Nucleic acid polypeptide compositions and methods for inducing exon skipping - Patent Application 20070229633

Abstract

Methods for treating a disease or disorder are provided. [Solution] The method includes administering to a subject a polynucleic acid molecule conjugate, the polynucleic acid molecule conjugate comprising a target cell binding portion and a targeted pre-mRNA splice-regulator polynucleic acid portion, wherein the target cell binding portion specifically binds to the targeted cell, and the targeted pre-mRNA specific splice-regulator polynucleic acid portion induces an insertion, deletion, duplication, or modification of a targeted pre-mRNA transcript in the targeted cell to induce a splicing event in the targeted pre-mRNA transcript to produce an mRNA transcript, and the mRNA transcript encodes a protein that is modified compared to the same protein in untreated target cells, thereby treating a disease or disorder in the subject.

Description

[Technical field]

[0001] cross reference This application claims the benefit of U.S. Provisional Patent Application No. 62 / 561,939, filed September 22, 2017, and U.S. Provisional Patent Application No. 62 / 443,514, filed January 6, 2017, each of which is incorporated by reference in its entirety.

[0002] Sequence Listing This application contains a Sequence Listing, which has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy, created on December 22, 2017, has the filename 45532-715_601_SL.txt and is 210,534 bytes in size. [Background technology]

[0003] Modulation of RNA function is a developing area of ​​therapeutic interest. Drugs that affect mRNA stability, such as antisense oligonucleotides and small interfering RNA, are one way to modulate RNA function. Another group of oligonucleotides can modulate RNA function by altering the processing of pre-mRNA to include or exclude specific regions of the pre-mRNA from the final gene product: the encoded protein. Oligonucleotide therapeutics therefore represent a means to modulate protein expression in disease states and thus have utility as therapeutic agents. Summary of the Invention

[0004] Disclosed herein, in certain embodiments, are molecules and pharmaceutical compositions for modulating RNA processing.

[0005] Disclosed herein, in an embodiment, is a method for treating a disease or disorder caused by a mis-spliced ​​mRNA transcript in a subject, the method comprising administering to the subject a polynucleic acid molecule conjugate, wherein the polynucleic acid molecule conjugate is conjugated to a cell target binding moiety, wherein the polynucleotide optionally comprises at least one 2' modified nucleotide, at least one modified internucleotide bond, or at least one inverted abasic moiety, wherein the polynucleic acid molecule conjugate induces an insertion, deletion, duplication, or modification of the mis-spliced ​​mRNA transcript to induce exon skipping or exon inclusion in the mis-spliced ​​mRNA transcript to generate a fully processed mRNA transcript, and wherein the fully processed mRNA transcript encodes a functional protein, thereby treating the disease or disorder in the subject. In some embodiments, the disease or disorder is further characterized by one or more mutations in the mRNA. In some embodiments, the disease or disorder comprises a neuromuscular disease, a genetic disease, a cancer, a genetic disease, or a cardiovascular disease. In some embodiments, the disease or disorder is muscular dystrophy. In some embodiments, the disease or disorder is Duchenne muscular dystrophy. In some embodiments, the exon skipping is of exon 8, 23, 35, 43, 44, 45, 50, 51, 52, 53, or 55 of the DMD gene. In some embodiments, the exon skipping is of exon 23 of the DMD gene. In some embodiments, the polynucleic acid molecule conjugate comprises the structure of formula (I): AXB Formula I During the ceremony, A comprises a binding moiety, B consists of a polynucleotide, and X consists of a single bond or a first linker. In some embodiments, the polynucleic acid molecule conjugate comprises a structure of formula (II): AXBYC Formula II During the ceremony, A comprises a binding moiety, B comprises a polynucleotide, C is a polymer; X consists of a single bond or a first linker, and Y consists of a single bond or a second linker. In some embodiments, the polynucleic acid molecule conjugate comprises a structure of formula (III): AXCYB Formula III During the ceremony, A comprises a binding moiety, B comprises a polynucleotide, C is a polymer; X consists of a single bond or a first linker, and Y consists of a single bond or a second linker. In some embodiments, at least one 2' modified nucleotide comprises a morpholino, 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamide (2'-O-NMA) modified nucleotide. In some embodiments, at least one 2' modified nucleotide comprises a locked nucleic acid (LNA), an ethylene nucleic acid (ENA), or a peptide nucleic acid (PNA). In some embodiments, at least one 2' modified nucleotide comprises a morpholino. In some embodiments, at least one inverted base moiety is at least one terminal. In some embodiments, at least one modified internucleotide linkage comprises a phosphorothioate linkage or a dithiophosphate linkage. In some embodiments, the polynucleic acid molecule is at least about 10 to about 30 nucleotides in length. In some embodiments, the polynucleic acid molecule is at least one of about 15 to about 30, about 18 to about 25, about 18 to about 24, about 19 to about 23, about 20 to about 22 nucleotides in length. In some embodiments, the polynucleic acid molecule is at least about 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. In some embodiments, the polynucleic acid molecule comprises at least one of: about 5% to about 100% modification, about 10% to about 100% modification, about 20% to about 100% modification, about 30% to about 100% modification, about 40% to about 100% modification, about 50% to about 100% modification, about 60% to about 100% modification, about 70% to about 100% modification, about 80% to about 100% modification, and about 90% to about 100% modification.In some embodiments, the polynucleic acid molecule comprises at least one of the following: about 10% to about 90% modification, about 20% to about 90% modification, about 30% to about 90% modification, about 40% to about 90% modification, about 50% to about 90% modification, about 60% to about 90% modification, about 70% to about 90% modification, and about 80% to about 100% modification. In some embodiments, the polynucleic acid molecule comprises at least one of the following: about 10% to about 80% modification, about 20% to about 80% modification, about 30% to about 80% modification, about 40% to about 80% modification, about 50% to about 80% modification, about 60% to about 80% modification, and about 70% to about 80% modification. In some embodiments, the polynucleic acid molecule comprises at least one of the following: about 10% to about 70% modification, about 20% to about 70% modification, about 30% to about 70% modification, about 40% to about 70% modification, about 50% to about 70% modification, and about 60% to about 70% modification. In some embodiments, the polynucleic acid molecule comprises at least one of the following: about 10% to about 60% modification, about 20% to about 60% modification, about 30% to about 60% modification, about 40% to about 60% modification, and about 50% to about 60% modification. In some embodiments, the polynucleic acid molecule comprises at least one of the following: about 10% to about 50% modification, about 20% to about 50% modification, about 30% to about 50% modification, and about 40% to about 50% modification. In some embodiments, the polynucleic acid molecule comprises at least one of the following: about 10% to about 40% modifications, about 20% to about 40% modifications, and about 30% to about 40% modifications. In some embodiments, the polynucleic acid molecule comprises at least one of the following: about 10% to about 30% modifications, and about 20% to about 30% modifications. In some embodiments, the polynucleic acid molecule comprises about 10% to about 20% modifications. In some embodiments, the polynucleic acid molecule comprises about 15% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60% modifications. In some embodiments, the polynucleic acid molecule comprises at least about 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% modifications.In some embodiments, the polynucleic acid molecule comprises at least about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, or about 22 or more modifications. In some embodiments, the polynucleic acid molecule comprises at least about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22 or more modified nucleotides. In some embodiments, the polynucleic acid molecule comprises a single strand. In some embodiments, the polynucleic acid molecule comprises two or more strands. In some embodiments, the polynucleic acid molecule comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide to form a double stranded polynucleic acid molecule. In some embodiments, the second polynucleotide comprises at least one modification. In some embodiments, the first polynucleotide and the second polynucleotide are RNA molecules. In some embodiments, the first polynucleotide and the second polynucleotide are siRNA molecules. In some embodiments, X and Y are independently a single bond, a degradable linker, a non-degradable linker, a cleavable linker, or a non-polymeric linker group. In some embodiments, X is a single bond. In some embodiments, X is a C1-C6 alkyl group. In some embodiments, Y is a C1-C6 alkyl group. In some embodiments, X is a homobifunctional linker or a heterobifunctional linker, optionally conjugated to a C1-C6 alkyl group. In some embodiments, Y is a homobifunctional linker or a heterobifunctional linker. In some embodiments, the binding moiety is an antibody or a binding fragment thereof.In some embodiments, the antibody or binding fragment thereof comprises a humanized antibody or binding fragment thereof, a chimeric antibody or binding fragment thereof, a monoclonal antibody or binding fragment thereof, a monovalent Fab', a bivalent Fab2, a single chain variable fragment (scFv), a diabody, a minibody, a nanobody, a single domain antibody (sdAb), or a camelid antibody, or binding fragment thereof. In some embodiments, C is polyethylene glycol. In some embodiments, C has a molecular weight of about 5,000 Da. In some embodiments, AX is conjugated to the 5' end of B and YC is conjugated to the 3' end of B. In some embodiments, YC is conjugated to the 5' end of B and AX is conjugated to the 3' end of B. In some embodiments, AX, YC, or a combination thereof are conjugated to an internucleotide linkage group. In some embodiments, the method further comprises D. In some embodiments, D is conjugated to C or A. In some embodiments, D is conjugated to a molecular conjugate of formula (II) according to formula (IV). (AXBYC c )-LD Formula IV During the ceremony, A comprises a binding moiety, B comprises a polynucleotide, C is a polymer; X consists of a single bond or a first linker; Y consists of a bond or a second linker; L comprises a bond or a third linker; D consists of an endosomolytic moiety, and c is an integer between 0 and 1, wherein the polynucleotide comprises at least one 2' modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety, and D is conjugated to any position of A, B, or C. In some embodiments, D is INF7 or melittin. In some embodiments, L is a C1-C6 alkyl group. In some embodiments, L is a homobifunctional linker or a heterobifunctional linker. In some embodiments, the method further comprises at least a second binding moiety, A. In some embodiments, at least a second binding moiety, A, is conjugated to A, B, or C.

[0006] In some embodiments, disclosed herein is a method for inducing insertion, deletion, duplication, or modification of a mis-spliced ​​mRNA transcript to induce exon skipping or exon inclusion in the mis-spliced ​​mRNA transcript, the method comprising: contacting a target cell with a polynucleic acid molecule conjugate, the polynucleotide comprising at least one 2' modified nucleotide, at least one modified internucleotide bond, or at least one inverted abasic portion; hybridizing the polynucleic acid molecule conjugate to a mis-spliced ​​mRNA transcript in the target cell to induce insertion, deletion, duplication, or modification of the mis-spliced ​​mRNA transcript to induce exon skipping or exon inclusion, the mis-spliced ​​mRNA transcript being capable of encoding a functional form of a protein; and translating the functional form of the protein of the fully processed mRNA transcript of the previous step. In some embodiments, the target cell is a target cell of a subject. In some embodiments, the misspliced ​​mRNA transcript further induces a disease or disorder. In some embodiments, the disease or disorder is further characterized by one or more mutations in the mRNA. In some embodiments, the disease or disorder comprises a neuromuscular disease, a genetic disease, a cancer, a genetic disease, or a cardiovascular disease. In some embodiments, the disease or disorder is a muscular dystrophy. In some embodiments, the disease or disorder is Duchenne muscular dystrophy. In some embodiments, the exon skipping is of exon 8, 23, 35, 43, 44, 45, 50, 51, 52, 53, or 55 of the DMD gene. In some embodiments, the exon skipping is of exon 23 of the DMD gene. In some embodiments, the polynucleic acid molecule conjugate comprises a structure of formula (I): AXB Formula I During the ceremony, A comprises a binding moiety, B consists of a polynucleotide, and X consists of a single bond or a first linker. In some embodiments, the polynucleic acid molecule conjugate comprises a structure of formula (II): AXBYC Formula II During the ceremony, A comprises a binding moiety, B comprises a polynucleotide, C is a polymer; X consists of a single bond or a first linker, and Y consists of a single bond or a second linker. In some embodiments, the polynucleic acid molecule conjugate comprises a structure of formula (III): AXCYB Formula III During the ceremony, A comprises a binding moiety, B comprises a polynucleotide, C is a polymer; X consists of a single bond or a first linker, and Y consists of a single bond or a second linker. In some embodiments, the at least one 2' modified nucleotide comprises a morpholino, 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamide (2'-O-NMA) modified nucleotide. In some embodiments, the at least one 2' modified nucleotide comprises a locked nucleic acid (LNA), an ethylene nucleic acid (ENA), or a peptide nucleic acid (PNA). In some embodiments, the at least one 2' modified nucleotide comprises a morpholino. In some embodiments, the at least one inverted base moiety is at least one terminal. In some embodiments, at least one modified internucleotide linkage comprises a phosphorothioate linkage or a dithiophosphate linkage. In some embodiments, the polynucleic acid molecule is at least about 10 to about 30 nucleotides in length. In some embodiments, the polynucleic acid molecule is at least one of about 15 to about 30, about 18 to about 25, about 18 to about 24, about 19 to about 23, about 20 to about 22 nucleotides in length. In some embodiments, the polynucleic acid molecule is at least about 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. In some embodiments, the polynucleic acid molecule comprises at least one of: about 5% to about 100% modification, about 10% to about 100% modification, about 20% to about 100% modification, about 30% to about 100% modification, about 40% to about 100% modification, about 50% to about 100% modification, about 60% to about 100% modification, about 70% to about 100% modification, about 80% to about 100% modification, and about 90% to about 100% modification.In some embodiments, the polynucleic acid molecule comprises at least one of the following: about 10% to about 90% modification, about 20% to about 90% modification, about 30% to about 90% modification, about 40% to about 90% modification, about 50% to about 90% modification, about 60% to about 90% modification, about 70% to about 90% modification, and about 80% to about 100% modification. In some embodiments, the polynucleic acid molecule comprises at least one of the following: about 10% to about 80% modification, about 20% to about 80% modification, about 30% to about 80% modification, about 40% to about 80% modification, about 50% to about 80% modification, about 60% to about 80% modification, and about 70% to about 80% modification. In some embodiments, the polynucleic acid molecule comprises at least one of the following: about 10% to about 70% modification, about 20% to about 70% modification, about 30% to about 70% modification, about 40% to about 70% modification, about 50% to about 70% modification, and about 60% to about 70% modification. In some embodiments, the polynucleic acid molecule comprises at least one of the following: about 10% to about 60% modification, about 20% to about 60% modification, about 30% to about 60% modification, about 40% to about 60% modification, and about 50% to about 60% modification. In some embodiments, the polynucleic acid molecule comprises at least one of the following: about 10% to about 50% modification, about 20% to about 50% modification, about 30% to about 50% modification, and about 40% to about 50% modification. In some embodiments, the polynucleic acid molecule comprises at least one of the following: about 10% to about 40% modifications, about 20% to about 40% modifications, and about 30% to about 40% modifications. In some embodiments, the polynucleic acid molecule comprises at least one of the following: about 10% to about 30% modifications, and about 20% to about 30% modifications. In some embodiments, the polynucleic acid molecule comprises about 10% to about 20% modifications. In some embodiments, the polynucleic acid molecule comprises about 15% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60% modifications. In some embodiments, the polynucleic acid molecule comprises at least about 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% modifications.In some embodiments, the polynucleic acid molecule comprises at least about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, or about 22 or more modifications. In some embodiments, the polynucleic acid molecule comprises at least about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22 or more modified nucleotides. In some embodiments, the polynucleic acid molecule comprises a single strand. In some embodiments, the polynucleic acid molecule comprises two or more strands. In some embodiments, the polynucleic acid molecule comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide to form a double stranded polynucleic acid molecule. In some embodiments, the second polynucleotide comprises at least one modification. In some embodiments, the first polynucleotide and the second polynucleotide are RNA molecules. In some embodiments, the first polynucleotide and the second polynucleotide are siRNA molecules. In some embodiments, X and Y are independently a single bond, a degradable linker, a non-degradable linker, a cleavable linker, or a non-polymeric linker group. In some embodiments, X is a single bond. In some embodiments, X is a C1-C6 alkyl group. In some embodiments, Y is a C1-C6 alkyl group. In some embodiments, X is a homobifunctional linker or a heterobifunctional linker, optionally conjugated to a C1-C6 alkyl group. In some embodiments, Y is a homobifunctional linker or a heterobifunctional linker. In some embodiments, the binding moiety is an antibody or a binding fragment thereof.In some embodiments, the antibody or binding fragment thereof comprises a humanized antibody or binding fragment thereof, a chimeric antibody or binding fragment thereof, a monoclonal antibody or binding fragment thereof, a monovalent Fab', a bivalent Fab2, a single chain variable fragment (scFv), a diabody, a minibody, a nanobody, a single domain antibody (sdAb), or a camelid antibody, or binding fragment thereof. In some embodiments, C is polyethylene glycol. In some embodiments, C has a molecular weight of about 5,000 Da. In some embodiments, AX is conjugated to the 5' end of B and YC is conjugated to the 3' end of B. In some embodiments, YC is conjugated to the 5' end of B and AX is conjugated to the 3' end of B. In some embodiments, AX, YC, or a combination thereof are conjugated to an internucleotide linkage group. In some embodiments, the method further comprises D. In some embodiments, D is conjugated to C or A. In some embodiments, D is conjugated to a molecular conjugate of formula (II) according to formula (IV). (AXBYC c )-LD Formula IV During the ceremony, A comprises a binding moiety, B comprises a polynucleotide, C is a polymer; X consists of a single bond or a first linker; Y is a bond or a second linker; L comprises a bond or a third linker; D consists of an endosomolytic moiety, and c is an integer between 0 and 1, wherein the polynucleotide comprises at least one 2' modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety, and D is conjugated to any position of A, B, or C. In some embodiments, D is INF7 or melittin. In some embodiments, L is a C1-C6 alkyl group. In some embodiments, L is a homobifunctional linker or a heterobifunctional linker. In some embodiments, the method further comprises at least a second binding moiety, A. In some embodiments, at least a second binding moiety, A, is conjugated to A, B, or C. In some embodiments, the method is an in vivo method. In some embodiments, the method is an in vitro method. In some embodiments, the subject is a human.

[0007] In some embodiments, disclosed herein is a pharmaceutical composition comprising a molecule obtained by any one of the methods disclosed herein and a pharma- ceutical acceptable excipient.In some embodiments, the pharmaceutical composition is formulated as a nanoparticle formulation.In some embodiments, the pharmaceutical composition is formulated for parenteral, oral, intranasal, buccal, rectal, or transdermal administration.

[0008] Disclosed herein, in certain embodiments, is a kit comprising a molecule obtained by any one of the methods disclosed herein.

[0009] In certain embodiments, disclosed herein is a composition comprising a polynucleic acid molecule conjugate, wherein the polynucleic acid molecule conjugate comprises a polynucleotide comprising a sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:54-972. In certain embodiments, disclosed herein is a composition comprising a polynucleic acid molecule conjugate, wherein the polynucleic acid molecule conjugate comprises a polynucleotide comprising a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:54-972. In certain embodiments, the polynucleic acid molecule conjugate comprises a structure of formula (I): AXB Formula I During the ceremony, A comprises a binding moiety, B consists of a polynucleotide, and X consists of a single bond or a first linker. In one embodiment, the polynucleic acid molecule conjugate comprises a structure of formula (II): AXBYC Formula II During the ceremony, A comprises a binding moiety, B comprises a polynucleotide, C is a polymer; X consists of a single bond or a first linker, and Y consists of a single bond or a second linker. In one embodiment, the polynucleic acid molecule conjugate comprises a structure of formula (III): AXCYB Formula III During the ceremony, A comprises a binding moiety, B comprises a polynucleotide, C is a polymer; X consists of a single bond or a first linker, and Y consists of a single bond or a second linker. In certain embodiments, at least one 2' modified nucleotide comprises a morpholino, 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamide (2'-O-NMA) modified nucleotide. In certain embodiments, at least one 2' modified nucleotide comprises a morpholino.

[0010] In one embodiment, a method for treating a disease or disorder is disclosed herein, comprising administering to a subject a polynucleic acid molecule conjugate, the polynucleic acid molecule conjugate comprising a target cell binding portion and a targeted pre-mRNA specific splice regulator polynucleic acid portion, the target cell binding portion specifically binds to the targeted cell, and the targeted pre-mRNA specific splice regulator polynucleic acid portion induces an insertion, deletion, duplication, or modification of the targeted pre-mRNA transcript in the targeted cell to induce a splicing event in the targeted pre-mRNA transcript to generate an mRNA transcript, and the mRNA transcript encodes a modified protein compared to the same protein in untreated target cells, thereby treating the disease or disorder in the subject. In one embodiment, the splicing event is exon skipping. In one embodiment, the splicing event is exon inclusion. In one embodiment, the disease or disorder is further characterized by one or more mutations in the pre-mRNA. In some embodiments, the disease or disorder comprises a neuromuscular disease, a genetic disease, a cancer, a genetic disease, or a cardiovascular disease. In some embodiments, the disease or disorder is a muscular dystrophy. In some embodiments, the disease or disorder is Duchenne muscular dystrophy. In some embodiments, the splicing event is in exon 8, 23, 35, 43, 44, 45, 50, 51, 52, 53, or 55 of the DMD gene. In some embodiments, the splicing event is in exon 23 of the DMD gene. In some embodiments, the splicing event is in an exon of the PAH, MSTN, or K-Ras gene. In some embodiments, the polynucleic acid molecule conjugate comprises a structure of formula (I): AXB Formula I During the ceremony, A comprises a binding moiety, B consists of a polynucleotide, and X consists of a single bond or a first linker. In one embodiment, the polynucleic acid molecule conjugate comprises a structure of formula (II): AXBYC Formula II During the ceremony, A comprises a binding moiety, B comprises a polynucleotide, C is a polymer; X consists of a single bond or a first linker, and Y consists of a single bond or a second linker. In one embodiment, the polynucleic acid molecule conjugate comprises a structure of formula (III): AXCYB Formula III During the ceremony, A comprises a binding moiety, B comprises a polynucleotide, C is a polymer; X consists of a single bond or a first linker, and Y consists of a single bond or a second linker. In some embodiments, the polynucleic acid molecule conjugate optionally comprises at least one 2' modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety. In some embodiments, the at least one 2' modified nucleotide comprises a morpholino, 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamide (2'-O-NMA) modified nucleotide. In some embodiments, the at least one 2' modified nucleotide comprises a locked nucleic acid (LNA), ethylene nucleic acid (ENA), or peptide nucleic acid (PNA). In some embodiments, at least one 2' modified nucleotide comprises a morpholino. In some embodiments, at least one inverted base moiety is at least one terminal. In some embodiments, at least one modified internucleotide linkage comprises a phosphorothioate linkage or a phosphorodithioate linkage. In some embodiments, the polynucleic acid molecule comprises at least about 10 to about 30 nucleotides in length. In some embodiments, the polynucleic acid molecule comprises at least about 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% modifications. In some embodiments, the polynucleic acid molecule comprises a single strand. In some embodiments, the polynucleic acid molecule comprises two or more strands. In some embodiments, the polynucleic acid molecule comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide to form a double-stranded polynucleic acid molecule. In some embodiments, the second polynucleotide comprises at least one modification. In some embodiments, the first polynucleotide and the second polynucleotide comprise RNA molecules. In certain embodiments, the first polynucleotide and the second polynucleotide comprise siRNA molecules. In certain embodiments, X is a single bond.In some embodiments, X and Y are independently a bond, a degradable linker, a non-degradable linker, a cleavable linker, or a non-polymeric linker group. In some embodiments, X and Y are independently a bond, a degradable linker, a non-degradable linker, a cleavable linker, or a non-polymeric linker group. In some embodiments, X is a C1-C6 alkyl group. In some embodiments, X or Y is a C1-C6 alkyl group. In some embodiments, X or Y is a C1-C6 alkyl group. In some embodiments, the binding moiety is an antibody or binding fragment thereof. In some embodiments, the binding moiety is an antibody or binding fragment thereof. In some embodiments, the binding moiety is an antibody or binding fragment thereof. In some embodiments, C is polyethylene glycol. In some embodiments, C is polyethylene glycol. In some embodiments, AX is conjugated to the 5' end of B and YC is conjugated to the 3' end of B. In some embodiments, YC is conjugated to the 5' end of B and AX is conjugated to the 3' end of B. In some embodiments, the method further comprises D. In some embodiments, D is conjugated to C or A. In certain embodiments, the method further comprises at least a second binding moiety A. In certain embodiments, the method further comprises at least a second binding moiety A. In certain embodiments, the method further comprises at least a second binding moiety A.

