Gene therapy for eye diseases

Abstract

Kind Code: A1 Compositions and methods for treating Leber congenital amaurosis (LCA) in a subject are provided. [Solution] A codon-optimized, modified nucleic acid sequence encoding human revertisin, an expression cassette comprising the codon-optimized nucleic acid sequence, and a recombinant adeno-associated virus (rAAV), wherein the rAAV comprises an AAV capsid and a vector genome packaged therein, the vector genome comprising: (a) an AAV 5' inverted terminal repeat (ITR) sequence; (b) a promoter; (c) a coding sequence encoding human revertisin; and (d) an AAV 3' ITR.

Description

[Technical field]

[0001] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with United States Government support under Grant Nos. R21EY020662 and P30EY001583 from the National Eye Institute (NEI) / National Institutes of Health (NIH). The United States Government has certain rights in this invention.

[0002] Incorporation of materials submitted in electronic form Applicants hereby incorporate by reference the sequence listing material submitted in electronic form, which is stored as a file under the name "UPN-16-7696PCT_Seq_Listing_ST25.txt." [Background technology]

[0003] One of the most severe groups of inherited blinding disorders is Leber congenital amaurosis (LCA; OMIM 204000). LCA is rare, occurring in 1:50,000 cases, is usually inherited in an autosomal recessive manner, and is due to mutations in any of at least 22 different genes (sph.uth.edu / RetNet / sum-dis.htm). Clinical features include severe abnormal vision (reduced visual acuity, visual field) in infancy or early childhood, nystagmus, and progressive loss of vision early in life. Clinical examination reveals loss of scotopic and photopic electroretinogram (ERG) responses, amaurosis, reduced light sensitivity, and retinal pigmentary changes. There is currently no approved treatment for LCA.

[0004] A morphology of LCA caused by mutations in RPE65, a gene encoding a 65 kDa protein in the retinal pigment epithelium (Redmond TM, Yu S, Lee E, Bok D, Hamasaki D, Chen N, et al. Rpe65 is necessary for production of 11-cis-vitamin B. A in the retinal visual cycle. Nat Genet (1998) 20(4):344-51; Redmond T, Hamel C. Genetic analysis of RPE65: from human disease to mouse model. Methods in Enzymol (2000) 317:705-24, both of which are incorporated herein by reference) has attracted considerable attention in recent years because it has been the subject of several genetic augmentation therapy clinical trials. Using adeno-associated virus (AAV) serotype 2, several groups have shown that delivery of wild-type copies of RPE65 cDNA to the retinal pigment epithelium (RPE) is safe and can ameliorate a number of defects, including night blindness (3-9). A randomized, multicenter, phase 3 study testing AAV2-hRPE65v2 (or voretigene neparvovec, funded by Spark Therapeutics, Philadelphia, PA) showed that subretinal injection of the agent improved light sensitivity, visual field, and the ability to navigate accurately and quickly with visual stimuli under a range of luminance conditions (10,11). The US Food and Drug Administration (FDA) granted drug approval for voretigene neparvovec-rzyl on December 19, 2017, making it one of the first gene therapy drugs approved in the United States. Progress in developing treatments for LCA caused by mutations in RPE65, i.e., LCA2, paves the way for the development of treatments for most early-onset retinal degenerations caused by mutations in photoreceptor-specific genes, not just RPE-specific genes.

[0005] One of the most severe forms of this already severe condition (LCA) is due to mutations in LCA5, a photoreceptor-specific gene that encodes reversillin (12-20). LCA5 mutations are estimated to account for approximately 2% of LCA cases, but may be more common in genetically isolated populations. (16) LCA5 mutations have also been identified as a cause of early-onset forms of other retinal degenerations, including cone dystrophies and autosomal recessive retinitis pigmentosa (ARRP). (15,16,21) Summary of the Invention [Problem to be solved by the invention]

[0006] Thus, there is a need for compositions useful for expressing levelsilin in a subject in need thereof. [Means for solving the problem]

[0007] DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention relates to compositions and methods relating to AAV gene therapy vectors for delivering human LCA5 to a subject in need thereof, which upon intravitreal or subretinal administration results in clinically meaningful correction of Leber congenital amaurosis (LCA) for long periods of time, potentially for more than 10 years.

[0008] In one aspect, a codon-optimized, modified nucleic acid sequence is provided that encodes human resilirin. In one embodiment, the codon-optimized nucleic acid sequence is SEQ ID NO: 3 or a variant of SEQ ID NO: 2. In another embodiment, the codon-optimized nucleic acid sequence is SEQ ID NO: 3. In another embodiment, the nucleic acid sequence is codon optimized for human expression.

[0009] In another aspect, an expression cassette is provided comprising a codon-optimized nucleic acid sequence encoding reversillin. In one embodiment, the expression cassette comprises the nucleic acid sequence of SEQ ID NO: 3, which encodes human reversillin. In yet another embodiment, the sequence encoding reversillin is located between the 5' and 3' AAV ITR sequences.

[0010] In yet another aspect, a recombinant adeno-associated virus (rAAV) vector is provided. The rAAV comprises an AAV capsid and a vector genome packaged therein. In one embodiment, the vector genome comprises: (a) an AAV 5' inverted terminal repeat (ITR) sequence, (b) a promoter, (c) a coding sequence encoding human reversillin; and (d) an AAV 3' ITR. In one embodiment, the rAAV vector further comprises an expression control sequence directing expression of reversillin in a host cell. In a further embodiment, the reversillin sequence is the protein sequence of SEQ ID NO: 1. In one embodiment, the vector genome is the sequence of nt 1-4379 of SEQ ID NO: 8. In another embodiment, the vector genome is the sequence of nt 1-4368 of SEQ ID NO: 9. In yet another embodiment, the LCA5 coding sequence in any of the identified vector genomes is replaced with another LCA5 coding sequence described herein.

[0011] In another aspect, an aqueous suspension suitable for administration to a patient with LCA is provided. In one embodiment, the suspension comprises an aqueous suspension and about 1×10 10 GC or viral particles ~ approx. 1 x 10 13 The viral particles or viral particles / eye of GC include recombinant adeno-associated viruses (rAAV) described herein that are useful for the treatment of LCA.

[0012] In another aspect, the pharmaceutical composition comprises a pharma- ceutically acceptable carrier, diluent, excipient, and / or adjuvant, as specifically described herein, and a nucleic acid sequence, a plasmid, a vector, or a viral vector, such as an rAAV.

[0013] In another aspect, a method for treating Leber congenital amaurosis caused by a defect in the reversillin gene (LCA5) and / or restoring visual function in a mammalian subject having LCA comprises delivering a recombinant AAV vector encoding reversillin as described herein to a subject in need thereof via intravitreal, subretinal, or intravascular injection.

[0014] In another aspect, there is provided a use of an AAV vector as described herein in treating Leber's congenital amaurosis resulting from a defect in the reversillin gene (LCA5) and / or restoring visual function in a mammalian subject having LCA, comprising delivering a recombinant AAV vector encoding reversillin as described herein to a subject in need thereof via intravitreal, subretinal or intravascular injection.

[0015] Other aspects and advantages of the present invention will become apparent from the following detailed description of the invention. [Brief description of the drawings]

[0016] [Figure 1]FIG. 1A shows the transgene cassettes used to generate AAV7m8.CBA.hopt.LCA5 and AAV7m8.CBA.EGFP described herein. FIGS. 1B-1D provide an alignment of the human nucleic acid sequence of LCA5 (Native_LCA5) in SEQ ID NO:2 with the codon-optimized LCA5 (Codon_optimized_LCA5) sequence in SEQ ID NO:3. FIGS. 1E-1F provide a plasmid map and feature list for the pAAV.CMV.CBA.human codon-optimized levelsilin vector. The nucleic acid sequence is reproduced in SEQ ID NO:8. FIGS. 1G-1H provide immunofluorescence analysis of eyes injected with AAV7m8-hopt-LCA5 at P5, and analysis performed at P15 shows levelsilin colocalizing with the base of tubulin-positive outer segments as described in Examples 1, 2, and 4. Following intravitreal (IVT, FIG. 1G) or subretinal (SR, FIG. 1L) injection, levelsilin was distributed throughout the retina and was nearly absent from photoreceptors at P95. In contrast, levelsilin was absent in untreated P15 and P95 Lca5- / - retinas. SR, subretinal; IVT, intravitreal; (-) untreated Lca5- / -. Schematics showing the intravitreal (FIG. 1G) and subretinal (FIG. 1H) injection schemes are provided. FIG. 1I shows levelsilin expression in both wild-type and Lca5- / - mice subretinally injected with the AAV.LCA5 vector at P20. [Diagram 2]Figures 2A-2I show normalized pupillary reflex amplitudes measured at 3 months of age for mice injected with AAV7m8.hopt-LCA5 compared to control (mock-injected) eyes of Lca5- / - mice treated with PN5 and PN15. Results are shown after (A) intravitreal and (B) subretinal injections or (C) untreated (-) control mice. (D) Relative pupillary reflex amplitudes (% of baseline pupil diameter) for the right eyes of animals in each of the subgroups (A-C) and wild-type (C57B16) positive (+) control mice (E). Figures 2F and 2G are representative of the testing scheme used to obtain the results shown in Figures 2A-2D. Figures 2H and 2I show a comparison of normalized pupillary reflex amplitudes in experimental and control mice shown in Figures 2A-2D treated with PN5 versus PN15 via subretinal (SR, I) or intravitreal (IV, H) injections. *p<0.1; **p<0.05; ***p<0.01. [Diagram 3] 3A-3F show water maze results for AAV7m8.hopt-LCA5 injected and control (mock injected) eyes of Lca5- / - mice treated at PN5 and PN15 and measured at 3 months of age, as described in Example 3. FIG. 3A is a table showing the results of the statistical analysis. FIG. 3B is an illustration of a typical result of the water maze test. FIG. 3D is a bar graph showing the number of days until first successful training in Lca5- / - mice treated intravitreally or subretinally at birth with AAV7m8.LCA5 vector at PN5 or PN15. Wild-type mice served as controls. FIG. 3D is a line graph of success rate at PN5 for various light intensities (x-axis) in Lca5- / - mice treated intravitreally at birth with AAV7m8.LCA5 vector. Figure 3E is a line graph of the success rate of Lca5- / - mice treated subretinally at birth with the AAV7m8.LCA5 vector at various light intensities (x-axis) at PN5 and Figure 3F is a line graph of the success rate of Lca5- / - mice treated intravitreally at birth with the AAV7m8.LCA5 vector at various light intensities (x-axis) at PN15. [Figure 4] 1 is a graph providing representative histology results following delivery of AAV7m8.hopt-LCA5 to Lca5gt / gt retinas at 5 days postnatal (PN), showing column counts in the outer nuclear layer (ONL) following IVT or SR treatment with AAV.LCA5 and mock injections. [Diagram 5] Figure 5A provides immunofluorescence results showing that rhodopsin (red) persists in treated (but not control) photoreceptors up to 3 months. Occasional photoreceptors are eGFP positive (injection area identified by co-injection with AAV7m8.eGFP). Figures 5B-5D show that the multi-electrode array (MEA) responses of rod and cone photoreceptors treated with AAV7m8.hopt-LCA5 in Lca5gt / gt are similar to those of wild-type (WT) retinas. (B) Response amplitude (difference in firing rate before and after illumination) versus illumination intensity data (not shown) measured from the average trace per illumination. Responses from treated retinas are as high as 70% of those from WT retinas, while responses in untreated retinas are minimal or absent. (C) Response amplitudes from the retina in panel A for the first and second intensity series trials (before / during and after the brightest exposure at the end of the first trial, the stimulus series intensity increased by approximately 0.5 log from scotopic to brightest photopic values ​​during each intensity series trial). (D) Transient ON- (difference in firing rate before and after light onset), sustained ON- (difference before light onset and disappearance), and OFF responses (difference before and after light disappearance) amplitudes as a function of light intensity for the first and second intensity series trials. The light blue shaded area represents the range of WT responses (four retinas, MEAN ± STD), and the line-only traces show the mean WT response amplitudes. The horizontal arrow indicates the rightward shift in sensitivity due to exposure to the brightest light at the end of the first intensity series trial. Treated Lca5gt / gt and WT retinas show similar response / intensity dependence before and after bleaching, whereas the response of untreated Lca5gt / gt retinas becomes flat. Lined circles represent treated LCA5gt / gt. Lined triangles represent control Lca5gt / gt. [Figure 6] Figures 6A-6E show that in untreated Lca5- / - retinas, there is massive cell death during photoreceptor degeneration early in life (and a delay in this degeneration after treatment with AAV.hopt.LCA5), as evidenced by (A) TUNEL assays (Figure 6A; Figure 6B-E, third row) and (B) rhodopsin immunofluorescence analysis (Figure 6B-E, rows 1, 3, and 4). [Figure 7] Figures 7A-7D show that outer segments were present in AAV7m8.hopt.LCA5-treated Lca5- / - retinas but not in control Lca5- / - retinas. Transmission electron microscopy evaluation of AAV7m8.hopt.LCA5-injected retinas shows that in 3-month-old Lca5- / -, both rod and cone photoreceptor outer segments comprise stacked discs and connected cilia. Such structures were absent in untreated Lca5- / - retinas. (A,B) PN80 after intravitreal injection of AAV7m8p643 (codon-optimized levulin) at PN5, representative pictures; (A1-A3): 12K resolution, stitched pictures showing rows of photoreceptors, rod photoreceptors (arrowheads), cone photoreceptors (arrows), and many mitochondria in photoreceptors (asterisks); (B), 20K resolution; (Bl) cross section of cilium showing 9+0 structures of microtubules, membranous discs of rod-derived OS (arrows); (C) 30K resolution, basal body (arrowhead); (C1) sagittal section of connecting cilium; (D) 12K resolution, no photoreceptors remain in the ONL; (Dl) pyknotic nuclei of dying cells (arrowheads); (D2) floating remnants of dead organelles including undulating ER (arrow). [Figure 8] Shown are the results of the pupil light response of one retina of an adult male with LCA5 (red trace - upper line) with similar temporal characteristics as an age-matched male with normal vision (blue trace - lower line). The amplitude of constriction was reduced in the LCA5 patient compared to normal individuals. [Figure 9]Table showing the thickness of the various retinal layers, showing that the thickness of the outer nuclear layer (ONL) remained the same for at least 3 months in treated (*) compared to control retinas. No such clear trend was observed in the other retinal layers (outer plexiform layer, OPL; inner nuclear layer, INL; inner plexiform layer, IPL). At each time point, the bars from left to right represent the thickness of ONL, OPL, INL, and IPL, respectively. [Figure 10] 13 provides the results of light-mediated changes in the location of phototransduction-specific molecules following injection of AAV7m8.hopt.LCA5. [Figure 11] 11A-11B provide a plasmid map and a list of features of the pAAV.CMV.CBA.human native level cytosine vector, the nucleic acid sequence of which is reproduced in SEQ ID NO:9. [Figure 12]Figures 12A-12F show rescued cilia phenotype in homozygous human LCA5 p.(Q279*) iPSC-RPE after treatment with AAV7m8.hopt-LCA5. (A) Confocal images show hexagonal morphology of mature RPE cells along with immunofluorescence detectable RPE markers; ZO-1 and MITF. Phase contrast (PC) images display the structure of iPSC-RPE cultures of RPE derived from both healthy subjects and LCA5 patients. (B) Quantitative real-time PCR (qRT-PCR) of LCA5 mRNA expression in normal vision control RPE and RPE from LCA5 patients. GAPDH is used to normalize expression levels. (C) Western blot analysis shows endogenous (*) levels cilin protein in normal vision control cells untreated ("-") or treated with AAV7m8.eGFP ("G"). No endogenous cillin is observed in untreated or AAV7m8.GFP-treated LCA5-affected cells. Stable levels of cillin are present following infection of cells from both normal subjects and LCA5 carriers with AAV7m8.LCA5 ("L"). Immunofluorescence analysis shows the presence of Arl13b-positive primary cilia in normal-vision (D) and LCA5-derived (E) iPSC-RPE. cillin is present in normal-vision control cells and LCA5-affected cells treated with AAV7m8.LCA5 (but not AAV7m8.eGFP). (F) Quantitative analysis of the number of cilia per cell in normal-vision vs. LCA5-iPSC-RPE shows the rescue of ciliogenesis following treatment of LCA5-iPSC-RPE cells with AAV7m8.LCA5 (but not AAV7m8.eGFP). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0017] The methods and compositions described herein include compositions and methods for delivering the LCA5 nucleic acid sequence encoding the Leber congenital amaurosis (LCA) protein to a subject in need of treatment. In some embodiments, such compositions involve codon optimization of the Lebersilin coding sequence. It is desirable to increase the efficacy and therefore safety of the product since lower doses of the reagent may be used. Compositions comprising the native Lebersilin coding sequence as shown in SEQ ID NO:2 are also encompassed herein.

[0018] The technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs and by reference to the publications which provide such a person with general guidance to many of the terms used in this application. The definitions set forth herein are provided for clarity in describing the components and compositions described herein and are not intended to be limiting of the invention as claimed.

[0019] "Reversilin" is encoded by the LCA5 gene on chromosome 6ql4 and is a ciliary protein that localizes to the connecting cilia of photoreceptors and to microtubules, centrioles, and primary villi in cultured mammalian cells.

[0020] Reversillin is widely expressed throughout development and is found in the cilia of cultured cells as well as in the connecting cilia of mature photoreceptor cells. The connecting cilia are narrow structures between the photoreceptor inner segment, which houses the cell's biosynthetic machinery, and the outer segment, which contains the opsin-driven visual cascade. The connecting cilia function as conduits, supporting the bidirectional exchange of proteins and vesicles along ciliary microtubule tracks in a process known as intraflagellar transport (IFT). Applying quantitative affinity proteomics to a genetically engineered Lca5 mouse model, Boldt et al. demonstrated that loss of function of Lca5 disrupts IFT, which results in defects in photoreceptor outer segment development and impaired exchange of arrestins with opsins. Lca5 null (Lca5gt / gt) mice exhibit no cone or rod ERG responses and, by 19 years and 2 months of age, suffer early progressive retinal degeneration with only a single row of dispersed nuclei in the outer nuclear layer (ONL) (compared to 8-10 rows of adjacent cells in wild-type mouse retinas).

[0021] Mutations in LCA5 cause an inherited retinal degeneration called Leber congenital amaurosis (LCA). The phenotype in affected individuals is confined to the eye and leads to blindness. Five of the six families studied by den Hollander had homozygous nonsense and frameshift mutations, and one family had a complete lack of LCA5 transcripts. Reversilin cDNA, or a nucleic acid encoding a codon-optimized version thereof, is of appropriate size to fit into an adeno-associated virus (AAV) vector. See, for example, the sequences in Figures 1A and 1E-1F and Figures 11A-11B. As described in the Examples below, it has been shown that rAAV-mediated gene augmentation strategies can be used to correct retinal degeneration caused by LCA5 mutations. Such therapy is particularly advantageous when wild-type or optimized copies of the gene are delivered early in life, e.g., during childhood or early postnatal life. Furthermore, the intravitreal or subretinal administration used in certain embodiments efficiently delivers genes to target cells (eg, photoreceptors).

[0022] The reversillin gene LCA5 encodes reversillin, a 697 amino acid protein thought to be involved in centrosome or ciliary function and involved in minus-end directed microtubule transport. As used herein, the terms "LCA5" and "reversillin" are used interchangeably to refer to the coding sequence. Natural nucleic acid sequences encoding human reversillin are reported in NCBI Reference Sequence NM_181714.3 (transcript variant 1), NM_001122769.2 (transcript variant 2), XM_011535504.1 (transcript variant XI), and XM_005248665.4 (transcript variant X2), and are reproduced herein as SEQ ID NOs: 4, 5, 6, and 7, respectively. The native human amino acid sequence of reversillin is reproduced herein in SEQ ID NO: 1 (NCBI Reference Sequence: NP_001116241.1 or NP_859065.2, and UniProtKB / Swiss-Prot ID: Q86VQ0-1). Mutations in the LCA5 gene are associated with Leber's congenital amaurosis (LCA). In certain embodiments, the terms "LCA5" and "reversillin" are used interchangeably.

