiated into CTLs or expanded primary natural killer (NK) cells transformed to express CD3 genes) and then co-cultured with labeled target cells. These target T cells can be expanded tumor cells (e.g., tumor cells expanded from a tumor resection biopsy sample), MHC class I-expressing cells pulsed with antigens derived from tumor samples, and / or MHC class I-expressing cell lines transfected with antigen plasmids expressing tumor-specific genes. In these cases, CTL activity can be measured by loading target T cells with either a radioisotope, such as chromium 51, or a dye, and measuring the release of the loaded marker after incubation (Rowe et al., Toxicol. Appl. Pharmacol., 221:179-88 (2007)). When interested in the specificity of the TCR and its ability to promote lytic hits in effector cells, degranulation can be measured as a useful assessment of the cytotoxic potential of TCR-transformed effector cells. After incubation of effector cells with targets, perforin or granzyme B ELISA can be performed. Measurement of CD107a expression on the surface of effector cells (Betts et al., Methods Cell Biol., 75:497-512 (2004)) and target cell death by flow cytometry can be used to assess the cytotoxic potential of effector cell populations.

[0155] In some cases, cell expansion in response to a known or suspected antigen following TCR stimulation can be used to assess antigen-specific activation of cloned TCRs. The ability of the TCR vectors described herein to drive proliferation of primary mammalian (e.g., human) T cells can be measured with CFSE or another cell proliferation dye (Lyons, Immunol. Cell. Biol., 77:509-15 (1999)). Measurement of cell proliferation can be used to determine antigen specificity of vector-based TCRs. Briefly, primary T cells can be infected with TCR expression vectors provided herein that have been verified for function and TCR chain pairing. Primary T cells can be labeled with CFSE and incubated with APCs pulsed with vectors expressing one or more antigen peptides or one or more antigen proteins. Primary T cells receiving a TCR vector specific for the antigen expressed by the APC will divide, thereby diluting the CFSE dye. Those cells expressing lesser amounts of CFSE (i.e., more divided) can be isolated via single cell sorting and the assembled nucleic acid encoding the αβTCR (or γδTCR) can be amplified (e.g., PCR amplified) from the single cell.

[0156] Using the methods and materials provided herein, many different cloned TCRs can be obtained. Once obtained, they can be screened to identify those that can be used to treat various conditions, such as autoimmunity, cancer, organ transplant rejection, viral infections, bacterial infections, inflammatory processes that can be controlled by T cells (e.g., inflammatory bowel disease, psoriasis, vasculitis, atherosclerosis, non-infectious hepatitis, or autoimmune cholangitis). For example, in some cases, tumor-infiltrating T cells can be isolated from a human patient with cancer. Those T cells can be used as described herein to rapidly generate a collection of hundreds or thousands of different cloned TCRs from that human. Those cloned TCRs can then be rapidly screened to identify a population of cloned TCRs that also have the ability to kill cancer cells obtained from that patient. Those cloned and identified TCRs can be used to generate additional cell lines expressing those TCRs, which can be used to treat the human. In some cases, all of these steps, from obtaining source T cells to using cells transfected with an expression vector encoding a cloned therapeutically effective TCR as described herein as a therapeutic agent, can be performed without determining the sequence identity of the therapeutically effective TCR.

[0157] In some cases, the methods provided herein can be performed without performing nucleic acid sequencing, without performing a restriction enzyme cleavage step, without performing other steps or techniques described herein, and / or without using certain reagents or materials described herein. For example, in some cases, the methods used to obtain a collection of expression vectors designed to express cloned TCRs obtained from a single T cell as described herein can be performed from the point of sorting T cells into single T cells to the point of having assembled expression vectors without performing nucleic acid sequencing. In some cases, the methods provided herein can include obtaining a collection of expression vectors designed to express cloned TCRs obtained from a single T cell, and identifying a particular TCR from that collection of expression vectors without performing any nucleic acid sequencing. For example, a TCR with a particular function can be cloned and identified using the methods and materials provided herein without performing any nucleic acid sequencing of the TCR sequence.

[0158] As described herein, in some cases, the methods used to obtain a collection of expression vectors designed to express cloned TCRs obtained from a single T cell can be performed from the point of sorting T cells into single T cells to the point of having assembled expression vectors without performing any restriction enzyme cleavage reactions for cloning or otherwise. For example, seamless cloning techniques can be used to assemble expression vectors from first and second amplification products.

[0159] Also as described herein, in some cases, the method used to obtain a collection of expression vectors designed to express cloned TCRs obtained from a single T cell may be performed from the point of sorting the T cells into single T cells to the point of having assembled expression vectors without performing a first round of nested amplification (e.g., PCR) amplification in a reaction mixture designed to amplify only one type of variable chain nucleic acid (e.g., designed to amplify only alpha variable chain nucleic acid and not beta variable chain nucleic acid (or vice versa), or designed to amplify only gamma variable chain nucleic acid and not delta variable chain nucleic acid (or vice versa)). For example, a first round of nested amplification (e.g., PCR) amplification may be performed in a reaction mixture designed to amplify both alpha and beta variable chain nucleic acid (or both gamma and delta variable chain nucleic acid) in that reaction mixture.

[0160] As described herein, in some cases, the method used to obtain a collection of expression vectors designed to express cloned TCRs obtained from a single T cell may be performed from the point of sorting the T cells into single T cells to the point of having assembled expression vectors without performing a second round of nested amplification (e.g., PCR) amplification in a reaction mixture designed to amplify only one type of variable chain nucleic acid (e.g., designed to amplify only alpha variable chain nucleic acid and not beta variable chain nucleic acid (or vice versa), or designed to amplify only gamma variable chain nucleic acid and not delta variable chain nucleic acid (or vice versa)). For example, a second round of nested amplification (e.g., PCR) amplification may be performed in a reaction mixture designed to amplify both alpha and beta variable chain nucleic acid (or both gamma and delta variable chain nucleic acid) in that reaction mixture.

[0161] In some cases, the method used to obtain a collection of expression vectors designed to express cloned TCRs obtained from a single T cell as described herein can be performed from the point of sorting T cells into single T cells to the point of having assembled expression vectors without performing a first round of amplification of a nested amplification (e.g., PCR) method using a first round of primer collection in which primers specific for amplifying nucleic acid of a variable chain (e.g., α, β, γ, or δ variable chain) include an exogenous nucleic acid sequence (e.g., primer barcode sequence or primer adapter sequence). For example, the first round of primer collection can include primers that lack an exogenous nucleic acid sequence (e.g., primer barcode sequence or primer adapter sequence) but have a sequence specific for amplifying nucleic acid of a variable chain (e.g., α, β, γ, or δ variable chain) that is longer than 5 consecutive nucleotides and is not complementary to the variable chain being amplified, and that are linked to a nucleic acid sequence complementary to the variable chain being amplified.

[0162] In some cases, the method used to obtain a collection of expression vectors designed to express cloned TCRs obtained from a single T cell as described herein can be performed from the point of sorting T cells into single T cells to the point of having assembled expression vectors without performing a nested amplification (e.g., PCR) method designed to produce an amplification product that does not contain the full-length coding region of the variable chain (e.g., alpha, beta, gamma, or delta variable chain), e.g., an amplification product that contains the CDR3 region of the variable chain (e.g., alpha, beta, gamma, or delta variable chain), in the absence of the CDR1 region or in the absence of both the CDR1 and CDR2 regions. For example, a nested amplification (e.g., PCR) method provided herein can be designed to amplify a first amplification product that contains a full-length alpha variable chain (or a full-length gamma variable chain) and a second amplification product that contains a full-length beta variable chain (or a full-length delta variable chain).

[0163] In some embodiments, the method for obtaining a collection of expression vectors designed to express cloned TCRs obtained from a single T cell includes: (a) without performing any nucleic acid sequencing; (b) without performing any restriction enzyme cleavage reactions for cloning or otherwise; (c) without performing a first round of amplification of a nested amplification (e.g., PCR) method in a reaction mixture designed to amplify only one type of variable chain nucleic acid (e.g., designed to amplify only alpha variable chain nucleic acid and not beta variable chain nucleic acid (or vice versa), or designed to amplify only gamma variable chain nucleic acid and not delta variable chain nucleic acid (or vice versa)); and (d) without performing a first round of amplification of a nested amplification (e.g., PCR) method in a reaction mixture designed to amplify only one type of variable chain nucleic acid (e.g., designed to amplify only alpha variable chain nucleic acid and not beta variable chain nucleic acid (or vice versa), or designed to amplify only gamma variable chain nucleic acid and not delta variable chain nucleic acid (or vice versa). The process can be performed from the time of sorting the T cells into single T cells to the time of having the assembled expression vector without performing a second round of amplification (e.g., PCR) method, (e) without performing a first round of amplification of a nested amplification (e.g., PCR) method using a first round of primer collection in which primers specific for amplifying nucleic acid of a variable chain (e.g., an alpha, beta, gamma, or delta variable chain) include an exogenous nucleic acid sequence (e.g., a primer barcode sequence or a primer adapter sequence) that is longer than 5 consecutive nucleotides and is not complementary to the variable chain being amplified and is linked to a nucleic acid sequence that is complementary to the variable chain being amplified, and / or (f) without performing a nested amplification (e.g., PCR) method designed to produce an amplification product that does not contain the full-length coding region of the variable chain (e.g., an alpha, beta, gamma, or delta variable chain), e.g., an amplification product that contains the CDR3 region of the variable chain (e.g., an alpha, beta, gamma, or delta variable chain) in the absence of the CDR1 region or in the absence of both the CDR1 and CDR2 regions.In some cases, the methods described herein (e.g., the multiplex methods described herein) may be performed such that any one or more of the exclusionary items (a) through (f) of the preceding sentence are met from the time of cell sorting to the time of obtaining an expression vector capable of expressing a functional TCR.Examples of such combinations of exclusive items that may be met when performing the methods described herein (e.g., the multiplex methods described herein) from the time of cell sorting to the time of obtaining the expression vectors include: (a) and (b); (a) and (c); (a) and (d); (a) and (e); (a) and (f); (b) and (c); (b) and (d); (b) and (e); (b) and (f); (c) and (d); (c) and (e); (c) and (f); (d) and (e); (d and (f); (a). ,(b), and (c);(a), (b), and (d);(a), (b), and (e);(a), (b), and (f);(a), (c), and (d);(a), (c), and (e);(a), (c), and (f);(a), (d), and (e);(a), (d), and (f);(a), (e), and (f);(b), (c), and (d);(b), (c), and (e);(b), (c), and (f);(b), (d), and (e);(b), (d), and (f);(b), (e), and (f); (c), (d), and (e);(c), (d), and (f);(c), (e), and (f);(d), (e), and (f);(a), (b), (c), and (d);(a), (b), (c), and (e);(a), (b), (c), and (f);(a), (c), (d), and (e);(a), (c), (d), and (f);(a), (d), (e), and (f);(a), (b), (d), and (e);(a), (b), (d), and (e);(a), (b), (d), and (f);(a), (d), (e), and (f);(b) , (c), (d), and (e); (b), (c), (d), and (f); (b), (d), (e), and (f); (c), (d), (e), and (f); (a), (b), (c), (d), and (e); (a), (b), (c), (d), and (f); (a), (c), (d), (e), and (f); (a), (b), (d), (e), and (f); (a), (b), (c), (e), and (f); and (a), (b), (c), (d), (e), and (f).For example, the methods described herein (e.g., the multiplex methods described herein) can be performed from the point of cell sorting to the point of obtaining an expression vector capable of expressing a functional TCR (a) without performing any nucleic acid sequencing, and (b) without performing any restriction enzyme cleavage reaction. In some cases, the methods described herein (e.g., the multiplex methods described herein) can be performed without performing a first round of amplification of a nested amplification method using a first round primer collection in which primers specific for amplifying nucleic acid of a variable chain (e.g., an α, β, γ, or δ variable chain) include an exogenous nucleic acid sequence (e.g., a primer barcode sequence or a primer adapter sequence) that is longer than 5 consecutive nucleotides and is not complementary to the variable chain being amplified and is bound to a nucleic acid sequence that is complementary to the variable chain being amplified.

[0164] This document also provides kits for obtaining nucleic acid encoding a TCR from a single T cell and arranging the nucleic acid to form a nucleic acid vector successfully designed to express a TCR (e.g., a fully intact TCR, e.g., a fully intact TCR having the combination of variable chains present in the single T cell). For example, the kits provided herein can include a primer collection for performing a first round of amplification of a nested amplification reaction (e.g., nested PCR) described herein in combination with a primer collection for performing a second round of amplification of a nested amplification reaction (e.g., nested PCR) described herein.

[0165] In one embodiment, the kit provided herein may include (a) a primer collection for performing a first round of amplification of a nested amplification reaction (e.g., nested PCR) described herein, (b) a primer collection for performing a second round of amplification of a nested amplification reaction (e.g., nested PCR) described herein, and (c) a cloning fragment and / or vector. In this case, the primer collection may be capable of generating a first amplification product containing a nucleic acid encoding at least a portion of an L sequence, a Vα segment (or a Vγ segment), a Jα segment (or a Jγ segment), and a Cα region (or a Cγ region) during the nested amplification reaction, and a second amplification product containing a nucleic acid encoding at least a portion of an L sequence, a Vβ segment (or a Vδ segment), a Dβ segment (or a Dδ segment), a Jβ segment (or a Jδ segment), and a Cβ region (or a Cδ region). In those cases where the kit includes a cloning fragment, the cloning fragment may contain a nucleic acid encoding a portion of the C region of a TCR (e.g., a portion of a Cα region, a Cγ region, a Cβ region, or a Cδ region). In those cases where the kit comprises a vector, the vector may contain a nucleic acid encoding a portion of a TCR (eg, a portion of the Cα, Cγ, Cβ, or Cδ region).

[0166] In some cases, the kits provided herein include a kit in which (a) at least one of the primers in the first primer set is described in Table 1 or Table 2 (e.g., hTRAV1_12_F, hTRBV4_123_F, hTRBV10_12_F, and / or hTRBV12_34_F), or (b) at least one of the primers in the second primer set is described in Table 5 or Table 6 (e.g., Vect_hTRAV1_12_F, Vect_hTRAV8_246, Vect_hTRBV4_123 ... _F, Vect_hTRBV6_23_F, Vect_hTRBV6_89_F, Vect_hTRBV7_2348_F, and / or Vect_hTRBV12_34_F), a first primer set for performing a first round of amplification of a nested amplification reaction (e.g., nested PCR) described herein, and a second primer set for performing a second round of amplification of a nested amplification reaction (e.g., nested PCR) described herein. In this case, one or more of the primers of the first primer set (e.g., all forward primers of the first set) may lack an adapter sequence, and one or more of the primers of the second primer set (e.g., all forward primers of the second set) may include an adapter sequence. In some cases, such kits may include reverse primers for the first and second rounds of amplification. Other optional components for the kit may include reverse transcription primers (e.g., random oligomers), reverse transcriptase, a DNA polymerase enzyme for PCR (e.g., Taq polymerase), buffers, a cloning fragment, an expression vector (e.g., a lentiviral vector) configured to receive a nucleic acid encoding a TCR, a 5' exonuclease enzyme, a DNA polymerase for performing a Gibson assembly reaction, a DNA ligase enzyme, and combinations thereof. For example, the kits provided herein may include a primer collection described herein in combination with a cloning fragment and / or an expression vector configured to receive a nucleic acid encoding a TCR. As described herein, the cloning fragment may include a nucleic acid encoding a portion of the TCR and a nucleic acid encoding a self-cleaving peptide (or IRES). In some cases, the cloning fragment may include a nucleic acid encoding a portion of the TCR and a promoter sequence. In some cases, an expression vector (e.g., a lentiviral vector) may be constructed to include a nucleic acid encoding at least a portion of the TCR described herein.

