Composition for preventing or treating neurofibromatosis type 2 syndrome

Abstract

The present invention relates to a composition for preventing or treating neurofibromatosis type 2 syndrome, and the compound represented by chemical formula 1 according to the present invention, its pharma- ceutically acceptable salt, solvate, stereoisomer, or combination thereof inhibits TGF-β receptor 1 (TβR1)-mediated RKIP reduction without interfering with normal TGF-β signaling, unlike the existing TβR1 kinase inhibitor TEW7197, and can therefore be used as a new type of therapeutic agent for neurofibromatosis type 2 syndrome that can solve the problem of side effects caused by inhibition of normal TGF-β signaling.

Description

[Technical field]

[0001] The present invention relates to a novel compound that inhibits TGF-β receptor 1 (TβR1)-mediated RKIP reduction without interfering with normal TGF-β signaling, and a composition containing the same for preventing or treating neurofibromatosis type 2 syndrome (NF2 syndrome). [Background technology]

[0002] Neurofibromatosis (NF) is a genetic disease that affects bones, soft tissues, skin, and the nervous system, and is classified into neurofibromatosis type 1 (NF1) and neurofibromatosis type 2 (NF2). Neurofibromatosis type 2 is a benign tumor that occurs in the cranial nerve, the eighth nerve, and is a disease that manifests with symptoms of hearing loss, tinnitus, and balance disorders. It is also called vestibular schwannomas because it occurs in the schwann cells in the central nervous system. The average age at which neurofibromatosis type 2 develops is 18-24 years old, and it is known that by the age of 30, almost all patients will develop bilateral vestibular schwannomas. In addition, schwannomas of the cranial and peripheral nerves, meningiomas, ventricular theca cells, and very rarely, astrocytomas, can progress.

[0003] Neurofibromatosis type 2 is caused by a mutation in the NF2 gene located on the long arm of chromosome 22 (22q12.2). The NF2 gene is responsible for the synthesis of a protein called merlin, which is produced by the sheath cells that surround nerve cells in the brain and spinal cord in the nervous system.

[0004] Our previous studies reported an association between NF2 and RKIP in NF2 syndrome, and showed that loss of NF2 reduces TβR2 expression, causing an imbalance between TβR1 and TβR2, and increased TβR1 phosphorylates RKIP and promotes RKIP instability.

[0005] TEW7197, a representative TGF-β inhibitor, inhibited TβR1 kinase activity and suppressed neurilemmomas in a mouse model of NF2 syndrome (Mol Cancer Ther 17, 2271-2284, 2018). However, considering the physiological and pathological characteristics of NF2 syndrome, which is classified as a pediatric genetic disease and has an average onset in adolescence or earlier, inhibition of TGF-β by TEW7197 may cause side effects, since standard TGF-β is important for normal homeostasis and development.

[0006] Therefore, in order to develop a therapeutic agent for NF2 syndrome without side effects, it is extremely important to identify novel candidate substances for NF2 syndrome that suppress TβR1-mediated RKIP reduction without interfering with normal TGF-β signaling. Summary of the Invention [Problem to be solved by the invention]

[0007] An object of the present invention is to provide a pharmaceutical composition for preventing or treating neurofibromatosis type 2 (NF2) syndrome.

[0008] Another object of the present invention is to provide a health food composition for the prevention or treatment of neurofibromatosis type 2 (NF2) syndrome.

[0009] It is yet another object of the present invention to provide a method for treating Neurofibromatosis Type 2 (NF2) syndrome. [Means for solving the problem]

[0010] In order to achieve the above object, the present invention provides a compound selected from the group consisting of a compound represented by the following chemical formula 1, a pharma- ceutically acceptable salt thereof, a solvate thereof, and a stereoisomer thereof:

[0011] [ka]

[0012] In the above formula 1, R 1 is NR 5 R 6 or CN, R 5 or R 6 are the same or different and each is hydrogen or (C1-C4) alkyl; R 2 is halo, (C1-C4) alkyl or (C1-C4) alkoxy; R 3 or R 4 are the same or different and each is hydrogen, (C1-C4) alkyl or (C1-C4) alkoxy, and n is an integer of 0 to 3.

[0013] The present invention also provides a pharmaceutical composition for preventing or treating neurofibromatosis type 2 (NF2) syndrome, or a health food composition for preventing or ameliorating neurofibromatosis type 2 syndrome, comprising a compound selected from the group consisting of a compound represented by Chemical Formula 1, a pharma- ceutical acceptable salt thereof, a solvate thereof, and a stereoisomer thereof.

[0014] The present invention also provides a method for treating neurofibromatosis type 2 (NF2) syndrome, comprising administering a compound represented by Chemical Formula 1, a pharma- ceutically acceptable salt thereof, a solvate thereof, a stereoisomer thereof, or a combination thereof. Effect of the Invention

[0015] The compound represented by Chemical Formula 1 according to the present invention, its pharma- ceutically acceptable salt, solvate, stereoisomer, or combination thereof inhibits TGF-β receptor 1 (TβR1)-mediated RKIP reduction without interfering with normal TGF-β signaling, unlike the existing TβR1 kinase inhibitor TEW7197, and can therefore be used as a new type of therapeutic agent for neurofibromatosis type 2 syndrome that can solve the problem of side effects caused by inhibition of normal TGF-β signaling. [Brief description of the drawings]