[0011] In one embodiment, a method of inducing a splicing event in a targeted pre-mRNA transcript is disclosed herein, the method comprising the steps of: (a) contacting a target cell with a polynucleic acid molecule conjugate, the polynucleic acid molecule conjugate comprising a target cell binding portion and a targeted pre-mRNA splice regulating polynucleic acid portion; (b) hybridizing the targeted pre-mRNA splice regulating polynucleic acid portion to the targeted pre-mRNA transcript in the target cell to induce a splicing event in the targeted pre-mRNA transcript to produce an mRNA transcript; and (c) optionally translating the mRNA transcript of step (b) in the target cell to produce a protein. In one embodiment, the splicing event is exon skipping. In one embodiment, the splicing event is exon inclusion. In one embodiment, the targeted pre-mRNA transcript induces a disease or disorder. In one embodiment, the disease or disorder comprises a neuromuscular disease, a genetic disease, cancer, a genetic disease, or a cardiovascular disease. In one embodiment, the polynucleic acid molecule conjugate comprises: a) comprising the structure of formula (I), AXB Formula I During the ceremony, A comprises a binding moiety, B consists of a polynucleotide, and X consists of a single bond or a first linker; b) comprising the structure of formula (II), AXBYC Formula II During the ceremony, A comprises a binding moiety, B comprises a polynucleotide, C is a polymer; X consists of a single bond or a first linker, and Y consists of a bond or a second linker; or c) comprising the structure of formula (III), AXCYB Formula III During the ceremony, A comprises a binding moiety, B comprises a polynucleotide, C is a polymer; X consists of a single bond or a first linker, and Y consists of a single bond or a second linker. In some embodiments, the polynucleic acid molecule conjugate optionally comprises at least one 2'-modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety. In some embodiments, the at least one 2'-modified nucleotide comprises a morpholino, 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamide (2'-O-NMA) modified nucleotide. In some embodiments, the at least one 2'-modified nucleotide comprises a locked nucleic acid (LNA), ethylene nucleic acid (ENA), or peptide nucleic acid (PNA). In some embodiments, at least one 2' modified nucleotide comprises a morpholino. In some embodiments, at least one inverted base moiety is at least one terminal. In some embodiments, at least one modified internucleotide linkage comprises a phosphorothioate linkage or a phosphorodithioate linkage. In some embodiments, the polynucleic acid molecule comprises at least about 10 to about 30 nucleotides in length. In some embodiments, the polynucleic acid molecule comprises at least about 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% modifications. In some embodiments, the polynucleic acid molecule comprises at least about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, or about 22 or more modifications. In some embodiments, X and Y are independently a single bond, a degradable linker, a non-degradable linker, a cleavable linker, or a non-polymeric linker group. In some embodiments, X is a single bond. In some embodiments, X is a C1-C6 alkyl group. In some embodiments, Y is a C1-C6 alkyl group. In some embodiments, X is a homobifunctional linker or a heterobifunctional linker, optionally conjugated to a C1-C6 alkyl group.In some embodiments, Y is a homobifunctional linker or a heterobifunctional linker. In some embodiments, the binding moiety is an antibody or binding fragment thereof. In some embodiments, C is polyethylene glycol. In some embodiments, AX is conjugated to the 5' end of B and YC is conjugated to the 3' end of B. In some embodiments, YC is conjugated to the 5' end of B and AX is conjugated to the 3' end of B. In some embodiments, AX, YC, or a combination thereof are conjugated to an internucleotide linkage group. In some embodiments, the method further comprises D. In some embodiments, D is conjugated to C or A. In some embodiments, the method further comprises at least a second binding moiety A.

[0012] In certain embodiments, disclosed herein are polynucleic acid molecule conjugate compositions comprising a target cell binding moiety and a targeted pre-mRNA specific splice regulator polynucleic acid moiety, wherein the targeted pre-mRNA specific splice regulator polynucleic acid moiety comprises a sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:54-972. a) comprising the structure of formula (I), AXB Formula I During the ceremony, A comprises a binding moiety, B consists of a polynucleotide, and X consists of a single bond or a first linker; b) comprising the structure of formula (II), AXBYC Formula II During the ceremony, A comprises a binding moiety, B comprises a polynucleotide, C is a polymer; X consists of a single bond or a first linker, and Y consists of a bond or a second linker; or c) comprising the structure of formula (III), AXCYB Formula III During the ceremony, A comprises a binding moiety, B comprises a polynucleotide, C is a polymer; X consists of a single bond or a first linker, and Y consists of a single bond or a second linker. In certain embodiments, the pharmaceutical composition is formulated as a nanoparticle formulation. [Brief description of the drawings]

[0013] [Figure 1] The phosphorodiamidate morpholino oligomer (PMO) sequence with extended terminal nucleotides is depicted (SEQ ID NO:28). [Figure 2A] The phosphorothioate antisense oligonucleotide (PS ASO) sequence with terminal nucleotide extension is depicted (SEQ ID NO:29). [Figure 2B-1] The complete extended phosphorothioate antisense oligonucleotide (PS ASO) sequence (SEQ ID NO:29) is depicted. [Figure 2B-2] The complete extended phosphorothioate antisense oligonucleotide (PS ASO) sequence (SEQ ID NO:29) is depicted. [Figure 2B-3] The complete extended phosphorothioate antisense oligonucleotide (PS ASO) sequence (SEQ ID NO:29) is depicted. [Figure 2B-4] The complete extended phosphorothioate antisense oligonucleotide (PS ASO) sequence (SEQ ID NO:29) is depicted. [Diagram 3] FIG. 1 depicts the method used to quantify skipped DMD mRNA in total RNA using Taqman qPCR. [Figure 4]1 depicts a chromatogram of the produced anti-CD71 mAb-PMO reaction mixture using hydrophobic interaction chromatography (HIC) method 2. [Figure 5A] Chromatograms of produced anti-CD71 mAbs using size exclusion chromatography (SEC) method 1 are depicted. [Figure 5B] 2 depicts a chromatogram of the produced anti-CD71 mAb-PMODAR1,2 using size exclusion chromatography (SEC) method 1. [Figure 5C] 2 depicts a chromatogram of the produced anti-CD71 mAb-PMODAR>2 using size exclusion chromatography (SEC) method 1. [Figure 6A] 2 depicts a chromatogram of the produced anti-CD71 mAb using hydrophobic interaction chromatography (HIC) method 2. [Figure 6B] 2 depicts a chromatogram of purified anti-CD71 mAb-PMODAR1,2 conjugate produced using hydrophobic interaction chromatography (HIC) method 2. [Figure 6C] 2 depicts a chromatogram of purified anti-CD71 mAb-PMODAR>2 conjugate produced using hydrophobic interaction chromatography (HIC) method 2. [Figure 7A] 1 depicts a chromatogram of fast protein liquid chromatography (FPLC) purification of anti-CD71 Fab-PMO using hydrophobic interaction chromatography (HIC) method 3. [Figure 7B] 2 depicts a chromatogram of the produced anti-CD71 Fab using SEC method 1. [Figure 7C] 2 depicts a chromatogram of the produced anti-CD71 Fab-PMO DAR1 conjugate using SEC method 1. [Figure 7D] 2 depicts a chromatogram of the produced anti-CD71 Fab-PMO DAR2 conjugate using SEC method 1. [Figure 7E]2 depicts a chromatogram of the produced anti-CD71 Fab-PMO DAR3 conjugate using SEC method 1. [Figure 7F] Chromatogram of produced anti-CD71 Fab using HIC method 4 is depicted. [Figure 7G] 2 depicts a chromatogram of the produced anti-CD71 Fab-PMO DAR1 conjugate using HIC method 4. [Figure 7H] 2 depicts a chromatogram of the produced anti-CD71 Fab-PMO DAR2 conjugate using HIC method 4. [Figure 7I] 2 depicts a chromatogram of the produced anti-CD71 Fab-PMO DAR3 conjugate using HIC method 4. [Figure 8A] 1 depicts a chromatogram of an anti-CD71 mAb-PS ASO reaction mixture produced using SAX method 2. [Figure 8B] Chromatogram of produced anti-CD71 mAb using SEC method 1 is depicted. [Figure 8C] Chromatogram of the produced anti-CD71 mAb-PS ASO DAR1 conjugate using SEC method 1 is depicted. [Figure 8D] Chromatogram of produced anti-CD71 mAb-PS ASO DAR2 conjugate using SEC method 1 is depicted. [Figure 8E] Chromatogram of produced anti-CD71 mAb-PS ASO DAR3 conjugate using SEC method 1 is depicted. [Figure 8F] Chromatogram of produced anti-CD71 mAb-PS ASO DAR1 conjugate using SAX method 2 is depicted. [Figure 8G] Chromatogram of produced anti-CD71 mAb-PS ASO DAR2 conjugate using SAX method 2 is depicted. [Figure 8H] Chromatogram of produced anti-CD71 mAb-PS ASO DAR3 conjugate using SAX method 2 is depicted. [Figure 9]1 depicts an agarose gel of nested PCR detecting exon 23 skipping in differentiated C2C12 cells using PMO and anti-CD71 mAb-PMO conjugate. [Figure 10] 1 depicts an agarose gel of nested PCR detecting exon 23 skipping in differentiated C2C12 cells using PMO, anti-CD71 mAb-PMO, and anti-CD71 mAb-PMO conjugate. [Figure 11] 1 depicts an agarose gel of nested PCR detecting exon 23 skipping in differentiated C2C12 cells using PMO, ASO, anti-CD71 mAb-ASO conjugated to DAR1 ("ASC-DAR1"), anti-CD71 mAb-ASO conjugated to DAR2 ("ASC-DAR2"), and anti-CD71 mAb-ASO conjugated to DAR3 ("ASC-DAR3"). [Figure 12A] 1 depicts an agarose gel of nested PCR detecting exon 23 skipping in gastrocnemius muscle of wild-type mice receiving a single intravenous injection of anti-CD71 mAb-PMO conjugate. [Figure 12B] 13 is a graph of quantification of PCR products from gastrocnemius muscle. [Figure 12C] FIG. 13 is a graph of quantification of exon skipping in vivo using Taqman qPCR in gastrocnemius muscle from wild type mice. [Figure 13A] 1 depicts an agarose gel of nested PCR detecting exon 23 skipping in wild type mouse cardiac muscle after a single intravenous injection. [Figure 13B] 13 is a graph of quantification of PCR products from cardiac muscle. [Figure 14] Depicts sequencing data of DNA fragments from skipped and wild-type PCR products (SEQ ID NOS 976-977, respectively). [Figure 15A] Quantification of exon skipping in vivo in wild type mice in gastrocnemius muscle using Taqman qPCR. [Figure 15B]FIG. 13 is a graph of quantification of exon skipping in vivo in wild-type mice in gastrocnemius muscle using nested PCR. [Figure 15C] Quantification of in vivo exon skipping in wild type mice in diaphragm muscle using Taqman qPCR. [Figure 15D] 13 is a graph of quantification of in vivo exon skipping in wild type mice in diaphragm muscle using nested PCR. [Figure 15E] Quantification of in vivo exon skipping in wild type mice in cardiac myocardium using Taqman qPCR. [Figure 15F] FIG. 13 is a graph of quantification of in vivo exon skipping in wild type mice in cardiac myocardium using nested PCR. [Figure 16A] Agarose gel of PCR detecting CD71 mAb-PMO conjugate induction of MSTN exon 2 skipping in diaphragm muscle tissue in wild-type mice after a single intravenous (iv) injection. [Figure 16B] Agarose gel of PCR detecting CD71 mAb-PMO conjugate induction of MSTN exon 2 skipping in cardiac muscle tissue in wild type mice after a single intravenous (iv) injection. [Figure 16C] Agarose gel of PCR detecting CD71 mAb-PMO conjugate induction of MSTN exon 2 skipping in gastrocnemius tissue in wild-type mice after a single intravenous (iv) injection. [Figure 17] Agarose gel of PCR detecting ASGPR mAb-PMO conjugate induction of PAH exon 11 skipping in primary mouse hepatocytes. [Figure 18] Agarose gel of PCR detecting ASGPR mAb-PMO conjugate induction of PAH exon 11 skipping in wild type mouse liver after a single intravenous (iv) injection. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0014] Nucleic acid (e.g., RNAi) therapy is a targeted therapy that boasts high selectivity and specificity. However, in some cases, nucleic acid therapy is also hindered by poor cellular uptake, insufficient intracellular concentration in target cells, and low efficacy. To address these issues, various modifications of nucleic acid compositions are being explored, such as novel linkers for better stabilization and / or lower toxicity, optimization of binding moieties for increased target specificity and / or targeted delivery, and nucleic acid polymer modifications for increased stability and / or reduced off-target effects.

[0015] In some examples, one such area that oligonucleotides are used is for treating muscular dystrophy.Muscular dystrophy encompasses a number of diseases that affect muscle.Duchenne muscular dystrophy is a severe form of muscular dystrophy, and is caused by mutation in DMD gene.In some examples, mutation in DMD gene disrupts translation reading frame, resulting in non-functional dystrophin protein.

[0016] In some embodiments, methods and compositions related to nucleic acid therapy for inducing insertions, deletions, duplications, or modifications of mis-spliced ​​mRNA transcripts to induce exon skipping or exon inclusion used to restore the translation reading frame. Also described herein in some embodiments are methods and compositions for treating diseases or disorders characterized by mis-processed mRNA transcripts, where after removal of the exon, the mRNA can code for a functional protein, thereby treating the disease or disorder. In further embodiments, described herein are pharmaceutical compositions and kits for treating the above diseases or disorders.

[0017] RNA processing RNA has a central role in regulating gene expression and cell physiology. Proper processing of RNA is important for the translation of functional proteins. Alterations in RNA processing, such as the result of incorrect splicing of RNA, can result in disease. For example, mutations in splice sites can result in exposure of premature stop codons, loss of exons, or inclusion of introns. In some instances, alterations in RNA processing result in insertions, deletions, or duplications. In some instances, alterations in RNA processing result in insertions, deletions, or duplications of exons. Alterations in RNA processing can result in insertions, deletions, or duplications of introns, in some cases.

[0018] Alternative transcription or splicing events include, but are not limited to, exon skipping, alternative 3' splice site selection, alternative 5' splice site selection, intron retention, mutually exclusive exons, alternative promoter usage, and alternative polyadenylation. In some embodiments, a splicing event results in the insertion, deletion, or duplication of an exon, for example, by exon skipping or exon inclusion.

[0019] Exon skipping Exon skipping is a form of RNA splicing. In some cases, exon skipping occurs when an exon is skipped in or spliced ​​out of processed mRNA. As a result of exon skipping, the processed mRNA does not contain the skipped exon. In some cases, exon skipping results in the expression of a modified product.

[0020] In some instances, antisense oligonucleotides (AONs) are used to induce exon skipping. In some instances, AONs are short nucleic acid sequences that bind to specific mRNA or pre-mRNA sequences. For example, AONs bind to splice sites or exon enhancers. In some instances, binding of AONs to specific mRNA or pre-mRNA sequences generates a double-stranded region. In some instances, the formation of the double-stranded region occurs at a location where the spliceosome or spliceosome-associated proteins would normally bind, resulting in exon skipping. In some instances, exon skipping results in restoration of the transcript reading frame, allowing for the production of a partially functional protein.

[0021] Exon inclusion In some instances, the mutation in the RNA results in exon skipping. In some instances, the mutation is at least one of a splice site, near a splice site, and at a distance from a splice site. In some instances, the mutation results in at least one of inactivating or weakening a splice site, destroying an exon splice enhancer or an intron splice enhancer, and creating an exon splice silencer or an intron splice enhancer. In some instances, the mutation alters the RNA secondary structure. In some instances, the mutation alters the RNA secondary structure, causing disruption of the accessibility of signals important for exon recognition.

[0022] In some instances, the use of AONs results in inclusion of a skipped exon. In some instances, the AONs bind to at least one of a splice site, a site near a splice site, and a site distant from a splice site. In some instances, the AONs bind to a site in the RNA to prevent destruction of an exon splice enhancer or an intron splice enhancer. In some instances, the AONs bind to a site in the RNA to prevent generation of an exon splice silencer or an intron splice silencer.

[0023] Intron Retention In some instances, the mutation in the RNA results in intron retention. Intron retention results in an intron remaining in the mature mRNA transcript. In some instances, the presence of the retained intron prevents or reduces translation of a functional protein. In some instances, intron retention occurs in coding regions, non-coding regions, the 5'UTR, or the 3'UTR. When intron retention occurs in coding regions, in some instances the retained intron encodes an in-frame or out-of-frame amino acid, which generates a truncated or non-functional protein with a stop codon or frameshift. In some instances, the intron is retained between two exons located in the 5'UTR or in the 3'UTR.

[0024] In some examples, AONs are used to hybridize partially processed mRNA to initiate removal of retained introns. In some examples, AONs hybridize to intron splicing enhancers or intron splicing silencers. In some examples, AONs hybridize at or away from the 5' splice site, at or away from the 3' splice site, at or away from the branch site, at or away from the branch site, at or away from the polypyrimidine tract, at or away from the intron silencer site, at or away from the cryptic intron splice site, at or away from the cryptic intron splice site, at or away from the pseudo splice site, or at or away from the intron enhancer of the intron. In some instances, the AON hybridizes to an internal region of an intron.

[0025] Symptoms In some embodiments, the polynucleic acid molecules or pharmaceutical compositions described herein are used to treat diseases or disorders characterized by defective mRNA. In some embodiments, the polynucleic acid molecules or pharmaceutical compositions described herein are used to treat diseases or disorders by inducing insertions, deletions, duplications, or modifications of misspliced ​​mRNA transcripts to induce splicing events. In some embodiments, the splicing events are exon skipping or exon inclusion. In some embodiments, the splicing events are intron retention.

[0026] In some embodiments, the polynucleic acid molecules or pharmaceutical compositions described herein are used to treat a disease or disorder by inducing insertions, deletions, duplications, or modifications of misspliced ​​mRNA transcripts to induce exon skipping or exon inclusion.

[0027] The majority of human protein-coding genes are alternatively spliced. In some instances, the mutation causes an inappropriately spliced ​​or partially spliced ​​mRNA. For example, the mutation is in at least one of the splice sites in the protein-coding gene, a silencer or enhancer sequence, an exon sequence, or an intron sequence. In some instances, the mutation causes gene dysfunction. In some instances, the mutation causes a disease or disorder.

[0028] In some examples, diseases or disorders resulting from improperly spliced ​​or partially spliced ​​mRNA include, but are not limited to, neuromuscular diseases, genetic diseases, cancer, inherited diseases, or cardiovascular diseases.

[0029] In some examples, the genetic disease or disorder comprises an autosomal dominant disorder, an autosomal recessive disorder, an X-linked dominant disorder, an X-linked recessive disorder, a Y-linked disorder, a mitochondrial genetic disorder, or a multifactorial or multigenic disorder.

[0030] In some instances, cardiovascular diseases such as hypercholesterolemia result from improperly spliced ​​or partially spliced ​​mRNA. In hypercholesterolemia, a single nucleotide polymorphism in exon 12 of the low-density lipoprotein receptor (LDLR) has been shown to promote exon skipping.

[0031] In some instances, improperly spliced ​​or partially spliced ​​mRNA causes cancer. For example, improperly spliced ​​or partially spliced ​​mRNA affects cellular processes involved in cancer, including but not limited to proliferation, motility, and drug response. In some instances, the cancer is a solid cancer or a hematological cancer. In some instances, the cancer is bladder cancer, lung cancer, brain cancer, melanoma, breast cancer, non-Hodgkin's lymphoma, cervical cancer, ovarian cancer, colon cancer, pancreatic cancer, esophageal cancer, prostate cancer, kidney cancer, skin cancer, leukemia, thyroid cancer, liver cancer, or uterine cancer.

[0032] In some cases, improperly spliced ​​or partially spliced ​​mRNA causes neuromuscular disease or disorder. Exemplary neuromuscular diseases include muscular dystrophies such as Duchenne muscular dystrophy, Becker muscular dystrophy, facioscapulohumeral muscular dystrophy, congenital muscular dystrophy, or myotonic dystrophy. In some cases, muscular dystrophy is genetic. In some cases, muscular dystrophy is caused by spontaneous mutation. Becker muscular dystrophy and Duchenne muscular dystrophy have been shown to be associated with mutations in the DMD gene, which encodes the protein dystrophin. Facioscapulohumeral muscular dystrophy has been shown to be associated with mutations in the double homeobox 4 (DUX4) gene.

[0033] In some instances, improperly spliced ​​or partially spliced ​​mRNA causes Duchenne muscular dystrophy. Duchenne muscular dystrophy is caused by a mutation in the DMD gene that causes severe muscle weakness and abolishes the production of functional dystrophin. In some instances, Duchenne muscular dystrophy is the result of a mutation in an exon in the DMD gene. In some instances, Duchenne muscular dystrophy is the result of a mutation in at least one of exons 1, 2, 3, 4, 5, 6, 7, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, and 79 in the DMD gene. In some instances, Duchenne muscular dystrophy is the result of a mutation in at least one of exons 3, 4, 5, 6, 7, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, and 63 in the DMD gene. In some instances, Duchenne muscular dystrophy is the result of a mutation in at least one of exons 8, 23, 35, 43, 44, 45, 50, 51, 52, 53, and 55 in the DMD gene. In some instances, multiple exons are mutated. For example, mutations in exons 48-50 are common in patients with Duchenne muscular dystrophy. In some instances, Duchenne muscular dystrophy is the result of a mutation in exon 51. In some instances, Duchenne muscular dystrophy is the result of a mutation in exon 23. In some instances, the mutation involves an exon deletion. In some instances, the mutation involves an exon duplication. In some instances, the mutation involves an exon point mutation.For example, some patients have been shown to harbor nonsense point mutations in exon 51 of the DMD gene.

[0034] In some examples, the polynucleic acid molecules or pharmaceutical compositions described herein are used to treat muscular dystrophy. In some examples, the polynucleic acid molecules or pharmaceutical compositions described herein are used to treat Duchenne muscular dystrophy, Becker muscular dystrophy, facioscapulohumeral muscular dystrophy, congenital muscular dystrophy, or myotonic dystrophy. In some examples, the polynucleic acid molecules or pharmaceutical compositions described herein are used to treat Duchenne muscular dystrophy.

[0035] Polynucleic acid molecule In some embodiments, polynucleic acid molecules are described herein that induce insertions, deletions, duplications, or modifications of misspliced ​​mRNA transcripts to induce exon skipping or exon inclusion. In some examples, the polynucleic acid molecules restore the translation reading frame. In some examples, the polynucleic acid molecules result in functional, truncated proteins.

[0036] In some examples, the polynucleic acid molecule targets an mRNA sequence. In some examples, the polynucleic acid molecule targets a splice site. In some examples, the polynucleic acid molecule targets a cis-regulatory element. In some examples, the polynucleic acid molecule targets a trans-regulatory element. In some examples, the polynucleic acid molecule targets an exon splice enhancer or an intron splice enhancer. In some examples, the polynucleic acid molecule targets an exon splice silencer or an intron splice silencer.

[0037] In some examples, the polynucleic acid molecule targets a sequence found in an intron or exon. For example, the polynucleic acid molecule targets a sequence found in an exon that mediates the splicing of said exon. In some examples, the polynucleic acid molecule targets an exon recognition sequence. In some examples, the polynucleic acid molecule targets a sequence upstream of an exon. In some examples, the polynucleic acid molecule targets a sequence downstream of an exon.

[0038] As described above, the polynucleic acid molecules target misprocessed mRNA transcripts that result in a disease or disorder, such as, but not limited to, a neuromuscular disease, a genetic disease, a cancer, a hereditary disease, or a cardiovascular disease.