[0023] Leber congenital amaurosis (LCA) is an eye disorder that primarily affects the retina, a specialized tissue at the back of the eye that detects light and color. People with the disorder usually have severe vision problems from infancy. The vision loss tends to stabilize, but can worsen very slowly over time. Leber congenital amaurosis can also be accompanied by other vision problems, such as increased sensitivity to light (photophobia), involuntary eye movements (nystagmus), and extreme farsightedness (hyperopia). The pupil, which normally expands and contracts depending on the amount of light entering the eye, no longer responds normally to light. Instead, it may expand and contract more slowly than normal or may not respond to light at all. Additionally, the clear front covering of the eye (cornea) may be cone-shaped and abnormally thin, a condition known as keratoconus. A specific behavior called Franceschetti's finger sign is characteristic of Leber congenital amaurosis. This sign consists of poking, pushing, and rubbing the eye with the knuckles or fingers. Researchers speculate that this behavior is related to the sunken eyes and keratoconus of affected children. Rarely, developmental delays and intellectual disability have been reported in people with characteristics of Leber congenital amaurosis. However, researchers are unsure whether these people actually have Leber congenital amaurosis or another syndrome with similar signs and symptoms. At least 13 types of Leber congenital amaurosis have been reported. These types are distinguished by their genetic causes, patterns of vision loss, and associated eye abnormalities.

[0024] The terms "percent (%) identity," "sequence identity," "percent sequence identity," or "percent identical" in the context of nucleic acid sequences refer to the residues in two sequences that are the same when aligned for correspondence. The length of sequence identity comparison may be desired to span the entire length of a genome, the entire length of a gene coding sequence, or a fragment of at least about 500-5000 nucleotides. However, identity over smaller fragments, e.g., at least about 9 nucleotides, usually at least about 20-24 nucleotides, at least about 28-32 nucleotides, at least about 36 nucleotides or more, may also be desired.

[0025] Percent identity of amino acid sequences over the entire length of a protein, polypeptide, about 32 amino acids, about 330 amino acids, or peptide fragments thereof, or the corresponding nucleic acid sequence coding sequences, can be readily determined. Suitable amino acid fragments are at least about 8 amino acids in length and can be up to about 700 amino acids. Generally, when referring to "identity", "homology" or "similarity" between two different sequences, the "identity", "homology" or "similarity" is determined with respect to "aligned" sequences. "Aligned" sequences or "alignment" refers to multiple nucleic acid or protein (amino acid) sequences compared to a reference sequence, which often includes modifications such as missing or added bases or amino acids.

[0026] Identity can be determined by preparing an alignment of sequences and using various algorithms and / or computer programs known in the art or commercially available (e.g., BLAST, ExPASy; ClustalO; FASTA; e.g., using the Needleman-Wunsch algorithm, Smith-Waterman algorithm). Alignment is performed using any of a variety of publicly available or commercially available Multiple Sequence Alignment Programs. Sequence alignment programs available for amino acid sequences include, for example, the programs "Clustal Omega", "Clustal X", "MAP", "PIMA", "MSA", "BLOCKMAKER", "MEME" and "Match-Box". Generally, all of these programs are used with default settings, but the skilled artisan can change these settings as needed. Alternatively, the skilled artisan can utilize another algorithm or computer program that provides at least the same level of identity or alignment as the referenced algorithm and program provides. See, e.g., JD Thomson et al, Nucl. Acids. Res., "A comprehensive comparison of multiple sequence alignments", 27(13):2682-2690 (1999).

[0027] For nucleic acid sequences, multiple sequence alignment programs are also available. Examples of such programs include "Clustal Omega", "Clustal W", "CAP Sequence Assembly", "BLAST", "MAP" and "MEME", which are available through web servers on the Internet. Other sources of such programs are known to those of skill in the art. Alternatively, use the Vector NTI utility. There are many algorithms known in the art that can be used to measure nucleotide sequence identity, including those included in the programs listed above. As another example, polynucleotide sequences can be compared using Fasta™, a program in GCG Version 6.1. Fasta™ provides alignment of the best overlap region between the query sequence and the search sequence and percent sequence identity. For example, percent sequence identity between nucleic acid sequences can be determined using Fasta™ using default parameters (word size of 6 and NOPAM factor for the scoring matrix) as provided in GCG Version 6.1, which is incorporated herein by reference.

[0028] In one aspect, a codon-optimized modified nucleic acid sequence encoding human silin is provided. Preferably, the codon-optimized silin coding sequence has less than about 80% identity, preferably about 75% or less identity, to the full-length native silin coding sequence (FIGS. 1B-1D, SEQ ID NO: 2). In one embodiment, the codon-optimized silin coding sequence has about 74% identity to the native silin coding sequence of SEQ ID NO: 2. In one embodiment, the codon-optimized silin coding sequence is characterized by an improved translation rate compared to native silin after AAV-mediated delivery (e.g., rAAV). In some embodiments, the codon-optimized silin coding sequence shares about 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61% or less identity to the full-length native silin coding sequence of SEQ ID NO: 2. In some embodiments, the codon-optimized nucleic acid sequence is a variant of SEQ ID NO: 3. In another embodiment, the codon-optimized nucleic acid sequence is a sequence that shares about 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61% or more identity with SEQ ID NO: 3. In one embodiment, the codon-optimized nucleic acid sequence is SEQ ID NO: 3. In another embodiment, the nucleic acid sequence is codon optimized for human expression. In another embodiment, the reversilin coding sequence is nt 1883 to nt 3976 of SEQ ID NO: 8. In other embodiments, different levels of silencing coding sequences are selected.

[0029] Codon-optimized coding regions can be designed in a variety of different ways. This optimization can be performed using methods available online (e.g., GeneArt), published methods, or by companies that provide codon optimization services, e.g., DNA2.0 (Menlo). Codon optimization may be performed using a codon optimization technique (Codon Optimization Kit, MIT Press, Park, CA). Certain codon optimization methods are described, for example, in U.S. International Patent Publication No. WO2015 / 012924, the entire contents of which are incorporated herein by reference. See also, for example, U.S. Patent Publication Nos. 2014 / 0032186 and 2006 / 0136184. Preferably, the entire length of the open reading frame (ORF) for the product is altered. However, in some embodiments, only a fragment of the ORF may be modified. Using one of these methods, it is possible to apply the frequency to any given polypeptide sequence to generate a nucleic acid fragment of a codon-optimized coding region that encodes the polypeptide.

[0030] Numerous options are available to perform the actual changes to the codons or to synthesize the codon-optimized coding region designed as described herein. Such modifications or synthesis can be performed using standard and routine molecular biology procedures well known to those skilled in the art. In one approach, a series of complementary oligonucleotide pairs, each of which is 80-90 nucleotides in length and spans the length of the desired sequence, are synthesized by standard methods. These oligonucleotide pairs are synthesized as they are annealed together to form a double-stranded fragment of 80-90 base pairs containing sticky ends, e.g., each oligonucleotide of the pair is synthesized to extend 3, 4, 5, 6, 7, 8, 9, 10 or more bases beyond the region complementary to the other oligonucleotide of the pair. The single-stranded end of each pair of these oligonucleotides is designed to anneal to the single-stranded end of another pair of these oligonucleotides. These oligonucleotide pairs are annealed, then about 5-6 of these double-stranded fragments are annealed together via their cohesive single-stranded ends and ligated together, then cloned into a standard bacterial cloning vector, such as the TOPO® vector available from Invitrogen Corporation, Carlsbad. Calif. The construct is then sequenced by standard methods. Several of these constructs are prepared consisting of 5-6 fragments of 80-90 base pair fragments ligated together, i.e., fragments of about 500 base pairs, so that the entire desired sequence can be represented in a series of plasmid constructs. The inserts of these plasmids are then cut with appropriate restriction enzymes and ligated to form the final construct. The final construct is then cloned into a standard bacterial cloning vector and sequenced. Further methods will be readily apparent to those skilled in the art. In addition, gene synthesis is readily available commercially.

[0031] By "modified" is meant assembling a nucleic acid sequence encoding a Reversilin protein as described herein and placing it in a suitable genetic element, e.g., naked DNA, phage, transposon, cosmid, episome, etc., to transfer the Reversilin sequence carried therein to a host cell, e.g., to generate a non-viral delivery system (e.g., RNA-based system, naked DNA, etc.), or to generate a viral vector in a packaging host cell and / or for delivery to a host cell in a subject. In one embodiment, the genetic element is a plasmid. Methods used to generate such modified constructs are known to those skilled in the art of nucleic acid manipulation and involve genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Green and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).

[0032] The term "host cell" as used herein may refer to a packaging cell line that produces recombinant AAV from a production plasmid. Alternatively, the term "host cell" may refer to any target cell in which expression of a coding sequence is desired. Thus, "host cell" refers to a prokaryotic or eukaryotic cell that contains exogenous or heterologous DNA introduced into the cell by any means, such as electroporation, calcium phosphate precipitation, microinjection, transformation, viral infection, transfection, liposome delivery, membrane fusion, high-speed DNA-coated pellets, viral infection, and protoplast fusion. In certain embodiments herein, the term "host cell" refers to a cell used to produce and package a viral vector or recombinant virus. In other aspects herein, the term "host cell" refers to cultures of ocular cells of various mammalian species for in vitro evaluation of the compositions described herein. In yet other embodiments, the term "host cell" is intended to refer to ocular cells of a subject treated in vivo for LCA.

[0033] As used herein, the term "ocular cell" refers to any cell in the eye or associated with ocular function. The term may refer to any one of photoreceptor cells, including rod photoreceptors, cone photoreceptors, and light-sensitive ganglion cells, retinal pigmented epithelial (RPE) cells, Muller cells, choroid cells, bipolar cells, horizontal cells, and amacrine cells. In some embodiments, the ocular cell is a photoreceptor cell. In other embodiments, the ocular cell is a cone photoreceptor cell. In another embodiment, the ocular cell is a rod photoreceptor cell.

[0034] In one embodiment, the nucleic acid sequence encoding reversillin further comprises a nucleic acid encoding a tag polypeptide covalently linked thereto. The tag polypeptide may be selected from known "epitope tags," including, but not limited to, a myc tag polypeptide, a glutathione-S-transferase tag polypeptide, a green fluorescent protein tag polypeptide, a myc-pyruvate kinase tag polypeptide, a His6 tag polypeptide, an influenza virus hemagglutinin tag polypeptide, a flag tag polypeptide, and a maltose binding protein tag polypeptide.

[0035] In another aspect, an expression cassette is provided comprising a nucleic acid sequence encoding reversillin. In one embodiment, the sequence is a codon-optimized sequence. In another embodiment, the codon-optimized nucleic acid sequence is SEQ ID NO: 3, which encodes human reversillin.

[0036] As used herein, "expression cassette" refers to a nucleic acid molecule that includes coding sequences for a levelsillin protein, a promoter, and may include other regulatory sequences therefor, which may be packaged into the capsid of a viral vector (e.g., a viral particle). Generally, such expression cassettes for generating viral vectors include the LCA5 sequence described herein flanked by packaging signals of the viral genome, and other expression control sequences, as described herein. For example, for AAV viral vectors, these packaging signals are the 5' inverted terminal repeats (ITRs) and the 3' ITRs. When packaged into an AAV capsid, the expression cassette together with the ITRs may be referred to herein as the "recombinant AAV (rAAV) genome" or "vector genome." In some embodiments, the expression cassette includes a codon-optimized nucleic acid sequence encoding a levelsillin protein. In some embodiments, the cassette provides a codon-optimized LCA5 in operative association with expression control sequences that direct the expression of the codon-optimized nucleic acid sequence encoding levelsillin in a host cell. In one embodiment, the vector genome is the sequence of nt 1-4379 of SEQ ID NO: 8. In another embodiment, the vector genome is the sequence of nt 1-4368 of SEQ ID NO: 9. In yet another embodiment, the LCA5 coding sequence in any of the identified vector genomes is replaced with another LCA5 coding sequence described herein.

[0037] In another embodiment, an expression cassette for use in an AAV vector is provided. In that embodiment, the AAV expression cassette comprises at least one AAV inverted terminal repeat (ITR) sequence. In another embodiment, the expression cassette comprises a 5'ITR sequence and a 3'ITR sequence. In one embodiment, the 5' and 3'ITRs flank a codon-optimized nucleic acid sequence encoding a level silin, and optionally comprise additional sequences that direct the expression of the codon-optimized nucleic acid sequence encoding a level silin in a host cell. Thus, as described herein, an AAV expression cassette is meant to describe an expression cassette as described above that is flanked at its 5' end by a 5'AAV inverted terminal repeat (ITR) and at its 3' end by a 3'AAV ITR. Thus, the rAAV genome comprises the minimal sequences required for packaging the expression cassette into an AAV viral particle, i.e., AAV 5' and 3' ITRs. The AAV ITRs may be obtained from any AAV ITR sequence, as described herein. These ITRs are included in the resulting recombinant AAV. They may be of the same AAV origin as the capsid used in the AV, or of a different AAV origin (to generate AAV pseudotypes). In one embodiment, the ITR sequences from AAV2, or deleted versions thereof (ΔITR), are used for convenience and to facilitate regulatory approval. However, ITRs from other AAV sources may be selected. If the source of the ITRs is from AAV2 and the AAV capsid is from another AAV source, the resulting vector may be referred to as a pseudotype. In general, the AAV vector genome includes the AAV 5'ITR, the reversilin coding sequence, and any regulatory sequences, and the AAV 3'ITR. However, other configurations of these elements may be suitable. A shortened version of the 5'ITR, termed ΔITR, has been described in which the D sequence and the terminal resolution site (trs) are deleted. In other embodiments, the full-length AAV 5' and 3'ITRs are used. Each rAAV genome can then be introduced into a production plasmid.

[0038] As used herein, the terms "regulatory sequence," "transcriptional control sequence," or "expression control sequence" refer to DNA sequences, such as initiation sequences, enhancer sequences, and promoter sequences, that induce, repress, or control the transcription of protein-coding nucleic acid sequences operably linked to them.

[0039] As used herein, the terms "operably linked" or "operably associated" refer to both expression control sequences adjacent to the nucleic acid sequence encoding reversillin and / or expression control sequences that control its transcription and expression, either in trans or at a distance.

[0040] In one aspect, a vector is provided that includes any of the expression cassettes described herein. As described herein, such vectors can be plasmids of various origins, and are useful in certain embodiments for the generation of recombinant replication-defective viruses, as further described herein.

[0041] As used herein, a "vector" is a nucleic acid molecule into which an exogenous, heterologous, or modified nucleic acid transgene can be inserted, which can then be introduced into a suitable host cell. These vectors preferably have one or more origins of replication and one or more sites into which recombinant DNA can be inserted. These vectors often have a means by which vector-containing cells can be selected from vector-free cells, e.g., by encoding a drug resistance gene. Common vectors include plasmids, viral genomes, and "artificial chromosomes" (mainly in yeast and bacteria). Specific plasmids are described herein.

[0042] In some embodiments, the vectors are non-viral plasmids that include expression cassettes as described herein, e.g., "naked DNA," "naked plasmid DNA," RNA, and mRNA, and are linked to various compositions and nanoparticles, e.g., micelles, liposomes, cationic lipid-nucleic acid compositions, polyglycan compositions, and other polymer, lipid, and / or cholesterol-based nucleic acid conjugates, and other constructs described herein. See, e.g., X. Su et al., Mol. Pharmaceutics, 2011, 8(3), pp 774-787; Web Publication: March 21, 2011; WO2013 / 182683, WO2010 / 053572, and WO2012 / 170930, the entire contents of which are incorporated herein by reference. Such non-viral respiratory vectors may be administered by the routes described herein. Viral or non-viral vectors can be formulated with physiologically acceptable carriers for use in gene transfer and gene therapy applications.

[0043] In another embodiment, the vector is a viral vector comprising an expression cassette as described therein. A "viral vector" is defined as a replication-deficient virus comprising an exogenous or heterologous LCA5 nucleic acid transgene. In an embodiment, the expression cassette as described herein may be modified with a plasmid for use in drug delivery or viral vector construction. Suitable viral vectors are preferably selected from those that are replication-deficient and target ocular cells. Viral vectors may include any virus suitable for gene therapy, including, but not limited to, adenovirus, herpesvirus, lentivirus, retrovirus, parvovirus, and the like. However, for ease of understanding, adeno-associated virus is referred to herein as an exemplary viral vector.

[0044] "Replication-defective virus" or "viral vector" refers to synthetic or recombinant viral particles in which an expression cassette containing a gene of interest is packaged in a viral capsid or envelope, where any viral genomic sequences packaged within the viral capsid or envelope are also replication-defective; that is, they cannot produce progeny virions, but retain the ability to infect target cells. In some embodiments, the genome of the viral vector does not contain genes encoding enzymes required for replication (the genome can be modified to be "gutless," containing only the transgene of interest flanked by signals required for amplification and packaging of the artificial genome), but can provide these genes during production. Therefore, it is considered safe for use in gene therapy, since replication and infection by progeny virions cannot occur unless the viral enzymes required for replication are present.

[0045] In another embodiment, a recombinant adeno-associated virus (rAAV) vector is provided. The rAAV impairs the AAV capsid and vector genome packaged therein. The vector genome, in one embodiment, comprises (a) an AAV 5' inverted terminal repeat (ITR) sequence; (b) a promoter; (c) a coding sequence encoding human level silin; and (d) an AAV 3' ITR. In another embodiment, the vector genome is an expression cassette as described herein. In one embodiment, the LCA5 sequence encodes a full-length level silin protein. In one embodiment, the level silin sequence is the protein sequence of SEQ ID NO: 1. In another embodiment, the coding sequence is SEQ ID NO: 3, or a variant thereof.

[0046] Adeno-associated viruses (AAV), members of the parvovirus family, are small, non-enveloped, icosahedral viruses with a single-stranded, linear DNA genome of 4.7 kilobases (kb) to 6 kb. Known AAV serotypes include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9. The ITRs or other AAV components can be readily isolated or modified from AAV using techniques available to those of skill in the art. Such AAV can be isolated, modified, or obtained from academic, commercial, or public sources (e.g., the American Type Culture Collection, Manassas, VA). Alternatively, these AAV sequences can be modified synthetically or by other suitable means by reference to published sequences available in the literature or databases such as, for example, GenBank, PubMed, and the like. By modifying the AAV virus using conventional molecular biology techniques, these particles can be optimized to enable cell-specific delivery of nucleic acid sequences, minimize immunogenicity, tune stability and particle lifetime, efficient degradation, and precise delivery to the nucleus.

[0047] Fragments of AAV can be readily utilized in a variety of vector systems and host cells. Desired AAV fragments include the cap proteins, including vp1, vp2, vp3, and hypervariable regions, the rep proteins, including rep78, rep68, rep52, and rep40, and the sequences encoding these proteins. Such fragments can be used alone or in combination with other The AAV serotypes may be used in combination with AAV serotype sequences or fragments of the AAV serotypes of the present invention, or in combination with elements derived from other AAV or non-AAV viral sequences. As used herein, artificial AAV serotypes include, but are not limited to, AAVs that contain non-native capsid proteins. Such artificial capsids may be generated by any suitable technique using the novel AAV sequences of the present invention (e.g., fragments of vp1 capsid protein) in combination with another AAV serotype (known or novel), non-contiguous portions of the same AAV serotype, non-AAV viral sources, or heterologous sequences that may be obtained from non-viral sources. The artificial AAV serotypes may be, but are not limited to, chimeric AAV capsids, recombinant AAV capsids, or "humanized" AAV capsids. In certain embodiments, the vectors include the AAV8 cap and / or rep sequences of the present invention. See, for example, U.S. Patent Application Publication No. US2009 / 02270030, incorporated herein by reference.

