How to identify the sex of mackerel

Abstract

To provide new technical means that can simply and accurately identify the sex of a mackerel.SOLUTION: A polynucleotide consisting of a base sequence represented by sequence number 2 or 3, a gene including its nucleotide fragment or a mutant thereof is used as a marker for identifying the sex of a mackerel.SELECTED DRAWING: Figure 7

Description

[Technical field]

[0001] The present invention relates to a sex-identification marker for mackerel and a method for identifying the sex of mackerel, and more particularly to a sex-identification marker for mackerel based on a sex-determining gene and a method for testing the sex of mackerel using the sex-determining gene as an indicator. [Background technology]

[0002] Mackerel is an important fishery species, and although there are high value-added species such as chub mackerel and pied mackerel, it is mainly produced by fishing. On the other hand, in recent years, there has been progress in improving safety and adding value through aquaculture production, and in the future mackerel may also attract attention as a target species for aquaculture, so stable seed production is essential to realizing complete aquaculture.

[0003] For stable aquaculture, selective breeding and early sexing techniques are important. For example, in order to obtain more fertilized eggs in a limited breeding space, the ratio of female parent fish is important, and it is necessary to separate pre-mature females. However, in the past, the most common methods used in the field for mackerel were to observe the presence or absence of eggs after maturation by cannulation (a method to physically check for the presence of eggs) or to detect sex steroids present in extracts obtained by cutting a large amount of blood or fins using the ELISA method, and sexing could only be done after maturation by highly invasive methods, making selection at the immature stage difficult. Therefore, it is desirable to establish a method for easily and non-invasively identifying the genetic sex of mackerel.

[0004] In recent years, various methods for identifying the sex of fish have been reported with a view to realizing stable fish farming. For example, Patent Document 1 discloses a marker for determining the genetic sex of bluefin tuna and a method for determining the genetic sex of bluefin tuna using the marker.

[0005] Patent Document 2 reports SNP markers linked to the genetic sex of yellowtails that can be used to reliably determine the genetic sex of unripe yellowtails without killing them, a method for sexing yellowtails using these genetic markers, and primers used in the sexing method.

[0006] Patent Document 3 reports a method for determining the sex of fish by preparing a biological sample from the fish and examining the mRNA expression pattern of genes whose expression differs between the sexes in the biological sample.

[0007] Patent Document 4 discloses a method and apparatus for determining the sex of fish, particularly fish whose biological structure makes it impossible to determine the sex of fish by using non-invasive methods, based on the differences between males and females, and specifically discloses inserting a probe inside the gonads to perform the determination. However, no method has yet been reported that can easily and accurately identify the genetic sex of mackerel. [Prior art documents] [Patent documents]

[0008] [Patent Document 1] JP 2019-88234 A [Patent Document 2] JP 2014-180233 A [Patent Document 3] JP 2000-60569 A [Patent Document 4] Special Publication No. 2011-505794 Summary of the Invention

[0009] The present inventors took advantage of the fact that genetic sex determination in mackerel is heterozygous, compared the genome sequences of male and female mackerel individuals, and found single nucleotide polymorphisms (SNPs) associated with sex chromosomes. Furthermore, they found that the sex of mackerel can be easily and accurately identified based on such genes or genome sequence information of the genes. The present invention is based on such findings.

[0010] The present invention aims to provide a new technical means for easily and accurately identifying the sex of mackerel.

[0011] The present invention includes the following inventions. [1] A gene comprising any one of the following polynucleotides (a) to (h) or a nucleotide fragment thereof: (a) a polynucleotide consisting of the base sequence represented by SEQ ID NO: 2, or a nucleotide fragment thereof, which contains at least one nucleotide residue selected from the group consisting of a thymine residue at position 652, a thymine residue at position 665, a thymine residue at position 667, a cytosine residue at position 768, an adenine residue at position 2039, an adenine residue at position 2039, an adenine residue at position 2041, an adenine residue at position 2137, an adenine residue at position 2140, and an adenine residue at position 2143 in SEQ ID NO: 2; (b) a polynucleotide having a base sequence having an identity of 90% or more to the base sequence represented by SEQ ID NO: 2, or a nucleotide fragment thereof, A polynucleotide or a nucleotide fragment thereof, comprising at least one nucleotide residue selected from the group consisting of a thymine residue at position 652, a thymine residue at position 665, a thymine residue at position 667, a cytosine residue at position 768, an adenine residue at position 2039, an adenine residue at position 2039, an adenine residue at position 2041, an adenine residue at position 2137, an adenine residue at position 2140, and an adenine residue at position 2143 in SEQ ID NO: 2; (c) A polynucleotide or a nucleotide fragment thereof, which is a nucleotide sequence represented by SEQ ID NO: 2 in which one or several nucleotides are substituted, deleted or added. A polynucleotide or a nucleotide fragment thereof, comprising at least one nucleotide residue selected from the group consisting of a thymine residue at position 652, a thymine residue at position 665, a thymine residue at position 667, a cytosine residue at position 768, an adenine residue at position 2039, an adenine residue at position 2039, an adenine residue at position 2041, an adenine residue at position 2137, an adenine residue at position 2140, and an adenine residue at position 2143 in SEQ ID NO: 2; (d) a polynucleotide or a nucleotide fragment thereof that hybridizes under stringent conditions with a polynucleotide consisting of a complementary sequence of the base sequence represented by SEQ ID NO:2, A polynucleotide or a nucleotide fragment thereof, comprising at least one nucleotide residue selected from the group consisting of a thymine residue at position 652, a thymine residue at position 665, a thymine residue at position 667, a cytosine residue at position 768, an adenine residue at position 2039, an adenine residue at position 2039, an adenine residue at position 2041, an adenine residue at position 2137, an adenine residue at position 2140, and an adenine residue at position 2143 in SEQ ID NO: 2; (e) a polynucleotide consisting of the base sequence represented by SEQ ID NO: 3, which retains the guanine residue at position 1896 in SEQ ID NO: 3, or a nucleotide fragment thereof; (f) a polynucleotide having a base sequence having an identity of 90% or more with the base sequence represented by SEQ ID NO: 3, which retains the guanine residue at position 1896 in SEQ ID NO: 3, or a nucleotide fragment thereof; (g) A polynucleotide or a nucleotide fragment thereof, which is a nucleotide sequence represented by SEQ ID NO:3 in which one or several nucleotides are substituted, deleted, inserted or added, A polynucleotide or a nucleotide fragment thereof, which comprises a guanine residue at position 1896 in SEQ ID NO: 3; (h) a polynucleotide or a nucleotide fragment thereof that hybridizes under stringent conditions with a polynucleotide consisting of a complementary sequence of the nucleotide sequence represented by SEQ ID NO:3, A polynucleotide or a nucleotide fragment thereof, comprising the 1896th guanine residue in SEQ ID NO:3. [2] The gene described in [1], which has sex-discrimination activity for mackerel. [3] The gene according to [1] or [2], wherein the length of the polynucleotide is 100 to 200 residues. [4] A sex identification marker for mackerel, comprising the gene according to any one of [1] to [3] or an expression product of said gene. [5] The gender identification marker described in [4], wherein the expression product of the gene is the mRNA of the gene or a protein encoded by the gene. [6] A method for identifying the sex of mackerel, comprising the step of detecting a gene according to any one of [1] to [3] or an expression product of said gene in a sample obtained from a test mackerel. [7] The method according to [6], wherein the sex of mackerel is determined to be female when a gene comprising any one of the polynucleotides (a) to (d) or an expression product of the gene is detected. [8] The method according to [6] or [7], wherein the sex of mackerel is determined to be male when a gene comprising any one of the polynucleotides (e) to (h) or an expression product of the gene is detected. [9] The method according to any one of [6] to [8], wherein the detection step comprises amplifying the gene according to any one of [1] to [3] or a complementary gene thereof by a nucleic acid amplification method.

