Otoferlin dual vector system and composition for treating sensorineural hearing loss comprising the same

Abstract

This disclosure features compositions and methods for treating sensorineural hearing loss and auditory neuropathy, particularly forms of the disease associated with mutations in OTOE, through otoferlin (OTOE) gene therapy. The disclosure provides various compositions comprising a first nucleic acid vector comprising a polynucleotide encoding an N-terminal portion of OTOE isoform 5 protein and a second nucleic acid vector comprising a polynucleotide encoding a C-terminal portion of OTOE isoform 5 protein. These vectors can be used to increase expression of OTOE in a subject, such as a human subject suffering from sensorineural hearing loss.

Description

[Technical field]

[0001] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy created on October 23, 2020 is named 51471-004WO5_Sequence_Listing_10_23_2020_ST25 and is 222,004 bytes in size.

[0002] Described herein are compositions and methods for the treatment of sensorineural hearing loss and auditory neuropathy, particularly forms of the disease associated with mutations in otoferlin (OTOF), by OTOF gene therapy. The present disclosure provides a dual vector system comprising a first nucleic acid vector comprising a polynucleotide encoding the N-terminal portion of OTOF isoform 5 protein, and a second nucleic acid vector comprising a polynucleotide encoding the C-terminal portion of OTOF isoform 5 protein. These vectors can be used to increase or provide expression of wild-type OTOF in a subject, such as a human subject suffering from sensorineural hearing loss. [Background technology]

[0003] Sensorineural hearing loss is a type of hearing loss caused by defects in the cells of the inner ear or in the neural pathways that project from the inner ear to the brain. In many cases, sensorineural hearing loss is acquired and can be caused by noise, infection, head trauma, ototoxic drugs, or aging, but there is also congenital sensorineural hearing loss associated with autosomal recessive mutations. One such form of autosomal recessive sensorineural hearing loss is associated with mutations in the otoferlin (OTOF) gene, which is implicated in prelingual nonsyndromic hearing loss. In recent years, efforts to treat hearing loss have increasingly focused on gene therapy as a possible solution. However, OTOF is too large to be treated using standard gene therapy approaches. New therapies are needed to treat OTOF-related sensorineural hearing loss. Summary of the Invention

[0004] The present invention is based on the inventors' discovery that OTOF isoform 5 is preferentially expressed in the inner ear of non-human primates, and that human OTOF isoform 5, but not human OTOF isoform 1, was able to restore hearing in otoferlin-deficient genetically engineered congenital deaf mice. Thus, the present invention provides compositions and methods for treating sensorineural hearing loss or auditory neuropathy in a subject, such as a human subject. The compositions and methods of the present disclosure relate to a dual vector system for delivering a polynucleotide encoding otoferlin (OTOF) isoform 5 protein to a subject having or at risk of developing sensorineural hearing loss or auditory neuropathy (e.g., a subject having a mutation in OTOF). For example, using the compositions and methods described herein, a first nucleic acid vector (e.g., a first adeno-associated virus (AAV) vector) and a second nucleic acid vector (e.g., a second AAV vector), each encoding a functional OTOF isoform 5 protein, can be delivered to a subject by viral gene therapy. The compositions and methods described herein can also be used to increase expression of WT OTOF protein (e.g., full-length OTOF isoform 5 protein) in cochlear hair cells (e.g., inner hair cells) and / or to treat subjects who have or are at risk of developing sensorineural hearing loss, such as subjects with mutations in OTOF.

[0005] In a first aspect, the invention provides a dual vector system comprising a first AAV vector comprising a Myol5 promoter operably linked to a first coding polynucleotide encoding an N-terminal portion of otoferlin (OTOF) isoform 5 protein, a splice donor sequence located at a 3' position of the first coding polynucleotide, and a first recombinogenic region located at a 3' position of the splice donor sequence, and a second AAV vector comprising a second recombinogenic region, a splice acceptor sequence located at a 3' position of the second recombinogenic region, a second coding polynucleotide encoding a C-terminal portion of OTOF isoform 5 protein located at a 3' position of the splice acceptor sequence, and a poly(A) sequence located at a 3' position of the second coding polynucleotide. The first and second coding polynucleotides encoding OTOF isoform 5 protein do not overlap, and neither the first nor the second AAV vector encodes a full-length OTOF isoform 5 protein.

[0006] In some embodiments, the first AAV vector and the second AAV vector comprise an AAV1 capsid. In some embodiments, the first AAV vector and the second AAV vector comprise an AAV9 capsid.

[0007] In some embodiments, the Myo promoter comprises a first region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:7, or a functional portion or derivative thereof, including the sequence of SEQ ID NO:9 and / or SEQ ID NO:10, and a second region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:8, or a functional portion or derivative thereof, including the sequence of SEQ ID NO:14 and / or SEQ ID NO:15, bound thereto (e.g., operably linked thereto). , or more sequence identity), and optionally containing a linker having 1 to 100 nucleotides (e.g., 1 to 5, 1 to 10, 1 to 15, 1 to 20, 1 to 25, 1 to 30, 1 to 35, 1 to 40, 1 to 45, 1 to 50, 1 to 60, 1 to 70, 1 to 80, 1 to 90, 10 to 20, 10 to 30, 10 to 40, 10 to 50, 10 to 60, 10 to 70, 10 to 80, 10 to 90, 10 to 100, 20 to 30, 20 to 40, 20 to 50, 20 to 60, 20 to 70, 20 to 80, 20 to 90, or 20 to 100 nucleotides) between the first region and the second region. In some embodiments, the first region comprises or consists of the sequence of SEQ ID NO:7. In some embodiments, the second region comprises or consists of the sequence of SEQ ID NO:8. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO:19. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO:21. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO:22. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO:36. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO:37. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO:42. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO:43.

[0008] In some embodiments, the Myo promoter comprises a first region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:8, or a functional portion or derivative thereof, including the sequence of SEQ ID NO:14 and / or SEQ ID NO:15, and a second region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:7, or a functional portion or derivative thereof, including the sequence of SEQ ID NO:9 and / or SEQ ID NO:10, bound thereto (e.g., operably linked thereto). , or more sequence identity), and optionally containing a linker having 1 to 100 nucleotides (e.g., 1 to 5, 1 to 10, 1 to 15, 1 to 20, 1 to 25, 1 to 30, 1 to 35, 1 to 40, 1 to 45, 1 to 50, 1 to 60, 1 to 70, 1 to 80, 1 to 90, 10 to 20, 10 to 30, 10 to 40, 10 to 50, 10 to 60, 10 to 70, 10 to 80, 10 to 90, 10 to 100, 20 to 30, 20 to 40, 20 to 50, 20 to 60, 20 to 70, 20 to 80, 20 to 90, or 20 to 100 nucleotides) between the first region and the second region. In some embodiments, the first region comprises or consists of the sequence of SEQ ID NO:8. In some embodiments, the second region comprises or consists of the sequence of SEQ ID NO: 7. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 20. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 41.

[0009] In some embodiments, the Myo15 promoter comprises a region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:7 or a functional portion or derivative thereof, including the sequences of SEQ ID NO:9 and / or SEQ ID NO: 10. In some embodiments, this region comprises or consists of the sequence of SEQ ID NO:7.

[0010] In some embodiments, the Myo15 promoter comprises a region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:8 or a functional portion or derivative thereof, including the sequences of SEQ ID NO:14 and / or SEQ ID NO:15. In some embodiments, this region comprises or consists of the sequence of SEQ ID NO:8.

[0011] In some embodiments, the functional portion of SEQ ID NO:7 comprises the sequence of SEQ ID NO:9. In some embodiments, the functional portion of SEQ ID NO:7 comprises the sequence of SEQ ID NO:10. In some embodiments, the functional portion of SEQ ID NO:7 comprises the sequence of SEQ ID NO:9 and the sequence of SEQ ID NO:10. In some embodiments, the functional portion of SEQ ID NO:7 comprises the sequence of SEQ ID NO:11. In some embodiments, the functional portion of SEQ ID NO:7 comprises the sequence of SEQ ID NO:12. In some embodiments, the functional portion of SEQ ID NO:7 comprises the sequence of SEQ ID NO:13. In some embodiments, the functional portion of SEQ ID NO:7 comprises the sequence of SEQ ID NO:33.

[0012] In some embodiments, the functional portion of SEQ ID NO:8 comprises the sequence of SEQ ID NO:14. In some embodiments, the functional portion of SEQ ID NO:8 comprises the sequence of SEQ ID NO:15. In some embodiments, the functional portion of SEQ ID NO:8 comprises the sequence of SEQ ID NO:34. In some embodiments, the functional portion of SEQ ID NO:8 comprises the sequence of SEQ ID NO:35. In some embodiments, the functional portion of SEQ ID NO:8 comprises the sequence of SEQ ID NO:14 and the sequence of SEQ ID NO:15. In some embodiments, the functional portion of SEQ ID NO:8 comprises the sequence of SEQ ID NO:16. In some embodiments, the functional portion of SEQ ID NO:8 comprises the sequence of SEQ ID NO:17. In some embodiments, the functional portion of SEQ ID NO:8 comprises the sequence of SEQ ID NO:18. In some embodiments, the functional portion of SEQ ID NO:8 comprises the sequence of SEQ ID NO:38.

[0013] In some embodiments, the Myo15 promoter has at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to the nucleic acid sequence of any of SEQ ID NOs: 33-41. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 33. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 34. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 35. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 36. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 37. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 38. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 39. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 40. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO:41.

[0014] In some embodiments, the Myol5 promoter comprises a first region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:23, or a functional portion or derivative thereof, comprising the sequence of SEQ ID NO:25, and linked thereto (e.g., operably linked to) SEQ ID NO:24, or a functional portion or derivative thereof, comprising the sequence of SEQ ID NO:26 and / or SEQ ID NO:27. and a second region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to the target gene, and optionally having 1 to 400 nucleotides (e.g., 1 to 5, 1 to 10, 1 to 15, 1 to 20, 1 to 25, 1 to 30, 1 to 35, 1 to 40, 1 to 45, 1 to 50, 1 to 60, 1 to 70, 1 to 80, 1 to 90, 1 to 100, 1 to 125, 1 to 150, 1~175, 1~200, 1~225, 1~250, 1~275, 1~300, 1~325, 1~350, 1~375, 1~400, 10~20, 10~30, 10~40, 10~50, 10~60, 10~70, 10~80, 10~90, 10~100, 20~30, 20~40, 20~50, 20~60, 20~70, 20~80, 20~90, 20~100, 30~100, 40~100, 50~100, 50~150, 50~200, 50~250 , 50-300, 50-350, 50-400, 100-150, 100-200, 100-250, 100-300, 100-350, 100-400, 150-200, 150-250, 150-300, 150-350, 150-400, 200-250, 200-300, 200-350, 200-400, 250-300, 250-350, 250-400, 300-400, or 350-400 nucleotides). In some embodiments, the first region comprises or consists of the sequence of SEQ ID NO:23. In some embodiments, the second region comprises or consists of the sequence of SEQ ID NO:24. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 31. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 32.

[0015] In some embodiments, the Myol5 promoter comprises a first region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:24, or a functional portion or derivative thereof, including the sequences of SEQ ID NO:26 and / or SEQ ID NO:27, and a second region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:23, or a functional portion or derivative thereof, including SEQ ID NO:25, which is linked thereto (e.g., operably linked thereto). and a second region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) between the first region and the second region, and optionally 1 to 400 nucleotides (e.g., 1 to 5, 1 to 10, 1 to 15, 1 to 20, 1 to 25, 1 to 30, 1 to 35, 1 to 40, 1 to 45, 1 to 50, 1 to 60, 1 to 70, 1 to 80, 1 to 90, 1 to 100, 1 to 125, 1 to 150, 1 to 175, 1-200, 1-225, 1-250, 1-275, 1-300, 1-325, 1-350, 1-375, 1-400, 10-20, 10-30, 10-40, 10-50, 10-60, 10-70, 10-80, 10-90, 10-100, 20-30, 20-40, 20-50, 20-60, 20-70, 20-80, 20-90, 20-100, 30-100, 40-100, 50-100, 50-150, 50-200, 50-250, The linker may be 50-300, 50-350, 50-400, 100-150, 100-200, 100-250, 100-300, 100-350, 100-400, 150-200, 150-250, 150-300, 150-350, 150-400, 200-250, 200-300, 200-350, 200-400, 250-300, 250-350, 250-400, 300-400, or 350-400 nucleotides. In some embodiments, the first region comprises or consists of the sequence of SEQ ID NO:24. In some embodiments, the second region comprises or consists of the sequence of SEQ ID NO:23.

[0016] In some embodiments, the Myol5 promoter comprises a region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:23 or a functional portion or derivative thereof, including the sequence of SEQ ID NO:25. In some embodiments, this region comprises or consists of the sequence of SEQ ID NO:23.

[0017] In some embodiments, the Myol5 promoter comprises a region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:24 or a functional portion or derivative thereof, including the sequences of SEQ ID NO:26 and / or SEQ ID NO:27. In some embodiments, this region comprises or consists of the sequence of SEQ ID NO:24.

[0018] In some embodiments, the functional portion of SEQ ID NO:23 comprises the sequence of SEQ ID NO:25. In some embodiments, the functional portion of SEQ ID NO:24 comprises the sequence of SEQ ID NO:26. In some embodiments, the functional portion of SEQ ID NO:24 comprises the sequence of SEQ ID NO:27. In some embodiments, the functional portion of SEQ ID NO:24 comprises the sequence of SEQ ID NO:26 and the sequence of SEQ ID NO:27. In some embodiments, the functional portion of SEQ ID NO:24 comprises the sequence of SEQ ID NO:28. In some embodiments, the functional portion of SEQ ID NO:24 comprises the sequence of SEQ ID NO:29. In some embodiments, the functional portion of SEQ ID NO:24 comprises the sequence of SEQ ID NO:30.

[0019] In another aspect, the invention provides a dual vector system comprising a first AAV1 vector containing a ubiquitous promoter operably linked to a first coding polynucleotide encoding an N-terminal portion of an OTOF isoform 5 protein, a splice donor sequence located at a 3' position of the first coding polynucleotide, and a first recombinogenic region located at a 3' position of the splice donor sequence, and a second AAV1 vector containing a second recombinogenic region, a splice acceptor sequence located at a 3' position of the second recombinogenic region, a second coding polynucleotide encoding a C-terminal portion of an OTOF isoform 5 protein located at a 3' position of the splice acceptor sequence, and a poly(A) sequence located at a 3' position of the second coding polynucleotide. The first and second coding polynucleotides encoding the OTOF isoform 5 protein do not overlap, and neither the first nor the second AAV1 vector encodes a full-length OTOF isoform 5 protein.

[0020] In some embodiments, the ubiquitous promoter is selected from the group consisting of a CAG promoter, a cytomegalovirus (CMV) promoter, and a truncated CMV-chicken β-actin promoter (smCBA). In some embodiments, the ubiquitous promoter is a smCBA promoter. In some embodiments, the smCBA promoter comprises or consists of the sequence of SEQ ID NO:44.

[0021] In some embodiments of any of the aforementioned aspects, the first recombinogenic region and the second recombinogenic region are the same. In some embodiments of any of the foregoing aspects, the first recombinogenic region and / or the second recombinogenic region is an AK recombinogenic region. In some embodiments, the AK recombinogenic region comprises or consists of the sequence of SEQ ID NO:47.

[0022] In some embodiments of any of the foregoing aspects, the first recombinogenic region and / or the second recombinogenic region is an AP gene fragment. In some embodiments, the AP gene fragment comprises or consists of the sequence of any one of SEQ ID NOs: 48-53. In some embodiments, the AP gene fragment comprises or consists of the sequence of SEQ ID NO: 51.

[0023] In some embodiments of any of the aforementioned aspects, the first coding polynucleotide and the second coding polynucleotide each encode about half of the OTOF isoform 5 protein sequence.

[0024] In some embodiments of any of the aforementioned aspects, the first coding polynucleotide encodes amino acids 1-802 of SEQ ID NO: 1. In some embodiments of any of the aforementioned aspects, the second coding polynucleotide encodes amino acids 803-1997 of SEQ ID NO: 1.

[0025] In some embodiments of any of the foregoing aspects, the first coding polynucleotide and the second coding polynucleotide are split at an OTOF exon boundary, in some embodiments, the first coding polynucleotide and the second coding polynucleotide are split at the boundary between exon 20 and exon 21 of the OTOF.

[0026] In some embodiments of any of the aforementioned aspects, the first coding polynucleotide consists of exons 1 to 20 of a polynucleotide encoding an OTOF isoform 5 protein, and the second coding polynucleotide consists of exons 21 to 45 and 47 of a polynucleotide encoding an OTOF isoform 5 protein (e.g., a polynucleotide encoding a human OTOF isoform 5 protein).

[0027] In some embodiments of any of the aforementioned aspects, the first coding polynucleotide and the second coding polynucleotide that encode the OTOF isoform 5 protein do not include an intron.

[0028] In some embodiments of any of the aforementioned aspects, the OTOF isoform 5 protein is a human OTOF isoform 5 protein (eg, a protein having the sequence of SEQ ID NO:1).

[0029] In some embodiments of any of the foregoing aspects, the OTOF isoform 5 protein comprises the sequence of SEQ ID NO: 1 or a variant thereof, having one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) conservative amino acid substitutions. In some embodiments, 10% or less (10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less) of the amino acids in the OTOF isoform 5 protein variant are conservative amino acid substitutions. In some embodiments, the OTOF isoform 5 protein consists of the sequence of SEQ ID NO: 1.

[0030] In some embodiments of any of the aforementioned aspects, the OTOF isoform 5 protein is encoded by the sequence of SEQ ID NO:2. In some embodiments of any of the aforementioned aspects, the OTOF isoform 5 protein is encoded by the sequence of SEQ ID NO:3.

[0031] In some embodiments of any of the foregoing aspects, the N-terminal portion of the OTOF isoform 5 protein consists of the sequence of SEQ ID NO: 58 or a variant thereof, having one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) conservative amino acid substitutions. In some embodiments, 10% or less (10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less) of the amino acids in the N-terminal portion of the OTOF isoform 5 protein variant are conservative amino acid substitutions. In some embodiments, the N-terminal portion of the OTOF isoform 5 protein consists of the sequence of SEQ ID NO: 58. In some embodiments, the N-terminal portion of the OTOF isoform 5 protein is encoded by the sequence of SEQ ID NO: 56.

[0032] In some embodiments of any of the foregoing aspects, the C-terminal portion of the OTOF isoform 5 protein consists of the sequence of SEQ ID NO: 59 or a variant thereof, having one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) conservative amino acid substitutions. In some embodiments, 10% or less (10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less) of the amino acids in the C-terminal portion of the OTOF isoform 5 protein variant are conservative amino acid substitutions. In some embodiments, the C-terminal portion of the OTOF isoform 5 protein consists of the sequence of SEQ ID NO: 59. In some embodiments, the C-terminal portion of the OTOF isoform 5 protein is encoded by the sequence of SEQ ID NO: 57.

[0033] In some embodiments of any of the foregoing aspects, the first vector comprises a first inverted terminal repeat (ITR) sequence 5' of the promoter and a second ITR sequence 3' of the recombinogenic region, and the second vector comprises a first ITR sequence 5' of the recombinogenic region and a second ITR sequence 3' of the poly(A) sequence. In some embodiments, the ITRs of the first vector and the second vector are AAV2 ITRs. In some embodiments, the ITRs of the first vector and the second vector have at least 80% sequence identity to the AAV2 ITRs (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity).

[0034] In some embodiments of any of the aforementioned aspects, the poly(A) sequence is a bovine growth hormone (bGH) poly(A) signal sequence. In some embodiments of any of the aforementioned aspects, the splice donor sequence of the first vector comprises or consists of the sequence of SEQ ID NO:54.

[0035] In some embodiments of any of the aforementioned aspects, the splice acceptor sequence of the second vector comprises or consists of the sequence of SEQ ID NO:55. In some embodiments of any of the aforementioned aspects, the first AAV vector includes a Kozak sequence 3' of the promoter and 5' of a first coding polynucleotide encoding an N-terminal portion of OTOF isoform 5 protein.

[0036] In some embodiments of any of the aforementioned aspects, the first AAV vector comprises a polynucleotide sequence that includes, or consists of, the sequence of nucleotides 2272 to 6041 of SEQ ID NO: 60. In some embodiments of any of the aforementioned aspects, the first AAV vector comprises a polynucleotide sequence that includes, or consists of, the sequence of nucleotides 2049 to 6264 of SEQ ID NO: 60.

[0037] In some embodiments of any of the aforementioned aspects, the first AAV vector comprises a polynucleotide sequence that includes, or consists of, the sequence of nucleotides 182 to 3949 of SEQ ID NO: 62. In some embodiments of any of the aforementioned aspects, the first AAV vector comprises a polynucleotide sequence that includes, or consists of, the sequence of nucleotides 19 to 4115 of SEQ ID NO: 62.

[0038] In some embodiments of any of the aforementioned aspects, the first AAV vector comprises a polynucleotide sequence that includes the sequence of positions 2267 to 6014 of SEQ ID NO: 64. In some embodiments of any of the aforementioned aspects, the first AAV vector comprises a polynucleotide sequence that includes, or consists of, the sequence of positions 2049 to 6237 of SEQ ID NO: 64.

[0039] In some embodiments of any of the aforementioned aspects, the first AAV vector comprises a polynucleotide sequence comprising the sequence of positions 177 to 3924 of SEQ ID NO: 65. In some embodiments of any of the aforementioned aspects, the first AAV vector comprises a polynucleotide sequence comprising, or consisting of, the sequence of positions 19 to 4090 of SEQ ID NO: 65.

[0040] In some embodiments of any of the aforementioned aspects, the second AAV vector comprises a polynucleotide sequence that includes, or consists of, the sequence of nucleotides 2267 to 6476 of SEQ ID NO: 61. In some embodiments of any of the aforementioned aspects, the second AAV vector comprises a polynucleotide sequence that includes, or consists of, the sequence of nucleotides 2049 to 6693 of SEQ ID NO: 61.

[0041] In some embodiments of any of the aforementioned aspects, the second AAV vector comprises a polynucleotide sequence that includes, or consists of, the sequence of nucleotides 187 to 4396 of SEQ ID NO: 63. In some embodiments of any of the aforementioned aspects, the second AAV vector comprises a polynucleotide sequence that includes, or consists of, the sequence of nucleotides 19 to 4589 of SEQ ID NO: 63.

[0042] In some embodiments of any of the aforementioned aspects, the first AAV vector comprises a polynucleotide sequence that includes the sequence of nucleotides 235 to 4004 of SEQ ID NO: 66. In some embodiments of any of the aforementioned aspects, the first AAV vector comprises a polynucleotide sequence that includes, or consists of, the sequence of nucleotides 12 to 4227 of SEQ ID NO: 66.

[0043] In some embodiments of any of the aforementioned aspects, the first AAV vector comprises a polynucleotide sequence that includes the sequence of nucleotides 230 to 3977 of SEQ ID NO: 68. In some embodiments of any of the aforementioned aspects, the first AAV vector comprises a polynucleotide sequence that includes, or consists of, the sequence of nucleotides 12 to 4200 of SEQ ID NO: 68.

[0044] In some embodiments of any of the aforementioned aspects, the second AAV vector comprises a polynucleotide sequence that includes, or consists of, the sequence of nucleotides 229 to 4438 of SEQ ID NO: 67. In some embodiments of any of the aforementioned aspects, the second AAV vector comprises a polynucleotide sequence that includes, or consists of, the sequence of nucleotides 12 to 4655 of SEQ ID NO: 67.

[0045] In another aspect, the invention provides pharmaceutical compositions comprising the dual vector system of the invention and a pharma- ceutical acceptable excipient, hi some embodiments, the pharmaceutical composition is formulated for administration to the inner ear.