[0016] [Figure 1]The results are shown in Fig. 1. Screening of RKIP inducers in NF2 syndrome cells. (A) shows Western blot analysis of RKIP expression after incubating HEI-193 cells with compounds (10 μM) for 24 hours, and (B) shows cell viability measured by MTT assay after incubating HEI-193 cells or mouse neurilemmoma cells with compounds (10 μM) for 48 hours. [Diagram 2] NF2 syndrome cells were treated with each compound (10 μM) for 72 hours, and it was confirmed that 14 compounds (shown in red) induced RKIP expression. [Diagram 3] Normal fibroblasts were reacted with each compound (10 μM) for 48 hours, and then cell viability was measured by MTT assay. [Figure 4] HEI-193 cells (A), mouse schwannoma cells (B), or normal fibroblasts (C) were treated with 39 Nf-08001-related derivatives for 48 hours, and cell viability was measured by MTT assay (TβR1 inhibitors - TEW7197, SB431542, LY2157299; mTOR inhibitor - Rad001). [Diagram 5] The results of compound derivation through optimization of Nf-08001. (A) shows the results of measuring cell viability by MTT assay after treating HEI-193 cells or normal fibroblasts with the indicated concentrations of compounds for 7 days. (B) shows the results of bead-bound GST. Western blot analysis was performed after co-incubation of RKIP recombinant protein with TβR1-transfected HEK293 cell eluate and the indicated compounds for 2 hours (+: 5 μM, ++: 10 μM, SUP: supernatant). (C) HEI-193 cells were incubated with various concentrations of compounds for 24 hours. (D) HEI-193 cells were treated with 10 μM of compound, and after 12 hours, TGF-β1 (2 ng / ml) was added and incubated for 12 hours. Western blot analysis was performed. (E) HEK293 cells were transfected with 3TP-luciferase vector to examine 3TP-luciferase activity. After 24 hours, 10 μM of compound was treated, and after 12 hours, TGF-β1 (2 ng / ml) was added and incubated for 12 hours. [Figure 6] Further results related to the derivation of compounds through the optimization of Nf-08001: (A) the reaction of HEI-193 cells with the indicated compounds for 24 hours, (B) Western blot analysis of bead-bound GST RKIP recombinant protein after co-incubation with TβR1-transfected HEK293 cell lysate and the indicated compounds for 2 hours (SUP: supernatant), and (C) immunoblotting of normal fibroblasts after treatment with 10 μM of compounds for 24 hours. [Figure 7] The results confirmed that the optimized Nf-08001 does not interfere with other signal pathways. (A) shows the results of reacting 10 μM of the compound with HEI-193 cells, and after 12 hours, IGF-1 (5 μg / ml) was added and the cells were cultured for 12 hours, followed by immunoblotting. (B) shows the molecular structure of PRG-N-01. [Figure 8]1 shows the selective effect of PRG-N-01 under NF2-deficient conditions. (A) HEI-193 cells were transfected with a FLAG-tagged TβR1 expression vector, and after 24 hours, the cells were treated with the indicated concentrations of compounds. After 6 hours, the cells were eluted and subjected to IP and Western blot analysis. (B) HEI-193 cells were transfected with a FLAG-tagged NF2 expression vector, and after 24 hours, the cells were treated with the indicated concentrations of compounds for 48 hours, and the cell viability was measured by MTT assay. (C) HEI-193 cells were transfected with a FLAG-tagged NF2 expression vector, and after 24 hours, the cells were treated with the indicated concentrations of compounds for 48 hours, and the cell viability was measured by MTT assay. (D) shows the results of immunoblot analysis after 24 hours of transfection of HEI-193 cells with 3TP-luciferase vector and examining 3TP-luciferase activity. After 24 hours, the indicated compounds were treated, and after 12 hours, TGF-β1 (2 ng / ml) was added and reacted for 12 hours (TβR1 inhibitors - TEW7197, LY2157299). (E) shows the results of immunoblot analysis after transfection of HEI-193 cells and mouse schwannoma cells with the indicated expression vectors (WT: wild type, TA: T101A mutation, TD: T101D mutation) and after 24 hours, the indicated compounds (10 μM) were treated for 24 hours. [Figure 9]The effect of PRG-N-01 was investigated. (A) HEI-193 cells were transfected with an HA-tagged RKIP expression vector, and after 24 hours, the cells were treated with the indicated concentrations of compounds. After 6 hours, the cells were eluted and subjected to IP and Western blot analysis. (B) Immunoblotting results after treating the cells with PRG-N-01 or TEW7197 for 36 hours. (C) Immunoblotting results after transfecting mouse schwannoma cells with a FLAG-tagged NF2 expression vector, and after 24 hours, the cells were treated with the indicated compounds (10 μM) for 24 hours. (D) MTT assay was performed on mouse schwannoma cells transfected with a FLAG-tagged NF2 expression vector, and after 48 hours, the cells were treated with the indicated concentrations of compounds. (E) HEI-193 cells were transfected with the indicated expression vectors (WT: wild type, RKIP T101A: mutation), and 24 hours later, the cells were treated with the specified compound (2 μM) for 48 hours, and then further reacted with TGF-β1 (2 ng / ml) for 12 hours, followed by immunoblot analysis. [Figure 10] Gene expression profile results in PRG-N-01-treated NF2 syndrome cells. (A) is the microarray result after treating HEI-193 cells with PRG-N-01 at the indicated concentrations for the indicated times, where Cluster A is the up-regulated gene set and Cluster B is the down-regulated gene set. (B-C) is the GO term analysis result of genes differentially expressed between the control group and 2 μM PRG-N-01-treated HEI-193 cells (red bars: lipid metabolism-related process; blue bars: cell cycle arrest-related process). (D) is a table listing representative genes related to lipid metabolism or cell cycle. [Figure 11]Further results of gene expression profiles in PRG-N-01-treated NF2 syndrome cells, (AB) shows the cellular component (CC) or molecular function (MF) of GO term analysis of genes differentially expressed between control and HEI-193 cells treated with 2 μM PRG-N-01 for 6 days, and (CF) shows the GO term analysis of genes differentially expressed between control and HEI-193 cells treated with 1 μM PRG-N-01 for 6 days. [Figure 12] PRG-N-01 inhibits cell cycle and promotes differentiation into neurite outgrowth cells. (A) HEI-193 cells were treated with 10 μM PRG-N-01 for 4 days and then subjected to cell cycle analysis. (B) HEI-193 cells were treated with 10 μM PRG-N-01 for the indicated times and then counted. (C) HEI-193 cells were treated with PRG-N-01 for 7 days or transfected with a FLAG-tagged NF2 expression vector to induce differentiation. (D) HEI-193 cells reacted with the indicated compounds were subjected to RT-PCR (D) or Western blot analysis (E) (TEW:TEW7197; SB:SB431542). (FG) HEI-193 cells were stained with anti-neurite outgrowth cell marker protein antibodies and then subjected to FACS analysis (F) or immunofluorescence analysis (G). [Figure 13] Further results showing that PRG-N-01 inhibits the cell cycle and promotes differentiation into neurite outgrowth cells: (A) HEI-193 cells were treated with 10 μM PRG-N-01 for 4 days and then subjected to cell cycle analysis; (B) HEI-193 cells were treated with 10 μM PRG-N-01 for 7 days to induce differentiation, and then the cells were fixed with 4% paraformaldehyde and stained with phalloidin; (C) HEI-193 cells were treated with PRG-N-01 at the indicated concentrations for 7 days and then the neurite outgrowth cell markers (MPZ and PMP22) were examined; and (D) HEI-193 cells were treated with 10 μM PRG-N-01 for 7 days and then stained with anti-neurite outgrowth cell marker protein antibodies. [Figure 14]Results of PRG-N-01 suppressing the stem cell potential of schwannoma by inducing RKIP expression. (A) Western blot results after 4 days of treatment of HEI-193 cells with PRG-N-01 or TEW7197 at the indicated concentrations. (B) Images of tumor spheres captured on day 10 after incubating HEI-193 cells or schwannoma cells with the indicated compounds (10 μM) in DMEM / F12 medium. (C) Images of tumor spheres lysed on day 10 after incubating HEI-193 cells or schwannoma cells with the indicated compounds (10 μM) in DMEM / F12 medium were immunoblotted with the indicated antibodies. (E) Western blot analysis of tumor spheres. (F) Leptomycin was used to inhibit nuclear export. (B) HEI-193 cells were treated with MG132 (2 ng / ml), and 6 hours later, 10 μM of the indicated compound was added, followed by incubation for 24 hours and immunoblotting. (G) HEI-193 cells were treated with MG132 (5 μM) to inhibit proteasomal degradation, and 6 hours later, 10 μM of the indicated compound was added, followed by incubation for 24 hours and immunoblotting. [Figure 15]Further results of PRG-N-01 inducing RKIP and suppressing the stemness of schwannoma. (A) HEI-193 cells were treated with the indicated compounds (10 μM) in DMEM / F12 medium for the indicated dates, and tumorsphere images were captured on day 4. (B) HEI-193 cells were treated with the indicated compounds (10 μM) in DMEM / F12 medium, and tumorspheres were lysed on day 10 and immunoblotted with the indicated antibodies. (C) HEI-193 cells were treated with the indicated compounds (2 μM) for 24 hours and stained with anti-SOX2 antibody. (D) HEI-193 cells were treated with the indicated compounds (2 μM) for 24 hours, and stained with anti-SOX2 antibody. (E) HEI-193 cells were treated with the indicated compounds (2 μM) for 24 hours, and stained with anti-SOX2 antibody. (F) HEI-193 cells were treated with the indicated compounds (2 μM) for 24 hours, and stained with anti-SOX2 antibody. (G) HEI-193 cells were treated with the indicated compounds (2 μM) for 24 hours, and stained with anti-SOX2 antibody. (H) HEI-193 cells were treated with the indicated compounds (2 μM) for 24 hours, and stained with anti-SOX2 antibody. (I ... (B) HEI-193 cells were transfected with the indicated siRNAs (T101D mutation) and then treated with the indicated compounds (10 μM) for 24 hours followed by immunoblotting; (C) HEI-193 cells were transfected with the indicated siRNAs and then treated with the indicated compounds (2 μM) for 24 hours followed by immunoblotting. [Figure 16] The results of elucidating that RKIP is an important factor in SOX2 reduction and TGF-β signaling in schwannoma cells are shown in Fig. 1. (A) shows the results of immunoblot analysis after treating HEI-193 cells with 10 μM PRG-N-01, adding TGF-β1 (1 ng / ml) after 12 hours, and incubating for the indicated times. (B) shows the results of HEI-193 cells fixed with 4% paraformaldehyde and stained with anti-phospho-SMAD2 / 3 antibody. (C) shows the results of immunoblot analysis after transfecting HEI-193 cells with the indicated expression vector, adding TGF-β1 at the indicated concentration after 12 hours, and incubating for the indicated times. [Figure 17]The in vivo anticancer effect of PRG-N-01 is shown. (A) When the tumor volume reached 300 mm3, mice were administered a carrier or PRG-N-01 (20 mg / kg) for 5 weeks (3 times per week). The tumor images are shown 5 weeks after administration. (B) After 5 weeks of administration, the mice were dissected and the weight of the isolated tumor was quantified. (C) The tumor volume was measured every week. (D-E) Protein and mRNA were extracted from the isolated tumor and subjected to immunoblotting and RT-PCR. [Figure 18] Further in vivo anticancer effects of PRG-N-01 are shown. (A) shows an image of a tumor-injected mouse 5 weeks after administration of PRG-N-01, and (B) shows the weight of the mouse after intraperitoneal administration of a high concentration of PRG-N-01 (200 mg / kg) to examine the toxicity of PRG-N-01. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0017] The present invention will now be described in more detail.