[0039] In some examples, the polynucleic acid molecule targets an exon that is mutated in a gene that causes a disease or disorder. Exemplary diseases or disorders include, but are not limited to, familial autonomic failure (FD), spinal muscular atrophy (SMA), medium-chain acyl-CoA dehydrogenase (MCAD) deficiency, Hutchinson-Gilford progeria syndrome (HGPS), myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2 (DM2), autosomal dominant retinitis pigmentosa (RP), Duchenne muscular dystrophy (DMD), microcephalic steodysplastic primordial dwarfism type 1 (MOPD1) (Taybi-Linder syndrome (TALS)), frontotemporal dementia with Parkinsonism-17 (FTDP-17), Fukuyama congenital muscular dystrophy (FCMD), amyotrophic lateral sclerosis (ALS), hypercholesterolemia, and cystic fibrosis (CF). Exemplary genes involved in a disease or disorder include, but are not limited to, IKBKAP, SMN2, MCAD, LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, LDLR, CFTR, DMD, PAH, MSTN, and K-Ras. In some embodiments, the gene is DMD, PAH, MSTN, or K-Ras.

[0040] In some examples, the polynucleic acid molecules described herein target a region at an exon-intron junction of an exon of a disease or disorder-causing gene. In some embodiments, the gene is IKBKAP, SMN2, MCAD, LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, LDLR, CFTR, DMD, PAH, MSTN, or K-Ras. In some embodiments, the polynucleic acid molecules described herein target a region at an exon-intron junction of exon 1, 2, or 3 of MSTN. In some embodiments, the polynucleic acid molecules described herein target a region at an exon-intron junction of exon 2 of MSTN. In some embodiments, the polynucleic acid molecules described herein target a region at the exon-intron junction of exon 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 of PAH. In some embodiments, the polynucleic acid molecules described herein target a region at the exon-intron junction of exon 11 of PAH.

[0041] In some examples, the polynucleic acid molecule hybridizes to a target region at either a 5' intron-exon junction or a 3' exon-intron junction of at least one exon of a disease or disorder causing gene. In some embodiments, the gene is IKBKAP, SMN2, MCAD, LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, LDLR, CFTR, DMD, PAH, MSTN, or K-Ras. In some embodiments, the polynucleic acid molecule described herein targets either a 5' intron-exon junction or a 3' exon-intron junction of exon 1, 2, or 3 of MSTN. In some embodiments, the polynucleic acid molecule described herein targets a region at either a 5' intron-exon junction or a 3' exon-intron junction of exon 2 of MSTN. In some embodiments, the polynucleic acid molecules described herein target a region that is either a 5' intron-exon junction or a 3' exon-intron junction of exons 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 of PAH. In some embodiments, the polynucleic acid molecules described herein target a region that is either a 5' intron-exon junction or a 3' exon-intron junction of exon 11 of PAH.

[0042] In some cases, the polynucleic acid molecule hybridizes to a target region at the 5' intron-exon junction of at least one exon of a gene causing a disease or disorder. In some embodiments, the gene is IKBKAP, SMN2, MCAD, LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, LDLR, CFTR, DMD, PAH, MSTN, or K-Ras. In some embodiments, the polynucleic acid molecule described herein targets a region at the 5' intron-exon junction of exon 1, 2, or 3 of MSTN. In some embodiments, the polynucleic acid molecule described herein targets a region at the 5' intron-exon junction of exon 2 of MSTN. In some embodiments, the polynucleic acid molecules described herein target a region at the 5' intron-exon junction of exon 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 of PAH. In some embodiments, the polynucleic acid molecules described herein target a region at the 5' intron-exon junction of exon 11 of PAH.

[0043] In some cases, the polynucleic acid molecule hybridizes to a target region at the 3' exon-intron junction of at least one exon of a disease or disorder causing gene. In some embodiments, the gene is IKBKAP, SMN2, MCAD, LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, LDLR, CFTR, DMD, PAH, MSTN, or K-Ras. In some embodiments, the polynucleic acid molecule described herein targets a region at the 3' exon-intron junction of exon 1, 2, or 3 of MSTN. In some embodiments, the polynucleic acid molecule described herein targets a region at the 3' exon-intron junction of exon 2 of MSTN. In some embodiments, the polynucleic acid molecules described herein target a region at the 3' exon-intron junction of exon 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 of PAH. In some embodiments, the polynucleic acid molecules described herein target a region at the 3' exon-intron junction of exon 11 of PAH.

[0044] In some cases, the polynucleic acid molecules described herein target the splice site of an exon of a gene causing a disease or disorder. In some embodiments, the gene is IKBKAP, SMN2, MCAD, LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, LDLR, CFTR, DMD, PAH, MSTN, or K-Ras. In some embodiments, the polynucleic acid molecules described herein target the splice site of exon 1, 2, or 3 of MSTN. In some embodiments, the polynucleic acid molecules described herein target the splice site of exon 2 of MSTN. In some embodiments, the polynucleic acid molecules described herein target the splice site of exon 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 of PAH. In some embodiments, the polynucleic acid molecules described herein target a splice site in exon 11 of PAH. As used herein, a splice site includes a canonical splice site, a cryptic splice site, or an alternative splice site that can induce insertions, deletions, duplications, or modifications of a misspliced ​​mRNA transcript to induce exon skipping or exon inclusion.

[0045] In some examples, the polynucleic acid molecules described herein target a region that is at least 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt, 200 nt, 100 nt, 80 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 5 nt upstream of an exon of a disease or disorder-causing gene. In some embodiments, the gene is IKBKAP, SMN2, MCAD, LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, LDLR, CFTR, DMD, PAH, MSTN, or K-Ras. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000nt, 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or 5nt upstream of (or from the 5' of) exon 1, 2, or 3 of the MSTN gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000nt, 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or 5nt upstream of (or from the 5' of) exon 2 of the MSTN gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000nt, 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or 5nt upstream of (or from the 5' of) exon 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 of the PAH gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000nt, 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or 5 nt upstream of (or from the 5' of) exon 11 of the PAH gene.

[0046] In some examples, the polynucleic acid molecule hybridizes to a target region that is upstream (or 5') of at least one exon of a gene that causes a disease or disorder. In some embodiments, the gene is IKBKAP, SMN2, MCAD, LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, LDLR, CFTR, DMD, PAH, MSTN, or K-Ras. In some examples, the polynucleic acid molecule hybridizes to a target region that is upstream (or 5') of at least one exon 1, 2, or 3 of the MSTN gene. In some examples, the polynucleic acid molecule hybridizes to a target region that is about 5, 10, 15, 20, 50, 100, 200, 300, 400, or 500 bp upstream (or 5') of at least one exon 2 of the MSTN gene. In some examples, the polynucleic acid molecule hybridizes to a target region that is upstream (5') of at least one of exons 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 of the PAH gene. In some examples, the polynucleic acid molecule hybridizes to a target region that is about 5, 10, 15, 20, 50, 100, 200, 300, 400, or 500 bp upstream (or 5') of at least one of exons 11 of the PAH gene.

[0047] In some examples, the polynucleic acid molecules described herein target a region that is at least 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt, 200 nt, 100 nt, 80 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 5 nt downstream of (or 3' from) an exon of a disease or disorder-causing gene. In some embodiments, the gene is IKBKAP, SMN2, MCAD, LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, LDLR, CFTR, DMD, PAH, MSTN, or K-Ras. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt, 200 nt, 100 nt, 80 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 3 nt downstream of (or from the 5' of) exon 1, 2, or 3 of the MSTN gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt, 200 nt, 100 nt, 80 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 5 nt downstream of (or from the 3' of) exon 2 of the MSTN gene. In some examples, the polynucleic acid molecules described herein target a region at least 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt, 200 nt, 100 nt, 80 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 5 nt downstream of (or 3' from) exon 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 of the PAH gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt, 200 nt, 100 nt, 80 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 5 nt downstream of (or 3' from) exon 11 of the PAH gene.

[0048] In some examples, the polynucleic acid molecule hybridizes to a target region that is downstream (or 3') of at least one exon of a gene that causes a disease or disorder. In some embodiments, the gene is IKBKAP, SMN2, MCAD, LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, LDLR, CFTR, DMD, PAH, MSTN, or K-Ras. In some examples, the polynucleic acid molecule hybridizes to a target region that is about 5, 10, 15, 20, 50, 100, 200, 300, 400, or 500 bp downstream (or 3') of at least one exon 1, 2, or 3 of the MSTN gene. In some examples, the polynucleic acid molecule hybridizes to a target region that is about 5, 10, 15, 20, 50, 100, 200, 300, 400, or 500 bp downstream (or 3') of at least one exon 2 of the MSTN gene. In some examples, the polynucleic acid molecule hybridizes to a target region that is about 5, 10, 15, 20, 50, 100, 200, 300, 400, or 500 bp downstream (or 3') of at least one of exons 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 of the PAH gene. In some examples, the polynucleic acid molecule hybridizes to a target region that is about 5, 10, 15, 20, 50, 100, 200, 300, 400, or 500 bp downstream (or 3') of at least one of exon 11 of the PAH gene.

[0049] In some examples, the polynucleic acid molecules described herein target an internal region within an exon of a gene causing a disease or disorder. In some embodiments, the gene is IKBKAP, SMN2, MCAD, LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, LDLR, CFTR, DMD, PAH, MSTN, or K-Ras. In some examples, the polynucleic acid molecules described herein target an internal region within exon 1, 2, or 3 of the MSTN gene. In some examples, the polynucleic acid molecules described herein target an internal region within exon 2 of the MSTN gene. In some examples, the polynucleic acid molecules described herein target an internal region within region 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 of the PAH gene. In some examples, the polynucleic acid molecules described herein target an internal region within exon 11 of the PAH gene.

[0050] In some cases, the polynucleic acid molecule targets the misprocessed mRNA transcripts that cause neuromuscular disease or disorder.In some cases, the neuromuscular disease or disorder is Duchenne muscular dystrophy, Becker muscular dystrophy, facioscapulohumeral muscular dystrophy, congenital muscular dystrophy, or myotonic dystrophy.In some cases, the polynucleic acid molecule targets the misprocessed mRNA transcripts that cause Duchenne muscular dystrophy, Becker muscular dystrophy, facioscapulohumeral muscular dystrophy, congenital muscular dystrophy, or myotonic dystrophy.In some cases, the polynucleic acid molecule targets the misprocessed mRNA transcripts that cause Duchenne muscular dystrophy.

[0051] In some examples, the polynucleic acid molecule targets the exon that mutates in the DMD gene that causes Duchenne muscular dystrophy.In some examples, the typical exon that mutates in the DMD gene that causes Duchenne muscular dystrophy includes, but is not limited to, exon 3, 4, 5, 6, 7, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62 and 63.In some examples, the polynucleic acid molecule targets the sequence adjacent to the mutated exon. For example, if there is a deletion of exon 50, the polynucleic acid molecule targets a sequence in exon 51 such that exon 51 is skipped. In another example, if there is a mutation in exon 23, the polynucleic acid molecule targets a sequence in exon 22 such that exon 23 is skipped.

[0052] In some examples, the polynucleic acid molecules described herein target a region at an exon-intron junction of exon 3, 4, 5, 6, 7, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, or 63 of the DMD gene. In some examples, the polynucleic acid molecules described herein target a region at an exon-intron junction of exon 8, 23, 35, 43, 44, 45, 50, 51, 52, 53, or 55 of the DMD gene. In some cases, the polynucleic acid molecules described herein target a region at the exon-intron junction of exon 8 of the DMD gene. In some cases, the polynucleic acid molecules described herein target a region at the exon-intron junction of exon 23 of the DMD gene. In some cases, the polynucleic acid molecules described herein target a region at the exon-intron junction of exon 35 of the DMD gene. In some cases, the polynucleic acid molecules described herein target a region at the exon-intron junction of exon 43 of the DMD gene. In some cases, the polynucleic acid molecules described herein target a region at the exon-intron junction of exon 44 of the DMD gene. In some cases, the polynucleic acid molecules described herein target a region at the exon-intron junction of exon 45 of the DMD gene. In some cases, the polynucleic acid molecules described herein target a region at the exon-intron junction of exon 48 of the DMD gene. In some cases, the polynucleic acid molecules described herein target a region at the exon-intron junction of exon 49 of the DMD gene. In some cases, the polynucleic acid molecules described herein target a region at the exon-intron junction of exon 50 of the DMD gene.In some cases, the polynucleic acid molecules described herein target a region at the exon-intron junction of exon 51 of the DMD gene. In some cases, the polynucleic acid molecules described herein target a region at the exon-intron junction of exon 52 of the DMD gene. In some cases, the polynucleic acid molecules described herein target a region at the exon-intron junction of exon 53 of the DMD gene. In some cases, the polynucleic acid molecules described herein target a region at the exon-intron junction of exon 55 of the DMD gene.

[0053] In some examples, the polynucleic acid molecule hybridizes to a target region at a 5' intron-exon junction or a 3' exon-intron junction of at least one of exons 3, 4, 5, 6, 7, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, and 63 of the DMD gene. In some examples, the polynucleic acid molecule hybridizes to a target region at a 5' intron-exon junction or a 3' exon-intron junction of exon 8, 23, 35, 43, 44, 45, 50, 51, 52, 53, or 55 of the DMD gene.

[0054] In some cases, the polynucleic acid molecule hybridizes to a target region at a 5' intron-exon junction of at least one of exons 3, 4, 5, 6, 7, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, and 63 of the DMD gene. In some cases, the polynucleic acid molecule hybridizes to a target region located at a 5' intron-exon junction of exon 8, 23, 35, 43, 44, 45, 50, 51, 52, 53, or 55 of the DMD gene. In some cases, the polynucleic acid molecule hybridizes to a target region located at a 5' intron-exon junction of exon 8 of the DMD gene. In some cases, the polynucleic acid molecule hybridizes to a target region located at a 5' intron-exon junction of exon 23 of the DMD gene. In some cases, the polynucleic acid molecule hybridizes to a target region located at a 5' intron-exon junction of exon 35 of the DMD gene. In some cases, the polynucleic acid molecule hybridizes to a target region located at a 5' intron-exon junction of exon 43 of the DMD gene. In some cases, the polynucleic acid molecule hybridizes to a target region located at the 5' intron-exon junction of exon 44 of the DMD gene. In some cases, the polynucleic acid molecule hybridizes to a target region located at the 5' intron-exon junction of exon 45 of the DMD gene. In some cases, the polynucleic acid molecule hybridizes to a target region located at the 5' intron-exon junction of exon 50 of the DMD gene. In some cases, the polynucleic acid molecule hybridizes to a target region located at the 5' intron-exon junction of exon 51 of the DMD gene. In some cases, the polynucleic acid molecule hybridizes to a target region located at the 5' intron-exon junction of exon 52 of the DMD gene. In some cases, the polynucleic acid molecule hybridizes to a target region located at the 5' intron-exon junction of exon 53 of the DMD gene.In some cases, the polynucleic acid molecule hybridizes to a target region located at the 5' intron-exon junction of exon 55 of the DMD gene.

[0055] In some cases, the polynucleic acid molecule hybridizes to a target region at a 3' exon-intron junction of at least one of exons 3, 4, 5, 6, 7, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, and 63 of the DMD gene. In some cases, the polynucleic acid molecule hybridizes to a target region located at the 3' exon-intron junction of exon 8, 23, 35, 43, 44, 45, 50, 51, 52, 53, or 55 of the DMD gene. In some cases, the polynucleic acid molecule hybridizes to a target region located at the 3' exon-intron junction of exon 8 of the DMD gene. In some cases, the polynucleic acid molecule hybridizes to a target region located at the 3' exon-intron junction of exon 23 of the DMD gene. In some cases, the polynucleic acid molecule hybridizes to a target region located at the 3' exon-intron junction of exon 35 of the DMD gene. In some cases, the polynucleic acid molecule hybridizes to a target region located at the 3' exon-intron junction of exon 43 of the DMD gene. In some cases, the polynucleic acid molecule hybridizes to a target region located at the 3' exon-intron junction of exon 44 of the DMD gene. In some cases, the polynucleic acid molecule hybridizes to a target region located at the 3' exon-intron junction of exon 45 of the DMD gene. In some cases, the polynucleic acid molecule hybridizes to a target region located at the 3' exon-intron junction of exon 50 of the DMD gene. In some cases, the polynucleic acid molecule hybridizes to a target region located at the 3' exon-intron junction of exon 51 of the DMD gene. In some cases, the polynucleic acid molecule hybridizes to a target region located at the 3' exon-intron junction of exon 52 of the DMD gene. In some cases, the polynucleic acid molecule hybridizes to a target region located at the 3' exon-intron junction of exon 53 of the DMD gene.In some cases, the polynucleic acid molecule hybridizes to a target region located at the 3' exon-intron junction of exon 55 of the DMD gene.

[0056] In some examples, the polynucleic acid molecules described herein target the splice sites of exons 3, 4, 5, 6, 7, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, or 63 of the DMD gene. In some examples, the polynucleic acid molecules described herein target the splice sites of exons 8, 23, 35, 43, 44, 45, 50, 51, 52, 53, or 55 of the DMD gene. In some cases, the polynucleic acid molecules described herein target the splice site of exon 8 of the DMD gene. In some cases, the polynucleic acid molecules described herein target the splice site of exon 23 of the DMD gene. In some cases, the polynucleic acid molecules described herein target the splice site of exon 35 of the DMD gene. In some cases, the polynucleic acid molecules described herein target the splice site of exon 43 of the DMD gene. In some cases, the polynucleic acid molecules described herein target the splice site of exon 44 of the DMD gene. In some cases, the polynucleic acid molecules described herein target the splice site of exon 45 of the DMD gene. In some cases, the polynucleic acid molecules described herein target the splice site of exon 48 of the DMD gene. In some cases, the polynucleic acid molecules described herein target the splice site of exon 49 of the DMD gene. In some cases, the polynucleic acid molecules described herein target the splice site of exon 50 of the DMD gene. In some cases, the polynucleic acid molecules described herein target the splice site of exon 51 of the DMD gene. In some cases, the polynucleic acid molecules described herein target the splice site of exon 52 of the DMD gene. In some cases, the polynucleic acid molecules described herein target the splice site of exon 53 of the DMD gene. In some cases, the polynucleic acid molecules described herein target the splice site of exon 55 of the DMD gene.As used herein, a splice site includes canonical, cryptic, or alternative splice sites that can induce insertions, deletions, duplications, or modifications of a misspliced ​​mRNA transcript to induce exon skipping or exon inclusion.

[0057] In some embodiments, the polynucleic acid molecule targets a partially spliced ​​mRNA sequence that contains additional exons involved in Duchenne muscular dystrophy, such as exons 3, 4, 5, 6, 7, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, or 63.

[0058] In some examples, the polynucleic acid molecules described herein target a region at least 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt, 200 nt, 100 nt, 80 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 5 nt upstream (or 5') of exon 3, 4, 5, 6, 7, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, or 63 of the DMD gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000nt, 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or 5nt upstream of (or from the 5' of) exon 8, 23, 35, 43, 44, 45, 50, 51, 52, 53, or 55 of the DMD gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000nt, 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or 5nt upstream of (or from the 5' of) exon 8 of the DMD gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000nt, 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or 5nt upstream of (or from the 5' of) exon 23 of the DMD gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000nt, 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or 5 nt upstream of (or from the 5' of) exon 35 of the DMD gene.In some examples, the polynucleic acid molecules described herein target a region that is at least 1000nt, 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or 5nt upstream of (or from the 5' of) exon 43 of the DMD gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000nt, 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or 5nt upstream of (or from the 5' of) exon 44 of the DMD gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000nt, 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or 5 nt upstream of (or from the 5' of) exon 45 of the DMD gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000 nucleotides (nt), 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or 5 nt upstream of (or from the 5' of) exon 48 of the DMD gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt, 200 nt, 100 nt, 80 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 5 nt upstream of (or from the 5' of) exon 49 of the DMD gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt, 200 nt, 100 nt, 80 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 5 nt upstream of (or from the 5' of) exon 50 of the DMD gene.In some examples, the polynucleic acid molecules described herein target a region that is at least 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt, 200 nt, 100 nt, 80 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 5 nt upstream of (or from 5') exon 51 of the DMD gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt, 200 nt, 100 nt, 80 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 5 nt upstream of (or from 5') exon 52 of the DMD gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000nt, 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or 5nt upstream of (or from 5') exon 53 of the DMD gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000nt, 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or 5nt upstream of (or from 5') exon 55 of the DMD gene.

[0059] In some examples, the polynucleic acid molecule hybridizes to a target region that is upstream (or 5') of at least one of exons 3, 4, 5, 6, 7, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, and 63 of the DMD gene. In some examples, the polynucleic acid molecule hybridizes to a target region that is upstream (or 5') of at least one of exons 8, 23, 35, 43, 44, 45, 50, 51, 52, 53, or 55 of the DMD gene. In some examples, the polynucleic acid molecule hybridizes to a target region that is about 5, 10, 15, 20, 50, 100, 200, 300, 400, or 500 bp upstream (or 5') of at least one of exons 3, 4, 5, 6, 7, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, and 63 of the DMD gene.

[0060] In some examples, the polynucleic acid molecules described herein target a region at least 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt, 200 nt, 100 nt, 80 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 5 nt downstream (or 3') of exon 3, 4, 5, 6, 7, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, or 63 of the DMD gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000 nucleotides (nt), 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or 5 nt downstream of (or from the 3' of) exon 8, 23, 35, 43, 44, 45, 50, 51, 52, 53, or 55 of the DMD gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000 nucleotides (nt), 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or 5 nt downstream of (or from the 3' of) exon 8 of the DMD gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt, 200 nt, 100 nt, 80 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 5 nt downstream of (or 3' from) exon 23 of the DMD gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt, 200 nt, 100 nt, 80 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 5 nt downstream of (or 3' from) exon 35 of the DMD gene.In some examples, the polynucleic acid molecules described herein target a region that is at least 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt, 200 nt, 100 nt, 80 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 5 nt downstream of (or from the 3' of) exon 43 of the DMD gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt, 200 nt, 100 nt, 80 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 5 nt downstream of (or from the 3' of) exon 44 of the DMD gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt, 200 nt, 100 nt, 80 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 5 nt downstream of (or 3' from) exon 45 of the DMD gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt, 200 nt, 100 nt, 80 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 5 nt downstream of (or 3' from) exon 48 of the DMD gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt, 200 nt, 100 nt, 80 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 5 nt downstream of (or from the 3' of) exon 49 of the DMD gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt, 200 nt, 100 nt, 80 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 5 nt downstream of (or from the 3' of) exon 50 of the DMD gene.In some examples, the polynucleic acid molecules described herein target a region that is at least 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt, 200 nt, 100 nt, 80 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 5 nt downstream of (or 3' from) exon 51 of the DMD gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt, 200 nt, 100 nt, 80 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 5 nt downstream of (or 3' from) exon 52 of the DMD gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt, 200 nt, 100 nt, 80 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 5 nt downstream of (or from the 3' of) exon 53 of the DMD gene. In some examples, the polynucleic acid molecules described herein target a region that is at least 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt, 200 nt, 100 nt, 80 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 5 nt downstream of (or from the 3' of) exon 55 of the DMD gene.

[0061] In some examples, the polynucleic acid molecule hybridizes to a target region that is downstream (or 3') of at least one of exons 3, 4, 5, 6, 7, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, and 63 of the DMD gene. In some examples, the polynucleic acid molecule hybridizes to a target region that is about 5, 10, 15, 20, 50, 100, 200, 300, 400, or 500 bp downstream (or 5') of at least one of exons 3, 4, 5, 6, 7, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, and 63 of the DMD gene. In some examples, the polynucleic acid molecule hybridizes to a target region that is about 5, 10, 15, 20, 50, 100, 200, 300, 400, or 500 bp downstream (or 3') of at least one of exons 8, 23, 35, 43, 44, 45, 50, 51, 52, 53, or 55 of the DMD gene.