[0167] In another example, a kit provided herein may include a primer collection including: (a) a first set of primers listed in Table 1; (b) a second set of primers listed in Table 2; (c) a reverse primer for each of the first and second sets; (d) a third set of primers listed in Table 5 (with a primer adapter sequence added at the 5' end); (e) a fourth set of primers listed in Table 6 (with a primer adapter sequence added at the 5' end that is different from the adapter sequence used for the third set of primers); and (f) a reverse primer for each of the third and fourth sets.

[0168] This document also provides a reaction mixture. For example, in one embodiment, the reaction mixture provided herein may include (a) a first amplification product containing a nucleic acid encoding at least a portion of an L sequence, a Vα segment (or a Vγ segment), a Jα segment (or a Jγ segment), and a Cα region (or a Cγ region), and (b) a second amplification product containing a nucleic acid encoding at least a portion of an L sequence, a Vβ segment (or a Vδ segment), a Dβ segment (or a Dδ segment), a Jβ segment (or a Jδ segment), and a Cβ region (or a Cδ region). In this embodiment, the reaction mixture may optionally include a cloning fragment and / or a vector. In those cases where the reaction mixture includes a cloning vector, the cloning fragment may include a nucleic acid encoding a portion of the C region of the TCR (e.g., a portion of the Cα region, the Cγ region, the Cβ region, or the Cδ region). In those cases where the reaction mixture includes a vector, the vector may include a nucleic acid encoding a portion of the TCR (e.g., a portion of the Cα region, the Cγ region, the Cβ region, or the Cδ region).

[0169] In another example, the reaction mixture provided herein may include (a) a primer collection for performing a second round of the nested amplification reaction (e.g., nested PCR) provided herein, (b) a first amplification product containing a nucleic acid encoding at least a portion of the L sequence, the Vα segment (or the Vγ segment), the Jα segment (or the Jγ segment), and the Cα region (or the Cγ region), and (c) a second amplification product containing a nucleic acid encoding at least a portion of the L sequence, the Vβ segment (or the Vδ segment), the Dβ segment (or the Dδ segment), the Jβ segment (or the Jδ segment), and the Cβ region (or the Cδ region). In this embodiment, the reaction mixture may optionally include a polymerase enzyme (e.g., Taq polymerase).

[0170] This document also provides a collection of nucleic acid primers designed to perform a nested amplification method capable of generating the first and second amplification products described herein. For example, the collection of nucleic acid primers provided herein can be designed to perform a nested amplification method capable of generating (a) a first amplification product containing nucleic acid encoding at least a portion of an L sequence, a Vα segment (or a Vγ segment), a Jα segment (or a Jγ segment), and a Cα region (or a Cγ region), and (b) a second amplification product containing nucleic acid encoding at least a portion of an L sequence, a Vβ segment (or a Vδ segment), a Dβ segment (or a Dδ segment), a Jβ segment (or a Jδ segment), and a Cβ region (or a Cδ region).

[0171] In some instances, the collection of nucleic acid primers provided herein includes a nucleic acid primer set in which (a) at least one of the primers in a first primer set is listed in Table 1 or Table 2 (e.g., hTRAV1_12_F, hTRBV4_123_F, hTRBV10_12_F, and / or hTRBV12_34_F), or (b) at least one of the primers in a second primer set is listed in Table 5 or Table 6 (e.g., Vect_hTRAV1_12_F, Vect_hTRAV8_246, Vect_hTRAV12_34_F ... The primer collection may include a primer set including a first primer set for performing a first round of amplification of a nested amplification reaction (e.g., nested PCR) described herein, a second primer set for performing a second round of amplification of a nested amplification reaction (e.g., nested PCR) described herein, and a primer collection including a first primer set for performing a first round of amplification of a nested amplification reaction (e.g., nested PCR) described herein. In this case, one or more of the primers of the first primer set (e.g., all forward primers of the first set) may lack an adapter sequence, and one or more of the primers of the second primer set (e.g., all forward primers of the second set) may include an adapter sequence. In some cases, the collection of primers provided herein may include reverse primers for the first and second rounds of amplification.

[0172] In another example, the collection of primers provided herein may include (a) a first set of primers set forth in Table 1, (b) a second set of primers set forth in Table 2, (c) a reverse primer for each of the first and second sets, (d) a third set of primers set forth in Table 5 (having a primer adapter sequence added to the 5' end), (e) a fourth set of primers set forth in Table 6 (having a primer adapter sequence added to the 5' end that is different from the adapter sequence used in the third set of primers), and (f) a reverse primer for each of the third and fourth sets.

[0173] This document also provides a method of making the kits described herein, the reaction mixtures described herein, and the collections of nucleic acid primers described herein. For example, the components of the kits described herein can be obtained and placed in a package to form the kits described herein. In some cases, each component of the kits described herein can be housed in a separate container with a package. To make the reaction mixtures described herein, the components of the reaction mixtures described herein can be combined in a single reaction vessel. For example, the components of the reaction mixtures described herein can be combined in a single well of a multi-well plate. To make the collections of nucleic acid primers described herein, the primers of the collections described herein can be combined in a single reaction vessel. For example, each primer of the collections of nucleic acid primers described herein can be combined in a single well of a multi-well plate.

[0174] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims. EXAMPLES

[0175] [Example 1] Selection of T cells from single T cells and acquisition of cDNA Amplification of individual pairs of TCR α and β chains using the methods and materials described herein included accurate seeding of single T cells, efficient extraction of RNA, and preservation of RNA integrity. To confirm each of these, a mouse hybridoma T cell line, 1B9, expressing mTRAV6-7 α chain and mTRBV17 β chain was used. Detection of mouse GAPDH mRNA was detected using real-time qPCR using serial 2-fold limiting cell dilutions down to 0.08 cells per well. qPCR reactions were performed in a Biorad CFX384 real-time instrument using the KAPA SYBR Green FAST kit (commercially obtained from Kapa Biosystems), forward primer (5'-TCCCACTCTTCCACCTTCGA-3', SEQ ID NO: 323), and reverse primer (5'-AGTTGGGATAGGGCCTCTCTT-3', SEQ ID NO: 324). PCR conditions included 10 min at 95° C. for DNA polymerase activation, followed by 55 cycles of 10 s at 95° C. for denaturation and 30 s at 60° C. for annealing / extension. Melting curve analysis was performed to establish specificity.

[0176] GAPDH was used as readout and effective conditions were determined to be as follows: 1 1B9 cell / well was suspended in 1 μL PBS containing 1 mg / mL bovine serum albumin (commercially obtained from Ambion) and lysed using 1 μL 0.3% IGEPAL CA-630 (commercially obtained from Sigma). cDNA was generated by adding 1 μL Random Hexamers (commercially obtained from Promega), 1 μL dNTPs (commercially obtained from Bioline), 1 μL RNase OUT (commercially obtained from Promega), 1 μL DTT, 2 μL 5× buffer, and 1 μL Superscript IV (commercially obtained from ThermoFisher Scientific) to a total volume of 10 μL. cDNA synthesis was performed by incubating at 25° C. for 10 min for primer binding, 50° C. for 40 min for extension, and 85° C. for 5 min for enzyme heat inactivation.

[0177] Amplification of the mouse TRBV17 β chain from cDNA generated from serial dilutions of cells was performed using Phusion (a proofreading DNA polymerase) using the forward primer for mTRBV17 (sequence number 251) together with the corresponding reverse primer (mTRBCn; sequence number 273) to reduce mutations incorporated during the amplification stage and make it compatible with subsequent cloning steps.

[0178] As shown in Figures 6A and 6B, we efficiently extracted RNA from single cells located in wells containing single cells using serial dilutions down from 10 cells down to 0.08 cells per well in a 384-well PCR plate, and successfully obtained cDNA from the RNA. GAPDH was detected using 5 μL of the cDNA reaction down to an estimated 0.31 cells / well (Figure 6A). In parallel, the other half of the cDNA reaction was used to amplify mTRBV17 in all wells that tested positive for GAPDH, again down to an estimated 0.31 cells / well (Figure 6B). Each dilution was tested in triplicate (Figure 6B).

[0179] To confirm that these conditions can amplify TCR chains from single cells, single 1B9 cells were seeded into 384-well plates using a micromanipulator and glass pipette as monitored under a microscope. In this example, 22 out of 24 single 1B9 cells resulted in amplification of their specific mTRBV17 β chain, followed by cell lysis to release RNA and reverse transcription to convert the RNA to cDNA (Figure 6C).

[0180] After confirming effective amplification of TCR chains from single cells, single 1B9 cells were sorted into separate wells of a 384-well plate using a FACS sorter. mTRBV17 amplification was used as a readout to confirm successful amplification from single T cells sorted using a cell sorter. The cell sorter was a BD FACSAria sorter configured with a 100 micron nozzle and set at 25 psi for efficient seeding in 384-well plates. In this example, 22 wells out of 24 containing 1B9 single cells sorted by the BD FACSAria cell sorter resulted in amplification of their specific mTRBV17 β chains, followed by cell lysis to release RNA and reverse transcription to convert the RNA to cDNA (Figure 6D).

[0181] These results demonstrate that using the methods and materials described herein, it is possible to sort single T cells into separate locations (e.g., to obtain one T cell / well), obtain RNA from those single T cells, and convert that RNA to cDNA in a manner that allows amplification of TCR sequences from the cDNA.

[0182] [Example 2] Confirmation of amplification efficiency of the first round amplification primers A panel of primers was synthesized for the amplification of all human hTRAV and hTRBV listed in Tables 1 and 2. Human peripheral blood mononuclear cells (PBMCs) were isolated from blood of healthy donors using density gradient centrifugation. Briefly, 35 mL of freshly isolated blood was carefully layered on top of 15 mL of Ficoll-Paque PLUS (commercially obtained from GE LifeSciences) and centrifuged for 30 min at 400 x g in a swinging bucket rotor at room temperature without the brake. The mononuclear cell layer was isolated and platelets were removed by centrifugation twice at 100 x g for 7 min. RNeasy kits (commercially obtained from Qiagen) were used to isolate 10 PBMCs. 7Total RNA from human mononuclear cells was isolated. cDNA was synthesized using Superscript IV reverse transcriptase and each individual primer listed in Tables 1 and 2 was tested for its amplification efficiency to amplify the corresponding variant. For the hTRAV forward primers listed in Table 1, the hTRACf reverse primer (SEQ ID NO: 265) was used. For the hTRBV forward primers listed in Table 2, the hTRBC reverse primer (SEQ ID NO: 268) was used. PCR amplification reactions used Phusion DNA polymerase.

[0183] All hTRAV primers had the ability to amplify the corresponding hTRAV, generating DNA products ranging from 463 base pairs to 569 base pairs in length (Figure 7). Similarly, all hTRBV primers had the ability to amplify the corresponding hTRBV, generating DNA products ranging from 561 base pairs to 636 base pairs in length (Figure 7).

[0184] A similar approach was used to confirm the amplification efficiency of the first round mouse primers listed in Tables 3 and 4. Briefly, lymphocytes were isolated from the thymus of young BL6 mice, and total RNA was isolated using the RNeasy Qiagen kit. cDNA was generated using Superscript IV, and amplification efficiency was tested in a PCR reaction using Phusion as a thermostable DNA polymerase and the corresponding mTRAC reverse primer (SEQ ID NO: 266) and the corresponding mTRBC reverse primer (SEQ ID NO: 269). All mTRAV forward primers in Table 3, except for mTRAV5-1, mTRAV6-1, mTRAV6-2, and mTRAV6-3 primers, were shown to amplify the corresponding mTRAV via gel electrophoresis (Figure 8). It was confirmed that mTRAV6-1, mTRAV6-2, and mTRAV6-3 primers amplify the corresponding mTRAV via sequencing of the amplified products. This data revealed that the mTRAV5-1 variant may be rare in the mouse repertoire. All mTRBV forward primers were shown to amplify the corresponding mTRBVs via gel electrophoresis (Figure 8), which was also confirmed via sequencing.

[0185] Example 3 Implementation of nested amplification method to obtain mouse TCR sequences Amplification of mouse TCR was performed using the primers listed in Tables 3 and 4. Naive CD8 from C57BL / 6 mice + Splenocytes were sorted and single cells were seeded into two 384-well PCR plates containing 1 μL PBS and 1 mg / mL ultra-pure BSA using a FACS Aria. cDNA was synthesized using the method described in Example 1, and 5 μL of the cDNA reaction was used to amplify the α and β TCR chain pairs.

[0186] In the first PCR amplification step, all primers listed in Tables 3 and 4 were combined into one PCR reaction containing 200 nM of two specific reverse primers (mTRAC, SEQ ID NO: 266; and mTRBC, SEQ ID NO: 269) for each individual primer. PCR was performed in a 25 μL reaction in the presence of 200 nM dNTPs and 1.5 mM MgCl2, using 1 unit of Phusion DNA polymerase per reaction. Thermal cycling conditions included 98°C for 1 minute, 98°C for 10 seconds, 55°C for 30 seconds, and 72°C for 40 seconds for a total of 30 cycles.

[0187] After the first round of amplification, two separate "nested" PCR reactions were performed for the separate amplification of the α and β chains. Briefly, 1 μL of the first amplification was amplified with either a mixture of all primers listed in Table 7 for the nested amplification of mTRAV plus mTRACn primer (SEQ ID NO: 271) as the reverse primer, or a mixture of all primers listed in Table 8 for the nested amplification of mTRBV plus mTRBCn primer (SEQ ID NO: 273) as the reverse primer. PCR was performed in 25 μL reactions in the presence of 200 nM dNTPs and 1.5 mM MgCl2 using 1 unit of Phusion DNA polymerase per reaction. Thermal cycling conditions included 98° C. for 1 minute, 98° C. for 10 seconds, 55° C. for 30 seconds, and 72° C. for 40 seconds for a total of 45 cycles, with a final incubation at 72° C. for 10 minutes.

[0188] CD8 sorted in two 384-well plates + / TCR β +T cell staining and selection were shown in FACS scans (Figure 9A). In addition, the amplification reactions for the first 24 wells with a single T cell / well on plate #1 and for the first 24 wells with a single T cell / well on plate #2 were analyzed by ethidium bromide gel electrophoresis (Figure 9B). The ability of these methods to amplify TCR α and β chain pairs from single T cells was confirmed (Figure 9B). The amplified DNA products showed different sizes than expected between mTRAV and mTRBV, indicating the specificity of the amplification and not the amplification due to DNA contamination (Figure 9B). In total, 45 out of 48 α chains were amplified, 44 out of 48 β chains were amplified, and 41 out of 48 TCR pairs were amplified, reaching an efficiency of 85.4 percent. These PCR amplified products were abundant, specific, and devoid of nonspecific amplified bands, making them suitable for downstream high-throughput cloning of functional TCRs. The amplified products were sequenced and a wide variety of different TCRs were identified with examples of clonality determined by their sequences in the CDR3 region.