[0048] As used herein, the term "AAV" or "AAV serotype" refers to the numerous naturally occurring and available adeno-associated viruses as well as man-made AAVs. Among the well-characterized AAVs isolated or engineered from humans or non-human primates (NHPs), human AAV2 was the first AAV developed as a gene transfer vector; it has been widely used for effective gene transfer experiments in various target tissues and animal models. Unless otherwise specified, the AAV capsid, ITRs, and other selected AAV components described herein may be readily selected from any AAV, including, but not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV8bp, AAV7M8, and AAVAnc80, any variant of known or described AAVs, or undiscovered AAVs, or variants or mixtures thereof. See, for example, WO2005 / 033321, which is incorporated herein by reference. In another embodiment, the AAV capsid is an AAV8bp capsid that preferentially targets bipolar cells. See, for example, WO2014 / 024282, which is incorporated herein by reference. In another embodiment, the AAV capsid is an AAV7m8 capsid that has shown preferential delivery to the outer retina. The AAV7m8 capsid nucleic acid sequence is reproduced in SEQ ID NO: 11, and the amino acid sequence is reproduced in SEQ ID NO: 12. See, for example, Dalkara et al, In Vivo-Directed Evolution of a New Adeno-Associated Virus for Therapeutic Outer Retinal Gene Delivery from the Vitreous, Sci Transl Med 5, 189ra76 (2013), which is incorporated herein by reference.

[0049] As used herein, an "AAV7m8 capsid" is a self-assembling AAV capsid composed of multiple AAV7m8 vp (variable protein) proteins. These AAV7m8 vp proteins are typically expressed as alternative splice variants encoded by the nucleic acid sequence of SEQ ID NO:11 or a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical thereto and encodes the vp1 amino acid sequence of SEQ ID NO:12. These splice variants result in different lengths of the protein of SEQ ID NO:12. In certain embodiments, an "AAV7m8 capsid" includes an AAV having an amino acid sequence that is 99% identical to SEQ ID NO:12.

[0050] In another embodiment, the rAAV capsid is selected from an AAV8 capsid or variant thereof, an AAV6 capsid or variant thereof, an AAV9 capsid or variant thereof, an AAV7 capsid or variant thereof, an AAV5 capsid or variant thereof, an AAV2 capsid or variant thereof, an AAV1 capsid or variant thereof, an AAV3 capsid or variant thereof, and an AAV4 capsid or variant thereof. In one embodiment, a recombinant adeno-associated virus (rAAV) comprising an AAV7m8 capsid and an expression cassette as described herein is provided. A vector is provided, the expression cassette comprising a nucleic acid sequence encoding Reversilin, an inverted terminal repeat, and an expression control sequence that directs expression of Reversilin in a host cell.

[0051] In further embodiments, recombinant adeno-associated virus (AAV) vectors for delivery of the LCA5 constructs and optimized sequences described herein are provided. Adeno-associated virus (AAV) viral vectors are AAV DNase-resistant particles with AAV protein capsids that package nucleic acid sequences for delivery to target cells. AAV capsids are composed of 60 capsid protein subunits, VP1, VP2, and VP3, arranged in icosahedral symmetry in a ratio of about 1:1:10 to 1:1:20, depending on the AAV selected. AAV may be selected as a source of capsid for the AAV viral vectors defined above. See, for example, U.S. Published Patent Application No. 2007-0036760-A1; U.S. Published Patent Application No. 2009-0197338-A1; EP1310571. Also, WO2003 / 042397 (AAV7 and other monkey AAVs), U.S. Pat. No. 7,790,449 and U.S. Pat. No. 7,282,199 (AAV8), WO2005 / 033321 and U.S. Pat. No. 7,906,111 (AAV9), and WO2006 / 110689 and WO2003 / 042397 (rh.10) and (Dalkara D, Byrne LC, Klimczak RR, Visel See also M, Yin L, Merigan WH, et al. In vivo-directed evolution of a new adeno-associated virus for therapeutic outer retinal gene delivery from the vitreous, Sci Transl Med (2013) 5 (189): 189ra76. doi: 10.1126 / scitranslmed.3005708.) (AAV7m8). Each of these references is incorporated herein by reference. These references also describe other AAV capsids that can be selected to generate AAV, and are incorporated herein by reference. In some embodiments, the AAV cap for use in the viral vector can be generated by mutagenesis (i.e., by insertion, deletion, or substitution) of one of the AAV capsids described above, or its encoding nucleic acid. In some embodiments, the AAV capsid is chimeric and contains domains from two, three, or more of the above AAV capsid proteins. In some embodiments, the AAV capsid is a mosaic of Vp1, Vp2, and Vp3 monomers from two or three different AAV or recombinant AAVs. In some embodiments, the rAAV composition contains two or more of the above Caps.

[0052] The term variant, as used herein with respect to AAV, refers to any AAV sequence derived from a known AAV sequence that shares at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% or more sequence identity with the amino acid or nucleic acid sequence. In another embodiment, the AAV capsid includes a variant that may include up to about 10% variation from a described or known AAV capsid sequence. That is, the AAV capsid shares about 90% identity to about 99.9% identity, about 95% to about 99% identity, or about 97% to about 98% identity with an AAV capsid provided herein and / or known in the art. In one embodiment, the AAV capsid shares at least 95% identity with an AAV capsid. When determining the percent identity of an AAV capsid, comparison can be made to any of the variable proteins (e.g., vpl, vp2, or vp3). In one embodiment, the AAV capsid shares at least 95% identity with AAV7m8 for vp1, vp2, or vp3. In another embodiment, the capsid is a nucleotide sequence similar to that described in Kay et al., Targ, Published Online April 26, 2013, and incorporated herein by reference. The capsid is an AAV8 capsid having the mutations Y447F, Y733F, and T494V (also known as "AAV8(C&G+T494V)" and "rep2-cap8(Y447F+733F+T494V)"), which is described in "Etching Photoreceptors via Intravitreal Delivery Using Novel, Capsid-Mutated AAV Vectors," PLoS one. 2013;8(4):e62097.

[0053] In some embodiments, it may be desirable to utilize an AAV capsid that exhibits tropism for a desired target cell, such as a photoreceptor (e.g., rod and / or cone), RPE, or other ocular cell. In some embodiments, the AAV capsid is a tyrosine capsid mutant in which certain surface-exposed tyrosine residues are replaced with phenylalanine (F). Such AAV mutants are described, for example, in Mowat et al, Tyrosine capsid-mutant AAV vectors for gene delivery to the canine retina from a subretinal or intravitreal approach, Gene Therapy 21, 96-105 (January 2014), which is incorporated herein by reference.

[0054] As used herein, "artificial AAV" refers to, but is not limited to, an AAV having a capsid protein that does not occur in nature. Such an artificial capsid can be generated by a suitable method using a selected AAV sequence (e.g., a fragment of vp1 capsid protein) in combination with a different selected AAV, a non-contiguous portion of the same AAV, a non-AAV viral source, or a heterologous sequence that can be obtained from a non-viral source. The artificial AAV can be, but is not limited to, a pseudotyped AAV, a chimeric AAV capsid, a recombinant AAV capsid, or a "humanized" AAV capsid. Pseudotype vectors in which the capsid of an AAV is replaced with a heterologous capsid protein are useful in the present invention. In one embodiment, AAV2 / 5 and AAV2 / 8 are exemplary pseudotype vectors.

[0055] In another embodiment, self-complementary AAV is used. "Self-complementary AAV" refers to a plasmid or vector with an expression cassette designed such that the coding region carried by the recombinant AAV nucleic acid sequence forms an intramolecular double-stranded DNA template. Upon infection, rather than waiting for cell-mediated synthesis of the second strand, the two complementary halves of scAAV associate to form a single double-stranded DNA (dsDNA) unit that is immediately ready for replication and transcription. See, for example, DM McCarty et al. "Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis", Gene Therapy, (August 2001), Vol 8, Number 16, pages 1248-1254. Self-complementary AAVs are described, for example, in U.S. Patent Nos. 6,596,535; 7,125,717, and 7,456,683, the entire contents of each of which are incorporated by reference herein.

[0056] The term "exogenous" when used to describe a nucleic acid sequence or protein means that the nucleic acid or protein does not naturally occur in the chromosome or location present in the host cell. Exogenous nucleic acid sequences also refer to sequences that are derived from and inserted into the same host cell or subject, but exist in a non-natural state, for example, in different copy number or under the control of different regulatory elements.

[0057] The term "heterologous" as used to describe a nucleic acid sequence or protein refers to a nucleic acid or protein that means that the protein is derived from a different organism or a different species of the same organism from the host cell or subject in which it is expressed. The term "heterologous" when used with reference to a protein or nucleic acid within a plasmid, expression cassette, or vector means that the protein or nucleic acid and another sequence or subsequence are not found in the same relationship to each other in nature.

[0058] In yet another embodiment, any of the expression cassettes described herein are used to generate a recombinant AAV genome.

[0059] In some embodiments, the expression cassettes described herein are modified into suitable genetic elements (vectors) useful for generating viral vectors and / or delivery to host cells, e.g., naked DNA, phages, transposons, cosmids, episomes, etc., to carry the LCA5 sequences carried therein. The selected vector may be delivered by any suitable method, such as transfection, electroporation, liposome delivery, membrane fusion techniques, high speed DNA coated pellets, viral infection, and protoplast fusion. Methods used to generate such constructs are known to those skilled in the art of nucleic acid manipulation and involve genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY.

[0060] The ITRs are the only AAV components required in cis in the same construct as the expression cassette for packaging an expression cassette, or rAAV genome, or production plasmid into virions. In one embodiment, the coding sequences for replication (rep) and / or encapsidation (cap) are removed from the AAV genome and supplied in trans or in a packaging cell line for production of the AAV vector.

[0061] Methods for making and isolating AAV viral vectors suitable for delivery to a subject are known in the art. See, for example, U.S. Pat. No. 7,790,449; U.S. Pat. No. 7,282,199; WO2003 / 042397; WO2005 / 033321, WO2006 / 110689, and U.S. Pat. No. 7,588,772B2. In one system, a producer cell line is transiently transfected with a construct encoding a transgene flanked by ITRs and a construct(s) encoding rep and cap. In a second system, a packaging cell line that stably supplies rep and cap is transiently transfected with a construct encoding a transgene flanked by ITRs. In each of these systems, AAV virions are produced in response to infection with a helper adenovirus or herpesvirus, which requires separation of rAAV from contaminating viruses. Recently, systems have been developed that do not require infection with a helper virus for recovery of the AAV - the required helper functions (i.e., adenovirus E1, E2a, VA, and E4, or herpesvirus UL5, UL8, UL52, and UL29, and herpesvirus polymerase) are also supplied in trans in these new systems. In these new systems, the helper functions can be supplied by transient transfection of cells with constructs encoding the required helper functions, or cells can be engineered to stably contain genes encoding the helper functions, the expression of which can be controlled at the transcriptional or post-transcriptional level.

[0062] The term "isolated" means that the material has been removed from its original environment (e.g., the natural environment if it occurs in nature). For example, a naturally occurring polynucleotide or polypeptide present in a living animal is not isolated, but rather is one that occurs in nature. The same polynucleotide or polypeptide, separated from some or all of the coexisting materials, would still be isolated if it were subsequently returned to nature. Such a polynucleotide can be part of a vector and / or such a polynucleotide or polypeptide can be part of a composition, but such a vector or composition would still be isolated in that it is not part of its natural environment.

[0063] In yet another system, an expression cassette flanked by the ITRs and rep / cap genes is introduced into insect cells by infection with a baculovirus-based vector. For a review of these production systems, see generally, e.g., Zhang et al., 2009, "Adenovirus-adeno-associated virus hybrid for large-scale recombinant adeno-associated virus production," Human Gene Therapy 20:922-929, the entire contents of which are incorporated herein by reference. Methods for making and using these and other AAV production systems are also described in the following U.S. patents, the entire contents of each of which are incorporated herein by reference: 5,139,941; 5,741,683; 6,057,152; 6,204,059; 6,268,213; 6,491,907; 6,660,514; 6,951,753; 7,094,604; 7,172,893; 7,201,898; 7,229,823; and 7,439,065. See generally, e.g., Grieger & Samulski, 2005, "Adeno-associated virus as a gene therapy vector: Vector development, production and clinical applications," Adv. Biochem. Engin / Biotechnol. 99:119-145; Buning et al., 2008, "Recent developments in adeno-associated virus vector technology," J. Gene Med. 10:717-733, and the following references, each of which is incorporated herein by reference in its entirety:

[0064] The methods used to construct any embodiment of the present invention are known to those skilled in the art of nucleic acid manipulation and involve genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Green and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor Press, Cold Spring Harbor, NC. See Spring Harbor, NY (2012). Similarly, methods for producing rAAV virions are well known, and the selection of an appropriate method is not a limitation of the present invention. See, e.g., K. Fisher et al., (1993) J. Virol., 70:520-532, and U.S. Patent No. 5,478,745.

[0065] "Plasmids" are generally designated herein by a lower case p preceded and / or followed by capital letters and / or numbers, in accordance with standard naming conventions well known to those of skill in the art. Numerous plasmids and other cloning and expression vectors that can be used in accordance with the present invention are well known to those of skill in the art and are readily available. Moreover, one of skill in the art can readily construct any number of other plasmids suitable for use in the present invention. The properties, construction, and use of such plasmids, as well as other vectors, in the present invention will be apparent to those of skill in the art from the present disclosure.

[0066] In one embodiment, the production plasmid is one described herein or in WO2012 / 158757, which is incorporated herein by reference. A variety of plasmids for use in the manufacture of rAAV vectors are known in the art and are useful herein. The production plasmid can be used to express an AAV carrier. The rAAV genomes are then cultured in host cells expressing the capsid and / or rep proteins, where they are rescued and packaged into capsid or envelope proteins to form infectious viral particles.

[0067] In one aspect, a production plasmid is provided that includes the expression cassette described above. In one embodiment, the production plasmid is shown in SEQ ID NO:8 and in Figures 1E-1F and is designated p643. This plasmid is used in the example of the generation of a rAAV-human codon-optimized level silin vector. Such a plasmid is a plasmid that includes a 5' AAV ITR sequence; a selected promoter; a polyA sequence; and a 3' ITR; in addition, it also includes a stuffer sequence, such as lambda. In further embodiments, the stuffer sequence maintains the rAAV vector genome at a size of about 3 kilobases (kb) to about 6 kb, about 4.7 kb to about 6 kb, about 3 kb to about 5.5 kb, or about 4.7 kb to 5.5 kb. In one embodiment, a non-coding lambda stuffer region is included in the vector backbone. An example of p643 that includes a level silin-encoding sequence is set forth in SEQ ID NO:8. In another embodiment, the production plasmid is as set forth in Figures 11A-11B and SEQ ID NO:9. In another embodiment, the production plasmid is modified for optimized vector plasmid production efficiency. Such modifications include the addition of other neutral sequences or deletion of part(s) or all of the lambda stuffer sequence to adjust the level of supercoiling of the vector plasmid. Such modifications are contemplated herein. In other embodiments, terminators and other sequences are incorporated into the plasmid.

[0068] In certain embodiments, the rAAV expression cassette, the vector (e.g., an rAAV vector), the virus (e.g., an rAAV), or the production plasmid comprises an AAV inverted terminal repeat, a codon-optimized nucleic acid sequence encoding reversilin, and an expression control sequence that directs expression of the encoded protein in a host cell. In other embodiments, the rAAV expression cassette, the virus, the vector (e.g., an rAAV vector), or the production plasmid further comprises one or more of an intron, a Kozak sequence, a polyA, a post-transcriptional regulatory element, and the like. In one embodiment, the post-transcriptional regulator is a woodchuck hepatitis virus (WHP) post-transcriptional regulator (WPRE).

[0069] The expression cassettes, vectors, and plasmids include other components that may be optimized for a particular species using methods known in the art, including, for example, codon optimization as described herein. The cassettes, vectors, plasmids, and viruses, or other components of the compositions described herein, include a promoter sequence as part of the expression control sequence. In another aspect, the promoter is cell-specific. The term "cell-specific" means that the particular promoter selected for the recombinant vector can direct expression of the cilin coding sequence at an optimized level in a particular ocular cell type. In one embodiment, the promoter is specific for expression of the transgene in photoreceptor cells. In another embodiment, the promoter is specific for expression in rods and cones. In another embodiment, the promoter is specific for expression in rods. In another embodiment, the promoter is specific for expression in cones. In one embodiment, the photoreceptor-specific promoter is a human rhodopsin kinase promoter. The rhodopsin kinase promoter has been shown to be active in both rods and cones. See, e.g., Sun et al, Gene Therapy with a Promoter Targeting Both Rods and Cones Rescues Retinal Degeneration Caused by AIPL1 Mutations, Gene Ther. 2010 January;17(1):117-131, the entire contents of which are incorporated by reference. In one embodiment, the promoter may further comprise one or more restriction sites. This will allow for modifications to facilitate cloning.

[0070] In another embodiment, the promoter is a human rhodopsin promoter. In some embodiments, the promoter is modified to provide restriction at the ends for cloning purposes. See, e.g., Nathans and Hogness, Isolation and nucleotide sequence of the human rhodopsin promoter, incorporated herein by reference in its entirety. See gene encoding human rhodopsin, PNAS, 81:4851-5 (August 1984). In another embodiment, the promoter is a portion or fragment of the human rhodopsin promoter. In another embodiment, the promoter is a mutant of the human rhodopsin promoter.

[0071] Another exemplary promoter is the human G-protein coupled receptor protein kinase 1 (GRK1) promoter (Genbank Accession No. AY327580). In another embodiment, the promoter is a 292 nt fragment (positions 1793-2087) of the GRK1 promoter (see Beltran et al, Gene Therapy 2010 17:1162-74, incorporated herein in its entirety). In another preferred embodiment, the promoter is the human interphotoreceptor retinoid-binding protein proximal (IRBP) promoter. In one embodiment, the promoter is a 235 nt fragment of the hIRBP promoter. In one embodiment, the promoter is the RPGR proximal promoter (Shu et al, IOVS, May 2102, incorporated herein in its entirety). Other promoters useful in the present invention include the rod opsin promoter, the red-green opsin promoter, the blue opsin promoter, and the cGMP-β-phosphodiesterase promoter (Qgueta et al, IOVS, Invest Ophthalmol Vis Sci.2000 Dec;41(13):4059-63), mouse opsin promoter (Beltran et al 2010, supra), rhodopsin promoter (Mussolino et al, Gene Ther, July 2011,18(7):637-45); alpha-subunit of cone transducin (Morrissey et al, BMC Dev,Biol, Jan 2011,11:3); beta phosphodiesterase (PDE) promoter; retinitis pigmentosa (RP1) promoter (Nicord et al,J. Gene Med,Dec 2007,9(12):1015-23); NXNL2 / NXNL1 promoter (Lambard et al,PLoS One,Oct.2010,5(10):el3025), RPE65 promoter; retinal degeneration slow / peripherin 2 (Rds / perph2) promoter (Cai et al,Exp Eye Res.2010 Aug;91(2):186-94); and VMD2 promoter (Kachi et al, Human Gene Therapy, 2009(20:31-9)). The entire contents of each of these documents are incorporated herein by reference. In another embodiment, the promoter is selected from human EF1α promoter, rhodopsin promoter, rhodopsin kinase, interphotoreceptor binding protein (IRBP), cone opsin promoter (red-green, blue), cone opsin upstream sequence including red-green cone locus control region, cone transduction, and transcription factor promoters (neural retinal leucine zipper (Nrl) and photoreceptor specific nuclear receptor Nr2e3, bZIP).