[10] The method according to any one of [6] to [9], wherein the sample is a sample derived from a tissue selected from the group consisting of fin, blood, mucus, scales, and body surface (epidermis).

[11] Mackerel: Chub mackerel ( Scomber japonicus ) or mackerel ( Scomber australasicus The method according to any one of [6] to

[10] , wherein

[12] A nucleic acid molecule for use in the method according to any one of [6] to

[11] , A nucleic acid molecule capable of specifically hybridizing to the gene according to [1], or to a polynucleotide comprising the mRNA or cDNA of said gene, or to a polynucleotide complementary thereto.

[13] A primer pair for use in the method according to any one of [6] to

[11] , A primer pair capable of specifically hybridizing to the gene according to claim 1, or a polynucleotide comprising the mRNA or cDNA of said gene, or a complementary polynucleotide thereof.

[14] A kit for identifying the sex of mackerel, comprising the nucleic acid molecule according to

[12] and / or the primer pair according to

[13] .

[0012] According to the present invention, the sex of mackerel can be easily and accurately identified. The present invention is advantageous in non-invasively identifying the sex of mackerel. Furthermore, the present invention is advantageous in identifying the sex of subject mackerel with high accuracy not only in cultured mackerel but also in wild populations. [Brief description of the drawings]

[0013] [Figure 1] This is a schematic diagram showing concentrically arranged M / Ffst, male-specific SNPs, female-specific SNPs, and M / F coverage information obtained by sex-specific SNP screening for chub mackerel (female heterozygous) and pied mackerel (male heterozygous). [Diagram 2] This is a schematic diagram of M / Ffst, male-specific SNPs, female-specific SNPs, and M / F coverage information obtained by sex-specific SNP search for chub mackerel (female heterozygous) and pied mackerel (male heterozygous) arranged in concentric circles. The arrows in the square frames in Figure 2 indicate female-specific SNPs whose expression was confirmed in chub mackerel (female heterozygous), and male-specific SNPs whose expression was confirmed in pied mackerel (male heterozygous). [Diagram 3] This is a schematic diagram of a comparison of the DNA sequences of male and female chub mackerel (female heterozygous). [Figure 4] FIG. 1 is a schematic diagram showing the process of designing primers for detecting a nucleotide fragment containing SNPs at nucleotide residues 652, 665, 667, and 768 in SEQ ID NO: 2 (hereinafter also referred to as "Jap_F1"). [Diagram 5] FIG. 1 is a schematic diagram showing the primer design process for detecting a nucleotide fragment containing SNPs at nucleotide residues 2039, 2041, 2137, 2140, and 2143 in SEQ ID NO: 2 (hereinafter also referred to as "Jap_F2"). [Figure 6] FIG. 2 is a schematic diagram showing the process of designing a primer for detecting a nucleotide fragment Aus_M (hereinafter also referred to as "Aus_M") containing a SNP at nucleotide residue 1896 in SEQ ID NO:3. [Figure 7] 13 is a photograph showing the results of PCR detection of SNP-containing nucleotide fragments Jap_F1, Jap_F2, and Aus_M as sex-identification markers using blood samples from chub mackerel (Scomber japonicus) and spotted mackerel (Scomber australasicus). Description of the Invention

[0014] The mackerel of the present invention refers to fish of the genus Scombridae, including fish of the family Scombridae. According to a preferred embodiment of the present invention, the mackerel is Chub mackerel ( Scomber japonicus ) or mackerel ( Scomber australasicus ).

[0015] According to one embodiment of the present invention, sex identification of mackerel can be performed based on SNPs in the polynucleotide sequence represented by SEQ ID NO: 2 or 3 that occur due to differences in sex of mackerel. In a more specific embodiment, the nucleotide group of SEQ ID NO: 2 containing a female-specific SNP (below, (a) to (d)) or the nucleotide group of SEQ ID NO: 3 containing a male-specific SNP (below, (e) to (h)) can be used as a sex identification marker for mackerel to identify the sex of the subject mackerel based on the presence or absence of expression of the marker. Here, the "sex identification marker" is a marker that can be used to identify the genetic sex of a subject mackerel.