[0062] In some examples, the polynucleic acid molecules described herein target an internal region within exon 3, 4, 5, 6, 7, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, or 63 of the DMD gene. In some examples, the polynucleic acid molecules described herein target an internal region within exon 8, 23, 35, 43, 44, 45, 50, 51, 52, 53, or 55 of the DMD gene. In some examples, the polynucleic acid molecules described herein target an internal region within exon 8 of the DMD gene. In some examples, the polynucleic acid molecules described herein target an internal region within exon 23 of the DMD gene. In some examples, the polynucleic acid molecules described herein target an internal region within exon 35 of the DMD gene. In some examples, the polynucleic acid molecules described herein target an internal region within exon 43 of the DMD gene. In some examples, the polynucleic acid molecules described herein target an internal region within exon 44 of the DMD gene. In some examples, the polynucleic acid molecules described herein target an internal region within exon 45 of the DMD gene. In some examples, the polynucleic acid molecules described herein target an internal region within exon 48 of the DMD gene. In some examples, the polynucleic acid molecules described herein target an internal region within exon 49 of the DMD gene. In some examples, the polynucleic acid molecules described herein target an internal region within exon 50 of the DMD gene. In some examples, the polynucleic acid molecules described herein target an internal region within exon 51 of the DMD gene. In some examples, the polynucleic acid molecules described herein target an internal region within exon 52 of the DMD gene. In some examples, the polynucleic acid molecules described herein target an internal region within exon 53 of the DMD gene. In some examples, the polynucleic acid molecules described herein target an internal region within exon 55 of the DMD gene.

[0063] In some examples, the polynucleic acid molecule hybridizes to a target region that is within at least one of exons 3, 4, 5, 6, 7, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, and 63 of the DMD gene. In some examples, the polynucleic acid molecule hybridizes to a target region that is within at least one of exons 8, 23, 35, 43, 44, 45, 50, 51, 52, 53, or 55 of the DMD gene.

[0064] In some embodiments, the polynucleic acid molecules described herein target a partially spliced ​​mRNA sequence that includes exon 51. In some examples, the polynucleic acid molecule hybridizes to a target region that is upstream (or 5') to exon 51. In some examples, the polynucleic acid molecule hybridizes to a target region that is about 5, 10, 15, 20, 50, 100, 200, 300, 400, or 500 bp upstream (or 5') of exon 51. In some examples, the polynucleic acid molecule hybridizes to a target region that is downstream (or 3') to exon 51. In some examples, the polynucleic acid molecule hybridizes to a target region that is about 5, 10, 15, 20, 50, 100, 200, 300, 400, or 500 bp downstream (or 3') of exon 51.

[0065] In some instances, the polynucleic acid molecule hybridizes to a target region within exon 51. In some cases, the polynucleic acid molecule hybridizes to a target region at a 5' intron-exon 51 junction or a 3' exon 51-intron junction.

[0066] In some embodiments, the polynucleic acid molecule comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the target sequence of the subject. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 50% sequence identity to the target sequence of the subject. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 60% sequence identity to the target sequence of the subject. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 70% sequence identity to the target sequence of the subject. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 75% sequence identity to the target sequence of the subject. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 80% sequence identity to the target sequence of the subject. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 85% sequence identity to the target sequence of the subject. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 90% sequence identity to the target sequence of the subject. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 95% sequence identity to the target sequence of the subject. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 96% sequence identity to the target sequence of the subject. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 97% sequence identity to the target sequence of the subject. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 98% sequence identity to the target sequence of the subject. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 99% sequence identity to the target sequence of the subject. In some embodiments, the polynucleic acid molecule consists of the target sequence of the subject.

[0067] In some embodiments, the polynucleic acid molecule comprises a first polynucleotide and a second polynucleotide. In some examples, the first polynucleotide comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the target sequence of interest. In some examples, the second polynucleotide comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the target sequence of interest. In some examples, the polynucleic acid molecule comprises a first polynucleotide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a target sequence of interest and a second polynucleotide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the target sequence of interest.

[0068] In some embodiments, the polynucleic acid molecules described herein comprise RNA or DNA. In some cases, the polynucleic acid molecule comprises RNA. In some examples, the RNA comprises small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA (miRNA), double-stranded RNA (dsRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), or heterogeneous nuclear RNA (hnRNA). In some examples, the RNA comprises shRNA. In some examples, the RNA comprises miRNA. In some examples, the RNA comprises dsRNA. In some examples, the RNA comprises tRNA. In some examples, the RNA comprises rRNA. In some examples, the RNA comprises hnRNA. In some examples, the RNA comprises siRNA. In some examples, the polynucleic acid molecule comprises siRNA.

[0069] In some embodiments, the nucleic acid polymer is about 10 to about 50 nucleotides in length. In some embodiments, the polynucleic acid molecule is about 10 to about 30, about 15 to about 30, about 18 to about 25, about 18 to about 24, about 19 to about 23, or about 20 to about 22 nucleotides in length.

[0070] In some embodiments, the polynucleic acid molecule is about 50 nucleotides in length. In some examples, the polynucleic acid molecule is about 45 nucleotides in length. In some examples, the polynucleic acid molecule is about 40 nucleotides in length. In some examples, the polynucleic acid molecule is about 35 nucleotides in length. In some examples, the polynucleic acid molecule is about 30 nucleotides in length. In some examples, the polynucleic acid molecule is about 25 nucleotides in length. In some examples, the polynucleic acid molecule is about 20 nucleotides in length. In some examples, the polynucleic acid molecule is about 19 nucleotides in length. In some examples, the polynucleic acid molecule is about 18 nucleotides in length. In some examples, the polynucleic acid molecule is about 17 nucleotides in length. In some examples, the polynucleic acid molecule is about 16 nucleotides in length. In some examples, the polynucleic acid molecule is about 15 nucleotides in length. In some examples, the polynucleic acid molecule is about 14 nucleotides in length. In some examples, the polynucleic acid molecule is about 13 nucleotides in length. In some examples, the polynucleic acid molecule is about 12 nucleotides in length. In some examples, the polynucleic acid molecule is about 11 nucleotides in length. In some examples, the polynucleic acid molecule is about 10 nucleotides in length. In some examples, the polynucleic acid molecule is about 10 to about 50 nucleotides in length. In some examples, the polynucleic acid molecule is about 10 to about 45 nucleotides in length. In some examples, the polynucleic acid molecule is about 10 to about 40 nucleotides in length. In some examples, the polynucleic acid molecule is about 10 to about 35 nucleotides in length. In some examples, the polynucleic acid molecule is about 10 to about 30 nucleotides in length. In some examples, the polynucleic acid molecule is about 10 to about 25 nucleotides in length. In some examples, the polynucleic acid molecule is about 10 to about 20 nucleotides in length. In some examples, the polynucleic acid molecule is about 15 to about 25 nucleotides in length. In some examples, the polynucleic acid molecule is about 15 to about 30 nucleotides in length. In some examples, the polynucleic acid molecule is about 12 to about 30 nucleotides in length.

[0071] In some embodiments, the polynucleic acid molecule comprises a first polynucleotide. In some examples, the polynucleic acid molecule comprises a second polynucleotide. In some examples, the polynucleic acid molecule comprises a first polynucleotide and a second polynucleotide. In some examples, the first polynucleotide is a sense strand or a passenger strand. In some examples, the second polynucleotide is an antisense strand or a guide strand.

[0072] In some embodiments, the polynucleic acid molecule is a first polynucleotide. In some embodiments, the first polynucleotide is about 10 to about 50 nucleotides in length. In some embodiments, the first polynucleotide is about 10 to about 30, about 15 to about 30, about 18 to about 25, about 18 to about 24, about 19 to about 23, or about 20 to about 22 nucleotides in length.

[0073] In some examples, the first polynucleotide is about 50 nucleotides in length. In some examples, the first polynucleotide is about 45 nucleotides in length. In some examples, the first polynucleotide is about 40 nucleotides in length. In some examples, the first polynucleotide is about 35 nucleotides in length. In some examples, the first polynucleotide is about 30 nucleotides in length. In some examples, the first polynucleotide is about 25 nucleotides in length. In some examples, the first polynucleotide is about 20 nucleotides in length. In some examples, the first polynucleotide is about 19 nucleotides in length. In some examples, the first polynucleotide is about 18 nucleotides in length. In some examples, the first polynucleotide is about 17 nucleotides in length. In some examples, the first polynucleotide is about 16 nucleotides in length. In some examples, the first polynucleotide is about 15 nucleotides in length. In some examples, the first polynucleotide is about 14 nucleotides in length. In some examples, the first polynucleotide is about 13 nucleotides in length. In some examples, the first polynucleotide is about 12 nucleotides in length. In some examples, the first polynucleotide is about 11 nucleotides in length. In some examples, the first polynucleotide is about 10 nucleotides in length. In some examples, the first polynucleotide is about 10 to about 50 nucleotides in length. In some examples, the first polynucleotide is about 10 to about 45 nucleotides in length. In some examples, the first polynucleotide is about 10 to about 40 nucleotides in length. In some examples, the first polynucleotide is about 10 to about 35 nucleotides in length. In some examples, the first polynucleotide is about 10 to about 30 nucleotides in length. In some examples, the first polynucleotide is about 10 to about 25 nucleotides in length. In some examples, the first polynucleotide is about 10 to about 20 nucleotides in length. In some examples, the first polynucleotide is about 15 to about 25 nucleotides in length.In some examples, the first polynucleotide is about 15 to about 30 nucleotides in length. In some examples, the first polynucleotide is about 12 to about 30 nucleotides in length.

[0074] In some embodiments, the polynucleic acid molecule is a second polynucleotide. In some embodiments, the second polynucleotide is about 10 to about 50 nucleotides in length. In some embodiments, the second polynucleotide is about 10 to about 30, about 15 to about 30, about 18 to about 25, about 18 to about 24, about 19 to about 23, or about 20 to about 22 nucleotides in length.

[0075] In some examples, the second polynucleotide is about 50 nucleotides in length. In some examples, the second polynucleotide is about 45 nucleotides in length. In some examples, the second polynucleotide is about 40 nucleotides in length. In some examples, the second polynucleotide is about 35 nucleotides in length. In some examples, the second polynucleotide is about 30 nucleotides in length. In some examples, the second polynucleotide is about 25 nucleotides in length. In some examples, the second polynucleotide is about 20 nucleotides in length. In some examples, the second polynucleotide is about 19 nucleotides in length. In some examples, the second polynucleotide is about 18 nucleotides in length. In some examples, the second polynucleotide is about 17 nucleotides in length. In some examples, the second polynucleotide is about 16 nucleotides in length. In some examples, the second polynucleotide is about 15 nucleotides in length. In some examples, the second polynucleotide is about 14 nucleotides in length. In some examples, the second polynucleotide is about 13 nucleotides in length. In some examples, the second polynucleotide is about 12 nucleotides in length. In some examples, the second polynucleotide is about 11 nucleotides in length. In some examples, the second polynucleotide is about 10 nucleotides in length. In some examples, the second polynucleotide is about 10 to about 50 nucleotides in length. In some examples, the second polynucleotide is about 10 to about 45 nucleotides in length. In some examples, the second polynucleotide is about 10 to about 40 nucleotides in length. In some examples, the second polynucleotide is about 10 to about 35 nucleotides in length. In some examples, the second polynucleotide is about 10 to about 30 nucleotides in length. In some examples, the second polynucleotide is about 10 to about 25 nucleotides in length. In some examples, the second polynucleotide is about 10 to about 20 nucleotides in length. In some examples, the second polynucleotide is about 15 to about 25 nucleotides in length.In some examples, the second polynucleotide is about 15 to about 30 nucleotides in length. In some examples, the second polynucleotide is about 12 to about 30 nucleotides in length.

[0076] In some embodiments, the polynucleic acid molecule comprises a first polynucleotide and a second polynucleotide. In some examples, the polynucleic acid molecule further comprises a blunt end, an overhang, or a combination thereof. In some examples, the blunt end is a 5' blunt end, a 3' blunt end, or both. In some cases, the overhang is a 5' overhang, a 3' overhang, or both. In some cases, the overhang comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 non-base paired nucleotides. In some cases, the overhang comprises 1, 2, 3, 4, 5, or 6 non-base paired nucleotides. In some cases, the overhang comprises 1, 2, 3, 4, 5, or 6 non-base paired nucleotides. In some cases, the overhang comprises 1, 2, 3, or 4 non-base paired nucleotides. In some cases, the overhang comprises 1 non-base paired nucleotide. In some cases, the overhang comprises 2 non-base paired nucleotides. In some cases, the overhang comprises 3 non-base paired nucleotides. In some cases, the overhang comprises 4 non-base paired nucleotides.

[0077] In some embodiments, the sequence of the polynucleic acid molecule is at least 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 99.5% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 50% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 60% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 70% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 80% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 90% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 95% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 99% complementary to a target sequence described herein. In some examples, the sequence of the polynucleic acid molecule is 100% complementary to the target sequence described herein.

[0078] In some embodiments, the sequence of the polynucleic acid molecule has 5 or less mismatches to the target sequences described herein. In some embodiments, the sequence of the polynucleic acid molecule has 4 or less mismatches to the target sequences described herein. In some embodiments, the sequence of the polynucleic acid molecule has 3 or less mismatches to the target sequences described herein. In some embodiments, the sequence of the polynucleic acid molecule has 2 or less mismatches to the target sequences described herein. In some embodiments, the sequence of the polynucleic acid molecule has 1 or less mismatch to the target sequences described herein.

[0079] In some embodiments, the specificity of a polynucleic acid molecule hybridizing to a target sequence described herein is 95%, 98%, 99%, 99.5%, or 100% sequence complementarity of the polynucleic acid molecule to the target sequence, in some instances, hybridization is under high stringency hybridization conditions.

[0080] In some embodiments, the polynucleic acid molecule has reduced off-target effects. In some instances, "off-target" or "off-target effect" refers to any instance where a polynucleic acid polymer for a given target causes an unintended effect by directly or indirectly interacting with another mRNA sequence, DNA sequence, or cellular protein or other moiety. In some instances, an "off-target effect" occurs when there is simultaneous degradation of other transcripts due to partial homology or complementarity between the other transcripts and the sense and / or antisense strands of the polynucleic acid molecule.

[0081] In some embodiments, the polynucleic acid molecule comprises natural or synthetic or artificial nucleotide analogs or bases. In some cases, the polynucleic acid molecule comprises a combination of DNA, RNA, and / or nucleotide analogs. In some examples, the synthetic or artificial nucleotide analogs or bases comprise modifications at one or more of the ribose moiety, the phosphate moiety, the nucleoside moiety, or a combination thereof.

[0082] In some embodiments, the nucleotide analog or artificial nucleotide base comprises a nucleic acid having a modification at the 2' hydroxyl group of the ribose moiety. In some examples, the modification comprises H, OR, R, halo, SH, SR, NH2, NHR, NR2, or CN, where R is an alkyl moiety. Exemplary alkyl moieties include, but are not limited to, halogen, sulfur, thiol, thioether, thioester, amine (primary, secondary, or tertiary), amide, ether, ester, alcohol, and oxygen. In some examples, the alkyl moiety further comprises a modification. In some examples, the modification comprises an azo group, a keto group, an aldehyde group, a carboxyl group, a nitro group, a nitroso group, a nitrile group, a heterocyclic (e.g., imidazole, hydrazino, or hydroxylamino) group, an isocyanate or cyanate group, or a sulfur-containing group (e.g., sulfoxide, sulfone, sulfide, and disulfide). In some examples, the alkyl moiety further comprises a heterosubstitution. In some examples, a carbon of a heterocyclic group is replaced by nitrogen, oxygen, or sulfur. In some examples, heterocyclic substitutions include, but are not limited to, morpholino, imidazole, and pyrrolidino.

[0083] In some cases, the modification of the 2' hydroxyl group is a 2'-O-methyl modification or a 2'-O-methoxyethyl (2'-O-MOE) modification. In some cases, the 2'-O-methyl modification adds a methyl group to the 2' hydroxyl group of the ribose moiety, while the 2'O-methoxyethyl modification adds a methoxyethyl group to the 2' hydroxyl group of the ribose moiety. Exemplary chemical structures of a 2'-O-methyl modification of an adenosine molecule and a 2'O-methoxyethyl modification of a uridine are illustrated below.

[0084] [ka]

[0085] In some embodiments, the modification of the 2' hydroxyl group is a 2'-O-aminopropyl modification, in which an extended amine group containing a propyl linker attaches the amine group to the 2' oxygen. In some instances, this modification neutralizes the overall negative charge from the phosphate of the oligonucleotide molecule by introducing one positive charge from the amine group per sugar, thereby improving its cellular uptake properties due to its zwitterionic properties. A typical chemical structure of a 2'-O-aminopropyl nucleoside phosphoramidite is illustrated below.

[0086] [ka]

[0087] In some instances, the modification of the 2' hydroxyl group is a locked or bridged ribose modification (e.g., Locked Nucleic Acid or LNA), in which the oxygen border of the 2' carbon is linked to the 4' carbon by a methylene group, thus forming a 2'-C, 4'-C-oxy-methylene linked bicyclic ribonucleotide monomer. Representative examples of LNA chemical structures are illustrated below. The representative example shown on the left highlights the chemical connectivity of the LNA monomer. The representative example shown on the right highlights the locked 3'-endo (3E) structure of the furanose ring of the LNA monomer.

[0088] LNA (Locked Nucleic Acid)

[0089] [ka]

[0090] In some embodiments, the modification at the 2' hydroxyl group includes ethylene nucleic acid (ENA), such as 2'-4'-ethylene bridged nucleic acid, which locks the sugar structure into a 3'-endo sugar puckering conformation. ENA is part of the bridged nucleic acid class of modified nucleic acid, which also includes LNA. The typical chemical structures of ENA and bridged nucleic acid are illustrated below.

[0091] [ka]

[0092] In some embodiments, additional modifications at the 2' hydroxyl group include 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamide (2'-O-NMA).

[0093] In some embodiments, the nucleotide analogs include, but are not limited to, 5-propyluridine, 5-propynylcytidine, 6-methyladenine, 6-methylguanine, N,N-dimethyladenine, 2-propyladenine, 2 propylguanine, 2-aminoadenine, 1-methylinosine, 3-methyluridine, 5-methylcytidine, 5-methyluridine, and other nucleotides with modifications at the 5 position, deazanucleotides such as 5-(2-amino)propyluridine, 5-halocytidine, 5-halouridine, 4-acetylcytidine, 1-methyladenosine, 2-methyladenosine, 3-methylcytidine, 6-methyluridine, 2-methylguanosine, 7-methylguanosine, 2,2-dimethylguanosine, 5-methylaminoethyluridine, 5-methoxyuridine, 7-deaza-adenosine, 6-azouridine, 6-azocytidine, 6-azothymidine, 5- Included are modified bases such as methyl-2-thiouridine, 2-thiouridine and 4-thiouridine, and other thio bases such as 2-thiocytidine, dihydrouridine, pseudouridine, queosine, archaeosine, naphthyl and substituted naphthyl groups, O- and N-alkylated purines and pyrimidines such as N6-methyladenosine, 5-methylcarbonylmethyluridine, uridine, 5-oxyacetic acid, pyridin-4-one, pyridin-2-one, phenyl, and modified phenyl groups such as aminophenol or 2,4,6-trimethoxybenzene, modified cytosines that act as G-clamp nucleotides, 8-substituted adenines and guanines, 5-substituted uracils and thymines, azapyrimidines, carboxyhydroxyalkyl nucleotides, carboxyalkylaminoalkyl nucleotides, and alkylcarbonyl alkylated nucleotides. Modified nucleotides further include nucleotides modified on the sugar moiety, as well as nucleotides having non-ribosyl sugars or analogs thereof. For example, in some cases the sugar moiety is or is based on mannose, arabinose, glucopyranose, galactopyranose, 4'-thioribose, and other sugars, heterocycles, or carbocycles. The term nucleotide further includes those known in the art as universal bases.By way of example, universal bases include, but are not limited to, 3-nitropyrrole, 5-nitroindole, or nebularine.

[0094] In some embodiments, the nucleotide analogs further comprise morpholino, peptide nucleic acid (PNA), methyl phosphonate nucleotides, thiol phosphonate nucleotides, 2'-fluoro N3-P5'-phosphoramidites, 1',5'-anhydrohexitol nucleic acid (HNA), or combinations thereof. Morpholino or phosphorodiamidate morpholino oligos (PMOs) comprise synthetic molecules whose structure mimics natural nucleic acid structures by deviating from normal sugar and phosphate structures. In some instances, the five-membered ribose ring is replaced with a six-membered morpholino ring containing four carbons, one nitrogen, and one oxygen. In some cases, ribose monomers are linked by phosphorodiamidate groups instead of phosphate groups. In some cases, backbone alterations remove all positive and negative charges making morpholino neutral molecules capable of crossing cell membranes without the aid of cellular delivery agents such as those used by charged oligonucleotides.

[0095] [ka]

[0096] In some embodiments, peptide nucleic acids (PNAs) contain no sugar backbone rings or phosphate linkages, and the bases are linked and appropriately spaced by molecules such as oligoglycines, thus eliminating the backbone charge.

[0097] [ka]

[0098] In some embodiments, one or more modifications are optionally made at the internucleotide linkage. In some examples, the modified internucleotide linkage may be, but is not limited to, phosphorothioates, dithiophosphates, methylphosphonates, 5'-alkylenephosphonates, 5'-methylphosphonates, 3'-alkylenephosphonates, borontrifluoridates, 3'-5' or 2'-5' linked boranophosphates and selenophosphates, phosphate triesters, thionoalkylphosphotriesters, hydrogen phosphonate linkages, alkyl phosphonates, alkyl phosphorothioates, aryl phosphorothioates, phosphoroselenoates, phosphorodiselenoates, phosphinates, phosphoramidates, 3'-alkylphosphoramidates, aminoalkylphosphoramidates, thionophosphoric acid salts ... The antisense oligonucleotides include amidates, phosphoropiperazidates, phosphoroanilothioates, phosphoroanilidates, ketones, sulfones, sulfonamides, carbonates, carbamates, methylenehydrazo, methylenedimethyldimethylhydrazo, formacetals, thioformacetals, oximes, methyleneimino, methylenemethylimino, thioamidates, bonds with riboacetyl groups, aminoethylglycine, silyl, or siloxane bonds, such as saturated or unsaturated and / or substituted and / or heteroatom-containing alkyl or cycloalkyl bonds of 1-10 carbons with or without heteroatoms, bonds with morpholino structures, amides, polyamides in which bases are directly or indirectly bound to the aza nitrogen of the backbone, or combinations thereof. Phosphorothioate antisense oligonucleotides (PS ASOs) are antisense oligonucleotides that contain phosphorothioate bonds. Exemplary PS ASOs are described below.

[0099] [ka]

[0100] In some instances, the modification is a methyl or thiol modification, such as a methylphosphonate or thiolphosphonate modification. Exemplary thiolphosphonate nucleotides (left) and methylphosphonate nucleotides (right) are illustrated below.

[0101] [ka]

[0102] In some examples, modified nucleotides include 2'-fluoro N3-P5'-phosphoramidites, exemplified but not limited to, as follows:

[0103] [ka]

[0104] In some examples, modified nucleotides include, but are not limited to, hexitol nucleic acids (alternatively, 1',5'-anhydrohexitol nucleic acids (HNA)), exemplified as follows:

[0105] [ka]

[0106] In some embodiments, the one or more modifications further include modifications of the ribose moiety, the phosphate backbone, and the nucleoside, or nucleotide analog modifications at the 3' or 5' terminus. For example, the 3' terminus optionally includes a 3' cationic group, or includes a 3' cationic group by inverting the nucleoside at the 3' terminus including a 3'-3' bond. In another alternative, the 3' terminus is optionally conjugated with an amino alkyl group, e.g., a 3'C5-amino alkyl dT. In an additional alternative, the 3' terminus is optionally conjugated with an abasic site, e.g., an apurinic or apyrimidinic site. In some instances, the 5' terminus is conjugated with an amino alkyl group, e.g., a 5'-O-amino alkyl substituent. In some cases, the 5' terminus is conjugated with an abasic site, e.g., an apurinic or apyrimidinic site.