[0072] In another embodiment, the promoter is a ubiquitous or constitutive promoter. An example of a suitable promoter is a hybrid chicken beta-actin (CBA) promoter with a cytomegalovirus (CMV) enhancer element, such as the sequence shown in Figures 1E-1F. In another embodiment, the promoter is a CB7 promoter. Other suitable promoters include human β-actin promoter, human elongation factor-1α promoter, cytomegalovirus (CMV) promoter, simian virus 40 promoter, and herpes simplex virus thymidine kinase promoter. See, for example, Damdindorj et al, (August 2014) A Comparative Analysis of Constitutive Promoters Located in Adeno-Associated Viral Vectors. PLoS ONE 9(8): e106472. Still other suitable promoters include viral promoters, constitutive promoters, and regulatable promoters (see, for example, WO2011 / 126808 and WO2013 / 04943). Alternatively, promoters that respond to physiological cues may be utilized in the expression cassettes, rAAV genomes, vectors, plasmids, and viruses described herein. In some embodiments, due to size limitations of AAV vectors, the promoter is small in size, less than 1000 bp. In another embodiment, the promoter is less than 400 bp. Other promoters may be selected by one of skill in the art.

[0073] In further embodiments, the promoter is an SV40 promoter, a dihydrofolate reductase promoter, and a phosphoglycerol kinase (PGK) promoter, a rhodopsin kinase promoter, a rod opsin promoter, a red-green opsin promoter, a blue opsin promoter, an inter-photoreceptor binding protein (IRBP) promoter, and a cGMP-β-phosphodiesterase promoter, a phage lambda (PL) promoter, a herpes simplex virus (HSV) promoter, a tetracycline-regulated transactivator responsive promoter (tet) system, a long terminal repeat (LTR) promoter, such as the RSV LTR, MoMLV LTR, BIV LTR, or an HIV The promoter is selected from the following: LTR, the U3 region promoter of Moloney murine sarcoma virus, the granzyme A promoter, the regulatory sequence(s) of the metallothionein gene, the CD34 promoter, the CD8 promoter, the thymidine kinase (TK) promoter, the B19 parvovirus promoter, the PGK promoter, the glucocorticoid promoter, the heat shock protein (HSP) promoter, such as the HSP65 and HSP70 promoters, the immunoglobulin promoter, the MMTV promoter, the Rous sarcoma virus (RSV) promoter, the lac promoter, the CaMV 35S promoter, the nopaline synthetase promoter, the MND promoter, or the MNC promoter. These promoter sequences are known to those skilled in the art or are publicly available in the literature or databases, such as GenBank, PubMed, etc.

[0074] In another embodiment, the promoter is an inducible promoter. The inducible promoter may be selected from known promoters such as rapamycin / rapalog promoters, ecdysone promoters, estrogen-responsive promoters, and tetracycline-responsive promoters, or heterodimeric repressor switches. See Sochor et al, An Autogenously Regulated Expression System for Gene Therapeutic Ocular Applications. Scientific Reports. 2015 Nov 24; 5: 17105, and Daber R, Lewis M., A novel molecular switch. J Mol Biol. 2009 Aug 28; 391 (4): 661-70, Epub 2009 Jun 21, both of which are incorporated herein by reference in their entirety.

[0075] In a further embodiment, the promoter is a chicken beta-actin promoter having the nucleic acid sequence from nt 546 to nt 283 of SEQ ID NO:8.

[0076] In other embodiments, the expression cassettes, vectors, plasmids, and and the virus may contain other appropriate transcription initiation, termination, and enhancer sequences, efficient RNA processing signals, such as splicing and polyadenylation (polyA) signals, TATA sequences, sequences that stabilize cytoplasmic mRNA, sequences that enhance translation efficiency (i.e., Kozak consensus sequences), introns, sequences that enhance protein stability, and, optionally, sequences that enhance secretion of the encoded product. An expression cassette or vector may contain none, one or more of the elements described herein.

[0077] Examples of suitable polyA sequences include, for example, synthetic polyA, or bovine growth hormone (bGH), human growth hormone (hGH), SV40, rabbit β-globin (RGB), or modified RGB (mRGB). In a further embodiment, the polyA has the nucleic acid sequence from nt 3993 to nt 4200 of SEQ ID NO:8.

[0078] Examples of suitable enhancers include, for example, CMV enhancer, RSV enhancer, alpha fetoprotein enhancer, TTR minimal promoter / enhancer, LSP (TH-binding globulin promoter / alpha 1-microglobulin / bikunin enhancer), APB enhancer, ABPS enhancer, alpha mic / bik enhancer, TTR enhancer, en34, ApoE, among others. In one embodiment, the enhancer has the nucleic acid sequence from nt 241 to nt 544 of SEQ ID NO:8.

[0079] In one embodiment, a Kozak sequence is placed upstream of the Rebelsilin coding sequence to facilitate translation from the correct start codon. In another embodiment, CBA exon 1 and an intron are incorporated into the expression cassette. In one embodiment, the Rebelsilin coding sequence is placed under the control of a hybrid chicken beta actin (CBA) promoter. This promoter is composed of CBA exon 1 flanked by the cytomegalovirus (CMV) immediate early enhancer, the proximal chicken beta actin promoter, and intron 1 sequence.

[0080] In another embodiment, the intron is selected from CBA, human beta globin, IVS2, SV40, bGH, alpha-globulin, beta-globulin, collagen, ovalbumin, p53, or a fragment thereof.

[0081] In one embodiment, the expression cassettes, vectors, plasmids, and viruses comprise a 5'ITR, a chicken beta-actin (CBA) promoter, a CMV enhancer, a CBA exon 1 and intron, a human codon-optimized leucine sequence, a bGH polyA, and a 3'ITR. In a further embodiment, the expression cassette comprises nt 1 to 4379 of SEQ ID NO:8. In yet another embodiment, the 5'ITR comprises the nucleic acid sequence from nt 1 to nt 130 of SEQ ID NO:8, and the 3'ITR comprises the nucleic acid sequence from nt 4250 to nt 4379 of SEQ ID NO:8. In a further embodiment, the CBA exon 1 and intron comprise the nucleic acid sequence from nt 824 to nt 824 of SEQ ID NO:8. In a further embodiment, the production plasmid has the sequence of SEQ ID NO: 8, also shown in Figures 1E-1F. In a further embodiment, the production plasmid has the sequence of SEQ ID NO: 9, also shown in Figures 1A-11B.

[0082] In another aspect, a method of treating Leber's congenital amaurosis resulting from a defect in the reversillin gene and / or restoring visual function in a subject with LCA comprises delivering to a subject in need thereof a vector (such as a rAAV) encoding reversillin as described herein. In one embodiment, a method of treating a subject with LCA with a rAAV as described herein is provided.

[0083] As used in the methods, "administering" refers to delivering the composition to a target selected cell characterized as an LCA. In one embodiment, the method includes delivering the composition to the RPE, photoreceptor, or other ocular cell by subretinal injection. In another embodiment, the subject is injected intravitreally. In another embodiment, the subject is injected subretinal. In yet another method, intravascular injection, such as injection via the palpebral vein, may be used. Still other methods of administration may be selected by one of skill in the art given the present disclosure.

[0084] "Administering" or "route of administration" refers to delivery of the compositions described herein to a subject with or without a pharmaceutical carrier or excipient. Routes of administration may be combined as needed. In some embodiments, the administration is repeated periodically. The pharmaceutical compositions described herein are designed to be delivered to a subject in need thereof by any suitable route or combination of different routes. In some embodiments, direct delivery to the eye (optionally via intraocular delivery, subretinal injection, intraretinal injection, intravitreal, topical) or delivery via systemic routes, such as intravascular, intraarterial, intraocular, intravenous, intramuscular, subcutaneous, intradermal, and other parenteral routes of administration are used. The nucleic acid molecules, expression cassettes, and / or vectors described herein may be delivered in a single composition or in multiple compositions. Optionally, two or more different AAVs or multiple viruses may be delivered [see, for example, WO20 2011 / 126808 and WO2013 / 049493]. In another embodiment, the multiple viruses can include different replication-deficient viruses (eg, AAV and adenovirus), either alone or in combination with proteins.

[0085] Pharmaceutical compositions are also provided herein. The pharmaceutical compositions described herein are designed for delivery to a subject in need thereof by any suitable route or combination of different routes. These delivery means are designed to avoid direct systemic delivery of a suspension containing the AAV composition(s) described herein. Suitably, this may have the advantage of lowering the dose, reducing toxicity, and / or suppressing undesirable immune responses against the AAV and / or transgene products compared to systemic administration.

[0086] In yet another aspect, these nucleic acid sequences, vectors, expression cassettes, and rAAV viral vectors are useful in pharmaceutical compositions, including pharma- ceutical acceptable carriers, excipients, buffers, diluents, surfactants, preservatives, and / or adjuvants, etc. Such pharmaceutical compositions are used to express optimized levels of ribozyme in a host cell via delivery by such recombinantly modified or engineered AAV.

[0087] To prepare these pharmaceutical compositions containing nucleic acid sequences, vectors, expression cassettes, and rAAV viral vectors, the sequences or vectors or viral vectors are preferably evaluated for contamination by conventional methods and then formulated into pharmaceutical compositions suitable for administration to the eye. Such formulations include the use of pharma- ceutical and / or physiologically acceptable vehicles or carriers, particularly buffered saline or other buffers suitable for administration to the eye, such as HEPES, to maintain pH at an appropriate physiological level, and optionally other medicinal agents, drugs, stabilizers, buffers, carriers, additives, diluents, surfactants, or excipients. For injection, the carrier is generally a liquid. Exemplary physiologically acceptable carriers include sterile pyrogen-free water and sterile pyrogen-free phosphate buffered saline. A variety of such known carriers are provided in U.S. Patent Publication No. 7,629,322, which is incorporated herein by reference. In one embodiment, the carrier is an isotonic sodium chloride solution. In another aspect, the carrier is a balanced salt solution. In one embodiment, the carrier comprises a tween. If the virus is to be stored for a long period of time, it can be frozen in the presence of glycerol or Tween 20.

[0088] In certain embodiments, for administration to a human patient, the rAAV is suitably suspended in an aqueous solution comprising saline, a surfactant, and a physiologically compatible salt or mixture of such salts. Suitably, the formulation is adjusted to a physiologically acceptable pH, for example, in the range of pH 6-9, or pH 6.5-7.5, pH 7.0-7.7, or pH 7.2-7.8. The pH of cerebrospinal fluid is about 7.28 to about 7.32, so a pH within this range is desirable for intrathecal delivery; whereas, for intravitreal or subretinal delivery, a pH of 6.8 to about 7.2 may be desirable. However, other pHs in the broadest range, and subranges of these, may be selected for other delivery routes.

[0089] A suitable surfactant or combination of surfactants may be selected from non-toxic non-ionic surfactants. In one embodiment, a difunctional block copolymer surfactant terminated with a primary hydroxyl group, such as Pluronic® F68 [BASF], also known as Poloxamer 188, which exhibits a neutral pH and has an average molecular weight of 8400, may be selected. Other surfactants and other Poloxamers may be selected, namely, non-ionic triblock copolymers composed of a central hydrophobic chain of polyoxypropylene (poly(propylene oxide)) flanked by two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)), SOLUTOL HS 15 (macrogol-15 hydroxystearate), LABRASOL (polyoxycaprylglyceride), polyoxy 10 oleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid ester), ethanol, and polyethylene glycol. In one embodiment, the formulation includes a poloxamer. These copolymers are generally designated by a "P" (for poloxamer) followed by three digits; the first two digits x 100 indicate the approximate molecular weight of the polyoxypropylene core, and the last digit x 10 indicates the polyoxyethylene content. In one embodiment, Poloxamer 188 is selected. The surfactant may be present in an amount from about 0.0005% to about 0.001% of the suspension.

[0090] In one example, the formulation may include a buffered saline solution, including, for example, an aqueous solution containing one or more of sodium chloride, sodium bicarbonate, dextrose, magnesium sulfate (e.g., magnesium sulfate-7H2O), potassium chloride, calcium chloride (e.g., calcium chloride-2H2O), dibasic sodium phosphate, and mixtures thereof. Suitably, for intrathecal delivery, the osmolality is within a range compatible with cerebrospinal fluid (e.g., about 275 to about 290); see, e.g., emedicine.medscape.com / article / 2093316-overview. Optionally, for intrathecal delivery, a commercially available diluent may be used as a suspending agent, or in combination with another suspending agent and any other excipients. See, e.g., Elliotts B® solution [Lukare Medical]. In other embodiments, the formulation may include one or more permeation enhancers. Examples of suitable permeation enhancers may include, for example, mannitol, sodium glycocholate, sodium taurocholate, sodium deoxycholate, sodium salicylate, sodium caprylate, sodium caprate, sodium lauryl sulfate, polyoxyethylene-9-laurel ether, or EDTA.

[0091] In another embodiment, the composition includes a carrier, diluent, excipient, and / or adjuvant. A suitable carrier can be easily selected by a person skilled in the art, taking into consideration the indication caused by the transfer virus. For example, one suitable carrier is saline, which can be formulated with various buffer solutions (e.g., phosphate buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The buffer / carrier must include a component that prevents the rAAV from clogging the injection tube, while not interfering with the rAAV binding activity in vivo.

[0092] Optionally, the compositions of the invention may contain other conventional pharmaceutical ingredients, such as preservatives or chemical stabilizers, in addition to the rAAV and carrier(s). Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.

[0093] The composition of the present invention may comprise a pharma- ceutically acceptable carrier as defined above.Suitably, the composition described herein comprises an effective amount of one or more AAV suspended in a pharma- ceutically suitable carrier and / or mixed with a suitable excipient designed for delivery to a subject via injection, osmotic pump, intrathecal catheter, or by another device or route.In some examples, the composition is formulated for intravitreal delivery.In some examples, the composition is formulated for subretinal delivery.

[0094] In one exemplary specific embodiment, the carrier or excipient in the composition comprises 180 mM NaCl, 10 mM NaPi, pH 7.3, and 0.0001% to 0.01% Pluronic F68 (PF68). The exact composition of the saline component of the buffer ranges from 160 mM to 180 mM NaCl. Optionally, a different pH buffer (potentially HEPES, sodium bicarbonate, TRIS) is substituted for the specifically described buffer. Additionally, a buffer containing 0.9% NaCl is useful.

[0095] In the case of AAV viral vectors, the quantification of genome copies ("GC"), vector genomes ("VG"), or viral particles can be used as a measure of the dose contained in the formulation or suspension. Any method known in the art can be used to determine the genome copy (GC) number of the replication-defective viral composition of the present invention. One example of a method for titrating AAV GC number is as follows: First, a purified AAV vector sample is treated with DNase to eliminate non-encapsidated AAV genomic DNA or contaminating plasmid DNA from the production process. Next, the DNase-resistant particles are heat-treated to release the genome from the capsid. The released genome is then quantified by real-time PCR using a primer / probe set that targets a specific region of the viral genome (usually the polyA signal). In another method, an effective amount of a recombinant adeno-associated virus carrying a nucleic acid sequence encoding an optimized cytosine coding sequence is determined as described in SK McLaughlin et al., 1988 J. Virol., 62:1963, the entire contents of which are incorporated herein by reference.

[0096] As used herein, the term "dose" can refer to the total dose delivered to a subject during the course of treatment or the amount delivered in a single unit (or multiple units or divided doses). The pharmaceutical virus composition can be formulated in a dosage unit containing an amount of replication-deficient virus carrying a codon-optimized nucleic acid sequence encoding reversilin as described herein, said amount being about 1.0×10 9 GC~approx. 1.0×10 15 In one embodiment, the composition comprises at least 1×10 9 , 2×10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , or 9×10 9In another embodiment, the composition is formulated to contain at least 1×10 GC / dose, including all integers or decimals within the range. 10 , 2×10 10 , 3×10 10 , 4×10 10 , 5×10 10 , 6×10 10 , 7×10 10 , 8×10 10 , or 9×10 10 In another embodiment, the composition is formulated to contain at least 1×10 GC / dose, including all integers or decimals within the range. 11 , 2×10 11 , 3×10 11 , 4×10 11 , 5×10 11 , 6×10 11 , 7×10 11 , 8×10 11 , or 9×10 11 Formulated to include GC / dose, including all integer or decimal values ​​within the range. Then, the composition is dissolved in at least 1×10 12 , 2×10 12 , 3×10 12 , 4×10 12 , 5×10 12 , 6×10 12 , 7×10 12 , 8×10 12 , or 9×10 12 In another embodiment, the composition is formulated to contain at least 1×10 GC / dose, including all integers or decimals within the range. 13 , 2×10 13 , 3×10 13 , 4×10 13 , 5×10 13 , 6×10 13 , 7×10 13 , 8×10 13 , or 9×10 13 In another embodiment, the composition is formulated to contain at least 1×10 GC / dose, including all integers or decimals within the range. 14 , 2×1014 , 3×10 14 , 4×10 14 , 5×10 14 , 6×10 14 , 7×10 14 , 8×10 14 , or 9×10 14 In another embodiment, the composition is formulated to contain at least 1×10 GC / dose, including all integers or decimals within the range. 15 , 2×10 15 , 3×10 15 , 4×10 15 , 5×10 15 , 6×10 15 , 7×10 15 , 8×10 15 , or 9×10 15 GC / dose, including all integer or decimal values ​​within the range. In one embodiment, for human applications, the dose is 1×10 10 ~Approx. 1×10 12 GC / dose, including all integer or fractional values ​​within the range. All doses may be measured by any known method, such as oqPCR or digital droplet PCR (ddPCR), as described in, for example, M. Lock et al, Hum Gene Ther Methods 2014 Apr;25(2):115-25.doi:10.1089 / hgtb.2013.131, which is incorporated herein by reference.

[0097] In one embodiment, an aqueous suspension suitable for administration to an LCA patient is provided. The suspension comprises an aqueous suspension and about 1×10 10 GC or viral particles ~ approx. 1 x 10 12 and a recombinant adeno-associated virus (rAAV) as described herein useful as a therapeutic agent for treating LCA, which is GC or viral particles / eye.

[0098] It may also be desirable to administer the pharmaceutical composition of the present invention in multiple "booster" doses.For example, depending on the duration of transgene in ocular target cells, booster doses can be delivered at 6-month intervals or annually after the first administration.The fact that AAV neutralizing antibodies are not generated by administration of rAAV vector allows for further booster administration.

[0099] Such booster doses and their necessity can be monitored by the attending physician using, for example, the retinal and visual function tests and visual behavior tests described in the following examples. Other similar tests can be used to determine the pathology of treated subjects over time. The selection of the appropriate test can be made by the attending physician. Alternatively, the method of the present invention allows for a level of visual function approaching that found in wild-type retina by injecting a large volume of a single or multiple infection virus-containing solution.