[0189] This approach was performed multiple times using different sources of mouse T cells and the primers listed in Tables 3 and 4 as forward primers and two reverse primers (SEQ ID NO: 266 and 269) for the first round of amplification. Two separate second round amplifications were performed using portions of the resulting first round amplification reaction mixtures, one containing the primers listed in Table 7 as forward primers together with the reverse primer (SEQ ID NO: 271) and the other containing the primers listed in Table 8 as forward primers together with the reverse primer (SEQ ID NO: 273). More than 400 different amplification products were sequenced. These sequencing results confirmed successful amplification from all TRAV primers in Tables 3 and 7 (except for the primers specific for TRAV5-1). Sequencing results also confirmed successful amplification of all 22 mTRBVs. In some cases, the amplification products were cloned into expression vectors (e.g., retroviral vectors). Five of these expression vectors were introduced into cells and expression of functional cloned TCRs was confirmed via stimulation with anti-CD3 antibodies. One of these five is described in more detail in Examples 5 and 6.

[0190] [Example 4] Evaluation of gene expression levels in single T cells Due to the high efficiency of RNA extraction and cDNA conversion, a portion (e.g., about half) of the generated cDNA was successfully used to obtain TCR chain pairs from single T cells, leaving about half for further characterization of the state of these single T cells using gene expression analysis either in a pre-amplification step or directly from the generated cDNA.

[0191] Screening for a particular TCR can be performed using several screening assays to confirm hits.In some cases, gene expression can be performed in parallel while cloning TCR to determine the activation state of individual T cells.FACS can address this by, for example, using the upregulation of CD69 expression, but the identification of activation genes in a second screening assay can be used to further confirm positive hits.

[0192] CD4 was isolated by positive selection from PBMCs using BD iMag streptavidin beads and a biotinylated human anti-CD4 antibody. + Human T cells were isolated. The cells were cultured for 5 days in RPMI1640, 10% FCS, and 1% PS / Glu medium. Then, CD4 T cells were lysed with anti-CD3 / anti-CD28 antibodies bound to DYNA beads for 16 hours at 37°C. + The cells were activated to mimic the activation of T cells by antigen-presenting cells (APCs). After activation, positively selected CD4 +Cells were seeded at 1 T cell / well in a 384-well PCR plate using a micromanipulator, with each well containing 1 μL PBS, 1 mg / mL ultrapure BSA. RNA was extracted and cDNA was generated in 10 μL reactions as described herein. 2 μL of the resulting cDNA mixture was used for gene expression analysis of human IL-2 relative to RLP13A expression as a reference gene for normalization. qPCR reactions were performed using IL-2 forward primer (5'-AGGGATCTGAAACAACATTC-3', SEQ ID NO: 325), IL-2 reverse primer (5'-GCCTGATATGTTTTAAGTGGG-3', SEQ ID NO: 326), RLP13A forward primer (5'-GTCTGAAGCCTACAAGAAAG-3', SEQ ID NO: 327), and RLP13A reverse primer (5'-TGTCAATTTTCTTCTCCACG-3', SEQ ID NO: 328) utilizing the KAPA SYBR Green FAST kit (commercially obtained from Kapa Biosystems) in a Biorad CFX384 real-time instrument. PCR conditions included 95°C for 10 minutes for DNA polymerase activation, 95°C for 10 seconds for denaturation, and 60°C for 30 seconds for annealing / extension, for a total of 45 cycles, followed by melting curve analysis to establish specificity. The fold increase in IL-2 expression normalized to the RLP13A reference gene was determined. Upon activation with anti-CD3 / anti-CD28 beads, IL-2 expression ranged from no stimulation to several hundred-fold increase, confirming that this assay can be used to distinguish single sorted T cells that responded to a particular stimulus from those that did not (Figure 10).

[0193] [Example 5 TCR cloning] Wild-type female C57Bl / 6 mice were vaccinated with H60 peptide (LTFNYRNL) or OVA peptide (SINFEKL) conjugated to anti-DEC205 antibody as described elsewhere (Li et al., Blood, 118:5965-76 (2011)). Seven days after vaccination, spleens and lymph nodes were harvested, made into single cell suspensions, and stained with fluorescently labeled antibodies for anti-TCRβ (clone H57 conjugated to PerCp Cy5.5, Biolegend), anti-CD8α (clone 53-6.7 conjugated to PE, Biolegend, or clone 53-6.7 conjugated to AF488), anti-CD44 (clone IM7 conjugated to either AF647 or AF488), and, in the case of H60 isolation only, anti-CD4 (clone GK1.5 conjugated to PE-Cy7, Biolegend). Single cell suspensions were also stained with V450-conjugated MHC-I tetramers loaded with either H60 or OVA peptide.

[0194] After surface staining, cells were washed once in PBS and stained with Ghost780 (Tonbo) for 30 minutes at room temperature in PBS. Cells were washed twice and suspended in sterile PBS. Cells from separate mice were not pooled prior to sorting. Cells from individual mice were sorted onto different plates or onto different sections of a shared plate. Vaccine-activated antigen-specific cells (CD8 + , TCRβ + , CD44 hi , OVA or H60 tetramer + ) were sorted into multiple 384-well plates. hi CD8 +Relative binding of tetramers by splenocytes was assessed by flow cytometry (Figures 11A and 11B). Total cDNA was generated using random hexamers (Promega) and Superscript IV (Thermo Fisher). The quality of the cDNA was confirmed by qPCR for GAPDH (forward primer: 5'-TCCCACTCTTCCACCTTCGA-3', SEQ ID NO: 329; and reverse primer: 5'-AGTTGGATAGGGCCTCTCTT-3', SEQ ID NO: 330) using KAPA SYBR FAST qPCR Master Mix (Sigma Aldrich). Each well was treated to amplify the TCR alpha and beta chains. Mouse-specific forward primers listed in Tables 3 and 4 together with reverse primers (SEQ ID NOs: 266 and 269) were used together in the first round of amplification. For the second round, a portion of the PCR products from the first round was used to amplify the TCR alpha or TCR beta chain in two separate reactions using all primers included in Table 7 plus a reverse primer (SEQ ID NO: 271) in one reaction, and all primers listed in Table 8 plus a reverse primer (SEQ ID NO: 273) in the other reaction.

[0195] A subset of TCR alpha and beta positive wells were sequenced using Sanger sequencing (Genewiz). Two primers (SEQ ID NOs: 263 and 262) were used as sequencing primers, and the results were analyzed using SnapGene software (SnapGene). Cloning results (Figure 11C) showed the presence of unique clonal cell populations.

[0196] Based on the sequencing, TCR α and β pairs were cloned into Tdtomato-expressing retroviral constructs. Briefly, five TCR α and β pairs from H60 sorts were assembled into retroviral vectors with mouse INSERT_B from Table 14 using a Gibson cloning kit (New England Biolabs). The assembled vectors were grown as plasmids in NEB5α competent cells (New England Biolabs) and selected based on ampicillin resistance. Platinum E retroviral packaging cells (PLAT-E cells) were grown according to the manufacturer's instructions (Cell Biolabs Inc) and transfected with plasmids containing TCRs using a LipoJet in vitro transfection kit (Signa Gen Laboratories). 48 hours after transfection, supernatants from transfected PLAT-E cell cultures were harvested.

[0197] TCRα - β - Hybridoma cell lines were isolated from CD8 cells that bound H60-tetramer and infected with individual retroviral vectors that contained either the expanded TCR genes or TCR gene vectors assembled using alternative primer sets. Two, four, and six days after infection, cells were assessed by flow cytometry for expression of TCRβ and tdtomato. All five TCRs selected for amplification from H60 sorting successfully expressed TCRs on the surface of hybridoma cell lines. Six days after infection, Tdtomato +Cells were sorted out using bulk sorting techniques, and cells expressed both the Tdtomato gene and surface TCR for 2 months. Two of the H60 TCRβ cells were identified as expressing the TRVB2 gene (encoding the TCR Vβ4 gene). Sequence specificity and fidelity of virus production were tested by staining cell lines infected with TRVB2-containing virus with anti-TCR Vβ4 (clone KT4, biotin-labeled, BD Biosciences). Staining was assessed using an LSR II (BD Bioscience). Staining results showed that the TCR (in this case, TCR Vβ4 from H60) that had been cloned and selected via staining or sequencing was selectively expressed (Figure 11D-F). These transformed cell lines stably expressed the selected TCR for 2 months.

[0198] [Example 6] Expression of functional TCR cloned from a single T cell 4G4 cells were transfected with an NFAT-RE-driven luciferase reporter plasmid containing a hygromycin resistance gene using a Lipojet transfection kit (Signa Gen Laboratories). Two days after transfection, 4G4 were placed in culture containing 1 mg / mL concentration of hygromycin. This concentration killed 100% of untransfected 4G4 cells within 10 days. Hygromycin-resistant 4G4 cells were repeatedly subcloned and stimulated with PMA / I to induce NFAT-driven luciferase. Luciferase activity was measured in 384-well milky tissue culture treated plates (Greiner) using a BioGlow luciferase assay kit (Promega). Sublines of hygromycin-resistant cells were selected with low luciferase background expression and high inducible luciferase expression.

[0199] 4G4 cells were infected with two different TCR-expressing retroviral vectors assembled using Gibson assembly using TCR sequences obtained from single-cell sorted T cells. Viruses were generated using PLAT-E cells. One TCR-expressing vector was generated from single-cell sorting of primary T cells and contained a viral backbone expressing Tdtomato. The other TCR-expressing vector was generated from TCRs obtained from ex vivo expanded T cells and contained an eGFP-expressing backbone.

[0200] To determine the specificity and efficiency of retroviral transfection and TCR expression, background levels were obtained by staining uninfected cells with anti-TCRβ (clone H57) and assessing them for tdtomato and TCR expression. Uninfected 4G4 cells did not express TCRβ (Figure 12A, left panel). Virus-infected cells stained 24 hours post-infection for TCRβ, and both eGFP and tdtomato expression (depending on the viral vector used) were assessed. There were detectable levels of surface TCR and eGFP expression 24 hours post-infection (Figure 12A, right panel).

[0201] Luciferase reporter cells were infected with TCR-expressing viruses. One day after infecting the cells, 4G4 cells were plated into 384-well milky white tissue culture treated plates (Greiner). Individual wells of the milky white tissue culture treated 384-well plates were coated with varying concentrations of anti-mouse CD3 antibody and incubated overnight at 4°C (clone 2C11, BD Biosceinces). Wells were washed twice with PBS and 3 × 10 IgG from the cultures were added. 4 4G4 cells were infected with TCR-expressing viral vectors and seeded in a total volume of 40 μL of medium. Flow cytometric analysis of infected 4G4 cultures found that infection efficiency was less than 80% in most cases, as judged by Tdtomato or eGFP expression. TCR expression on the surface of cells was measured by staining with anti-mouse TCRβ clone H57 (Biolegend).

[0202] After 3.5 hours of incubation with anti-CD3, 40 μL of BioGlow substrate (Promega) was added to each well and the plate was incubated for 10 minutes at room temperature. Relative light units were measured over a 100 ms period using a SpectaMax i3 (Molecular Devices).

[0203] Uninfected cells expressed some luciferase as measured by RLU above 0 (FIG. 12B). However, uninfected cells were unresponsive to anti-CD3 stimulation. Infected cell cultures were highly responsive to anti-CD3 stimulation (FIG. 12B).

[0204] Example 7 Compositions and methods for simultaneous capture of full-length T cell receptor variable regions from single T cells. Background technology The quest to clone genes encoding TCRs and the discovery data date back more than 30 years. Isolation, characterization and re-expression of TCRs represent major goals for understanding T cell-driven diseases and for using T cells with defined TCRs as a therapy to cure cancer. Thus, such methods have both research / basic and therapeutic implications.

[0205] Here, in a general method for identifying T cell clones specific for a defined antigen, T cells are isolated from an organism and expanded in vitro in the presence of antigen and / or non-specific stimuli and pro-inflammatory cytokines. They are then immortalized as T cell hybridomas by cloning with cells and / or fusing with persistent T cell tumor lines that lack their own TCR expression. This is a biased method because T cells with lower affinity for an antigen may be overgrown by T cells with higher affinity for that same antigen, leaving the low affinity TCR undiscovered. Also, many T cells isolated from tissues or solid tumors do not expand well in vitro and lose their TCR specificity. Moreover, it is low throughput, slow and labor intensive.

[0206] An approach that partially overcomes these challenges is to perform immunization in vivo and select single T cells that exhibit expression of activation markers or bind to a given MHC-tetramer that is preloaded with a specific known peptide antigen target. The drawback of previous approaches is that many T cells that exhibit activation markers are stimulated by a bystander mechanism and are not specific for the antigen. Although the use of tetramers is an advancement, it is limited in that there are only a limited number of tetramers available, they can be laborious and expensive to produce, and furthermore, they are HLA / MHC restricted and they can lack the sensitivity to extract lower affinity T cells. The tetramer approach can also only isolate cells with known, predefined specificities and cannot be used to discover T cells and their receptors that recognize unknown but important antigenic peptides.

[0207] The T cells so isolated are then typically subjected to TCR sequencing. Capturing sequences beyond the VDJ boundary of TCRβ and the VJ boundary of TCRVα is the "hook" to fully distinguish the TCR and therefore immortalize the respective T cells (with some further effort), which is necessary since the cells themselves are not immortalized. This is typically achieved by using a pool of published primers that bind in the variable regions of the alpha (Vα) and beta (Vβ) chains, and primers that bind to the constant parts of the alpha and beta chains, followed by nested PCR. Until recently, T cell repertoires have been usually analyzed by sequencing either Vβ or Vα from pools of cells, even using high-throughput sequencing (HTS). However, while this method evaluates diversity and origin, it loses the Vα / Vβ pairs of single cells that can only together determine specificity.

[0208] Thus, in the past few years, several methods and literature have been developed to capture concatenated Vα / Vβ from single T cells. Such methods are low to medium throughput and expensive ($3-7 per sequence, considering both alpha and beta chains per TCR $6-14), depending on how they are constructed. Such sequencing identifies the necessary information, but they are not full-length Vα / Vβ. Therefore, this full-length sequence must be reconstructed if the goal is expression, and either PCR specific for each TCR must be performed (order of primers for each TCR costs about $5 per primer, $20 per TCR) or the complete alpha and beta sequences must be synthesized ($160-200 per TCR). Once both Vα and Vβ sequences are amplified / synthesized, they can finally be cloned into a vector of choice. There is no technology developed that will allow one to perform unbiased high-throughput identification and cloning of any single T cell isolated from tissue or blood suitable for high-throughput screening of antigens or therapeutic applications.

[0209] The compositions, vectors, and methods disclosed in this Example 7 can address these and other needs.

[0210] overview A method for assembling a TCR expression vector comprising full length Vα and full length Vβ from a single T cell (or a homogeneous T cell population) in a single vector is provided in this Example 7. A method for assembling a TCR expression vector comprising full length Vγ and full length Vδ from a single T cell (or a homogeneous T cell population) in a single vector is also provided in this Example 7. The TCR can be easily expressed without an additional cloning step.