[0016] Therefore, according to a preferred embodiment of the present invention, there is provided a gene consisting of any one of the following polynucleotides (a) to (d) or a nucleotide fragment thereof: (a) a polynucleotide consisting of the base sequence represented by SEQ ID NO: 2, or a nucleotide fragment thereof, which contains at least one nucleotide residue selected from the group consisting of a thymine residue at position 652, a thymine residue at position 665, a thymine residue at position 667, a cytosine residue at position 768, an adenine residue at position 2039, an adenine residue at position 2039, an adenine residue at position 2041, an adenine residue at position 2137, an adenine residue at position 2140, and an adenine residue at position 2143 in SEQ ID NO: 2; (b) a polynucleotide having a base sequence having an identity of 90% or more to the base sequence represented by SEQ ID NO: 2, or a nucleotide fragment thereof, A polynucleotide or a nucleotide fragment thereof, comprising at least one nucleotide residue selected from the group consisting of a thymine residue at position 652, a thymine residue at position 665, a thymine residue at position 667, a cytosine residue at position 768, an adenine residue at position 2039, an adenine residue at position 2039, an adenine residue at position 2041, an adenine residue at position 2137, an adenine residue at position 2140, and an adenine residue at position 2143 in SEQ ID NO: 2; (c) A polynucleotide or a nucleotide fragment thereof, which is a nucleotide sequence represented by SEQ ID NO: 2 in which one or several nucleotides are substituted, deleted or added. A polynucleotide or a nucleotide fragment thereof, comprising at least one nucleotide residue selected from the group consisting of a thymine residue at position 652, a thymine residue at position 665, a thymine residue at position 667, a cytosine residue at position 768, an adenine residue at position 2039, an adenine residue at position 2039, an adenine residue at position 2041, an adenine residue at position 2137, an adenine residue at position 2140, and an adenine residue at position 2143 in SEQ ID NO: 2; (d) a polynucleotide or a nucleotide fragment thereof that hybridizes under stringent conditions with a polynucleotide consisting of a complementary sequence of the base sequence represented by SEQ ID NO:2, A polynucleotide or a nucleotide fragment thereof, comprising at least one nucleotide residue selected from the group consisting of a thymine residue at position 652, a thymine residue at position 665, a thymine residue at position 667, a cytosine residue at position 768, an adenine residue at position 2039, an adenine residue at position 2039, an adenine residue at position 2041, an adenine residue at position 2137, an adenine residue at position 2140, and an adenine residue at position 2143 in SEQ ID NO: 2.

[0017] According to another preferred embodiment of the present invention, there is provided a gene comprising any one of the following polynucleotides (e) to (h) or a nucleotide fragment thereof: (e) a polynucleotide consisting of the base sequence represented by SEQ ID NO: 3, which retains the guanine residue at position 1896 in SEQ ID NO: 3, or a nucleotide fragment thereof; (f) a polynucleotide having a base sequence having an identity of 90% or more with the base sequence represented by SEQ ID NO: 3, which retains the guanine residue at position 1896 in SEQ ID NO: 3, or a nucleotide fragment thereof; (g) A polynucleotide or a nucleotide fragment thereof, which is a nucleotide sequence represented by SEQ ID NO:3 in which one or several nucleotides are substituted, deleted, inserted or added, A polynucleotide or a nucleotide fragment thereof, which comprises a guanine residue at position 1896 in SEQ ID NO: 3; (h) a polynucleotide or a nucleotide fragment thereof that hybridizes under stringent conditions with a polynucleotide consisting of a complementary sequence of the nucleotide sequence represented by SEQ ID NO:3, A polynucleotide or a nucleotide fragment thereof, comprising the 1896th guanine residue in SEQ ID NO:3.

[0018] In (a) to (h), the number of nucleotide residues to be retained is preferably 1 to 9, more preferably 1 to 5, and even more preferably 1 to 3.

[0019] The combination of nucleotide residues retained in (a) is not particularly limited, but is preferably a combination of a thymine residue at position 652, a thymine residue at position 665, a thymine residue at position 667, and a cytosine residue at position 768, or a combination of an adenine residue at position 2041, an adenine residue at position 2137, an adenine residue at position 2140, and an adenine residue at position 2143.

[0020] Furthermore, in the above (b) or (f), the identity to the base sequence represented by SEQ ID NO:2 is preferably 90% or more, more preferably 95% or more, even more preferably 97% or more, even more preferably 98% or more, and even more preferably 99% or more.

[0021] As used herein, the "identity" of a base sequence refers to the percentage (%) of identical bases between two base sequences relative to the total bases of the base sequence shown in SEQ ID NO: 2 when the two base sequences are aligned and, if necessary, gaps are introduced to maximize the degree of base identity between the two sequences. The identity of a base sequence can be determined using known software such as ClustalW or BLAST.

[0022] In addition, in the above (c) or (g), "several" in terms of the substituted, deleted, inserted or added nucleotides refers to, for example, 1 to 20, preferably 1 to 15, more preferably 1 to 10, even more preferably 1 to 7, even more preferably 1 to 5, even more preferably 1 to 4, and even more preferably 1 to 3.

[0023] In the above (d) or (h), "hybridizing under stringent conditions" refers to hybridization under conditions in which a so-called specific hybrid is formed and a non-specific hybrid is not formed, and examples of such conditions include hybridization and washing under conditions of low salt concentration and / or high temperature. For example, "stringent conditions" may be "5xSSPE, 5xDenhardt's solution, 0.5% sodium dodecyl sulfate (SDS), 50% formamide, 200 μg / mL salmon sperm DNA, overnight at 42°C," and examples of washing conditions include "0.5xSSC, 0.1% SDS, 42°C." In addition, "more stringent conditions" include "5xSSPE, 5xDenhardt's solution, 0.5%SDS, 50% formamide, 200μg / mL salmon sperm DNA, 42°C overnight" for hybridization conditions, and "0.2xSSC, 0.1%SDS, 65°C" for washing conditions. Stringent hybridization conditions are described in Green, MR and Sambrook, J., 2012, Molecular Cloning: A Laboratory Manual Fourth Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, and can be used as a reference.