[0018] The present inventors have made intensive efforts aimed at discovering a novel candidate substance for the treatment of NF2 syndrome that suppresses TβR1-mediated RKIP reduction without interfering with normal TGF-β signaling, and have completed the present invention by confirming that the new compound PRG-N-01 promotes differentiation of NF2 syndrome cells and suppresses tumor growth in an allograft tumor model without interfering with normal TGF-β signaling.

[0019] The present invention provides a compound selected from the group consisting of a compound represented by the following chemical formula 1, a pharma- ceutically acceptable salt thereof, a solvate thereof, and a stereoisomer thereof:

[0020] [ka]

[0021] In the above Chemical Formula 1,

[0022] R 1 is NR 5 R 6 or CN, R 5 or R 6 are the same or different and each is hydrogen or (C1-C4) alkyl; R 2 is halo, (C1-C4) alkyl or (C1-C4) alkoxy; R 3 or R 4 are the same or different and each is hydrogen, (C1-C4) alkyl or (C1-C4) alkoxy, and n is an integer of 0 to 3.

[0023] Preferably, in the compound represented by Formula 1, R 1 NH 2 or NR 5 R 6 and R 5 or R 6 are the same or different and each is (C1-C2) alkyl; R 2 is (C1-C4)alkoxy, R 3 or R 4 are the same or different and are each (C1-C4) alkyl; and n is an integer of 1 or 2.

[0024] More preferably, in the compound represented by Formula 1, R 1 NH 2 and R 2 is (C1-C2)alkoxy, R 3 and R 4 is (C1-C2) alkyl, and n is an integer from 1 to 2.

[0025] More preferably, the compound is a compound of the following formula 2 (PRG-N-01):

[0026] [ka]

[0027] The present invention provides a pharmaceutical composition for preventing or treating neurofibromatosis type 2 (NF2) syndrome, comprising a compound selected from the group consisting of a compound represented by Chemical Formula 1, a pharma- ceutical acceptable salt thereof, a solvate thereof, and a stereoisomer thereof.

[0028] The compounds according to the present invention can inhibit the interaction between TGF-β receptor 1 (TβR1) and RKIP, and in particular, can inhibit TGF-β receptor 1 (TβR1)-mediated RKIP reduction without interfering with normal TGF-β signaling.

[0029] Furthermore, the compounds according to the present invention can promote differentiation into neurilemmoma cells by inhibiting the cell cycle, and can inhibit the stem cell potential of neurilemmoma cells by inducing RKIP.

[0030] In the present invention, it is clearly stated that the pharma- ceutically acceptable salt is one or more basic salts selected from the group consisting of sodium salts, potassium salts, calcium salts, lithium salts, magnesium salts, cesium salts, aminium salts, ammonium salts, triethylaminium salts, and pyridinium salts, but is not limited thereto.

[0031] It is also clearly stated that the pharma- ceutically acceptable salt is one or more acid salts selected from the group consisting of hydrochloric acid, bromic acid, sulfuric acid, sulfurous acid, phosphoric acid, citric acid, acetic acid, maleic acid, fumaric acid, glucosane, methanesulfonic acid, benzenesulfonic acid, camphorsulfonic acid, oxalic acid, malonic acid, glutaric acid, acetic acid, glycolic acid, succinic acid, tartaric acid, 4-toluenesulfonic acid, galacturonic acid, embonic acid, glutamic acid, citric acid, and aspartic acid, but is not limited thereto.

[0032] The pharmaceutical composition of the present invention may contain pharma- ceutically acceptable carriers, excipients, or diluents for administration in addition to the above-mentioned components, such as lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginic acid, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, amorphous cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil.

[0033] The pharmaceutical composition of the present invention can be formulated and used in the form of oral preparations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories, or sterile injection solutions by a conventional method. In particular, when the pharmaceutical composition is formulated, it is prepared using diluents or excipients such as fillers, weighting agents, binders, wetting agents, disintegrants, and surfactants that are commonly used. Solid preparations for oral administration include, but are not limited to, tablets, pills, powders, granules, capsules, and the like. Such solid preparations are prepared by mixing at least one or more excipients, such as starch, calcium carbonate, sucrose, lactose, gelatin, and the like, in addition to the active ingredient. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. In addition to liquids for oral administration, such as liquid paraffin, various excipients, such as wetting agents, sweeteners, flavorings, and preservatives, are added to the preparation. Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, and suppositories. Non-aqueous solvents and suspensions include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases include witepsol, macrogol, Tween 61, cacao butter, laurin butter, and glycerogelatin.

[0034] It is expressly understood that the pharmaceutical composition of the present invention can be prepared in an oral or parenteral formulation and can be administered via oral, intravenous, intracerebroventricular, intradermal, intramuscular, intraperitoneal, nasal or epidural routes, but is not limited thereto.

[0035] The appropriate dosage of the pharmaceutical composition of the present invention varies depending on the condition and weight of the patient, the severity of the disease, the drug form, and the time, but can be appropriately selected by those skilled in the art. The daily dosage of the composition is preferably 0.01 to 100 mg / kg, and can be administered once or several times a day as needed.

[0036] The present invention also provides a health food composition for preventing or improving neurofibromatosis type 2 (NF2) syndrome, comprising a compound selected from the group consisting of a compound represented by Chemical Formula 1, a pharma- ceutically acceptable salt thereof, a solvate thereof, and a stereoisomer thereof.