[0107] In some embodiments, the polynucleic acid molecule comprises one or more of the artificial nucleotide analogs described herein. In some examples, the polynucleic acid molecule described herein comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 25 or more of the artificial nucleotide analogs described herein. In some embodiments, the artificial nucleotide analogs include 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), T-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or modified 2'-ON-methylacetamide (2'-O-NMA), LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, 2'-fluoro N3-P5'-phosphoramidites, or combinations thereof. In some embodiments, the polynucleic acid molecule is 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), T-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 25 or more artificial nucleotide analogs selected from modified 2'-ON-methylacetamide (2'-O-NMA), LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, 2'-fluoro N3-P5'-phosphoramidites, or combinations thereof. In some embodiments, the polynucleic acid molecule comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 25 or more 2'-O-methyl modified nucleotides.In some embodiments, a polynucleic acid molecule comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 25 or more 2'-O-methoxyethyl (2'-O-MOE) modified nucleotides. In some examples, a polynucleic acid molecule described herein comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 25 or more thiol phosphonate nucleotides.

[0108] In some examples, the polynucleic acid molecule comprises at least one of: about 5% to about 100% modification, about 10% to about 100% modification, about 20% to about 100% modification, about 30% to about 100% modification, about 40% to about 100% modification, about 50% to about 100% modification, about 60% to about 100% modification, about 70% to about 100% modification, about 80% to about 100% modification, and about 90% to about 100% modification.

[0109] In some examples, the polynucleic acid molecule comprises at least one of the following: about 10% to about 90% modification, about 20% to about 90% modification, about 30% to about 90% modification, about 40% to about 90% modification, about 50% to about 90% modification, about 60% to about 90% modification, about 70% to about 90% modification, and about 80% to about 100% modification.

[0110] In some examples, the polynucleic acid molecule comprises at least one of the following: about 10% to about 80% modification, about 20% to about 80% modification, about 30% to about 80% modification, about 40% to about 80% modification, about 50% to about 80% modification, about 60% to about 80% modification, and about 70% to about 80% modification.

[0111] In some examples, the polynucleic acid molecule comprises at least one of the following: about 10% to about 70% modification, about 20% to about 70% modification, about 30% to about 70% modification, about 40% to about 70% modification, about 50% to about 70% modification, and about 60% to about 70% modification.

[0112] In some examples, the polynucleic acid molecule comprises at least one of the following: about 10% to about 60% modifications, about 20% to about 60% modifications, about 30% to about 60% modifications, about 40% to about 60% modifications, and about 50% to about 60% modifications.

[0113] In some examples, the polynucleic acid molecule comprises at least one of the following: about 10% to about 50% modifications, about 20% to about 50% modifications, about 30% to about 50% modifications, and about 40% to about 50% modifications.

[0114] In some examples, the polynucleic acid molecules contain at least one of the following: about 10% to about 40% modifications, about 20% to about 40% modifications, and about 30% to about 40% modifications.

[0115] In some examples, the polynucleic acid molecule comprises at least one of the following: about 10% to about 30% modifications, and about 20% to about 30% modifications.

[0116] Optionally, the polynucleic acid molecule contains about 10% to about 20% modifications.

[0117] Optionally, the polynucleic acid molecule contains from about 15% to about 90%, from about 20% to about 80%, from about 30% to about 70%, or from about 40% to about 60% modifications.

[0118] In further cases, the polynucleic acid molecule contains at least about 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% modifications.

[0119] In some embodiments, a polynucleic acid molecule contains at least about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, or more modifications.

[0120] In some examples, the polynucleic acid molecule comprises at least about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, or more modified nucleotides.

[0121] In some examples, about 5% to about 100% of the polynucleic acid molecules contain artificial nucleotide analogs described herein. In some examples, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the polynucleic acid molecules contain artificial nucleotide analogs described herein. In some examples, about 5% of the polynucleic acid molecules contain artificial nucleotide analogs described herein. In some examples, about 10% of the polynucleic acid molecules contain artificial nucleotide analogs described herein. In some examples, about 15% of the polynucleic acid molecules contain artificial nucleotide analogs described herein. In some examples, about 20% of the polynucleic acid molecules contain artificial nucleotide analogs described herein. In some examples, about 25% of the polynucleic acid molecules contain artificial nucleotide analogs described herein. In some examples, about 30% of the polynucleic acid molecules comprise an artificial nucleotide analog described herein. In some examples, about 35% of the polynucleic acid molecules comprise an artificial nucleotide analog described herein. In some examples, about 40% of the polynucleic acid molecules comprise an artificial nucleotide analog described herein. In some examples, about 45% of the polynucleic acid molecules comprise an artificial nucleotide analog described herein. In some examples, about 50% of the polynucleic acid molecules comprise an artificial nucleotide analog described herein. In some examples, about 55% of the polynucleic acid molecules comprise an artificial nucleotide analog described herein. In some examples, about 60% of the polynucleic acid molecules comprise an artificial nucleotide analog described herein. In some examples, about 65% of the polynucleic acid molecules comprise an artificial nucleotide analog described herein. In some examples, about 70% of the polynucleic acid molecules comprise an artificial nucleotide analog described herein. In some examples, about 75% of the polynucleic acid molecules comprise an artificial nucleotide analog described herein. In some examples, about 80% of the polynucleic acid molecules comprise an artificial nucleotide analog described herein. In some examples, about 85% of the polynucleic acid molecule comprises the artificial nucleotide analogs described herein.In some examples, about 90% of the polynucleic acid molecules comprise an artificial nucleotide analog described herein. In some examples, about 95% of the polynucleic acid molecules comprise an artificial nucleotide analog described herein. In some examples, about 96% of the polynucleic acid molecules comprise an artificial nucleotide analog described herein. In some examples, about 97% of the polynucleic acid molecules comprise an artificial nucleotide analog described herein. In some examples, about 98% of the polynucleic acid molecules comprise an artificial nucleotide analog described herein. In some examples, about 99% of the polynucleic acid molecules comprise an artificial nucleotide analog described herein. In some examples, about 100% of the polynucleic acid molecules comprise an artificial nucleotide analog described herein. In some embodiments, the artificial nucleotide analogs include 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), T-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or modified 2'-ON-methylacetamide (2'-O-NMA), LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, 2'-fluoro N3-P5'-phosphoramidites, or combinations thereof.

[0122] In some embodiments, the polynucleic acid molecule comprises about 1 to about 25 modifications, wherein the modifications comprise an artificial nucleotide analog described herein. In some embodiments, the polynucleic acid molecule comprises about 1 modification, wherein the modification comprises an artificial nucleotide analog described herein. In some embodiments, the polynucleic acid molecule comprises about 2 modifications, wherein the modification comprises an artificial nucleotide analog described herein. In some embodiments, the polynucleic acid molecule comprises about 3 modifications, wherein the modification comprises an artificial nucleotide analog described herein. In some embodiments, the polynucleic acid molecule comprises about 4 modifications, wherein the modification comprises an artificial nucleotide analog described herein. In some embodiments, the polynucleic acid molecule comprises about 5 modifications, wherein the modification comprises an artificial nucleotide analog described herein. In some embodiments, the polynucleic acid molecule comprises about 6 modifications, wherein the modification comprises an artificial nucleotide analog described herein. In some embodiments, the polynucleic acid molecule comprises about 7 modifications, wherein the modification comprises an artificial nucleotide analog described herein. In some embodiments, the polynucleic acid molecule comprises about 8 modifications, wherein the modification comprises an artificial nucleotide analog described herein. In some embodiments, the polynucleic acid molecule comprises about 9 modifications, wherein the modification comprises an artificial nucleotide analog described herein. In some embodiments, the polynucleic acid molecule comprises about 10 modifications, wherein the modifications comprise an artificial nucleotide analogue described herein. In some embodiments, the polynucleic acid molecule comprises about 11 modifications, wherein the modifications comprise an artificial nucleotide analogue described herein. In some embodiments, the polynucleic acid molecule comprises about 12 modifications, wherein the modifications comprise an artificial nucleotide analogue described herein. In some embodiments, the polynucleic acid molecule comprises about 13 modifications, wherein the modifications comprise an artificial nucleotide analogue described herein. In some embodiments, the polynucleic acid molecule comprises about 14 modifications, wherein the modifications comprise an artificial nucleotide analogue described herein.In some embodiments, the polynucleic acid molecule comprises about 15 modifications, wherein the modifications comprise an artificial nucleotide analog described herein. In some embodiments, the polynucleic acid molecule comprises about 16 modifications, wherein the modifications comprise an artificial nucleotide analog described herein. In some embodiments, the polynucleic acid molecule comprises about 17 modifications, wherein the modifications comprise an artificial nucleotide analog described herein. In some embodiments, the polynucleic acid molecule comprises about 18 modifications, wherein the modifications comprise an artificial nucleotide analog described herein. In some embodiments, the polynucleic acid molecule comprises about 19 modifications, wherein the modifications comprise an artificial nucleotide analog described herein. In some embodiments, the polynucleic acid molecule comprises about 20 modifications, wherein the modifications comprise an artificial nucleotide analog described herein. In some embodiments, the polynucleic acid molecule comprises about 21 modifications, wherein the modifications comprise an artificial nucleotide analog described herein. In some embodiments, the polynucleic acid molecule comprises about 22 modifications, wherein the modifications comprise an artificial nucleotide analog described herein. In some embodiments, the polynucleic acid molecule comprises about 23 modifications, wherein the modifications comprise an artificial nucleotide analog described herein. In some embodiments, the polynucleic acid molecule comprises about 24 modifications, where the modifications include artificial nucleotide analogs described herein. In some embodiments, the polynucleic acid molecule comprises about 25 modifications, where the modifications include artificial nucleotide analogs described herein.

[0123] In some embodiments, the polynucleic acid molecule is assembled from two separate polynucleotides, where one polynucleotide comprises the sense strand and the second polynucleotide comprises the antisense strand of the polynucleic acid molecule, in other embodiments, the sense strand is connected to the antisense strand by a linker molecule, which in some instances is a polynucleotide linker or a non-nucleotide linker.

[0124] In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, wherein the pyrimidine nucleotides in the sense strand comprise 2'-O-methylpyrimidine nucleotides and the purine nucleotides in the sense strand comprise 2'-deoxypurine nucleotides.In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, wherein the pyrimidine nucleotides present in the sense strand comprise 2'-deoxy-2'-fluoropyrimidine nucleotides and the purine nucleotides present in the sense strand comprise 2'-deoxypurine nucleotides.

[0125] In some embodiments, a polynucleic acid molecule comprises a sense strand and an antisense strand, wherein pyrimidine nucleotides, when present in the antisense strand, are 2'-deoxy-2'-fluoro pyrimidine nucleotides, and purine nucleotides, when present in the antisense strand, are 2'-O-methyl purine nucleotides.

[0126] In some embodiments, a polynucleic acid molecule comprises a sense strand and an antisense strand, wherein pyrimidine nucleotides, when present in said antisense strand, are 2'-deoxy-2'-fluoro pyrimidine nucleotides, and purine nucleotides, when present in said antisense strand, comprise 2'-deoxy-purine nucleotides.

[0127] In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, wherein the sense strand comprises a cap moiety at the 5'-end, the 3'-end, or both the 5' and 3' ends of the sense strand, hi other embodiments, the terminal cap moieties are inverted deoxy abasic moieties.

[0128] In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, wherein the antisense strand comprises a phosphate backbone modification at the 3' end of the antisense strand. In some examples, the phosphate backbone modification is phosphorothioate.

[0129] In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, wherein the antisense strand comprises a glyceryl modification at the 3' end of the antisense strand.

[0130] In some embodiments, a polynucleic acid molecule comprises a sense strand and an antisense strand, wherein the sense strand comprises one or more, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more phosphorothioate internucleotide linkages, and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) and / or universal base modified nucleotides, and optionally at the 3'-terminus, 5'-terminus, or at the 3'- and 5'-terminus of the sense strand. and the antisense strand comprises about 1 to about 10, particularly about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more phosphorothioate internucleotide linkages, and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base-modified nucleotides, and optionally terminal cap molecules at the 3'-end, 5'-end, or both the 3'- and 5'-ends of the antisense strand. In other embodiments, one or more, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more, pyrimidine nucleotides of the sense and / or antisense strands are chemically modified with 2'-deoxy, 2'-O-methyl, and / or 2'-deoxy-2'-fluoro nucleotides, or with one or more, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more, phosphorothioate internucleotide linkages, and / or with or without terminal cap molecules at the 3'-terminus, the 5'-terminus, or both the 3'- and 5'-terminus, present on the same or different strands.

[0131] In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, wherein the sense strand has from about 1 to about 25, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more phosphorothioate internucleotide linkages, and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally at the 3'-terminus, 5'-terminus, or at both the 3'- and 5'-terminus of the sense strand. and the antisense strand comprises from about 1 to about 25, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more phosphorothioate internucleotide linkages, and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base-modified nucleotides, and optionally terminal cap molecules at the 3'-end, 5'-end, or both the 3'- and 5'-ends of the antisense strand. In other embodiments, one or more, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more, pyrimidine nucleotides of the sense and / or antisense strand are chemically modified with 2'-deoxy, 2'-O-methyl, and / or 2'-deoxy-2'-fluoro nucleotides, with or without about 1 to about 25 or more, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more phosphorothioate internucleotide linkages, and / or terminal cap molecules at the 3'-terminus, 5'-terminus, or both the 3'- and 5'-terminus, present on the same or different strands.

[0132] In some embodiments, a polynucleic acid molecule comprises a sense strand and an antisense strand, wherein the antisense strand has one or more, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more, phosphorothioate internucleotide linkages, and / or about one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally at the 3'-terminus, 5'-terminus, or terminal cap molecules at both the 3'- and 5'-ends; and the antisense strand comprises from about 1 to about 10, particularly about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more phosphorothioate internucleotide linkages, and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base-modified nucleotides, and optionally terminal cap molecules at the 3'-end, 5'-end, or both the 3'- and 5'-ends of the antisense strand. In other embodiments, one or more, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more, pyrimidine nucleotides of the sense and / or antisense strand are chemically modified with 2'-deoxy, 2'-O-methyl, and / or 2'-deoxy-2'-fluoro nucleotides, with or without one or more, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, phosphorothioate internucleotide linkages, and / or terminal cap molecules at the 3'-terminus, the 5'-terminus, or both the 3'- and 5'-terminus, present on the same or different strands.

[0133] In some embodiments, a polynucleic acid molecule comprises a sense strand and an antisense strand, wherein the antisense strand has from about 1 to about 25, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more phosphorothioate internucleotide linkages, and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally at the 3'-terminus, 5'-terminus, or at the 3'- and 5'-terminus of the sense strand. and the antisense strand comprises from about 1 to about 25, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more phosphorothioate internucleotide linkages, and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base-modified nucleotides, and optionally terminal cap molecules at the 3'-terminus, 5'-terminus, or both the 3'- and 5'-terminus of the antisense strand. In other embodiments, one or more, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more, pyrimidine nucleotides of the sense and / or antisense strand are chemically modified with 2'-deoxy, 2'-O-methyl, and / or 2'-deoxy-2'-fluoro nucleotides, with or without about 1 to about 5, e.g., about 1, 2, 3, 4, 5 or more phosphorothioate internucleotide linkages, and / or terminal cap molecules at the 3'-terminus, the 5'-terminus, or both the 3'- and 5'-terminus, present on the same or different strands.

[0134] In some embodiments, the polynucleic acid molecules described herein are chemically modified short interfering nucleic acid molecules having from about 1 to about 25, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more phosphorothioate internucleotide linkages in each strand of the polynucleic acid molecule.

[0135] In another embodiment, the polynucleic acid molecules described herein comprise 2'-5' internucleotide linkages. In some examples, the 2'-5' internucleotide linkages are at the 3'-terminus, the 5'-terminus, or at both the 3'-terminus and the 5'-terminus of one or both sequences. In additional examples, the 2'-5' internucleotide linkages are present at various other locations within one or both strands of sequences present, such as about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more of all internucleotide linkages of pyrimidine nucleotides in one or both strands of the polynucleic acid molecule comprise 2'-5' internucleotide linkages, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more of all internucleotide linkages of purine nucleotides in one or both strands of the polynucleic acid molecule comprise 2'-5' internucleotide linkages.

[0136] In some embodiments, the polynucleic acid molecule is a single-stranded polynucleic acid molecule that mediates RNAi activity in a cell or reconstituted in an in vitro system, wherein the polynucleic acid molecule comprises a single-stranded polynucleotide having complementarity to a target nucleic acid sequence, and wherein one or more pyrimidine nucleotides present in the polynucleic acid are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all of the pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides, or alternatively, a plurality of the pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and any purine nucleotides present in the polynucleic acid are 2'-deoxy purine nucleotides (e.g., wherein all of the purine nucleotides are 2'-deoxy purine nucleotides, or alternatively, a plurality of the purine nucleotides are 2'-deoxy purine nucleotides), and a terminal cap modification is optionally present at the 3'-end, the 5'-end, or both the 3' and 5'-ends of the antisense sequence. The polynucleic acid molecule optionally further comprises about one to about four (e.g., about 1, 2, 3, or 4) terminal 2'-deoxyribonucleotides at the 3' end of the polynucleic acid molecule, where the terminal nucleotides further comprise one or more (e.g., 1, 2, 3, or 4) phosphorothioate internucleotide linkages, and the polynucleic acid molecule optionally further comprises a terminal phosphate group, such as a 5'-terminal phosphate group.

[0137] In some cases, one or more of the artificial nucleotide analogs described herein are resistant to nucleases, e.g., ribonucleases such as RNase H, deoxyribonucleases such as DNase, or exonucleases such as 5'-3' exonucleases and 3'-5' exonucleases, as compared to naturally occurring polynucleic acid molecules. In some examples, the nucleotide analogs are resistant to nucleases, e.g., 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or modified 2'-ON-methylacetamide (2'-O-DMAOE). Artificial nucleotide analogs including 2'-O methyl modified polynucleic acid molecules, such as 2'-O-methyl-NMA, LNA, ENA, PNA, HNA, morpholino, methyl phosphonate nucleotides, thiol phosphonate nucleotides, 2'-fluoro N3-P5'-phosphoramidites, or combinations thereof, are resistant to nucleases, such as ribonucleases, such as RNase H, deoxyribonucleases, such as DNases, or exonucleases, such as 5'-3' exonucleases and 3'-5' exonucleases. In some examples, the 2'-O methyl modified polynucleic acid molecules are nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, 2'O-methoxyethyl (2'-O-MOE) modified polynucleic acid molecules are nuclease resistant (e.g., RNaseH, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, 2'-O-aminopropyl modified polynucleic acid molecules are nuclease resistant (e.g., RNaseH, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, 2'-deoxy modified polynucleic acid molecules are nuclease resistant (e.g., RNaseH, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant).In some examples, T-deoxy-2'-O-fluoro modified polynucleic acid molecules are nuclease resistant (e.g., RNaseH, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, 2'-O-aminopropyl (2'-O-AP) modified polynucleic acid molecules are nuclease resistant (e.g., RNaseH, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, 2'-O-dimethylaminoethyl (2'-O-DMAOE) modified polynucleic acid molecules are nuclease resistant (e.g., RNaseH, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, 2'-O-dimethylaminopropyl (2'-O-DMAP) modified polynucleic acid molecules are nuclease resistant (e.g., RNaseH, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, TO-dimethylaminoethyloxyethyl (2'-O-DMAEOE) modified polynucleic acid molecules are nuclease resistant (e.g., RNaseH, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, 2'-ON-methylacetamide (2'-O-NMA) modified polynucleic acid molecules are nuclease resistant (e.g., RNaseH, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, the LNA modified polynucleic acid molecule is nuclease resistant (e.g., RNaseH, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, the ENA modified polynucleic acid molecule is nuclease resistant (e.g., RNaseH, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, the HNA modified polynucleic acid molecule is nuclease resistant (e.g., RNaseH, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant).In some examples, the morpholinos are nuclease resistant (e.g., RNaseH, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, the PNA modified polynucleic acid molecules are resistant to nucleases (e.g., RNaseH, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, the methylphosphonate nucleotide modified polynucleic acid molecules are nuclease resistant (e.g., RNaseH, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, the thiol phosphonate nucleotide modified polynucleic acid molecules are nuclease resistant (e.g., RNaseH, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, polynucleic acid molecules comprising 2'-fluoro N3-P5'-phosphoramidites are nuclease resistant (e.g., RNaseH, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, the 5' conjugates described herein inhibit 5'-3' exonuclease cleavage. In some examples, the 3' conjugates described herein inhibit 3'-5' exonuclease cleavage.

[0138] In some embodiments, one or more of the artificial nucleotide analogs described herein have increased binding affinity for their mRNA targets compared to a comparable naturally occurring polynucleic acid molecule. Polynucleic acid molecules containing one or more of artificial nucleotide analogs including 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), T-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or modified 2'-ON-methylacetamide (2'-O-NMA), LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, or 2'-fluoro N3-P5'-phosphoramidites have increased binding affinity to their mRNA targets compared to comparable naturally occurring polynucleic acid molecules. In some examples, 2'-O-methyl modified polynucleic acid molecules have increased binding affinity to their mRNA targets compared to comparable natural polynucleic acid molecules. In some examples, 2'-O-methoxyethyl (2'-O-MOE) modified polynucleic acid molecules have increased binding affinity to their mRNA targets compared to comparable natural polynucleic acid molecules. In some examples, 2'-O-aminopropyl modified polynucleic acid molecules have increased binding affinity to their mRNA targets compared to comparable natural polynucleic acid molecules. In some examples, 2'-deoxy modified polynucleic acid molecules have increased binding affinity to their mRNA targets compared to comparable natural polynucleic acid molecules. In some examples, T-deoxy-2'-fluoro modified polynucleic acid molecules have increased binding affinity to their mRNA targets compared to comparable natural polynucleic acid molecules. In some examples, 2'-O-aminopropyl (2'-O-AP) modified polynucleic acid molecules have increased binding affinity to their mRNA targets compared to comparable natural polynucleic acid molecules. In some instances, 2'-O-dimethylaminoethyl (2'-O-DMAOE) modified polynucleic acid molecules have increased binding affinity for their mRNA targets compared to comparable native polynucleic acid molecules.In some examples, 2'-O-dimethylaminopropyl (2'-O-DMAP) modified polynucleic acid molecules have increased binding affinity to their mRNA targets compared to comparable natural polynucleic acid molecules. In some examples, 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE) modified polynucleic acid molecules have increased binding affinity to their mRNA targets compared to comparable natural polynucleic acid molecules. In some examples, 2'-ON-methylacetamide (2'-O-NMA) modified polynucleic acid molecules have increased binding affinity to their mRNA targets compared to comparable natural polynucleic acid molecules. In some examples, LNA modified polynucleic acid molecules have increased binding affinity to their mRNA targets compared to comparable natural polynucleic acid molecules. In some examples, ENA modified polynucleic acid molecules have increased binding affinity to their mRNA targets compared to comparable natural polynucleic acid molecules. In some examples, PNA modified polynucleic acid molecules have increased binding affinity to their mRNA targets compared to comparable natural polynucleic acid molecules. In some examples, HNA modified polynucleic acid molecules have increased binding affinity to their mRNA targets compared to comparable natural polynucleic acid molecules. In some examples, morpholino modified polynucleic acid molecules have increased binding affinity to their mRNA targets compared to comparable natural polynucleic acid molecules. In some examples, methylphosphonate nucleotide modified polynucleic acid molecules have increased binding affinity to their mRNA targets compared to comparable natural polynucleic acid molecules. In some examples, thiol phosphonate nucleotide modified polynucleic acid molecules have increased binding affinity to their mRNA targets compared to comparable natural polynucleic acid molecules. In some examples, polynucleic acid molecules comprising 2'-fluoro N3-P5'-phosphoramidites have increased binding affinity to their mRNA targets compared to comparable natural polynucleic acid molecules. In some cases, the increased affinity is exemplified by a lower Kd, a higher melting temperature (Tm), or a combination thereof.