[0211] In one embodiment, a method for assembling a TCR expression vector comprising Vα and Vβ regions from a single T cell (or a homogenous population of T cells) is provided in this Example 7, comprising the steps of: a. obtaining a linearized vector comprising a 5' end, a 3' end, and a first polynucleotide sequence encoding a TCR Cβ; b. obtaining a fragment b polynucleotide sequence, the fragment b polynucleotide sequence comprising a second polynucleotide sequence encoding a TCR C alpha operably linked to a third polynucleotide sequence encoding 2A; c. Obtaining RNA from a single T cell (or a homogenous population of T cells); d. performing a one-step reverse transcriptase-polymerase chain reaction (RT-PCR) to amplify a first set of TCR Vα amplicon products; i. reverse transcribing the RNA into cDNA; ii. performing a polymerase chain reaction on the cDNA, 1. A first forward Vα primer comprising at its 5′ end a first nucleotide sequence that is complementary to a second nucleotide sequence at the 5′ end of a linearized vector, the first nucleotide sequence being operably linked to a first leader sequence of a Vα gene; and 2. A first reverse Cα primer having a third nucleotide sequence that is complementary to a fourth nucleotide sequence at the 5' end of fragment b. A process that uses A process comprising: e. performing a one-step reverse transcriptase-polymerase chain reaction (RT-PCR) to amplify a first set of TCR Vβ amplicon products; i. reverse transcribing the RNA into cDNA; ii. performing a polymerase chain reaction on the cDNA, 1. A first forward Vβ primer comprising at its 5′ end a fifth nucleotide sequence that is complementary to a sixth nucleotide sequence at the 3′ end of fragment b, wherein the fifth nucleotide sequence is operably linked to a second leader sequence of a Vβ gene; and 2. A first reverse Cβ primer having a seventh nucleotide sequence that is complementary to the eighth nucleotide sequence at the 3' end of the linearized vector. A process that uses A process comprising: f. performing a nested polymerase chain reaction on the first set of TCR V alpha amplicon products to amplify a second set of TCR V alpha amplicon products; i. a second forward Vα primer comprising a ninth nucleotide sequence that contains a portion of the first nucleotide sequence of the first forward Vα primer; and ii. a second reverse Cα primer having a 10th nucleotide sequence that is complementary to the 11th nucleotide sequence at the 5' end of fragment b; A process of using g. performing a nested polymerase chain reaction on the first set of TCR Vβ amplicons to amplify a second set of TCR β amplicon products; i. a second forward Vβ primer having a 12th nucleotide sequence at its 5' end that contains a portion of the 5th nucleotide sequence of the first forward Vβ primer; and ii. a second reverse Cβ primer having a 13th nucleotide sequence that is complementary to the 14th nucleotide sequence at the 3' end of the linearized vector; A process of using h. Below: i. the 5' end of the linearized vector; ii. a second set of TCR Vα amplicon products; iii. fragment b polynucleotide sequence; iv. a second set of TCR Vβ amplicon products; and v. The 3' end of the linearized vector Assembling the TCR expression vector by ligation in the 5' to 3' direction of

[0212] In another embodiment, a method for assembling a TCR expression vector comprising Vα and Vβ regions from a single T cell (or a homogenous population of T cells) is provided in this Example 7, comprising the steps of: a. obtaining a linearized vector comprising a 5' end, a 3' end, and a first polynucleotide sequence encoding a TCR Cβ; b. obtaining a fragment b polynucleotide sequence, the fragment b polynucleotide sequence comprising a second polynucleotide sequence encoding a TCR C alpha operably linked to a third polynucleotide sequence encoding 2A; c. Obtaining RNA from a single T cell (or a homogenous population of T cells); d. performing a one-step reverse transcriptase-polymerase chain reaction (RT-PCR) to amplify a first set of TCR Vα amplicon products; i. reverse transcribing the RNA into cDNA; ii. performing a polymerase chain reaction on the cDNA, 1. A plurality of first forward Vα primers comprising at their 5′ ends a first nucleotide sequence that is complementary to a second nucleotide sequence at the 5′ end of a linearized vector, the first nucleotide sequence being operably linked to a plurality of first leader sequences of a Vα gene; and 2. A first reverse Cα primer having a third nucleotide sequence that is complementary to a fourth nucleotide sequence at the 5' end of fragment b. A process that uses A process comprising: e. performing a one-step reverse transcriptase-polymerase chain reaction (RT-PCR) to amplify a first set of TCR Vβ amplicon products; i. reverse transcribing the RNA into cDNA; ii. performing a polymerase chain reaction on the cDNA, 1. A plurality of first forward Vβ primers comprising at their 5′ ends a fifth nucleotide sequence that is complementary to a sixth nucleotide sequence at the 3′ end of fragment b, wherein the fifth nucleotide sequence is operably linked to a plurality of second leader sequences of a Vβ gene; and 2. A first reverse Cβ primer having a seventh nucleotide sequence that is complementary to the eighth nucleotide sequence at the 3' end of the linearized vector. A process that uses A process comprising: f. performing a nested polymerase chain reaction on the first set of TCR V alpha amplicon products to amplify a second set of TCR V alpha amplicon products; i. a second forward Vα primer comprising a ninth nucleotide sequence that contains a portion of the first nucleotide sequence of the first forward Vα primer; and ii. a second reverse Cα primer having a 10th nucleotide sequence that is complementary to the 11th nucleotide sequence at the 5' end of fragment b; A process of using g. performing a nested polymerase chain reaction on the first set of TCR Vβ amplicons to amplify a second set of TCR β amplicon products; i. a second forward Vβ primer having a 12th nucleotide sequence at its 5' end that contains a portion of the 5th nucleotide sequence of the first forward Vβ primer; and ii. a second reverse Cβ primer having a 13th nucleotide sequence that is complementary to the 14th nucleotide sequence at the 3' end of the linearized vector; A process of using h. Below: i. the 5' end of the linearized vector; ii. a second set of TCR Vα amplicon products; iii. fragment b polynucleotide sequence; iv. a second set of TCR Vβ amplicon products; and v. The 3' end of the linearized vector Assembling the TCR expression vector by ligation in the 5' to 3' direction of

[0213] In one aspect, a method for assembling a TCR expression vector comprising Vγ and Vδ regions from a single T cell (or a homogenous population of T cells) is provided in this Example 7, comprising the steps of: a. obtaining a linearized vector comprising a 5' end, a 3' end, and a first polynucleotide sequence encoding a TCR C delta; b. obtaining a fragment b polynucleotide sequence, the fragment b polynucleotide sequence comprising a second polynucleotide sequence encoding TCR Cγ operably linked to a third polynucleotide sequence encoding 2A; c. Obtaining RNA from a single T cell (or a homogenous population of T cells); d. performing a one-step reverse transcriptase-polymerase chain reaction (RT-PCR) to amplify a first set of TCR Vγ amplicon products; i. reverse transcribing the RNA into cDNA; ii. performing a polymerase chain reaction on the cDNA, 1. A first forward Vγ primer comprising at its 5′ end a first nucleotide sequence that is complementary to a second nucleotide sequence at the 5′ end of a linearized vector, the first nucleotide sequence being operably linked to a first leader sequence of a Vγ gene; and 2. A first reverse Cγ primer having a third nucleotide sequence that is complementary to a fourth nucleotide sequence at the 5′ end of fragment b. A process that uses A process comprising: e. performing a one-step reverse transcriptase-polymerase chain reaction (RT-PCR) to amplify a first set of TCR Vδ amplicon products, i. reverse transcribing the RNA into cDNA; ii. performing a polymerase chain reaction on the cDNA, 1. A first forward Vδ primer comprising at its 5' end a fifth nucleotide sequence that is complementary to a sixth nucleotide sequence at the 3' end of fragment b, wherein the fifth nucleotide sequence is operably linked to a second leader sequence of a Vδ gene; and 2. A first reverse Cδ primer having a seventh nucleotide sequence that is complementary to the eighth nucleotide sequence at the 3' end of the linearized vector. A process that uses A process comprising: f. performing a nested polymerase chain reaction on the first set of TCR Vγ amplicon products to amplify a second set of TCR Vγ amplicon products; i. a second forward Vγ primer comprising a ninth nucleotide sequence that contains a portion of the first nucleotide sequence of the first forward Vγ primer; and ii. a second reverse Cγ primer having a 10th nucleotide sequence that is complementary to the 11th nucleotide sequence at the 5′ end of fragment b; A process of using g. performing a nested polymerase chain reaction on the first set of TCR V delta amplicons to amplify a second set of TCR delta amplicon products; i. a second forward Vδ primer having a 12th nucleotide sequence at its 5' end that contains a portion of the 5th nucleotide sequence of the first forward Vδ primer; and ii. a second reverse Cδ primer having a 13th nucleotide sequence that is complementary to the 14th nucleotide sequence at the 3' end of the linearized vector; A process of using h. Below: i. the 5' end of the linearized vector; ii. a second set of TCR Vγ amplicon products; iii. fragment b polynucleotide sequence; iv. a second set of TCR Vδ amplicon products, and v. The 3' end of the linearized vector Assembling the TCR expression vector by ligation in the 5' to 3' direction of

[0214] In another aspect, a method for assembling a TCR expression vector comprising Vγ and Vδ regions from a single T cell (or a homogenous population of T cells) is provided in this Example 7, comprising the steps of: a. obtaining a linearized vector comprising a 5' end, a 3' end, and a first polynucleotide sequence encoding a TCR C delta; b. obtaining a fragment b polynucleotide sequence, the fragment b polynucleotide sequence comprising a second polynucleotide sequence encoding TCR Cγ operably linked to a third polynucleotide sequence encoding 2A; c. Obtaining RNA from a single T cell (or a homogenous population of T cells); d. performing a one-step reverse transcriptase-polymerase chain reaction (RT-PCR) to amplify a first set of TCR Vγ amplicon products; i. reverse transcribing the RNA into cDNA; ii. performing a polymerase chain reaction on the cDNA, 1. A plurality of first forward Vγ primers comprising at their 5′ ends a first nucleotide sequence that is complementary to a second nucleotide sequence at the 5′ end of a linearized vector, the first nucleotide sequence being operably linked to a plurality of first leader sequences of Vγ genes; and 2. A first reverse Cγ primer having a third nucleotide sequence that is complementary to a fourth nucleotide sequence at the 5′ end of fragment b. A process that uses A process comprising: e. performing a one-step reverse transcriptase-polymerase chain reaction (RT-PCR) to amplify a first set of TCR Vδ amplicon products, i. reverse transcribing the RNA into cDNA; ii. performing a polymerase chain reaction on the cDNA, 1. A plurality of first forward Vδ primers comprising at their 5' ends a fifth nucleotide sequence that is complementary to a sixth nucleotide sequence at the 3' end of fragment b, wherein the fifth nucleotide sequence is operably linked to a plurality of second leader sequences of a Vδ gene; and 2. A first reverse Cδ primer having a seventh nucleotide sequence that is complementary to the eighth nucleotide sequence at the 3' end of the linearized vector. A process that uses A process comprising: f. performing a nested polymerase chain reaction on the first set of TCR Vγ amplicon products to amplify a second set of TCR Vγ amplicon products; i. a second forward Vγ primer comprising a ninth nucleotide sequence that contains a portion of the first nucleotide sequence of the first forward Vγ primer; and ii. a second reverse Cγ primer having a 10th nucleotide sequence that is complementary to the 11th nucleotide sequence at the 5′ end of fragment b; A process of using g. performing a nested polymerase chain reaction on the first set of TCR V delta amplicons to amplify a second set of TCR delta amplicon products; i. a second forward Vδ primer having a 12th nucleotide sequence at its 5' end that contains a portion of the 5th nucleotide sequence of the first forward Vδ primer; and ii. a second reverse Cδ primer having a 13th nucleotide sequence that is complementary to the 14th nucleotide sequence at the 3' end of the linearized vector; A process of using h. Below: i. the 5' end of the linearized vector; ii. a second set of TCR Vγ amplicon products; iii. fragment b polynucleotide sequence; iv. a second set of TCR Vδ amplicon products, and v. The 3' end of the linearized vector in the 5' to 3' direction to assemble the TCR expression vector by ligation.

[0215] In one embodiment, steps (d) and (e) are carried out in a single reaction. In one embodiment, steps (f) and (g) are carried out in a single reaction.

[0216] In one embodiment, the step of assembling the TCR expression vector by ligation comprises a seamless cloning method that utilizes short regions of homology, hi one embodiment, the step of assembling the TCR expression vector by ligation comprises the Gibson assembly method.

[0217] In one embodiment, the first nucleotide sequence is 15-25 nucleotides in length. In one embodiment, the first nucleotide sequence is 20 nucleotides in length.

[0218] In one embodiment, the fifth nucleotide sequence is 15 to 25 nucleotides in length. In one embodiment, the fifth nucleotide sequence is 20 nucleotides in length.

[0219] In one embodiment, the ninth nucleotide sequence is 15 to 25 nucleotides in length. In one embodiment, the ninth nucleotide sequence is 18 nucleotides in length.

[0220] In one embodiment, the twelfth nucleotide sequence is 15 to 25 nucleotides in length. In one embodiment, the twelfth nucleotide sequence is 18 nucleotides in length.

[0221] In one embodiment, the linearized vector comprises pMIGII.

[0222] In one embodiment, the third polynucleotide sequence encoding 2A is selected from a nucleotide sequence encoding a 2A peptide sequence, wherein the 2A peptide sequence is selected from SEQ ID NO: 331, SEQ ID NO: 332, SEQ ID NO: 333, SEQ ID NO: 334, or SEQ ID NO: 335. In one embodiment, the third polynucleotide sequence encoding 2A is selected from a nucleotide sequence encoding a 2A peptide sequence, wherein the 2A peptide sequence is selected from SEQ ID NO: 332, SEQ ID NO: 333, SEQ ID NO: 334, or SEQ ID NO: 335. In one embodiment, the third polynucleotide sequence encoding 2A is selected from a nucleotide sequence encoding a 2A peptide sequence, wherein the 2A peptide sequence is SEQ ID NO: 335.

[0223] In one embodiment, the third polynucleotide sequence encoding 2A is SEQ ID NO:336.

[0224] In one embodiment, the T cells are of human origin. In one embodiment, the T cells are of mouse origin.

[0225] In one embodiment, RNA is obtained directly from the T cells as part of a one-step RT-PCR reaction. In one embodiment, RNA is obtained and isolated from the T cells prior to the RT-PCR reaction.

[0226] explanation A method for assembling a TCR expression vector containing full-length Vα and full-length Vβ from a single T cell (or a homogeneous T cell population) in a single vector is provided in this Example 7. A method for assembling a TCR expression vector containing full-length Vγ and full-length Vδ from a single T cell (or a homogeneous T cell population) in a single vector is also provided in this Example 7. TCRs can be easily expressed without additional cloning steps. See, for example, Figures 13-23.

[0227] Terms used throughout this application should be interpreted as having their ordinary and typical meaning to those of ordinary skill in the art. However, the following terms are given specific definitions, as defined below.

[0228] As used in this specification and claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a cell" includes a plurality of cells, including mixtures thereof.

[0229] The terms "about" and "approximately" are defined as "approximately" as understood by one of ordinary skill in the art. In one non-limiting embodiment, the term is defined to be within 10%. In another non-limiting embodiment, the term is defined to be within 5%. In yet another non-limiting embodiment, the term is defined to be within 1%.

[0230] The terms "cell," "cell line," and "cell culture" include progeny. It is also understood that all progeny may not be precisely identical in DNA content due to deliberate or inadvertent mutations. Variant progeny within the population are included, which have the same TCR expression as screened for in the originally engineered cell population.

[0231] As used herein, the term "comprising" is intended to mean that the compositions and methods include the recited elements, but do not exclude others. "Consisting essentially of," when used to define compositions and methods, means excluding other elements that are of any essential significance to the combination. Thus, a composition consisting essentially of the elements defined herein does not exclude trace contaminants from isolation and purification methods, as well as pharma- ceutical acceptable carriers, e.g., phosphate buffered saline, preservatives, and the like. "Consisting of" means excluding more than trace amounts of other components of the elements and substantial method steps for administering the compositions of the invention. Embodiments defined by each of these transition terms are within the scope of the invention.

[0232] A "control" is a substitute control or sample used in an experiment for comparison purposes. Controls can be "positive" or "negative."