[0100] In another embodiment, the amount of the vectors, viruses, and replication-defective viruses described herein carrying a codon-optimized nucleic acid sequence encoding reversilin is about 1.0×10 7 VG / eye ~ approx. 1.0×10 15 VG / eye, including all integer or decimal values ​​within the range. In one embodiment, the amount is at least 1×10 7 , 2×10 7 , 3×10 7 , 4×10 7 , 5×10 7 , 6×10 7 , 7×10 7 , 8×10 7 , or 9×l0 7 VG / eye, including all integer or decimal values ​​therein. In one embodiment, the amount is at least 1×10 8 , 2×10 8 , 3×10 8 , 4×10 8 , 5×10 8 , 6×10 8 , 7×10 8 , 8×10 8 , or 9×l0 8VG / eye, including all integer or decimal values ​​therein. In one embodiment, the amount is at least 1×10 9 , 2×10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , or 9×l0 9 VG / eye, including all integer or decimal values ​​therein. In one embodiment, the amount is at least 1×10 10 , 2×10 10 , 3×10 10 , 4×10 10 , 5×10 10 , 6×10 10 , 7×10 10 , 8×10 10 , or 9×l0 10 VG / eye, including all integer or decimal values ​​therein. In one embodiment, the amount is at least 1×10 11 , 2×10 11 , 3×10 11 , 4×10 11 , 5×10 11 , 6×10 11 , 7×10 11 , 8×10 11 , or 9×l0 11 VG / eye, including all integer or decimal values ​​therein. In one embodiment, the amount is at least 1×10 12 , 2×10 12 , 3×10 12 , 4×10 12 , 5×10 12 , 6×10 12 , 7×10 12 , 8×10 12 , or 9×l0 12 VG / eye, including all integer or decimal values ​​therein. In one embodiment, the amount is at least 1×10 13 , 2×10 13 , 3×10 13 , 4×10 13 , 5×1013 , 6×10 13 , 7×10 13 , 8×10 13 , or 9×l0 13 VG / eye, including all integer or decimal values ​​therein. In one embodiment, the amount is at least 1×10 14 , 2×10 14 , 3×10 14 , 4×10 14 , 5×10 14 , 6×10 14 , 7×10 14 , 8×10 14 , or 9×l0 14 VG / eye, including all integer or decimal values ​​therein. In one embodiment, the amount is at least 1×10 15 , 2×10 15 , 3×10 15 , 4×10 15 , 5×10 15 , 6×10 15 , 7×10 15 , 8×10 15 , or 9×l0 15 GC / eye, including all integer or decimal values ​​within the range. In one embodiment, the method comprises: 9 ~Approx. 1×10 13 In another embodiment, the method includes delivering the vector in an aqueous suspension. In another embodiment, the method includes delivering the vector in an aqueous suspension in a volume of about or at least 150 microliters. 9 ~1×10 13 The present invention relates to a method for treating visual impairment in a subject, comprising administering a rAAV as described herein at a dose of GC, thereby restoring visual function to the subject. All doses may be measured by any known method, such as by oqPCR or digital droplet PCR (ddPCR), as described, for example, in M. Lock et al, Hum Gene Ther Methods 2014 Apr;25(2):115-25.doi:10.1089 / hgtb.2013.131, which is incorporated herein by reference.

[0101] These doses, as described above, may be administered in various volumes of the carrier, excipient, or buffer formulation ranging from about 25 to about 1000 microliters, including all values ​​therein, depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method. In one embodiment, the volume of the carrier, excipient, or buffer is at least about 25 μL. In one embodiment, the volume is about 50 μL. In another embodiment, the volume is about 75 μL. In another embodiment, the volume is about 100 μL. In another embodiment, the volume is about 125 μL. In another embodiment, the volume is about 150 μL. In another embodiment, the volume is about 175 μL. In yet another embodiment, the volume is about 200 μL. In another embodiment, the volume is about 225 μL. In yet another embodiment, the volume is about 250 μL. In yet another embodiment, the volume is about 275 μL. In yet another embodiment, the volume is about 300 μL. In yet another embodiment, the volume is about 325 μL. In another embodiment, the volume is about 350 μL. In another embodiment, the volume is about 375 μL. In another embodiment, the volume is about 400 μL. In another embodiment, the volume is about 450 μL. In another embodiment, the volume is about 500 μL. In another embodiment, the volume is about 550 μL. In another embodiment, the volume is about 600 μL. In another embodiment, the volume is about 650 μL. In another embodiment, the volume is about 700 μL. In another embodiment, the volume is about 800 μL. In another embodiment, the volume is about 150-800 μL. In another embodiment, the volume is between about 700 and 1000 μL. In another embodiment, the volume is between about 250 and 500 μL.

[0102] In one embodiment, the viral construct is administered to a small animal subject, such as a mouse, in a volume of about 1 μL to about 3 μL at least 1×10 9 ~ At least 1×10 11The GC can be delivered in a dose of 100 mg / kg / day. For large livestock subjects, whose eyes are roughly the same size as the human eye, the larger human doses and volumes described above are useful. See, for example, Diehl et al, J. Applied Toxicology, 21:15-23 (2001), for a discussion of best practices for administering substances to various livestock animals, which is incorporated herein by reference.

[0103] It is desirable to utilize the lowest effective concentration of virus or other delivery vehicle to reduce the risk of undesirable effects such as toxicity, retinal dysplasia, and detachment. Further doses within these ranges may be selected by the attending physician, taking into account the physical condition of the subject, preferably human, being treated, the subject's age, LCA, and the extent of the disorder, if progressive.

[0104] Yet another aspect described herein is a method of treating, slowing, or halting the progression of LCA in a mammalian subject. In some embodiments, a rAAV carrying a modified or codon-optimized version of Reversilin sequence, preferably suspended in a physiologically compatible carrier, diluent, excipient, and / or adjuvant, may be administered to a desired subject, such as a human subject. The method includes administering to a subject in need thereof either a nucleic acid sequence, an expression cassette, a rAAV genome, a plasmid, a vector, or a rAAV vector, or a composition containing the same. In some embodiments, the composition is delivered subretinal. In other embodiments, the composition is delivered intravitreally. In yet other embodiments, the composition is delivered using a combination of administration routes suitable for treating LCA, and may also include administration via the ophthalmic vein, or other intravenous or conventional administration routes.

[0105] For use in these methods, the volume and viral titer of each dose is determined individually as further described herein and may be the same or different from other treatments performed on the same or opposite eye. The dose, administration, or management may be determined by the attending physician in view of the teachings herein. In some embodiments, the affected eye is administered the composition in a single dose selected from those listed above. In another embodiment, both affected eyes are administered the composition in a single dose selected from those listed above, either simultaneously or sequentially. Sequential administration may refer to a time difference between administration from one eye to the other eye, such as an interval of minutes, hours, days, weeks, or months. In another embodiment, the method includes administering the composition to the eye in two or more doses (e.g., split doses). In another embodiment, multiple injections are performed in different parts of the same eye. In another embodiment, a second administration of rAAV containing a selected expression cassette (e.g., an LCA5-containing cassette) is performed at a later time point. Such time may be weeks, months, or years after the first administration. In one embodiment, such second administration is with an rAAV having a different capsid than the rAAV in the first administration. In another embodiment, the rAAV in the first and second administrations have the same capsid.

[0106] In yet other embodiments, the compositions described herein may be delivered in a single composition or in multiple compositions. Optionally, two or more different AAVs or multiple viruses may be delivered (see, e.g., WO2011 / 126808 and WO2013 / 049493). In another embodiment, the multiple viruses may include different replication-deficient viruses (e.g., AAV and adenovirus).

[0107] In certain embodiments of the invention, non-invasive retinal imaging and functional studies are performed to identify rod and cone photoreceptor regions to target for therapy and to test the efficacy of treatment. In these embodiments, clinical diagnostic tests are used to determine the exact location(s) for one or more subretinal injection(s). These tests include electroretinography (ERG), perimetry, topographic mapping of the retinal layers and thickness measurements of those layers by means of confocal scanning laser ophthalmoscopy (cSLO) and optical coherence tomography (OCT), topographic mapping of cone density via adaptive optics (AO), functional ophthalmic tests, multi-electrode arrays (MEA), pupil light response, etc., depending on the species of subjects to be treated, their physical condition, and health, as well as the dose. In terms of imaging and functional studies, in some embodiments of the invention, one or more injections are performed in the same eye to target different regions of the affected eye. As further described herein, the volume and viral titer of each injection is determined individually and may be the same or different from other injections in the same or contralateral eye. In another embodiment, a single large volume is injected to treat the entire eye. In some embodiments, the volume and concentration of the rAAV composition is selected to affect only the area of ​​damaged ocular cells, while in other embodiments, the volume and / or concentration of the rAAV composition is increased to reach most of the eye, including undamaged photoreceptors.

[0108] In another embodiment, the method includes performing further studies, such as functional and imaging studies, to determine the effectiveness of the treatment. For animal testing, such tests include retinal and visual function assessment via electroretinogram (ERG) to look at rod and cone photoreceptor function, optokinetic nystagmus, pupillometry, water maze test, light-dark choice, optical coherence tomography (to measure the thickness of various layers of the retina), histology (immunofluorescence to document retinal thickness, nuclear alignment in the outer nuclear layer, transgene expression, cone photoreceptor counting, staining of retinal sections with peanut agglutinin to identify cone photoreceptor sheaths).

[0109] In particular, for human subjects, following administration of the compositions in the dosages described herein, the subject is examined for efficacy of treatment using electroretinograms (ERG) to test rod and cone photoreceptor function, pupillometric visual acuity, contrast sensitivity color vision tests, visual field testing (Humphrey / Goldmann visual fields), visual field mobility tests (obstacle course), and reading speed tests. Other useful post-treatment efficacy tests that may be performed on the subject following treatment with the pharmaceutical compositions described herein are functional magnetic resonance imaging (fMRI), full-field light sensitivity testing, retinal structure studies including optical coherence tomography, fundus photography, fundus autofluorescence, adaptive optics laser scanning ophthalmoscopy, mobility testing, reading speed and accuracy testing, microperimetry, and / or ophthalmoscopy. These and other efficacy tests are described in U.S. Pat. No. 8,147,823; co-pending International Patent Application Publication No. WO2014 / 011210 or WO2014 / 124282, which are incorporated herein by reference.

[0110] In some embodiments of the methods described herein, one-time intraocular delivery of the compositions described herein, e.g., AAV delivery of an optimized LCA5 cassette, is useful for treating LCA in a subject. In other embodiments of the methods described herein, one-time intraocular delivery of the compositions described herein, e.g., AAV delivery of an optimized LCA5 cassette, is useful for treating LCA in a subject at risk.

[0111] Thus, in one embodiment, the composition is administered prior to the onset of disease. In another embodiment, the composition is administered prior to the onset of visual impairment or vision loss. In another embodiment, the composition is administered after the onset of visual impairment or vision loss. In yet another embodiment, the composition is administered when less than 90% of the rods and / or cones or photoreceptors are functional or remaining compared to an unaffected eye. In one embodiment, neonatal treatment involves administering a levelcilin coding sequence, expression cassette or vector described herein within 8 hours, within the first 12 hours, within the first 24 hours, or up to 30 minutes of delivery. In another embodiment, particularly for primates (human or non-human), delivery to a neonate is within a period of about 12 hours to about 1 week, 2 weeks, 3 weeks, or about 1 month, or about 24 hours to about 48 hours. In another embodiment, the composition is delivered after the onset of symptoms. In one embodiment, the patient is treated (e.g., first injection) before the first year of life. In another embodiment, treatment begins after the first year, or after the first 2-3 years of age, after 5 years of age, after 11 years of age, or older. In one embodiment, treatment begins at about 4 years of age to about 12 years of age. In one embodiment, treatment begins after about 4 years of age or older. In one embodiment, treatment begins after about 5 years of age or older. In one embodiment, treatment begins after about 6 years of age or older. In one embodiment, treatment begins after about 7 years of age or older. In one embodiment, treatment begins after about 8 years of age. In some embodiments, treatment begins at about 9 years of age or later. In some embodiments, treatment begins at about 10 years of age or later. In some embodiments, treatment begins at about 11 years of age or later. In some embodiments, treatment begins at about 12 years of age or later. However, treatment can begin at about 15 years of age, about 20 years of age, about 25 years of age, about 30 years of age, about 35 years of age, or about 40 years of age or later. In some embodiments, in utero treatment is defined as administering a composition described herein to the fetus. See, for example, David et al, Recombinant adeno-associated virus-mediated in utero gene transfer gives therapeutic transgene expression in the sheep, Hum Gene Ther. 2011 Apr;22(4):419-26. doi: See 10.1089 / hum.2010.007. Epub 2011 Feb 2.

[0112] In another embodiment, the composition is re-administered at a later date. Optionally, multiple re-administrations are permitted. Such re-administrations may be with the same types of vectors as described herein, different viral vectors, or non-viral delivery. In some embodiments, the vector is re-administered to the patient at a different location in the retina from where the initial injection occurred. In some embodiments, the vector is re-administered to the patient at the same location in the retina from where the initial injection occurred.

[0113] In yet another embodiment, any of the above methods are combined with another or secondary therapy. The secondary therapy may be any known or yet unknown therapy that helps prevent, block, or ameliorate any of these mutations or defects or their associated effects. The secondary therapy may be administered before, at the same time, or after administration of the above-mentioned compositions. In one embodiment, the secondary therapy involves a non-specific approach to maintain the health of retinal cells, such as administration of neurotrophic factors, antioxidants, and anti-apoptotic agents. The non-specific approach is achieved by injection of proteins, recombinant DNA, recombinant viral vectors, stem cells, fetal tissue, or genetically modified cells. The latter may include encapsulated genetically modified cells.

[0114] In one embodiment, a method of producing a recombinant rAAV comprises obtaining a plasmid containing an AAV expression cassette as described above, and culturing packaging cells harboring the plasmid in the presence of sufficient viral sequences to permit packaging of the AAV viral genome into an infectious AAV envelope or capsid. Certain methods of rAAV vector production are described above, and may be used to generate rAAV vectors capable of delivering the codon-optimized LCA5 in the expression cassettes and genomes described above and in the Examples below.

[0115] In certain embodiments of the invention, the subject has Leber's congenital amaurosis (LCA), for which the components, compositions, and methods of the invention are designed to treat. As used herein, the term "subject" refers to a human, a domestic or farm animal, a domestic house animal, or a pet. "Subject" refers to a mammal, including animals commonly used in clinical research, including mice, rats, dogs, cats, pigs, cows, sheep, non-human primates, and the like. As used herein, the term "subject" is used interchangeably with "patient." In certain embodiments, the subject of these methods and compositions is a human. Still other suitable subjects include, but are not limited to, mice, rats, dogs, cats, pigs, cows, sheep, non-human primates, and the like. As used herein, the term "subject" is used interchangeably with "patient."

[0116] The term "treatment" or "treating" as used herein is defined to include administering to a subject one or more compounds or compositions described herein for the purpose of ameliorating one or more symptoms of LCA. Thus, "treatment" can include one or more of reducing the onset or progression of LCA in a given subject, preventing the disease, reducing the severity of symptoms of the disease or slowing their progression, including progression of blindness, eliminating symptoms of the disease, slowing the onset of the disease, or monitoring the progression of the disease or the effectiveness of a treatment.

[0117] It should be noted that the terms "a" or "an" refer to one or more. As such, the terms "a" (or "an"), "one or more," and "at least one" are used interchangeably herein.

[0118] The terms "comprise," "comprises," and "comprising" are to be interpreted inclusively rather than exclusively. The terms "consist," "consisting," and variations thereof are to be interpreted exclusively rather than inclusively. Although various embodiments herein are presented using the language of "comprising," it is intended that, under other circumstances, the relevant embodiment(s) be construed and described using the language of "consisting of" or "consisting essentially of."

[0119] As used herein, the terms "disease," "disorder," and "pathology" are used interchangeably to refer to an abnormal condition in a subject.

[0120] As used herein, the term "about" or "to" refers to a variation of 10% from the given reference, unless otherwise specified.

[0121] As used herein, the term "modulation" or variations thereof refers to the ability of a composition to inhibit one or more components of a biological pathway.

[0122] Unless otherwise defined herein, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art and with reference to the published documents, and they provide those of ordinary skill in the art with general guidance to many of the terms used herein. EXAMPLES

[0123] The following examples are illustrative only and are not intended to limit the invention.

[0124] Example 1: Recombinant rAAV and in vitro expression studies Retinal gene transfer using AAV2, the most studied recombinant AAV serotype, has been performed in humans and in more than 310 eyes in 29 different clinical trials (clinicaltrials.gov). These trials target a variety of diseases, including autosomal disorders (RPE65 deficiency, MERTK-mutated retinitis pigmentosa, choroideremia, color vision disorders), mitochondrial diseases (Leber's hereditary optic neuropathy), complications of age-related macular degeneration (choroidal neovascularization), and end-stage retinal degeneration (using optogenetic therapy). In the majority (18 / 29, or 18 of 22 studies using AAV and subretinal injection), the goal was to efficiently target RPE cells. The end result is a large amount of safety data for intraocular delivery of AAV. Subretinal injection is the same surgical technique required to target photoreceptors in LCA5 patients.

[0125] Based on the information obtained, great efforts have been made to develop procedures to treat LCA5 and other diseases involving primary photoreceptor defects. Unfortunately, AAV2 vectors do not efficiently target photoreceptors, and as mentioned above, photoreceptors comprise the major cell type in LCA5 and most other inherited retinal degenerations. For this reason, we selected AAV7m8, a vector generated by evolutionary design. This vector has been shown to efficiently target photoreceptors in various species (mouse and non-human primates (NHP)) and using different administration routes.

[0126] Efficacy reported herein includes improved ability of treated animals to navigate using visual stimuli, restoration of visual pathways to the brain as seen by pupillometry, reduced photoreceptor apoptosis, and preservation of functional photoreceptors with morphology and markers characteristic of this cell type, such as the presence of rhodopsin in the outer retina. Treated Lca5gt / gt photoreceptors show a thick outer nuclear layer with preserved outer segments with stacked outer segment disks. This is in stark contrast to untreated Lca5gt / gt retinas, which were reduced to a single row of non-contiguous photoreceptor nuclei by age 19 years and 3 months. The improvements were not permanent; however, they persisted for at least 3 months, at which point untreated Lca5gt / gt mice had no remaining photoreceptors. Electroretinogram and MEA results indicate that LCA5 gene therapy can at least partially restore both rod and cone photoreceptor-mediated responses upon successful photoreceptor transduction. The cellular responses included responses reflecting the activity of various ganglion cell types as well as a reversal of the dominant melanopsin response seen in untreated Lca5gt / gt retinas, with near-normal kinetics. These results complement the pupillometry and visual behavior findings and provide a framework for future studies (including visual behavior studies in low light conditions) aimed at further characterizing and optimizing treatment efficacy. These data indicate that a gene augmentation approach in humans similar to that used in Lca5gt / gt mice holds promise for improving vision. It may be possible to further optimize the therapeutic intervention to obtain more durable rescue effects. Varying the components of the transgene cassette (e.g., promoter) and the area of ​​the retina treated may lead to further benefits. Dosing studies will identify optimal doses for therapeutic efficacy. The fact that patients without LCA5 may retain photoreceptors throughout adulthood (mice lose photoreceptors early in their life) suggests that the window of opportunity may be greater for LCA5 humans compared to Lca5- / - mice. Photoreceptors have been reported in humans with no LCA5 in the outer foveal nuclear layer for up to 30 years, which is important because successful gene therapy requires the presence of affected cells.We could demonstrate that the retained photoreceptors in adults with LCA5 mutations exhibit a temporal pattern of light response (albeit reduced amplitude) similar to that of photoreceptors derived from individuals with normal vision. These results indicate that the remaining photoreceptors in LCA5 patients are functional, despite their structural and physiological defects. The primary cilia in iPSC-RPE derived from LCA5 mutant patients were much fewer than those derived from control cells. The fact that the cilia defects in photoreceptors in Lca5gt / gt mice can be corrected with gene augmentation therapy, and the number of cilia can be increased to normal levels, suggests that the cilia defects observed in humans with this condition may be ameliorated.