[0046] In another aspect, the present invention provides a kit comprising the dual vector system or pharmaceutical composition of the present invention. In another aspect, the present invention provides a method for increasing OTOF expression (e.g., wild-type OTOF expression, e.g., full-length OTOF isoform 5 expression) in a subject in need thereof by administering a therapeutically effective amount of a dual vector system of the present invention to the subject.

[0047] In another aspect, the present invention provides a method of treating a subject having or at risk of developing sensorineural hearing loss by administering to the subject a therapeutically effective amount of the dual vector system of the present invention.

[0048] In another aspect, the present invention provides a method of treating a subject having or at risk of developing auditory neuropathy by administering to the subject a therapeutically effective amount of a dual vector system of the present invention.

[0049] In some embodiments of any of the aforementioned aspects, the subject has a mutation in OTOF. In some embodiments of any of the aforementioned aspects, the subject has been identified as having a mutation in OTOF.

[0050] In some embodiments of any of the aforementioned aspects, the method further includes identifying the subject as having a mutation in OTOF prior to administering the composition. In some embodiments of any of the aforementioned aspects, the subject has or has been confirmed as having autosomal recessive deafness 9 (DFNB9).

[0051] In some embodiments of any of the aforementioned aspects, the method further comprises assessing the subject's hearing prior to administering the dual vector system. In some embodiments of any of the foregoing aspects, the dual vector system is administered locally to the ear, hi some embodiments, the dual vector system is administered by injection through the round window membrane, injection into the semicircular canal, canalostomy, insertion of a catheter through the round window membrane, middle ear injection, or intratympanic injection.

[0052] In some embodiments of any of the preceding aspects, the method increases OTOF expression in a cochlear hair cell. In some embodiments, the cochlear hair cell is an inner hair cell. In some embodiments of any of the aforementioned aspects, the subject is a mammal. In some embodiments, the subject is a human.

[0053] In some embodiments of any of the aforementioned aspects, the method further includes assessing the hearing of the subject after administering the dual vector system. In some embodiments of any of the foregoing aspects, the dual vector system increases OTOF expression in cells (e.g., cochlear hair cells), improves hearing (e.g., as assessed by standard tests such as audiometry, auditory brainstem response (ABR), electrocochleography (ECOG), and otoacoustic emissions), prevents or reduces hearing loss, delays the onset of hearing loss, slows the progression of hearing loss, improves speech discrimination, or improves hair cell function.

[0054] In some embodiments of any of the foregoing aspects, the dual vector system is administered in an amount sufficient to increase OTOF expression in cochlear hair cells, prevent or reduce hearing loss, delay the onset of hearing loss, slow the progression of hearing loss, improve hearing (e.g., as assessed by standard tests such as audiometry, ABR, ECOG, and otoacoustic emissions), improve speech discrimination, or improve hair cell function.

[0055] In another aspect, the present invention provides a method for increasing OTOF expression in a cell by introducing into the cell the dual vector system of the present invention. In some embodiments, the cell is a cochlear hair cell. In some embodiments, the cell is an inner hair cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a human cell.

[0056] In some embodiments of any of the aforementioned aspects, the first vector and the second vector are administered simultaneously. In some embodiments of any of the aforementioned aspects, the first vector and the second vector are administered sequentially.

[0057] In some embodiments of any of the preceding aspects, the first vector and the second vector are at least 1×10 7 Vector genome (VG) / ear ~ approx. 2 x 10 15 VG / ear (e.g. 1×10 7VG / ear, 2×10 7 VG / ear, 3×10 7 VG / ear, 4×10 7 VG / ear, 5×10 7 VG / ear, 6×10 7 VG / ear, 7×10 7 VG / ear, 8×10 7 VG / ear, 9×10 7 VG / ear, 1×10 8 VG / ear, 2×10 8 VG / ear, 3×10 8 VG / ear, 4×10 8 VG / ear, 5×10 8 VG / ear, 6×10 8 VG / ear, 7×10 8 VG / ear, 8×10 8 VG / ear, 9×10 8 VG / ear, 1×10 9 VG / ear, 2×10 9 VG / ear, 3×10 9 VG / ear, 4×10 9 VG / ear, 5×10 9 VG / ear, 6×10 9 VG / ear, 7×10 9 VG / ear, 8×10 9 VG / ear, 9×10 9 VG / ear, 1×10 10 VG / ear, 2×10 10 VG / ear, 3×10 10 VG / ear, 4×10 10 VG / ear, 5×10 10 VG / ear, 6×10 10 VG / ear, 7×10 10 VG / ear, 8×10 10 VG / ear, 9×10 10 VG / ear, 1×10 11 VG / ear, 2×10 11 VG / ear, 3×10 11 VG / ear, 4×10 11 VG / ear, 5×10 11 VG / ear, 6×10 11 VG / ear, 7×10 11 VG / ear, 8×10 11 VG / ear, 9×10 11 VG / ear, 1×10 12 VG / ear, 2×1012 VG / ear, 3×10 12 VG / ear, 4×10 12 VG / ear, 5×10 12 VG / ear, 6×10 12 VG / ear, 7×10 12 VG / ear, 8×10 12 VG / ear, 9×10 12 VG / ear, 1×10 13 VG / ear, 2×10 13 VG / ear, 3×10 13 VG / ear, 4×10 13 VG / ear, 5×10 13 VG / ear, 6×10 13 VG / ear, 7×10 13 VG / ear, 8×10 13 VG / ear, 9×10 13 VG / ear, 1×10 14 VG / ear, 2×10 14 VG / ear, 3×10 14 VG / ear, 4×10 14 VG / ear, 5×10 14 VG / ear, 6×10 14 VG / ear, 7×10 14 VG / ear, 8×10 14 VG / ear, 9×10 14 VG / ear, 1×10 15 VG / ear, or 2×10 15 It is administered at a concentration of 100 mg / ear (VG).

[0058] definition As used herein, the term "about" refers to a value within 10% above or below the stated value.

[0059] As used herein, "administration" refers to providing or giving a therapeutic agent (e.g., a composition comprising a first nucleic acid vector comprising a polynucleotide encoding an N-terminal portion of an otoferlin protein, and a second nucleic acid vector comprising a polynucleotide encoding a C-terminal portion of an otoferlin protein) to a subject by any effective route. Exemplary administration routes are described herein below.

[0060] As used herein, the term "cell type" refers to a group of cells that share a statistically separable phenotype based on gene expression data. For example, cells of a common cell type may share similar structural and / or functional characteristics, such as similar gene activation patterns and antigen presentation properties. Cells of a common cell type may include cells isolated from a common tissue (e.g., epithelial, nervous, connective, or muscle tissue) and / or a common organ, tissue system, blood vessel, or other structure and / or region in the body.

[0061] As used herein, the term "cochlear hair cells" refers to a specialized group of cells in the inner ear that are involved in the detection of sound. There are two types of cochlear hair cells: inner hair cells and outer hair cells. Damage to cochlear hair cells and genetic mutations that disrupt the function of cochlear hair cells are associated with hearing loss and hearing loss.

[0062] As used herein, the terms "conservative mutation," "conservative substitution," and "conservative amino acid substitution" refer to the substitution of one or more amino acids with one or more different amino acids that exhibit similar physicochemical properties, such as polarity, electrostatic charge, and steric bulk, as summarized in Table 1 below for each of the 20 naturally occurring amino acids.

[0063] [Table 1]

[0064] According to this table, it is understood that the families of conservative amino acids include: (i) G, A, V, L, and I; (ii) D and E; (iii) C, S, and T; (iv) H, K, and R; (v) N and Q; and (vi) F, Y, and W. Thus, a conservative variation or substitution is one that replaces an amino acid with a member of the same amino acid family (e.g., Ser for Thr, or Lys for Arg).

[0065] As used herein, the terms "effective amount", "therapeutically effective amount" and "sufficient amount" of a composition, vector construct, or viral vector described herein refer to an amount sufficient to produce beneficial or desired results, including clinical results, when administered to a subject in need thereof, including a mammal, e.g., a human, and thus the "effective amount" or its synonyms depend on the context in which it is applied. For example, with respect to the treatment of sensorineural hearing loss, it is the amount of the composition, vector construct, or viral vector sufficient to achieve a therapeutic response compared to the response obtained without administration of the composition, vector construct, or viral vector. The amount of a given composition described herein that corresponds to such an amount will vary depending on various factors, such as the given drug, pharmaceutical formulation, route of administration, type of disease or disorder, characteristics of the subject (e.g., age, sex, weight) or host to be treated, but can nevertheless be routinely determined by one of skill in the art. Also, as used herein, a "therapeutically effective amount" of a composition, vector construct, or viral vector of the present disclosure is an amount that produces beneficial or desired results in a subject compared to a control. It should be noted that when active ingredients are administered in combination, the effective amount of the combination may or may not include the amount of each ingredient that would be effective when administered individually.As defined herein, the therapeutically effective amount of the composition, vector construct, or viral vector of the present disclosure can be easily determined by those skilled in the art by routine methods known in the art.Dosage regimen can be adjusted to provide optimal therapeutic response.

[0066] As used herein, the term "endogenous" refers to a molecule (e.g., a polypeptide, nucleic acid, or cofactor) that is naturally found in a particular organism (e.g., a human) or in a particular location within an organism (e.g., an organ, tissue, or cell, e.g., a human cell, e.g., a human cochlear hair cell).

[0067] As used herein, the term "express" refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of the RNA transcript (e.g., splicing, editing, 5' capping, and / or 3' end processing); (3) translation of the RNA into a polypeptide or protein; and (4) post-translational modification of the polypeptide or protein.

[0068] As used herein, the term "exogenous" refers to a molecule (e.g., a polypeptide, nucleic acid, or cofactor) that is not naturally found in a particular organism (e.g., a human) or in a particular location within an organism (e.g., an organ, tissue, or cell, e.g., a human cell, e.g., a human cochlear hair cell). Exogenous material includes materials provided from an external source to an organism or a culture extracted therefrom.

[0069] As used herein, the term "hair cell-specific expression" refers to the production of an RNA transcript or polypeptide primarily in hair cells (e.g., cochlear hair cells) compared to other cell types of the inner ear (e.g., spiral ganglion neurons, glia, or other inner ear cell types). Hair cell-specific expression of a transgene can be confirmed by comparing expression of the transgene (e.g., RNA or protein expression) among various cell types of the inner ear (e.g., in hair cells versus non-hair cells) using any standard technique (e.g., quantitative RT PCR, immunohistochemistry, Western blot analysis, or fluorescence measurement of a reporter (e.g., GFP) operably linked to a promoter). A hair cell specific promoter induces expression (e.g., RNA or protein expression) of a transgene to which it is operably linked, and the induced expression is at least 50% (e.g., 50%, 75%, 100%, 125%, 150%, 175%, 200% or more) greater in hair cells (e.g., cochlear hair cells) than in at least three (e.g., 3, 4, 5, 6, 7, 8, 9, 10, or more) of the following inner ear cell types: border cells, inner phalangeal cells, inner pillar cells, outer pillar cells, first row Deiters cells, second row Deiters cells, third row Deiters cells, Hensen cells, Claudius cells, inner sulcus cells, outer sulcus cells, spiral ridge cells, root cells, interdental cells, basal cells of the stria vascularis, intermediate cells of the stria vascularis, marginal cells of the stria vascularis, spiral ganglion neurons, and Schwann cells.

[0070] As used herein, the terms "increase" and "decrease" refer to the modulation of a function, expression, or activity, resulting in a greater or lesser amount, respectively, of a baseline value, as compared to a reference. For example, following administration of a composition in the manner described herein, the amount of a quantification marker described herein (e.g., OTOF expression) may be increased or decreased by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98% or more in a subject relative to the amount of the marker before administration. Generally, the baseline value is measured at a time when administration produces the described effect, e.g., at least 1 week, 1 month, 3 months, or 6 months after starting a treatment regimen.

[0071] As used herein, the term "intron" refers to a region in the coding region of a gene whose nucleotide sequence is not translated into the amino acid sequence of the corresponding protein. The term intron also refers to the corresponding region of the RNA transcribed from the gene. Introns are transcribed into pre-mRNA but are removed during processing and are not included in the mature mRNA.

[0072] As used herein, "local" or "local administration" refers to administration at a particular site of the body for a local rather than a systemic effect. Examples of local administration are onto the skin of a subject, inhalation, intra-articular, intrathecal, intravaginal, intravitreal, intrauterine, intralesional, lymph node, intratumor, to the inner ear, and to mucous membranes, where administration is intended to produce a local rather than a systemic effect.

[0073] As used herein, the term "operably linked" refers to a first molecule that can bind to a second molecule, positioning the molecules such that the first molecule affects the function of the second molecule. The term "operably linked" includes juxtaposing two or more components (e.g., a promoter and another sequence element) such that both components function normally and can mediate the function of at least one component acting on at least one other component. The two molecules may or may not be part of a single unbroken molecule, and may be adjacent or non-adjacent. For example, a promoter is operably linked to a transcribable polynucleotide molecule of interest if it regulates the transcription of the transcribable polynucleotide molecule of interest in a cell. In further embodiments, two portions of a transcriptional regulatory element are operably linked to each other when they are bound such that the transcriptional activation function of one portion is not adversely affected by the presence of the other portion. Two transcriptional regulatory elements may be operably linked to each other via a linker nucleic acid (e.g., an intervening non-coding nucleic acid) or may be operably linked to each other without the presence of an intervening nucleotide.

[0074] As used herein, the terms "otoferlin isoform 5" and "OTOF isoform 5" refer to an isoform of the gene associated with non-syndromic recessive hearing loss DFNB9. The human isoform of the gene is related to reference sequence NM_001287489, and the transcript contains exons 1-45 and 47 of human otoferlin, but lacks exon 46 of the OTOF gene. Human OTOF isoform 5 protein is also known as otoferlin isoform e. The terms "otoferlin isoform 5" and "OTOF isoform 5" refer to variants of wild-type OTOF isoform 5 protein, and polynucleotides encoding same, that have at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% or more identity) to the amino acid sequence of wild-type OTOF isoform 5 protein (e.g., SEQ ID NO:1). It refers to a mutant protein having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identity or more) to the polynucleotide sequence of the wild-type OTOF isoform 5 gene, provided that the encoded OTOF isoform 5 analog retains the therapeutic function of wild-type OTOF isoform 5. OTOF isoform 5 protein variants can have one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) conservative amino acid substitutions relative to wild-type OTOF isoform 5 (e.g., SEQ ID NO:1), provided that the OTOF isoform 5 variant retains the therapeutic function of wild-type OTOF isoform 5 and has no more than 10% amino acid substitutions in the N-terminal portion of the amino acid sequence and no more than 10% amino acid substitutions in the C-terminal portion of the amino acid sequence.As used herein, OTOF isoform 5 may refer to a protein localized to inner hair cells or to the gene encoding this protein, depending on the context, as will be understood by those of skill in the art. OTOF isoform 5 may refer to human OTOF isoform 5, or to a homologue in another mammalian species. Mouse otoferlin contains one additional exon compared to human otoferlin (48 exons in mouse otoferlin), and the exons in mouse otoferlin that correspond to those encoding human OTOF isoform 5 are 1-5, 7-46, and 48. The exon numbering rules used herein are based on the exons currently understood to be present in the consensus transcript of human OTOF.

[0075] As used herein, the term "plasmid" refers to an extrachromosomal circular double-stranded DNA molecule into which additional DNA segments can be ligated. A plasmid is a type of vector, a nucleic acid molecule that can transport another nucleic acid to which it is linked. Certain plasmids are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial plasmids having a bacterial origin of replication and episomal mammalian plasmids). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Certain plasmids can induce the expression of genes to which they are operatively linked.

[0076] As used herein, the terms "nucleic acid" and "polynucleotide", which are used interchangeably herein, refer to a polymeric form of nucleosides of any length. Generally, polynucleotides are composed of nucleosides naturally found in DNA or RNA (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine) linked by phosphodiester bonds. However, the term encompasses molecules containing nucleosides or nucleoside analogs with chemically or biologically modified bases, modified backbones, and the like, whether or not found in natural nucleic acids, and such molecules may be preferred for certain applications. When the application refers to polynucleotides, it is understood that both DNA, RNA, and in each case both single-stranded and double-stranded forms (and the complement of each single-stranded molecule) are provided. As used herein, "polynucleotide sequence" can refer to the polynucleotide material itself and / or to the sequence information (i.e., the series of letters used as abbreviations for bases) that biochemically characterize a particular nucleic acid. Polynucleotide sequences presented herein are shown in the 5' to 3' orientation unless otherwise indicated.

[0077] As used herein, the term "complementarity" or "complementary" of a nucleic acid means that a nucleotide sequence of one strand of a nucleic acid forms hydrogen bonds with another sequence on an opposite nucleic acid strand due to the orientation of its nucleobases. Complementary bases in DNA are usually A and T, and C and G. In RNA, they are usually C and G, and U and A. Complementarity can be complete or substantial / sufficient. Complete complementarity between two nucleic acids means that the two nucleic acids can form a duplex, in which all bases in the duplex bind to complementary bases by Watson-Crick pairing. "Substantially" or "fully" complementary means that the sequence of one strand is not completely and / or perfectly complementary to the sequence of the opposite strand, but that sufficient binding occurs between the bases of the two strands under a set of hybridization conditions (e.g., salt concentration and temperature) to form a stable hybrid complex. Such conditions can be predicted by predicting the Tm (melting temperature) of the hybridized strands using the sequences and standard mathematical calculations, or by empirically determining the Tm using routine methods. The Tm comprises the temperature at which 50% of the population of hybridization complexes formed between two nucleic acid strands denatures (i.e., half of the population of double-stranded nucleic acid molecules dissociates into single strands). At temperatures below the Tm, the formation of hybridization complexes is favored, while at temperatures above the Tm, melting or separation of the strands in the hybridization complexes is favored. The Tm of a nucleic acid may be estimated using a known G+C content in 1M NaCl aqueous solution, for example, Tm=81.5+0.41(%G+C), although other known Tm calculations take into account the structural properties of the nucleic acid.

[0078] As used herein, the term "promoter" refers to a recognition site on DNA to which RNA polymerase binds. The polymerase promotes transcription of the transgene. Exemplary promoters suitable for use in the compositions and methods described herein include ubiquitous promoters (e.g., CAG promoter, cytomegalovirus (CMV) promoter, and smCBA promoter), and cochlear hair cell specific promoters (e.g., myosin 15 (Myo15) promoter).

[0079] "Percentage of amino acid sequence identity" to a reference polynucleotide or polypeptide sequence is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to the nucleic acids or amino acids in the reference polynucleotide or polypeptide sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percentage of sequence identity. Alignment for the purpose of measuring percentage of nucleic acid or amino acid sequence identity can be achieved in a variety of ways within the capabilities of those skilled in the art, for example, using publicly available computer software, such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine the appropriate parameters for aligning sequences, including any algorithms required to obtain maximum alignment over the full length of the sequences being compared. For example, percentage of sequence identity values ​​can be generated using the sequence comparison computer program BLAST. By way of illustration, the percentage of sequence identity of a given nucleic acid or amino acid sequence A to or with a given nucleic acid or amino acid sequence B (which can alternatively be referred to as a given nucleic acid or amino acid sequence A having a particular percentage of identity to or with a given nucleic acid or amino acid sequence B) is calculated as follows:

[0080] 100×(fraction X / Y) where X is the number of nucleotides or amino acids scored as identical matches by a sequence alignment program (e.g., BLAST) in a programmatic alignment of A and B, and Y is the total number of nucleic acids in B. If the length of nucleic acid or amino acid sequence A is not equal to the length of nucleic acid or amino acid sequence B, then the percentage of sequence identity of A to B will not be equal to the percentage of sequence identity of B to A.

[0081] As used herein, the term "derivative" refers to a nucleic acid, peptide, or protein, or a variant or analog thereof, that contains one or more mutations and / or chemical modifications compared to the corresponding full-length wild-type nucleic acid, peptide, or protein. Non-limiting examples of chemical modifications involving nucleic acids include, for example, modifications to the base moiety, sugar moiety, phosphate moiety, phosphate-sugar backbone, or combinations thereof.

[0082] As used herein, the term "pharmaceutical composition" refers to a mixture containing a therapeutic agent, optionally in combination with one or more pharma- ceutically acceptable excipients, diluents, and / or carriers, for administration to a subject, such as a mammal, e.g., a human, to prevent, treat, or control a particular disease or condition that affects or may affect the subject.

[0083] As used herein, the term "pharmaceutical acceptable" refers to compounds, substances, compositions, and / or dosage forms that are suitable for contact with the tissues of a subject, such as a mammal (e.g., a human), without undue toxicity, irritation, allergic response, and other problematic hazards, and with a reasonable benefit / risk ratio. Preferably, the term "pharmaceutical acceptable" means approved by a federal or state government regulatory agency, or listed in the United States Pharmacopeia or other generally recognized pharmacopoeias, for use in mammals, and more specifically, in humans.

[0084] As used herein, the term "recombinogenic region" refers to a region of homology that mediates recombination between two distinct sequences. As used herein, the term "regulatory sequence" includes promoters, enhancers, and other expression control elements (e.g., polyadenylation signals) that control the transcription or translation of a polynucleotide encoding OTOF. Such regulatory sequences are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185 (Academic Press, San Diego, CA, 1990), which is incorporated herein by reference.

[0085] As used herein, the term "sample" refers to a specimen isolated from a subject (e.g., blood, blood components (e.g., serum or plasma), urine, saliva, amniotic fluid, cerebrospinal fluid, tissue (e.g., placenta or skin), pancreatic juice, chorionic villus samples, and cells).

[0086] As used herein, the term "transfection" refers to any of a wide variety of techniques commonly used for the introduction of foreign DNA into prokaryotic or eukaryotic host cells, such as electroporation, lipofection, calcium phosphate precipitation, DEAE-dextran transfection, Nucleofection, squeezeporation, sonoporation, phototransfection, magnetofection, imparefection, and the like.

[0087] As used herein, the terms "subject" and "patient" refer to animals (e.g., mammals such as humans), veterinary subjects (e.g., cats, dogs, cows, horses, sheep, pigs, etc.), and experimental animal models of disease (e.g., mice, rats). Subjects treated according to the methods described herein may be subjects who have been diagnosed with hearing loss (e.g., hearing loss associated with a mutation in OTOF) or who are at risk for developing these conditions. Diagnosis may be performed by any method or technique known in the art. Those skilled in the art will understand that subjects treated according to the present disclosure may have undergone standard testing or may not have undergone testing but have been identified as at risk due to the presence of one or more risk factors associated with the disease or condition.

[0088] As used herein, the terms "transduction" and "transducing" refer to a method of introducing a vector construct or a portion thereof into a cell. When the vector construct is contained in a viral vector, such as, for example, an AAV vector, transduction refers to viral infection of a cell and the subsequent transfer and integration of the vector construct or a portion thereof into the cellular genome.

[0089] As used herein, "treatment" and "treating" of a condition, disorder or condition can include: (1) preventing, delaying, or reducing the incidence and / or likelihood of at least one clinical or asymptomatic symptom of the condition, disorder or condition developing in a subject who may be afflicted with or predisposed to the condition, disorder or condition, but who has not yet experienced or exhibited clinical or asymptomatic symptoms; or (2) inhibiting the condition, disorder or condition, i.e., preventing, reducing, or delaying the onset of the disease or its recurrence or the onset of at least one clinical or asymptomatic symptom; or (3) relieving the disease, i.e., regressing the condition, disorder or condition, or at least one clinical or asymptomatic symptom thereof. The benefit to a subject being treated is statistically significant or at least perceptible to the patient or physician.