[0233] The term "fragment b" as used herein refers to a DNA polynucleotide sequence that includes, in the 5' to 3' direction, a Cα polynucleotide and a viral 2a polynucleotide, and fragment b is capable of linking at both its 5' and 3' ends to the amplicon product of this Example 7 using the Gibson assembly method. In one embodiment, fragment b is as set forth in SEQ ID NO:337.

[0234] As used herein, "gene expression" and "protein expression" refer to the process by which a polynucleotide is transcribed into mRNA and the transcribed mRNA is subsequently translated into a peptide, polypeptide, or protein, respectively. If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in eukaryotic cells. "Gene overexpression" refers to the overproduction of mRNA transcribed from a gene at a level 2.5-fold, 5-fold, or 10-fold higher than the expression level detected in a control sample. "Protein overexpression" includes the overproduction of a protein encoded by a gene at a level 2.5-fold, 5-fold, or 10-fold higher than the expression level detected in a control sample.

[0235] As used herein, "surface expression" refers to a process in which at least a portion of a polypeptide is transferred to the surface of a cell such that it is located on the outside of the cell surface. "Surface overexpression" includes an increase in the amount of a particular polypeptide on the outer surface of a cell at a level 2.5-fold, 5-fold, or 10-fold higher than the surface expression level detected in a control sample.

[0236] The term "Gibson assembly method" as used in Example 7 refers to a method known to those skilled in the art that results in directional closure of multiple DNA fragments, first described in Gibson DG, Young L et al. (2009), Enzymatic assembly of DNA molecules up to several hundred kilobases, Nature Methods, 6(5):343-345. The Gibson assembly method uses DNA fragments and an acceptor vector designed to have overlapping sequences at the positions to be ligated, along with an exonuclease, a ligase and a polymerase.

[0237] The term "identity" or "homology" is interpreted to mean the percentage of nucleotide bases or amino acid residues in a candidate sequence that are identical to the bases or residues of the corresponding sequence to which it is compared, without considering any conservative substitutions as part of the sequence identity, after aligning the sequences and introducing gaps, if necessary to achieve the maximum percent identity for the entire sequence. Neither N-terminal nor C-terminal extensions nor insertions are interpreted as reducing the identity or homology. A polynucleotide or polynucleotide region (or polypeptide or polypeptide region) having a certain percentage (e.g., 80%, 85%, 90%, or 95%) of "sequence homology" to another sequence means that, when aligned, the percentage of bases (or amino acids) are the same in the comparison of the two sequences. This alignment and percent homology or sequence identity can be determined using software programs known in the art. In one embodiment, default parameters are used for the alignment. In one embodiment, the BLAST program is used with default parameters. In one embodiment, the BLAST programs BLASTN and BLASTP are used with the following default parameters: genetic code=normal, filter=none, normal=both, cutoff=60, expectation=10, matrix=BLOSUM62, listing=50 sequences, sorting=high score, database=non-redundant, GenBank+EMBL+DDBJ+PDB+GenBank CDS translation+SwissProtein+SPupdate+PIR.

[0238] "Mammal" for purposes of treatment as used in Example 7 refers to any animal classified as a mammal, including humans, domestic and farm animals, non-human primates, and zoo, sports, or pet animals, such as dogs, horses, cats, cows, etc.

[0239] The terms "polynucleotide" and "oligonucleotide" are used interchangeably and refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. A polynucleotide may have any three-dimensional structure and may perform any function, known or unknown. Non-limiting examples of polynucleotides are: a gene or gene fragment, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may contain modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component. The term also refers to both double-stranded and single-stranded molecules. Unless otherwise specified or required, any embodiment of the present invention that is a polynucleotide encompasses both the double-stranded form and each of the two complementary single-stranded forms that are known or predicted to make up the double-stranded form. A polynucleotide consists of a specific sequence of the four nucleotide bases adenine (A), cytosine (C), guanine (G), thymine (T), and uracil (U) in place of thymine (T) when the polynucleotide is RNA. Thus, the term "polynucleotide sequence" is the alphabetical representation of a polynucleotide molecule. This alphabetical representation can be input into a database in a computer having a central processing unit and used for bioinformatics applications, such as functional genomics and homology searching.

[0240] The term "polypeptide" is used in its broadest sense to refer to a compound of two or more subunit amino acids, amino acid analogs, or peptidomimetics. The subunits may be linked by peptide bonds. In alternative embodiments, the subunits may be linked by other bonds, such as esters, ethers, and the like. As used herein, the term "amino acid" refers to any natural and / or unnatural or synthetic amino acid, including glycine and both the D or L optical isomers, as well as amino acid analogs and peptidomimetics. If the peptide chain is short, a peptide of three or more amino acids is commonly referred to as an oligopeptide. If the peptide chain is long, the peptide is commonly referred to as a polypeptide or a protein.

[0241] A "primer" is a short polynucleotide that typically has a free 3'-OH group that specifically hybridizes to the target and then binds to a target or "template" potentially present in a sample of interest by promoting polymerization of a polynucleotide complementary to the target. "Primer specificity" refers to the ability of a primer to specifically bind to a target. Primer specificity is determined by the polynucleotide region within the primer that hybridizes to the target, also referred to herein as the "hybridizing region."

[0242] "Polymerase chain reaction" ("PCR") is a reaction in which replicate copies are made from a target polynucleotide using a "primer pair" or "primer set" consisting of a "forward" and a "reverse" primer, and a catalyst for polymerization, e.g., a DNA polymerase, and typically a thermostable polymerase enzyme. In some embodiments, the forward primer specifically binds to a T cell leader sequence, resulting in an amplicon product that includes the leader sequence. PCR methods are well known in the art and are taught, for example, in "PCR: A PRACTICAL APPROACH" (M. MacPherson et al., IRL Press at Oxford University Press (1991)). The term "RT-PCR" as used herein refers to a reverse transcription PCR process in which an RNA molecule, e.g., mRNA, is reverse transcribed into a cDNA molecule and then amplified as known to those of skill in the art. The term "nested PCR" as used herein refers to a PCR process in which a first PCR process is followed by at least one primer that is different from the first process to amplify a target within the product of the first PCR process. In some embodiments, the first PCR process is an RT-PCR process. All processes that create duplicate copies of a polynucleotide, such as PCR or gene cloning, are collectively referred to herein as "replication."

[0243] The term "subject" is defined herein to include animals, e.g., mammals, including, but not limited to, primates (e.g., humans), cows, sheep, goats, horses, dogs, cats, rabbits, rats, mice, etc. In some embodiments, the subject is a human.

[0244] The term "T cell" as used herein refers to a lymphocyte that expresses a T cell receptor. T cells are CD4 + T cells, CD8 + T cells, and NK T cells. CD4 + The T cell subsets are Th1, Th2, Th9, Th22, Treg, and Tfh. CD8+ T cells comprise both memory and effector cell subsets.

[0245] The term "T cell receptor" is used interchangeably with the term "TCR." These terms typically refer to a complex of integral membrane proteins involved in the activation of T cells in response to antigen (the alpha (α) chain (or gamma (γ) chain), the beta (β) chain (or delta (δ) chain), two zeta (ζ) chains, the CD3 delta (δ) chain, the CD3 (ε) chain, and the CD3 (γ) chain), although as used herein, the terms "T cell receptor" and "TCR" refer to the alpha (α) (or gamma (γ)) and beta (β) (or delta (δ)) chains (polypeptides) of the TCR. A "TCR alpha polynucleotide" encodes the TCR alpha chain (including the variable region (V) and the constant region (C)), whereas a "TCR beta polynucleotide" encodes the TCR beta chain (including the variable region (V) and the constant region (C). Thus, a "V alpha polynucleotide" refers herein to a polynucleotide encoding a TCR alpha chain variable region polypeptide. "Cα polynucleotide" as used herein refers to a polynucleotide encoding a TCR α chain constant region polypeptide. "Vβ polynucleotide" as used herein refers to a polynucleotide encoding a TCR β chain variable region polypeptide. "Cβ polynucleotide" as used herein refers to a polynucleotide encoding a TCR β chain constant region polypeptide. In some embodiments, the encoded polypeptide is a full-length polypeptide. In other embodiments, the encoded polypeptide is a fragment. It should be understood that a Vα polynucleotide includes both a TCR Vα polynucleotide and a TCR Jα polynucleotide. It should be further understood that a Vβ polynucleotide includes all of a TCR Vβ polynucleotide, a TCR Dβ polynucleotide, and a TCR Jβ polynucleotide. In one embodiment, the Cβ polynucleotide sequence is SEQ ID NO: 338.

[0246] The term "expression vector" as used in Example 7 refers to a DNA construct containing a DNA sequence operably linked to suitable control sequences capable of effecting expression of the DNA in a suitable host. Such control sequences include a promoter that effects transcription, an optional operator sequence that controls such transcription, a sequence that codes for a suitable mRNA ribosome binding site, and sequences that control the termination of transcription and translation. An expression vector may be a plasmid, a phage particle, or simply a possible genomic insert. When transformed into a suitable host, the expression vector may replicate and function independently of the host genome, or in some cases, may integrate into the genome itself. Although plasmids are the most commonly used form of expression vector, the present invention is intended to include such other forms of expression vectors that perform equivalent functions to those known in the art, and that are or become known in the art.

[0247] The term "2a polynucleotide" as used herein refers to a polynucleotide encoding a 2A peptide or a 2A peptide consensus motif of Asp-Val / Ile-Glu-X-Asn-Pro-Gly-Pro (SEQ ID NO: 331). 2A peptides include, but are not limited to, the 2A peptide of foot and mouth disease virus (VKQTLNFDLLKLAGDVESNPGP, SEQ ID NO: 332), the 2A peptide of equine rhinitis A virus (QCTNYALLKLAGDVESNPGP, SEQ ID NO: 333), the 2A peptide of Zawczynski virus (EGRGSLLTCGDVEENPGP, SEQ ID NO: 334), and the 2A peptide of porcine teschovirus-1 (ATNFSLLKQAGDVEENPGP, SEQ ID NO: 335).

[0248] method A method for assembling a TCR expression vector by capturing full length Va and Vβ from a single T cell (or a homogeneous T cell population) in a single vector is provided in this Example 7. A method for assembling a TCR expression vector including capturing full length Vγ and full length Vδ from a single T cell (or a homogeneous T cell population) in a single vector is also provided in this Example 7. TCRs can be easily expressed without additional cloning steps.

[0249] Methods are disclosed in Example 7 that allow for the rapid cloning of any known or unknown TCR in any vector. These methods are less expensive and more fair than prior art methods. In some embodiments, these methods allow for the rapid and inexpensive amplification of intact TCRs of any T cell and direct seamless cloning of the product in a vector of choice. Applications of these methods and materials are numerous, for example, medium to high throughput isolation and cloning of TCRs into retroviral vectors for antigen screening and / or generation of retrogenic or transgenic mice.

[0250] The method described in Example 7 is adapted to the human system by designing a set of primers specific for human α and β chains and by using a vector (e.g., a retroviral vector or provirus) suitable for infecting human cells. In some embodiments, these methods can be used for immunotherapy of cancer. This is achieved by cloning TCRs from a large number of tumor infiltrating cells (TILs) into an acceptor retroviral vector, with the ultimate goal of transducing patient lymphocytes to be used for immunotherapy. In some embodiments, the method disclosed in Example 7 is used to clone a large number of TCRs from inflamed tissues of autoimmune patients and screen them for self-antigens. With this knowledge, a strategy is used to neutralize either the antigen or the specific autoreactive T cells that recognize it. In another embodiment, TCRs are cloned from T cells taken from solid organ transplants experiencing rejection by the host, such as liver, kidney, lung, or intestine. Such TCRs can be used to study and monitor the rejection process, and these T cells can be introduced into host human T cells with regulatory functions that can be used to treat the rejection.

[0251] In one embodiment, a method for assembling a TCR expression vector comprising Vα and Vβ regions from a single T cell (or a homogenous population of T cells) is provided in Example 7, comprising the steps of: a. obtaining a linearized vector comprising a 5' end, a 3' end, and a first polynucleotide sequence encoding a TCR Cβ; b. obtaining a fragment b polynucleotide sequence, the fragment b polynucleotide sequence comprising a second polynucleotide sequence encoding a TCR C alpha operably linked to a third polynucleotide sequence encoding 2A; c. Obtaining RNA from a single T cell (or a homogenous population of T cells); d. performing a one-step reverse transcriptase-polymerase chain reaction (RT-PCR) to amplify a first set of TCR Vα amplicon products; i. reverse transcribing the RNA into cDNA; ii. performing a polymerase chain reaction on the cDNA, 1. A first forward Vα primer comprising at its 5′ end a first nucleotide sequence that is complementary to a second nucleotide sequence at the 5′ end of a linearized vector, the first nucleotide sequence being operably linked to a first leader sequence of a Vα gene; and 2. A first reverse Cα primer having a third nucleotide sequence that is complementary to a fourth nucleotide sequence at the 5' end of fragment b. A process that uses A process comprising: e. performing a one-step reverse transcriptase-polymerase chain reaction (RT-PCR) to amplify a first set of TCR Vβ amplicon products; i. reverse transcribing the RNA into cDNA; ii. performing a polymerase chain reaction on the cDNA, 1. A first forward Vβ primer comprising at its 5′ end a fifth nucleotide sequence that is complementary to a sixth nucleotide sequence at the 3′ end of fragment b, wherein the fifth nucleotide sequence is operably linked to a second leader sequence of a Vβ gene; and 2. A first reverse Cβ primer having a seventh nucleotide sequence that is complementary to the eighth nucleotide sequence at the 3' end of the linearized vector. A process that uses A process comprising: f. performing a nested polymerase chain reaction on the first set of TCR V alpha amplicon products to amplify a second set of TCR V alpha amplicon products; i. a second forward Vα primer comprising a ninth nucleotide sequence that contains a portion of the first nucleotide sequence of the first forward Vα primer; and ii. a second reverse Cα primer having a 10th nucleotide sequence that is complementary to the 11th nucleotide sequence at the 5' end of fragment b; A process of using g. performing a nested polymerase chain reaction on the first set of TCR Vβ amplicons to amplify a second set of TCR β amplicon products; i. a second forward Vβ primer having a 12th nucleotide sequence at its 5' end that contains a portion of the 5th nucleotide sequence of the first forward Vβ primer; and ii. a second reverse Cβ primer having a 13th nucleotide sequence that is complementary to the 14th nucleotide sequence at the 3' end of the linearized vector; A process of using h. Below: i. the 5' end of the linearized vector; ii. a second set of TCR Vα amplicon products; iii. fragment b polynucleotide sequence; iv. a second set of TCR Vβ amplicon products; and v. The 3' end of the linearized vector Assembling the TCR expression vector by ligation in the 5' to 3' direction (e.g., seamless cloning method or Gibson assembly method).