[0127] A. Recombinant AAV Recombinant AAV was developed using the AAV7m8 capsid, which is known to infect photoreceptors more efficiently than AAV2, at the Center for Advanced Reproduction. (Dalkara D, Byrne LC, Klimczak RR, Visel M, Yin L, Merigan WH, et al. In vivo-directed evolution of a new adeno-associated virus for therapeutic outer retinal gene delivery from the vitreous. Sci Transl Med (2013) 5(189): 189ra76. doi:10.1126 / scitranslmed.3005708.). An optimized cDNA (hopt.LCA5) encoding human (h) wild-type level activin was individually designed for optimal codon usage and synthesized by DNA2.0 (Menlo Park, CA). The LCA5 cDNA was placed under the control of hybrid chicken β-actin (CBA) exon 1 flanked by intron 1 sequences and the cytomegalovirus (CMV) immediate early enhancer (Figure 1A and IE). The cDNA was followed by bovine growth hormone poly(A). A long stuffer sequence was included to prevent reverse packaging (i.e., non-transgene-containing) vector derived from the AAV2 inverted terminal repeats. These vectors were generated by triple transfection and formulated in a vehicle consisting of phosphate-buffered saline (PBS) and 0.001% Pluronic F68 (PF68). See, e.g., Mizukami, Hiroaki, et al. A Protocol for AAV vector production and purification. Diss. Division of Genetic Therapeutics, Center for MolecularMedicine, 1998. The control vector contained an enhanced green fluorescent protein (eGFP) cDNA instead of the LCA5 cDNA.

[0128] These rAAVs were tested for expression of the appropriate size transgenic protein by Western blot. 8431 cells were cultured at 2×10 6 Two days after seeding, the cells were transfected with AAV7m8.hopt.LCA5 (or AAV7m8.CBA.EGFP as a control) at 1 × 10 5 or 5×10 5vg. After 48 hours, cells were harvested and processed for electrophoresis and Western blot. Antibodies included LCA5 rabbit polyclonal antibody (Proteintech, Rosemont, IL), and signals were quantified and normalized to GAPDH immunosignal to correct each value for differences in background and protein loading.

[0129] The AAV7m8.CBA.hopt.LCA5 virus can drive efficient expression of the LCA5 transgene in 8431 cells. The expected silin protein level of approximately 81 kDA was produced after infection with AAV7m8.CBA.hopt.LCA5, demonstrating a dose-dependent response.

[0130] Example 2: LCA Mouse Model Study of Lca5− / − Mice Developing a proof-of-concept gene augmentation therapy in the Lca5gt / gt mouse model entails several challenges: 1) retinal degenerative changes begin very early and progress rapidly, necessitating therapeutic intervention in neonatal mice; 2) this is a photoreceptor-specific disease, so recombinant AAV vectors must be used that efficiently target photoreceptors. AAV2 vectors, widely used in animal and human studies targeting RPE cells, do not target photoreceptors as efficiently as other AAV serotypes, as transduction comparisons of different serotypes after infection at comparable doses have shown. Ideally, a therapy must be developed that can eventually be translated into human clinical trials; and 3) retinal and visual function is very low at baseline and difficult to score, and outcome assessments must be developed to precisely identify and quantify these improvements. Herein, we present a methodology to develop a targeted gene therapy designed in response to directed evolution. We used a recombinant AAV vector (AAV7m8) to deliver a cDNA encoding codon-optimized human resilirin. By using AAV7m8 to deliver LCA5 to diseased photoreceptors early in life, we show that gene augmentation therapy results in both structural improvement of the Lca5gt / gt mouse retina and functional improvement of their vision.

[0131] Reversillin is localized to the connecting cilium of photoreceptor cells (22). The connecting cilium is a transition zone between the photoreceptor inner segment and the antenna-like outer segment that supports the selective transport of proteins and membrane vesicles. Thus, the connecting cilium is a conduit that supports bidirectional protein transport along the ciliary microtubule track, or intraflagellar transport (IFT). Using both quantitative affinity proteomics (affinity purification, mass spectrometry, and bioinformatics analysis) and transgenic mouse models, Boldt et al. demonstrated that LCA5 mutations interfere with IFT (22), leading to premature defects in the development of photoreceptor outer segments and the inability to properly transport two distinct proteins that are specifically expressed in photoreceptors, arrestin and opsin. Knockout of the Lca5 gene in mice resulted in a retinal degenerative phenotype. The Lca5- / - mice develop hypopigmented retinal spots, never develop outer segments, and lack cone and rod ERG responses to light. There is early and rapidly progressive retinal degeneration, and by 2 months of age, only a single (pathological) row of nuclei is present in the ONL. (22) Therefore, the Lca5- / - mice were used as an animal model of LCA.

[0132] Adult Lca5 gt / gt (Lca5- / -) mice were purchased from Jackson Labs (Bar Harbor, ME) and sib-bred to generate strains. All animals used in this study were genotype verified (see Supplementary Methods). Mice were subjected to a 12-h light / 12-h dark cycle and provided food / water ad libitum. This study was conducted in compliance with federal and state regulations.

[0133] For the cohorts of pups, subretinal injections were performed unilaterally in neonatal mice as previously described (28). Mice were anesthetized by hypothermia on postnatal day 5 (PN5). On postnatal day 15 (PN15), animals were anesthetized with ketamine / xylazine. Table 1 shows the number of animals used per cohort.

[0134] We also performed intravitreal injections of AAV7m8, because this vector was previously reported to penetrate the mouse retina from the vitreous side toward target photoreceptors. (25) AAV7m8.CBA.hopt.LCA5 was administered to cohort 1 in 1 μl for a total of 9.20 × 10 9 vg (Table 1). The injection solution contained 5% v / v AAV7m8.CBA.EGFP, which allowed reliable identification of the injection area at later time points by the presence of enhanced green fluorescent protein (EGFP). Additional animals were sham-injected (cohort 2), injected with AAV7m8.CBA.EGFP alone (cohort 3), or kept uninjected as controls (cohort 4). After injection, pups were returned to their mothers until weaning. [Table 1]

[0135] Ophthalmoscopy was performed approximately one month after injection to ensure that the tunica media was clear and that the retina was not detached, thus eliminating surgical complications. Animals with corneal or vitreous opacities were excluded from further studies.

[0136] Cohorts of mice were bred and studied and injected at early postnatal (PN5) and juvenile stages (PN15) (Table 1). Few complications were observed due to the injections. After injection at PN5, the majority of animals did not have corneal or vitreous opacities that would preclude further studies. Some animals with opacities were excluded from further analysis.

[0137] This AAV7m8.CβA.hopt-LCA5 virus was able to promote efficient expression of the human LCA5 transgene in mouse retina after both intravitreal (IVT) and subretinal (SR) administration (Figures 1C and 1D, respectively). Western blot analysis shows the production of the expected ∼81 kDa LCA5 protein after intraocular delivery of AAV7m8.CβA.hopt-LCA5 in Lca5gt / gt and wild-type mice at PN20 (Figure 1B). Immunofluorescence analysis shows the presence of levelsilin protein in the ONL, inner segment (IS), and connecting cilium (CC) of wild-type adult retinas (Figure 1E). Levels were expressed in Lca5gt / gt retinas after intravitreal or subretinal injection of AAV7m8.CβA.hopt-LCA5. Lucilin was found in the CC as well as in the IS and ONL (Figures 1G and 1H). In contrast, no lucilin was found in sham-injected Lca5gt / gt retinas (Figure 1F). In addition, after IVT injection, a significant number of Müller cells produced lucilin (Figure 1G).

[0138] Example 3: Retinal / visual function testing Tests of visual and retinal function included light-cued water maze (2-3 months post-injection), pupillometry (2.5 months post-injection), multi-electrode array (3 months post-injection), and electroretinography using mice as shown or described in Example 2. Retinas were then evaluated for histopathology and immunofluorescence as described in Example 4. Extensive histological analysis was also performed.

[0139] A. Electroretinography ERGs were recorded from 8 Lca5gt / gt mice, 5 wild-type animals, and 16 Lca5gt / gt mice that were intravitreally injected at PN5 with vehicle in the left eye and AAV7m8.CβA.hopt-LCA5 in the right eye. Control eyes not injected with Lca5gt / gt or vehicle-injected Lca5gt / gt eyes (32 eyes in total) did not produce detectable ERG responses. Of the 16 eyes injected with AAV7m8.CβA.hopt-LCA5, 4 eyes showed ERG responses to a dim light flash in the dark-adapted state consistent with rod mediation of the signal, as well as mixed rod-cone responses to brighter light flashes that resembled the small-scale wild-type (WT) mixed rod-cone ERG waveforms (Figure S2). Light-adapted ERGs were also detectable in these eyes, suggesting cone mediation of the photopic response. The amplitude of detectable ERGs after treatment ranged from 20–25% of WT amplitude (Figure S2). This result suggests restoration of both rod and cone photoreceptor function after gene therapy in some animals. The discrepancy in findings in ERGs across fields may reflect incomplete retinal coverage and / or tissue damage (e.g., cataracts, unresolved detachment) that persists after these technically challenging subretinal injections performed early in the postnatal period. However, these results, although variable in magnitude and frequency, were dramatically different from the undetectable ERGs observed in untreated Lca5gt / gt eyes. B. Water Maze Guidance Studies

[0140] A water maze test was performed to assess each animal's ability to identify the chamber containing a submerged platform within a five-chamber water maze (Figure 11). The apparatus was placed in a room with no external light, and a light source was placed directly above the platform prior to testing. Dark-adapted mice were released in the center of the maze and given 60 seconds, without interruption, to find the illuminated platform and land with all four paws.

[0141] Mice were dark adapted and training was performed under room light (approximately 200 lux) before testing under dim light procedures. During training, if the mouse had not found the platform at the end of 60 seconds, the experimenter guided the mouse to the platform. For each trial, the light and platform were placed in different chambers using random selection.

[0142] Training pass criterion was defined as the ability of the mouse to independently enter the appropriate chamber without veering into a different chamber and to climb the platform within 60 seconds on more than five out of nine consecutive trials. All mice were trained for five days, regardless of the day on which the training pass criterion was met. Testing was performed over four days using the same procedure used in training, but with a series of filters to further dim the light source. The use of filters reduced the luminance: 1.06 × 10 5 , 8.69×10 3 , 5.87×10 2 scot cd m 2 or the luminance when the light is off is 0 scot cd m 2 It was.

[0143] Animals were trained and tested in the light-cued water maze at 2-2.5 months of age. Results of the light-cued water maze test showed that the AAV7m8.CBA.hopt.LCA5 subretinal or intravitreal injected groups performed significantly better than the control group (Table 2B, see bolded values; Figure 3). Table 2A shows the raw data of the number of animals analyzed in each cohort and tested to specify light levels using the water maze. Table 2B shows the results of the statistical analysis using one-way analysis of variance (ANOVA). Treated animals had a significantly higher mean score of 8.69 × 10 3 scot cd m 2 passed the test in the control cohort of animals injected with the vehicle, but not in the control cohort of animals (p<0.01). [Table 2-1] [Table 2-2]

[0144] C. Pupillary light reflex The amplitude of pupil constriction was measured with 10 consecutive flashes / eye. Flash intensity was 1,000 scot lux. PLR was defined as having a maximum amplitude of pupil constriction response within a 0.6-1.2 s interval following a flash that exceeded 3 standard deviations of the pre-stimulus diameter. A scientist blinded to the treatment paradigm assessed each animal's data prior to analysis to ensure that each pupil was accurately tracked. If this was not the case, that particular animal was excluded from further analysis.

[0145] For statistical analysis, treated (right) and contralateral sham-injected control (left) Lca5- / - eyes were compared at each light intensity. The normalized amplitude of contraction of the treated eye was divided by that of the untreated eye to obtain the percentage of maximum difference amplitude of response (MDAR). A higher percentage of MDAR indicates a stronger response to the therapeutic intervention. Additional untreated Lca5- / - and wild-type (C57B1 / 6) mice of the same age were used as positive and negative controls, respectively. The MDAR of untreated Lca5- / - and C57B1 / 6 mice was set to approximately 0 because the difference between the two eyes was minimal.

[0146] In further analyses, the magnitude of pupil constriction amplitude in the right eye of different cohorts of mice was assessed, so that the amplitude of constriction could be compared between treated and untreated Lca5- / - mice and untreated C57B1 / 6 mice.

[0147] Analysis of the amplitude of the pupillary light reflex produced by stimulation of treated and control eyes revealed a significant (p<0.05) improvement in pupillary reflex amplitude in Lca5- / - mice treated with AAV7m8.hopt-LCA5 either subretinal or intravitreal compared to untreated control Lca5- / - animals (Figure 2). Animals injected with either delivery route at PN5 (Figures 2A, 2B, 2H, and 2I) and with subretinal delivery at PN15 had a significant improvement in the pupillary light reflex (PLR), with a trend towards improvement with intravitreal delivery (Figures 2H and 2I).

[0148] D. Multielectrode Array AAV7m8.CMV / CBA.hopt.LCA5 (approximately 9.87 × 10 10 Multielectrode array (MEA) testing was performed in five animals 2.5–3.5 months after intravitreal injection of 1000 mg / vg / eye in one eye. The other eye was sham-injected and used as a negative control. Five untreated, age-matched wild-type (WT) C57B1 / 6 mice served as positive controls. Retinas of light-adapted mice were dissected under red light, and ganglion cells were placed in a perforated MEA chamber. The explants were placed facing downward. The presence of GFP in the explants confirmed exposure of the photoreceptors to AAV. Calibrated full-field flashes of 455 nm light of different intensities (pigment excitation efficiency approx. 40%: rhodopsin and M-opsin; approx. 0.2%: S-opsin) were used for photostimulation (2 s flashes at 0.1 Hz or 50 ms flashes at 4 Hz). Data were analyzed using custom code in Matlab (MatLab, Natick, MA); spike sorting was performed with Plexon Offline Sorter (Plexon, Dallas, TX). AAV7m8.CβA.hopt-LCA5 at PN5 was probed using multielectrode array (MEA) analysis. The reason for using an MEA is that it measures the retinal output signal sent to the brain, providing information about the retinal neural network in addition to testing photoreceptor function. Of the five retinas / animals tested with the MEA, two had clearly detectable rod and cone ERGs (see representative tracings in Figure S2), one had a residual faint, approximately 10 V ERG, and two had no detectable ERGs. Three of the five retinas injected with AAV7m8.CBA.hopt.LCA5 showed strong light responses, one showed a median response, and one showed a minimal response in the MEA test (Figure 5A-D). Responses became detectable at scotopic intensities (42-112 photons*s -1* μm -2 , or, on average, 8.28el hv / μm 2 ;455nm) and 2.00e9 photons*s -1* μm -2 Strong responses were observed at the brightest photopic intensity of 1 μm . The collection areas of the rods and cones for end-on illumination are approximately 1 μm at the wavelength of peak sensitivity. 2Assuming that the efficiency of 455 nm light for rhodopsin and stimulation by M- and S-cone opsins is approximately 60%, 50%, and 0.3%, respectively,25-27 the dim light that would produce a clearly detectable response in our experiments should result in fewer than 70 photoisomerizations / sec / cell in rods, fewer than 60 in M-cones, and approximately 0.3 in S-cones. Data from suction pipette recordings show that dye excitation at this rate can produce detectable light responses (response amplitudes >20% of maximum) in rods, whereas cone responses would be at least 20-fold smaller under the most favorable conditions (rod-transducin knockout retinas containing dark-adapted M-cones) and should be undetectable in rod-dominated mouse retinas25,26,28 (the collection area for side-on illumination in suction pipette recordings is approximately 0.5 μm-2 for cones and 0.2 μm-2 for cones). Thus, in our experiments, the observation of light responses in the dimmer intensity range attests to the restoration of rod function in treated Lca5gt / gt retinas. Responses at the bright end of the intensity range should be cone-derived (the brightest intensity produces approximately 1.00e9 and 6.00e6 photoisomerizations / sec / cell for M- and S-cones, respectively, and should be able to drive at least both M- and S-cones). As expected for rod / cone-driven responses, after exposure to the brightest stimulus series, at the end of the first intensity series (light-sensitive retinas were subjected to at least two intensity series tests, increasing approximately 0.5 logs from scotopic to the brightest photopic intensity), scotopic responses disappeared, whereas photopic responses were not significantly affected (Fig. 5C and D). WT and treated Lca5gt / gt retinas also responded to 4 Hz flicker stimuli at intensities that would be expected to drive cone responses (data not shown). The retina of the sham-injected contralateral eye showed minimal to absent response, with high autoluminescence and prominent melanopsin response.

[0149] A slower melanopsin-driven response was also detected in both AAV7m8.CβA.hopt-LCA5-treated Lca5gt / gt retinas, and the melanopsin response of wild-type mice (which appears to have a slower recovery after the first flash in the series, resulting in an increased emission rate at the onset of the second flash) appeared to be absent in treated retinas compared to untreated retinas. [Table 3]

[0150] The two treated Lca5- / - retinas showed signs of injury after injection and, despite being highly autoluminescent, showed no light response.

[0151] Responses of AAV7m8.CBA.hopt.LCA5-treated retinas were similar to those of untreated wild-type retinas. One treated retina tested at the shortest time post-injection showed reduced light sensitivity and lack of OFF- and sustained ON-responses (red downward triangles in Fig. 5D). The development of OFF-responses required a longer time post-injection compared to ON-responses, consistent with the increased variability in OFF-response amplitude observed in the 10 treated retinas. Functions of all ganglion cell types identifiable in WT retinas under full-field stimulation were detected in Lca5gt / gt AAV-treated retinas after spike sorting (Fig. S10). Under scotopic and photopic stimulation, at the brightest intensity (approximately 100 mW / cm2), 100% of the ganglion cell types were detected in the Lca5gt / gt AAV-treated retinas after spike sorting (Fig. S10). 2 ) were observed. As expected for a rod / cone-driven response, after exposure to the brightest light, the scotopic response was abolished, whereas the photopic response was not significantly affected (data not shown).

[0152] The response of AAV7m8.hopt.LCA5-treated retinas became detectable at scotopic intensities (42-112 photons). * s-1 * μm-2, or on average, 8.28el hv / μm2; 455nm) and 2.00e9 photons * s-1 *A robust response was observed at the brightest photopic intensity of 1.5 μm-2. Retinas from sham-injected contralateral eyes showed minimal to absent responses (data not shown, control Lca5- / -). Responses in AAV7m8.hopt.LCA5-treated retinas were similar to those in wild-type mice. After exposure to the brightest light (2E9 hv / cm2), flicker responses indicate that the photopic response was not significantly affected (data not shown, Lca5- / - treated). Flicker response intensity series (3.53E2-1.52E6 hv / cm2) Starting with a representative AAV7m8.CBAhopt.LCA5 treated retina (cm2), the amplitude of the response increases as light intensity increases. Examination of rod and cone durability responses after the brightest light flash shows a persistence of cone responses similar to that seen in wild type retinas. Flicker response studies show similar responses in treated Lca5- / - retinas compared to wild type mouse retinas. The light emission rates of rods and cones in treated Lca5- / - retinas as a function of light intensity approximate those of wild type retinas (as opposed to control untreated Lca5- / - retinas).

[0153] The response kinetics was similar to that of the WT retina (data not shown). * s -1* μm -2 The light sensitivity of treated Lca5- / - was slightly lower compared to the most sensitive WT retina, where the first response was detected at 1000 nm (data not shown). All ganglion cell types (ON, OFF, and ON / OFF types) identifiable in the WT retina under full-field stimulation were detected in the Lca5- / - treated retina after spike sorting. WT and treated Lca5- / - retinas were detected at 3.53e2-2.00e9 photons. * s -1* μm -2 , and responded to 4 Hz flicker stimuli (data not shown). All untreated Lca5- / - retinas showed a bright intensity and slow melanopsin-driven response that was absent in the light-sensitive treated Lca5- / - retinas. A summary of the findings is shown in Table 3.