[0139] In some embodiments, the polynucleic acid molecules described herein are chirally pure (or stereopure) polynucleic acid molecules or polynucleic acid molecules that include a single enantiomer. In some examples, the polynucleic acid molecules include L-nucleotides. In some examples, the polynucleic acid molecules include D-nucleotides. In some examples, the polynucleic acid molecule composition includes less than 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, or 1% of its enantiomer. In some cases, the polynucleic acid molecule composition includes less than 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, or 1% of a racemic mixture. In some examples, the polynucleic acid molecule is a polynucleic acid molecule described in U.S. Patent Application Publication Nos. 2014 / 194610 and 2015 / 211006; WO2015107425.

[0140] In some embodiments, the polynucleic acid molecules described herein are further modified to include an aptamer-conjugated moiety. In some examples, the aptamer-conjugated moiety is a DNA aptamer-conjugated moiety. In some examples, the aptamer-conjugated moiety is Alphamer (Centauri Therapeutics), which includes an aptamer moiety that recognizes a specific cell surface target and a moiety that displays a specific epitope for binding to circulating antibodies. In some examples, the polynucleic acid molecules described herein are further modified to include an aptamer-conjugated moiety as described in U.S. Patent Nos. 8,604,184, 8,591,910, and 7,850,975.

[0141] In additional embodiments, the polynucleic acid molecule described herein is modified to increase its stability. In some embodiments, the polynucleic acid molecule is RNA (e.g., siRNA). In some examples, the polynucleic acid molecule is modified by one or more of the modifications described above to increase its stability. In some cases, the polynucleic acid molecule is modified at the 2 hydroxyl position, such as by 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamide (2'-O-NMA) modification, or by a locked or bridged ribose structure (e.g., LNA or ENA). In some cases, the polynucleic acid molecule is modified by 2'-O-methyl and / or 2'-O-methoxyethyl ribose. In some cases, the polynucleic acid molecule further comprises morpholino, PNA, HNA, methyl phosphonate nucleotide, thiol phosphonate nucleotide, and / or 2'-fluoro N3-P5'-phosphoramidite to increase its stability. In some examples, the polynucleic acid molecule is a chirally pure (or stereopure) polynucleic acid molecule. In some examples, the chirally pure (or stereopure) polynucleic acid molecule is modified to increase its stability. Suitable modifications of RNA to increase the stability of delivery are clear to those skilled in the art.

[0142] In some embodiments, the polynucleic acid molecules described herein have RNAi activity that modulates expression of RNA encoded by genes involved in a disease or disorder, such as, but not limited to, IKBKAP, SMN2, MCAD, LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, LDLR, CFTR, DMD, PAH, MSTN, or K-Ras. In some examples, the polynucleic acid molecules described herein are double-stranded siRNA molecules that downregulate expression of at least one of IKBKAP, SMN2, MCAD, LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, LDLR, CFTR, DMD, PAH, MSTN, or K-Ras, wherein one strand of the double-stranded siRNA molecule downregulates expression of at least one of IKBKAP, SMN2, MCAD, LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, LDLR, CFTR, DMD, PAH, MSTN, or K-Ras, or ... , MSTN, or K-Ras, and the second strand of the double-stranded siRNA molecule comprises a nucleotide sequence complementary to the nucleotide sequence of an RNA encoded by at least one of IKBKAP, SMN2, MCAD, LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, LDLR, CFTR, DMD, PAH, MSTN, or K-Ras, or a portion thereof, and the second strand of the double-stranded siRNA molecule comprises a nucleotide sequence substantially similar to the nucleotide sequence of an RNA encoded by at least one of IKBKAP, SMN2, MCAD, LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, LDLR, CFTR, DMD, PAH, MSTN, or K-Ras, or a portion thereof.In some cases, the polynucleic acid molecules described herein are double-stranded siRNA molecules that downregulate expression of at least one of IKBKAP, SMN2, MCAD, LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, LDLR, CFTR, DMD, PAH, MSTN, or K-Ras, wherein each strand of the siRNA molecule comprises about 15-25, 18-24, or 19 to about 23 nucleotides, and each strand comprises at least about 14, 17, or 19 nucleotides that are complementary to nucleotides of the other strand. In some cases, the polynucleic acid molecules described herein are double-stranded siRNA molecules that downregulate expression of at least one of IKBKAP, SMN2, MCAD, LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, LDLR, CFTR, DMD, PAH, MSTN, or K-Ras, wherein each strand of the siRNA molecule comprises about 19 to about 23 nucleotides, and each strand comprises at least about 19 nucleotides that are complementary to the nucleotides of the other strand. In some examples, the RNAi activity occurs in a cell. In other examples, the RNAi activity occurs in a reconstituted in vitro system.

[0143] In some embodiments, the polynucleic acid molecule described herein has RNAi activity to regulate the expression of RNA encoded by genes involved in muscular dystrophy, such as, but not limited to, DMD, DUX4, DYSF, EMD, or LMNA.In some examples, the polynucleic acid molecule described herein is a double-stranded siRNA molecule that downregulates the expression of at least one of DMD, DUX4, DYSF, EMD, or LMNA, wherein one strand of the double-stranded siRNA molecule comprises a nucleotide sequence complementary to the nucleotide sequence of at least one of DMD, DUX4, DYSF, EMD, or LMNA, or the RNA encoded by at least one of DMD, DUX4, DYSF, EMD, or LMNA, or a portion thereof, and wherein the second strand of the double-stranded siRNA molecule comprises a nucleotide sequence substantially similar to the nucleotide sequence of at least one of DMD, DUX4, DYSF, EMD, or LMNA, or the RNA encoded by at least one of DMD, DUX4, DYSF, EMD, or LMNA, or a portion thereof. In some cases, the polynucleic acid molecules described herein are double-stranded siRNA molecules that downregulate the expression of at least one of DMD, DUX4, DYSF, EMD, or LMNA, where each strand of the siRNA molecule comprises about 15-25, 18-24, or 19-about 23 nucleotides, and each strand comprises at least about 14, 17, or 19 nucleotides that are complementary to the nucleotides of the other strand. In some cases, the polynucleic acid molecules described herein are double-stranded siRNA molecules that downregulate the expression of at least one of DMD, DUX4, DYSF, EMD, or LMNA, where each strand of the siRNA molecule comprises about 19-about 23 nucleotides, and each strand comprises at least about 19 nucleotides that are complementary to the nucleotides of the other strand. In some cases, the RNAi activity occurs in a cell. In other cases, the RNAi activity occurs in a reconstituted in vitro system.

[0144] In some embodiments, the polynucleic acid molecules described herein have RNAi activity that modulates expression of an RNA encoded by a DMD gene. In some examples, the polynucleic acid molecules described herein are single-stranded siRNA molecules that downregulate expression of DMD, where the single-stranded siRNA molecule comprises a nucleotide sequence complementary to a nucleotide sequence of DMD, or an RNA encoded by DMD, or a portion thereof. In some cases, the polynucleic acid molecules described herein are single-stranded siRNA molecules that downregulate expression of DMD, where the siRNA molecule comprises about 15-25, 18-24, or 19 to about 23 nucleotides. In some cases, the polynucleic acid molecules described herein are single-stranded siRNA molecules that downregulate expression of DMD, where the siRNA molecule comprises about 19 to about 23 nucleotides. In some examples, the RNAi activity occurs in a cell. In other examples, the RNAi activity occurs in a reconstituted in vitro system.

[0145] In some examples, the polynucleic acid molecule is a double-stranded polynucleotide molecule comprising self-complementary sense and antisense regions, where the antisense region comprises a nucleotide sequence complementary to a nucleotide sequence in a target nucleic acid molecule or a portion thereof, and the sense region has a nucleotide sequence corresponding to a target nucleic acid sequence or a portion thereof. In some examples, the polynucleic acid molecule is assembled from two separate polynucleotides, one strand being a sense strand and the other strand being an antisense strand, where the antisense strand and the sense strand are self-complementary (e.g., each strand comprises a nucleotide sequence complementary to a nucleotide sequence in the other strand; such as when the antisense strand and the sense strand form a duplex or double-stranded structure, e.g., the double-stranded region is about 19, 20, 21, 22, 23 or more base pairs); the antisense strand comprises a nucleotide sequence complementary to a nucleotide sequence in a target nucleic acid molecule or a portion thereof, and the sense strand comprises a nucleotide sequence corresponding to a target nucleic acid sequence or a portion thereof. Alternatively, the polynucleic acid molecule can be assembled from a single oligonucleotide, where the self-complementary sense and antisense regions of the polynucleic acid molecule are joined by a nucleic acid-based or non-nucleic acid-based linker.

[0146] In some cases, the polynucleic acid molecule is a polynucleotide having a double, asymmetric double, hairpin, or asymmetric hairpin secondary structure with self-complementary sense and antisense regions, where the antisense region comprises a nucleotide sequence complementary to the nucleotide sequence of another target nucleic acid molecule or a portion thereof, and the sense region comprises a nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.In other cases, the polynucleic acid molecule is a circular single-stranded polynucleotide having two or more loop structures and a base comprising self-complementary sense and antisense regions, where the antisense region comprises a nucleotide sequence complementary to the nucleotide sequence of the target nucleic acid molecule or a portion thereof, and the sense region comprises a nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and the circular polynucleotide is processed in vivo or in vitro to generate an active polynucleic acid molecule capable of mediating RNAi. In further cases, the polynucleic acid molecule further comprises a single-stranded polynucleotide having a nucleotide sequence complementary to a nucleotide sequence of a target nucleic acid molecule or a portion thereof (e.g., such a polynucleic acid molecule need not be present within the polynucleic acid molecule of a nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof), and the single-stranded polynucleotide further comprises a terminal phosphate group, such as a 5'-phosphate (see, e.g., Martinez et al., 2002, Cell., 110, 563-574 and Schwarz et al., 2002, Molecular Cell, 10, 537-568) or a 5',3'-diphosphate.

[0147] In some instances, a linear polynucleic acid molecule comprising an antisense region, a loop portion comprising nucleotides or non-nucleotides, and a sense region is asymmetric, with the sense region comprising fewer nucleotides than the antisense region, such that the sense region has nucleotides sufficiently complementary to base pairs with the antisense region to form a looped duplex. For example, an asymmetric hairpin polynucleic acid molecule comprises an antisense region (e.g., about 19 to about 22 nucleotides) having a length sufficient to mediate RNAi in a cell or in an in vitro system, and a loop region comprising about 4 to about 8 nucleotides, and a sense region having about 3 to about 18 nucleotides complementary to the antisense region. In some instances, the asymmetric hairpin polynucleic acid molecule further comprises a chemically modified 5'-terminal phosphate group. In further instances, the loop portion of the asymmetric hairpin polynucleic acid molecule comprises nucleotides, non-nucleotides, linker molecules, or conjugate molecules.

[0148] In some embodiments, an asymmetric duplex is a polynucleic acid molecule having two separate strands, including a sense region and an antisense region, where the sense region contains fewer nucleotides than the antisense region, such that the sense region has sufficient complementary nucleotides to base pair with the antisense region and form a duplex. For example, an asymmetric duplex polynucleic acid molecule includes an antisense region (e.g., about 19 to about 22 nucleotides) having a length sufficient to mediate RNAi in a cell or in an in vitro system, and a sense region having about 3 to about 18 nucleotides complementary to the antisense region.

[0149] In some cases, universal base refers to nucleotide base analogues that form base pairs with each of the few natural DNA / RNA bases.Non-limiting examples of universal bases include C-phenyl, C-naphthyl and other aromatic derivatives, inosine, azole carboxamide, and nitroazole derivatives such as 3-nitropyrrole, 4-nitroindole, 5-nitroindole and 6-nitroindole, as known in the prior art (see, for example, Loakes, 2001, Nucleic Acids Research, 29, 2437-2447).

[0150] Polynucleic acid molecule synthesis In some embodiments, the polynucleic acid molecules described herein are constructed using chemical synthesis and / or enzymatic ligation reactions, using procedures known in the art.For example, polynucleic acid molecules are chemically synthesized using naturally occurring nucleotides, or using various modified nucleotides designed to increase the biological stability of the molecule, or to increase the physical stability of the duplex formed between the polynucleic acid molecule and the target nucleic acid.Exemplary methods include those described in U.S. Patent Nos. 5,142,047; 5,185,444; 5,889,136; 6,008,400; and 6,111,086; PCT Publication No. WO2009099942; or European Publication No. 1579015.Additional exemplary methods include those described in: Griffey et al., "2'-O-aminopropyl ribonucleotides: a zwitterionic modification that enhances the exonuclease resistance and biological activity of antisense oligonucleotides," J. Med. Chem. 39(26):5100-5109 (1997)); Obika, et al. "Synthesis of 2'-O,4'-C-methyleneuridine and -cytidine. Novel bicyclic nucleosides having a fixed C3, -endo sugar puckering". Tetrahedron Letters 38 (50): 8735 (1997); Koizumi, M. "ENA oligonucleotides as therapeutics". Current opinion in molecular therapeutics 8 (2): 144-149 (2006); and Abramova et al., "Novel oligonucleotide analogues based on morpholino nucleoside subunits-antisense technologies: new Alternatively, the polynucleic acid molecule can be produced biologically using an expression vector into which the polynucleic acid molecule has been subcloned in an antisense orientation (i.e., the transcribed RNA of the inserted polynucleic acid molecule will be in an antisense orientation to the desired target polynucleic acid molecule).

[0151] In some embodiments, the polynucleic acid molecule is synthesized by a tandem synthesis method, where both strands are synthesized as a single contiguous oligonucleotide fragment or strand separated by a cleavable linker, which is subsequently cleaved to provide separate fragments or strands that hybridize to the duplex and allow purification of the duplex.

[0152] In some instances, the polynucleic acid molecule is also assembled from two distinct nucleic acid strands or fragments, where one fragment comprises the sense region and the second fragment comprises the antisense region of the molecule.

[0153] These are slightly less expensive than the rest of the world One of the most important of these is:Eckstein et al., PCT International Publication no. WO 92 / 07065; According to Perrault et al. Nature, 1990, 344, 565-568; Pieken et al. Science, 1991, 253, 314-317; Usman and Cedergren, Trends in Bi°Chem. Sci., 1992, 17, 334–339; Usman et al. International Publication PCT No. WO 93 / 15187; Sproat, US Pat. No. 5,334,711 and Beigelman et al., 1995, J. Biol. Chem., 270, 25702; Beigelman et al., International PCT publication no. WO 97 / 26270; Beigelman et al., US Pat. No. 5,716,824; Usman et al., US Pat. No. 5,627,053; Woolf et al., International PCT Publication no. WO 98 / 13526; Thompson et al., US Ser. No. 60 / 082,404 which was filed on Apr. 20, 1998; Karpeisky et al., 1998, Tetrahedron Lett., 39, 1131; Earnshaw and Gait, 1998, Biopolymers (Nucleic Acid Sciences), 48, 39-55; Verma and Eckstein , 1998 , Annu. Rev. Fr. Bi°Chem., 67, 99-134; and Burlina et al., 1997, Bioorg. Med. Chem., 5, 1999–2010.The publications described methods and strategies for determining the locations for incorporating sugar, base, and / or phosphate modifications into nucleic acid molecules without modulating catalysis.

[0154] In some instances, chemical modification of the internucleotide linkages of polynucleic acid molecules with phosphorothioate, dithiophosphate, and / or 5'-methylphosphonate linkages improves stability, while excessive modification often causes toxicity or reduced activity. Thus, when designing nucleic acid molecules, the amount of these internucleotide linkages is sometimes minimized. In such cases, reducing the concentration of these linkages reduces the toxicity of these molecules and increases their efficacy and high specificity.

[0155] Nucleic Acid Polypeptide Conjugates In some embodiments, the polynucleic acid molecule is further conjugated to a polypeptide A, which is delivered to a desired site. Optionally, the polynucleic acid molecule is conjugated to a polypeptide A and optionally to a polymer moiety.

[0156] In some examples, at least one polypeptide A is conjugated to at least one B. In some examples, at least one polypeptide A is conjugated to at least one B to form an AB conjugate. In some embodiments, at least one A is conjugated to the 5' end of B, the 3' end of B, an internal site of B, or any combination thereof. In some examples, at least one polypeptide A is conjugated to at least two Bs. In some examples, at least one polypeptide A is conjugated to at least 2, 3, 4, 5, 6, 7, 8, or more Bs.

[0157] In some embodiments, at least one polypeptide A is conjugated at one end of at least one B, while at least one C is conjugated at the opposite end of at least one B to form an ABC conjugate. In some examples, at least one polypeptide A is conjugated at one end of at least one B, while at least one C is conjugated at an internal site of at least one B. In some examples, at least one polypeptide A is directly conjugated to at least one C. In some examples, at least one B is indirectly conjugated to at least one polypeptide A via at least one C to form an ACB conjugate.

[0158] In some examples, at least one B and / or at least one C, and optionally at least one D, are conjugated to at least one polypeptide A. In some examples, at least one B is conjugated to at least one polypeptide A at a terminal end (e.g., at the 5' end or 3' end) or is conjugated to at least one polypeptide A via an internal site. In some cases, at least one C is conjugated to at least one polypeptide A directly or indirectly by at least one B. Indirectly, by at least one B, at least one C is conjugated at the same end as at least one polypeptide A on B, at the opposite end from at least one polypeptide A, or independently at an internal site. In some examples, at least one additional polypeptide A is further conjugated to at least one polypeptide A, B, or C. In further examples, at least one D is optionally conjugated to at least one polypeptide A, at least one B, or at least one C, directly or indirectly. When conjugated directly to at least one polypeptide A, the at least one D is also optionally conjugated to at least one B to form an ADB conjugate, or is optionally conjugated to at least one B and at least one C to form an ADBC ​​conjugate. In some examples, the at least one D is directly conjugated to at least one polypeptide A and indirectly conjugated to at least one B and at least one C to form a DABC conjugate. When conjugated indirectly to at least one polypeptide A, the at least one D is also optionally conjugated to at least one B to form an ABD conjugate, or is optionally conjugated to at least one B and at least one C to form an ABDC conjugate. In some examples, the at least one additional D is further conjugated to at least one polypeptide A, B, or C.

[0159] In some embodiments, the polynucleic acid molecule conjugate comprises a construct as exemplified:

[0160] [ka]

[0161] In some embodiments, the polynucleic acid molecule conjugate comprises a construct as exemplified:

[0162] [ka]

[0163] In some embodiments, the polynucleic acid molecule conjugate comprises a construct as exemplified:

[0164] [ka]

[0165] In some embodiments, the polynucleic acid molecule conjugate comprises a construct as exemplified:

[0166] [ka]

[0167] In some embodiments, the polynucleic acid molecule conjugate comprises a construct as exemplified:

[0168] [ka]

[0169] In some embodiments, the polynucleic acid molecule conjugate comprises a construct as exemplified:

[0170] [ka]

[0171] In some embodiments, the polynucleic acid molecule conjugate comprises a construct as exemplified:

[0172] [ka]

[0173] In some embodiments, the polynucleic acid molecule conjugate comprises a construct as exemplified:

[0174] [ka]

[0175] In some embodiments, the polynucleic acid molecule conjugate comprises a construct as exemplified:

[0176] [ka]

[0177] In some embodiments, the polynucleic acid molecule conjugate comprises a construct as exemplified:

[0178] [ka]

[0179] In some embodiments, the polynucleic acid molecule conjugate comprises a construct as exemplified:

[0180] [ka]

[0181] In some embodiments, the polynucleic acid molecule conjugate comprises a construct as exemplified:

[0182] [ka]

[0183] As shown above

[0184] [ka] includes, by way of example only, a humanized antibody or binding fragment thereof, a chimeric antibody or binding fragment thereof, a monoclonal antibody or binding fragment thereof, a monovalent Fab', a bivalent Fab2, a single chain variable fragment (scFv), a diabody, a minibody, a nanobody, a single domain antibody (sdAb), or a camelid antibody, or binding fragment thereof.

[0185] joining part In some embodiments, binding moiety A is a polypeptide. In some examples, the polypeptide is an antibody or a fragment thereof. In some cases, the fragment is a binding fragment. In some examples, the antibody or binding fragment thereof comprises a humanized antibody or a binding fragment thereof, a murine antibody or a binding fragment thereof, a chimeric antibody or a binding fragment thereof, a monoclonal antibody or a binding fragment thereof, a monovalent Fab', a bivalent Fab2, a F(ab)'3 fragment, a single chain variable fragment (scFv), a bis-scFv (scFv)2, a diabody, a minibody, a nanobody, a triabody, a tetrabody, a disulfide stabilized Fv protein (dsFv), a single domain antibody (sdAb), an Ig NAR, a camelid antibody or a binding fragment thereof, a bispecific antibody or a binding fragment thereof, or a chemically modified derivative thereof.

[0186] In some examples, A is an antibody or binding fragment thereof. In some examples, A is a humanized antibody or binding fragment thereof, a murine antibody or binding fragment thereof, a chimeric antibody or binding fragment thereof, a monoclonal antibody or binding fragment thereof, a monovalent Fab', a bivalent Fab2, a F(ab)'3 fragment, a single chain variable fragment (scFv), a bis-scFv (scFv)2, a diabody, a minibody, a nanobody, a triabody, a tetrabody, a disulfide stabilized Fv protein ("dsFv"), a single domain antibody (sdAb), an Ig NAR, a camelid antibody or binding fragment thereof, a bispecific antibody or binding fragment thereof, or a chemically modified derivative thereof. In some examples, A is a humanized antibody or binding fragment thereof. In some examples, A is a murine antibody or binding fragment thereof. In some examples, A is a chimeric antibody or binding fragment thereof. In some examples, A is a monoclonal antibody or binding fragment thereof. In some examples, A is a monovalent Fab'. In some examples, A is a bivalent Fab2. In some examples, A is a single chain variable fragment (scFv).

[0187] In some embodiments, binding moiety A is a bispecific antibody or a binding fragment thereof. In some examples, the bispecific antibody is a trispecific antibody or a bispecific miniantibody. In some cases, the bispecific antibody is a trispecific antibody. In some examples, the trispecific antibody is a full-length monoclonal antibody that contains binding sites for two different antigens.

[0188] In some cases, the bispecific antibody is a bispecific miniantibody. In some examples, the bispecific miniantibody comprises a bivalent Fab2, F(ab)'3 fragment, a bis-scFv (scFv)2, a diabody, a minibody, a triabody, a tetrabody, or a bispecific T cell engager (BiTE). In some embodiments, the bispecific T cell engager is a fusion protein comprising two single chain variable fragments (scFvs), where the two scFvs target epitopes of two different antigens.

[0189] In some embodiments, binding moiety A is a bispecific miniantibody. In some examples, A is a bispecific Fab2. In some examples, A is a bispecific F(ab)'3 fragment. Optionally, A is a bispecific bis-scFv. Optionally, A is a bispecific (scFv). In some embodiments, A is a bispecific diabody. In some embodiments, A is a bispecific minibody. In some embodiments, A is a bispecific triabody. In other embodiments, A is a bispecific tetrabody. In other embodiments, A is a bispecific T cell engager (BiTE).

[0190] In some embodiments, binding moiety A is a trispecific antibody. In some examples, the trispecific antibody comprises a F(ab)'3 fragment or a trispecific antibody. In some examples, A is a trispecific F(ab)'3 fragment. In some cases, A is a trispecific antibody. In some embodiments, A is a trispecific antibody as described in Dimas, et al., "Development of a trispecific antibody designed to simultaneously and efficiently target three different antigens on tumor cells," Mol. Pharmaceutics, 12(9): 3490-3501 (2015).

[0191] In some embodiments, binding moiety A is an antibody or binding fragment thereof that recognizes a cell surface protein. In some examples, binding moiety A is an antibody or binding fragment thereof that recognizes a cell surface protein on muscle cells. Exemplary cell surface proteins recognized by antibodies or binding fragments thereof include, but are not limited to, Sca-1, CD34, Myo-D, myogenin, MRF4, NCAM, CD43, and CD95 (Fas).