[0252] In another embodiment, a method of assembling a TCR expression vector comprising Vα and Vβ regions from a single T cell (or a homogenous population of T cells) is provided in Example 7, comprising the steps of: a. obtaining a linearized vector comprising a 5' end, a 3' end, and a first polynucleotide sequence encoding a TCR Cβ; b. obtaining a fragment b polynucleotide sequence, the fragment b polynucleotide sequence comprising a second polynucleotide sequence encoding a TCR C alpha operably linked to a third polynucleotide sequence encoding 2A; c. Obtaining RNA from a single T cell (or a homogenous population of T cells); d. performing a one-step reverse transcriptase-polymerase chain reaction (RT-PCR) to amplify a first set of TCR Vα amplicon products; i. reverse transcribing the RNA into cDNA; ii. performing a polymerase chain reaction on the cDNA, 1. A plurality of first forward Vα primers comprising at their 5′ ends a first nucleotide sequence that is complementary to a second nucleotide sequence at the 5′ end of a linearized vector, the first nucleotide sequence being operably linked to a plurality of first leader sequences of a Vα gene; and 2. A first reverse Cα primer having a third nucleotide sequence that is complementary to a fourth nucleotide sequence at the 5' end of fragment b. A process that uses A process comprising: e. performing a one-step reverse transcriptase-polymerase chain reaction (RT-PCR) to amplify a first set of TCR Vβ amplicon products; i. reverse transcribing the RNA into cDNA; ii. performing a polymerase chain reaction on the cDNA, 1. A plurality of first forward Vβ primers comprising at their 5′ ends a fifth nucleotide sequence that is complementary to a sixth nucleotide sequence at the 3′ end of fragment b, wherein the fifth nucleotide sequence is operably linked to a plurality of second leader sequences of a Vβ gene; and 2. A first reverse Cβ primer having a seventh nucleotide sequence that is complementary to the eighth nucleotide sequence at the 3' end of the linearized vector. A process that uses A process comprising: f. performing a nested polymerase chain reaction on the first set of TCR V alpha amplicon products to amplify a second set of TCR V alpha amplicon products; i. a second forward Vα primer comprising a ninth nucleotide sequence that contains a portion of the first nucleotide sequence of the first forward Vα primer; and ii. a second reverse Cα primer having a 10th nucleotide sequence that is complementary to the 11th nucleotide sequence at the 5' end of fragment b; A process of using g. performing a nested polymerase chain reaction on the first set of TCR Vβ amplicons to amplify a second set of TCR β amplicon products; i. a second forward Vβ primer having a 12th nucleotide sequence at its 5' end that contains a portion of the 5th nucleotide sequence of the first forward Vβ primer; and ii. a second reverse Cβ primer having a 13th nucleotide sequence that is complementary to the 14th nucleotide sequence at the 3' end of the linearized vector; A process of using h. Below: i. the 5' end of the linearized vector; ii. a second set of TCR Vα amplicon products; iii. fragment b polynucleotide sequence; iv. a second set of TCR Vβ amplicon products; and v. The 3' end of the linearized vector Assembling the TCR expression vector by ligation in the 5' to 3' direction (e.g., seamless cloning method or Gibson assembly method).

[0253] In one embodiment, a method for assembling a TCR expression vector comprising Vγ and Vδ regions from a single T cell (or a homogenous population of T cells) is provided in Example 7, comprising the steps of: a. obtaining a linearized vector comprising a 5' end, a 3' end, and a first polynucleotide sequence encoding a TCR C delta; b. obtaining a fragment b polynucleotide sequence, the fragment b polynucleotide sequence comprising a second polynucleotide sequence encoding TCR Cγ operably linked to a third polynucleotide sequence encoding 2A; c. Obtaining RNA from a single T cell (or a homogenous population of T cells); d. performing a one-step reverse transcriptase-polymerase chain reaction (RT-PCR) to amplify a first set of TCR Vγ amplicon products; i. reverse transcribing the RNA into cDNA; ii. performing a polymerase chain reaction on the cDNA, 1. A first forward Vγ primer comprising at its 5′ end a first nucleotide sequence that is complementary to a second nucleotide sequence at the 5′ end of a linearized vector, the first nucleotide sequence being operably linked to a first leader sequence of a Vγ gene; and 2. A first reverse Cγ primer having a third nucleotide sequence that is complementary to a fourth nucleotide sequence at the 5′ end of fragment b. A process that uses A process comprising: e. performing a one-step reverse transcriptase-polymerase chain reaction (RT-PCR) to amplify a first set of TCR Vδ amplicon products, i. reverse transcribing the RNA into cDNA; ii. performing a polymerase chain reaction on the cDNA, 1. A first forward Vδ primer comprising at its 5' end a fifth nucleotide sequence that is complementary to a sixth nucleotide sequence at the 3' end of fragment b, wherein the fifth nucleotide sequence is operably linked to a second leader sequence of a Vδ gene; and 2. A first reverse Cδ primer having a seventh nucleotide sequence that is complementary to the eighth nucleotide sequence at the 3' end of the linearized vector. A process that uses A process comprising: f. performing a nested polymerase chain reaction on the first set of TCR Vγ amplicon products to amplify a second set of TCR Vγ amplicon products; i. a second forward Vγ primer comprising a ninth nucleotide sequence that contains a portion of the first nucleotide sequence of the first forward Vγ primer; and ii. a second reverse Cγ primer having a 10th nucleotide sequence that is complementary to the 11th nucleotide sequence at the 5′ end of fragment b; A process of using g. performing a nested polymerase chain reaction on the first set of TCR V delta amplicons to amplify a second set of TCR delta amplicon products; i. a second forward Vδ primer having a 12th nucleotide sequence at its 5' end that contains a portion of the 5th nucleotide sequence of the first forward Vδ primer; and ii. a second reverse Cδ primer having a 13th nucleotide sequence that is complementary to the 14th nucleotide sequence at the 3' end of the linearized vector; A process of using h. Below: i. the 5' end of the linearized vector; ii. a second set of TCR Vγ amplicon products; iii. fragment b polynucleotide sequence; iv. a second set of TCR Vδ amplicon products, and v. The 3' end of the linearized vector Assembling the TCR expression vector by ligation in the 5' to 3' direction (e.g., seamless cloning method or Gibson assembly method).

[0254] In another embodiment, a method of assembling a TCR expression vector comprising Vγ and Vδ regions from a single T cell (or a homogenous population of T cells) is provided in Example 7, comprising the steps of: a. obtaining a linearized vector comprising a 5' end, a 3' end, and a first polynucleotide sequence encoding a TCR C delta; b. obtaining a fragment b polynucleotide sequence, the fragment b polynucleotide sequence comprising a second polynucleotide sequence encoding TCR Cγ operably linked to a third polynucleotide sequence encoding 2A; c. Obtaining RNA from a single T cell (or a homogenous population of T cells); d. performing a one-step reverse transcriptase-polymerase chain reaction (RT-PCR) to amplify a first set of TCR Vγ amplicon products; i. reverse transcribing the RNA into cDNA; ii. performing a polymerase chain reaction on the cDNA, 1. A plurality of first forward Vγ primers comprising at their 5′ ends a first nucleotide sequence that is complementary to a second nucleotide sequence at the 5′ end of a linearized vector, the first nucleotide sequence being operably linked to a plurality of first leader sequences of Vγ genes; and 2. A first reverse Cγ primer having a third nucleotide sequence that is complementary to a fourth nucleotide sequence at the 5′ end of fragment b. A process that uses A process comprising: e. performing a one-step reverse transcriptase-polymerase chain reaction (RT-PCR) to amplify a first set of TCR Vδ amplicon products, i. reverse transcribing the RNA into cDNA; ii. performing a polymerase chain reaction on the cDNA, 1. A plurality of first forward Vδ primers comprising at their 5' ends a fifth nucleotide sequence that is complementary to a sixth nucleotide sequence at the 3' end of fragment b, wherein the fifth nucleotide sequence is operably linked to a plurality of second leader sequences of a Vδ gene; and 2. A first reverse Cδ primer having a seventh nucleotide sequence that is complementary to the eighth nucleotide sequence at the 3' end of the linearized vector. A process that uses A process comprising: f. performing a nested polymerase chain reaction on the first set of TCR Vγ amplicon products to amplify a second set of TCR Vγ amplicon products; i. a second forward Vγ primer comprising a ninth nucleotide sequence that contains a portion of the first nucleotide sequence of the first forward Vγ primer; and ii. a second reverse Cγ primer having a 10th nucleotide sequence that is complementary to the 11th nucleotide sequence at the 5′ end of fragment b; A process of using g. performing a nested polymerase chain reaction on the first set of TCR V delta amplicons to amplify a second set of TCR delta amplicon products; i. a second forward Vδ primer having a 12th nucleotide sequence at its 5' end that contains a portion of the 5th nucleotide sequence of the first forward Vδ primer; and ii. a second reverse Cδ primer having a 13th nucleotide sequence that is complementary to the 14th nucleotide sequence at the 3' end of the linearized vector; A process of using h. Below: i. the 5' end of the linearized vector; ii. a second set of TCR Vγ amplicon products; iii. fragment b polynucleotide sequence; iv. a second set of TCR Vδ amplicon products, and v. The 3' end of the linearized vector Assembling the TCR expression vector by ligation in the 5' to 3' direction (e.g., seamless cloning method or Gibson assembly method).

[0255] In one embodiment, steps (d) and (e) are carried out in a single reaction. In one embodiment, steps (f) and (g) are carried out in a single reaction.

[0256] In one embodiment, assembling the TCR expression vector by ligation comprises a seamless cloning method that utilizes short regions of homology, hi one embodiment, assembling the TCR expression vector by ligation comprises the Gibson assembly method.

[0257] In one embodiment, the first nucleotide sequence is 15-25 nucleotides in length. In one embodiment, the first nucleotide sequence is 20 nucleotides in length.

[0258] In one embodiment, the fifth nucleotide sequence is 15 to 25 nucleotides in length. In one embodiment, the fifth nucleotide sequence is 20 nucleotides in length.

[0259] In one embodiment, the ninth nucleotide sequence is 15 to 25 nucleotides in length. In one embodiment, the ninth nucleotide sequence is 18 nucleotides in length.

[0260] In one embodiment, the twelfth nucleotide sequence is 15 to 25 nucleotides in length. In one embodiment, the twelfth nucleotide sequence is 18 nucleotides in length.

[0261] In one embodiment, the first nucleotide sequence is fully complementary to the second nucleotide sequence at the 5' end of the linearized vector, hi one embodiment, the third nucleotide sequence is fully complementary to the fourth nucleotide sequence at the 5' end of fragment b.

[0262] In one embodiment, the fifth nucleotide sequence is fully complementary to the sixth nucleotide sequence at the 3' end of fragment b. In one embodiment, the seventh nucleotide sequence is fully complementary to the eighth nucleotide sequence at the 3' end of the linearized vector. In one embodiment, the tenth nucleotide sequence is fully complementary to the eleventh nucleotide sequence at the 5' end of fragment b. In one embodiment, the thirteenth nucleotide sequence is fully complementary to the fourteenth nucleotide sequence at the 3' end of the linearized vector.

[0263] In one embodiment, the plurality of first forward Vα primers includes SEQ ID NO: 345 to SEQ ID NO: 416 (a total of 72 types of primers). In one embodiment, the plurality of first forward Vβ primers includes SEQ ID NO: 417 to SEQ ID NO: 441 (a total of 25 types of primers).

[0264] In one embodiment, the linearized vector comprises pMIGII.

[0265] In one embodiment, the third polynucleotide sequence encoding 2A is selected from SEQ ID NO: 331, SEQ ID NO: 332, SEQ ID NO: 333, SEQ ID NO: 334, or SEQ ID NO: 335. In one embodiment, the third polynucleotide sequence encoding 2A is selected from SEQ ID NO: 332, SEQ ID NO: 333, SEQ ID NO: 334, or SEQ ID NO: 335. In one embodiment, the third polynucleotide sequence encoding 2A is SEQ ID NO: 335.

[0266] In an alternative embodiment, the methods herein can use a linker sequence, including any self-cleavable peptide, in place of the 2A sequence.

[0267] In some embodiments, the methods disclosed herein use primers that include the entire leader sequence in the 5' "first" primer for each Vα and Vβ.

[0268] In some embodiments, the TCR expression vector construct may be cloned in different configurations. For example, the TCR expression vector may be cloned in the following configuration: i. the 5' end of the linearized vector; ii. a second set of TCR Vβ amplicon products; iii. fragment b polynucleotide sequence; iv. a second set of TCR Vα amplicon products, and v. The 3' end of the linearized vector may be assembled in the 5' to 3' direction by ligation (eg, by the seamless cloning method or the Gibson assembly method).

[0269] In some embodiments, the TCR expression vector comprises: i. the 5' end of the linearized vector; ii. a second set of TCR Vδ amplicon products; iii. fragment b polynucleotide sequence; iv. a second set of TCR Vγ amplicon products; and v. The 3' end of the linearized vector may be assembled in the 5' to 3' direction by ligation (eg, by the seamless cloning method or the Gibson assembly method).

[0270] In one embodiment, the T cells are of human origin. In one embodiment, the T cells are of mouse origin.

[0271] In other embodiments, the TCR α and β RNA is obtained from a clonal population rather than a single T cell.

[0272] In some embodiments, either or both of the TCR α and TCR β RNA are exposed to multiple first forward Vα primers, each primer having the same terminal 5' end and a different primer specificity. As used herein, "primer specificity" refers to the ability of a primer to specifically bind to a target TCR α or TCR β RNA. Primer specificity is determined by the polynucleotide region within the primer that hybridizes to the TCR α or TCR β RNA, also referred to herein as the "hybridizing region."

[0273] The expression vector used according to the method can be any suitable expression vector known to those of skill in the art. In some embodiments, the expression vector is a viral vector. In some embodiments, the expression vector is a retroviral vector. In some embodiments, the expression vector is an adenoviral vector. In some embodiments, the expression vector is pMIGII (Holst et al., Nat. Protoc., 1(1):406-17 (2006)).

[0274] Primer generation An algorithm was developed using Matlab language code for the generation of primers for a given DNA sequence obtained in raw text format from an internet-based genome database. This method can be easily adapted for other forms of input. The IMGT database was used to generate a text format list of all annotated functional mouse Vα and Vβ chains. The user could set one or two desired temperature ranges of melting points for the primers, as well as the desired range of the number of nucleotides. In addition, the user could add any constant nucleotide sequence to the 5' side of the resulting primer. In this example, the constant nucleotide sequence was 20 nucleotides, which were added to the primers for Vα and Vβ with homology to the acceptor vector or fragment b, respectively. Once the input parameters were set, the program scanned the raw text containing hundreds or thousands of DNA sequences, automatically recognizing each sequence name and its associated sequence, and determining the optimal primer within the given input constraints for each sequence. The program uses the nearest neighbor method (Santa Lucia, J Jr. (1998) "A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics." Proc. Natl. Acad. Sci. USA 95, 1460-1465) to calculate melting temperatures and assemble primers that are as close to each other as possible in terms of their melting points.

[0275] As output, the program automatically saves a series of listings in a text file.

[0276] 1. A full results report listing all primers and their characteristics, such as melting point temperature, temperature range, whether the primers fit within the desired parameters as well as general descriptions of how many primers were successful and how many were repeat primers.

[0277] 2. A list containing only non-repetitive primers and all their properties.

[0278] 3. A list containing repeat primers and all their properties.

[0279] 4. List of primer names.

[0280] 5. Shopping list for ordering primers.

[0281] 6. Statistical analysis including histograms of the distribution of primers over their melting temperatures, their sizes, and the temperature ranges to which they fall.

[0282] The entire calculation process is virtually instantaneous, saving the user days of work and allowing them to quickly try different possibilities for the desired final primer.