[0024] Furthermore, the chain length of the polynucleotides or nucleotide fragments thereof described in (a) to (h) is not particularly limited, but is preferably 15 to 450 bases, more preferably 25 to 450 bases, and even more preferably 50 to 150 bases.

[0025] As described above, the polynucleotides or nucleotide fragments thereof described in (a) to (h) can be suitably used as sex-discriminating markers for mackerel. Therefore, according to a preferred embodiment of the present invention, the polynucleotides or nucleotide fragments thereof described in (a) to (h) have sex-discriminating activity for mackerel. Here, the presence or absence of "sex-discriminating activity for mackerel" can be determined by performing PCR according to the procedure of Test Example 2 and determining whether or not a band of the polynucleotide or its nucleotide fragment is detected in a sex-specific manner.

[0026] According to a preferred embodiment of the present invention, the expression product of a gene containing the polynucleotide represented by SEQ ID NO: 2 or SEQ ID NO: 3 or a nucleotide fragment thereof can be used as a sex identification marker for mackerel, and such expression products may include mRNA, cDNA, or a protein encoded by the gene.

[0027] Specific examples of expression products of genes containing the polynucleotide represented by SEQ ID NO: 2 or SEQ ID NO: 3 or nucleotide fragments thereof include parts or mutants of FERM and PDZ domain-containing 4-like protein (NW_019174360), tyrosine-protein kinase PRAG1 (NW_019175644), etc.

[0028] How to Identify the Sex of Mackerel Detection process According to one embodiment of the present invention, the method for identifying the sex of mackerel can identify the sex of the mackerel by detecting the presence or absence of a gene comprising any one of the polynucleotides (a) to (h) or a nucleotide fragment thereof or an expression product of the gene. As described above, the genes (a) to (d) are present only in males, and the genes (e) to (h) are present only in females, so the presence or absence of such genes or expression products of the genes is considered to be an index for accurate sexing of mackerel.

[0029] In the present invention, for example, a sample is taken from a part of a subject mackerel individual, for example, fins (caudal fin, dorsal fin, pectoral fin, pelvic fin, anal fin), blood, scales, mucus, kidney muscle, fertilized egg, or other tissues containing nuclei, and a nucleic acid sample such as genomic DNA or mRNA is extracted from the obtained sample, and if necessary, a nucleic acid sample obtained by preparing cDNA from mRNA using reverse transcriptase can be used. In addition, the obtained nucleic acid sample can be used as a template to carry out a nucleic acid amplification method using, for example, a primer pair described below, and the obtained nucleic acid sample can be used.

[0030] According to a preferred embodiment of the method of the present invention, there is provided a method comprising amplifying a gene region comprising any one of the polynucleotides (a) to (h) above or a nucleotide fragment thereof by a nucleic acid amplification method. In such an embodiment, the primers used in the nucleic acid amplification method and the reaction conditions for nucleic acid amplification can be appropriately selected according to technical common knowledge widely known to those skilled in the art. As the nucleic acid amplification method, for example, when genomic DNA or cDNA is used as a template, a normal PCR method or the like can be used, and when mRNA is used as a template, an RT-PCR method, a NASBA method or the like can be used. Here, the sex identification marker can be any one of the DNAs (a) to (h) above or a nucleotide fragment thereof, or an expression product of the gene (e.g., mRNA).

[0031] According to a preferred embodiment of the method of the present invention, the nucleic acid amplification method can be carried out using a pair of primers for amplifying a sex-identification marker, the region of which is a part or the whole of any one of the polynucleotides (a) to (h) or a nucleotide fragment thereof as the amplification target. The two primers constituting such a primer pair can be appropriately designed by a person skilled in the art based on the base sequence of the region to be amplified. For example, one primer of the primer pair can have the base sequence of the 5'-end portion in the base sequence of the region to be amplified, and the other primer can have the base sequence of the 5'-end portion in the base sequence of the complementary strand of the region to be amplified. According to a preferred embodiment of the method of the present invention, the primer pair used in the nucleic acid amplification method is a primer pair that can specifically hybridize to a gene comprising any one of the polynucleotides (a) to (h) or a nucleotide fragment thereof, or a polynucleotide comprising the mRNA or cDNA of the gene, or a polynucleotide complementary thereto. Here, the term "specifically hybridizable" includes the meaning that a primer "specific" to the polynucleotide binds to the polynucleotide under stringent conditions, and can preferably distinguish between males and females. The primer can be synthesized by a known method for synthesizing oligonucleotides, but more conveniently, it can be synthesized using a DNA synthesizer (for example, manufactured by Applied Biosystem).

[0032] In the method of the present invention, when a nucleic acid amplification method is used, the length of the primer is 15 to 100 nucleotides, more preferably at least 17 nucleotides, even more preferably at least 18 nucleotides, even more preferably 18 to 50 nucleotides, and even more preferably 18 to 40 nucleotides. A primer having such a length is preferable when carrying out a nucleic acid amplification method using a nucleic acid sample containing impurities.

[0033] More specifically, for detection of a gender-identification marker by nucleic acid amplification methods, it is preferable to use a pair of primers for amplifying the gender-identification marker, consisting of a forward primer (5' primer) and a reverse primer (3' primer) capable of amplifying part or all of the region of the gender-identification marker.