[0192] In some examples, the cell surface protein comprises a cluster of differentiation (CD) cell surface marker. Exemplary CD cell surface markers include, but are not limited to, CD1, CD2, CD3, CD4, CD5, CD6, CD7, CD8, CD9, CD10, CD11a, CD11b, CD11c, CD11d, CDw12, CD13, CD14, CD15, CD15s, CD16, CDw17, CD18, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD26, CD27, CD28, CD29, CD30, CD31, CD32, CD33, CD34, CD35, CD36, CD37, CD38, CD39, CD40, CD41, CD42, CD43, CD44, CD45, CD46, CD47, CD48, CD49, CD50, CD51, CD52, CD53, CD54, CD55, CD56, CD57, CD58, CD59, CD60, CD61, CD62, CD63, CD64, CD65, CD66, CD67, CD68, CD69, CD70, CD71, CD72, CD73, CD74, CD75, CD76, CD77, CD78, CD79, CD80, CD81, CD82, CD83, CD84, CD85, CD86, CD87, CD88, CD89, CD90, CD91, CD92, CD93, CD94, CD95, CD96, CD97, CD98, CD99, CD100, CD101, CD102, CD103, CD104, CD105, CD106, CD107, CD108, CD109, CD110, CD111, CD1 D45, CD45RO, CD45RA, CD45RB, CD46, CD47, CD48, CD49a, CD49b, CD49c, CD49d, CD49e, CD49f, CD50, CD51, CD52, CD53, CD54, CD55, CD56, CD57, CD58, CD59, CDw60, CD61, CD62E, CD62L (L-selectin), CD62P, CD63, CD64, CD65, CD66a, CD66b, CD66c, CD66d, CD66e, CD79 (e.g., CD79a, CD79b), CD90, CD95 (Fas), CD103, CD104, CD125 (IL5RA), CD134 (OX40), CD137 (4-1BB), CD152 (CTLA-4), CD221, CD274, CD279 (PD-1), CD319 (SLAMF7), CD326 (EpCAM), etc.

[0193] In some embodiments, the restricting moiety A is an antibody or binding fragment thereof that recognizes a CD cell surface marker. In some embodiments, the binding moiety A is an antibody or binding fragment thereof that recognizes a CD cell surface marker. In some embodiments, the binding moiety A is an antibody or binding fragment thereof that recognizes a CD cell surface marker. In some embodiments, the binding moiety A is an antibody or binding fragment thereof that recognizes a CD cell surface marker. In some embodiments, the binding moiety A is an antibody or binding fragment thereof that recognizes a CD cell surface marker. , CD27, CD28, CD29, CD30, CD31, CD32, CD33, CD34, CD35, CD36, CD37, CD38, CD39, CD40, CD41, CD42, C D43, CD44, CD45, CD45RO, CD45RA, CD45RB, CD46, CD47, CD48, CD49a, CD49b, CD49c, CD49d, CD49e, CD 49f, CD50, CD51, CD52, CD53, CD54, CD55, CD56, CD57, CD58, CD59, CDw60, CD61, CD62E, CD62L (L-selectin), CD62P, CD63, CD64, CD65, CD66a, CD66b, CD66c, CD66d, CD66e, CD79 (e.g., CD79a, CD79b), CD90 , CD95 (Fas), CD103, CD104, CD125 (IL5RA), CD134 (OX40), CD137 (4-1BB), CD152 (CTLA-4), CD221, CD274, CD279 (PD-1), CD319 (SLAMF7), CD326 (EpCAM), or a combination thereof, or a binding fragment thereof.

[0194] In some embodiments, binding moiety A is conjugated non-specifically to polynucleic acid molecule (B). In some instances, binding moiety A is conjugated in a non-site specific manner to polynucleic acid molecule (B) via a lysine or cysteine ​​residue. In some instances, binding moiety A is conjugated in a non-site specific manner to polynucleic acid molecule (B) via a lysine residue. In some instances, binding moiety A is conjugated in a non-site specific manner to polynucleic acid molecule (B) via a cysteine ​​residue.

[0195] In some embodiments, the binding moiety A is conjugated to the polynucleic acid molecule (B) in a non-site specific manner. In some examples, the binding moiety A is conjugated to the polynucleic acid molecule (B) in a site specific manner via a lysine residue, a cysteine ​​residue, at the 5'-end, at the 3'-end, at an unnatural amino acid, or at an enzyme-modified or enzyme-catalyzed residue. In some examples, the binding moiety A is conjugated to the polynucleic acid molecule (B) in a site specific manner via a lysine residue. In some examples, the binding moiety A is conjugated to the polynucleic acid molecule (B) in a site specific manner via a cysteine ​​residue. In some examples, the binding moiety A is conjugated to the polynucleic acid molecule (B) in a site specific manner at the 5'-end. In some examples, the binding moiety A is conjugated to the polynucleic acid molecule (B) in a site specific manner at the 3'-end. In some examples, the binding moiety A is conjugated to the polynucleic acid molecule (B) in a site specific manner via an unnatural amino acid. In some instances, the binding moiety A is conjugated to the polynucleic acid molecule (B) via an enzyme-modified or enzyme-catalyzed residue in a site-specific manner.

[0196] In some embodiments, one or more polynucleic acid molecules (B) are conjugated to binding moiety A. In some examples, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more polynucleic acid molecules are conjugated to one binding moiety A. In some examples, about 1 polynucleic acid molecule is conjugated to one binding moiety A. In some examples, about 2 polynucleic acid molecules are conjugated to one binding moiety A. In some examples, about 3 polynucleic acid molecules are conjugated to one binding moiety A. In some examples, about 4 polynucleic acid molecules are conjugated to one binding moiety A. In some examples, about 5 polynucleic acid molecules are conjugated to one binding moiety A. In some examples, about 6 polynucleic acid molecules are conjugated to one binding moiety A. In some examples, about 7 polynucleic acid molecules are conjugated to one binding moiety A. In some examples, about 8 polynucleic acid molecules are conjugated to one binding moiety A. In some examples, about 9 polynucleic acid molecules are conjugated to one binding moiety A. In some examples, about 10 polynucleic acid molecules are conjugated to one binding moiety A. In some examples, about 11 polynucleic acid molecules are conjugated to one binding moiety A. In some examples, about 12 polynucleic acid molecules are conjugated to one binding moiety A. In some examples, about 13 polynucleic acid molecules are conjugated to one binding moiety A. In some examples, about 14 polynucleic acid molecules are conjugated to one binding moiety A. In some examples, about 15 polynucleic acid molecules are conjugated to one binding moiety A. In some examples, about 16 polynucleic acid molecules are conjugated to one binding moiety A. In some cases, one or more of the polynucleic acid molecules are the same. In other examples, one or more of the polynucleic acid molecules are different.

[0197] In some embodiments, the number of polynucleic acid molecules (B) conjugated to binding moiety A forms a ratio. In some examples, the ratio is referred to as a DAR (drug to antibody) ratio, and the drug as referred to herein is the polynucleic acid molecule (B). In some examples, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more. In some examples, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 1 or more. In some examples, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 2 or more. In some examples, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 3 or more. In some examples, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 4 or more. In some examples, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 5 or more. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 6 or greater. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 7 or greater. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 8 or greater. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 9 or greater. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 10 or greater. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 11 or greater. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 12 or greater.

[0198] In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 1. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 2. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 3. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 4. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 5. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 6. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 7. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 8. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 9. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 10. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 11. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 12. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 13. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 14. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 15. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 16.

[0199] In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is 1. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is 2. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is 4. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is 6. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is 8. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is 12.

[0200] In some examples, a conjugate comprising a polynucleic acid molecule (B) and a binding moiety A has improved activity compared to a conjugate comprising a polynucleic acid molecule (B) without a binding moiety A. In some examples, the improved activity results in an enhancement of a biologically relevant function, such as improved stability, affinity, binding, functional activity, and efficacy in treating or preventing a disease condition. In some examples, the disease condition is the result of one or more mutated exons of a gene. In some examples, a conjugate comprising a polynucleic acid molecule (B) and a binding moiety A results in increased exon skipping of one or more mutated exons compared to a conjugate comprising a polynucleic acid molecule (B) without a binding moiety A. In some examples, exon skipping is increased by at least or about 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more in a conjugate comprising polynucleic acid molecule (B) and binding moiety A compared to a conjugate comprising polynucleic acid molecule (B) without binding moiety A.

[0201] In some embodiments, the antibody or binding fragment thereof is further modified, alone or in combination, using conventional techniques known in the art, for example, by using amino acid deletion, insertion, substitution, addition, and / or recombination, and / or other modifications known in the art (e.g., post-translational and chemical modifications such as glycosylation and phosphorylation). In some examples, the modifications further include modifications to modulate interaction with Fc receptors. In some examples, one or more modifications include, for example, those described in International Publication No. WO 97 / 34631, which discloses amino acid residues involved in the interaction between the Fc domain and the FcRn receptor. Methods for introducing such modifications into the nucleic acid sequence underlying the amino acid sequence of the antibody or binding fragment thereof are well known to those skilled in the art.

[0202] In some instances, an antibody binding fragment further includes derivatives thereof and comprises a polypeptide sequence comprising at least one CDR.

[0203] In some instances, the term "single-chain" as described herein means that the first and second domains of the bispecific single-chain construct are covalently linked, preferably in the form of a colinear amino acid sequence that can be encoded by a single nucleic acid molecule.

[0204] In some instances, the bispecific single chain antibody construct relates to a construct comprising binding domains from two antibodies. In such an embodiment, the bispecific single chain antibody construct is a tandem bi-scFv or diabody. In some instances, the scFv comprises a VH and a VL domain connected by a linker peptide. In some instances, the linker is of sufficient length and sequence to allow each of the first and second domains to retain their differential binding specificity independently of each other.

[0205] In some embodiments, as used herein, binding with or interaction by defines the binding / interaction of at least two antigen interaction sites with each other. In some examples, the antigen interaction site defines a motif of a polypeptide that exhibits a capacity for a specific interaction with a specific antigen or a specific group of antigens. In some cases, the binding / interaction is also understood to define a specific recognition. In such cases, the specific recognition refers to the ability of an antibody or a binding fragment thereof to specifically interact and / or bind to at least two amino acids of each of the target molecules. For example, the specific recognition relates to the specificity of the antibody molecule or its ability to distinguish a specific range of target molecules. In additional examples, the specific interaction of the antigen interaction site with its specific antigen results in the initiation of a signal, for example, by inducing a conformational change of the antigen, oligomerization of the antigen, and the like. In further embodiments, the binding is exemplified by the specificity of the "key-lock-principle". Thus, in some examples, the antigen interaction site and the specific motif in the amino acid sequence of the antigen bind to each other as a result of their primary, secondary, or tertiary structure, as well as as a result of a second modification of said structure. In such cases, the specific interaction of the antigen interaction site with its specific antigen results in the simple binding of the site to the antigen.

[0206] In some instances, specific interaction further refers to reduced cross-reactivity of an antibody or its binding fragment, or reduced off-target effects. For example, an antibody or its binding fragment that binds to a desired polypeptide / protein but does not essentially bind to any other polypeptide is considered to be specific for the desired polypeptide / protein. Specificity of antigen interaction site Examples of specific interactions with an antigen include the specificity of a ligand with its receptor, for example, the interaction of a group of antigenic determinants (epitopes) with the antigen binding site of an antibody.

[0207] Conjugation Chemistry In some embodiments, polynucleic acid molecule B is conjugated to a binding moiety. In some examples, the binding moiety includes amino acids, peptides, polypeptides, proteins, antibodies, antigens, toxins, hormones, lipids, nucleotides, nucleosides, sugars, carbohydrates, polymers such as polyethylene glycol and polypropylene glycol, as well as all analogs or derivatives of these classes of substances. Additional examples of binding moieties further include cholesterol, phospholipids, diacylglycerol and triacylglycerol, fatty acids, carbohydrates (e.g., saturated, unsaturated, or substituted), enzyme substrates, steroids such as biotin, digoxigenin, and polysaccharides. In some examples, the binding moiety is an antibody or binding fragment thereof. In some examples, the polynucleic acid molecule is further conjugated to a polymer, and optionally to an endosomolytic moiety.

[0208] In some embodiments, the polynucleic acid molecule is conjugated to the binding moiety by a chemical ligation process. In some examples, the polynucleic acid molecule is conjugated to the binding moiety by native ligation. In some instances, the conjugation can be accomplished using methods such as those described in Dawson, et al. "Synthesis of proteins by native chemical ligation," Science 1994, 266, 776-779; Dawson, et al. "Modulation of Reactivity in Native Chemical Ligation through the Use of Thiol Additives," J. Am. Chem. Soc. 1997, 119, 4325-4329; Hackeng, et al. "Protein synthesis by native chemical ligation: Expanded scope by using straightforward methodology.," Proc. Natl. Acad. Sci. USA 1999, 96, 10068-10073; or Wu, et al. "Building complex glycopeptides: Development of a cysteine-free native chemical ligation protocol," Angew. Chem. Int. Ed. 2006, 45, 4116-4125. In some examples, conjugation is as described in U.S. Patent No. 8,936,910. In some embodiments, the polynucleic acid molecules are site-specifically or non-specifically conjugated to binding moieties via native ligation chemistry.

[0209] In some instances, polynucleic acid molecules are conjugated to binding moieties in a site-directed manner using "traceless" coupling technology (PhiloChem). In some instances, the "traceless" coupling technology utilizes N-terminal 1,2-aminothiol groups of the binding moiety that are then conjugated to polynucleic acid molecules that contain aldehyde groups. (See Casi et al., "Site-specific traceless coupling of potent cytotoxic drugs to recombinant antibodies for pharmacodelivery," JACS 134(13): 5887-5892 (2012)).

[0210] In some examples, the polynucleic acid molecule is conjugated to the binding moiety by a site-directed method utilizing an unnatural amino acid introduced into the binding moiety. In some examples, the unnatural amino acid comprises p-acetylphenylalanine (pAcPhe). In some examples, the keto group of pAcPhe is selectively attached to an alkoxy-amine derived conjugate moiety to form an oxime bond. (See Axup et al., "Synthesis of site-specific antibody-drug conjugates using unnatural amino acids," PNAS 109(40): 16101-16106 (2012)).

[0211] In some examples, polynucleic acid molecules are conjugated by a site-directed method utilizing an enzyme-catalyzed process. In some examples, the site-directed method utilizes SMARTag™ technology (Redwood). In some examples, SMARTag™ technology involves the generation of formylglycine (FGly) residues from cysteine ​​by formylglycine generating enzyme (FGE) via an oxidation process in the presence of an aldehyde tag, and the subsequent conjugation of FGly to an alkylhydrazine-functionalized polynucleic acid molecule via hydrazino-Pictet-Spengler (HIPS) ligation. (See Wu et al., “Site-specific chemical modification of recombinant proteins produced in mammalian cells by using the genetically encoded aldehyde tag,” PNAS 106(9): 3000-3005 (2009); Agarwal, et al., “A Pictet-Spengler ligation for protein chemical modification,” PNAS 110(1): 46-51 (2013))

[0212] In some examples, the enzyme-catalyzed process includes microbial transglutaminase (mTG). In some examples, the polynucleic acid molecule is conjugated to the binding moiety using a microbial transglutaminase-catalyzed process. In some examples, mTG catalyzes the formation of a covalent bond between the amide side chain of a glutamine in the recognition sequence and a primary amine of the functionalized polynucleic acid molecule. In some examples, mTG is produced from Streptomyces mobaraensis. (See Strop et al., “Location matters: site of conjugation modulates stability and pharmacokinetics of antibody drug conjugates,” Chemistry and Biology 20(2) 161-167 (2013))

[0213] In some examples, the polynucleic acid molecule is conjugated to the binding moiety by the methods described in WO2014 / 140317, which utilize sequence-specific transpeptidases.

[0214] In some examples, the polynucleic acid molecules are conjugated to the binding moieties by methods such as those described in U.S. Patent Publication Nos. 2015 / 0105539 and 2015 / 0105540.

[0215] Production of antibodies or binding fragments thereof In some embodiments, the polypeptides described herein (e.g., antibodies and binding fragments thereof) are produced using any method known in the art to aid in the synthesis of polypeptides (e.g., antibodies), particularly by chemical synthesis or by recombinant expression, and are preferably produced by recombinant expression techniques.

[0216] In some instances, antibodies or binding fragments thereof are recombinantly expressed and nucleic acids encoding the antibodies or binding fragments thereof are assembled from chemically synthesized oligonucleotides (e.g., as described in Kutmeier et al., 1994, BioTechniques 17:242), which involves using PCR to synthesize overlapping oligonucleotide-containing portions of the antibody-encoding sequence, annealing and ligating those oligonucleotides, and then amplifying the ligated oligonucleotides.

[0217] Alternatively, nucleic acid molecules encoding antibodies are optionally produced from a suitable source (e.g., an antibody cDNA library, or a cDNA library generated from any tissue or cell expressing immunoglobulins) by PCR amplification using synthetic primers capable of hybridizing to the 3' and 5' ends of the sequence, or by cloning using oligonucleotide probes specific for the particular gene sequence.

[0218] In some examples, the antibody or binding thereof is optionally produced by immunizing an animal such as a rabbit to produce polyclonal antibodies, or more preferably, by producing monoclonal antibodies, e.g., as described by Kohler and Milstein (1975, Nature 256:495-497), or by Kozbor et al. (1983, Immunology Today 4:72) or Cole et al. (1985 in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). Alternatively, clones encoding at least the Fab portion of the antibody can optionally be obtained by screening Fab expression libraries (e.g., as described in Huse et al., 1989, Science 246:1275-1281) for clones of FAb fragments that bind specific antigens, or by screening antibody libraries (see Clackson et al., 1991, Nature 352:624; Hane et al., 1997 Proc. Natl. Acad. Sci. USA 94:4937).

[0219] In some embodiments, techniques developed for the production of "chimeric antibodies" (Morrison et al., 1984, Proc. Natl. Acad. Sci. 81:851-855; Neuberger et al., 1984, Nature 312:604-608; Takeda et al., 1985, Nature 314:452-454) by splicing genes from a mouse antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity are used. Chimeric antibodies are molecules in which different portions are derived from different animal species, such as those having a variable region derived from a mouse monoclonal antibody and a human immunoglobulin constant region (e.g., humanized antibodies).

[0220] In some embodiments, techniques described for the production of single chain antibodies (US Pat. No. 4,694,778; Bird, 1988, Science 242:423-42; Huston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; and Ward et al., 1989, Nature 334:544-54) are suitable for producing single chain antibodies. Single chain antibodies are formed by linking heavy or light chain fragments of the Fv region by an amino acid bridge to produce a single chain polypeptide. Techniques for the assembly of functional Fv fragments in E. coli are also optionally used (Skerra et al., 1988, Science 242:1038-1041).

[0221] In some embodiments, an expression vector containing an antibody nucleotide sequence or the antibody nucleotide sequence is introduced into a host cell by conventional techniques (e.g., electroporation, liposomal transfection, and calcium phosphate precipitation) and the transfected cells are then cultured by conventional techniques to produce the antibody. In certain embodiments, expression of the antibody is regulated by a constitutive, inducible, or tissue-specific promoter.

[0222] In some embodiments, a variety of host-expression vector systems are utilized to express the antibodies or binding fragments thereof described herein. Such host-expression systems represent vehicles in which antibody coding sequences are produced and subsequently purified, but also represent cells which, when transformed or transfected with the appropriate nucleotide coding sequences, express the antibodies or binding fragments thereof in situ. These include, but are not limited to, microorganisms such as bacteria (e.g., E. coli and Bacillus subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA, or cosmid DNA expression vectors containing the antibody or binding fragment coding sequence; yeast (e.g., Saccharomyces pichia) transformed with recombinant yeast expression vectors containing the antibody or binding fragment coding sequence; insect cell systems (e.g., baculovirus) infected with recombinant virus expression vectors containing the antibody or binding fragment coding sequence; plant cell systems infected with recombinant virus expression vectors (e.g., Cauliflower Mosaic Virus (CaMV) and Tobacco Mosaic Virus (TMV)) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing the antibody or binding fragment coding sequence; or mammalian cell systems (e.g., COS, CHO, BH, 293, 293T, 3T3 cells) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., the metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter).

[0223] For long-term and high-yield production of recombinant proteins, stable expression is preferred. In some instances, cell lines that stably express antibodies are optionally engineered. Rather than using expression vectors containing viral origins of replication, host cells are transformed with DNA controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.) and selectable markers. After introduction of the foreign DNA, cells are engineered to grow in enriched medium for 1-2 days and then switched to selective medium. The selectable marker in the recombinant plasmid confers resistance to selection, allowing the cells to stably integrate the plasmid into their chromosomes and grow to form foci that are cloned and spread into cell lines. This method can be advantageously used to engineer cell lines that advantageously express antibodies or binding fragments thereof.

[0224] In some instances, a number of selection systems are used, including, but not limited to, herpes simplex virus thymidine kinase (Wigler et al., 1977, Cell 11:223), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, 192, Proc. Natl. Acad. Sci. USA 48:202), and adenine phosphoribosyltransferase (Lowy et al., 1980, Cell 22:817) genes employed in tk-, hgprt-, or aprt- cells, respectively. Similarly, antimetabolite resistance is used as the selection criterion for the following genes: dhfr, which confers resistance to methotrexate (Wigler et al., 1980, Proc. Natl. Acad. Sci. USA 77:357; O'Hare et al., 1981, Proc. Natl. Acad. Sci. USA 78:1527); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072); neo, which confers resistance to the aminoglycoside G-418 (Clinical Pharmacy 12:488-505; Wu and Wu, 1991, Biotherapy 3:87-95; Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol. 32:573-596; Mulligan, 1993, Science 260:926-932; and Morgan and Anderson, 1993, Ann. Rev. Biochem. 62:191-217; May, 1993, TIB TECH 11(5):155-215), and hygro, which confers resistance to hygromycin (Santerre et al., 1984, Gene 30:147).Methods known in the art of recombinant DNA technology that can be used are generally described in Ausubel et al. (eds., 1993, Current Protocols in Molecular Biology, John Wiley & Sons, NY; Kriegler, 1990, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY; and in Chapters 12 and 13, Dracopoli et al. (eds), 1994, Current Protocols in Human Genetics, John Wiley & Sons, NY.; Colberre-Garapin et al., 1981, J. Mol. Biol. 150:1).

[0225] In some instances, antibody expression levels are increased by vector amplification (for review, see Bebbington and Hentschel, The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning, Vol. 3. (Academic Press, New York, 1987)). When the marker in the antibody expression vector system is amplifiable, increasing the level of inhibitor present in the host cell culture increases the number of copies of the marker gene. Because the amplified region is related to the antibody nucleotide sequence, antibody production also increases (Crouse et al., 1983, Mol. Cell Biol. 3:257).

[0226] In some examples, any method known in the art for purification or analysis of antibodies or antibody conjugates is used, such as, for example, by chromatography (e.g., ion exchange, affinity, especially affinity to specific antigens followed by Protein A and sizing column chromatography), centrifugation, differential solubility, or other standard techniques for purification of proteins. Exemplary chromatographic methods include, but are not limited to, strong anion exchange chromatography, hydrophobic interaction chromatography, size exclusion chromatography, and fast protein liquid chromatography.

[0227] Polymer conjugated moiety In some embodiments, the polymer moiety C is further conjugated to a polynucleic acid molecule as described herein, a binding moiety as described herein, or a combination thereof. In some examples, the polymer moiety C is conjugated to a polynucleic acid molecule. In some cases, the polymer moiety C is conjugated to a binding moiety. In other cases, the polymer moiety C is conjugated to a polynucleic acid molecule binding moiety. In further cases, the polymer moiety C is conjugated as illustrated above.

[0228] In some examples, the polymer moiety C is a natural or synthetic polymer consisting of long chains of branched or unbranched monomers and / or crosslinked networks of two- or three-dimensional monomers. In some examples, the polymer moiety C includes polysaccharides, lignin, rubber, or polyalkylene oxides (e.g., polyethylene glycol). In some examples, at least one polymer moiety C includes, but is not limited to, alpha, omega-dihydroxyl polyethylene glycol, biodegradable lactone-based polymers such as polyacrylic acid, polylactide acid (PLA), poly(glycolic acid) (PGA), polypropylene, polystyrene, polyolefins, polyamides, polycyanoacrylates, polyimides, polyethylene terephthalate (PET, PETG), polyethylene terephthalate (PETE), polytetramethylene glycol (PTG), or polyurethanes, and mixtures thereof. As used herein, a mixture refers to the use of various polymers within the same compound, as in the context of a block copolymer. In some cases, a block copolymer is a polymer in which at least one portion of the polymer is constructed from monomers of another polymer. In some examples, polymer portion C includes a polyalkylene oxide. In some examples, polymer portion C includes a PEG. In some examples, polymer portion C includes a polyethyleneimide (PEI) or a hydroxyethyl starch (HES).