[0037] The health food composition may contain various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, colorants and fillers (cheese, chocolate, etc.), pectinic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH regulators, stabilizers, preservatives, glycerin, alcohol, carbonation agents used in carbonated drinks, etc. In addition, it may contain fruit pulp for the production of natural fruit juice, synthetic juice, and vegetable drinks. These ingredients may be used independently or in combination. In addition, the health functional food composition may be in the form of any one of meat, sausage, bread, chocolate, candy, snacks, sweets, pizza, ramen, gum, ice cream, soup, drinking water, tea, functional water, drink, alcohol, and vitamin complex.

[0038] In addition, the health food composition may further contain a food additive, and the suitability as a food additive shall be determined according to the specifications and standards for the relevant item in accordance with the general provisions and general test methods of the Food Additives Code approved by the Ministry of Food and Drug Safety, unless otherwise specified.

[0039] Examples of items listed in the Food Additives Code include chemically synthesized products such as ketones, glycine, potassium citrate, nicotinic acid, and cinnamic acid; natural additives such as indigo blue dye, licorice extract, crystalline cellulose, sorghum color, and guar gum; and mixed preparations such as sodium L-glutamate preparations, alkaline agents added to noodles, preservative preparations, and tar color preparations.

[0040] In this case, the content of the composition according to the present invention added to food during the process of producing the health food composition can be appropriately adjusted as necessary.

[0041] The present invention also provides a method for treating neurofibromatosis type 2 (NF2) syndrome, comprising administering a compound represented by Chemical Formula 1, a pharma- ceutically acceptable salt thereof, a solvate thereof, a stereoisomer thereof, or a combination thereof.

[0042] The present invention will be described in more detail with reference to the following examples and experimental examples. It will be apparent to those skilled in the art that these examples and experimental examples are merely intended to more specifically explain the present invention, and that the scope of the present invention is not limited by these examples and experimental examples according to the gist of the present invention.

[0043] [Anti 1] JPEG0007672031000004.jpg62166

[0044] Synthesis Example 1: Synthesis of NF-08001

[0045] 1. Synthesis of 2-(4-(2-(diethylamino)ethoxy)phenyl)acetonitrile (a)

[0046] 2-(4-hydroxyphenyl)acetonitrile (1 equivalent) and PPh in THF 3(1.3 equivalents) was mixed in a solution, and diisopropyl azodicarboxylate (1.5 equivalents) and 2-(diethylamino)ethan-1-ol (1.3 equivalents; 300 mg, 2.25 mmol) were added at 0°C under an argon atmosphere. After stirring at room temperature for 3 hours, the reaction was quenched with water and extracted with EtOAc. The organic phase obtained by extraction was diluted with MgSO 4 The mixture was dried at 40° C. and concentrated in vacuo, and the residue was purified by flash column chromatography on silica gel (MeOH:EtOAc=1:9) to give compound a as a yellow oil (530 mg (99%)).

[0047] 2. Synthesis of 1-(4-(benzyloxy)benzyl)-4-(4-(2-(diethylamino)ethoxy)phenyl)-1H-1,2,3-triazol-5-amine (b)

[0048] To a solution of 2-(4-(2-diethylamino)ethoxy)phenyl)acetonitrile (a) [1 equivalent; 118 mg, 0.51 mmol] and 1-(azidomethyl)-4-(benzyloxy)benzene [1 equivalent; 98.8 mg, 0.41 mmol] in DMSO, t-BuOK (0.25 equivalent; 1.0 M dissolved in THF) was added at room temperature under an argon atmosphere. After stirring at the same temperature for 6 hours, NH 4 The reaction was stopped with Cl, and then extracted with EtOAc. The organic phase obtained by extraction was diluted with MgSO 4 The residue was purified by flash column chromatography on silica gel (MeOH:CH 2 Cl 2 =1:10) to obtain ivory-colored solid compound b [1.12 g (70%)].

[0049] 1 H NMR (CDCl 3 , 400MHz) δ7.54(d, 2H, J=8.6Hz), 7.38(m, 4H), 7.32(t, 1H, J=6.4Hz), 7.20(d, 2H, J=8.5Hz), 6.95(m, 4H), 5.36(s, 2H) ), 5.03(s, 2H), 4.10(t, 2H, J=6.1Hz), 3.64(s, 2H), 2.93(t, 2H, J=6.1Hz), 2.70(q, 4H, J=7.2Hz), 1.10(t, 6H, 7.1Hz);

[0050] 13 C NMR (CDCl 3 , 100MHz) δ159.0, 157.9, 136.8, 136.7, 131.6, 128.9, 128.7, 128.2, 127.6, 12 7.2, 126.6, 124.4, 115.6, 115.1, 70.2, 66.2, 51.7, 50.4, 47.8, 11.6;HRMS(ESI + ) m / z: [M+H] + calcd.for C 28 H 34 N 5 O 2 472.2707, found 472.2713.

[0051] 3. Synthesis of tert-butyl (1-(4-(benzyloxy)benzyl)-4-(4-(2-diethylamino)ethoxy)phenyl)-1H-1,2,3-triazol-5-yl)carbamate [NF-08001]

[0052] CH 2 Cl 2 (25 mL) of 1-(4-(benzyloxy)benzyl)-4-(4-(2-(diethylamino)ethoxy)phenyl)-1H-1,2,3-triazol-5-amine (b) was dissolved in 10 mL of 10 ... 2 HO (60.2 μL, 0.26 mmol) and DMAP (3.0 mg, 0.026 mmol) were added. After stirring at the same temperature for 3 days, the reaction was quenched with water and then with CH 2 Cl 2 The organic phase obtained by extraction was extracted with Na 2 SO 4 The mixture was dried at 40° C. and concentrated in vacuo. The residue was purified by flash column chromatography on silica gel (MeOH:EtOAc=1:10) to give compound [NF-08001] [15.0 mg (10%)].

[0053] 1 H NMR (CDCl 3, 500MHz) δ7.61(d, 2H, J=8.8Hz), 7.38(m, 5H), 7.31(m, 1H), 7.26(d, 2H, J=8.6Hz), 6.92(m, 4H), 5.31(s, 2H), 5.02(s, 2H) ), 4.07(t, 2H, J=6.2Hz), 2.89(t, 2H, J=6.2Hz), 2.66(q, 4H, J=7.1Hz), 1.25(s, 1H), 1.16(s, 9H), 1.07(t, 6H, J=7.1Hz);

[0054] 13 C NMR (CDCl 3 , 125MHz) δ159.1, 159.0, 148.7, 141.0, 136.7, 131.2, 129.8, 128.8, 128.2, 127.5, 127. 1, 126.2, 122.6, 115.3, 115.0, 84.7, 70.1, 66.5, 51.6, 51.4, 47.9, 27.6, 11.7; + ) m / z: [M+H] + calcd.for C 33 H 42 N 5 O 4 572.3231, found 572.3233.

[0055] Synthesis Example 2: Synthesis of PRG-N-01

[0056] Synthesis of 4-(4-(2-(diethylamino)ethoxy)phenyl)-1-(4-ethoxybenzyl)-1H-1,2,3-triazole-5-amino [PRG-N-01]

[0057] To a solution of 2-(4-(2-diethylamino)ethoxy)phenyl)acetonitrile (a) [1 equivalent; 659 mg, 4.04 mmol] and 1-(azidomethyl)-4-ethoxybenzene [1 equivalent; 864 mg, 3.72 mmol] in DMSO, t-BuOK (0.25 equivalent; 1.0 M dissolved in THF) was added at room temperature under an argon atmosphere. After stirring at the same temperature for 6 hours, NH 4 The reaction was stopped with Cl, and then extracted with EtOAc. The organic phase obtained by extraction was diluted with MgSO 4 The residue was purified by flash column chromatography on silica gel (MeOH:CH 2 Cl2 =1:10) to obtain an ivory-colored solid compound [PRG-N-01] [1.12 g (70%)].