[0090] As used herein, the term "vector" includes nucleic acid vectors (e.g., DNA vectors such as plasmids), RNA vectors, viruses, or other suitable replicons (e.g., viral vectors). A variety of vectors have been developed to deliver polynucleotides encoding foreign proteins to prokaryotic or eukaryotic cells. Examples of such expression vectors are disclosed, for example, in WO94 / 011026, which is incorporated herein by reference as it relates to vectors suitable for expressing genes of interest. Expression vectors suitable for use in the compositions and methods described herein include polynucleotide sequences and additional sequence elements used, for example, for protein expression and / or integration of these polynucleotide sequences into the genome of mammalian cells. Particular vectors that can be used to express the OTOFs described herein include vectors that include regulatory sequences such as promoter and enhancer regions that direct gene transcription. Other vectors useful for expressing OTOFs include polynucleotide sequences that increase the translation rate of these genes or improve the stability or nuclear export of mRNA resulting from gene transcription. These sequence elements include, for example, 5' and 3' untranslated regions and polyadenylation signal sites to direct efficient transcription of genes incorporated on the expression vector. Expression vectors suitable for use in the compositions and methods described herein may also include a polynucleotide encoding a marker for selecting cells containing such a vector. Examples of suitable markers include genes encoding resistance to antibiotics such as ampicillin, chloramphenicol, kanamycin, or nourseothricin.

[0091] As used herein, the term "wild type" refers to the most frequently occurring genotype for a particular gene in a given organism. [Brief description of the drawings]

[0092] [Figure 1A]Graph showing analysis of auditory brainstem responses (ABRs) in OTOF homozygous mutant (OTOF Q828X / Q828X) mice administered the OTOF dual vector system, showing that AAV-mediated gene transfer of human OTOF isoform 5, but not human OTOF isoform 1, improved hearing function. ABR thresholds to pure tone stimuli at 22.6 kHz were recorded from mice receiving the OTOF dual vector system with either codon-optimized (CO) or native sequences encoding human OTOF isoform 1 (V1) (SEQ ID NO: 4) or isoform 5 (V5) (SEQ ID NO: 1). The dose of virus in the vector genome (vg) delivered to the ear is shown below the description of the sequence administered to each treatment group. OTOF virus was injected through the round window membrane of 4-7 week-old OTOF Q828X / Q828X mice (a mouse model of the human OTOF mutation p.Gln828Ter). ABR responses were measured approximately 4 weeks after virus injection. ABR responses were significantly improved in mice treated with human OTOF isoform 5, regardless of codon optimization. No ABR responses were detected in mice treated with human OTOF isoform 1. The range of ABR thresholds observed in wild-type and heterozygous OTOF mutant mice (OTOFQ828X / +) is indicated by boxes. [Figure 1B]A series of fluorescent images of mouse cochleae transduced with the OTOF dual vector system carrying codon-optimized (CO) sequences encoding human OTOF isoform 1 (V1) or isoform 5 (V5). Mice were injected with the OTOF dual vector system carrying codon-optimized (CO) sequences of human OTOF isoform 1 (V1) (SEQ ID NO: 6) or isoform 5 (V5) (SEQ ID NO: 3). After physiological testing was completed (see data in Figure 1A), mice were euthanized and perfused with 10% neutral buffered formalin. Cochleae were harvested and decalcified in 8% EDTA for 3 days. Cochleae were dissected from the decalcified temporal bones, immunostained with OTOF antibody to detect expression of the OTOF transgene, and mounted on slides for fluorescent imaging. Cochleae injected with the dual vector system encoding either human OTOF isoform 1 (V1) or isoform 5 (V5) showed comparable levels of OTOF expression (Figure 1B). Because functional recovery was observed only with human OTOF isoform 5 (V5) and not with isoform 1 (V1) (see Figure 1A ), these data indicate that human OTOF isoform 5 (V5) is the functionally relevant OTOF isoform in cochlear inner hair cells. [Diagram 2]Graph showing analysis of ABRs in OTOF homozygous mutant (OTOF Q828X / Q828X) mice, demonstrating that AAV-mediated gene transfer of human OTOF isoform 5 improves hearing function to wild-type levels when delivered at high doses. ABR thresholds to pure tone stimuli at 22.6 kHz were recorded from mice receiving OTOF dual vectors with either the codon-optimized (CO) or native sequence of human OTOF isoform 5 (V5) (SEQ ID NO:3 and SEQ ID NO:2, respectively). For each treatment group, the dose of virus in the vector genome (vg) delivered to the ear is shown below the description of the sequence administered to each treatment group. OTOF virus was injected through the round window membrane of 4-7 week-old OTOF Q828X / Q828X mice. ABR responses were measured approximately 4 weeks after injection of virus. Compared to animals receiving 7E9 or 6E9 vector genomes / ear (Figure 1A), these animals showed even stronger ABR responses, regardless of codon optimization (Figure 2). The range of ABR thresholds observed in wild-type and heterozygous OTOF mutant mice (OTOFQ828X / +) is indicated by boxes. [Figure 3A] Figure 3A-C is a series of graphs showing electrophysiological signs of hearing function in mice treated with viral vectors expressing OTOF via a double hybrid vector system. Homozygous OTOF-Q828X mice were treated with the AAV1-Myo15 (SEQ ID NO: 21)-hOTOF (isoform 5, SEQ ID NO: 1) double hybrid vector system by injection through the round window membrane. Auditory brainstem response (ABR) thresholds were used to assess hearing function (Figure 3A). Untreated animals (Otof HOM Untreated) showed no detectable recovery of hearing function, whereas treated animals showed robust recovery, consistent from 4 weeks post-treatment (Otof HOM 4 weeks post-treatment) to 8 weeks post-treatment (Otof HOM 8-11 weeks post-treatment). ABR thresholds in heterozygous mice (Otof HET) were also tested. [Figure 3B]In another set of experiments, homozygous OTOF-Q828X mice were treated with the AAV1-truncated chimeric CMV-chicken β-actin (smCBA, SEQ ID NO: 44)-hOTOF (isoform 5, SEQ ID NO: 1) double hybrid vector system by injection through the round window membrane. ABR thresholds were used to assess hearing function as described above (Figure 3B). Untreated animals showed no detectable recovery of hearing function, whereas treated animals showed robust recovery 4 weeks after treatment (Otof HOM 4 weeks after treatment). When the same mice were evaluated 8 weeks after treatment (Otof HOM 8 weeks after treatment), ABR thresholds were increased, suggesting poor durability of recovery due to the smCBA promoter. ABR thresholds of heterozygous mice were also tested. [Figure 3C] In yet another set of experiments, heterozygous OTOF-Q828X mice were treated with the AAV1-smCBA (SEQ ID NO: 44)-hOTOF (isoform 5, SEQ ID NO: 1) double hybrid vector system by injection through the round window membrane. High dose and ABR thresholds were used to assess hearing function 4 and 8 weeks after treatment (Figure 3C). Dose-dependent recovery of ABR thresholds was observed at both time points. Comparing the 8 and 4 week time points, recovery was stable at low and mid doses but decreased in high dose animals. ABR thresholds of HET animals were also tested. [Figure 4]Graph showing the durability of hearing recovery in mice treated with viral vectors expressing OTOF via a double hybrid vector system. Homozygous OTOF-Q828X mice were treated with AAV2quad(YF)-Myo15 (SEQ ID NO: 21)-mouse OTOF (mOTOF, transcription variant 1, RefSeq NM_001100395) and AAV2quad(YF)-Myo15 (SEQ ID NO: 31)-mOTOF (transcription variant 1, RefSeq NM_001100395) double hybrid vector systems by injection through the round window membrane. Hearing function was assessed using ABR thresholds. Untreated animals showed no detectable recovery of hearing function, whereas treated animals showed robust recovery, which was consistent from 4 weeks post-treatment to 17 weeks post-treatment (FIG. 4). Graph shows mean hearing thresholds at 22.6 kHz + / - standard deviation. [Diagram 5] A-C are a series of fluorescent images of the cochlea of ​​non-human primates, showing that the double hybrid vector can be used to express full-length functional GFP in hair cells. Non-human primates (NHPs) received local injections of the AAV1-Myo15(SEQ ID NO:21)-GFP (viral titers of 3.18E13vg / mL for the 5' vector and 3.42E13vg / mL for the 3' vector) double hybrid vector system at a flow rate of 6 μL / min into the round window of the inner ear. Four weeks after injection, the inner ear was removed and the basilar plate was surface treated. The double hybrid vector resulted in GFP expression in hair cells throughout the basal-apical axis of the cochlea. High magnification images at 4 kHz showed that GFP expression was observed within the inner hair cells (IHC) (Figure 5B). Immunohistochemistry for Myo7A was used to visualize hair cells (Figure 5A) and nuclei were stained with DAPI (Figure 5C). [Figure 6]1 is a series of images of sections including differential interference contrast images (top three panels) and corresponding BaseScope™ fluorescent staining specific to the exon 20 / exon 21 junction of human OTOF (bottom three panels) from various regions of NHP ears 4 weeks after treatment with the dual hybrid viral vector system described in Example 6 herein to express full-length OTOF. The fluorescent staining is specific to the full-length human OTOF transcript generated from the dual vector. "IHC" refers to inner hair cells. "OHC" refers to outer hair cells. "HC" refers to hair cells. The scale bar displayed in the bottom panel represents a scale of 10 μm. [Figure 7A] Figures 7A-B depict GFP expression in inner hair cells at various locations in the organ of Corti of NHPs treated with a dual vector system expressing eGFP under the control of the Myo15 promoter in either an AAV1 or AAV9 vector, as described in Example 6. Figure 7A shows a series of confocal images of inner hair cells at different frequency locations throughout the organ of Corti and the corresponding eGFP signal after AAV1 dual hybrid GFP transduction. [Figure 7B] FIG. 7B is a graph showing quantification of the number of eGFP-expressing inner hair cells in various regions of the organ of Corti. [Figure 8]Schematic diagram showing an exemplary dual vector system of the present invention. The 5' vector contains the Myol5 promoter from 5' to 3', the first 20 exons of the 5' half of the human otoferlin isoform 5 coding sequence, a splice donor site (SD), and a homology region from alkaline phosphatase (AP). The 3' vector contains a 5' to 3' copy of the AP homology region, a complementary splice acceptor site (SA), the remaining 3' portion of the human otoferlin isoform 5 coding sequence (exons 21-45 and 47), and a polyadenylation (polyA) signal. Both the 5' and 3' vectors contain flanking inverted terminal repeats (ITRs). These vectors are designed to reconstitute a functional human OTOF isoform 5 gene cassette when co-transduced into the same target cell, and vector recombination can occur in vivo via two recombination mechanisms. The ITRs spontaneously bind during synthesis and elongation of second-strand DNA, and identical AP sequences in each vector undergo homologous recombination to form a functional human OTOF isoform 5 cassette in both cases. The resulting double-stranded DNA can express RNA from the Myo15 promoter, and the SD / SA sites facilitate removal of the AP region and ITR sequences by splicing to generate a mature mRNA encoding the full-length human OTOF isoform 5 coding sequence. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0093] Described herein are compositions and methods for treating sensorineural hearing loss or auditory neuropathy in a subject (e.g., a mammalian subject, such as a human) by administering a first nucleic acid vector (e.g., an AAV vector) containing a promoter and a polynucleotide encoding an N-terminal portion of otoferlin (OTOF) isoform 5 protein (e.g., wild-type (WT) human OTOF isoform 5 protein) and a second nucleic acid vector (e.g., an AAV vector) containing a polynucleotide encoding a C-terminal portion of OTOF isoform 5 protein and a polyadenylation (poly(A)) sequence. When introduced into a mammalian cell, such as a cochlear hair cell, the polynucleotides encoded by the two nucleic acid vectors can combine to form a nucleic acid molecule encoding a full-length OTOF isoform 5 protein. Thus, the compositions and methods described herein can be used to induce or increase expression of WT OTOF isoform 5 in cochlear hair cells of a subject suffering from an OTOF deficiency (e.g., low OTOF expression, or an OTOF mutation that impairs OTOF expression or function).

[0094] Otoferin OTOF is a 230 kDa membrane protein that contains at least six C2 domains that are involved in calcium, phospholipid, and protein binding. Human OTOF is encoded by a gene containing 47 exons, and the full-length protein consists of 1,997 amino acids. OTOF is located at the ribbon synapse of inner hair cells and is thought to function as a calcium sensor for synaptic vesicle fusion, triggering the fusion of neurotransmitter-containing vesicles with the plasma membrane. It has also been implicated in vesicle recruitment and clathrin-mediated endocytosis, and has been shown to interact with myosin VI, Rab8b, SNARE proteins, calcium channels Cav1.3, Ergic2, and AP-2. The mechanism by which OTOF mediates exocytosis and the physiological significance of its interactions with binding partners remain to be elucidated.

[0095] The otoferlin gene has multiple long and short isoforms. Studies of human hereditary hearing loss suggest that the long isoform is important for inner ear function. However, the role of these individual long isoforms and other protein variants in inner ear function is not understood. To develop effective transgenic therapy for patients with hearing loss secondary to genetically induced otoferlin deficiency, cDNA sequences encoding functional OTOF isoforms in the ear must be identified.

[0096] The present invention is based, in part, on the discovery that OTOF isoform 5 is preferentially expressed in the inner ear of non-human primates, and that human OTOF isoform 5, but not human OTOF isoform 1, was able to restore hearing in otoferlin-deficient, genetically engineered, congenital deaf mice. Thus, the dual vector system described herein (e.g., a dual vector system for expression of OTOF isoform 5) can be used to treat sensorineural hearing loss or auditory neuropathy in human subjects having a defect (e.g., a mutation) in the OTOF gene.

[0097] Otoferlin-related hearing loss OTOF was first identified by a study investigating the genetics of autosomal recessive deafness 9 (DFNB9), a form of nonsyndromic hearing loss. Mutations in OTOF have since been found to cause sensorineural hearing loss in patients worldwide. Many patients with OTOF mutations suffer from auditory neuropathy, a disorder in which the inner ear detects sound but fails to properly transmit sound from the ear to the brain. These patients suffer from abnormal auditory brainstem responses (ABRs) and speech discrimination with initially normal otoacoustic emissions. Patients with homozygous or compound heterozygous mutations often develop hearing loss during early childhood, and the severity of hearing impairment has been found to vary depending on the location and type of OTOF mutation.

[0098] The compositions and methods described herein can be used to treat sensorineural hearing loss or auditory neuropathy by administering a first nucleic acid vector containing a polynucleotide encoding the N-terminal portion of OTOF isoform 5 protein and a second nucleic acid vector containing a polynucleotide encoding the C-terminal portion of OTOF isoform 5 protein. The full-length OTOF isoform 5 coding sequence is too large to be included in the types of vectors commonly used in gene therapy (e.g., adeno-associated virus (AAV) vectors, which are believed to have a packaging limit of 5 kb). The compositions and methods described herein overcome this problem by splitting the OTOF isoform 5 coding sequence between two different nucleic acid vectors (e.g., AAV vectors) that can combine in cells to reconstitute the full-length OTOF isoform 5 sequence. These compositions and methods can be used to treat subjects with one or more mutations in the OTOF gene, such as OTOF mutations that reduce OTOF expression, reduce OTOF function, or are associated with hearing loss (e.g., frameshift mutations, nonsense mutations, deletions, or missense substitutions). When the first nucleic acid vector and the second nucleic acid vector are administered in a composition, the polynucleotides encoding the N-terminal and C-terminal portions of OTOF isoform 5 combine within a cell (e.g., a human cell, e.g., a cochlear hair cell) to form a single nucleic acid molecule containing the full-length OTOF isoform 5 coding sequence (e.g., via homologous recombination and / or splicing).

[0099] Nucleic acid vectors (e.g., AAV vectors) used in the compositions and methods described herein include polynucleotide sequences encoding wild-type OTOF isoform 5 or variants thereof, such as polynucleotide sequences that, when combined, encode a protein having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to the amino acid sequence of wild-type mammalian (e.g., human or mouse) OTOF isoform 5. Polynucleotides used in the nucleic acid vectors described herein can encode the N-terminal and C-terminal portions of the OTOF isoform 5 amino acid sequence in Table 2 below (e.g., two portions that, when combined, encode the full-length OTOF isoform 5 amino acid sequence set forth in Table 2, e.g., SEQ ID NO:1).

[0100] According to the methods described herein, a subject is provided with a polynucleotide sequence encoding the amino acid sequence of SEQ ID NO:1, or an amino acid sequence having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to the amino acid sequence of SEQ ID NO:1, or one or more conservative amino acid substitutions (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more conservative amino acid substitutions) to SEQ ID NO:1. A composition comprising a first nucleic acid vector and a second nucleic acid vector, each comprising an N-terminal portion and a C-terminal portion of a polynucleotide sequence encoding an amino acid sequence containing a conservative amino acid substitution (amino acid substitution), can be administered, provided that the encoded OTOF analog retains the therapeutic function of wild-type OTOF isoform 5 (e.g., the ability to regulate ribbon synapse exocytosis or rescue or improve ABR response in an animal model of hearing loss associated with otoferlin gene deficiency (e.g., OTOF mutation). Up to 10% of the amino acids in the N-terminal portion of human OTOF isoform 5 protein and up to 10% of the amino acids in the C-terminal portion of human OTOF isoform 5 protein can be replaced with conservative amino acid substitutions. OTOF isoform 5 protein can be encoded by a polynucleotide having the sequence of SEQ ID NO:2 or SEQ ID NO:3. OTOF isoform 5 protein can also be encoded by a polynucleotide having a single nucleotide variant (SNV) that is known to be non-pathogenic in human subjects. The OTOF isoform 5 protein may be a human OTOF isoform 5 protein or may be a homologue of the human isoform 5 protein from another mammalian species (e.g., mouse, rat, cow, horse, goat, sheep, donkey, cat, dog, rabbit, guinea pig, or other mammal).

[0101] [Table 2-1]

[0102]

Table 2-2

[0103]

Table 2-3

[0104]

Table 2-4

[0105]

Table 2-5

[0106]

Table 2-6

[0107]

Table 2-7

[0108]

Table 2-8

[0109]

Table 2-9

[0110]

Table 2-10

[0111]

Table 2-11

[0112]

Table 2-12

[0113]

Table 2-13

[0114]

Table 2-14

[0115]

Table 2-15

[0116]

Table 2-16

[0117]

Table 2-17

[0118]

Table 2-18

[0119]

Table 2-19

[0120]

Table 2-20

[0121]

Table 2-21

[0122]

Table 2-22

[0123] [Table 2-23]

[0124] [Table 2-24]

[0125] [Table 2-25]

[0126] [Table 2-26]

[0127] [Table 2-27]

[0128] [Table 2-28]

[0129] Expression of OTOF in mammalian cells Mutations in OTOF are associated with sensorineural hearing loss and auditory neuropathy. The compositions and methods described herein increase the expression of WT OTOF isoform 5 protein by administering a first nucleic acid vector containing a polynucleotide encoding the N-terminal portion of OTOF isoform 5 protein and a second nucleic acid vector containing a polynucleotide encoding the C-terminal portion of OTOF isoform 5 protein. To utilize nucleic acid vectors for therapeutic use in the treatment of sensorineural hearing loss and auditory neuropathy, they can be directed to the interior of cells, particularly to specific cell types. A wide range of methods have been established for delivering proteins to mammalian cells and for stably expressing genes encoding proteins in mammalian cells.

[0130] Polynucleotide encoding OTOF One platform that can be used to reach therapeutically effective intracellular concentrations of OTOF isoform 5 in mammalian cells is by stably expressing a gene encoding OTOF isoform 5 (e.g., by integration into the nuclear or mitochondrial genome of mammalian cells, or by episomal concatemer formation in the nucleus of mammalian cells). A gene is a polynucleotide that encodes the primary amino acid sequence of a corresponding protein. To introduce an exogenous gene into a mammalian cell, the gene can be incorporated into a vector. The vector can be introduced into the cell by a variety of methods, including transformation, transfection, transduction, direct uptake, particle bombardment, and encapsulation of the vector in liposomes. Examples of suitable methods for transfecting or transforming cells include calcium phosphate precipitation, electroporation, microinjection, infection, lipofection, and direct uptake. Such methods are described in further detail in, for example, Green, et al., Molecular Cloning: A Laboratory Manual, Fourth Edition (Cold Spring Harbor University Press, New York 2014), and Ausubel, et al., Current Protocols in Molecular Biology (John Wiley & Sons, New York 2015), the disclosures of each of which are incorporated herein by reference.

[0131] OTOF isoform 5 can also be introduced into mammalian cells by targeting a vector containing a part of the gene encoding OTOF isoform 5 protein to cell membrane phospholipids. For example, the vector can be targeted to phospholipids on the extracellular surface of the cell membrane by binding the vector molecule to the VSV-G protein, a viral protein that has affinity for all cell membrane phospholipids. Such constructs can be generated using methods well known to those skilled in the art.

[0132] It is important for gene expression that the polynucleotide encoding OTOF isoform 5 protein is recognized and bound by mammalian RNA polymerase.Therefore, the polynucleotide may contain sequence elements that show high affinity for the transcription factors that recruit RNA polymerase and promote the assembly of transcription complex at the transcription start site.Such sequence elements include, for example, mammalian promoters, whose sequence can be recognized and bound by specific transcription start factors and ultimately RNA polymerase.

[0133] Polynucleotides suitable for use in the compositions and methods described herein also include those encoding OTOF proteins downstream of a mammalian promoter (e.g., polynucleotides encoding the N-terminal portion of OTOF isoform 5 protein downstream of a mammalian promoter). Promoters useful for expressing OTOF proteins in mammalian cells include ubiquitous promoters and cochlear hair cell specific promoters. Ubiquitous promoters include the CAG promoter, the cytomegalovirus (CMV) promoter, and a truncated version of the chimeric CMV-chicken β-actin promoter (CBA), in which a hybrid chicken β-actin / rabbit β-globin intron is significantly shortened to generate a small version of the promoter called smCBA. Cochlear hair cell specific promoters include the myosin 15 (Myo15) promoter. Myo15 promoter sequences for use in the methods and compositions described herein are listed below and in Table 3. However, promoters derived from viral genomes can also be used to stably express these agents in mammalian cells. Examples of functional viral promoters that can be used to drive mammalian expression of these agents include the adenovirus late promoter, the vaccinia virus 7.5K promoter, the SV40 promoter, the HSV tk promoter, the mouse mammary tumor virus (MMTV) promoter, the HIV LTR promoter, the Moloney virus promoter, the Epstein-Barr virus (EBV) promoter, and the Ruth sarcoma virus (RSV) promoter.

[0134] Mouse myosin 15 promoter In some embodiments, the Myo15 promoter for use in the compositions and methods described herein comprises a polynucleotide sequence from a region of the mouse Myo15 locus capable of specifically expressing a transgene in hair cells, such as a polynucleotide sequence having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to a region of the mouse Myo15 locus capable of specifically expressing a transgene in hair cells, or a variant thereof. These regions include the polynucleotide sequence immediately preceding the mouse Myo15 translation start site and upstream regulatory elements located 5 kb or more away from the mouse Myo15 translation start site. The mouse Myo15 promoter for use in the compositions and methods described herein may optionally comprise a linker operably linking the regions of the mouse Myo15 locus capable of specifically expressing a transgene in hair cells, or the regions of the mouse Myo15 locus may be directly linked without an intervening linker.