[0283] Assembly of TCR expression vectors Using the method described in the "Primer Generation" section, a set of forward primers was generated that together can bind to all leader sequences of the Vα and Vβ repertoires of any mouse strain annotated in the IMGT databank so far. The sequences of these Vα and Vβ primers are provided in SEQ ID NOs: 345-416 and 417-441, respectively. These primers in combination with reverse primers that bind to the α and β constant regions (SEQ ID NO: 339 and SEQ ID NO: 340, respectively) can be used in a one-step RT-PCR reaction with either clonal population mRNA or single cells to amplify full-length expressible V sequences. On the 5' end of each forward primer, there is a constant 20 nucleotide segment with homology to the vector or to a DNA fragment containing the constant region of the alpha chain and its downstream 2a element (hereinafter "fragment b") (see Figure 15). In one embodiment, the 20 constant nucleotides of the Vα primer are homologous to the 5' end of the pMIGII retroviral vector-based linearized acceptor vector, and the 20 constant nucleotides of the Vβ primer are homologous to the 3' end of fragment b (Figures 14 and 15). The linearized acceptor vector contains the constant region of the beta chain on its 3' end.

[0284] After RT-PCR, the samples are split and nested PCR is performed with 18 nucleotide forward primers that bind to either the invariant portion of Vα or Vβ for the α and β chains, and nested reverse primers for Cα and Cβ. After completion of nested PCR, the products containing Vα+20 nucleotides of Cα and Vβ+20 nucleotides of Cβ are assembled into a linearized acceptor vector together with fragment b using the Gibson assembly method in a total reaction of 10 μL. As an example, 50 ng of linearized (acceptor) vector, 10 ng of alpha amplicon, 10 ng of beta amplicon, and 10 ng of fragment b (total mixture of 10 μL) are added to 10 μL of 2× Gibson assembly enzyme (kit from NEB) and incubated at 50° C. for 1 hour.

[0285] Characterization of TCR expression vectors Note that after construction of the TCR expression vector, there are two possible downstream strategies, in which the Vα / Vβ of each single cell are linked in one circular DNA fragment (Figure 16).

[0286] Strategy 1 consists of keeping the Gibson assembly reactions of each differentiated TCR and transforming each as a single reaction in E. coli. The steps from the first RT-PCR to Gibson assembly and transformation in E. coli are completed in approximately 8 hours. The next day, five colonies of each TCR are grown together in 5-10 mL of LB medium containing ampicillin, and a plasmid miniprep is performed for each TCR. The Gibson assembly reaction results in approximately 30-50% positive colonies, so that at least one colony out of approximately five contains a retroviral vector with the correct α and β inserts. Next, PlaTe cells grown on 12-well plates are transfected with 2-5 μg of each plasmid pool and 1.4-3.6 μg of Ecohelper plasmid in 1-1.5 mL of DMEM medium. After 24 hours, 4G4 TCRα - / - CD4+ cells 0.5~1×10 5 Transduce each well with 1-1.5 mL of RV supernatant from each PlatE well in a 12-well plate or 1 mL in a 48-well plate. The next day, repeat the transduction with viral supernatant.

[0287] Detection of TCR expression on the membrane and screening for antigens is performed on day 3 or 4. When a single correct RV vector is preferred instead of the pool (which may contain incorrectly assembled and / or empty acceptor vectors), the pool is transformed back into bacteria and bacterial colonies are screened for correct insertion of the α and β chains by digesting the plasmid with EcoRI and XhoI. After digestion, the size of the fragment containing the correctly assembled α and β products (or the sum of the fragments if alpha or / and beta contain EcoRI or / and XhoI restriction enzyme sites) should be approximately 1.8 kb and the size of the vector backbone should be approximately 6.3 kb. This strategy is suitable for medium throughput cloning of unknown T cells and screening for antigens.

[0288] Strategy 2 is designed to address the high throughput objective. In this strategy, Gibson assembly reactions of each TCR are pooled (up to 40 TCRs per pool) and transformed with 8 μL of E. coli in 120 μL of chemical components. Bacteria are plated on LB agar containing ampicillin. Immediately after plating, bacterial colonies are picked and grown in liquid LB containing ampicillin. No more than 200 colonies (1 colony / 2.5 mL of LB medium) are picked and grown together overnight in 500 mL of LB medium. Since the Gibson assembly reaction yields approximately 30-50% positive colonies, the 200 colonies picked will contain 60-100 retroviral vectors with the correct α and β inserts, theoretically at least one correct retrovirus per input TCR (40 per pool, as above). Approximately 12 hours later, maxipreps are performed to isolate the plasmid DNA library. PlatE cells grown for 12 hours in six T175 flasks containing 20 mL of DMEM medium are transfected with 25 μg of Eco-helper plasmid and 35 μg of the plasmid library per flask using lipid transfection reagent. After 24 hours, each of them was transfected with 2×10 6 Exponentially growing 4G4 TCRα - / - CD4 + Cells (or other CD4 + , e.g., B3Z / lacZ, or CD8 + Transduce 5 T75 flasks containing 100 ng / ml of 10 ...

[0289] Detection of TCR expression on the membrane and screening for antigen specificity is performed on days 3-4. 4G4 cells that experienced TCR-dependent recognition of antigen secreted IL-2 (note that other recipient indicator cells can easily be used). Responsive 4G4 cells are sorted as single cells based on surface IL-2 capture or other means. The Vα-2a-Vβ transgene (approximately 1850 bp) in these cells is amplified by PCR with primers designed to bind to the provirus integrated in the genome 20 nucleotides upstream of EcoRI and 20 nucleotides downstream of the XhoI restriction enzyme site. To obtain a retroviral vector with a functional and antigen-specific TCR, the Vα-2a-Vβ transgene can be rapidly assembled in an assembly vector cut with EcoRI and XhoI. This strategy is well suited for high-throughput cloning of unknown specificity followed by large-scale screening of candidate antigens. The generated library can also be amplified and reused.

[0290] Further sequences used in the methods disclosed herein: Nucleotide sequence encoding self-cleavable peptide 2A in FASTA format (SEQ ID NO:336): 5'-GCCACGAACTTCTCTCTGTTAAAGCAAGCAGGAGACGTGGAAGAAAACCCCGGTCCC-3'

[0291] Nucleotide sequence encoding fragment b in FASTA format (SEQ ID NO:337): 5'-ACATCCAGAACCCAGAACCTGCTGTGTACCAGTTAAAAGATCCT CGGTCTCAGGACAGCACCCTCTGCCTGTTCACCGACTTTGACTCCCAAATCAATGTGCCGAAAACCATGGAATCTGGAACGTTCATCACTGACAAAACTGTGCTGGACATGAAAGCTATGGATTCCAAGAGCAATGGGGCCATTGCCTGGAGCAACCAGACAAGCTTCACCTGCCAAGATATCTTCAAAGAGACCAACGCCACCTACCCCAGTTCAG ACGTTCCCTGTGATGCCACGTTGACCGAGAAAAGCTTTGAAACAGATATGAACCTAAACTTTCAAAACCTGTCAGTTATGGGACTCCGAATCCTCCTGCTGAAAGTAGCGGGATTTAACCTGCTCATGACGCTGAGGCTGTGGTCCAGTGGCTCCGGAGCCACGAACTTCTCTCTGTTAAAGCAAGCAGGAGACGTGGAAGAAACCCCGGTCCC-3'

[0292] Nucleotide sequence encoding Cβ in FASTA format (SEQ ID NO:338): 5'-AGGATCTGAGAAATGTGACTCCACCCAAGGTCTCCTTGTTTGAGCC ATCAAAAGCAGAGATTGCAAACAAACAAAAGGCTACCCTCGTGTGCTTGGCCAGGGGCTTCTTCCCTGACCACGTGGAGCTGAGCTGGTGGGTGAATGGCAAGGAGGTCCACAGTGGGTCAGCACGGACCCTCAGGCCTACAAGGAGAGCAATTATAGCTACTGCCTGAGCAGCCGCCTGAGGGTCTCTGCTACCTTCTGGCACAATCCTCGAAACCACTTCCGCTGCCAAGTGCAGT TCCATGGGCTTTCAGAGGAGGACAAGTGGCCAGAGGGCTCACCCAAACCTGTCACACAGAACATCAGTGCAGAGGCCTGGGGCCGAGCAGACTGTGGAATCACTTCAGCATCCTATCATCAGGGGGTTCTGTCTGCAACCATCCTCTATGAGATCCTACTGGGGAAGGCCACCCTATATGCTGTGCTGGTCAGTGGCCTGGTGCTGATGGCCATGGTCAAGAAAAAAAATTCCTGA-3'

[0293] First reverse Cα primer (SEQ ID NO:339): GTCAAAGTCGGTGAACAGGC

[0294] First reverse Cβ primer (SEQ ID NO:340): TTGGGTGGAGTCACATTTCTC

[0295] Nested reverse primer for Cα (second reverse Cα primer) (SEQ ID NO:341): AGGTTCTGGGTTCTGGATGT

[0296] Nested reverse primer for Cβ (second reverse Cβ primer) (SEQ ID NO: 342): GGAGTCACATTTCTCAGATCCT

[0297] Nested Forward Alpha (Second Forward Vα Primer) (SEQ ID NO:343): TCTAGGCGCCGGAATTCA

[0298] Nested Forward Beta (Second Forward Vβ Primer) (SEQ ID NO:344): GAAGAAAACCCCGGTCCC

[0299] Primer alpha (Vα) pool (multiple first forward Vα primers) (SEQ ID NO: 345 to SEQ ID NO: 416): ATN-a1: tctctaggcgccggaattcaatgctgcagatgtgggggtttg (SEQ ID NO: 345) ATN-a2: tctctaggcgccggaattcaatgaagacatcccttcacactg (SEQ ID NO: 346) ATN-a3: tctctaggcgccggaattcaatggataaaacatcccttcaca (SEQ ID NO: 347) ATN-a4: tctctaggcgccggaattcaatggattaagacatcccttcac (SEQ ID NO: 348) ATN-a5: tctctaggcgccggaattcaatgaaaaagtgccttagtgcct (SEQ ID NO: 349) ATN-a6: tctctaggcgccggaattcaatgaaaaagcgcctgagtgcct (SEQ ID NO: 350) ATN-a7: tctctaggcgccggaattcaatgaaaaagtgcctgagtgcct (SEQ ID NO: 351) ATN-a8: tctctaggcgccggaattcaatgcgtcctgtcacctgctcag (SEQ ID NO: 352) ATN-a9: tctctaggcgccggaattcaatgaacatgcatcctgtcacct (SEQ ID NO: 353) ATN-a10: tctctaggcgccggaattcaatgcgtcctggcacctgc (SEQ ID NO: 354) ATN-a11: tctctaggcgccggaattcaatgcgtcctgacacctgctcag (SEQ ID NO: 355) ATN-a12: tctctaggcgccggaattcaatgaacatgcgtcctgtcacct (SEQ ID NO: 356) ATN-a13: tctctaggcgccggaattcaatgcgtcctgtcacctcctcag (SEQ ID NO: 357) ATN-a14: tctctaggcgccggaattcaatgcgtcctgacacctcctcag (SEQ ID NO: 358) ATN-a15: tctctaggcgccggaattcaatgaacaggctgctgtgctctc (SEQ ID NO: 359) ATN-a16: tctctaggcgccggaattcaatgaagaggctgctgtgttctc (SEQ ID NO: 360) ATN-a17: tctctaggcgccggaattcaatgaagaggctgctgtgctctc (SEQ ID NO: 361) ATN-a18: tctctaggcgccggaattcaatgaagaggctgatgtgctctc (SEQ ID NO: 362) ATN-a19: tctctaggcgccggaattcaatgaggaggctgatgtgttctc (SEQ ID NO: 363) ATN-a20: tctctaggcgccggaattcaatgaagaggctgctgagctctc (SEQ ID NO: 364) ATN-a21: tctctaggcgccggaattcaatgaagaggctagtgtgttctc (SEQ ID NO: 365) ATN-a22: tctctaggcgccggaattcaatgaaaaggctgctgtgctctc (SEQ ID NO: 366) ATN-a23: tctctaggcgccggaattcaatggacaagatcctgacagcaa (SEQ ID NO: 367) ATN-a24: tctctaggcgccggaattcaatggacacgatcctgacagcat (SEQ ID NO:368) ATN-a25: tctctaggcgccggaattcaatggacaagatcctgacagcat (SEQ ID NO: 369) ATN-a26: tctctaggcgccggaattcaatggacaagattctgacagcat (SEQ ID NO: 370) ATN-a27: tctctaggcgccggaattcaatggacaagaacctgacagcat (SEQ ID NO: 371) ATN-a28: tctctaggcgccggaattcaatgcctcctcacagcctg (SEQ ID NO: 372) ATN-a29: tctctaggcgccggaattcaatgcctcctcagagcctg (SEQ ID NO: 373) ATN-a30: tctctaggcgccggaattcaatgcctcctcacagcctgttct (SEQ ID NO: 374) ATN-a31: tctctaggcgccggaattcaatgctgattctaagcctgttgg (SEQ ID NO: 375) ATN-a32: tctctaggcgccggaattcaatgttcctagtgaccattctgc (SEQ ID NO: 376) ATN-a33: tctctaggcgccggaattcaatgttcccagtgaccattctgc (SEQ ID NO: 377) ATN-a34: tctctaggcgccggaattcaatgactggcttcctgaaggcct (SEQ ID NO: 378) ATN-a35: tctctaggcgccggaattcaatgaagcaggtggcaaaagtga (SEQ ID NO: 379) ATN-a36: tctctaggcgccggaattcaatgggatgtgtgagtggaattg (SEQ ID NO: 380) ATN-a37: tctctaggcgccggaattcaatgaagacagtgactggacctt (SEQ ID NO: 381) ATN-a38: tctctaggcgccggaattcaatgaagacggtgactggacctt (SEQ ID NO: 382) ATN-a39: tctctaggcgccggaattcaatgaaaacagtgactggacctt (SEQ ID NO: 383) ATN-a40: tctctaggcgccggaattcaatggagaggagcccggga (SEQ ID NO:384) ATN-a41: tctctaggcgccggaattcaatggagaggaacctggttgctg (SEQ ID NO: 385) ATN-a42: tctctaggcgccggaattcaatgcagaggaacctgggagctg (SEQ ID NO:386) ATN-a43: tctctaggcgccggaattcaatgcagaggaacctggttgctg (SEQ ID NO:387) ATN-a44: tctctaggcgccggaattcaatggagaggaacctgggagctg (SEQ ID NO:388) ATN-a45: tctctaggcgccggaattcaatgaagacagctattcatgctt (SEQ ID NO: 389) ATN-a46: tctctaggcgccggaattcaatgaaaacatacgctcctacat (SEQ ID NO: 390) ATN-a47: tctctaggcgccggaattcaatgaaaacatatgctcctacattattca (SEQ ID NO: 391) ATN-a48: tctctaggcgccggaattcaatgaactattctccagctttagtg (SEQ ID NO: 392) ATN-a49: tctctaggcgccggaattcaatgaacacttctccagctttag (SEQ ID NO: 393) ATN-a50: tctctaggcgccggaattcaatgaacaattccccagctttag (SEQ ID NO:394) ATN-a51: tctctaggcgccggaattcaatgaatacttctccagttttagtaact (SEQ ID NO: 395) ATN-a52: tctctaggcgccggaattcaatgaacctttatcctgaactgg (SEQ ID NO:396) ATN-a53: tctctaggcgccggaattcaatgaacctttgtcctgaactgg (SEQ ID NO:397) ATN-a54: tctctaggcgccggaattcaatggactcttctccaggcttcg (SEQ ID NO: 398) ATN-a55: tctctaggcgccggaattcaatgaactcttctccaggcttca (SEQ ID NO: 399) ATN-a56: tctctaggcgccggaattcaatgaatacttctccagttttagtga (SEQ ID NO: 400) ATN-a57: tctctaggcgccggaattcaatggacttttctccaggcttcg (SEQ ID NO: 401) ATN-a58: tctctaggcgccggaattcaatgaagtccttgtgtgtttcac (SEQ ID NO: 402) ATN-a59: tctctaggcgccggaattcaatgaaatccttgagtgtttcact (SEQ ID NO: 403) ATN-a60: tctctaggcgccggaattcaatgaaatcctttagtatttccctagtg (SEQ ID NO: 404) ATN-a61: tctctaggcgccggaattcaatgaaatccttgagtgtttccc (SEQ ID NO: 405) ATN-a62: tctctaggcgccggaattcaatgcattccttacatgtttcac (SEQ ID NO: 406) ATN-a63: tctctaggcgccggaattcaatggtacaaacacagatgttct (SEQ ID NO: 407) ATN-a64: tctctaggcgccggaattcaatgaaatccttgagtgttttactagt (SEQ ID NO: 408) ATN-a65: tctctaggcgccggaattcaatgcacagcctcctgggg (SEQ ID NO: 409) ATN-a66: tctctaggcgccggaattcaatgaacagattcctgggaatat (SEQ ID NO: 410) ATN-a67: tctctaggcgccggaattcaatgcacagcctcctagggttgt (SEQ ID NO: 411) ATN-a68: tctctaggcgccggaattcaatgctcctggtcctcatctcgt (SEQ ID NO: 412) ATN-a69: tctctaggcgccggaattcaatgctcctggttctcatctcgt (SEQ ID NO: 413) ATN-a70: tctctaggcgccggaattcaatgctcctggtgctcctc (SEQ ID NO: 414) ATN-a71: tctctaggcgccggaattcaatgctcctggcgctcctc (SEQ ID NO: 415) ATN-a72: tctctaggcgccggaattcaatgctcctggcactcctc (SEQ ID NO: 416)