[0058] 1 H NMR (CDCl 3 , 400MHz) δ7.53(d, 2H, J=8.9Hz), 7.19(d, 2H, J=8.4Hz), 6.94(d, 2H, J=8.8Hz), 6.87(d, 2H, J=8.7Hz), 5.36(s, 2H), 4 .07(t, 2H, J=6.2Hz), 3.77(s, 3H), 3.64(s, 2H), 2.89(t, 2H, J=6.2Hz), 2.66(q, 4H, J=7.1Hz), 1.07(t, 6H, J=7.2Hz);

[0059] 13 C NMR (CDCl 3 HRMS(ESI + ) m / z: [M+H] + calcd.for C 22 H 30 N 5 O 2 396.2394, found 396.2402.

[0060] Example 1: Cell lines and mouse preparation

[0061] 1. Cell line preparation

[0062] The HEK293 cell line was purchased from the American Type Culture Collection (ATCC, Manassas, VA). The human schwannoma cell line, HEI-193 (NF2 deficient), was provided by Dr. Zadehg (University Health Network, Toronto, Canada). floxMouse Schwann cells (Giovannini et al., 2000), derived from mice, were subjected to in vitro Cre-mediated depletion, after which the cells were transduced with pMSCV-hygro retroviral rescue constructs encoding either full-length Merlin isoform 1 or free vector (designated MSchw-WT and Mschw-KO, respectively). These cell lines were kindly provided by Drgreer P (Queen's University, Ontario, Canada). Normal fibroblast cells (GM00038, 9-year-old female N9) were kindly provided by Coriell Cell Repositories (Camden, NJ, USA) and were cultured in Eagle's minimal essential medium (EMEM) supplemented with 15% fetal bovine serum (FBS) and 2 mM glutamine without antibiotics.

[0063] All cells were cultured at 37°C in 5% CO 2 The cells were maintained in a humidified incubator. HEI-193, HEK293, and mouse neurilemma cells were cultured in liquid DMEM medium containing 10% FBS and 1% antibiotics. The morphology and growth characteristics of all cells used in this study were verified against published information.

[0064] 2. Mouse Preparation

[0065] All experimental procedures for animal experiments were approved by the Animal Care Committee of Pusan ​​National University, Republic of Korea. FVB / NJ mice were provided by Jackson Laboratory. Before the experiment, all mice were kept under temperature- and light-controlled conditions (20-23°C, 12 h / 12 ​​h light / dark cycle) and provided with sterilized food and water ad libitum.

[0066] Example 2: Vector and transfection, siRNA and antibody preparation

[0067] 1. Vectors and transfection

[0068] pCMV RKIP-HA was provided by Keumg (David Geffen School of Medicine at University of California, Los Angeles, CA, USA). pCMV RKIP-T101A-HA and pCMV RKIP-T101D-HA were prepared by Dr. Hwang Ji-hee (Pusan ​​National University). pcDNA3 NF2-FLAG, pRK5 TGF beta type 1 receptor-FLAG and TGF beta type 2 receptor-HA were provided by Addgene (Cambridge, MA, USA). Transfection was performed using Jetpei transfection agent (Polyplus New York, USA) for mammalian expression of such vectors.

[0069] That is, cells were plated at 2x10 5 The cells were dispensed at a density of 100 cells / well and cultured overnight before transfection. The vector (1.5 μg) was mixed with 1.5 μL of Jetpei reagent dissolved in 150 mM NaCl solution. The mixture was incubated at room temperature for 15 minutes and then added to the cells. After 3 hours, the serum-free medium was replaced with medium containing 10% FBS.

[0070] 2.siRNA preparation

[0071] For in vitro gene knockdown, siRNA against the target protein was produced (Cosmo Genetech, Seoul, Korea). The sequence of si-RKIP was [CACCAGCATTTCGTGGGATGGTCTTTCAAGAGAAGACCATCCCACGAAATGCTGGTG]. For siRNA transfection, INTERFERin® transfection reagent (Polyplus New York, USA) was used. Cells were cultured at 2x10 in 12-well plates. 5The cells were aliquoted at a density of 100 cells / well and incubated overnight before transfection. A total of 1.5 pmoles of siRNA (21 ng) duplex was mixed with 4 μL of INTERFERin® transfection reagent in 100 μL of medium without serum. The mixture was reacted for 15 min at room temperature to form INTERFERin® / siRNA complexes. These complexes were added to the cells and further reacted for 4 h, after which the serum-free medium was replaced with medium containing 10% FBS.

[0072] 3. Antibodies

[0073] Antibodies against RKIP (1:2000 for immunoblotting, ab76582), SOX10 (1:1000 for immunoblotting, 1:200 for immunostaining, ab155279), Myelin PLP (1:500 for immunoblotting, 1:300 for immunostaining, ab155279), MBP (1:500 for immunoblotting, 1:300 for immunostaining, 1:200 for FACS, ab62631), MPZ (1:500 for immunostaining, ab31851), GFAP (1:100 for FACS, 1:300 for immunostaining, ab270270), TβR1 (1:500 for immunoblotting, ab31013) and Tenascin C (1:1000 for immunoblotting, ac108930) were purchased from Abcam.

[0074] SOX2 (1:1000 for immunoblotting, 1:300 for immunostaining, 3579), Oct-4A (1:1000 for immunoblotting, 2840), NANOG (1:1000 for immunoblotting, 4903), c-Myc (1:1000 for immunoblotting, 5605), p-SMAD2 / 3 (1:1000 for immunoblotting, 8828), Erk (1:1000 for immunoblotting, 9102), p-Erk (1:1000 for immunoblotting, 9101), p-AKT S473 (1:1000 for immunoblotting, 9271), GFAP (1:500 for immunoblotting, 1:300 for immunostaining, 3670) were purchased from Cell Signaling Technology. Antibodies against anti-β-Actin (1:3000 for immunoblotting, 66009-1-Ig) and HA (1:1000 for immunoblotting, 51064-2-AP) were purchased from Proteintech, respectively.

[0075] Anti-FLAG (1:2000, F1804) antibody was purchased from Sigma, GST (1:1000 for immunoblotting, sc-138) specific antibody was purchased from Santa Cruz Biotechnology, and Anti-TβR2 (1:500 for immunoblotting, bs-0117R) antibody was purchased from Bioss.

[0076] 4. Reagent Preparation

[0077] Silica (S5631, silicon dioxide), TβR1 kinase inhibitors (SB431542 and LY2157299) were purchased from Sigma Aldrich (St, Louis, Mo, USA). Procrine TGF-β1 was purchased from R&D systems (Minneapolis, MN, USA). N-((4-([1,2,4]triazolo[1,5-a]pyridin-6-yl)-5-(6-methylpyridin-2-yl)-1H-imidazol-2-yl)methyl)-2-fluoroaniline (TEW7197) was provided by Dr. Kim Seong-soo (CHA University, Sungnam, Seoul, Korea). TEW7197 was synthesized with reference to a previous paper (Med Chem. 2014 May 22;57(10):4213-38).