[0135] In some embodiments, the mouse Myo15 promoter for use in the compositions and methods described herein has at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to a region that includes the first non-coding exon of the mouse Myo15 gene (the nucleic acid from -6755 to -7209 relative to the mouse Myo15 translation start site, the sequence of which is set forth in SEQ ID NO:7), or a functional portion or derivative thereof. The polynucleotide sequence of SEQ ID NO:7 includes a first region (an upstream regulatory element) that is linked to a polynucleotide sequence immediately preceding the mouse Myo15 translation start site (a nucleic acid sequence from -1 to -1157 relative to the mouse Myo15 translation start site, the sequence of which is set forth in SEQ ID NO:8), or a functional portion or derivative thereof, and associated therewith (e.g., operably linked thereto) a second region that has at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity). The functional portion of SEQ ID NO:7 may have the nucleic acid sequence from -7166 to -7091 relative to the mouse Myo15 translation start site (set forth in SEQ ID NO:9) and / or the nucleic acid sequence from -7077 to -6983 relative to the mouse Myo15 translation start site (set forth in SEQ ID NO:10). The first region may comprise the polynucleotide sequence of SEQ ID NO: 9 fused to the polynucleotide sequence of SEQ ID NO: 10 without the intervening nucleic acid set forth in SEQ ID NO: 11, or the first region may comprise the polynucleotide sequence of SEQ ID NO: 10 fused to the polynucleotide sequence of SEQ ID NO: 9 without the intervening nucleic acid set forth in SEQ ID NO: 12. Alternatively, the first region may comprise the sequences of SEQ ID NO: 9 and SEQ ID NO: 10 linked by an endogenous intervening polynucleotide sequence (e.g., the first region may have or include a nucleic acid sequence from -7166 to -6983 relative to the mouse Myo15 translation start site, as set forth in SEQ ID NO: 13 and SEQ ID NO: 33) or a nucleic acid linker. In a mouse Myo15 promoter in which the first region comprises both SEQ ID NO: 9 and SEQ ID NO: 10, the two sequences may be included in any order (e.g., SEQ ID NO: 9 may be linked to (e.g., preceded by) SEQ ID NO: 10, or SEQ ID NO: 10 may be linked to (e.g., preceded by) SEQ ID NO: 9).The functional portion of SEQ ID NO:8 can have a nucleic acid sequence from -590 to -509 relative to the mouse Myo15 translation start site (as set forth in SEQ ID NO:14) and / or a nucleic acid sequence from -266 to -161 relative to the mouse Myo15 translation start site (as set forth in SEQ ID NO:15). In some embodiments, the sequence comprising SEQ ID NO:14 has a sequence of SEQ ID NO:34. In some embodiments, the sequence comprising SEQ ID NO:15 has a sequence of SEQ ID NO:35. The second region can comprise the polynucleotide sequence of SEQ ID NO:14 fused to the polynucleotide sequence of SEQ ID NO:15 without an intervening nucleic acid as set forth in SEQ ID NO:16, or the second region can comprise the polynucleotide sequence of SEQ ID NO:15 fused to the polynucleotide sequence of SEQ ID NO:14 without an intervening nucleic acid as set forth in SEQ ID NO:17. The second region can comprise the nucleic acid sequence of SEQ ID NO:34 fused to the nucleic acid sequence of SEQ ID NO:35 without an intervening nucleic acid as set forth in SEQ ID NO:38, or the second region can comprise the nucleic acid sequence of SEQ ID NO:35 fused to the nucleic acid sequence of SEQ ID NO:34 without an intervening nucleic acid. Alternatively, the second region can include the sequences of SEQ ID NO:14 and SEQ ID NO:15, joined by an endogenous intervening polynucleotide sequence (e.g., the second region can have a nucleic acid sequence from -590 to -161 relative to the mouse Myo15 translation start site, as set forth in SEQ ID NO:18) or a nucleic acid linker. In a mouse Myo15 promoter in which the second region includes both SEQ ID NO:14 and SEQ ID NO:15, the two sequences can be included in any order (e.g., SEQ ID NO:14 can be linked to (e.g., preceding) SEQ ID NO:15, or SEQ ID NO:15 can be linked to (e.g., preceding) SEQ ID NO:14).

[0136] The first and second regions of the mouse Myo15 promoter can be linked directly or by a nucleic acid linker. For example, the mouse Myo15 promoter can comprise the sequence of SEQ ID NO:7 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs:9-13 and 33, e.g., SEQ ID NOs:9 and 10) fused to the sequence of SEQ ID NO:8 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs:14-18, 34, 35 and 38, e.g., SEQ ID NOs:14 and 15) without an intervening nucleic acid. For example, the polynucleotide sequence of the mouse Myo15 promoter resulting from the direct fusion of SEQ ID NO:7 to SEQ ID NO:8 is shown in SEQ ID NO:19. Alternatively, a linker can be used to link the sequence of SEQ ID NO:7 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs:9-13 and 33, e.g., SEQ ID NOs:9 and 10) to the sequence of SEQ ID NO:8 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs:14-18, 34, 35 and 38, e.g., SEQ ID NOs:14 and 15). Exemplary Myo15 promoters containing functional portions of both SEQ ID NO:7 and SEQ ID NO:8 are provided in SEQ ID NOs:21, 22, 36, 37, 42, and 43.

[0137] The length of the nucleic acid linker for use with the mouse Myo15 promoter described herein can be about 5 kb or less (e.g., about 5 kb, 4.5 kb, 4 kb, 3.5 kb, 3 kb, 2.5 kb, 2 kb, 1.5 kb, 1 kb, 900 bp, 800 bp, 700 bp, 600 bp, 500 bp, 450 bp, 400 bp, 350 bp, 300 bp, 250 bp, 200 bp, 150 bp, 100 bp, 90 bp, 80 bp, 70 bp, 60 bp, 50 bp, 40 bp, 30 bp, 25 bp, 20 bp, 15 bp, 10 bp, 5 bp, 4 bp, 3 bp, 2 bp, or less). The nucleic acid linker that can be used with the mouse Myo15 promoter described herein does not interfere with the ability of the mouse Myo15 promoter of the present invention to induce expression of a transgene in hair cells.

[0138] In some embodiments, the sequence of SEQ ID NO:7 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs:9-13 and 33, e.g., SEQ ID NOs:9 and 10) is joined (e.g., operably linked) to the sequence of SEQ ID NO:8 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs:14-18, 34, 35 and 38, e.g., SEQ ID NOs:14 and 15), and in some embodiments, the order of the regions is reversed (e.g., the sequence of SEQ ID NO:8 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs:14-18, 34, 35 and 38, e.g., SEQ ID NOs:14 and 15) is joined (e.g., operably linked) to the sequence of SEQ ID NO:7 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs:9-13 and 33, e.g., SEQ ID NOs:9 and 10). For example, the polynucleotide sequence of the mouse Myo15 promoter resulting from the direct fusion of SEQ ID NO:8 to SEQ ID NO:7 is shown in SEQ ID NO:20. An example of a mouse Myo15 promoter, in which a functional portion or derivative of SEQ ID NO:8 precedes a functional portion or derivative of SEQ ID NO:7, is provided in SEQ ID NO: 41. Regardless of order, the sequence of SEQ ID NO:7 or a functional portion or derivative thereof and the sequence of SEQ ID NO:8 or a functional portion or derivative thereof can be linked by direct fusion or by a nucleic acid linker, as described above.

[0139] In some embodiments, a mouse Myo15 promoter for use in the compositions and methods described herein comprises a region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to a region comprising the first non-coding exon of the mouse Myo15 gene (nucleic acid sequence −6755 to −7209 relative to the mouse Myo15 translation start site, the sequence of which is set forth in SEQ ID NO: 7), or a functional portion or derivative thereof. The functional portion of SEQ ID NO: 7 can have the nucleic acid sequence −7166 to −7091 relative to the mouse Myo15 translation start site (set forth in SEQ ID NO: 9) and / or the nucleic acid sequence −7077 to −6983 relative to the mouse Myo15 translation start site (set forth in SEQ ID NO: 10). The mouse Myo15 promoter may comprise the polynucleotide sequence of SEQ ID NO: 9 fused to the polynucleotide sequence of SEQ ID NO: 10 without the intervening nucleic acid set forth in SEQ ID NO: 11, or the mouse Myo15 promoter may comprise the polynucleotide sequence of SEQ ID NO: 10 fused to the polynucleotide sequence of SEQ ID NO: 9 without the intervening nucleic acid set forth in SEQ ID NO: 12. Alternatively, the mouse Myo15 promoter may comprise the sequences of SEQ ID NO: 9 and SEQ ID NO: 10 linked by an endogenous intervening polynucleotide sequence (e.g., the first region may have or include a nucleic acid sequence from -7166 to -6983 relative to the mouse Myo15 translation start site, as set forth in SEQ ID NO: 13 and SEQ ID NO: 33) or a polynucleotide linker. In a mouse Myo15 promoter that includes both SEQ ID NO: 9 and SEQ ID NO: 10, the two sequences may be included in any order (e.g., SEQ ID NO: 9 may be linked to (e.g., preceded by) SEQ ID NO: 10, or SEQ ID NO: 10 may be linked to (e.g., preceded by) SEQ ID NO: 9).

[0140] In some embodiments, a mouse Myo15 promoter for use in the compositions and methods described herein comprises a region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to a polynucleotide sequence immediately upstream of the mouse Myo15 translation start site (nucleic acids 1 to 1157 relative to the mouse Myo15 translation start site, the sequence of which is set forth in SEQ ID NO:8), or a functional portion or derivative thereof. A functional portion of SEQ ID NO:8 can have a nucleic acid sequence of -590 to -509 relative to the mouse Myo15 translation start site (set forth in SEQ ID NO:14) and / or a nucleic acid sequence of -266 to -161 relative to the mouse Myo15 translation start site (set forth in SEQ ID NO:15). In some embodiments, the sequence comprising SEQ ID NO:14 has a sequence of SEQ ID NO:34. In some embodiments, the sequence comprising SEQ ID NO:15 has a sequence of SEQ ID NO:35. The mouse Myo15 promoter can comprise the polynucleotide sequence of SEQ ID NO: 14 fused to the polynucleotide sequence of SEQ ID NO: 15 without an intervening nucleic acid as set forth in SEQ ID NO: 16, or the mouse Myo15 promoter can comprise the polynucleotide sequence of SEQ ID NO: 15 fused to the polynucleotide sequence of SEQ ID NO: 14 without an intervening nucleic acid as set forth in SEQ ID NO: 17. The mouse Myo15 promoter can comprise the nucleic acid sequence of SEQ ID NO: 34 fused to the nucleic acid sequence of SEQ ID NO: 35 without an intervening nucleic acid as set forth in SEQ ID NO: 38, or the mouse Myo15 promoter can comprise the nucleic acid sequence of SEQ ID NO: 35 fused to the nucleic acid sequence of SEQ ID NO: 41 without an intervening nucleic acid. Alternatively, the mouse Myo15 promoter can comprise the sequences of SEQ ID NO: 14 and SEQ ID NO: 15 linked by an endogenous intervening polynucleotide sequence (e.g., the second region can have a nucleic acid sequence from -590 to -161 relative to the mouse Myo15 translation start site as set forth in SEQ ID NO: 18) or a nucleic acid linker. In a mouse Myo15 promoter that contains both SEQ ID NO:14 and SEQ ID NO:15, the two sequences can be included in any order (e.g., SEQ ID NO:14 can be linked to (e.g., preceding) SEQ ID NO:15, or SEQ ID NO:15 can be linked to (e.g., preceding) SEQ ID NO:14).

[0141] In some embodiments, a mouse Myo15 promoter for use in the compositions and methods described herein comprises a functional portion or derivative of a region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to a region comprising the first non-coding exon of the Myo15 gene (nucleic acids -6755 to -7209 relative to the mouse Myo15 translation start site, the sequence of which is set forth in SEQ ID NO:7) flanked on either side by functional portions or derivatives of a region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to the nucleic acid sequence immediately upstream of the mouse Myo15 translation start site (nucleic acids -1 to -1157 relative to the mouse Myo15 translation start site, the sequence of which is set forth in SEQ ID NO:8). For example, a functional portion or derivative of SEQ ID NO:8, such as SEQ ID NO:14 or 34, may be fused or attached by a nucleic acid linker directly to a portion of SEQ ID NO:7, such as any one of SEQ ID NOs:9-13 and 33, which is fused or attached by a nucleic acid linker directly to a different functional portion of SEQ ID NO:8, such as SEQ ID NO:15 or 35. In other embodiments, a functional portion or derivative of SEQ ID NO:8, such as SEQ ID NO:15 or 35, may be fused or attached by a nucleic acid linker directly to a portion of SEQ ID NO:7, such as any one of SEQ ID NOs:9-13 and 33, which is fused or attached by a nucleic acid linker directly to a different functional portion of SEQ ID NO:8, such as SEQ ID NO:14 or 34. For example, polynucleotides having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to the nucleic acid sequences of SEQ ID NOs: 34, 33, and 35 can be fused to generate a polynucleotide having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to the nucleic acid sequence of SEQ ID NO: 39.In some embodiments, polynucleotides having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to the nucleic acid sequences of SEQ ID NOs: 35, 33, and 34 can be fused to generate a polynucleotide having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to the nucleic acid sequence of SEQ ID NO: 40.

[0142] Human myosin 15 promoter The polynucleotides of the compositions and methods described herein can also include a nucleic acid sequence derived from a region of the human Myo15 locus capable of expressing a transgene specifically in hair cells, or a variant thereof, such as a nucleic acid sequence having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to a region of the human Myo15 locus capable of expressing a transgene specifically in hair cells. The polynucleotides of the compositions and methods described herein can optionally include a linker that operably links the regions of the human Myo15 locus capable of expressing a transgene specifically in hair cells, or the regions of the human Myo15 locus can be directly linked without an intervening linker.

[0143] In some embodiments, the human Myol5 promoter used in the methods and compositions described herein comprises a first region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to the sequence set forth in SEQ ID NO:23, or a functional portion or derivative thereof, and associated (e.g., operably linked) thereto a second region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to the sequence set forth in SEQ ID NO:24, or a functional portion or derivative thereof. The functional portion of SEQ ID NO:23 can have the sequence set forth in SEQ ID NO:25. The functional portion of SEQ ID NO:24 can have the sequence set forth in SEQ ID NO:26 and / or the sequence set forth in SEQ ID NO:27. The second region may comprise the nucleic acid sequence of SEQ ID NO:26 fused to the nucleic acid sequence of SEQ ID NO:27 without the intervening nucleic acid as set forth in SEQ ID NO:28, or the second region may comprise the nucleic acid sequence of SEQ ID NO:27 fused to the nucleic acid sequence of SEQ ID NO:26 without the intervening nucleic acid as set forth in SEQ ID NO:29. Alternatively, the second region may comprise the sequences of SEQ ID NO:26 and SEQ ID NO:27 joined by an endogenous intervening nucleic acid sequence (as set forth in SEQ ID NO:30) or a nucleic acid linker. In a human Myol5 promoter in which the second region comprises both SEQ ID NO:26 and SEQ ID NO:27, the two sequences may be included in any order (e.g., SEQ ID NO:26 may be linked to (e.g., preceded by) SEQ ID NO:27, or SEQ ID NO:27 may be linked to (e.g., preceded by) SEQ ID NO:26).

[0144] The first and second regions of the human Myo15 promoter can be directly linked or linked by a nucleic acid linker. For example, the human Myo15 promoter can include the sequence of SEQ ID NO:23 or a functional portion or derivative thereof (e.g., SEQ ID NO:25) fused to the sequence of SEQ ID NO:24 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs:26-30, e.g., SEQ ID NO:26 and / or 27) without an intervening nucleic acid. Alternatively, a linker can be used to link the sequence of SEQ ID NO:23 or a functional portion or derivative thereof (e.g., SEQ ID NO:25) to the sequence of SEQ ID NO:24 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs:26-30, e.g., SEQ ID NO:26 and / or 27). Exemplary human Myo15 promoters including functional portions of both SEQ ID NO:23 and SEQ ID NO:24 are provided in SEQ ID NOs:31 and 32.

[0145] In some embodiments, the sequence of SEQ ID NO:23 or a functional portion or derivative thereof (e.g., SEQ ID NO:25) is joined (e.g., operably linked) to the sequence of SEQ ID NO:24 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs:26-30, e.g., SEQ ID NOs:26 and 27), and in some embodiments, the order of the regions is reversed (e.g., the sequence of SEQ ID NO:24 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs:26-30, e.g., SEQ ID NOs:26 and / or 27) is joined (e.g., operably linked) to the sequence of SEQ ID NO:23 or a functional portion or derivative thereof (e.g., SEQ ID NO:25)). Regardless of the order, the sequence of SEQ ID NO:23 or a functional portion or derivative thereof and the sequence of SEQ ID NO:24 or a functional portion or derivative thereof can be joined by direct fusion or by a nucleic acid linker, as described above.

[0146] In some embodiments, a human Myo15 promoter for use in the compositions and methods described herein comprises a region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to a region comprising the sequence set forth in SEQ ID NO:23, or a functional portion or derivative thereof. The functional portion of SEQ ID NO:23 can have the sequence of a nucleic acid set forth in SEQ ID NO:25.

[0147] In some embodiments, the human Myo15 promoter for use in the compositions and methods described herein comprises a region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to the sequence set forth in SEQ ID NO: 18 or a functional portion or derivative thereof. The functional portion of SEQ ID NO: 24 may have the sequence set forth in SEQ ID NO: 26 and / or the sequence set forth in SEQ ID NO: 27. The human Myo15 promoter may comprise the nucleic acid sequence of SEQ ID NO: 26 fused to the nucleic acid sequence of SEQ ID NO: 27 without the intervening nucleic acid set forth in SEQ ID NO: 28, or the human Myo15 promoter may comprise the nucleic acid sequence of SEQ ID NO: 27 fused to the nucleic acid sequence of SEQ ID NO: 26 without the intervening nucleic acid set forth in SEQ ID NO: 29. Alternatively, the human Myo15 promoter may comprise the sequences of SEQ ID NO: 26 and SEQ ID NO: 27 linked by an endogenous intervening nucleic acid sequence (e.g., as set forth in SEQ ID NO: 30) or a nucleic acid linker. In a human Myo15 promoter that includes both SEQ ID NO:26 and SEQ ID NO:27, the two sequences can be included in any order (e.g., SEQ ID NO:26 can be linked to (e.g., preceding) SEQ ID NO:27, or SEQ ID NO:27 can be linked to (e.g., preceding) SEQ ID NO:26).

[0148] The length of the nucleic acid linker for use with the human Myo15 promoter described herein can be about 5 kb or less (e.g., about 5 kb, 4.5 kb, 4 kb, 3.5 kb, 3 kb, 2.5 kb, 2 kb, 1.5 kb, 1 kb, 900 bp, 800 bp, 700 bp, 600 bp, 500 bp, 450 bp, 400 bp, 350 bp, 300 bp, 250 bp, 200 bp, 150 bp, 100 bp, 90 bp, 80 bp, 70 bp, 60 bp, 50 bp, 40 bp, 30 bp, 25 bp, 20 bp, 15 bp, 10 bp, 5 bp, 4 bp, 3 bp, 2 bp, or less). The nucleic acid linker that can be used with the human Myo15 promoter described herein does not interfere with the ability of the Myo15 promoter of the present invention to direct expression of a transgene in hair cells.

[0149] The aforementioned Myo15 promoters are summarized in Table 3 below.

[0150] [Table 3-1]

[0151] [Table 3-2]

[0152] [Table 3-3]

[0153] [Table 3-4]

[0154] [Table 3-5]

[0155] [Table 3-6]

[0156]

Table 3-7

[0157]

Table 3-8

[0158]

Table 3-9

[0159]

Table 3-10

[0160]

Table 3-11

[0161]

Table 3-12

[0162]

Table 3-13

[0163]

Table 3-14

[0164]

Table 3-15

[0165]

Table 3-16

[0166] [Table 3-17]

[0167] [Table 3-18]

[0168] [Table 3-19]

[0169] [Table 3-20]

[0170] Additional Myo15 promoters useful in combination with the compositions and methods described herein include nucleic acid molecules having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to the polynucleotide sequences set forth in Table 3 and functional portions or derivatives of the polynucleotide sequences set forth in Table 3. The Myo15 promoters set forth in Table 3 are characterized in International Patent Application Publication Nos. WO2019210181A1 and WO2020163761A1, which are incorporated herein by reference.

[0171] In embodiments in which the smCBA promoter is included in a dual vector system described herein (e.g., in the first vector of the dual vector system), the smCBA promoter can have the sequence of the smCBA promoter described in U.S. Patent No. 8,298,818, which is incorporated herein by reference. In some embodiments, the smCBA promoter has the following sequence:

[0172] GGTACCTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGCGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCGCTTGGTTTAATGACGGCTTGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTGAGGGGCTCCGGGAGCTAGAGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTATTGTGCTGTCTCATCATTTTGGCA (SEQ ID NO: 44).

[0173] Once a polynucleotide encoding an OTOF has been incorporated into the nuclear DNA of a mammalian cell or stabilized in an episomal monomer or concatemer, transcription of the polynucleotide can be induced by methods known in the art. For example, expression can be induced by exposing the mammalian cell to an external chemical reagent, such as an agent that modulates the binding of transcription factors and / or RNA polymerase to the mammalian promoter, thus regulating gene expression. The chemical reagent can function to promote the binding of RNA polymerase and / or transcription factors to the mammalian promoter, for example, by removing a repressor protein bound to the promoter. Alternatively, the chemical reagent can function to increase the affinity of the mammalian promoter for RNA polymerase and / or transcription factors, thereby increasing the transcription rate of genes located downstream of the promoter in the presence of the chemical reagent. Examples of chemical reagents that enhance polynucleotide transcription by the above mechanisms include tetracycline and doxycycline. These reagents are commercially available (Life Technologies, Carlsbad, CA) and can be administered to mammalian cells to promote gene expression according to established protocols.

[0174] Other DNA sequence elements that may be included in nucleic acid vectors for use in the compositions and methods described herein include enhancer sequences. Enhancers represent another class of regulatory elements that induce conformational changes in polynucleotides, including genes of interest, such that the DNA adopts a three-dimensional orientation that favors the binding of transcription factors and RNA polymerase at the transcription start site. Thus, polynucleotides for use in the compositions and methods described herein include polynucleotides encoding OTOF, and further include mammalian enhancer sequences. Many enhancer sequences are now known from mammalian genes, including, for example, enhancers from genes encoding mammalian globin, elastase, albumin, alpha-fetoprotein, and insulin. Enhancers for use in the compositions and methods described herein also include enhancers derived from the genetic material of viruses capable of infecting eukaryotic cells. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers. Additional enhancer sequences that induce activation of eukaryotic gene transcription are disclosed in Yaniv, et al., Nature 297:17 (1982). The enhancer may be spliced ​​into the vector containing the polynucleotide encoding the OTOF protein, for example, at the 5' or 3' position of the gene. In a preferred orientation, the enhancer is placed 5' to the promoter, which is then placed 5' to the polynucleotide encoding the OTOF protein.

[0175] The nucleic acid vectors described herein may include a Woodchuck Post-Transcriptional Regulatory Element (WPRE). The WPRE acts at the mRNA level and increases the total amount of mRNA in the cell by facilitating nuclear export of the transcript and / or by increasing the efficiency of polyadenylation of the nascent transcript. The addition of the WPRE to the vector can result in substantial improvement in the level of transgene expression from several different promoters, both in vitro and in vivo. The WPRE can be located in the second nucleic acid vector between the polynucleotide encoding the C-terminal portion of the OTOF protein and the poly(A) sequence. In some embodiments of the compositions and methods described herein, the WPRE has the following sequence:

[0176] (Sequence number 45).

[0177] In another embodiment, the WPRE has the sequence: AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTCTCCTGTGTATAAATCCTGGTTAGTTCTTGCCACGGCGGAACTCATCGCCGCCTGCTTGCCGCTGCTGGACAGGGGCTCGCTGTGGGCACTGACAATTCCGTGGTGTTATTTGTGGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTCAACGCTTTATTTGTGTAAATTTGTGTAAGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAAAATTGCATTCATTTTATGTTTCAGGTTCAGGGGAGAGTGTGGGAGGTTTTTTTAAA (SEQ ID NO: 46).