[0034] When the detection step is carried out by the nucleic acid amplification method, examples of the primer pair include those having the following sequences: Forward Jap_F1_F_648: TAGATGTTGTTAACTTGTGT (SEQ ID NO: 5) Reverse Jap_F1_R_787: TACGTCTGATCCATGGTCAG (SEQ ID NO: 6) Forward Jap_F2_F_2022: ACACCATCTCACTAGGAAGA (SEQ ID NO: 7) Reverse Jap_F2_R_2156: GAGGAGGAGGTGGCGGTGGT (SEQ ID NO: 8) Forward Aus_M_F1_1877: GTTTGATGGGGTCAGGTTGA (SEQ ID NO: 9) Reverse Aus_M_R1_2031: CTGGAATCTTGATCTATGAG (SEQ ID NO: 10)

[0035] According to one embodiment of the present invention, a primer pair of SEQ ID NOs: 5 and 6 or a primer pair of SEQ ID NOs: 7 and 8 is used for sex identification of chub mackerel. According to another embodiment, a primer pair of SEQ ID NOs: 9 and 10 is used for sex identification of pisces mackerel. In addition to the above, a person skilled in the art can easily design and synthesize other appropriate sequences based on the base sequence of SEQ ID NO: 2 or 3, and the primers are not limited to these.

[0036] The gender identification marker to be amplified may be a gene comprising any one of the polynucleotides (a) to (h) above or a nucleotide fragment thereof, or a polynucleotide comprising the mRNA or cDNA of the gene, or a complementary polynucleotide thereof, and preferably is the mRNA, cDNA, or a complementary polynucleotide thereof.

[0037] According to one embodiment of the present invention, the nucleic acid amplification method is carried out by the following method. The above-obtained genomic DNA or cDNA is used as a template, and the above-mentioned primer pair for amplifying the sex-identifying marker is added to perform PCR to amplify the target DNA fragment. The temperature conditions for PCR can be appropriately determined by those skilled in the art and are not particularly limited, but preferably the reaction is carried out sequentially at 92 to 96°C for 0.25 to 1 minute (dissociation of double-stranded DNA), 52 to 57°C for 0.25 to 1 minute (annealing of primers), and 70 to 74°C for 1 to 3 minutes (synthesis of complementary strands), and this is preferably repeated for 30 to 40 cycles. A heat block type programmable temperature control device can be used to set the temperature for the above-mentioned reaction.

[0038] Next, the amplified nucleic acid is detected from the reaction mixture obtained as described above. As a detection method, a method commonly used in the art can be used, but preferably, a method of agarose gel electrophoresis followed by gel staining with ethidium bromide can be used. Therefore, in a test system in which PCR amplification products are not obtained in males (such as chub mackerel), if a PCR amplification product is detected, the sex identification marker of the present invention is present in the test mackerel, and the test mackerel can be evaluated as female. On the other hand, in a test system in which PCR amplification products are not obtained in females (such as sesame mackerel), if a PCR amplification product is detected, the sex identification marker of the present invention is present in the test mackerel, and the test mackerel can be evaluated as male.

[0039] Furthermore, the nucleotide sequence of the resulting PCR amplification product may be determined by a sequencing method, etc. Determination of the nucleotide sequence is well known in the art and can be carried out, for example, using a commercially available kit.

[0040] According to another preferred embodiment of the method of the present invention, the detection step can be carried out by a hybridization method using a probe. The probe according to the present invention can be one that can hybridize to a part or all of the regions of the sex-identification marker, which is a polynucleotide. The above-mentioned probe can be, for example, a probe that can specifically hybridize to a gene comprising any one of the polynucleotides (a) to (h), or a polynucleotide comprising the mRNA or cDNA of the gene, or a polynucleotide complementary thereto. Here, the term "specifically hybridizable" includes the meaning that a probe "specific" to the above-mentioned polynucleotide binds to the polynucleotide under stringent conditions and can preferably distinguish between males and females. Therefore, according to the present invention, there is provided a method for identifying the sex of mackerel, which comprises a step of hybridizing the probe with a nucleic acid sample derived from an individual mackerel as a test subject, and then detecting the presence of a hybridization complex. The presence of the hybridization complex indicates the presence of a gene comprising any one of the polynucleotides (a) to (h) or a nucleotide fragment thereof, which is a sex-determining gene of mackerel. This method using hybridization can also be applied to a nucleic acid sample that is an amplification product obtained by the above-mentioned method using nucleic acid amplification.

[0041] According to one embodiment of the present invention, the length of the probe is at least 10 nucleotides, preferably 20 to 1000 nucleotides, more preferably 50 to 700 nucleotides, and even more preferably 100 to 500 nucleotides. The length of the probe according to the present invention can be appropriately adjusted depending on the application of the probe. A probe having such a length is particularly preferable when carrying out a hybridization method using a nucleic acid sample containing impurities.

[0042] In identifying the genetic sex of mackerel by the hybridization method, the presence or absence of a hybridization complex between a nucleic acid sample and the above-mentioned probe is detected under stringent conditions, and if present, the subject mackerel can be identified as male. Examples of "stringent conditions" in the hybridization method of the present invention include the conditions described above.

[0043] According to one embodiment of the present invention, the probe can be used as a probe in a conventional manner in known methods such as Northern blotting, Southern blotting, in situ hybridization, and the like.

[0044] According to one embodiment of the present invention, the probe according to the present invention can be produced based on the base sequence disclosed in the present specification. For example, a probe for detecting a sex-identification marker can be prepared by cutting out a desired DNA fragment from a plasmid containing any one of the cloned polynucleotides (preferably DNA) of (a) to (h) with an appropriate restriction enzyme, or by PCR using the plasmid or DNA prepared from a male mackerel as a template.

[0045] According to one preferred embodiment of the present invention, the probe for detecting the gender identification marker is a probe capable of specifically hybridizing to the UTR sequence of mRNA, preferably a probe capable of specifically hybridizing to the 5'-UTR or 3'-UTR sequence of the sequence represented by SEQ ID NO:4.

[0046] Judgment process In the present invention, as shown in the examples described later, the sex of mackerel can be determined using the sex identification marker of the present invention as an indicator.

[0047] According to one embodiment of the present invention, when a gene comprising any one of the polynucleotides (a) to (d) or a nucleotide fragment thereof is present, the sex of mackerel can be determined to be female. According to another embodiment of the present invention, when a gene comprising any one of the polynucleotides (e) to (h) or a nucleotide fragment thereof is present, the sex of mackerel can be determined to be male.