[0078] [TEW7197 Structure] JPEG0007672031000005.jpg71127

[0079] Example 3: RT-PCR analysis

[0080] For RT-PCR, total cellular RNA was extracted using an RNA extraction kit (Qiagen). Gene expression analysis was performed using cDNA synthesized from total RNA using MMLV RT (Invitrogen, Carlsbad, USA) and random hexamers. PCR of genomic DNA was performed using DiaStar Taq DNA polymerase (SolGent, Daejeon, Korea), and gene expression analysis was performed using the following specific primers:

[0081] hSOX2(Forward)5'-TCGCAGACCTACATGAACGG-3'

[0082] hSOX2(Reverse)5'-ACATGTGAAGTCTGCTGGGG-3'

[0083] hSOX10(Forward)5’-CATGGAGACCTTTGATGTGGC-3’

[0084] hSOX10(Reverse)5’-TCAGAGTAGTCAAACTGGGGG-3’

[0085] hMBP(Forward)5’-CAAGTACCATGGACCATGCC-3’

[0086] hMBP(Reverse)5’-TTTATAGTCGGACGCTCTGCC-3’

[0087] hMPZ(Forward)5’-CAACCCTACATTGACGAGGTG-3’

[0088] hMPZ(Reverse)5’-CACTGACAGCTTTGGTGCTTC-3’

[0089] hPMP22(Forward)5’-GCAATGGACACGCAACTGATC-3’

[0090] hPMP22(Reverse)5’-CGAAACCGTAGGAGTAATCCG-3’

[0091] mSOX2(Forward)5’-AGGATAAGTACACGCTTCCCG-3’

[0092] mSOX2(Reverse)5’-TAGGACATGCTGTAGGTGGG-3’

[0093] mSOX10(Forward)5’-ACTACAAGTACCAACCTCGGC-3’

[0094] mSOX10(Reverse)5’-GTTGGACATTACCTCGTGGC-3’

[0095] mMBP(Forward)5-’TTCTTTAGCGGTGACAGGGG-3’

[0096] mMBP(Reverse)5'-TAAATCTGCTGAGGGACAGGC-3'

[0097] mMPZ(Forward)5-'CTGCTCCTTCTGGTCCAGTGAA-3'

[0098] mMPZ(Reverse)5'-AGGTTGTCCCTTGGCATAGTGG-3'

[0099] mPMP22(Forward)5'-CGTCCAACACTGCTACTCCTCA-3'

[0100] mPMP22(Reverse)5'-GCCTTTGGTGAGAGTGAAGAGC-3'

[0101] Example 4: Protein-protein interaction analysis

[0102] For protein-protein interaction analysis, glutathione S-transferase (GST)-pull down analysis was performed. For GST pull down, agarose bead-conjugated GST RKIP recombinant protein was reacted with FLAG-tagged TβR1-transfected HEK 293 cell lysates in PBS buffer at 4°C for 1 h. For immunoprecipitation (IP) analysis, FLAG-tagged TβR1- or HA-tagged RKIP-transfected HEI-193 cell lysates were reacted with PBS buffer. Total lysates were reacted with appropriate primary antibodies at 4°C for 2 h and with agarose bead-conjugated protein A / G (Invitrogen, Carlsbad, CA, USA) for 2 h. After centrifugation, the precipitates were washed twice with RIPA buffer and used for SDS-PAGE and Western blot analysis.

[0103] Example 5: Western blot analysis

[0104] Cells were collected and lysed using RIPA buffer [50 mM Tris-Cl, pH 7.5, 150 mM NaCl, 1% NP-40, 0.1% SDS, and 10% sodium deoxycholate] and cell signals were analyzed. Protein concentrations in samples were measured using a protein analysis kit from Bio-Rad (Hercules, CA, USA) and BSA standards. Samples (20 μg protein per lane) were separated by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) and then stained with Immobilon-P. SQ The cells were transferred to transfer membranes (Millipore Corp., MA, USA), incubated in TBS-T buffer (Tris-HCl based buffer containing 20 mM Tris pH 7.6, 150 mM NaCl and 0.05% Tween 20) containing 3% skim milk for 1 hour at room temperature, and then reacted with primary antibodies in TBS-T overnight at 4°C. The membrane was then washed and reacted with HRP-conjugated secondary antibodies [goat anti-mouse, goat anti-rabbit and mouse anti-goat antibodies (Pierce, Thermo Fisher Scientific, Inc., Rockford, IL, USA)] in TBS-T for 2 hours at room temperature. Blotting analysis was performed using HRP-conjugated secondary antibodies using an ECL kit (Intron, Seoul, Korea).

[0105] Example 6: Immunofluorescence staining

[0106] The cells were seeded on cover glasses, washed with PBS, fixed with 4% paraformaldehyde (PFA) for 30 min at room temperature, and then permeabilized with 0.2% Triton X-100 for 5 min at room temperature. After treatment with blocking buffer [3% goat serum diluted in PBS] for 1 h, the cells were reacted with the indicated antibodies in blocking buffer overnight at 4°C. Finally, the cells were reacted with FITC-conjugated or rhodamine-conjugated secondary antibodies for 7 h at 4°C. Nuclei were stained with DAPI for 10 min at room temperature. After washing the cells three times with PBS, the cover glasses were mounted with mounting solution (H-5501, Vector Laboratories, Cambridgeshire, UK), and immunofluorescence signals were detected under a fluorescent microscope (Zeiss, Jena, Germany).

[0107] Example 7: MTT Assay

[0108] To measure cell viability, the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay was used. That is, cells were dispensed onto a 96-well plate and treated with the specified chemicals for a set time. After removing the medium, 200 μL of MTT solution (0.5 mg / ml) dissolved in PBS was added to each well. The plate was then incubated at 37°C for 4 hours, the MTT solution was removed, and the precipitated material was dissolved using a solution (DMSO:ethanol = 1:1). The amount of the formed formazan dye product was quantified by measuring the absorbance at 560 nm using an ELISA microplate reader (Thermo Fisher Scientific, MA, USA).

[0109] Example 8: Allograft tumor growth assay, tumor spheroid formation assay and flow cytometry assay

[0110] For allograft transplantation, FVB / NJ mice (8 weeks old) were subcutaneously injected with 1–10 7Mouse schwannoma cells were inoculated. Tumor-bearing mice were intraperitoneally injected with carrier (n=8) or PRG-N-01 (20 mg / kg; n=8) for 5 weeks (3 times per week). Tumor volume and body weight were measured every week. After the completion of the experiment for each group, the mice were dissected and the tumor tissues were isolated.

[0111] For tumor sphere formation analysis, Hei-193 or mouse schwannoma cells (3x10 6 Cells / plate) were cultured in DMEM / F12 medium (supplemented with 2% B27 and 40 ng / ml bFGF) and supplemented with the indicated chemicals on uncoated plates for the indicated days.

[0112] For flow cytometry, cells were dispensed into 6-well plates and treated with DMSO (control), PRG-N-01 (5 μM) or TEW7197 (5 μM). After 4 days, cells were fixed with 70% ethanol and labeled with propidium iodide. Such samples were analyzed by FACS for cell cycle analysis. After 7 days of treatment with DMSO (control), PRG-N-01 or TEW7197 at the indicated concentrations, cells were fixed with 4% paraformaldehyde and stained with the indicated antibodies. A minimum of 10,000 cells were analyzed on an Attune NxT Flow cytometer (Thermo Fisher Scientific, Inc., Rockford, IL, USA).

[0113] Example 9: Luciferase assay

[0114] To evaluate the transcriptional activity of TGF-β signaling, the 3TP-Luc vector was transfected into cells for 24 h, and the cells were treated with the indicated chemicals. After washing with washing buffer (Promega, Wisconsin, USA), the cells were lysed with elution buffer (Promega, Wisconsin, USA). Luciferase activity was measured using a luminimeter (MicroDigital, Gyeonggi-do, Korea).