[0178] In some embodiments, the nucleic acid vectors for use in the compositions and methods described herein contain a reporter sequence, which may be useful, for example, to verify the expression of the OTOF gene in specific cells and tissues (e.g., cochlear hair cells). Reporter sequences that may be provided in a transgene include DNA sequences encoding β-lactamase, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), luciferase, and other reporters known in the art. When associated with regulatory elements that drive their expression, reporter sequences provide a signal that can be detected by conventional means, including enzyme assays, radioassays, colorimetric assays, fluorescent assays or other spectroscopic assays, fluorescence-activated cell sorting assays, and immunological assays, including enzyme-linked immunosorbent assays (ELISAs), radioimmunoassays (RIAs), and immunohistochemistry. For example, if the marker sequence is a LacZ gene, the presence of a vector incorporating the signal is detected by assaying β-galactosidase activity. Where the transgene is green fluorescent protein or luciferase, vectors that have incorporated a signal may be measured visually by color or light production in a luminometer.

[0179] Double hybrid vector for expressing OTOF OTOF isoform 5 protein (e.g., OTOF isoform 5 protein having the sequence of SEQ ID NO:1) can be expressed in mammalian cells using a double hybrid vector system. In this method, two nucleic acid vectors (e.g., two adeno-associated virus vectors) are used to express a single large protein. Each of the two nucleic acid vectors (e.g., two adeno-associated virus vectors) contains a portion of the polynucleotide encoding the protein (e.g., one vector contains a polynucleotide encoding the N-terminal portion of the protein, and the other vector contains a polynucleotide encoding the C-terminal portion of the protein, and the polynucleotide encoding the N-terminal portion of the protein and the polynucleotide encoding the C-terminal portion of the protein do not overlap). The double hybrid vectors are also characterized by overlapping regions where homologous recombination can occur (e.g., recombination regions contained within each vector), as well as splice donor and splice acceptor sequences (e.g., the first vector contains a splice donor sequence and the second vector contains a splice acceptor sequence). The recombination region is 3' of the splice donor sequence of the first nucleic acid vector and 5' of the splice acceptor sequence of the second nucleic acid vector. The first polynucleotide sequence and the second polynucleotide sequence can then combine to form a single sequence based on one of two mechanisms: 1) recombination at the overlapping region, or 2) concatemerization of the ITRs. The remaining recombinogenic region(s) and / or the concatemerized ITRs can be removed by splicing, resulting in the formation of a contiguous polynucleotide sequence encoding the full-length protein of interest.

[0180] Recombination regions that can be used in the compositions and methods described herein include the F1 phage AK gene having the following sequence: GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAAT (SEQ ID NO:47), and the alkaline phosphatase (AP) gene fragment described in U.S. Patent No. 8,236,557, which is incorporated herein by reference. In some embodiments, the AP gene fragment has the following sequence:

[0181] CCCCGGGTGCGCGGCGTCGGTGGTGCCGGCGGGGGGCGCCAGGTCGCAGGCGGTGTAGGGCTCCAGGCAGGCGGCGAAGGCCATGACGTGCGCTATGAAGGTCTGCTCCTGCACGCCGTGAACCAGGTGCGCCTGCGGGCCGCGCGCGAACACCGCCACGTCCTCGCCTGCGTGGGTCTCTTCGTCCAGGGGCACTGCTGACTGCTGCCGATACTCGGGGCTCCCGCTCTCGCTCTCGGTAACATCCGGCCGGGCGCCGTCCTTGAGCACATAGCCTGGACCGTTTCCGTATAGGAGGACCGTGTAGGCCTTCCTGTCCCGGGCCTTGCCAGCGGCCAGCCCGATGAAGGAGCTCCCTCGCAGGGGGTAGCCTCCGAAGGAGAAGACGTGGGAGTGGTCGGCAGTGACGAGGCTCAGCGTGTCCTCCTCGCTGGTGAGCTGGCCCGCCCTCTCAATGGCGTCGTCGAACATGATCGTCTCAGTCAGTGCCCGGTAAGCCCTGCTTTCATGATGACCATGGTCGATGCGACCACCCTCCACGAAGAGGAAGAAGCCGCGGGGGTGTCTGCTCAGCAGGCGCAGGGCAGCCTCTGTCATCTCCATCAGGGAGGGGTCCAGTGTGGAGTCTCGGTGGATCTCGTATTTCATGTCTCCAGGCTCAAAGAGACCCATGAGATGGGTCACAGACGGGTCCAGGGAAGCCTGCATGAGCTCAGTGCGGTTCCACACGTACCGGGCACCCTGGCGTTCGCCGAGCCATTCCTGCACCAGATTCTTCCCGTCCAGCCTGGTCCCACCTTGGCTGTAGTCATCTGGGTACTCAGGGTCTGGGGTTCCCATGCGAAACATGTACTTTCGGCCTCCA (SEQ ID NO: 48).

[0182] In some embodiments, the AP gene fragment has the following sequence. CCCCGGGTGCGCGGCGTCGGTGGTGCCGGCGGGGGGCGCCAGGTCGCAGGCGGTGTAGGGCTCCAGGCAGGCGGCGAAGGCCATGACGTGCGCTATGAAGGTCTGCTCCTGCACGCCGTGAACCAGGTGCGCCTGCGGGCCGCGCGCGAACACCGCCACGTCCTCGCCTGCGTGGGTCTCTTCGTCCAGGGGCACTGCTGACTGCTGCCGATACTCGGGGCTCCCGCTCTCGCTCTCGGTAACATCCGGCCGGGCGCCGTCCTTGAGCACATAGCCTGGACCGTTTCCGTATAGGAGGACCGTGTAGGCCTTCCTGTCCCGGGCCTTGCCAGCGGCCAGCCCGATGAAGGAGCTCCCTCGCAGGGGGTAGCCTCCGAAGGAGAAGACGTGGGAGTGGTCGGCAGTGACGAGGCTCAGCGTGTCCTCCTCGCTGGTGA (SEQ ID NO: 49).

[0183] In some embodiments, the AP gene fragment has the following sequence. GCTGGCCCGCCCTCTCAATGGCGTCGTCGAACATGATCGTCTCAGTCAGTGCCCGGTAAGCCCTGCTTTCATGATGACCATGGTCGATGCGACCACCCTCCACGAAGAGGAAGAAGCCGCGGGGGTGTCTGCTCAGCAGGCGCAGGGCAGCCTCTGTCATCTCCATCAGGGAGGGGTCCAGTGTGGAGTCTCGGTGGATCTCGTATTTCATGTCTCCAGGCTCAAAGAGACCCATGAGATGGGTCACAGACGGGTCCAGGGAAGCCTGCATGAGCTCAGTGCGGTTCCACACGTACCGGGCACCCTGGCGTTCGCCGAGCCATTCCTGCACCAGATTCTTCCCGTCCAGCCTGGTCCCACCTTGGCTGTAGTCATCTGGGTACTCAGGGTCTGGGGTTCCCATGCGAAACATGTACTTTCGGCCTCCA (SEQ ID NO: 50).

[0184] In some embodiments, the AP gene fragment has the following sequence: CCCCGGGTGCGCGGCGTCGGTGGTGCCGGCGGGGCGCCAGGTCGCAGGCGGTGTAGGGCTCCAGGCAGGCGGCGAAGGCCATGACGTGCGCTATGAAGGTCTGCTCCTGCACGCCGTGAACCAGGTGCGCCTGCGGGCCGCGCGCG AACACCGCCACGTCCTCGCCTGCGTGGGTCTCTTCGTCCAGGGGCACTGCTGACTGCTGCCGATACTCGGGGCTCCCGCTCTCGCTCTCGGTAACATCCGGCCGGGCGCCGTCCTTGAGCACATAGCCTGGACCGTTTC (SEQ ID NO: 51).

[0185] In some embodiments, the AP gene fragment has the following sequence: CGTATAGGAGGACCGTGTAGGCCTTCCTGTCCCGGGCCTTGCCAGCGGCCAGCCCGATGAAGGAGCTCCCTCGCAGGGGGTAGCCTCCGAAGGAGAAGACGTGGGAGTGGTCGGCAGTGACGAGGCTCAGCGTGTCCTCCTCGCTGGTG AGCTGGCCCGCCCTCTCAATGGCGTCGTCGAACATGATCGTCTCAGTCAGTGCCCGGTAAGCCCTGCTTTCATGATGACCATGGTCGATGCGACCACCCTCCACGAAGAGGAAGAAGCCGCGGGGGTGTCTGCTCAGCAGG (SEQ ID NO: 52).

[0186] In some embodiments, the AP gene fragment has the following sequence: CGCAGGGCAGCCTCTGTCATCTCCATCAGGGAGGGGTCCAGTGTGGAGTCTCGGTGGATCTCGTATTTCATGTCTCCAGGCTCAAAGAGACCCATGAGATGGGTCACAGACGGGTCCAGGGAAGCCTGCATGAGCTCAGTGCGGTTCC ACACGTACCGGGCACCCTGGCGTTCGCCGAGCCATTCCTGCACCAGATTCTTCCCGTCCAGCCTGGTCCCACCTTGGCTGTAGTCATCTGGGTACTCAGGGTCTGGGGTTCCCATGCGAAACATGTACTTTCGGCCTCCA (SEQ ID NO: 53).

[0187] Exemplary splice donor sequences for use in the methods and compositions described herein can include the following sequences: GTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTCTGA (SEQ ID NO: 54).

[0188] Exemplary splice acceptor sequences for use in the methods and compositions described herein can include the following sequences: TAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAG (sequence number 55).

[0189] Additional examples of splice donor and splice acceptor sequences are known in the art. The double hybrid vectors for use in the methods and compositions described herein are designed such that approximately half of the OTOF gene is contained within each vector (e.g., each vector contains a polynucleotide that encodes approximately half of the OTOF isoform 5 protein). Decisions about how to divide the polynucleotide sequence between the two nucleic acid vectors can be made based on the size of the promoter and the location of the portion of the polynucleotide that encodes the OTOF C2 domain. In the case of using a short promoter such as CAG, CMV, smCBA, or Myo15 promoter having a sequence of 1 kb or less (e.g., the Myo15 promoter described above, e.g., the Myo15 promoter having the sequence of SEQ ID NO: 21 or SEQ ID NO: 42) in a dual hybrid vector system (e.g., a promoter of 1 kb or less, e.g., about 1 kb, 950 bp, 900 bp, 850 bp, 800 bp, 750 bp, 700 bp, 650 bp, 600 bp, 550 bp, 500 bp, 450 bp, 400 bp, 350 bp, 300 bp, or less), the OTOF polynucleotide sequence can be split between the two nucleic acid vectors at an exon boundary, e.g., exon 26 / 27 boundary, that occurs after the portion of the polynucleotide encoding the C2D domain and before the portion of the polynucleotide encoding the C2E domain. A nucleic acid vector containing a promoter of this size can optionally include an OTOF UTR (e.g., full-length 5' and 3' UTR). In the case of using a long promoter (e.g., a promoter longer than 1 kb, e.g., 1.1 kb, 1.25 kb, 1.5 kb, 1.75 kb, 2 kb, 2.5 kb, 3 kb or more) in a double hybrid vector system, such as the Myo15 promoter (e.g., SEQ ID NO: 19), which is longer than 1 kb, the OTOF polynucleotide sequence can be split between the two nucleic acid vectors at an exon boundary that occurs either after the portion of the polynucleotide encoding the C2C domain and before the portion of the polynucleotide encoding the C2D domain, e.g., at the exon 19 / 20 boundary or the exon 20 / 21 boundary, or within the portion of the polynucleotide encoding the C2D domain, e.g., the exon 25 / 26 boundary.Short promoters (e.g., CMV promoter, CAG promoter, smCBA promoter, or Myo15 promoter having a sequence of 1 kb or less, e.g., Myo15 promoter having the sequence of SEQ ID NO:21 or SEQ ID NO:42) can also be used in dual vector systems designed for large promoters. In this case, additional elements (e.g., OTOF UTR sequences) can be included in the first vector (e.g., a vector containing a portion of the polynucleotide encoding the C2C domain).

[0190] One exemplary two-hybrid vector system using a short promoter includes a first nucleic acid vector comprising a CAG promoter operably linked to exons 1-26 of a polynucleotide encoding an OTOF isoform 5 protein (e.g., human OTOF isoform 5, e.g., SEQ ID NO:1), a splice donor sequence 3' of the polynucleotide sequence, and a recombinogenic region 3' of the splice donor sequence, and a second nucleic acid vector comprising a polynucleotide 3' of the splice acceptor sequence comprising a recombinogenic region, a splice acceptor sequence 3' of the recombinogenic region, exons 27-45 and 47 of a polynucleotide encoding an OTOF isoform 5 protein (e.g., human OTOF isoform 5, e.g., SEQ ID NO:1), and a poly(A) sequence (e.g., a bGH poly(A) signal sequence). The first and second nucleic acid vectors may also contain full-length 5' and 3' OTOF UTRs, respectively (e.g., a 127 bp human OTOF 5' UTR may be included in the first nucleic acid vector, and a 1035 bp human OTOF 3' UTR may be included in the second nucleic acid vector). Another exemplary two-hybrid vector system using a short promoter includes a first nucleic acid vector comprising an smCBA promoter or a Myo15 promoter of 1 kb or less (e.g., a Myo15 promoter having the sequence of SEQ ID NO:21 or SEQ ID NO:42) operably linked to exons 1-20 of a polynucleotide encoding an OTOF isoform 5 protein (e.g., human OTOF isoform 5, e.g., SEQ ID NO:1), a splice donor sequence 3' of the polynucleotide sequence, and a recombinogenic region 3' of the splice donor sequence; and a second nucleic acid vector comprising a polynucleotide 3' of the splice acceptor sequence comprising a recombinogenic region, a splice acceptor sequence 3' of the recombinogenic region, exons 21-45 and 47 of a polynucleotide encoding an OTOF isoform 5 protein (e.g., human OTOF, e.g., SEQ ID NO:1), and a poly(A) sequence (e.g., a bGH poly(A) signal sequence).The first nucleic acid vector can also include a full-length 5' OTOF UTR (e.g., a 127 bp human OTOF 5' UTR can be included in the first nucleic acid vector). The CMV promoter can be used in place of the CAG, smCBA, or Myo15 promoter in any of the dual vector systems described above.

[0191] An exemplary two-hybrid vector system using a long promoter includes a first nucleic acid vector including a Myo15 promoter (e.g., SEQ ID NO: 19) of more than 1 kb operably linked to exons 1-19 or 1-20 of a polynucleotide encoding an OTOF isoform 5 protein (e.g., human OTOF isoform 5, e.g., SEQ ID NO: 1), a splice donor sequence 3' of the polynucleotide sequence, and a recombinogenic region 3' of the splice donor sequence, and a splice acceptor sequence 3' of the recombinogenic region. and a second nucleic acid vector comprising a splice acceptor sequence 3' of a polynucleotide encoding an OTOF isoform 5 protein (e.g., human OTOF isoform 5, e.g., SEQ ID NO: 1), exons 20 to 45 and 47 (when the first nucleic acid vector comprises exons 1 to 19 of the polynucleotide) or exons 21 to 45 and 47 (when the first nucleic acid vector comprises exons 1 to 20 of the polynucleotide), and a poly(A) sequence (e.g., a bGH poly(A) signal sequence). The first and second nucleic acid vectors of the Myo15 promoter dual hybrid vector system described above do not include an OTOF UTR. A short promoter (e.g., a CMV promoter, a CAG promoter, a smCBA promoter, or a Myo15 promoter having a sequence of 1 kb or less, e.g., a Myo15 promoter having a sequence of SEQ ID NO: 21 or SEQ ID NO: 42) can also be used in the above-mentioned dual vector system designed for a large promoter. In these dual vector systems, where a short promoter is included, the first vector may also include a 5'OTOF UTR.

[0192] To accommodate the OTOF UTRs, the OTOF coding sequence can be split into separate locations. In a two-hybrid vector system in which a first nucleic acid vector contains a Myo15 promoter (e.g., SEQ ID NO: 19) of more than 1 kb operably linked to exons 1-25 of a polynucleotide encoding an OTOF isoform 5 protein (e.g., human OTOF isoform 5, e.g., SEQ ID NO: 1), a splice donor sequence 3' of the polynucleotide sequence, and a recombinogenic region 3' of the splice donor sequence, and a second nucleic acid vector contains a recombinogenic region, a splice acceptor sequence 3' of the recombinogenic region, a polynucleotide 3' of the splice acceptor sequence comprising exons 26-45 and 47 of a polynucleotide encoding an OTOF protein (e.g., human OTOF isoform 5, e.g., SEQ ID NO: 1), and a poly(A) sequence (e.g., a bGH poly(A) signal sequence), the second nucleic acid also contains a full-length OTOF 3' UTR (e.g., a 1035 bp human OTOF UTR). Short promoters (e.g., CMV promoter, CAG promoter, smCBA promoter, or Myo15 promoter having a sequence of 1 kb or less, e.g., Myo15 promoter having a sequence of SEQ ID NO: 21 or SEQ ID NO: 42) can also be used in the dual vector systems described above designed for large promoters. When these dual vector systems contain short promoters, the first vector may also contain a 5'OTOF UTR.

[0193] The polynucleotide sequence encoding the OTOF isoform 5 protein may be a cDNA sequence (e.g., a sequence that does not contain introns). In some embodiments, the first nucleic acid vector and / or the second nucleic acid vector of the dual vector system may include an intron sequence. The intron sequence may be included between one or more exons of the OTOF coding sequence, or the intron sequence may be included between an exon of the coding sequence and another component of the nucleic acid vector (e.g., between an exon of the OTOF coding sequence and a splice donor sequence in the first nucleic acid vector, or between an exon of the OTOF coding sequence and a splice acceptor sequence in the second nucleic acid vector).

[0194] In some embodiments, the polynucleotide encoding OTOF isoform 5 is split between a first nucleic acid vector and a second nucleic acid vector (e.g., an AAV vector) of a dual vector system at the exon 20 / 21 boundary. When the polynucleotide encoding OTOF isoform 5 is split between a first nucleic acid vector and a second nucleic acid vector (e.g., an AAV vector) at the exon 20 / 21 boundary, the polynucleotide sequence encoding the N-terminal portion of OTOF has the following sequence:

[0195]

[0196] When a polynucleotide encoding OTOF isoform 5 is split between a first nucleic acid vector and a second nucleic acid vector (e.g., an AAV vector) at the exon 20 / 21 boundary, the polynucleotide sequence encoding the C-terminal portion of OTOF has the following sequence:

[0197]

[0198] In an embodiment in which a polynucleotide encoding OTOF isoform 5 is split between a first nucleic acid vector and a second nucleic acid vector (e.g., an AAV vector) at the exon 20 / 21 boundary, the N-terminal portion of the OTOF polypeptide has the following sequence:

[0199] (Sequence number 58).

[0200] In an embodiment in which a polynucleotide encoding OTOF isoform 5 is split between a first nucleic acid vector and a second nucleic acid vector (e.g., an AAV vector) at the exon 20 / 21 boundary, the C-terminal portion of the OTOF polypeptide has the following sequence:

[0201]

[0202] Transfer plasmids that can be used to generate nucleic acid vectors for use in the compositions and methods described herein are provided in Table 4. The transfer plasmid (e.g., a plasmid containing a DNA sequence delivered by a nucleic acid vector, e.g., delivered by AAV) is co-delivered into a producer cell with a helper plasmid (e.g., a plasmid providing proteins required for AAV production) and a rep / cap plasmid (e.g., a plasmid providing AAV capsid proteins and proteins that insert the transfer plasmid DNA sequence into the capsid shell, etc.) to generate a nucleic acid vector (e.g., an AAV vector) for administration. The nucleic acid vector (e.g., a nucleic acid vector (e.g., an AAV vector)) containing a polynucleotide encoding the N-terminal portion of OTOF isoform 5 and the nucleic acid vector (e.g., an AAV vector) containing a polynucleotide encoding the C-terminal portion of OTOF isoform 5 can be combined (e.g., into a single formulation) prior to administration. The following transfer plasmids: SEQ ID NO:60 and SEQ ID NO:61, SEQ ID NO:62 and SEQ ID NO:63, SEQ ID NO:64 and SEQ ID NO:61, SEQ ID NO:65 and SEQ ID NO:63, SEQ ID NO:66 and SEQ ID NO:67, and SEQ ID NO:68 and SEQ ID NO:67 are designed to produce nucleic acid vectors (e.g., AAV vectors) for co-formulation or co-administration (e.g., simultaneous or sequential administration) in a dual hybrid vector system.

[0203] [Table 4-1]

[0204] [Table 4-2]

[0205] [Table 4-3]

[0206]

Table 4-4

[0207]

Table 4-5

[0208]

Table 4-6

[0209]

Table 4-7

[0210]

Table 4-8

[0211]

Table 4-9

[0212]

Table 4-10

[0213]

Table 4-11

[0214]

Table 4-12

[0215]

Table 4-13

[0216]

Table 4-14

[0217]

Table 4-15

[0218]

Table 4-16

[0219]

Table 4-17

[0220]

Table 4-18

[0221]

Table 4-19

[0222]

Table 4-20

[0223]

Table 4-21

[0224]

Table 4-22

[0225]

Table 4-23

[0226]

Table 4-24

[0227]

Table 4-25

[0228]

Table 4-26

[0229]

Table 4-27

[0230]

Table 4-28

[0231]

Table 4-29

[0232]

Table 4-30

[0233]

Table 4-31

[0234]

Table 4-32

[0235]

Table 4-33

[0236]

Table 4-34

[0237]

Table 4-35

[0238]

Table 4-36

[0239]

Table 4-37

[0240]

Table 4-38

[0241]

Table 4-39

[0242]

Table 4-40

[0243]

Table 4-41

[0244]

Table 4-42

[0245]

Table 4-43

[0246]

Table 4-44

[0247]

Table 4-45

[0248]

Table 4-46

[0249]

Table 4-47

[0250]

Table 4-48

[0251]

Table 4-49

[0252]

Table 4-50

[0253]

Table 4-51

[0254]

Table 4-52

[0255]

Table 4-53

[0256]

Table 4-54

[0257]

Table 4-55

[0258]

Table 4-56

[0259]

Table 4-57

[0260]

Table 4-58

[0261]

Table 4-59

[0262]

Table 4-60

[0263]

Table 4-61

[0264]

Table 4-62

[0265]

Table 4-63

[0266]

Table 4-64

[0267]

Table 4-65

[0268]

Table 4-66

[0269]

Table 4-67

[0270]

Table 4-68

[0271]

Table 4-69

[0272]

Table 4-70

[0273]

Table 4-71

[0274]

Table 4-72

[0275]

Table 4-73

[0276]

Table 4-74

[0277]

Table 4-75

[0278]

Table 4-76

[0279]

Table 4-77

[0280]

Table 4-78

[0281]

Table 4-79

[0282]

Table 4-80

[0283]

Table 4-81

[0284]

Table 4-82

[0285]

Table 4-83

[0286]

Table 4-84

[0287]

Table 4-85

[0288] [Table 4-86]

[0289] [Table 4-87]

[0290] [Table 4-88]

[0291] Vectors for expression of OTOF In addition to achieving high rates of transcription and translation, stable expression of exogenous genes in mammalian cells can be achieved by integrating a polynucleotide containing the gene into the nuclear genome of the mammalian cell. Various vectors have been developed for delivering and integrating polynucleotides encoding exogenous proteins into the nuclear DNA of mammalian cells. Examples of expression vectors are disclosed, for example, in WO1994 / 011026, which is incorporated herein by reference. Expression vectors for use in the compositions and methods described herein include polynucleotide sequences encoding portions of OTOF, as well as additional sequence elements used, for example, to express these agents and / or integrate these polynucleotide sequences into the genome of mammalian cells. Particular vectors that can be used to express OTOF include plasmids that contain regulatory sequences, such as promoter and enhancer regions, that direct gene transcription. Other vectors useful for OTOF expression include polynucleotide sequences that increase the translation rate of these genes or improve the stability or nuclear export of mRNA resulting from gene transcription. These sequence elements include, for example, 5' and 3' untranslated regions and polyadenylation signal sites to direct efficient transcription of genes integrated on the expression vector. Expression vectors suitable for use in the compositions and methods described herein may also contain a polynucleotide encoding a marker for selecting cells containing such a vector. Examples of suitable markers include genes encoding resistance to antibiotics such as ampicillin, chloramphenicol, kanamycin, or nourseothricin.