[0048] Nucleic acid molecule / primer pair According to another aspect of the present invention, a nucleic acid molecule for use in the method of the present invention is provided. A preferred nucleic acid molecule of the present invention comprises, for example, a gene comprising any one of the polynucleotides (a) to (h) of mackerel or a nucleotide fragment thereof, or an mRNA or cDNA of the gene, or a polynucleotide fragment capable of specifically hybridizing to a complementary polynucleotide thereof. According to a preferred aspect of the present invention, the nucleic acid molecule of the present invention can be used as a probe in a hybridization method. A nucleic acid molecule used as such a probe can be appropriately designed by a person skilled in the art based on the base sequence of the relevant region. When used as a probe in a hybridization method, the chain length of the nucleic acid molecule is at least 10 nucleotides, preferably 20 to 1000 nucleotides, more preferably 50 to 700 nucleotides, and even more preferably 100 to 500 nucleotides. The chain length of the probe according to the present invention can be appropriately adjusted depending on the application of the probe. A probe having such a chain length is particularly preferable when carrying out a hybridization method using a nucleic acid sample containing impurities.

[0049] According to another aspect of the invention there is provided a primer pair for use in the method of the invention. A preferred primer pair of the present invention is one that can amplify a part or the whole region of the polynucleotide of the present invention or its nucleotide fragment by a nucleic acid amplification method. Such a primer pair for use in a nucleic acid amplification method can be appropriately designed by a person skilled in the art based on the base sequence of the region. When a nucleic acid amplification method is used, the length of the primer is 15 to 100 nucleotides, more preferably at least 17 nucleotides, even more preferably at least 18 nucleotides, even more preferably 18 to 50 nucleotides, and even more preferably 15 to 20 nucleotides. 18 ~ 40 A primer having such a chain length is particularly preferable when carrying out a nucleic acid amplification method using a nucleic acid sample containing impurities.

[0050] Reagents / Kits In the present invention, a kit can be prepared by collecting all reagents necessary for carrying out a method for identifying the sex of mackerel using as an index a sex-identification marker for mackerel comprising a gene comprising any one of the polynucleotides (a) to (h) or a nucleotide fragment thereof or an expression product of said gene. Thus, in one embodiment, the kit of the present invention comprises a reagent capable of detecting a sex-identification marker for mackerel comprising a gene comprising any one of the polynucleotides (a) to (h) or a nucleotide fragment thereof or an expression product of said gene.

[0051] The kit of the present invention may comprise the above-mentioned nucleic acid molecule according to the present invention and / or the primer pair according to the present invention as a reagent.

[0052] According to another embodiment of the present invention, the kit may contain, as a reagent, an antibody capable of recognizing a protein expressed by a gene comprising any one of the polynucleotides (a) to (h) or a nucleotide fragment thereof, and such an embodiment is also included in the present invention.

[0053] Use as a sex identification marker in mackerel According to one embodiment of the present invention, a gene comprising any one of the polynucleotides (a) to (h) or a nucleotide fragment thereof, or an expression product of the gene, can be used as a sex identification marker for mackerel. Therefore, according to another embodiment of the present invention, there is provided the use of a gene comprising any one of the polynucleotides (a) to (h) or a nucleotide fragment thereof, or an expression product of the gene, as a sex identification marker for mackerel. EXAMPLES

[0054] The present invention will be described based on the following test examples, but the present invention is not limited to these test examples.

[0055] Test Example 1 Wild mackerel ( Scomber japonicus : 30 males, 30 females), wild mackerel ( Scomber australasicus DNA was extracted from the fins of each individual (30 males and 30 females) and genome analysis was performed using a DNA sequencer (Illumina MiSeq™ System, Illumina, Inc. - number of reads: 150 bases x 2). The amount of data obtained was as follows:

[0056] [Table 1]

[0057] To date, no complete DNA sequence information has been reported for mackerel. Therefore, we remapped the mackerel data against the genome DNA sequence of the closely related species, amberjack (Assembly name: Sdu_1.0, Assembly accession: GCF_002260705.1), and searched for sex-specific SNPs in chub mackerel and pied mackerel.

[0058] Mackerel (Scomber japonicus) Figures 1 and 2 are schematic diagrams in which the M / Ffst (difference between male and female mapping data: peaks indicate male or female specific locations), male-specific SNPs, female-specific SNPs, and M / F coverage (mapping coverage: indicates that information is covered overall) information obtained by sex-specific SNP searches for chub mackerel (female heterozygous) and sesame mackerel (male heterozygous) are arranged in concentric circles. In particular, as indicated by the arrows in the square frame in Figure 2, the expression of multiple SNPs that are specifically expressed in females only was confirmed in chub mackerel (female heterozygous), and SNPs that are specifically expressed in males only were confirmed in sesame mackerel (male heterozygous).

[0059] In addition, we compared the DNA sequences of males and females of chub mackerel (female heterozygous) and spotted mackerel (male heterozygous). As an example, Figure 3 shows a schematic diagram of the comparison of the DNA sequences of males and females of chub mackerel (female heterozygous).

[0060] As a result, for the SNPs obtained in the above search, the occurrence rate was 50% only in females in the case of chub mackerel (female heterozygous), and the occurrence rate was 50% only in males in the case of pied mackerel (male heterozygous). The occurrence rate of 50% is consistent with the SNPs being heterozygous-specifically expressed, suggesting that the SNPs found are sex-specific SNPs.

[0061] As a result of comparing the DNA sequences of male and female mackerel (female heterozygous), the following SNPs that are specifically expressed in female genes were found in the FERM and PDZ domain-containing protein 4-like genome (NW_019174360).

[0062] [Table 2]

[0063] Mackerel (Scomber australasicus) In mackerel (male heterozygous), the following SNP mutations that are specifically expressed in male genes were found in the tyrosine-protein kinase PRAG1 genome (NW_019175644).

[0064] [Table 3]

[0065] Test Example 2: PCR Expression Analysis Test Primer production For detection of SNPs in mackerel, primers for detecting SNPs 652:Ct, 665:Gt, 667:Gt and 768:Gc in Table 2 above were designed as follows, as shown in FIG.