[0115] Example 10: Cell proliferation

[0116] 2x10 cells on a 6-well plate 4 Cell growth curves were analyzed by dispensing cells / well. After the designated days, cells were trypsinized and dissociated into single cells. A minimum of 10,000 cells were counted using an Attune NxT flow cytometer (Thermo Fisher Scientific, Inc., Rockford, IL, USA).

[0117] Example 11: Microarray analysis

[0118] Total RNA (500 ng) was extracted using the RNAeasy kit (Qiagen). RNA labeling, hybridization with Human Gene 1.0 ST arrays (Affymetrix), and data analysis were performed by DNA Link (Seoul, Korea). Genes showing a minimum of 2-fold difference in each cell line were selected for further analysis.

[0119] Experimental example 1: Screening of RKIP-inducing compounds in NF2 syndrome cell lines

[0120] Since RKIP reduction is clearly known in NF2 cells (Mol Cancer Ther 17, 2271-2284, 2018), we first measured RKIP expression in HEI-193, a human NF2 syndrome cell line, after treating 260 novel synthetic compounds. Western blot confirmed that 14 compounds induced RKIP expression in HEI-193 cells (Figure 1A and Figure 2). Of these, 4 compounds suppressed cell viability in HEI-193 cells and mouse NF2 syndrome cells similarly to TEW7197, which is known to be a TβR1 kinase inhibitor (Figure 1B). We then searched for SR08002 (renamed Nf-08001), a compound that has the effect of inhibiting the binding of TβR1 to RKIP.

[0121] [SR08002 (Nf-08001) Structure] JPEG0007672031000006.jpg3489

[0122] Experimental example 2: Optimization of Nf-08001

[0123] Despite RKIP induction and anti-proliferative effects in NF2 syndrome cells, Nf-08001 exhibited normal cytotoxicity, necessitating optimization (modification) of Nf-08001, as shown in FIG. 3.

[0124] Therefore, 39 derivatives of Nf-08001 were synthesized and their cell proliferation effects in NF2 syndrome cells and normal fibroblasts were examined (Figure 4). These results confirmed that two compounds (PRG-N-01 and Nf18011) did not cause toxicity in normal fibroblasts and showed clear anti-proliferative effects in NF2 syndrome cells (Figure 5A). These compounds also induced RKIP expression and suppressed Erk activation (Figure 6A).

[0125] We then investigated the effects on the interaction between TβR1 and RKIP, and found that four compounds, including PRG-N-01 and Nf18011, inhibited the interaction between TβR1 and RKIP in a concentration-dependent manner (Fig. 5B), and PRG-N-01 showed an inhibitory effect even at low concentrations (Fig. 6B). PRG-N-01 also increased RKIP expression in human and mouse NF2 syndrome cell lines (Fig. 5C and Fig. 6C).

[0126] On the other hand, since TEW7197 was excluded from the list of drug candidates due to its inhibition of TGF-β signaling, the effect of the compound on TGF-β signaling was examined through Smad2 / 3 phosphorylation and 3TP-luciferase analysis. Unlike TEW7197, this compound did not interfere with the increase in Smad2 / 3 phosphorylation and luciferase activity in response to TGF-β (Figures 5D and 5E). In addition, this compound did not change other signaling cascades such as IGF-1-induced AKT activation in HEI-193 (Figure 7A).

[0127] From the results of such compound screening and optimization, PRG-N-01 was selected as a candidate substance for further analysis (FIG. 7B).

[0128] Experimental Example 3: Effect of PRG-N-01 on NF2-deficiency

[0129] To reconfirm the effect of PRG-N-01, the interaction between TβR1 and RKIP was examined. PRG-N-01 inhibited their binding in a dose-dependent manner (A in FIG. 8 and A in FIG. 9). Since the interaction between TβR1 and RKIP occurs in NF2 or TβR2 deficient conditions, we expected that the restoration of NF2 would eliminate chemical effects such as RKIP induction, Erk inhibition, and anti-proliferative effects. In fact, RKIP induction and p-Erk inhibition were observed only in mouse schwannoma cells by PRG-N-01, but not in normal fibroblasts (B in FIG. 9). In addition, we could not observe chemical effects (anti-proliferative effects, RKIP induction, and p-Erk inhibition) in NF2-transfected HEI-193 cells (B in FIG. 8 and C in FIG. 8), or in NF2-transfected mouse schwannoma cells (C in FIG. 9 and D in FIG. 9). Of course, NF2 transfection itself increased RKIP expression (C in FIG. 8 and C in FIG. 9). Furthermore, PRG-N-01 did not suppress TGF-β signaling even at high concentrations (Figure 8D).

[0130] To investigate the mechanism of action of PRG-N-01 in more detail, we investigated the effect of PRG-N-01 on RKIP mutations. Previous studies have confirmed that phosphorylation at threonine 101 by TβR1 kinase promotes RKIP destabilization (Mol Cancer Ther 17, 2271-2284, 2018). PRG-N-01 did not alter the expression of two RKIP mutants (RKIP T101A; stable form, RKIP T101D; unstable form) even though it induced wild-type RKIP expression (Figure 8E). These results indicate that PRG-N-01 protects RKIP from TβR1-mediated destabilization.

[0131] Experimental Example 4: Gene expression profile of PRG-N-01-treated NF2 syndrome cells

[0132] To investigate the effect of PRG-N-01 on gene expression profiles, microarray analysis was performed using PRG-N-01-treated HEI-193 cells (Figure 10A). Compared to the control group, many genes were either decreased (Cluster A) or increased (Cluster B) in PRG-N-01-treated HEI-193 cells. Gene Ontology (GO) analysis of the clustered genes allowed them to be classified into two categories: cell cycle-related processes including "cell division" and lipid metabolism-related processes including "cholesterol biosynthesis" (Figure 10B and Figure 11). Pathway analysis also showed similar results, namely, cell cycle and steroid pathways (Figure 10C and Figure 11). In addition, gene clusters that were significantly upregulated by PRG-N-01 included lipid metabolism-related genes such as PNILPRP3, NR4A2, and ABCA1, while cell cycle-related genes such as PLK1 and CENPE were mostly included in the downregulated gene clusters (Figure 10D). Furthermore, the canonical TGF-β signaling reader Tenascin C was observed as a significantly upregulated gene, confirming previous results that PRG-N-01 promotes TGF-β signaling activation in HEI-193 cells (Table 1).

[0133] [Table 1]

[0134] Experimental Example 5: PRG-N-01 inhibits the cell cycle and promotes differentiation into neurilemma cells.

[0135] Based on the gene expression profile, the cell cycle was monitored after treatment with PRG-N-01, and cell cycle arrest was induced at G1 (FIG. 12A and FIG. 13A). PRG-N-01 treatment completely inhibited cell growth (FIG. 12B) and induced morphological changes (FIG. 12C and FIG. 13B). Since the morphological changes caused by PRG-N-01 were very similar to those of TEW7197-treated or NF2-transfected HEI-193, PRG-N-01 was expected to induce cell differentiation.

[0136] We investigated the expression of cell cycle-related genes as well as ensheathing cell markers, and found that cell cycle-related genes (CDK1, CDK4, CCNB1, and PLK4) were decreased by PRG-N-01 (Fig. 12D), whereas ensheathing cell markers (PLP, MBP, GFAPMPZ, PMP22, and SOX10) were increased by PRG-N-01 (Fig. 12D and Fig. 13C). At the protein level, we observed an increase in ensheathing cell markers and TβR2, and a decrease in the stem cell marker SOX2 (Fig. 12E).