[0292] AAV vectors for nucleic acid delivery In some embodiments, the nucleic acids of the compositions and methods described herein are incorporated into recombinant AAV (rAAV) vectors and / or viral particles to facilitate their introduction into cells. rAAV vectors useful in the compositions and methods described herein are recombinant nucleic acid constructs that include (1) a heterologous sequence to be expressed (e.g., a polynucleotide encoding an N-terminal or C-terminal portion of an OTOF protein) and (2) viral sequences that promote the stability and expression of the heterologous gene. The viral sequences may include sequences of AAV required in cis for DNA replication and packaging into viral particles (e.g., functional ITRs). Such rAAV vectors may also include marker or reporter genes. In useful rAAV vectors, one or more AAV WT genes have been deleted in whole or in part, but functional flanking ITR sequences are retained. The AAV ITRs may be of any serotype suitable for a particular application. For use in the methods and compositions described herein, the ITRs may be AAV2 ITRs. Methods for the use of rAAV vectors are described, for example, in Tal et al., J. Biomed. Sci. 7:279 (2000), and Monahan and Samulski, Gene Delivery 7:24 (2000), the disclosures of each of which are incorporated by reference herein as they pertain to AAV vectors for gene delivery.

[0293] The nucleic acids and vectors described herein can be incorporated into rAAV viral particles to facilitate the introduction of the nucleic acid or vector into cells. The capsid protein of AAV constitutes the external non-nucleic acid portion of the viral particle and is encoded by the AAV cap gene. The cap gene encodes three viral coat proteins VP1, VP2, and VP3, which are necessary for the assembly of viral particles. The construction of rAAV viral particles is described, for example, in US 5,173,414, US 5,139,941, US 5,863,541, US 5,869,305, US 6,057,152, and US 6,376,237, as well as Rabinowitz et al., J.Virol.76:791 (2002) and Bowles et al., J.Virol.77:423 (2003), the disclosures of each of which are incorporated herein by reference as they pertain to AAV vectors for gene delivery.

[0294] rAAV viral particles useful in combination with the compositions and methods described herein include viral particles derived from various AAV serotypes, including AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eb, and PHP.S. When targeting cochlear hair cells, AAV1, AAV2, AAV6, AAV9, Anc80, Anc80L65, DJ / 9, 7m8, and PHP.B may be particularly useful. Serotypes evolved for transduction of the retina may also be used in the methods and compositions described herein. The first nucleic acid vector and the second nucleic acid vector (e.g., AAV vector) of the compositions and methods described herein can have the same serotype or different serotypes. The construction and use of AAV vectors and AAV proteins of different serotypes are described, for example, in Chao et al., Mol. Ther. 2:619 (2000); Davidson et al., Proc. Natl. Acad. Sci. USA 97:3428 (2000); Xiao et al., J. Virol. 72:2224 (1998); Halbert et al., J. Virol. 74:1524 (2000); Halbert et al., J. Virol. 75:6615 (2001); and Auricchio et al., Hum. Molec. Genet. 10:3075 (2001), the disclosures of each of which are incorporated herein by reference as they pertain to AAV vectors for gene delivery.

[0295] Useful in combination with the compositions and methods described herein are pseudotyped rAAV vectors. Pseudotyped vectors include AAV vectors of a given serotype (e.g., AAV9) pseudotyped with a capsid gene from a serotype other than the given serotype (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, etc.). Techniques involving the construction and use of pseudotyped rAAV viral particles are known in the art and are described, for example, in Duan et al., J. Virol. 75:7662 (2001); Halbert et al., J. Virol. 74:1524 (2000); Zolotukhin et al., Methods, 28:158 (2002); and Auricchio et al., Hum. Molec. Genet. 10:3075 (2001).

[0296] AAV viral particles with mutations in the capsid of the viral particle can be used to infect specific cell types more effectively than non-mutated capsid viral particles. For example, suitable AAV mutants can have ligand insertion mutations to facilitate targeting of AAV to specific cell types. The construction and characterization of AAV capsid mutants, including insertion mutants, alanine screening mutants, and epitope tag mutants, are described in Wu et al., J. Virol. 74:8635 (2000). Other rAAV viral particles that can be used in the methods described herein include capsid hybrids generated by molecular breeding of viruses and by exon shuffling. See, for example, Soong et al., Nat. Genet., 25:436 (2000) and Kolman and Stemmer, Nat. Biotechnol. 19:423 (2001).

[0297] In some embodiments, the use of an AAV vector to deliver functional OTOF isoform 5 protein requires the use of a dual vector system, where a first member of the dual vector system encodes the N-terminal portion of the OTOF isoform 5 protein and a second member encodes the C-terminal portion of the OTOF isoform 5 protein, such that upon administration of the dual vector system to a cell, the polynucleotide sequences contained within the two vectors can combine to form a single sequence, resulting in the production of full-length OTOF isoform 5 protein.

[0298] In some embodiments, the first member of the dual vector system also includes, in 5' to 3' order, a first inverted terminal repeat ("ITR"), a promoter (e.g., Myol5 promoter), a Kozak sequence, an N-terminal portion of the OTOF isoform 5 coding sequence, a splice donor sequence, an AP gene fragment (e.g., an AP start sequence), and a second ITR, and the second member of the dual vector system includes, in 5' to 3' order, a first ITR, an AP gene fragment (e.g., an AP start sequence), a splice acceptor sequence, a C-terminal portion of the OTOF isoform 5 coding sequence, a polyA sequence, and a second ITR. In some embodiments, the N-terminal portion of the OTOF isoform 5 coding sequence and the C-terminal portion of the OTOF isoform 5 coding sequence are non-overlapping and combine in the cell (e.g., by recombination at the overlapping region (AP gene fragment) or by concatemerization of the ITRs) to generate the full-length OTOF isoform 5 amino sequence as set forth in SEQ ID NO:1. In certain embodiments, the N-terminal portion of the OTOF isoform 5 coding sequence encodes amino acids 1 to 802 of SEQ ID NO:1 (SEQ ID NO:58), and the C-terminal portion of the OTOF isoform 5 coding sequence encodes amino acids 803 to 1997 of SEQ ID NO:1 (SEQ ID NO:59).

[0299] In some embodiments, the first member of the dual vector system comprises a Myo15 promoter of SEQ ID NO:21 (also represented by nucleotides 235-1199 of SEQ ID NO:66) operably linked to nucleotides encoding the N-terminal 802 amino acids of OTOF isoform 5 protein (amino acids 1-802 of SEQ ID NO:1), which are encoded by exons 1-20 of a native polynucleotide sequence encoding the protein. In certain embodiments, the nucleotide sequence encoding the N-terminal amino acids of OTOF isoform 5 protein is nucleotides 1222-3627 of SEQ ID NO:66. In some embodiments, the nucleotide sequence encoding the N-terminal amino acids of OTOF isoform 5 protein is any nucleotide sequence that encodes amino acids 1-802 of SEQ ID NO:1 due to redundancy in the genetic code. The nucleotide sequence encoding the OTOF isoform 5 protein can be partially or fully codon optimized for expression. In some embodiments, the first member of the dual vector system comprises a Kozak sequence corresponding to nucleotides 1216-1225 of SEQ ID NO:66. In some embodiments, the first member of the dual vector system comprises a splice donor sequence corresponding to nucleotides 3628-3711 of SEQ ID NO: 66. In some embodiments, the first member of the dual vector system comprises an AP start sequence corresponding to nucleotides 3718-4004 of SEQ ID NO: 66. In certain embodiments, the first member of the dual vector system comprises nucleotides 235-4004 of SEQ ID NO: 66 flanked on each of the 5' and 3' sides by inverted terminal repeats. In some embodiments, the flanking inverted terminal repeats are any variant of the AAV2 inverted terminal repeat that can be encapsidated by a plasmid harboring the AAV2 Rep gene. In certain embodiments, the 5' proximal inverted terminal repeat has a sequence corresponding to nucleotides 12 to 141 of SEQ ID NO:66, or a sequence having at least 80% sequence identity thereto (at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity).The 3' adjacent inverted terminal repeats have a sequence corresponding to nucleotides 4098-4227 of SEQ ID NO:66, or a sequence having at least 80% sequence identity thereto (at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity). One of skill in the art will appreciate that for any given pair of inverted terminal repeat sequences in a transfer plasmid used to generate a viral vector (usually by transfecting that plasmid into a cell with other plasmids carrying the AAV genes necessary for viral vector formation) (e.g., any of SEQ ID NOs:60, 62, 64, 65, 66, or 68), the corresponding sequences in the viral vector may be altered due to the ITRs adopting a "flip" or "flop" orientation upon recombination. Thus, the sequence of the ITRs in the transfer plasmid is not necessarily the same as that found in the viral vector prepared therefrom. However, in some very specific embodiments, the first member of the dual vector system comprises nucleotides 12 to 4227 of SEQ ID NO:66.

[0300] In some embodiments, the second member of the dual vector system comprises nucleotides that immediately follow the C-terminal 1195 amino acids of OTOF isoform 5 protein (amino acids 803-1997 of SEQ ID NO:1) followed by a stop codon. In certain embodiments, the nucleotide sequence encoding the C-terminal amino acids of OTOF isoform 5 protein is nucleotides 587-4174 of SEQ ID NO:67. In some embodiments, the nucleotide sequence encoding the C-terminal amino acids of OTOF isoform 5 protein is any nucleotide sequence that encodes amino acids 803-1997 of SEQ ID NO:1 due to redundancy in the genetic code. The nucleotide sequence encoding the OTOF isoform 5 protein can be partially or fully codon optimized for expression. In some embodiments, the second member of the dual vector system comprises a splice acceptor sequence corresponding to nucleotides 538-586 of SEQ ID NO:67. In some embodiments, the second member of the dual vector system comprises an AP start sequence corresponding to nucleotides 229-515 of SEQ ID NO:67. In some embodiments, the second member of the dual vector system comprises a poly(A) sequence corresponding to nucleotides 4217-4438 of SEQ ID NO: 67. In certain embodiments, the second member of the dual vector system comprises nucleotides 229-4438 of SEQ ID NO: 67 flanked on the 5' and 3' sides, respectively, by inverted terminal repeats. In some embodiments, the flanking inverted terminal repeats are any variant of the AAV2 inverted terminal repeat that can be encapsidated by a plasmid harboring the AAV2 Rep gene. In certain embodiments, the 5' proximal inverted terminal repeat has a sequence corresponding to nucleotides 12 to 141 of SEQ ID NO:67, or a sequence having at least 80% sequence identity thereto (at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity).The 3' adjacent inverted terminal repeats have a sequence corresponding to nucleotides 4526 to 4655 of SEQ ID NO: 67, or a sequence having at least 80% sequence identity thereto (at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity). One of skill in the art will appreciate that for any given pair of inverted terminal repeat sequences in a transfer plasmid used to create a viral vector (usually by transfecting that plasmid into a cell with other plasmids carrying the AAV genes necessary for viral vector formation) (e.g., any of SEQ ID NOs: 61, 63, or 67), the corresponding sequences in the viral vector may be altered due to the ITRs adopting a "flip" or "flop" orientation upon recombination. Thus, the sequence of the ITRs in the transfer plasmid is not necessarily the same as that found in the viral vector prepared therefrom. However, in some very specific embodiments, the first member of the dual vector system comprises nucleotides 12 to 4655 of SEQ ID NO:67.

[0301] In some embodiments, the dual vector system is an AAV1 dual vector system. In some embodiments, the dual vector system is an AAV9 dual vector system. Pharmaceutical Compositions The nucleic acid vectors (e.g., AAV vectors) described herein can be incorporated into vehicles for administration to patients, such as human patients suffering from sensorineural hearing loss or auditory neuropathy, as described herein. Pharmaceutical compositions comprising vectors, such as viral vectors, that contain polynucleotides encoding OTOF isoform 5 protein can be prepared using methods known in the art. For example, such compositions can be prepared in desired form, such as lyophilized formulations or aqueous solutions, using, for example, physiologically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980); incorporated herein by reference).

[0302] Mixtures of the nucleic acid vectors (e.g., AAV vectors) described herein can be prepared in water, suitably mixed with one or more excipients, carriers, or diluents. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, and in oils. These preparations may contain preservatives to prevent the growth of microorganisms under ordinary storage and use conditions. Pharmaceutical forms suitable for injection use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (described in US 5,466,468, the disclosure of which is incorporated herein by reference). In any case, the formulations may be sterile and may have sufficient fluidity for easy injection. The formulations may be stable under the conditions of manufacture and storage and may be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier may be, for example, a solvent or dispersion medium containing water, ethanol, a polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), suitable mixtures thereof, and / or vegetable oils. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of microbial action can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of injectable compositions can be brought about by the use in the composition of agents that delay absorption, for example, aluminum monostearate and gelatin.

[0303] For example, the solution containing the pharmaceutical composition described herein may be appropriately buffered if necessary, and the liquid diluent may first be made isotonic with sufficient saline or glucose. These particular aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. In this regard, the sterile aqueous medium that may be employed will be known to those skilled in the art in light of this disclosure. For example, one dose may be dissolved in 1 ml of NaCl isotonic solution and added to 1000 ml of subcutaneous injection solution or injected at the intended injection site. Depending on the condition of the subject to be treated, some variation in dose will necessarily occur. For local administration to the inner ear, the composition may be formulated to contain synthetic perilymph solution. An exemplary synthetic perilymph solution contains 20-200 mM NaCl, 1-5 mM KCl, 0.1-10 mM CaCl2, 1-10 mM glucose, and 2-50 mM HEPES, has a pH between about 6 and 9, and an osmolality of about 300 mOsm / kg. In any event, the person responsible for administration will determine the appropriate dose for the individual subject. Moreover, for human administration, formulations may meet sterility, pyrogenicity, general safety, and purity standards as required by FDA Office of Biologics standards.

[0304] Treatment method The compositions described herein may be administered to a subject with sensorineural hearing loss or auditory neuropathy by a variety of routes, including, for example, local administration to the inner ear (e.g., administration to the perilymph or endolymph, e.g., administration to cochlear hair cells, by injection or catheterization through the round window membrane, injection into the semicircular canal, by canalostomy, or by intratympanic or intratympanic injection), intravenous, parenteral, intradermal, transdermal, intramuscular, intranasal, subcutaneous, transdermal, intratracheal, intraperitoneal, intraarterial, intravascular, inhalation, perfusion, lavage, and oral administration. When the composition is administered by direct delivery to the inner ear, a second fenestration or vent may be added elsewhere in the inner ear. The most appropriate route for administration in a given case depends on the particular composition administered, the patient, the pharmaceutical formulation method, the method of administration (e.g., administration time and route), the patient's age, weight, sex, the severity of the disease being treated, the patient's diet, and the patient's excretion rate. The composition may be administered once, or more than once (e.g., once a year, twice a year, three times a year, every other month, month, or every other week). In some embodiments, the first nucleic acid vector and the second nucleic acid vector (e.g., AAV vector) are administered simultaneously (e.g., in one composition). In some embodiments, the first nucleic acid vector and the second nucleic acid vector (e.g., AAV vector) are administered sequentially (e.g., the second nucleic acid vector is administered immediately after the first nucleic acid vector, or 5 minutes, 10 minutes, 15 minutes, 20 minutes, 25 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 8 hours, 12 hours, 1 day, 2 days, 7 days, 2 weeks, 1 month, or more after the first nucleic acid vector). The first nucleic acid vector and the second nucleic acid vector can have the same serotype or different serotypes (e.g., AAV serotypes).

[0305] Subjects that may be treated as described herein are those who have or are at risk of developing sensorineural hearing loss or auditory neuropathy. The compositions and methods described herein can be used to treat subjects with a mutation in OTOF (e.g., a mutation that reduces the function or expression of OTOF, or an OTOF mutation associated with sensorineural hearing loss), subjects with a family history of autosomal recessive sensorineural hearing loss or hearing loss (e.g., a family history of OTOF-associated sensorineural hearing loss), or subjects with unknown OTOF mutation status and / or OTOF activity level. The methods described herein may include screening the subject for a mutation in OTOF prior to treatment or administration with the compositions described herein. Subjects can be screened for OTOF mutations using standard methods known to those skilled in the art (e.g., genetic testing). The methods described herein may also include evaluating the hearing of the subject prior to treatment or administration with the compositions described herein. Hearing can be evaluated using standard tests such as audiometry, ABR, electrocochleography (ECOG), and otoacoustic emissions. The compositions and methods described herein may also be administered as a prophylactic treatment to patients at risk of developing hearing loss or auditory neuropathy, for example, patients with a family history of inherited hearing loss or patients with OTOF mutations who do not yet exhibit hearing loss or hearing impairment.

[0306] Treatment may include administration of a composition containing a nucleic acid vector (e.g., an AAV vector) as described herein in various unit doses. Each unit dose typically contains a predetermined amount of the therapeutic composition. The amount administered, as well as the specific route of administration and formulation, are within the skill of those skilled in the clinical arts. The unit dose need not be administered as a single injection, but may include continuous infusion over a set period of time. Administration may be performed using a syringe pump to control the rate of infusion in order to minimize damage to the cochlea. When the nucleic acid vector is an AAV vector (e.g., an AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eb, or PHP.S vector), the AAV vector can be, for example, about 1 × 10 9 Vector Genome (VG) ~ 1 × 10 16 VG (e.g., 1×10 9 VG / mL, 2×10 9 VG / mL, 3×10 9 VG / mL, 4×10 9 VG / mL, 5×10 9 VG / mL, 6×10 9 VG / mL, 7×10 9 VG / mL, 8×10 9 VG / mL, 9×10 9 VG / mL, 1×10 10 VG / mL, 2×10 10 VG / mL, 3×10 10 VG / mL, 4×10 10 VG / mL, 5×10 10 VG / mL, 6×10 10 VG / mL, 7×10 10 VG / mL, 8×10 10 VG / mL, 9×10 10 VG / mL, 1×10 11 VG / mL, 2×10 11 VG / mL, 3×10 11 VG / mL, 4×10 11 VG / mL, 5×10 11 VG / mL, 6×1011 VG / mL、7×10 11 VG / mL、8×10 11 VG / mL、9×10 11 VG / mL、1×10 12 VG / mL、2×10 12 VG / mL、3×10 12 VG / mL、4×10 12 VG / mL、5×10 12 VG / mL、6×10 12 VG / mL、7×10 12 VG / mL、8×10 12 VG / mL、9×10 12 VG / mL、1×10 13 VG / mL、2×10 13 VG / mL、3×10 13 VG / mL、4×10 13 VG / mL、5×10 13 VG / mL、6×10 13 VG / mL、7×10 13 VG / mL、8×10 13 VG / mL、9×10 13 VG / mL、1×10 14 VG / mL、2×10 14 VG / mL、3×10 14 VG / mL、4×10 14 VG / mL、5×10 14 VG / mL、6×10 14 VG / mL、7×10 14 VG / mL、8×10 14 VG / mL、9×10 14 VG / mL、1×10 15 VG / mL、2×10 15 VG / mL、3×10 15 VG / mL、4×10 15 VG / mL、5×10 15 VG / mL、6×10 15 VG / mL、7×10 15 VG / mL、8×10 15 VG / mL、9×10 15 VG / mL、or 1×10 16The AAV vector may have a titer of about 1 × 10 7 VG / ear ~ approx. 2 x 10 15 VG / ear (e.g. 1×10 7 VG / ear, 2×10 7 VG / ear, 3×10 7 VG / ear, 4×10 7 VG / ear, 5×10 7 VG / ear, 6×10 7 VG / ear, 7×10 7 VG / ear, 8×10 7 VG / ear, 9×10 7 VG / ear, 1×10 8 VG / ear, 2×10 8 VG / ear, 3×10 8 VG / ear, 4×10 8 VG / ear, 5×10 8 VG / ear, 6×10 8 VG / ear, 7×10 8 VG / ear, 8×10 8 VG / ear, 9×10 8 VG / ear, 1×10 9 VG / ear, 2×10 9 VG / ear, 3×10 9 VG / ear, 4×10 9 VG / ear, 5×10 9 VG / ear, 6×10 9 VG / ear, 7×10 9 VG / ear, 8×10 9 VG / ear, 9×10 9 VG / ear, 1×10 10 VG / ear, 2×10 10 VG / ear, 3×10 10 VG / ear, 4×10 10 VG / ear, 5×10 10 VG / ear, 6×10 10 VG / ear, 7×10 10 VG / ear, 8×10 10 VG / ear, 9×10 10VG / ear, 1×10 11 VG / ear, 2×10 11 VG / ear, 3×10 11 VG / ear, 4×10 11 VG / ear, 5×10 11 VG / ear, 6×10 11 VG / ear, 7×10 11 VG / ear, 8×10 11 VG / ear, 9×10 11 VG / ear, 1×10 12 VG / ear, 2×10 12 VG / ear, 3×10 12 VG / ear, 4×10 12 VG / ear, 5×10 12 VG / ear, 6×10 12 VG / ear, 7×10 12 VG / ear, 8×10 12 VG / ear, 9×10 12 VG / ear, 1×10 13 VG / ear, 2×10 13 VG / ear, 3×10 13 VG / ear, 4×10 13 VG / ear, 5×10 13 VG / ear, 6×10 13 VG / ear, 7×10 13 VG / ear, 8×10 13 VG / ear, 9×10 13 VG / ear, 1×10 14 VG / ear, 2×10 14 VG / ear, 3×10 14 VG / ear, 4×10 14 VG / ear, 5×10 14 VG / ear, 6×10 14 VG / ear, 7×10 14 VG / ear, 8×10 14 VG / ear, 9×10 14 VG / ear, 1×10 15 VG / ear, or 2×10 15 The subject may be administered a dose of 100 mg / ear (VG / ear).

[0307] The compositions described herein are administered in an amount sufficient to improve hearing, increase WT OTOF expression (e.g., expression of OTOF isoform 5 in cochlear hair cells, e.g., inner hair cells), or increase OTOF function. Hearing may be assessed using standard hearing tests (e.g., audiometry, ABR, electrocochleography (ECOG), and otoacoustic emissions) and may improve by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more) compared to hearing measurements obtained before treatment. In some embodiments, the compositions are administered in an amount sufficient to improve the subject's ability to understand speech. The compositions described herein can also be administered in an amount sufficient to delay or prevent the onset or progression of sensorineural hearing loss or auditory neuropathy (e.g., in subjects with a mutation in OTOF or a family history of autosomal recessive hearing loss but who do not exhibit hearing loss, or in subjects who exhibit mild to moderate hearing loss). The expression of OTOF can be assessed using immunohistochemistry, Western blot analysis, quantitative real-time PCR, or other methods known in the art for detecting protein or mRNA, and can be increased by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more) compared to the expression of OTOF before administration of the compositions described herein. OTOF function can be assessed directly (e.g., using electrophysiological or imaging methods to assess exocytosis) or indirectly based on hearing tests, and can be increased by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more) compared to the function of OTOF before administration of the compositions described herein. These effects can occur, for example, within 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 15 weeks, 20 weeks, 25 weeks, or more after administration of the compositions described herein. Depending on the dose and route of administration used for treatment, patients may be evaluated 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, or more after administration of the compositions.Depending on the results of the evaluation, the patient may receive additional treatment.

[0308] kit The compositions described herein can be provided in a kit for use in treating sensorineural hearing loss or auditory neuropathy (e.g., hearing loss associated with a mutation in OTOF). The compositions can include nucleic acid vectors (e.g., AAV vectors) described herein (e.g., a first nucleic acid vector comprising a polynucleotide encoding an N-terminal portion of an OTOF isoform 5 protein, and a second nucleic acid vector comprising a polynucleotide encoding a C-terminal portion of an OTOF isoform 5 protein), optionally packaged in an AAV viral capsid (e.g., an AAV1 capsid). The kit can further include a package insert that instructs a user of the kit, e.g., a physician, to carry out the methods described herein. The kit can also optionally include a syringe or other device for administering the composition. EXAMPLES

[0309] The following examples are presented to provide one of ordinary skill in the art with a description of how the compositions and methods described herein can be used, made, and evaluated, and are intended to be purely illustrative of the invention and are not intended to limit the scope of what the inventors regard as their invention.