[0300] Primer beta (Vβ) pool (multiple first forward Vβ primers) (SEQ ID NO: 417 to SEQ ID NO: 441): ATN-b1: tggaagaaaaccccggtcccatgtggcagttttgcattctgt (SEQ ID NO: 417) ATN-b2: tggaagaaaaccccggtcccatgccacggacaccaggc (SEQ ID NO: 418) ATN-b3: tggaagaaaaccccggtcccatgtctaacactgtcctcgctg (SEQ ID NO: 419) ATN-b4: tggaagaaaaccccggtcccatgtctaacactgccttccctg (SEQ ID NO: 420) ATN-b5: tggaagaaaaccccggtcccatgtgtaatactaccctccttaatttt (SEQ ID NO: 421) ATN-b6: tggaagaaaaccccggtcccatgggctccaggctctttctgg (SEQ ID NO: 422) ATN-b7: tggaagaaaaccccggtcccatgggctccaggctcttcttcg (SEQ ID NO: 423) ATN-b8: tggaagaaaaccccggtcccatgggctccagactcttctttg (SEQ ID NO: 424) ATN-b9: tggaagaaaaccccggtcccatgggcaccaggcttctt (SEQ ID NO: 425) ATN-b10: tggaagaaaaccccggtcccatgggcatccagaccctctgtt (SEQ ID NO: 426) ATN-b11: tggaagaaaaccccggtcccatggcccccaggctccttttc (SEQ ID NO: 427) ATN-b12: tggaagaaaaccccggtcccatggatcctagacttctttgct (SEQ ID NO: 428) ATN-b13: tggaagaaaaccccggtcccatgaacaagtgggttttctgct (SEQ ID NO: 429) ATN-b14: tggaagaaaaccccggtcccatgggctccattttcctcagtt (SEQ ID NO: 430) ATN-b15: tggaagaaaaccccggtcccatgttactgcttctattacttctgg (SEQ ID NO: 431) ATN-b16: tggaagaaaaccccggtcccatgggtgcacggctcatttgctat (SEQ ID NO: 432) ATN-b17: tggaagaaaaccccggtcccatgggtgcaagactgctc (SEQ ID NO: 433) ATN-b18: tggaagaaaaccccggtcccatgactgccaagttcatgcatt (SEQ ID NO: 434) ATN-b19: tggaagaaaaccccggtcccatggtcaccagtctctcaagat (SEQ ID NO: 435) ATN-b20: tggaagaaaaccccggtcccatgagagttaggctcatctctg (SEQ ID NO: 436) ATN-b21: tggaagaaaaccccggtcccatggatatctggcttctaggtt (SEQ ID NO: 437) ATN-b22: tggaagaaaaccccggtcccatgctgtactctctccttgcct (SEQ ID NO: 438) ATN-b23: tggaagaaaaccccggtcccatgggctgtaggctcctaagct (SEQ ID NO: 439) ATN-b24: tggaagaaaaccccggtcccatgagctgcaggcttctcctct (SEQ ID NO: 440) ATN-b25: tggaagaaaaccccggtcccatgggctgaaaaatgctctgct (SEQ ID NO: 441)

[0301] This document also provides:

[0302] Paragraph No. 1. A method for assembling a T cell receptor expression vector comprising Vα and Vβ regions from a single T cell, comprising: a. obtaining a linearized vector comprising a 5' end, a 3' end, and a first polynucleotide sequence encoding a TCR Cβ; b. obtaining a fragment b polynucleotide sequence, the fragment b polynucleotide sequence comprising a second polynucleotide sequence encoding a TCR C alpha operably linked to a third polynucleotide sequence encoding 2A; c. Obtaining RNA from a single T cell; d. performing a one-step reverse transcriptase-polymerase chain reaction (RT-PCR) to amplify a first set of TCR Vα amplicon products; i. reverse transcribing the RNA into cDNA; ii. performing a polymerase chain reaction on the cDNA, 1. A first forward Vα primer comprising at its 5′ end a first nucleotide sequence that is complementary to a second nucleotide sequence at the 5′ end of a linearized vector, the first nucleotide sequence being operably linked to a first leader sequence of a Vα gene; and 2. A first reverse Cα primer having a third nucleotide sequence that is complementary to a fourth nucleotide sequence at the 5' end of fragment b. A process that uses Process including e. performing a one-step reverse transcriptase-polymerase chain reaction (RT-PCR) to amplify a first set of TCR Vβ amplicon products; i. reverse transcribing the RNA into cDNA; ii. performing a polymerase chain reaction on the cDNA, 1. A first forward Vβ primer comprising at its 5′ end a fifth nucleotide sequence that is complementary to a sixth nucleotide sequence at the 3′ end of fragment b, wherein the fifth nucleotide sequence is operably linked to a second leader sequence of a Vβ gene; and 2. A first reverse Cβ primer having a seventh nucleotide sequence that is complementary to the eighth nucleotide sequence at the 3' end of the linearized vector. A process that uses A process comprising: f. performing a nested polymerase chain reaction on the first set of TCR V alpha amplicon products to amplify a second set of TCR V alpha amplicon products; i. a second forward Vα primer comprising a ninth nucleotide sequence that contains a portion of the first nucleotide sequence of the first forward Vα primer; and ii. a second reverse Cα primer having a 10th nucleotide sequence that is complementary to the 11th nucleotide sequence at the 5' end of f...

Claims

1. 1. A method for obtaining a plurality of nucleic acid vectors, each of which contains a nucleic acid encoding a T cell receptor (TCR), comprising: (a) performing a plurality of separate nested amplification methods, each of the plurality of separate nested amplification methods using cDNA from a single T cell as a template, to obtain, for each of the plurality of separate nested amplification methods, a first amplification product encoding a full-length TCR alpha variable (Vα) or gamma variable (Vγ) segment, and a second amplification product encoding a full-length TCR beta variable (Vβ) or delta variable (Vδ) segment; and (b) for each of the plurality of separate nested amplification methods, combining the first amplification product and the second amplification product with a cloning fragment and a linearized vector to assemble a nucleic acid vector encoding a TCR using seamless cloning, wherein the TCR is (i) a full-length Vα segment and a full-length Vβ segment of a TCR present in the single T cell generating the cDNA; or (ii) a full-length Vγ segment and a full-length Vδ segment of a TCR present in the single T cell generating the cDNA; Including, method.

2. (a) the cloned fragment comprises a nucleic acid sequence encoding an alpha constant (Cα) region or a gamma constant (Cγ) region at its 5' end and a nucleic acid sequence encoding a self-cleaving peptide or an internal ribosome entry site at its 3' end; (b) the linearized vector comprises a nucleic acid sequence encoding a beta constant (Cβ) region or a delta constant (Cδ) region at the 5' end and a promoter sequence at the 3' end; The method of claim 1.

3. (a) the first amplification product comprises a first adapter sequence (AS) followed by the leader (L) sequence of the Vα segment, the Vα segment, the Jα segment, and a portion of the 5' end of the Cα region, and the second amplification product comprises a second adapter sequence, the β leader (L) sequence of the Vβ segment, the Vβ segment, the Dβ segment, the Jβ segment, and a portion of the 5' end of the Cβ region; or (b) the first amplification product comprises a first adapter sequence (AS), followed by a leader (L) sequence of a Vγ segment, a Vγ segment, a Jγ segment, and a portion of the 5' end of the Cγ region, and the second amplification product comprises a second adapter sequence, a leader (L) sequence of a Vδ segment, a Vδ segment, a Dδ segment, a Jδ segment, and a portion of the 5' end of the Cδ region; The method according to claim 1 or 2.

4. 4. The method of claim 3, wherein each of the first adapter sequences is the same, each of the second adapter sequences is the same, and the first adapter sequences are different from the second adapter sequences.

5. (a) a first adapter sequence is added to a first amplification product and a second adapter sequence is added to a second amplification product in a first round of nested amplification; or (b) a first adapter sequence is added to the first amplification product and a second adapter sequence is added to the second amplification product in a second round of nested amplification; The method according to claim 3 or 4.

6. The method according to any one of claims 1 to 5, wherein the first amplification product comprises a sequence that overlaps with a portion of the 3' end of the linearized vector, and the second amplification product comprises a sequence that overlaps with a portion of the 3' end of the cloning fragment.

7. The method according to any one of claims 3 to 6, wherein the first adaptor sequence comprises a sequence that overlaps with a portion of the 3' end of the linearized vector, and the second adaptor sequence comprises a sequence that overlaps with a portion of the 3' end of the cloning fragment.

8. The nested amplification method comprises: (a) a plurality of first forward amplification primers designed to hybridize to a region upstream of or overlapping with the ATG start codon of a plurality of Vα or Vγ segments of a human TCR variant; (b) a plurality of second forward amplification primers designed to hybridize to a region upstream of or overlapping with the ATG start codon of a plurality of Vβ or Vδ segments of a human TCR variant; (c) a first reverse primer designed to bind to the 5' portion of the Cα sequence, and (d) a second reverse primer designed to hybridize to the 5' portion of the Cβ sequence; 8. The method of claim 1, comprising a first round of amplification using a forward primer and a reverse primer comprising:

9. 9. The method of claim 8, wherein the first plurality of forward amplification primers are designed to hybridize to the Vα or Vγ segments of all known human TCR variants, and the second plurality of forward amplification primers are designed to hybridize to the Vβ or Vδ segments of all known human TCR variants.

10. 10. The method of claim 8 or 9, wherein the plurality of first forward amplification primers comprises a set of primers having sequences of SEQ ID NOs: 1-10, 13-15, 18-30, 32, 34-36, 39, 283, and 286.

11. 11. The method of any one of claims 8 to 10, wherein the plurality of second forward amplification primers comprises a set of primers having sequences of SEQ ID NOs: 41-58, 62-72, 290, and 292.

12. The method of any one of claims 8 to 11, wherein the set of primers for amplifying the Vα segment in the second round of the nested amplification method comprises a set of primers having sequences of SEQ ID NOs: 127 to 166.

13. The method of any one of claims 8 to 12, wherein the set of primers for amplifying Vβ segments in the second round of the nested amplification method comprises a set of primers having the sequences of SEQ ID NOs: 167 to 198.

14. The method according to any one of claims 1 to 13, wherein the cloning fragment comprises the nucleotide sequence of SEQ ID NO:

337.

15. The method according to any one of claims 1 to 14, further comprising, prior to step (a), selecting single T cells and performing a reverse transcription reaction to obtain cDNA for each T cell.

16. The method of claim 15, wherein the T cells have not been expanded prior to sorting.

17. The method of any one of claims 1 to 16, wherein the TCR comprises a soluble TCR.

18. The TCR (a) the full-length Cα region and the full-length Cβ region, or (b) Full-length Cγ region and full-length Cδ region The method according to any one of claims 1 to 16, comprising:

19. 20. The method of claim 18, wherein the TCR further comprises a signaling domain.

20. The method of any one of claims 1 to 19, wherein the nucleic acid vector comprises an expression vector capable of expressing the TCR in a cell.

21. The method of any one of claims 1 to 20, wherein the nucleic acid vector comprises a lentiviral vector.

22. 22. The method of any one of claims 1 to 21, wherein each of the plurality of separate nested amplification methods is performed at a separate location on a device.

23. The method of claim 22, wherein the device comprises a multi-well plate.

24. The method of any one of claims 1 to 23, wherein the T cells are human T cells.

25. 1. A method for obtaining a plurality of nucleic acid vectors containing a nucleic acid encoding a T cell receptor (TCR), comprising: (a) sorting a plurality of T cells from a donor to obtain a plurality of isolated single T cells; (b) isolating RNA from each of the isolated single T cells; (c) generating cDNA from the mRNA; (d) performing a plurality of separate nested amplification methods, each of the plurality of separate nested amplification methods using cDNA from a single T cell as a template to obtain, for each of the plurality of separate nested amplification methods, a first amplification product encoding a full-length TCR alpha variable (Vα) or gamma variable (Vγ) segment, and a second amplification product encoding a full-length TCR beta variable (Vβ) or delta variable (Vδ) segment; and (e) for each of the plurality of separate nested amplification methods, combining the first amplification product and the second amplification product with a cloning fragment and a linearized vector to assemble a nucleic acid vector encoding a TCR using seamless cloning, wherein the TCR is (i) a full-length Vα segment and a full-length Vβ segment of a TCR present in the single T cell generating the cDNA; or (ii) a full-length Vγ segment and a full-length Vδ segment of a TCR present in the single T cell generating the cDNA; A process comprising: The method includes:

26. 1. A method for expressing cloned T cell receptors (TCRs) from a plurality of nucleic acid vectors, each of which contains a nucleic acid encoding a T cell receptor (TCR), comprising: (a) sorting a plurality of T cells from a donor to obtain a plurality of isolated single T cells; (b) isolating RNA from each of the isolated single T cells; (c) generating cDNA from the mRNA; (d) performing a plurality of separate nested amplification methods, each of the plurality of separate nested amplification methods using cDNA from a single T cell as a template, to obtain, for each of the plurality of separate nested amplification methods, a first amplification product encoding a full-length TCR alpha variable (Vα) or gamma variable (Vγ) segment, and a second amplification product encoding a full-length TCR beta variable (Vβ) or delta variable (Vδ) segment; (e) for each of the plurality of separate nested amplification methods, combining the first amplification product and the second amplification product with a cloning fragment and a linearized vector to assemble a plurality of nucleic acid vectors using seamless cloning, each encoding a cloned TCR, (i) a full-length Vα segment and a full-length Vβ segment of a TCR present in the single T cell generating the cDNA; or (ii) a full-length Vγ segment and a full-length Vδ segment of a TCR present in the single T cell generating the cDNA; A process comprising: (f) introducing said plurality of nucleic acid vectors into an immortal human T cell line, a reporter cell, or a primary cell, thereby expressing the cloned TCR in said cell; The method includes:

27. 27. The method of claim 26, further comprising screening the cloned TCR for antigen specificity.

Images