[0137] To reconfirm that PRG-N-01 induces differentiation into neurite outgrowth cells, we again examined the expression of differentiation markers through FACS analysis and IF staining. In the FACS analysis, PRG-N-01 significantly increased neurite outgrowth cell markers compared to TEW7197 (Figure 12F), and similar results were obtained in the IF staining results (Figure 12G and Figure 13D). These results confirmed that the physiological effects of PRG-N-01 are cell cycle arrest and differentiation promoter.

[0138] Experimental Example 6: PRG-N-01 suppresses the stemness of schwannoma cells by inducing RKIP.

[0139] SOX2 is a well-known stem cell factor that maintains stem cell potential under both physiological and pathological conditions, SOX10 is known to use SOX2 to regulate the differentiation of ensheathing cells, and in an NF2-null mouse model, ensheathing cells displayed low levels of SOX10.

[0140] In previous experiments, we observed induction of SOX10 and reduction of SOX2 by treatment with PRG-N-01. Therefore, we investigated the effect of PRG-N-01 on other stem cell factors such as c-Myc, Nanog, and Oct4, and found that it did not change the expression of these factors (Figure 14A). Then, to investigate the antitumor effect of PRG-N-01, we performed a tumor sphere formation assay. HEI-193 and mouse schwannoma cells readily formed tumor spheres, and TEW7197 had a weak inhibitory effect on such tumor spheres, while PRG-N-01 clearly inhibited tumor sphere formation (Figure 15A and Figure 14B). Figure 14C and Figure 14D show that PRG-N-01 reduced not only the number of tumor spheres but also the size of the tumor spheres. Under these conditions, expression of stem cell factors (SOX2, c-Myc, Nanog, and Oct4) was reduced to an unmeasurable extent by treatment with PRG-N-01, whereas SOX10 expression was clearly increased (Figure 15B and Figure 14E).

[0141] To investigate the molecular mechanism of SOX2 reduction, we examined the localization of SOX2 through IF and cell fractionation, and confirmed that nuclear SOX2 was translocated to the cytoplasm in response to PRG-N-01 and TEW7197 (Figures 15C and 15D). Inhibition of nuclear material efflux by leptomycin B or a proteasome inhibitor (MG312) blocked the SOX2 reduction induced by PRG-N-01 / TEW7197 (Figures 14F and 14G). These results indicate that PRG-N-01 promotes SOX2 efflux and degradation.

[0142] We also investigated the effect of RKIP on SOX2 reduction and SOX10 induction. The ectopic expression of wild-type and stabilized RKIP (T101A) reduced SOX2 expression, and RKIP T101A induced SOX10, whereas RKIP T101D did not reduce SOX2 expression (Fig. 15E). si-RKIP prevented PRG-N-01-induced SOX2 reduction and cytoplasmic localization (Fig. 15F). These results indicate that RKIP is crucial for PRG-N-01-induced SOX2 reduction and SOX10 increase.

[0143] In order to develop novel drug candidates for the treatment of NF2 syndrome without interfering with TGF-β signaling, the present inventors investigated the effect of PRG-N-01 on the standard TGF-β signaling cascade, and Smad2 / 3 phosphorylation was prolonged by treatment with PRG-N-01 in HEI-193 cells (FIGS. 16A and 16B). Similar characteristics were observed in HEI-193 cells transfected with RKIP or NF2 (FIGS. 16C and 16D). These results indicate that the effect of PRG-N-01 on TGF-β signaling was very similar to the NF2 restoration induction characteristics.

[0144] Experimental Example 7: PRG-N-01 exhibits anti-cancer effects in vivo.

[0145] To investigate the in vivo effect of PRG-N-01, schwannoma cells derived from NF2 syndrome model mice were allografted into 8-week-old mice, and PRG-N-01 was administered by intraperitoneal injection (20 mg / kg, 3 times a week). PRG-N-01 treatment suppressed tumor growth (Figures 17A and 18A). Tumor size and weight were clearly suppressed (Figures 17B and 17C).

[0146] When normal mice were injected with 200 mg / kg of PRG-N-01, a dose 10 times higher than the therapeutic dose, no changes in body weight were induced (Figure 18B), confirming that PRG-N-01 does not exhibit severe toxicity.

[0147] We then analyzed the expression of RKIP and related genes in tumors, and found that in PRG-N-01-treated tumor tissues, induction of RKIP, nerve sheath cell markers (PLP, MBP, and MPZ), and SOX10 was observed at the protein level (Figure 17D). RT-PCR analysis also showed induction of nerve sheath cell markers and SOX10, and reduction of SOX2 (Figure 17E).

[0148] Taking into account the results of previous in vitro and in vivo experiments, we were able to confirm that PRG-N-01 is a very promising candidate drug for schwannoma resulting from NF2 syndrome.

[0149] Although the specific parts of the present invention have been described in detail above, it is obvious to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the claims and their equivalents.

[0150] The scope of the present invention is defined by the claims set forth below, and all modifications and variations that fall within the meaning and scope of the claims and their equivalent concepts should be interpreted as being included in the scope of the present invention.

Claims

1. A compound selected from a compound represented by the following chemical formula 1, a pharma- ceutically acceptable salt thereof, a solvate thereof, or a stereoisomer thereof: 【Chemistry 1】 In the above Chemical Formula 1, R 1 is NH 2 or NR 5 R 6 , where R 5 or R 6 are the same or different and each is (C1-C2) alkyl; R 2 is (C1-C4)alkoxy, R 3 or R 4 are the same or different and are (C1-C4)alkyl; n is an integer from 1 to 2.

2. In the compound represented by formula 1, R １ NH ２ and R ２ is (C1-C2)alkoxy, R ３ and R ４ The compound according to claim 1, characterized in that: is (C1-C2) alkyl; and n is an integer from 1 to 2.

3. A pharmaceutical composition for preventing or treating neurofibromatosis type 2 (NF2) syndrome, comprising a compound selected from a compound represented by the following chemical formula 1, a pharma- ceutical acceptable salt thereof, a solvate thereof, or a stereoisomer thereof: 【Chemistry 2】 In the above Chemical Formula 1, R 1 is NH 2 or NR 5 R 6 , where R 5 or R 6 are the same or different and each is (C1-C2) alkyl; R 2 is (C1-C4)alkoxy, R 3 or R 4 are the same or different and are (C1-C4)alkyl; n is an integer from 1 to 2.

4. The pharmaceutical composition for preventing or treating neurofibromatosis type 2 syndrome according to claim 3, wherein the compound inhibits the interaction between TGF-β receptor 1 (TβR1) and RKIP.

5. The pharmaceutical composition for preventing or treating neurofibromatosis type 2 syndrome according to claim 3, characterized in that the compound inhibits TGF-β receptor 1 (TβR1)-mediated RKIP reduction without interfering with normal TGF-β signaling.

6. The pharmaceutical composition for preventing or treating neurofibromatosis type 2 syndrome according to claim 3, wherein the compound inhibits the cell cycle and promotes differentiation into nerve sheath cells.

7. The pharmaceutical composition for preventing or treating neurofibromatosis type 2 syndrome according to claim 3, wherein the compound induces RKIP and suppresses the stem cell ability of schwannoma cells.

8. A health food composition for preventing or improving neurofibromatosis type 2 (NF2) syndrome, comprising a compound selected from the group consisting of a compound represented by the following chemical formula 1, a pharma- ceutically acceptable salt thereof, a solvate thereof, and a stereoisomer thereof: 【Chemistry 3】 In the above Chemical Formula 1, R 1 is NH 2 or NR 5 R 6 , where R 5 or R 6 are the same or different and each is (C1-C2) alkyl; R 2 is (C1-C4)alkoxy, R 3 or R 4 are the same or different and are (C1-C4)alkyl; n is an integer from 1 to 2.

Images