[0310] Example 1. Human OTOF isoform 5, but not human OTOF isoform 1, is a genotype of OTOF Q828X / Q828X Restored mouse function The otoferlin (OTOF) gene has multiple long and short isoforms. Studies of human hereditary hearing loss suggest that the long isoform is important for inner ear function. However, the role of these individual long isoforms and other protein variants in inner ear function is not understood. To develop effective transgenic therapy for patients with hearing loss secondary to genetically caused OTOF deficiency, cDNA sequences encoding functional OTOF isoforms in the ear must be identified.

[0311] In humans, seven OTOF isoforms have been identified in extra-aural tissues. Two of these isoforms, isoform 1 (V1) and isoform 5 (V5), are long (both 1997 amino acids long).

[0312] Using dual hybrid AAV technology, human V1 and V5 isoforms were delivered locally to the inner ear of otoferlin-deficient genetically engineered congenitally deaf mice. One month after delivery of the human V5 isoform to congenitally deaf mice, hearing recovery was observed (Figure 1A). In contrast, no hearing recovery was observed in mice injected with the V1 human long isoform. These studies established the OTOFV5 sequence as one capable of restoring hearing in the context of gene transfer therapy.

[0313] Experiments that were performed to compare OTOF expression with functional restoration using a two-hybrid vector system encoding OTOF isoform 1 or OTOF isoform 5 are described in detail below.

[0314] AAV delivery to the inner ear Vectors (AAV2quad(YF)-smCBA-OTOF isoform 1 (native or codon optimized), or AAV2quad(YF)-smCBA-OTOF isoform 5 (native or codon optimized)) were injected via the round window membrane into P30-50 OTOF mice. Q828X / Q828XThe OTOF mutant mice (mouse model of human OTOF mutation p.Gln828Ter) were delivered. A polynucleotide encoding the N-terminal portion of the OTOF protein and a polynucleotide encoding the C-terminal portion of the OTOF protein were split between two vectors of a double hybrid vector system using the exon 20 / 21 boundary, and the AP gene fragment (SEQ ID NO: 51) was used as the recombinogenic region of both vectors of the double hybrid vector system. The vectors were delivered as follows: Animals were anesthetized with isoflurane. Ophthalmic ointment (Puralube Vet) was applied to both eyes, and meloxicam (Putney) / rimadyl was administered as an analgesic, 0.3-2.0 mg / kg SC. The surgical site was shaved and scrubbed with Betadine (Avrio Health LP) and 70% alcohol before a postauricular incision to expose the blister. A small hole was created in the bleb using a sterile 26-30 G needle or a 0.004-0.008 mm diameter drill bit (Performance Micro Tool) and expanded using sterile sharp forceps to visualize the round window niche. The round window was then punctured with the tip of a pulled glass micropipette or 35 G polyimide tubing (WPI Instrument), and the leaked liquid was absorbed using sterile gauze. Two microliters of vector were then injected using the micropipette (approximately 0.5 mm deep) or polyimide tubing. The injection lasted approximately 30 seconds. Once delivery was complete, a small piece of clavicle-mastoid muscle was cut and pushed into the bleb to cover the round window. The adipose tissue was then returned to its original area. The skin incision was then closed using 3-4 drops of GLUture (Zoetis Inc.) and allowed to dry for 1-2 minutes. The animal was then transferred to a clean, warm recovery cage. The animals were checked for 5 days postoperatively for signs of pain, infection, or other distress. Pain medication was administered once daily for the first three days after surgery. Animals also received saline, nutritional support, and additional pain medication as needed.

[0315] Auditory brainstem response Mice were assessed for peripheral hearing function by auditory brainstem response (ABR) 4 weeks after injection. After anesthesia (ketamine 100 mg / kg, ip; xylazine 10 mg / kg, ip; additional ketamine if necessary) was administered and adequate anesthesia depth was confirmed, subdermal needle electrodes were placed at the apex and ventral side of the pinna (differential recording), and at the base of the tail (ground). A custom sound system (Eaton-Peabody Laboratories, MEE) containing two speakers and a probe-tube microphone was placed in the ear canal, and in-ear calibration was performed before each testing session. Calibration of the probe-tube microphone was performed using a reference ¼-inch microphone and preamplifier (PCB Piezotronics models 2530, 426B31; Larson-Davis model 2221). In-ear calibration was performed using a probe-tube microphone and a custom microphone amplifier (Eaton-Peabody Laboratories, MEE). All ABR stimuli and responses were generated and acquired using an RZ6 Multi-I / O signal processor and BioSigRZ software (Tucker-Davis Technologies). Responses from the needle electrodes were amplified and digitized with a RA4PAMedusa preamplifier connected to a RA4LI low impedance headstage (Tucker-Davis Technologies). ABR stimuli were delivered in the form of 5 ms tone pips (0.5 ms cos stimuli) at 22.6 kHz. 2 Ramp) and were presented at a rate of 40 / s with alternating polarity from 5 to 105 dBSPL in 5 dB steps. For each volume, a total of 1024 trials were averaged (after removal of artifacts), digitally filtered (0.1–5 kHz), and further high-pass filtered offline (0.3 kHz). ABR thresholds were determined by visual inspection of stacked waveforms ("waterfall plots") as the lowest sound level at which a reproducible peak or trough was detected. If no response was detected up to the instrument's limit (105 dB SPL), an upper limit of 110 dBSPL was assigned. The results of the ABR threshold at 22.6 kHz are shown in Figure 1A.

[0316] immunohistochemistry After physiological testing was completed, mice were euthanized by carbon dioxide inhalation overdose. Immediately after euthanasia, mice were perfused with 10% neutral buffered formalin (NBF) via the vascular system. Cochleae were collected and immersed in 10% NBF for 2–16 h, followed by decalcification in 8% EDTA for 3 days. Cochleae were excised from the decalcified temporal bones and washed three times with PBS. After incubation in a blocking solution of 5% horse serum in PBST (0.5% Triton X-100 in 1x PBS) for 1 h at room temperature, dissected cochlear pieces were incubated in mouse anti-otoferlin antibody (abcam ab53233, diluted 1:200 in PBST) for 12–16 h at 4°C, followed by washing three times with PBS and incubation in Alexa568 donkey anti-mouse secondary antibody (ThermoFisher Scientific A10037) for 1–2 h at room temperature. After counterstaining with DAPI and a final wash in PBS, the cochlear pieces were mounted on glass slides using Vectashield mounting medium (Vector Laboratories H-1000) and covered with a glass coverslip. The tissue was imaged using a Zeiss Axio ImagerM2 microscope. Images are shown in Figure 1B.

[0317] Example 2. Administration of high doses of OTOF isoform 5 enhances OTOF Q828X / Q828X Improved functional recovery in mice OTOF Q828X / Q828X To evaluate the effect of administration of high doses of OTOF isoform 5 on functional recovery in mutant mice, the vector (AAV1-smCBA-OTOF isoform 5 (native or codon optimized)) was administered to 4- to 7-week-old OTOF mice as described in Example 1 above. Q828X / Q828XThe vectors were injected through the round window membrane of mice. Similar to the vectors used in Example 1, the polynucleotide encoding the N-terminal portion of the OTOF protein and the polynucleotide encoding the C-terminal portion of the OTOF protein were split between the two vectors of the double hybrid vector system using the exon 20 / 21 boundary, and the AP gene fragment (SEQ ID NO: 51) was used as the recombinogenic region of both vectors of the double hybrid vector system. As described in Example 1 above, the ABR response was measured approximately 4 weeks after the virus injection. Compared to animals administered the 7E9 or 6E9 vector genome / ear (Figure 1A), these animals showed a stronger ABR response regardless of codon optimization (Figure 2).

[0318] Example 3. Administration of a composition containing a double hybrid vector expressing OTOF to mice restores electrophysiological characteristics of hearing function Homozygous (HOM) OTOF-Q828X mice (7 weeks old) were left untreated or injected with 4E10 (4 × 10 10 ) vector genome (vg) / in the ear was treated (by injection through the round window membrane). There, exons 1 to 20 of the polynucleotide encoding the N-terminal portion of the OTOF protein (SEQ ID NO: 56), and exons 21 to 45 and 47 of the polynucleotide encoding the C-terminal portion of the OTOF protein (SEQ ID NO: 57) were delivered in separate vectors (Figure 3A). The AP recombination induction region (SEQ ID NO: 51) was included in both vectors of the double hybrid vector system. Auditory brainstem response (ABR) thresholds were used to assess hearing function. Untreated animals (Otof HOM untreated) showed no detectable recovery of hearing function, whereas treated animals showed a strong recovery, consistent from 4 weeks post-treatment (Otof HOM 4 weeks post-treatment) to 8 weeks post-treatment (Otof HOM 8 to 11 weeks post-treatment). ABR thresholds in heterozygous animals (Otof HET) were also tested.

[0319] In a separate set of experiments, homozygous OTOF-Q828X mice were either left untreated or administered 4E10 (4 × 10 10 )vg / ear were treated (by injection through the round window membrane) (Figure 3B). The first vector contained exons 1 to 20 of the polynucleotide encoding the N-terminal portion of the OTOF protein (SEQ ID NO: 56), as well as exons 21 to 45 and 47 of the polynucleotide encoding the C-terminal portion of the OTOF protein (SEQ ID NO: 57), and both vectors contained the AP recombination region (SEQ ID NO: 51). Untreated animals showed no detectable recovery of hearing function, whereas treated animals showed robust recovery 4 weeks after treatment (Otof HOM 4 weeks after treatment). When these same animals were evaluated 8 weeks after treatment (Otof HOM 8 weeks after treatment), ABR thresholds were increased, suggesting poor durability of recovery due to the smCBA promoter. ABR thresholds of heterozygous animals were also tested.

[0320] In yet another set of experiments, homozygous OTOF-Q828X mice were either left untreated or injected with the AAV1-smCBA (SEQ ID NO: 44)-hOTOF (isoform 5, SEQ ID NO: 1) double hybrid vector at 8E9 (8 × 10 9 )vg / ear (low dose), 1.6E10(1.6×10 10 ) vg / ear (medium dose), or 6.4E10 (6.4 × 10 10)vg / ear (high dose) or OTOF (high dose) (by injection through the round window membrane). The first vector contained exons 1-20 of the polynucleotide encoding the N-terminal portion of the OTOF protein (SEQ ID NO:56), as well as exons 21-45 and 47 of the polynucleotide encoding the C-terminal portion of the OTOF protein (SEQ ID NO:57), and both vectors contained the AP recombination region (SEQ ID NO:51). ABR thresholds were used to assess hearing function at 4 and 8 weeks after treatment (Figure 3C). Dose-dependent recovery of ABRs was observed at both time points. Comparing the 8-week and 4-week time points, recovery of hearing function was stable at the low and mid doses, but decreased in the high-dose animals. ABR thresholds in heterozygous animals were also tested.

[0321] Example 4. Administration of a composition containing a double hybrid vector expressing mouse OTOF to mice restores electrophysiological characteristics of hearing function Homozygous OTOF-Q828X mice (6-7 weeks old) were treated with AAV2quad(YF)-Myo15(SEQ ID NO:21)-mouse OTOF (mOTOF, transcript variant 1, RefSeq NM_001100395) and AAV2quad(YF)-Myo15(SEQ ID NO:31)-mOTOF (transcript variant 1, RefSeq NM_001100395) double hybrid vector systems by injection through the round window membrane as described above (total injection volume 2 μL, 1 μL of each vector). Hearing function was assessed using ABR thresholds. Exons 1-20 of the polynucleotide encoding the N-terminal portion of the mOTOF protein were included in the 5' vector and the remaining C-terminal portion of the mOTOF polynucleotide was included in the 3' vector. The AP recombination induction region (SEQ ID NO:51) was included in both vectors of the double hybrid vector system. The titer of the 5'AAV2quad(YF)-Myo15 (SEQ ID NO: 21)-mOTOF vector was 1.49E12vg / mL, the titer of the 5'AAV2quad(YF)-Myo15 (SEQ ID NO: 31)-mOTOF vector was 2.68E12vg / mL, and the titers of the corresponding 3' vectors were 1.05E12vg / mL and 1.58E12vg / mL. Untreated animals showed no detectable recovery of hearing function, whereas treated animals showed robust recovery, which was consistent from 4 weeks post-treatment to 17 weeks post-treatment (Figure 4). Figure 4 shows the mean hearing threshold at 22.6 kHz + / - standard deviation.

[0322] Example 5. Double hybrid vectors can be used to express full-length functional GFP in hair cells of non-human primates A 2.6-year-old non-human primate received a local injection of the AAV1-Myo15 (SEQ ID NO: 21)-GFP (viral titer of 3.18E13vg / mL for the 5' vector and 3.42E13vg / mL for the 3' vector) double hybrid vector system at the round window of the cochlea at a flow rate of 6 μL / min (total injection volume of 60 μL, 30 μL of each vector). Four weeks after injection, the cochlea was removed and the basilar plate was surface treated. The double hybrid vector resulted in GFP expression in hair cells throughout the basal-apical axis of the cochlea. High magnification images at 4 kHz showed that GFP expression was observed within the inner hair cells (IHC) (Figure 5B). Immunohistochemistry for Myo7A was used to visualize hair cells (Figure 5A) and nuclei were stained with DAPI (Figure 5C).

[0323] Example 6. Construction of a two-hybrid vector system encoding human OTOF HEK293T cells (obtained from ATCC, Manassas, VA) were seeded onto cell culture-treated dishes until they reached 70–80% confluence in the vessel. Gene transfer was performed using the AAV-1 packaging system from Cell Biolabs, Inc. (San Diego, CA). Culture surface area was 175 cm. 2 Per fraction, 16 μg of pHelper, 8 μg of pAAV-RC1, and 8 μg of transfer plasmid SEQ ID NO:66 were mixed with PEI (PEIpro, polyplus) in a 1:1 weight ratio. The DNA / PEI mixture was then added to the cell culture medium. Three days after transfection, the cell culture medium and cells were harvested to extract and purify AAV. The AAV from the cell culture medium was concentrated by tangential flow filtration. The AAV from the cells was released from the cells by three cycles of freeze-thawing. The AAV from either fraction was finally purified by iodixanol density gradient purification, and the purified AAV and sterile DPBS (Mg+, Ca+) containing 0.01% Pluronic F68 were passed through a 100 kDa MWCO centrifugal filter to exchange buffer, generating purified AAV, which is the first member of the dual vector system. A similar procedure was performed using the transfer plasmid SEQ ID NO:67 to create the second member of the dual vector system.

[0324] The same procedure was used to generate a dual vector system encoding OTOF with AAV9, except that during the gene transfer step, pAAV-RC1 was replaced with an equivalent plasmid containing the AAV9 cap gene instead of the AAV1 cap gene.

[0325] Example 7. A two-hybrid vector system encoding human OTOF is expressed in non-human primates In non-human primates (NHPs), the native otoferlin protein is expressed in sensory cells of the inner ear. The BaseScope™ system was used to detect expression of virally transduced human otoferlin in NHPs.

[0326] An initial cohort of six naive NHPs (1.5-4 years old) were injected through the round window membrane with the Myo15-otoferlin double hybrid vector packaged in the AAV1 serotype as described in Example 6. Each ear received 1.1 × 10 of each of the two vectors. 12 The copies were combined and administered in a total volume of 60 μl. The ears were vented at the lateral semicircular canal to allow for outflow of perilymph during viral delivery. A second cohort of naive NHPs (1.5-4 years old) were injected in the same manner and dose as the first cohort using the Myo15-otoferlin double hybrid system packaged in the AAV9 serotype, also as described in Example 6.

[0327] Four weeks after viral vector injection, all animals were sacrificed by cardiac perfusion with 10% neutral buffered formalin (NBF) and temporal bones were harvested. After decalcification in Immunocal for 5 days, the temporal bones were embedded in paraffin, sectioned at 5 μm intervals, and stained with BaseScope™ (Advanced Cell Diagnostics, Newark, CA) using a probe specific for spliced ​​mRNA at the junction of the two vectors between exons 20 and 21 of human otoferlin. Thus, detection required that the dual vectors were properly hybridized in vivo and expressed full-length human OTOF isoform 5.

[0328] The BaseScope™ assay was performed on a LeicaBondRX automated staining platform. Briefly, paraffin sections were baked at 60°C for 30 min and deparaffinized. The standard BaseScope™ protocol was performed with the E20 / 21 probe, including a target retrieval step at 95°C for 5 min, followed by a proteinase step at 40°C for 10 min, and finally eight amplification steps. Probe signal was detected using FastRed dye, which can be observed as a red stain in a brightfield microscope. Images were first scanned and digitized at 40x magnification and screened for positivity. Positive signals were then confirmed using the fluorescent signal of the fast red dye using confocal imaging (63x, 1.4NA, excitation: 568nm at 1% laser power, emission BP578-730nm on detector at 642V). Figure 6 shows sections from a representative NHP treated with the Myo15-otoferlin AAV1 dual vector system. In AAV1-injected animals, clear positivity was observed in sensory cells in all injected animals, with a bias towards the apical turn of the cochlea and the utricle. In AAV9-injected animals, 3 out of 6 animals showed clear positivity, with a similar trend in expression in the apical turn of the cochlea and the utricle (not shown). In both cases, OTOF transcripts were localized to the inner hair cells, outer hair cells, and hair cells of the vestibular apparatus.

[0329] Example 8. Quantification and localization of an alternative Myo15 promoter double hybrid vector system encoding eGFP in NHPs To confirm the specificity and transduction efficiency of the hair cell-specific Myo15 promoter in NHPs, a dual vector system was used with the same recombination region and promoter as described in Example 6, except that the 5' and 3' portions of human otoferlin in each of the two vectors were replaced by the first 393 nucleotides encoding the 5' portion of eGFP in the 5' vector and the last 908 nucleotides encoding the 3' portion of eGFP in the 3' vector, respectively. eGFP can be easily detected even in the otoferlin wild-type background.

[0330] All animals received an injection of 60 μl of the dual viral vectors through the round window membrane and the ear was vented at the lateral semicircular canal. Animals used in this study were 1.5–4 years old. Six NHP ears were injected with an alternative vector expressing eGFP under the Myo15 promoter of the AAV1 serotype mentioned above at 1.6 × 10 per ear. 12 Another six NHP ears were injected with the same alternate dual viral vector system expressing eGFP under the Myo15 promoter in the AAV9 serotype at a titer of 1.9 × 10 per ear. 12 Titers of vector genomes were injected into the mice. The dose for the NHP study was adjusted by correlating mouse expression data from previous mid- and high-dose experiments and comparing it to the smaller NHP mid-dose study (Table 5 below). The likely NHP outcomes were estimated as the percentage of inner hair cells (IHCs) expressing eGFP from the high-dose dual-vector approach (Table 5).

[0331] [Table 5]

[0332] Using the native eGFP signal as readout, whole-mount confocal imaging (40x, 0.95 NA, excitation: 488 nm at 14% laser power, emission BP 495-543 nm at 600V detector gain) was used to confirm expression in NHPs throughout the organ of Corti (Error! Source unknown. Figure 7A). Quantification of the number of inner hair cells showing expression correlated well with predictions from dose titration of the AAV1 serotype (Error! Source unknown. Figure 7B), with the AAV9 serotype showing lower expression rates.

[0333] Example 9. Administration of a composition containing a double hybrid vector expressing OTOF isoform 5 to a subject with sensorineural hearing loss According to the methods disclosed herein, a practitioner of the art can treat a patient, e.g., a human patient, having sensorineural hearing loss (sensorineural hearing loss associated with a mutation in OTOF), thereby improving or restoring hearing. To this end, a practitioner of the art can prepare a first AAV vector (e.g., a Myo15 promoter (e.g., SEQ ID NO: 19, 21, 22, 31, or 32) operably linked to exons 1-20 of a polynucleotide encoding an OTOF isoform 5 protein (e.g., a polynucleotide having the sequence of SEQ ID NO: 1, e.g., SEQ ID NO: 56), a splice donor sequence 3' of the polynucleotide sequence, and an AP recombinogenic region 3' of the splice donor sequence (e.g., an AP gene fragment, any one of SEQ ID NOs: 48-53, e.g., SEQ ID NO: 51). A composition can be administered to a human patient comprising a first AAV vector (e.g., AAV1) and a second AAV vector (e.g., AAV1) comprising an AP recombination induction region (AP gene fragment, any one of SEQ ID NOs: 48-53, e.g., SEQ ID NO: 51), a splice acceptor sequence 3' of the recombination induction region, a polynucleotide 3' of the splice acceptor sequence including exons 21-45 and 47 of a polynucleotide encoding an OTOF isoform 5 protein (e.g., human OTOF isoform 5, e.g., a polynucleotide having the sequence of SEQ ID NO: 1, e.g., SEQ ID NO: 57), and a bGH poly(A) sequence. A composition containing a double hybrid AAV vector can be administered to a patient, for example, by local administration to the inner ear (e.g., by injection through the round window membrane, injection into the semicircular canals, or by canalostomy) to treat sensorineural hearing loss.

[0334] After the composition is administered to the patient, those skilled in the art can monitor the development of OTOF and the improvement of the patient in response to the treatment in various ways.For example, the doctor can monitor the hearing of the patient by performing standard tests such as hearing test, ABR, electrocochleography (ECOG), and measurement of otoacoustic emissions after the composition is administered.If it is found that the hearing test results before the composition are compared with the one or more tests after the composition is administered show improvement in the patient's hearing (e.g., improved ABR), it indicates that the patient is responding favorably to the treatment.Subsequent doses can be determined and administered as necessary.

[0335] Exemplary embodiments of the present invention are described in the following enumerated paragraphs. E1. A first adeno-associated virus (AAV) vector comprising a Myo15 promoter operably linked to a first coding polynucleotide encoding an N-terminal portion of otoferlin (OTOF) isoform 5 protein, a splice donor signal sequence located at a 3' position of the first coding polynucleotide, and a first recombinogenic region located at a 3' position of the splice donor signal sequence; a second AAV vector comprising a second recombinogenic region, a splice acceptor signal sequence located at a 3' position of the second recombinogenic region, a second coding polynucleotide encoding a C-terminal portion of an OTOF isoform 5 protein located at a 3' position of the splice acceptor signal sequence, and a poly(A) sequence located at a 3' position of the second coding polynucleotide; A dual vector system, wherein the first coding polynucleotide and the second coding polynucleotide encoding the OTOF isoform 5 protein do not overlap, and neither the first AAV vector nor the second AAV vector encodes the full-length OTOF isoform 5 protein.

[0336] E2. The dual vector system of E1, wherein the first AAV vector and the second AAV vector comprise an AAV1 capsid. E3. The dual vector system of E1 or E2, wherein the Myo15 promoter comprises a first region having at least 85% sequence identity to SEQ ID NO:7 or a functional part or derivative thereof, comprising the sequence of SEQ ID NO:9 and / or SEQ ID NO:10, and a second region having at least 85% sequence identity to SEQ ID NO:8 or a functional part or derivative thereof, comprising the sequence of SEQ ID NO:14 and / or SEQ ID NO:15, operably linked thereto, and optionally comprising a linker comprising 1 to 100 nucleotides between said first and second regions.

[0337] E4. The dual vector system of E3, wherein said first region comprises or consists of the sequence of SEQ ID NO:7. E5. The dual vector system of E3, wherein the functional portion of SEQ ID NO:7 comprises the sequence of SEQ ID NO:9.

[0338] E6. The dual vector system of E3, wherein the functional part of SEQ ID NO:7 comprises the sequence of SEQ ID NO:10. E7. The dual vector system of E3, wherein the functional part of SEQ ID NO:7 comprises the sequence of SEQ ID NO:9 and the sequence of SEQ ID NO:10.