[0154] Although results from electroretinogram and MEA experiments showed recovery of rod and cone function in at least some animals, these methods produced useful ERG signals in only a quarter of treated mice, making them insufficient for assessing the efficacy of therapeutic intervention in the majority of animals. We therefore assessed the efficacy of therapeutic intervention based on two additional methods, the pupillary light reflex (PLR) and analysis of visual behavior, which showed, first, greater sensitivity than electroretinogram and, second, that treatment of Lca5gt / gt retinas with AAV7m8.CβA.hopt-LCA5 resulted in a light-induced signal that was relayed beyond the retina via the visual pathway to the brain.

[0155] The pupillary light reflex (PLR) relies on the relay of signals from photoreceptors first to retinal ganglion cells, then to the Edinger-Westphal nucleus in the brain, and finally back to the pupillary sphincter via the ciliary ganglion, which controls the diameter of the iris. Compared to sham-injected controls, the amplitude of the PLR ​​in eyes of Lca5gt / gt mice treated with AAV7m8.CβA.hopt-LCA5 was significantly (p<0.05) increased in the analysis of PLR after stimulation of treated and control eyes (Figure 2C). There was a marked improvement in the PLR ​​detected in animals injected intravitreally or subretinally at PN5 (Figures 2A-2B and 2E-2F), with a near wild-type response observed (Figure 2D). A statistically significant improvement in the amplitude of the PLR ​​was also demonstrated through a comparison of the maximum difference amplitude of the response (MDAR; Figures 2G-2I; Figure S1). Animals receiving IVT or SR delivery of AAV7m8.CβA.hopt-LCA5 also showed a significant improvement in PLR as quantified by MDAR (Figures 2H and 2I).

[0156] Because the PLR ​​demonstrates retinal signaling and function but does not provide information about formed vision, we used a light-cued water maze test to measure functional vision, as previously described. The majority of untreated wild-type (normal vision) mice successfully navigated the water maze at all light levels, whereas untreated Lca5gt / gt mice were severely impaired (Table 2, Figure 3A). Water maze results showed that Lca5gt / gt animals injected with AAV7m8.CβA.hopt-LCA5 both IVT and subretinally outperformed uninjected controls in a statistically significant manner under at least one light condition (Table 2; Figure 3). Animals receiving subretinal treatment at PN5 showed significantly improved success rates (p<0.01) over the control vehicle-injected cohorts across all light test conditions (1.06E+05, 8.69E+03, and 5.87E+02 scod cd m-2). Improvements were minimal when animals were injected PN15 (IVT or SR). To confirm that the mice were only using the prescribed light cues, we performed the test in the dark (0.00 scot cd m2), and more than 90% of the mice failed the test (including mice with normal vision, Figure 3B).

[0157] Example 4: Ocular histology, histopathology, immunofluorescence, and TUNEL assays Histological rescue of Lca5gt / gt photoreceptors at PN5 after treatment with AAV7m8.CβA.hopt-LCA5 was assessed through both molecular assessment and structural measurements related to the proper function of the phototransduction cascade. Animals described in Examples 2 and 3 were euthanized at 3 months of age. Eyes were enucleated and retinal sections were evaluated using a modified method described by Boldt et al. (22) Tissues were fixed in PBS containing 4% paraformaldehyde and cryoprotected in 30% sucrose / PBS before freezing and cryosectioning. Histopathology was analyzed by examination of 4',6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific, Philadelphia, PA)-stained sections and / or staining with hematoxylin and eosin. For immunofluorescence studies, sections were incubated with anti-reversilin (1:300, (12, 22)) in the presence of blocking solution, washed, and then treated with Cy3-conjugated secondary antibodies. Additional antibodies used were anti-rhodopsin (1:500, Leico Technologies), anti-red / green cone opsin (1:250, Chemicon), and anti-acetylated tubulin (1:1,000, Sigma-Aldrich). Stained sections were coverslipped with Citifluor mounting medium containing DAPI (Electron Microscopy Services, Hatsfield, PA). TUNEL staining was performed using a terminal deoxynucleotidyl transferase (TdT) dUTP nick end labeling (TUNEL) assay kit according to the manufacturer's recommendations (Vector Laboratories, Burlingame, CA). Sections were evaluated with a Zeiss Axio Imager M2 microscope equipped with epifluorescence and Axio-Vision 4.6 software, and a confocal laser scanning microscope (Olympus Fluoview 1000, Center Valley, PA, USA). Transmission electron microscopy (TEM) was performed on designated tissue samples using an FEI-Tecnai T12 S / TEM.

[0158] Immunofluorescence analysis of eyes injected with AAV7m8-hopt-LCA5 at PN5 and analyzed at PN15 showed levelsilin colocalizing with the base of tubulin-positive outer segments. After intravitreal injection, levelsilin was distributed throughout the retina and was nearly devoid of photoreceptors in PN95. In contrast, levelsilin was absent in untreated PN15 and PN95 Lca5- / - retinas.

[0159] Hematoxylin and eosin stained treated and control retinal sections were compared to sham injections after intravitreal (IVT) or subretinal (SR) injection of AAV7m8.hopt-LCA5 (5% v / v AAV7m8.eGFP) at PN40 versus PN99. Hematoxylin and eosin stained (H&E) retinal photomicrographs showed that the inner / outer segment (IS / OS) and ONL were preserved at 3 months (PN99) after either IVT or SR injection of AAV7m8.hopt-LCA5 (data not shown). In contrast, no such layers were observed in sham-injected control retinas at PN99 (data not shown). Furthermore, levelsilin was detected in treated retinas but not in sham-treated control retinas (data not shown). Persistent expression of rhodopsin in the ONL was also confirmed by immunofluorescence analysis (data not shown), but was only observed in treated eyes.

[0160] At PN5, the thickness of the photoreceptor layer in retinas treated with AAV7m8.CβA.hopt-LCA5, either by IVT or SR injection, was significantly greater than in control retinas ( Fig. 4 ). There was also a pronounced demarcation in thickness between areas of retina exposed or not exposed to AAV in retinas treated with subretinal injections (data not shown). Preservation of the photoreceptor layer persisted up to the latest time point (PN99). The increased thickness was due to an increased number of columns in the outer nuclear layer and the presence of inner and outer segments (Figure 4). Consistent with this, there was a significantly higher percentage of dying photoreceptors in control compared to AAV.LCA5-treated retinas, as judged by TUNEL labeling, especially within the first month of therapeutic intervention (data not shown).

[0161] Evaluation of Lca5- / - mouse retinas injected with AAV7m8.hLCA5 at PN5 1-3 months after injection revealed increased thickness of the outer nuclear layer (Figure 5A and Figure 9). Immunofluorescence analysis revealed that reversilin colocalized with the base of tubulin-positive outer segments in Lca5- / - retinas treated with AAV7m8.hOP.LCA5 (Figure 1M). Untreated Lca5- / - retinas had numerous TUNEL-positive cells at 1 month of age, whereas AAV7m8.hOPT.LCA5-treated retinas had significantly fewer TUNEL-positive cells (Figures 6B and 6C). The number of TUNEL-positive cells decreased by the time these animals were 3 months of age (Figures 6D and 6E). The majority of cells that degenerated over time in untreated Lca5- / - retinas compared to control (untreated) retinas were photoreceptors, as shown by the fact that rhodopsin-positive cells were only found in AAV-treated retinas (Figure 6B). Immunofluorescence analysis confirmed this result (see blue DAPI stained ONL) and showed a sustained increase in rhodopsin (red staining) at 3 months (Figure 6D). After injection of AAV7m8.hopt.LCA5, we observed evidence of light-mediated changes in the location of phototransduction-specific molecules (Figure 10).

[0162] Transmission electron microscopy (TEM) of AAV7m8.hopt.LCA5-treated retinas showed detailed outer segments with stacked outer segment discs, 9+0 microtubule arrays typical of primary villi (Figure 7B), and connecting cilia (Figure 7). In contrast, untreated Lca5- / - retinas lacked both connecting cilia and outer segments. Untreated retinas lacked outer segments and showed extensive degeneration of photoreceptors with only pyknotic nuclei and remnants of photoreceptor organelles. Only disorganized degenerated photoreceptor cell bodies were present in control untreated or sham-injected retinas.

[0163] Light stimulation of dark-adapted adult Lca5gt / gt retinas treated with AAV7m8.hopt-LCA5 on PN5 introduced normal translocation patterns of phototransduction proteins to the outer segments. Arrestin translocates appropriately after light exposure to AAV7m8.hopt-LCA5-treated retinas. Such behavior cannot be assessed in control retinas due to degeneration of the IS / OS. This data reflects the restoration of intraflagellar trafficking defects in mouse retinas after delivery of wild-type (WT) hLCA5 cDNA.

[0164] Developing proof-of-concept gene augmentation therapy in the Lca5- / - mouse model entails several challenges: 1) retinal degenerative changes begin early in life and progress rapidly, necessitating therapeutic intervention in neonatal mice; 2) because this is a photoreceptor-specific disease, recombinant AAV vectors must be used that efficiently target photoreceptors. The AAV2 vector, widely used in animal and human studies to target RPE cells, does not target photoreceptors as efficiently as other AAVs (23, 24). Ideally, reagents that can ultimately be used for human clinical trials should be used; and 3) retinal and visual function are at difficult-to-measure low levels at baseline, and outcome measures that reflect these improvements must be developed. Herein, we tested efficacy following delivery of a cDNA encoding native human leucine using a recombinant AAV designed following directed evolution, AAV7m8 (25). We have reported elsewhere that this vector efficiently targets photoreceptors following intravitreal delivery (25-27). We used AAV7m8 to deliver hLCA5 cDNA By delivering A to diseased photoreceptors early in life, gene augmentation therapy resulted in both structural improvement of the retina and functional improvement of the vision of Lca5- / - mice.

[0165] In Examples 3 and 4, we demonstrated that AAV7m8-mediated gene augmentation therapy in Lca5− / − mice rescued retinal and visual function, and also retinal structure.

[0166] Efficacy reported here included improved ability of the model to navigate using visual cues, restoration of rod and cone photoreceptor responses as demonstrated by multielectrode arrays (MEA), reduced apoptotic cell death (i.e., preservation of photoreceptors), and the presence of cell biological and physical features characteristic of normally functioning photoreceptors, such as the presence of rhodopsin in the outer retina and normal-appearing outer segment development with stacked outer segment discs. MEA results demonstrated that with successful injection and sufficient time post-injection to express the transgenic protein and restore rod / cone outer segment function, gene therapy restored degenerated retinal cells to a state nearly indistinguishable from the WT state. Furthermore, delivery of wild-type LCA5 protected photoreceptors from degeneration. Untreated Lca5- / - retinas were reduced to a single row of pathological photoreceptors by 3 months of age, whereas the areas treated with AAV had a thickened outer nucleus that later comprised inner and outer segments. These benefits persisted for at least 3 months - a crucial finding, especially considering that by this age, there were no remaining photoreceptors in the untreated Lca5- / - mouse retina. The data suggested that a genetic augmentation approach in humans similar to that used in Lca5- / - mice could improve vision.

[0167] Example 5: Human studies: Pupillary light reflex test The study was performed after obtaining written informed consent for an IRB approved protocol (#815348). Pupillary responses were recorded simultaneously in both eyes with a Procyon P3000 pupillometer and PupilFit6 software (Monmuthshire, UK). Pupillary responses to light were recorded after a dark interval following the presentation of a 10 lux green light stimulus to the right eye for 0.2 seconds. An infrared-sensitive camera capturing video images at 25 frames / second allowed the measurement of pupil diameter in both eyes every 40 milliseconds.

[0168] A pupillary light reflex test was performed to determine whether there was evidence of function in the remaining photoreceptors present in adults with homozygous LCA5 mutations. As shown in Figure 8, the pupillary light reflex was present in this individual and had the same temporal sequence as in individuals with normal vision. However, the amplitude of the response was significantly reduced compared to individuals with normal vision.

[0169] Example 6: Induced pluripotent stem cell (iPSC) model of LCA5 To aid in translating mouse rescue studies to humans, we studied human induced pluripotent stem cell (iPSC) lines generated for research purposes from individuals with normal vision and individuals affected by LCA due to LCA5 mutations. Recently, it has been reported that iPSC-derived retinal pigment epithelium (RPE) recapitulates the functional phenotype of polarized epithelium with secretory, gene expression, and maturation characteristics compared to fetal and adult RPE29. These cells hold great promise for understanding disease mechanisms associated with defects in ciliary biology30,31. Herein, we differentiated iPSCs into RPE cells (Figure ​(Figure12A),12), allowing for the assessment of ciliated cells in a shorter time and more efficiently than the process that generated neurons / photoreceptors (Figure S12). We assessed LCA5 gene expression and showed that LCA5 mRNA was expressed in unaffected iPSC-derived RPE and that the expression levels of LCA5 in RPE of LCA patients were significantly reduced compared to controls (Figure12B). When we measured the ciliary distribution, we found that iPSC-RPE derived from LCA5 patients had significantly fewer cilia than RPE derived from individuals with normal vision (Figure 12D-E). Treatment with AAV7m8.LCA5 resulted in the production of reversilin protein (Figure 12C) and a comparable number of cilia to RPE cells from individuals treated with AAV7m8.LCA5 and from individuals with normal vision (Figure 12D-F).

[0170] Peripheral blood mononuclear cells (PBMCs) were collected after obtaining signed informed consent (IRB approved protocol #808828) from two different probands carrying LCA5 mutations. One proband, JB605, was a compound heterozygote for LCA5 Gln279Stop CAG>TAG het and Lys172del4ctcAAAGhet; the other, JB590, was homozygote for LCA5 c.835C>Tp.Q279X. Wild-type cells were derived from individual PBWT4.6. Induced pluripotent stem cell lines were generated from each of the three individuals. These PBMCs were cultured in growth medium consisting of QBSF-60 (Invitrogen, Carlsbad, CA) medium supplemented with cytokines and hormones. Medium was replenished every 2–3 days for 7–9 days until the cells entered the exponential growth phase.

[0171] For reprogramming, expanded PBMCs were transduced with rTTA lentivirus and a doxycycline-inducible "stem cell cassette" with lentiviral vectors delivering OCT4, KLF4, SOX2, and cMyc cDNAs, as well as the microRNA 302 / 367 cluster driven by the TetO / CMV promoter. Cells were grown in growth medium supplemented with polybrene (5 μg / ml; Sigma-Aldrich, St. Louis, MO). These cells were incubated at 37°C for 20–24 h. Infected cells were then washed and placed in growth medium supplemented with 1 μg / ml doxycycline (DOX). After 48 hours, cells were resuspended in Iscove's modified Dulbecco's medium (IMDM) containing 10% fetal bovine serum (FBS), penicillin / streptomycin, L-glutamine, beta-mercaptoethanol, non-essential amino acids, 4 ng / ml basic fibroblast growth factor (bFGF), and 1 μg / ml DOX (Sigma-Aldrich, St. Louis, MO) and then transferred to Matrigel-coated (BD Biosciences, San Jose, CA) mouse embryonic fibroblast plates (MEF plates). Cells remained in this medium for 10 days before they were transferred to human embryonic stem cell (hESC) medium (DMEM / F12, 20% knockout serum replacement, non-essential amino acids, 4 ng / ml bFGF, 0.001% beta-mercaptoethanol, penicillin / streptomycin, L-glutamine, and 1 μg / ml DOX (Invitrogen, Carlsbad, CA). After 4 weeks, iPSC-like colonies were manually picked and expanded on Matrigel-coated MEF plates for 6 passages, and then transferred to 0.1% gelatin-coated MEF plates for at least 15 passages. iPSC characterization was performed using SSEA3+, SSEA4+, TRA-1-60, and TRA-1-81 (Biolegend, San Diego, CA). The results were based on surface antigen expression measured by flow cytometry using antibodies against pluripotency-expressing markers: DMNT3B, ABCG2, REX1, OCT4, SOX2, NANOG, cMYC, and KLF4.Karyotype analysis of iPSCs was performed by G-banding to generate a visible karyotype. The ability of these cells to differentiate into multiple different lineages was performed using a PCR germ layer assay (Qiagen. Germantown, MD, USA).

[0172] iPSCs characterized by activation of the Wnt signaling pathway, inhibition of the fibroblast growth factor signaling pathway, and inhibition of the Rho-associated coiled-coil-containing protein kinase signaling pathway were differentiated into RPE. Proliferated and pigmented cells were purified by plate adhesion on 8-chamber slides mounted on geltrex matrix. Enriched cells were cultured until they had a cuboidal cobblestone appearance. iPS-RPE characteristics were confirmed by gene expression, immunocytochemistry, and microscopy. Cilia length was measured by ARL 1. After fixation and staining for pericentrin, cilia lengths were measured in three dimensions using custom-designed software by the Wistar Imaging Facility (Wistar Institute, Philadelphia, PA).

[0173] Cilia were assessed for density and length in control and LCA5 iPSC-RPE cell lines. RPE cells derived from two LCA5 patients had significantly fewer cilia than the wild-type cell line. In addition, the cilia in the LCA5-derived lines were significantly shorter than those in the wild-type cells.

[0174] It has been previously recognized that LCA5 patients can retain photoreceptors, including the outer foveal nuclear layer, for up to 30 years. (21, 29) As the presence of cells is essential for successful gene therapy (even in diseased conditions), LCA5 photoreceptors may be suitable for therapy. The fact that we demonstrated that photoreceptors retained in adults with LCA5 showed a similar temporal pattern of light response (albeit with reduced amplitude) to photoreceptors in individuals with normal vision is encouraging. These results further supported the fact that the residual photoreceptors in these abnormal retinas are viable despite their structural and functional defects. Furthermore, the cilia of LCA patient-derived iPSC-RPE cells were significantly shorter than those of wild-type control cells. The fact that the cilia defect in photoreceptors in Lca5- / - mice could be corrected by gene augmentation therapy suggested that the cilia defect present in humans with this condition could be ameliorated. Studies are currently being conducted aimed at correcting the cilia defect in iPSC-derived RPE cells in vitro.

[0175] Genetic augmentation therapy in humans using LCA5 is being studied to test its safety and efficacy. In addition to the need to develop appropriate outcome measures for this severe blinding condition, this application provided solutions to some of the challenges in planning human clinical trials, including expanding the limitations in achieving relief. In Lca5- / - mice, rescue was demonstrated in both newborn (PN5) and juvenile (PN15) mice. In this mouse model, therapeutic intervention was not seen at later stages of the disease due to early loss of photoreceptors. Developmental abnormalities in the mouse model (consistent with photoreceptor degeneration) suggested that there was a developmental component to the disease. Similarly, there could be a developmental component to the human pathology. As noted above, there is evidence for persistence of some macular photoreceptors in adults in humans with LCA5. (21) Research is ongoing to determine ways to improve the function of these photoreceptors, as well as to determine whether visual pathways can be resuscitated in humans with LCA5, even after decades of suffering from vision loss, based on the successful resuscitation of cortical vision in humans enrolled in clinical trials of RPE65 gene therapy. (4, 30, 31)

[0176] Example 7: Genotyping of Lca5− / − mice Genomic DNA was PCR amplified using the following oligos: LCA-13F6 (common F) GCCTGTTCCTGCTTGCTTAC (included as SEQ ID NO: 13); LCA-13R2 (WT reverse) TGCTTTCCAAAGTAAGCACAAA (included as SEQ ID NO: 14).

[0177] en2.8r (mutant reverse) CCTGGCCTCCAGACAAGTAG (included as SEQ ID NO: 15). PCR was performed for 35 cycles with an annealing temperature of 50° C. and an extension step of 72° C. The expected products were 353 bp (wild type) and 439 bp (Lca5− / −).