[0066] Forward Jap_F1_F_648: TAGATGTTGTTAACTTGTGT (SEQ ID NO: 5) Reverse Jap_F1_R_787: TACGTCTGATCCATGGTCAG (SEQ ID NO: 6)

[0067] Furthermore, for the detection of SNPs in the tests described below, as shown in FIG. 5, primers for detecting SNPs 2039:Ca, 2041:Ga, 2137:Ga, 2140:Ta, and 2143:Cg in Table 2 above were designed as follows.

[0068] Forward Jap_F2_F_2022: ACACCATCTCACTAGGAAGA (SEQ ID NO: 7) Reverse Jap_F2_R_2156: GAGGAGGAGGTGGCGGTGGT (SEQ ID NO: 8)

[0069] Furthermore, in order to detect the SNP of sesame mackerel, as shown in FIG. 6, primers for detecting SNP 1896:Ga in Table 2 above were designed as follows.

[0070] Forward Aus_M_F1_1877: GTTTGATGGGGTCAGGTTGA (SEQ ID NO: 9) Reverse Aus_M_R1_2031: CTGGAATCTTGATCTATGAG (SEQ ID NO: 10)

[0071] To analyze mRNA expression in mackerel (Scomber japonicus), blood from immature individuals (n=3 for each sex) was obtained from the fins and genomic DNA was extracted. Genomic DNA was extracted using a DNeasy Blood and Tissue kit (Qiagen). The obtained genomic DNA was subjected to PCR using Takara Ex TaqDNA polymerase (Takara Bio). The PCR primers used to detect SNPs 652:Ct, 665:Gt, 667:Gt and 768:Gc were primers Jap_F1_F_648 forward: TAGATGTTGTTAACTTGTGT (sequence number: 5 ) and primer Jap_F1_R_787 Reverse: TACGTCTGATCCATGGTCAG (SEQ ID NO: 6 ), and primer Jap_F2_F_2022: ACACCATCTCACTAGGAAGA (SEQ ID NO: 1) as a primer for detecting SNPs 2039:Ca, 2041:Ga, 2137:Ga, 2140:Ta, and 2143:Cg. 7 ) and primer Jap_F2_R_2156: GAGGAGGAGGTGGCGGTGGT (SEQ ID NO: 8 ) primer set was used. PCR reaction was performed under the following conditions: 95℃ 1 minute, (95℃ 30 seconds, 55℃ 30 seconds, 72℃ 2 minutes) × 35 cycles, 72℃ 5 minutes. Then, agarose gel electrophoresis was performed using 1% (w / v) Agarose S (Nippon Gene Co., Ltd.) to separate the DNA fragments.

[0072] In addition, for the analysis of mRNA expression in mackerel (Scomber australasicus), primer Aus_M_F1_1877: GTTTGATGGGGTCAGGTTGA (SEQ ID NO: 1) was used to detect SNP 1896:Ga. 9 ) and primer Aus_M_R1_2031: CTGGAATCTTGATCTATGAG (SEQ ID NO:10 PCR was performed in the same manner as for mackerel (Scomber japonicus), except that the primer set was used.

[0073] The results are shown in FIG. For mackerel (Scomber japonicus), bands Jap_F1 corresponding to SNPs 652:Ct, 665:Gt, 667:Gt, and 768:Gc, and Jap_F2 corresponding to SNPs 2039:Ca, 2041:Ga, 2137:Ga, 2140:Ta, and 2143:Cg were detected only in females.

[0074] In mackerel (Scomber australasicus), the band Aus_M1 corresponding to SNP 1896:Ga was detected only in males.

[0075] Test Example 3: Identification of genetic sex of mackerel by nucleic acid amplification method For wild populations of chub mackerel (66 males and 72 females) living in Hokkaido, Niigata, Kagoshima, Oita, and Chiba, primers Jap_F1_F_648 forward: TAGATGTTGTTAACTTGTGT (sequence number: 5 ) and primer Jap_F1_R_787 Reverse: TACGTCTGATCCATGGTCAG (SEQ ID NO: 6 The sex of the eggs was determined by PCR using the primer set of . The sex was also confirmed by cannulation to confirm the presence or absence of ovaries.

[0076] As a result, the accuracy rate of sex determination was 98.5% for females and 100% for males.

[0077] For wild populations of mackerel (43 males and 43 females) living in Kagoshima and Chiba, primers Aus_M_F1_1877: GTTTGATGGGGTCAGGTTGA (sequence number: 9 ) and primer Aus_M_R1_2031: CTGGAATCTTGATCTATGAG (SEQ ID NO:10 The sex of the eggs was determined by PCR using the primer set of . The sex was also confirmed by cannulation to confirm the presence or absence of ovaries.

[0078] As a result, the accuracy rate of determining the sex of females was 97.7% and that of males was 90.7%. These results indicate that it is possible to distinguish between males and females based on the expression of SNPs even in wild populations.