[0339] E8. The dual vector system of E7, wherein the functional part of SEQ ID NO:7 comprises the sequence of SEQ ID NO:11. E9. The dual vector system of E7, wherein the functional part of SEQ ID NO:7 comprises the sequence of SEQ ID NO:12.

[0340] E10. The dual vector system of E7, wherein the functional part of SEQ ID NO:7 comprises the sequence of SEQ ID NO:13. E11. The dual vector system of E7, wherein the functional part of SEQ ID NO:7 comprises the sequence of SEQ ID NO:33.

[0341] E12. The dual vector system of any one of E3 to E11, wherein the second region comprises or consists of the sequence of SEQ ID NO:8. E13. The dual vector system according to any one of E3 to E11, wherein the functional part of SEQ ID NO:8 comprises the sequence of SEQ ID NO:14.

[0342] E14. The dual vector system according to any one of E3 to E11, wherein the functional part of SEQ ID NO:8 comprises the sequence of SEQ ID NO:15. E15. The dual vector system according to any one of E3 to E11, wherein the functional part of SEQ ID NO:8 comprises the sequence of SEQ ID NO:14 and the sequence of SEQ ID NO:15.

[0343] E16. The dual vector system of E15, wherein the functional part of SEQ ID NO:8 comprises the sequence of SEQ ID NO:16. E17. The dual vector system of E15, wherein the functional part of SEQ ID NO:8 comprises the sequence of SEQ ID NO:17.

[0344] E18. The dual vector system of E15, wherein the functional part of SEQ ID NO:8 comprises the sequence of SEQ ID NO:18. E19. The dual vector system according to any one of E3 to E11, wherein the functional part of SEQ ID NO:8 comprises the sequence of SEQ ID NO:34.

[0345] E20. The dual vector system according to any one of E3 to E11, wherein the functional part of SEQ ID NO:8 comprises the sequence of SEQ ID NO:35. E21. The dual vector system according to any one of E3 to E11, wherein the functional part of SEQ ID NO:8 comprises the sequence of SEQ ID NO:34 and the sequence of SEQ ID NO:35.

[0346] E22. The dual vector system of E21, wherein the functional part of SEQ ID NO:8 comprises the sequence of SEQ ID NO:38. E23. The dual vector system of E3, wherein said Myol5 promoter comprises or consists of the sequence of SEQ ID NO:19.

[0347] E24. The dual vector system of E3, wherein said Myol5 promoter comprises or consists of the sequence of SEQ ID NO:21. E25. The dual vector system of E3, wherein said Myol5 promoter comprises or consists of the sequence of SEQ ID NO: 22.

[0348] E26. The dual vector system of E3, wherein said Myol5 promoter comprises or consists of the sequence of SEQ ID NO: 42. E27. The dual vector system of E3, wherein said Myol5 promoter comprises or consists of the sequence of SEQ ID NO: 43.

[0349] E28. The dual vector system of E1 or E2, wherein the Myo15 promoter comprises a first region having at least 85% sequence identity to SEQ ID NO: 23 or a functional part or derivative thereof comprising sequence SEQ ID NO: 25, and a second region having at least 85% sequence identity to SEQ ID NO: 24 or a functional part or derivative thereof comprising sequence SEQ ID NO: 26 and / or SEQ ID NO: 27 operably linked thereto, and optionally comprising a linker comprising 1 to 400 nucleotides between the first and second regions.

[0350] E29. The dual vector system of E28, wherein said first region comprises or consists of the sequence of SEQ ID NO:23. E30. The dual vector system of E28, wherein the functional part of SEQ ID NO:23 comprises the sequence of SEQ ID NO:25.

[0351] E31. The dual vector system of any one of E28 to E30, wherein the second region comprises or consists of the sequence of SEQ ID NO:24. E32. The dual vector system according to any one of E28 to E30, wherein the functional part of SEQ ID NO:24 comprises the sequence of SEQ ID NO:26.

[0352] E33. The dual vector system according to any one of E28 to E30, wherein the functional part of SEQ ID NO:24 comprises the sequence of SEQ ID NO:27. E34. The dual vector system according to any one of E28 to E30, wherein the functional part of SEQ ID NO:24 comprises the sequence of SEQ ID NO:26 and the sequence of SEQ ID NO:27.

[0353] E35. The dual vector system of E34, wherein the functional part of SEQ ID NO:24 comprises the sequence of SEQ ID NO:28. E36. The dual vector system of E34, wherein the functional part of SEQ ID NO:24 comprises the sequence of SEQ ID NO:29.

[0354] E37. The dual vector system of E34, wherein the functional part of SEQ ID NO:24 comprises the sequence of SEQ ID NO:30. E38. The dual vector system of E28, wherein said Myol5 promoter comprises or consists of the sequence of SEQ ID NO: 31.

[0355] E39. The dual vector system of E28, wherein said Myol5 promoter comprises or consists of the sequence of SEQ ID NO: 32. E40. The dual vector system of E1 or E2, wherein said Myol5 promoter comprises a sequence having at least 85% sequence identity to SEQ ID NO: 34.

[0356] E41. The dual vector system of E1 or E2, wherein said Myol5 promoter comprises a sequence having at least 85% sequence identity to SEQ ID NO:38. E42. The dual vector system of E1 or E2, wherein said Myol5 promoter comprises a sequence having at least 85% sequence identity to SEQ ID NO:39.

[0357] E43. The dual vector system of E1 or E2, wherein said Myol5 promoter comprises a sequence having at least 85% sequence identity to SEQ ID NO: 40. a first AAV1 vector comprising a ubiquitous promoter operably linked to a first coding polynucleotide encoding an N-terminal portion of E44.OTOF isoform 5 protein, a splice donor signal sequence located at a 3' position of the first coding polynucleotide, and a first recombinogenic region located at a 3' position of the splice donor signal sequence; a second AAV1 vector comprising a second recombinogenic region, a splice acceptor signal sequence located at a 3' position of the second recombinogenic region, a second coding polynucleotide encoding a C-terminal portion of an OTOF isoform 5 protein located at a 3' position of the splice acceptor signal sequence, and a poly(A) sequence located at a 3' position of the second coding polynucleotide; A dual vector system, wherein the first coding polynucleotide and the second coding polynucleotide do not overlap, and neither the first AAV1 vector nor the second AAV1 vector encodes the full-length OTOF isoform 5 protein.

[0358] E45. The dual vector system of E44, wherein said ubiquitous promoter is selected from the group consisting of CAG promoter, cytomegalovirus (CMV) promoter, and truncated CMV-chicken β-actin promoter (smCBA promoter).

[0359] E46. The dual vector system of E45, wherein said ubiquitous promoter is a smCBA promoter. E47. The dual vector system of E46, wherein said smCBA promoter comprises or consists of the sequence of SEQ ID NO:44.

[0360] E48. The dual vector system of any one of E1 to E47, wherein the first recombination induction region and the second recombination induction region are the same. E49. The dual vector system of any one of E1 to E48, wherein the first recombinogenic region and / or the second recombinogenic region is an AK recombinogenic region.

[0361] E50. The dual vector system of E49, wherein said AK recombinogenic region comprises or consists of the sequence of SEQ ID NO:47. E51. The dual vector system of any one of E1 to E48, wherein the first recombination induction region and / or the second recombination induction region is an AP gene fragment.

[0362] E52. The dual vector system of E51, wherein the AP gene fragment comprises or consists of any one of SEQ ID NOs: 48-53. E53. The dual vector system of E52, wherein said AP gene fragment comprises or consists of the sequence of SEQ ID NO:51.

[0363] E54. The dual vector system of any one of E1-E53, wherein the first coding polynucleotide and the second coding polynucleotide each encode approximately half of the OTOF isoform 5 protein sequence.

[0364] E55. The dual vector system of any one of E1-E54, wherein the first coding polynucleotide and the second coding polynucleotide are separated by an OTOF exon boundary.

[0365] E56. The dual vector system of E55, wherein the first coding polynucleotide and the second coding polynucleotide are split at the OTOF exon 20 / exon 21 boundary.

[0366] E57. A dual vector system described in any one of E1 to E55, wherein the first coding polynucleotide consists of exons 1 to 20 of a polynucleotide encoding an OTOF isoform 5 protein, and the second coding polynucleotide consists of exons 21 to 45 and 47 of a polynucleotide encoding an OTOF isoform 5 protein.

[0367] E58. The dual vector system of any one of E1 to E57, wherein the first coding polynucleotide and the second coding polynucleotide encoding the OTOF isoform 5 protein do not contain an intron.

[0368] E59. The dual vector system of any one of E1-E58, wherein the OTOF isoform 5 protein is a human OTOF isoform 5 protein. E60. The dual vector system of any one of E1-E59, wherein the OTOF isoform 5 protein comprises the sequence of SEQ ID NO:1, or a variant thereof having one or more conservative amino acid substitutions.

[0369] E61. The dual vector system of E60, wherein no more than 10% of the amino acids in said OTOF isoform 5 protein variant are conservative amino acid substitutions. E62. The dual vector system of E60, wherein said OTOF isoform 5 protein consists of the sequence of SEQ ID NO:1.

[0370] E63. The dual vector system of any one of E1 to E60 and E62, wherein the OTOF isoform 5 protein is encoded by the sequence of SEQ ID NO:2. E64. The dual vector system of any one of E1 to E60 and E62, wherein the OTOF isoform 5 protein is encoded by the sequence of SEQ ID NO:3.

[0371] E65. The dual vector system of any one of E1 to E64, wherein the first coding polynucleotide encodes amino acids 1 to 802 of SEQ ID NO:1 and the second coding polynucleotide encodes amino acids 803 to 1997 of SEQ ID NO:1.

[0372] E66. The dual vector system of any one of E1 to E65, wherein the N-terminal portion of the OTOF isoform 5 protein consists of the sequence of SEQ ID NO: 58, or a variant thereof having one or more conservative amino acid substitutions.

[0373] E67. The dual vector system of E66, wherein 10% or less (e.g., 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less) of the amino acids in the N-terminal portion of the OTOF isoform 5 protein variant are conservative amino acid substitutions.

[0374] E68. The dual vector system of E66, wherein the N-terminal portion of the OTOF isoform 5 protein consists of the sequence of SEQ ID NO: 58. E69. The dual vector system of any one of E1 to E66 and E68, wherein the N-terminal portion of the OTOF isoform 5 protein is encoded by the sequence of SEQ ID NO: 56.

[0375] E70. The dual vector system of any one of E1 to E69, wherein the C-terminal portion of the OTOF isoform 5 protein consists of the sequence of SEQ ID NO: 59, or a variant thereof having one or more conservative amino acid substitutions.

[0376] E71. The dual vector system of E70, wherein 10% or less (e.g., 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less) of the amino acids in the C-terminal portion of the OTOF isoform 5 protein variant are conservative amino acid substitutions.

[0377] E72. The dual vector system of E70, wherein the C-terminal portion of the OTOF isoform 5 protein consists of the sequence of SEQ ID NO:59. E73. The dual vector system of any one of E1 to E70 and E72, wherein the C-terminal portion of the OTOF isoform 5 protein is encoded by the sequence of SEQ ID NO:57.

[0378] E74. The dual vector system of any one of E1-E73, wherein the first vector comprises a first inverted terminal repeat (ITR) sequence 5' of the promoter and a second ITR sequence 3' of the recombinogenic region, and the second vector comprises a first ITR sequence 5' of the recombinogenic region and a second ITR sequence 3' of the poly(A) sequence.

[0379] E75. The dual vector system of E74, wherein the ITRs of the first vector and the second vector are AAV2 ITRs and have at least 80% sequence identity to the AAV2 ITRs (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity).

[0380] E76. The dual vector system of any one of E1-E75, wherein said poly(A) sequence is the bovine growth hormone (bGH) poly(A) signal sequence. E77. The dual vector system of any one of E1 to E76, wherein the splice donor sequence of the first vector comprises or consists of the sequence of SEQ ID NO: 54.

[0381] E78. The dual vector system of any one of E1 to E77, wherein the splice acceptor sequence of the second vector comprises or consists of the sequence of SEQ ID NO: 55. E79. The dual vector system of any one of E1-E78, wherein the first AAV vector comprises a Kozak sequence 3' of the promoter and 5' of the first coding polynucleotide encoding the N-terminal portion of the OTOF isoform 5 protein.

[0382] E80. The dual vector system of E1, wherein the first AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 2272 to 6041 of SEQ ID NO: 60. E81. The dual vector system of E1 or E80, wherein the first AAV vector comprises a polynucleotide sequence comprising, or consisting of, the sequence of nucleotides 2049 to 6264 of SEQ ID NO: 60.

[0383] E82. The dual vector system of E1, wherein the first AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 182 to 3949 of SEQ ID NO: 62. E83. The dual vector system of E1 or E82, wherein the first AAV vector comprises a polynucleotide sequence comprising, or consisting of, the sequence of nucleotides 19 to 4115 of SEQ ID NO: 62.

[0384] E84. The dual vector system of E44, wherein the first AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 2267 to 6014 of SEQ ID NO: 64. E85. The dual vector system of E44 or E84, wherein the first AAV vector comprises a polynucleotide sequence comprising, or consisting of, the sequence of nucleotides 2049 to 6237 of SEQ ID NO: 64.

[0385] E86. The dual vector system of E44, wherein the first AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 177 to 3924 of SEQ ID NO: 65. E87. The dual vector system of E44 or E86, wherein the first AAV vector comprises a polynucleotide sequence comprising, or consisting of, a sequence of positions 19 to 4090 of SEQ ID NO: 65.

[0386] E88. The dual vector system of any one of E1, E44, E80, E81, E84, and E85, wherein the second AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 2267 to 6476 of SEQ ID NO: 61.

[0387] E89. The dual vector system of any one of E1, E44, E80, E81, E84, E85, and E88, wherein the second AAV vector comprises a polynucleotide sequence comprising, or consisting of, the sequence of nucleotides 2049 to 6693 of SEQ ID NO: 61.

[0388] E90. The dual vector system of any one of E1, E44, E82, E83, E86, and E87, wherein the second AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 187 to 4396 of SEQ ID NO: 63.

[0389] E91. The dual vector system of any one of E1, E44, E82, E83, E86, E87, and E90, wherein the second AAV vector comprises a polynucleotide sequence comprising, or consisting of, nucleotides 19 to 4589 of SEQ ID NO: 63.

[0390] E92. The dual vector system of E1, wherein the first AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 235 to 4004 of SEQ ID NO: 66. E93. The dual vector system of E1 or E92, wherein the first AAV vector comprises a polynucleotide sequence comprising, or consisting of, the sequence of nucleotides 12 to 4227 of SEQ ID NO: 66.

[0391] E94. The dual vector system of E44, wherein the first AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 230 to 3977 of SEQ ID NO: 68. E95. The dual vector system of E44 or E94, wherein the first AAV vector comprises a polynucleotide sequence comprising, or consisting of, the sequence of nucleotides 12 to 4200 of SEQ ID NO: 68.

[0392] E96. The dual vector system of any one of E1, E44, and E92-E95, wherein the second AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 229 to 4438 of SEQ ID NO: 67.

[0393] E97. The dual vector system of any one of E1, E44, and E92-E96, wherein the second AAV vector comprises a polynucleotide sequence comprising, or consisting of, nucleotides 12 to 4655 of SEQ ID NO: 67.

[0394] E98. A method for increasing OTOF expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the dual vector system described in any one of E1 to E97.

[0395] E99. A method of treating a subject having or at risk of developing sensorineural hearing loss, the method comprising administering to the subject a therapeutically effective amount of the dual vector system described in any one of E1-E97.

[0396] E100. A method of treating a subject having or at risk of developing auditory neuropathy, said method comprising administering to said subject a therapeutically effective amount of the dual vector system described in any one of E1-E97.

[0397] E101. The method of any one of E98 to E100, wherein the subject has a mutation in OTOF. E102. The method of any one of E98-E100, wherein the subject has been identified as having a mutation in OTOF.

[0398] E103. The method of any one of E98-E100, wherein the method further comprises identifying the subject as having a mutation in OTOF prior to administering the dual vector system.

[0399] E104. The method of any one of E98-E103, wherein the subject has, or is confirmed as having, autosomal recessive deafness 9 (DFNB9). E105. The method of any one of E98-E104, wherein the method further comprises assessing the subject's hearing prior to administering the dual vector system.

[0400] E106. The method of any one of E98-E105, wherein the dual vector system is administered locally to the middle ear or inner ear. E107. The method of E106, wherein said dual vector system is administered by injection through the round window membrane, injection into the semicircular canal, canalostomy, insertion of a catheter through the round window membrane, middle ear injection, or intratympanic injection.

[0401] E108. The method according to any one of E98 to E107, wherein said method increases OTOF expression in cochlear hair cells. E109. The method of E108, wherein the cochlear hair cells are inner hair cells.

[0402] E110. The method according to any one of E98 to E109, wherein the subject is a mammal. E111. The method of E110, wherein the subject is a human.

[0403] E112. The method of any one of E98 to E111, wherein the method further comprises assessing the subject's hearing after administering the dual vector system. E113. The method of any one of E98-E112, wherein said dual vector system prevents or reduces hearing loss, delays the onset of said hearing loss, slows the progression of said hearing loss, improves hearing, improves speech discrimination, or improves hair cell function.

[0404] E114. The method of any one of E98-E113, wherein the dual vector system is administered in an amount sufficient to increase OTOF expression in cochlear hair cells, prevent or reduce hearing loss, delay the onset of hearing loss, slow the progression of hearing loss, improve hearing, improve speech discrimination, or improve hair cell function.

[0405] E115. A method for increasing OTOF expression in a cell, said method comprising introducing into said cell the dual vector system described in any one of E1 to E97.

[0406] E116. The method of E115, wherein said cells are cochlear hair cells. E117. The method of E116, wherein the cell is an inner hair cell. E118. The method according to any one of E115 to E117, wherein said cell is a mammalian cell.

[0407] E119. The method of E118, wherein the cell is a human cell. E120. The method according to any one of E98 to E119, wherein said first vector and said second vector are administered simultaneously.

[0408] E121. The method of any one of E98 to E120, wherein the first vector and the second vector are administered sequentially. E122. The first vector and the second vector are about 1 x 10 7 Vector genome (VG) / ear ~ approx. 2 x 10 15 The method of any one of E98 to E121, administered at a concentration of VG / ear.

[0409] Other embodiments Various modifications and variations of the invention described herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific embodiments, it should be understood that the invention as claimed should not be unnecessarily limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are apparent to those skilled in the art are intended to be within the scope of the invention. Other embodiments are within the scope of the claims.

Claims

1. A first adeno-associated virus (AAV) vector comprising: a myosin 15 (Myo15) promoter operably linked to a first coding polynucleotide encoding an N-terminal portion of human otoferlin (OTOF) isoform 5 protein; a splice donor signal sequence located at the 3' position of the first coding polynucleotide; and a first recombination induction region located at the 3' position of the splice donor signal sequence; a second AAV vector comprising a second recombinogenic region, a splice acceptor signal sequence located at a 3' position of the second recombinogenic region, a second coding polynucleotide encoding a C-terminal portion of human OTOF isoform 5 protein located at a 3' position of the splice acceptor signal sequence, and a polyadenylation (poly(A)) sequence located at a 3' position of the second coding polynucleotide; A dual vector system, wherein the first coding polynucleotide and the second coding polynucleotide encoding the human OTOF isoform 5 protein do not overlap, neither the first AAV vector nor the second AAV vector encodes a full-length human OTOF isoform 5 protein, and when introduced into a mammalian cell, the first coding polynucleotide and the second coding polynucleotide combine to form a nucleic acid molecule encoding a full-length human OTOF isoform 5 protein.

2. The dual vector system of claim 1 , wherein the first AAV vector and the second AAV vector comprise an AAV1 capsid.

3. 3. The dual vector system of claim 1 or 2, wherein the Myo15 promoter comprises a first region having at least 95% sequence identity to the sequence of SEQ ID NO:7 or a portion thereof, the first region having at least 95% sequence identity to the sequence of SEQ ID NO:9, SEQ ID NO:10, or a portion thereof comprising both the sequences of SEQ ID NO:9 and SEQ ID NO:10, operably linked thereto, and a second region having at least 95% sequence identity to the sequence of SEQ ID NO:8 or a portion thereof, the second region having at least 95% sequence identity to the sequence of SEQ ID NO:14, SEQ ID NO:15, or a portion thereof comprising both the sequences of SEQ ID NO:14 and SEQ ID NO:15, wherein the first region is either directly fused to the second region or is linked to the second region by a linker comprising 1 to 100 nucleotides.

4. The dual vector system according to any one of claims 1 to 3, wherein the Myo15 promoter comprises or consists of the sequence of SEQ ID NO:

21.

5. The dual vector system according to any one of claims 1 to 4, wherein the first recombinogenic region and / or the second recombinogenic region is an alkaline phosphatase (AP) gene fragment comprising any one of the sequences of SEQ ID NOs: 48 to 53.

6. The dual vector system according to claim 5, wherein the AP gene fragment consists of any one of the sequences set forth in SEQ ID NOs: 48 to 53.

7. 6. The dual vector system of claim 5, wherein the AP gene fragment comprises or consists of the sequence of SEQ ID NO:

51.

8. The dual vector system according to any one of claims 1 to 7, wherein the human OTOF isoform 5 protein comprises the sequence of SEQ ID NO:

1.

9. The dual vector system according to any one of claims 1 to 8, wherein the human OTOF isoform 5 protein is encoded by the sequence of SEQ ID NO:2 or SEQ ID NO:

3.

10. 10. The dual vector system of any one of claims 1 to 9, wherein the first coding polynucleotide encodes amino acids 1 to 802 of SEQ ID NO:1 and the second coding polynucleotide encodes amino acids 803 to 1997 of SEQ ID NO:

1.

11. The dual vector system according to any one of claims 1 to 10, wherein the N-terminal part of the human OTOF isoform 5 protein consists of the sequence of SEQ ID NO:

58.

12. The dual vector system according to any one of claims 1 to 11, wherein the N-terminal part of the human OTOF isoform 5 protein is encoded by the sequence of SEQ ID NO:

56.

13. The dual vector system according to any one of claims 1 to 12, wherein the C-terminal part of the human OTOF isoform 5 protein consists of the sequence of SEQ ID NO:

59.

14. The dual vector system according to any one of claims 1 to 13, wherein the C-terminal part of the human OTOF isoform 5 protein is encoded by the sequence of SEQ ID NO:

57.

15. 15. The dual vector system of any one of claims 1 to 14, wherein the first AAV vector comprises a first inverted terminal repeat (ITR) sequence 5' of the promoter and a second ITR sequence 3' of the first recombinogenic region, and the second AAV vector comprises a first ITR sequence 5' of the second recombinogenic region and a second ITR sequence 3' of the poly(A) sequence.

16. 2. The dual vector system of claim 1, wherein the first AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 235-4004 of SEQ ID NO:66, and the second AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 229-4438 of SEQ ID NO:

67.

17. 2. The dual vector system of claim 1, wherein the first AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 2272-6041 of SEQ ID NO:60, and the second AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 2267-6476 of SEQ ID NO:

61.

18. 2. The dual vector system of claim 1, wherein the first AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 182-3949 of SEQ ID NO:62, and the second AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 187-4396 of SEQ ID NO:

63.

19. A composition comprising the dual vector system according to any one of claims 1 to 18 for use in a method for increasing OTOF expression in a human subject in need thereof.

20. 20. A composition comprising the dual vector system of any one of claims 1 to 18 for use in a method for treating a human subject suffering from or at risk of developing sensorineural hearing loss or auditory neuropathy.

21. The composition described in claim 19 or 20, wherein the human subject has a mutation in OTOF.

22. The composition of any one of claims 19 to 21, wherein the human subject has or has been confirmed to have autosomal recessive deafness 9 (DFNB9).

Images