[0178] Example 8: Intravitreal injection of AAV7m8.hLCA5 inhibits photoreception in Lca5− / − mice Bodily functions are restored to approximately WT levels. Early onset vision loss is due to mutations in LCA5, a gene that encodes reversillin, a protein critical for photoreceptor health and function. Because there is relative preservation of photoreceptors, LCA5 disease may be amenable to gene augmentation therapy. The potential for gene augmentation therapy using intravitreal delivery of AAV7m8.CMV / CBA.hLCA5 was tested in an Lca5 mouse model (Lca5- / -) using multielectrode arrays (MEAs) to restore photoreceptor and retinal function.

[0179] On postnatal day 5, Lca5 mice were inoculated with AAV7m8.CMV / CBA.hLCA5 (approximately 9.87 × 10 10 vg / eye) was injected intravitreally. The contralateral eye was not injected and served as a negative control. Three months after the intervention, Lca5- / - retinas were dissected under red light and placed ganglion cell side down in perforated MEA chambers under light-adapted conditions. As a positive control, age-matched untreated wild-type mice (C57Bl / 6) underwent the same dissection and preparation procedures. The presence of GFP confirmed that photoreceptors were exposed to AAV. Calibrated full-field flashes of 455 nm light in the scotopic and photopic intensity ranges (10 2 s flashes at 0.1 Hz or 400 50 ms flashes at 4 Hz) were used for light stimulation (blue light was used to target both M- and S-cones to maximize the chance of response detection, with excitation efficiencies of M- and S-cones of approximately 40% and 0.2%, respectively). Data were analyzed using custom code in Matlab and spike sorting was performed using Pllexon Offline Sorting.

[0180] After 3 months, of the eyes with intact retinas, 3 of 5 demonstrated strong light responses, 1 showed a median response, and 1 showed a minimal response when tested using MEA recordings. The 3 retinas showing strong responses were in the scotopic range (42–112 photons × s -1 ×μm -2) at which a photoresponse becomes detectable, and at 2.00 × 10 9 photon×s -1 ×μm -2 Strong responses were observed up to the brightest photopic intensities of 8–21 photons × s, whereas responses in the uninjected contralateral eye retina were minimal or absent. As expected for rod / cone-driven responses, scotopic responses were absent after exposure to the brightest stimulus series, whereas responses in the photopic range were not significantly affected. Response kinetics and sensitivity were very similar to those observed in five WT retinas tested with the same protocol (the sensitivity of treated retinas was slightly lower compared to the most sensitive WT retina, with the dimmest flashes generating rod-driven responses ranging from 8 to 21 photons × s). -1 ×μm -2 One of the treated retinas examined 2 months after injection showed a lower light sensitivity (1.52 × 10 4 photon×s -1 ×μm -2 The Lca5- / - treated retinas showed a 3.53 × 10 photopic intensity response, with most responses disappearing after the brightest exposure, indicating that 3 months may be required for sufficient expression of the target protein and generation of functional rod / cone outer segments. All ganglion cell types (ON, OFF-, and ON / OFF types) identifiable in the WT retina under full-field stimulation were detected in the Lca5- / - treated retinas after spike sorting. Similar to the WT retinas, the treated Lca5- / - retinas showed a 3.53 × 10 2 ~2.00×10 9 photon×s -1 ×μm -2 The Lca5- / - retinas responded to 4 Hz flicker stimuli at a range of intensities. Only one of seven control untreated Lca5- / - retinas demonstrated very weak light responses to bright photopic stimuli that may indicate residual cone function. All untreated Lca5- / - retinas demonstrated slow melanopsin-driven responses at bright intensities that were absent in light-sensitive treated Lca5- / - retinas.

[0181] Two of the treated Lca5- / - retinas showed signs of injury after injection and showed no light response despite being highly autoluminescent. One of the treated retina showed no obvious signs of injury after injection, but showed a high light intensity at the bright end of the stimulus intensity (8.07 × 10 8 photon×s -1 ×μm -2 ) showed only a very weak light response, which may be indicative of low expression of the target protein and / or residual weak cone function.

[0182] If the injection is successful and sufficient time is allowed post-injection to express the target protein and restore rod / cone outer segment function, gene therapy restores degenerated retinal cells to a state nearly indistinguishable from the WT state.

[0183] That is, LCA itself is one of the most severe retinal degenerative diseases, and LCA5 is one of the most severe subtypes in this category. In most cases, LCA5 patients enjoy only light perception early in life, and because of nystagmus, it is difficult to even perform structural studies or specialized tests of visual function in these very low vision subjects. Therefore, the disease is considered difficult to approach. However, the phenotype of Lca5- / - mice mirrors many of the clinical findings in humans with LCA5 mutations. Rescue data in Lca5- / - mice offers hope that similar genetic augmentation methods as in humans will improve vision. In parallel with preclinical studies leading to human clinical trials, it is important to develop methodologies to accurately measure LCA5 retinal structure and function so that the effects of gene therapy in clinical trials can be reliably and accurately captured. Such studies and gene therapy clinical trials will not only lead to treatment of this devastating condition, but also provide a framework for measuring the effects of therapeutic interventions in other severe early-onset blindness conditions.

[0184] Example 9: Preliminary Analysis of LCA5 Disease in Humans To determine whether there was evidence of function in the remaining photoreceptors present in human adults with homozygous LCA5 mutations, we performed PLR studies. As shown in Figure S11, PLR was present in these individuals at the same time sequence as in individuals with normal vision. However, the amplitude of the response was significantly reduced compared to individuals with normal vision.

[0185] Example 10: Loss of Reversilin leads to dysregulation of RPE maturation and ciliary function in cell and animal models We investigated Leber congenital amaurosis 5 (LCA5), a pathological change occurring in the visual system resulting from the loss of expression of the LCA5 gene encoding reversillin. Previous studies have elucidated the detrimental effects of reversillin deficiency on the neural retina, specifically, on photoreceptors. This study aimed to further elucidate the pathogenic mechanisms leading to LCA5 by focusing on the contribution of normal LCA5 expression to retinal pigment epithelium (RPE) development and function.

[0186] Two independent experimental paradigms were performed: one used induced pluripotent stem cell (iPSC)-derived RPE cells derived from both individuals with normal vision and individuals with LCA5. RPE cell morphology, pigmentation, cell-specific markers, and primary villi properties were measured. The second evaluated the study of wild-type mouse retinas compared to retinas from a mouse model of LCA5 deficiency (Lca5gt / gt mice). Spatiotemporal differentiation patterns were characterized in order to delineate the changes between degeneration and development that occur in the visual system due to the lack of LCA5 protein.

[0187] These results demonstrate that LCA5 deficiency in both human RPE cell models and live mouse RPE leads to profound changes in the development of these cells. Through gene expression analysis, we identified dysregulation of key proteins involved in ciliogenesis and intraflagellar transport, pigmentation, and the WNT signaling pathway during development. Immunostaining also identified differences in the epithelial barrier consistent with altered maturation due to loss of LCA5 protein function.

[0188] , This study potentially indicates that the inhibition of intracellular trafficking or indirectly We reveal the detrimental effects of LCA5 inhibition in the RPE through alterations in processes such as pigmentation by slowing maturation progression. In this study, we highlight a potential key role for RPE cells in retinal pathologies traditionally attributed to photoreceptor dysfunction.

[0189] All patents, patent publications, and other publications cited herein, as well as priority applications U.S. Provisional Patent Application No. 62 / 465,649, filed March 1, 2017, and U.S. Provisional Patent Application No. 62 / 469,642, filed March 10, 2017, are hereby incorporated by reference. Similarly, the sequence numbers referenced herein and found in the attached sequence listing are hereby incorporated by reference. While the invention has been described with reference to specific embodiments, it will be understood that modifications can be made without departing from the spirit of the invention. Such modifications are intended to fall within the scope of the appended claims.

[0190] (Sequence Listing Free Text) The following information is a numeric identifier <223> The sequence listing includes free text below. [Table 4]

[0191] source 1. Redmond TM, Yu S, Lee E, Bok D, Hamasaki D, Chen N, et al. Rpe65 is necessary for production of 11-cis-vitamin A in the retinal visual cycle. Nat Genet (1998) 20(4):344-51. PubMed PMID: 9843205. 2. Redmond T, Hamel C. Genetic analysis of RPE65: from human disease to mouse model. Methods in Enzymol (2000) 317:705-24. 3. Maguire AM, High KA, Auricchio A, Wright JF, Pierce EA, Testa F, et al. Age- dependent effects of RPE65 gene therapy for Leber’s congenital amaurosis: a phase 1 dose- escalation trial. Lancet (2009) 374(9701): 1597-605. PubMed PMID: 1985 4499. 4. Bennett J, Wellman J, Marshall KA, McCague S, Ashtari M, DiStefano-Pappas J, et al. Safety and durability of effect of contralateral-eye administration of AAV2 gene therapy in patients with childhood-onset blindness caused by RPE65 mutations: a follow-on phase 1 trial Lancet (2016) 388(10045):661-72. doi: 10.1016 / S0140-6736(16)30371-3. PubMed PMID: 27375040. 5. Jacobson SG, Cideciyan AV, Ratnakaram R, Heon E, Schwartz SB, Roman AJ, et al. Gene Therapy for Leber Congenital Amaurosis Caused by RPE65 Mutations: Safety and Efficacy in 15 Children and Adults Followed Up to 3 Years. Arch Ophthalmol (2012) 130(1):9-24. Epub 2011 / 09 / 14. doi: archophthalmol.2011.298 [pii] 10.1001 / archophthalmol.2011.298. PubMed PMID: 21911650. 6. Cideciyan AV, Jacobson SG, Beltran WA, Sumaroka A, Swider M, Iwabe S, et al. Human retinal gene therapy for Leber congenital amaurosis shows advancing retinal degeneration despite enduring visual improvement. Proc Natl Acad Sci U S A (2013). Epub 2013 / 01 / 24. doi: 1218933110 [pii] 10.1073 / pnas. 1218933110. PubMed PMID: 23341635. 7. Bainbridge JW, Smith AJ, Barker SS, Robbie S, Henderson R, Balaggan K, et al. Effect of gene therapy on visual function in Leber’s congenital amaurosis. N Engl J Med (2008) 358(21):2231-9. PubMed PMID: 18441371. 8. Weleber RG, Pennesi ME, Wilson DJ, Kaushal S, Erker LR, Jensen L, et al. Results at 2 Years after Gene Therapy for RPE65-Deficient Leber Congenital Amaurosis and Severe Early - Childhood-Onset Retinal Dystrophy. Ophthalmology (2016) 123(7): 1606-20. doi: 10.1016 / j.ophtha.2016.03.003. PubMed PMID: 27102010. 9. Banin E, Bandah-Rozenfeld D, Obolensky A, Cideciyan AV, Aleman TS, Marks-Ohana D, et al. Molecular anthropology meets genetic medicine to treat blindness in the north african jewish population: human gene therapy initiated in Israel. Hum Gene Ther (2010) 21(12): 1749- 57. Epub 2010 / 07 / 08. doi: 10.1089 / hum.2010.047. PubMed PMID: 20604683. 10. Maguire A, Russell S, Bennett J, Chung D, Wellman J, High K, editors. Phase 3 trial of AAV2-hRPE65v2 (SPK-RPE65) to treat RPE65 mutation-associated inherited retinal dystrophies. American Academy of Ophthalmology Retina Subspecialty Day;2015;, Los Vegas, NV. 11. Russell S, Bennett J, High K, Chung D, Wellman J, Maguire A. Phase 3 trial of AAV2- hRPE65v2 (SPK-RPE65) to treat RPE65 mutation-associated inherited retinal dystrophies. Saudi Ophthalmologic Society (2016). 12. den Hollander AI, Koenekoop RK, Mohamed MD, Arts HH, Boldt K, Towns KV, et al. Mutations in LCA5, encoding the ciliary protein lebercilin, cause Leber congenital amaurosis. Nat Genet (2007) 39(7):889-95. Epub 2007 / 06 / 05. doi: ng2066 [pii] 10.1038 / ng2066. PubMed PMID: 17546029. 13. Gerber S, Hanein S, Perrault I, Delphin N, Aboussair N, Leowski C, et al. Mutations in LCA5 are an uncommon cause of Leber congenital amaurosis (LCA) type II. Hum Mutat (2007) 28(12): 1245. doi: 10.1002 / humu.9513. PubMed PMID: 18000884.14. Chen X, Sheng X, Sun X, Zhang Y, Jiang C, Li H, et al. Next-generation Sequencing Extends the Phenotypic Spectrum for LCA5 Mutations: Novel LCA5 Mutations in Cone Dystrophy. Sci Rep (2016) 6:24357. doi: 10.1038 / srep24357. PubMed PMID: 27067258; PubMed Central PMCID: PMCPMC4828721. 15. Corton M, Avila-Fernandez A, Vallespin E, Lopez-Molina MI, Almoguera B, Martin- Garrido E, et al. Involvement of LCA5 in Leber congenital amaurosis and retinitis pigmentosa in the Spanish population. Ophthalmology (2014) 121(l):399-407. two: 10.1016 / j.ophtha.2013.08.028. PubMed PMID: 24144451. 16. Mackay DS, Borman AD, Sui R, van den Born LI, Berson EL, Ocaka LA, et al. Screening of a large cohort of leber congenital amaurosis and retinitis pigmentosa patients identifies novel LCA5 mutations and new genotype-phenotype correlations. Hum Mutat (2013) 34(11): 1537-46. doi: 10.1002 / humu.22398. PubMed PMID: 23946133;PubMed Central PMCID: PMCPMC4337959. 17. Vallespin E, Avila-Fernandez A, Almoguera B, Velez-Monsalve C, Cantalapiedra D, Garcia-Hoyos M, et al. Novel human pathological mutations. Gene symbol: LCA5. Disease: Leber congenital amaurosis. Hum Genet (2010) 127(4):487. PubMed PMID: 21488265. 18. Vallespin E, Avila-Fernandez A, Almoguera B, Cantalapiedra D, Garcia-Hoyos M, Riveiro-Alvarez R, et al. Novel human pathological mutations. Gene symbol: LCA5. Disease: Leber Congenital Amaurosis (LCA). Hum Genet (2010) 127(1): 118. PubMed PMID: 20108395. 19. Ahmad A, Daud S, Kakar N, Nurnberg G, Nurnberg P, Babar ME, et al. Identification of a novel LCA5 mutation in a Pakistani family with Leber congenital amaurosis and cataracts. Mol Vis (2011) 17:1940-5. PubMed PMID: 21850168;PubMed Central PMCID: PMCPMC3154126. 20. Seong MW, Kim SY, Yu YS, Hwang JM, Kim JY, Park SS. LCA5, a rare genetic cause of leber congenital amaurosis in Koreans. Ophthalmic Genet (2009) 30(l):54-5. doi: 10.1080 / 13816810802592567. PubMed PMID: 19172513. 21. Jacobson SG, Aleman TS, Cideciyan AV, Sumaroka A, Schwartz SB, Windsor EA, et al. Leber congenital amaurosis caused by Lebercilin (LCA5) mutation: retained photoreceptors adjacent to retinal disorganization. Mol Vis (2009) 15:1098-106. Epub 2009 / 06 / 09. doi: 116 [pii], PubMed PMID: 19503738;PubMed Central PMCID: PMC2690955. 22. Boldt K, Mans DA, Won J, van Reeuwijk J, Vogt A, Kinkl N, et al. Disruption of intraflagellar protein transport in photoreceptor cilia causes Leber congenital amaurosis in humans and mice. J Clin Invest (2011) 121(6):2169-80. Epub 2011 / 05 / 25. doi: 45627 [pii] 10.1172 / JCI45627. PubMed PMID: 21606596;PubMed Central PMCID: PMC3104757. 23. Vandenberghe L, Bell P, Maguire A, Cearley C, Xiao R, Calcedo R, et al. Dosage Thresholds for AAV2 and AAV8 Photoreceptor Gene Therapy in Monkey. Sci Transl Med (2011) 3(88):88ra54. Epub 22 June 2011. 24. Ramachandran PS, Lee V, Wei Z, Song JY, Casal G, Cronin T, et al. Evaluation of Dose and Safety of AAV7m8 and AAV8BP2 in the Non-Human Primate Retina. Hum Gene Ther (2016). doi: 10.1089 / hum.2016.111. PubMed PMID: 27750461. 25. Dalkara D, Byrne LC, Klimczak RR, Visel M, Yin L, Merigan WH, et al. In vivo-directed evolution of a new adeno-associated virus for therapeutic outer retinal gene delivery from the vitreous. Sci Transl Med (2013) 5(189): 189ra76. doi: 10.1126 / scitranslmed.3005708. PubMed PMID: 23761039. 26. Dalkara D, Kolstad KD, Caporale N, Visel M, Klimczak RR, Schaffer DV, et al. Inner limiting membrane barriers to AAV-mediated retinal transduction from the vitreous. Mol Ther (2009) 17(12):2096-102. doi: 10.1038 / mt.2009.181. PubMed PMID: 19672248;PubMed Central PMCID: PMCPMC2814392. 27. Mace E, Caplette R, Marre O, Sengupta A, Chaffiol A, Barbe P, et al. Targeting channelrhodopsin-2 to ON-bipolar cells with vitreally administered AAV Restores ON and OFF visual responses in blind mice. Mol Ther (2015) 23(1):7-16. doi: 10.1038 / mt.2014.154. PubMed PMID: 25095892;PubMed Central PMCID: PMCPMC4270733. 28. Liang FQ, Anand V, Maguire AM, Bennett J. Intraocular delivery of recombinant virus. Methods Mol Med (2001) 47:125-39. doi: 10.1385 / 1-59259-085-3:125. PubMed PMID:21394582. 29. Mohamed M, Topping N, Jafri H, Raashed Y, McKibbin M, Inglehearn C. Progression of phenotype in Leber’s congenital amaurosis with a mutation at the LCA5 loc us. Br J Ophthalmol (2003) 87(4):473-5. 30. Ashtari M, Cyckowski LL, Monroe JF, Marshall KA, Chung DC, Auricchio A, et al. The human visual cortex responds to gene therapy-mediated recovery of retinal function. J Clin Invest 121(6):2160-8. Epub 2011 / 05 / 25. doi: 57377 [pii] 10.1172 / JCI57377. PubMed PMID: 21606598;PubMed Central PMCID: PMC3104779. 31. Bennett J, Ashtari M, Wellman J, Marshall KA, Cyckowski LL, Chung DC, et al. AAV2 gene therapy readministration in three adults with congenital blindness. Sci Transl Med 4(120): 120ra15. Epub 2012 / 02 / 11. doi: 4 / 120 / 120ral5 [pii] 10.1126 / scitranslmed.3002865. PubMed PMID: 22323828.

Claims

1. 1. A recombinant adeno-associated virus (rAAV) comprising an AAV capsid and a vector genome packaged therein, the vector genome comprising: (a) the AAV 5′ inverted terminal repeat (ITR) sequence; (b) a hybrid promoter; (c) a coding sequence encoding human respirillin; and (d) the AAV 3′ ITR sequence; Including, the coding sequence comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:2, and the AAV capsid comprises an AAV7 capsid, an AAV7m8 capsid, an AAV8 capsid, an AAV9 capsid, or any combination thereof; The rAAV.

2. 1. An aqueous suspension suitable for administration to an LCA patient, the suspension comprising: an aqueous suspension; and 1×10 10 Virus particles ~ 1 x 10 12 and a genome copy (GC) or viral particle / recombinant adeno-associated virus (rAAV) useful for treating ocular LCA, The rAAV has an AAV capsid, and (a) the AAV 5′ inverted terminal repeat (ITR) sequence; (b) a promoter; (c) a coding sequence encoding human respirillin; and (d) an AAV 3′ ITR sequence, It has a vector genome packaged inside it. the coding sequence comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:2, and the AAV capsid comprises an AAV7 capsid, an AAV7m8 capsid, an AAV8 capsid, an AAV9 capsid, or any combination thereof; Said aqueous suspension.

Images