Claims

1. A nucleic acid molecule consisting of any one of the following polynucleotide fragments (a) to (f), wherein the chain length of the polynucleotide fragment is 100 to 200 residues: (a) a polynucleotide fragment consisting of a base sequence represented by SEQ ID NO: 2, which retains at least one nucleotide residue selected from the group consisting of a thymine residue at position 652, a thymine residue at position 665, a thymine residue at position 667, a cytosine residue at position 768, an adenine residue at position 2039, an adenine residue at position 2039, an adenine residue at position 2041, an adenine residue at position 2137, an adenine residue at position 2140, and an adenine residue at position 2143 in SEQ ID NO: 2; (b) a polynucleotide fragment having a base sequence having an identity of 90% or more to the base sequence represented by SEQ ID NO: 2, a polynucleotide fragment, which retains at least one nucleotide residue selected from the group consisting of a thymine residue at position 652, a thymine residue at position 665, a thymine residue at position 667, a cytosine residue at position 768, an adenine residue at position 2039, an adenine residue at position 2039, an adenine residue at position 2041, an adenine residue at position 2137, an adenine residue at position 2140, and an adenine residue at position 2143 in SEQ ID NO:2, said polynucleotide fragment having 90% or more identity compared to the corresponding portion of SEQ ID NO:2; (c) a polynucleotide fragment consisting of a base sequence represented by SEQ ID NO: 2 in which one or several bases have been substituted, deleted or added, which retains at least one nucleotide residue selected from the group consisting of a thymine residue at position 652, a thymine residue at position 665, a thymine residue at position 667, a cytosine residue at position 768, an adenine residue at position 2039, an adenine residue at position 2039, an adenine residue at position 2041, an adenine residue at position 2137, an adenine residue at position 2140 and an adenine residue at position 2143 in SEQ ID NO: 2, and which has an identity of 90% or more when compared with the corresponding portion of SEQ ID NO: 2; (d) a polynucleotide fragment consisting of the base sequence represented by SEQ ID NO: 3, which retains the guanine residue at position 1896 in SEQ ID NO: 3; (e) a polynucleotide fragment consisting of a base sequence having 90% or more identity to the base sequence represented by SEQ ID NO:3, which retains the guanine residue at position 1896 in SEQ ID NO:3, and which has 90% or more identity when compared to the corresponding portion of SEQ ID NO:3; (f) a polynucleotide fragment consisting of a base sequence represented by SEQ ID NO: 3 in which one or several bases have been substituted, deleted, inserted or added, A polynucleotide fragment which retains the guanine residue at position 1896 in SEQ ID NO:3, said polynucleotide fragment having 90% or greater identity compared to the corresponding portion of SEQ ID NO:

3.

2. The nucleic acid molecule according to claim 1, which has sex discrimination activity for mackerel.

3. A nucleic acid molecule comprising any one of the following polynucleotide fragments (a) to (f) in a sample obtained from a test mackerel, the polynucleotide fragment having a chain length of 100 to 200 residues: (a) a polynucleotide fragment consisting of a base sequence represented by SEQ ID NO: 2, which retains at least one nucleotide residue selected from the group consisting of a thymine residue at position 652, a thymine residue at position 665, a thymine residue at position 667, a cytosine residue at position 768, an adenine residue at position 2039, an adenine residue at position 2039, an adenine residue at position 2041, an adenine residue at position 2137, an adenine residue at position 2140, and an adenine residue at position 2143 in SEQ ID NO: 2; (b) a polynucleotide or fragment thereof having a base sequence having an identity of 90% or more to the base sequence represented by SEQ ID NO:2, a polynucleotide fragment, which retains at least one nucleotide residue selected from the group consisting of a thymine residue at position 652, a thymine residue at position 665, a thymine residue at position 667, a cytosine residue at position 768, an adenine residue at position 2039, an adenine residue at position 2039, an adenine residue at position 2041, an adenine residue at position 2137, an adenine residue at position 2140, and an adenine residue at position 2143 in SEQ ID NO:2, said polynucleotide fragment having 90% or more identity compared to the corresponding portion of SEQ ID NO:2; (c) a polynucleotide fragment consisting of a base sequence represented by SEQ ID NO: 2 in which one or several bases have been substituted, deleted or added, which retains at least one nucleotide residue selected from the group consisting of a thymine residue at position 652, a thymine residue at position 665, a thymine residue at position 667, a cytosine residue at position 768, an adenine residue at position 2039, an adenine residue at position 2039, an adenine residue at position 2041, an adenine residue at position 2137, an adenine residue at position 2140 and an adenine residue at position 2143 in SEQ ID NO: 2, and which has an identity of 90% or more when compared with the corresponding portion of SEQ ID NO: 2; (d) a polynucleotide fragment consisting of the base sequence represented by SEQ ID NO: 3, which retains the guanine residue at position 1896 in SEQ ID NO: 3; (e) a polynucleotide fragment consisting of a base sequence having 90% or more identity to the base sequence represented by SEQ ID NO:3, which retains the guanine residue at position 1896 in SEQ ID NO:3, and which has 90% or more identity when compared to the corresponding portion of SEQ ID NO:3; (f) a polynucleotide fragment consisting of a base sequence represented by SEQ ID NO: 3 in which one or several bases have been substituted, deleted, inserted or added, A polynucleotide fragment that retains the guanine residue at position 1896 in SEQ ID NO:3, and the polynucleotide fragment has 90% or more identity compared to the corresponding portion of SEQ ID NO:

3. A method for identifying the sex of mackerel, comprising the step of detecting

4. The method according to claim 3, wherein the sex of mackerel is determined to be female when a nucleic acid molecule consisting of any one of the polynucleotide fragments (a) to (c) is detected.

5. The method according to claim 3 or 4, wherein the sex of mackerel is determined to be male when a nucleic acid molecule consisting of any one of the polynucleotide fragments (d) to (f) is detected.

6. The method according to any one of claims 3 to 5, wherein the detection step comprises amplifying the nucleic acid molecule according to claim 1 or 2 or a complementary nucleic acid molecule thereof by a nucleic acid amplification method.

7. The method according to any one of claims 3 to 6, wherein the sample is a sample derived from a tissue selected from the group consisting of fin, blood, mucus, scales, and epidermis.

8. The method according to any one of claims 3 to 7, wherein the mackerel is Scomber japonicus or Scomber australasicus.

9. A nucleic acid molecule for use in the method according to any one of claims 3 to 8, comprising A nucleic acid molecule that specifically hybridizes to said residues of the nucleic acid molecule of claim 1, or a polynucleotide comprising the mRNA or cDNA of said nucleic acid molecule, or a polynucleotide complementary thereto.

10. A primer pair for use in the method according to any one of claims 3 to 8, A primer pair that specifically hybridizes to the above residues of the nucleic acid molecule of claim 1, or a polynucleotide fragment comprising the cDNA of said nucleic acid molecule, or a complementary polynucleotide thereof.

11. A kit for identifying the sex of mackerel, comprising the nucleic acid molecule according to claim 9 and / or the primer pair according to claim 10.

Images