[0229] In some examples, C is a PEG moiety. In some examples, the PEG moiety is conjugated at the 5' end of the polynucleic acid molecule, while the linking moiety is conjugated at the 3' end of the polynucleic acid molecule. In some examples, the PEG moiety is conjugated at the 3' end of the polynucleic acid molecule, while the linking moiety is conjugated at the 5' end of the polynucleic acid molecule. In some examples, the PEG moiety is conjugated to an internal site of the polynucleic acid molecule. In some examples, the PEG moiety, the linking moiety, or a combination thereof, is conjugated to an internal site of the polynucleic acid molecule. In some examples, the conjugation is a direct conjugate. In some examples, the conjugation is via native ligation.

[0230] In some embodiments, the polyalkylene oxide (e.g., PEG) is a polydisperse or monodisperse compound. In some examples, a polydisperse material comprises a dispersed distribution of materials of different molecular weights, characterized by average weight (weight average) size and dispersity. In some examples, a monodisperse PEG comprises molecules of one size. In some embodiments, C is a polydisperse or monodisperse polyalkylene oxide (e.g., PEG), and the molecular weight given represents the average molecular weight of the polyalkylene oxide (e.g., PEG) molecules.

[0231] In some embodiments, the molecular weight of the polyalkylene oxide (e.g., PEG) is about 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1450, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 260 0, 2700, 2800, 2900, 3000, 3250, 3350, 3500, 3750, 4000, 4250, 4500, 4600, 4750, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 10,000, 12,000, 20,000, 35,000, 40,000, 50,000, 60,000, or 100,000 Da.

[0232] In some embodiments, C is a polyalkylene oxide (e.g., PEG) and is about 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1450, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 260 having a molecular weight of 0, 2700, 2800, 2900, 3000, 3250, 3350, 3500, 3750, 4000, 4250, 4500, 4600, 4750, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 10,000, 12,000, 20,000, 35,000, 40,000, 50,000, 60,000, or 100,000 Da. In some embodiments, C is PEG and is 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1450, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, 4500, 4600, 4700, 4800, 4900, 5000, 5100, 5200, 5300, 5400, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500, 6600, 6700, 6800, 6900, 7000, 7100, 7200, 7300, 7400, 7500, 7600, 7700, 7800, 7900, 8000, 8100, 8200, 8300, 8400, 8500 In some examples, the molecular weight of C is about 200 Da. In some examples, the molecular weight of C is about 300 Da. In some examples, the molecular weight of C is about 400 Da. In some examples, the molecular weight of C is about 500 Da. In some examples, the molecular weight of C is about 600 Da. In some examples, the molecular weight of C is about 700 Da. In some examples, the molecular weight of C is about 800 Da. In some examples, the molecular weight of C is about 900 Da. In some examples, the molecular weight of C is about 1000 Da. In some examples, the molecular weight of C is about 1100 Da. In some examples, the molecular weight of C is about 1200 Da. In some examples, the molecular weight of C is about 1300 Da. In some examples, the molecular weight of C is about 1400 Da.In some examples, the molecular weight of C is about 1450 Da. In some examples, the molecular weight of C is about 1500 Da. In some examples, the molecular weight of C is about 1600 Da. In some examples, the molecular weight of C is about 1700 Da. In some examples, the molecular weight of C is about 1800 Da. In some examples, the molecular weight of C is about 1900 Da. In some examples, the molecular weight of C is about 2000 Da. In some examples, the molecular weight of C is about 2100 Da. In some examples, the molecular weight of C is about 2200 Da. In some examples, the molecular weight of C is about 2300 Da. In some examples, the molecular weight of C is about 2400 Da. In some examples, the molecular weight of C is about 2500 Da. In some examples, the molecular weight of C is about 2600 Da. In some examples, the molecular weight of C is about 2700 Da. In some examples, the molecular weight of C is about 2800 Da. In some examples, the molecular weight of C is about 2900 Da. In some examples, the molecular weight of C is about 3000 Da. In some examples, the molecular weight of C is about 3250 Da. In some examples, the molecular weight of C is about 3350 Da. In some examples, the molecular weight of C is about 3500 Da. In some examples, the molecular weight of C is about 3750 Da. In some examples, the molecular weight of C is about 4000 Da. In some examples, the molecular weight of C is about 4250 Da. In some examples, the molecular weight of C is about 4500 Da. In some examples, the molecular weight of C is about 4600 Da. In some examples, the molecular weight of C is about 4750 Da. In some examples, the molecular weight of C is about 5000 Da. In some examples, the molecular weight of C is about 5500 Da. In some examples, the molecular weight of C is about 6000 Da. In some examples, the molecular weight of C is about 6500 Da. In some examples, the molecular weight of C is about 7000 Da. In some examples, the molecular weight of C is about 7500 Da. In some examples, the molecular weight of C is about 8,000 Da. In some examples, the molecular weight of C is about 10,000 Da. In some examples, the molecular weight of C is about 12,000 Da. In some examples, the molecular weight of C is about 20,000 Da. In some examples, the molecular weight of C is about 35,000 Da. In some examples, the molecular weight of C is about 40,000 Da.In some examples, the molecular weight of C is about 50,000 Da. In some examples, the molecular weight of C is about 60,000 Da. In some examples, the molecular weight of C is about 100,000 Da.

[0233] In some embodiments, the polyalkylene oxide (e.g., PEG) comprises discrete ethylene oxide units (e.g., 4 to about 48 ethylene oxide units). In some instances, the polyalkylene oxide comprising discrete ethylene oxide units is linear. In other instances, the polyalkylene oxide comprising discrete ethylene oxide units is branched.

[0234] In some examples, the polymer portion C is a polyalkylene oxide (e.g., PEG) containing discrete ethylene oxide units. In some cases, the polymer portion C contains about 4 to about 48 ethylene oxide units. In some cases, the polymer portion C contains about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 41, about 42, about 43, about 44, about 45, about 46, about 47, or about 48 ethylene oxide units.

[0235] In some examples, polymer portion C comprises another PEG comprising, for example, about 4 to about 48 ethylene oxide units. In some cases, polymer portion C is a separate PEG comprising, for example, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 41, about 42, about 43, about 44, about 45, about 46, about 47, or about 48 ethylene oxide units. In some cases, polymer portion C is a separate PEG comprising, for example, about 4 ethylene oxide units. In some cases, the polymer moieties C are, for example, separate PEGs containing about 5 ethylene oxide units. In some cases, the polymer moieties C are, for example, separate PEGs containing about 6 ethylene oxide units. In some cases, the polymer moieties C are, for example, separate PEGs containing about 7 ethylene oxide units. In some cases, the polymer moieties C are, for example, separate PEGs containing about 8 ethylene oxide units. In some cases, the polymer moieties C are, for example, separate PEGs containing about 9 ethylene oxide units. In some cases, the polymer moieties C are, for example, separate PEGs containing about 10 ethylene oxide units. In some cases, the polymer moieties C are, for example, separate PEGs containing about 11 ethylene oxide units. In some cases, the polymer moieties C are, for example, separate PEGs containing about 12 ethylene oxide units. In some cases, the polymer moieties C are, for example, separate PEGs containing about 13 ethylene oxide units. In some cases, the polymer moieties C are, for example, separate PEGs containing about 14 ethylene oxide units. In some cases, the polymer moieties C are, for example, separate PEGs containing about 15 ethylene oxide units. In some cases, polymer moiety C is a discrete PEG containing, for example, about 16 ethylene oxide units. In some cases, polymer moiety C is a discrete PEG containing, for example, about 17 ethylene oxide units. In some cases, polymer moiety C is a discrete PEG containing, for example, about 18 ethylene oxide units.In some cases, the polymer moieties C are, for example, discrete PEGs containing about 19 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 20 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 21 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 22 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 23 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 24 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 25 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 26 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 27 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 28 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 29 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 30 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 31 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 32 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 33 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 34 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 35 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 36 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 37 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 38 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 39 ethylene oxide units.In some cases, the polymer moieties C are, for example, discrete PEGs containing about 40 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 41 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 42 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 43 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 44 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 45 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 46 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 47 ethylene oxide units. In some cases, the polymer moieties C are, for example, discrete PEGs containing about 48 ethylene oxide units.

[0236] In some cases, the polymer moiety C is dPEGR (Quanta Biodesign Ltd).

[0237] In some embodiments, the polymer portion C comprises a cationic mucic acid-based polymer (cMAP). In some examples, the cMAP comprises one or more subunits of at least one repeating subunit, and the subunit structure is represented as formula (∨):

[0238] [ka]

[0239] wherein m at each occurrence is independently 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, preferably 4-6, or 5, and n at each occurrence is independently 0, 1, 2, 3, 4, or 5. In some embodiments, m and n are, for example, about 10.

[0240] In some examples, cMAP is further conjugated to a PEG moiety to produce a cMAP-PEG copolymer, an mPEG-cMAP-PEGm triblock polymer, or a cMAP-PEG-cMAP triblock polymer. In some examples, the PEG moiety ranges from about 500 Da to about 50,000 Da. In some examples, the PEG moiety is about 500 Da to about 1000 Da, from 1000 Da to about 5000 Da, from 5000 Da to about 10,000 Da, from 10,000 Da to about 25,000 Da, from 25,000 Da to about 50,000 Da, or any combination of two or more of these ranges.

[0241] In some examples, the polymer moiety C is a cMAP-PEG copolymer, an mPEG-cMAP-PEGm triblock polymer, or a cMAP-PEG-cMAP triblock polymer. In some cases, the polymer moiety C is a cMAP-PEG copolymer. In other cases, the polymer moiety C is an mPEG-cMAP-PEGm triblock polymer. In further cases, the polymer moiety C is a cMAP-PEG-cMAP triblock polymer.

[0242] In some embodiments, the polymer moiety C is conjugated to a polynucleic acid molecule, a binding moiety, and optionally an endosomolytic moiety, as exemplified above.

[0243] Endosomolytic moiety In some embodiments, the molecule of formula (I): AXBYC further comprises an additional conjugated moiety. In some examples, the additional conjugated moiety is an endosomolytic moiety. In some cases, the endosomolytic moiety is a cell compartment releasing component, such as a compound that can be released from any of the cell compartments known in the art, such as endosomes, lysosomes, endoplasmic reticulum (ER), Golgi apparatus, microtubules, peroxisomes, or other endoplasmic reticulum with cells. In some cases, the endosomolytic moiety comprises an endosomolytic polypeptide, an endosomolytic polymer, an endosomolytic lipid, or an endosomolytic small molecule. In some cases, the endosomolytic moiety comprises an endosomolytic polypeptide. In other cases, the endosomolytic moiety comprises an endosomolytic polymer.

[0244] Endosomolytic Polypeptides In some embodiments, the molecule of formula (I), AXBYC, is further conjugated to an endosomolytic polypeptide. In some cases, the endosomolytic polypeptide is a pH-dependent membrane active peptide. In some cases, the endosomolytic polypeptide is an amphipathic polypeptide. In additional cases, the endosomolytic polypeptide is a peptidomimetic. In some examples, the endosomolytic polypeptide comprises INF, melittin, mucin, or their respective derivatives. In some examples, the endosomolytic polypeptide comprises INF or their respective derivatives. In other cases, the endosomolytic polypeptide comprises melittin or their respective derivatives. In further cases, the endosomolytic polypeptide comprises mucin or their respective derivatives.

[0245] In some examples, INF7 is a 24 residue polypeptide, the sequences of which include CGIFGEIEELIEEGLENLIDWGNA (SEQ ID NO: 1), or GLFEAIEGFIENGWEGMIDGWYGC (SEQ ID NO: 2). In some examples, INF7 or a derivative thereof includes the following sequences: GLFEAIEGFIENGWEGMIWDYGSGSCG (SEQ ID NO: 3), GLFEAIEGFIENGWEGMIDG WYG-(PEG)6-NH2 (SEQ ID NO: 4), or GLFEAIEGFIENGWEGMIWDYG-SGSC-K(GalNAc)2 (SEQ ID NO: 5).

[0246] In some instances, melittin is a 26 residue polypeptide and the sequence comprises CLIGAILKVLATGLPTLISWIKNKRKQ (SEQ ID NO:6), or alternatively, GIGAVLKVLTTGLPALISWIKRKRQQ (SEQ ID NO:7). In some instances, melittin comprises a polypeptide sequence described in U.S. Patent No. 8,501,930.

[0247] In some instances, the mucin is an antimicrobial peptide (AMP) derived from the venom gland of the scorpion Mesobuthus eupeus. In some instances, the mucin is comprised of mucin-13, the sequence of which comprises IFGAIAGLLKNIF-NH2 (SEQ ID NO:8), and mucin-18, the sequence of which comprises FFGHLFKLATKIIPSLFQ (SEQ ID NO:9).

[0248] In some examples, the endosomolytic polypeptide comprises a polypeptide whose sequence has at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% sequence identity to INF7 or a derivative thereof, a melittin or derivative thereof, or a mucin or derivative thereof, hi some examples, the endosomolytic moiety comprises INF7 or a derivative thereof, a melittin or derivative thereof, or a mucin or derivative thereof.

[0249] In some examples, the endosomolytic moiety is INF7 or a derivative thereof. In some examples, the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:1-5. In some examples, the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:1. In some examples, the endosomolytic portion comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:2-5. Optionally, the endosomolytic portion comprises SEQ ID NO:1. Optionally, the endosomolytic portion comprises SEQ ID NO:2-5. Optionally, the endosomolytic portion consists of SEQ ID NO:1. Optionally, the endosomolytic portion consists of SEQ ID NO:2-5.

[0250] In some examples, the endosomolytic moiety is melittin or a derivative thereof. In some examples, the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:6 or 7. In some examples, the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:6. In some examples, the endosomolytic portion comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:7. Optionally, the endosomolytic portion comprises SEQ ID NO:6. Optionally, the endosomolytic portion comprises SEQ ID NO:7. Optionally, the endosomolytic portion consists of SEQ ID NO:6. Optionally, the endosomolytic portion consists of SEQ ID NO:7.

[0251] In some examples, the endosomolytic moiety is a mucin or a derivative thereof. In some examples, the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:8 or 9. In some examples, the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:8. In some examples, the endosomolytic portion comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:9. Optionally, the endosomolytic portion comprises SEQ ID NO:8. Optionally, the endosomolytic portion comprises SEQ ID NO:9. Optionally, the endosomolytic portion consists of SEQ ID NO:8. Optionally, the endosomolytic portion consists of SEQ ID NO:9.

[0252] In some examples, the endosomolytic moiety comprises a sequence as illustrated in Table 1.

[0253] [Table 1-1]

[0254] [Table 1-2]

[0255] In some cases, the endosomolytic moiety comprises a Bak BH3 polypeptide that induces apoptosis through antagonism of inhibitory gene targets such as Bcl-2 and / or Bcl-xL. In some examples, the endosomolytic moiety comprises a Bak BH3 polypeptide described in Albarran, et al., "Efficient intracellular delivery of a pro-apoptotic peptide with a pH-responsive carrier," Reactive & Functional Polymers 71: 261-265 (2011).

[0256] In some examples, the endosomolytic moiety comprises a polypeptide (e.g., a cell-permeable polypeptide) as described in PCT Publication No. WO2013 / 166155 or WO2015 / 069587.

[0257] Linker In some embodiments, the linkers described herein are cleavable linkers or non-cleavable linkers. In some examples, the linker is a cleavable linker. In other examples, the linker is a non-cleavable linker.

[0258] In some cases, the linker is a non-polymeric linker. A non-polymeric linker refers to a linker that does not include repeating units of a monomer produced by a polymerization process. Exemplary non-polymeric linkers include, but are not limited to, C1-C6 alkyl groups (e.g., C5, C4, C3, C2, or C1 alkyl groups), homobifunctional cross-linkers, heterobifunctional cross-linkers, peptide linkers, traceless linkers, self-immolative linkers, maleimide-based linkers, or combinations thereof. In some cases, the non-polymeric linker includes C1-C6 alkyl groups (e.g., C5, C4, C3, C2, or C1 alkyl groups), homobifunctional cross-linkers, heterobifunctional cross-linkers, peptide linkers, traceless linkers, self-immolative linkers, maleimide-based linkers, or combinations thereof. In further cases, the non-polymeric linker does not include more than two of the same type of linker, for example, more than two homobifunctional cross-linkers, or more than two peptide linkers. In further instances, the non-polymeric linker optionally includes one or more reactive functional groups.

[0259] In some examples, the non-polymeric linker does not include a polymer as described above. In some examples, the non-polymeric linker does not include a polymer surrounded by the polymer moiety C. In some cases, the non-polymeric linker does not include a polyalkylene oxide (e.g., PEG). In some cases, the non-polymeric linker does not include PEG.

[0260] In some examples, the linker comprises a homobifunctional linker. Exemplary homobifunctional linkers include, but are not limited to, Lomant's reagent dithiobis(succinimidyl propionate) DSP, 3'3'-dithiobis(sulfosuccinimidyl proprionate (DTSSP), disuccinimidyl suberate (DSS), bis(sulfosuccinimidyl) suberate (BS), disuccinimidyl tartrate (DST), disulfosuccinimidyl tartrate (sulfo-DST). , ethylene glycobis(succinimidyl succinate), disuccinimidyl glutarate (DSG) (EGS), N,N'-disuccinimidyl carbonate (DSC), dimethyl adipimidate (DMA), dimethyl pimelimidate (DMP), dimethyl suberimidate (DMS), dimethyl-3,3'-dithiobispropionimidate (DTBP), 1,4-di-3'-(2'-pyridyldithio)propionamido)butane (DPDPB), bismaleimidohexane (BMH), halogenated aryl-containing compounds such as 1,5-difluoro-2,4-dinitrobenzene, 1,3-difluoro-4,6-dinitrobenzene (DFDNB), 4,4'-difluoro-3,3'-dinitrophenyl sulfone (DFDNPS), bis-[β-(4-azidosalicylamido)ethyl] disulfide (BASED) , formaldehyde, glutaraldehyde, 1,4-butanediol diglycidyl ether, adipic dihydrazide, carbohydrazide, o-toluidine, 3,3'-dimethylbenzidine, benzidine, α,α'-p-diaminodiphenyl, diiodo-p-xylene sulfonic acid, N,N'-ethylene-bis(iodoacetamide), or N,N'-hexamethylene-bis(iodoacetamide).

[0261] In some embodiments, the linker comprises a heterobifunctional linker. Exemplary heterobifunctional linkers include, but are not limited to, amine reactive and sulfhydryl crosslinking linkers, such as N-succinimidyl 3-(2-pyridyldithio)propionate (sPDP), long chain N-succinimidyl 3-(2-pyridyldithio)propionate (LC-sPDP), water soluble long chain N-succinimidyl 3-(2-pyridyldithio)propionate (sulfo-LC-sPDP), succinimidyloxycarbonyl-α-methyl-α-(2-pyridyldithio)toluene (sMPT), sulfosuccinimidyl-6-[α-methyl-α-(2-pyridyldithio)toluamide]hexanoate (sulfo-LC-sMPT), succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sMCC), sulfosuccinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sulfo-sMCC), m-maleimidobenzoyl-N-hydroxysuccinimide ester (MBs ... Imidobenzoyl-N-hydroxysulfosuccinimide ester (sulfo-MB), N-succinimidyl (4-iodoacetyl) aminobenzoate (sIAB), sulfosuccinimidyl (4-iodoacteyl) aminobenzoate (sulfo-sIAB), succinimidyl-4-(p-maleimidophenyl)butyrate (sMPB), sulfosuccinimidyl-4-(p-maleimidophenyl)butyrate, N-(γ-maleimidobutyryloxy)succinimide ester (GMB) (sulfo-sMPB)-N-(γ-maleimidobutyryloxy)sulfosuccinimide ester (sulfo-GMB), succinimidyl 6-((iodoacetyl)amino)hexanoate (sIAX), succinimidyl 6-[6-(((iodoacetyl)amino)hexanoyl)amino]hexanoate (sIAXX), succinimidyl 4-(((iodoacetyl)amino)methyl)cyclohexane-1-carboxylate (sIAC), succinimidylCarbonyl-reactive and -isotope hydrazides such as 6-((((4-iodoacetyl)amino)methyl)cyclohexane-1-carbonyl)amino)hexanoate (sIACX), p-nitrophenyl iodoacetate (NPIA), 4-(4-N-maleimidophenyl)butyric acid hydrazide (MPBH), 4-(N-maleimidomethyl)cyclohexane-1-carboxyl-hydrazide-8 (M2C2H), and 3-(2-pyridyldithio)propionyl hydrazide (PDPH). Sulfhydryl-reactive cross-linkers, amine-reactive and photoreactive cross-linkers, such as N-hydroxysuccinimidyl-4-azidosalicylate (NH-AsA), N-hydroxysulfosuccinimidyl-4-azidosalicylate (sulfo-NH-AsA), sulfosuccinimidyl-(4-azidosalicylamido) hexanoate (sulfo-NH-LC-AsA), sulfosuccinimidyl-2-(ρ-azidosalicylamido)ethyl-1, 3'-dithiopropionate (sAsD), N-hydroxysuccinimidyl-4-azidobenzoate (HsAB), N-hydroxysulfosuccinimidyl-4-azidobenzoate (sulfo-HsAB), N-succinimidyl-6-(4'-azido-2'-nitrophenylamino)hexanoate (sANPAH), sulfosuccinimidyl-6-(4'-azido-2'-nitrophenylamino)hexanoate (sulfo-sANPAH), N-5 -Azido-2-nitrobenzoyloxysuccinimide (ANB-NOs), sulfosuccinimidyl-2-(m-azido-o-nitrobenzamido)-ethyl-1,3'-dithiopropionate (sAND), N-succinimidyl-4(4-azidophenyl)1,3'-dithiopropionate (sADP), N-sulfosuccinimidyl(4-azidophenyl)-1,3'-dithiopropionate (sulfo-sADP), sulfosuccinimidyl 4-(ρ-azidophenyl)butyrate (sulfo-sAPB), sulfosuccinimidyl 2-(7-azido-4-methylcoumarin-3-acetamido)ethyl-1,3'-dithiopropionate (sAED), sulfosuccinimidyl7-Azido-4-methylcoumarin-3-acetate (sulfo-sAMCA), ρ-nitrophenyl diazopyruvate (ρNPDP), ρ-nitrophenyl-2-diazo-3,3,3-trifluoropropionate (PNP-DTP), sulfhydryl-reactive and photoreactive cross-linkers, such as 1-(ρ-azido-salicylamido)-4-(iodoacetamido)butane (AsIB), N-[4-(ρ-azido-salicylamido)butyl]-3'-(2'-pyridyldithio) ) propionamide (APDP), benzophenone-4-iodoacetamide, benzophenone-4-maleimidocarbonyl reactive and photoreactive cross-linkers, such as ρ-azidobenzoylhydrazide (ABH), carboxylate reactive and photoreactive cross-linkers, such as 4-(ρ-azidosalicylamido)butylamine (AsBA), and arginine reactive and photoreactive cross-linkers, such as ρ-azidophenylglyoxal (APG).

[0262] In some examples, the linker comprises a reactive functional group. In some cases, the reactive functional group comprises a nucleophilic group that is reactive to an electrophilic group present in the linking moiety. Exemplary electrophilic groups include carbonyl groups such as aldehydes, ketones, carboxylic acids, esters, amides, enones, acyl halides, or acid anhydrides. In some embodiments, the reactive functional group is an aldehyde. Exemplary nucleophilic groups include hydrazides, oximes, aminos, hydrazines, thiosemicarbazones, hydrazine carboxylates, and aryl hydrazides.

[0263] In some embodiments, the linker comprises a maleimide group. In some examples, the maleimide group is also referred to as a maleimide spacer. In some examples, the maleimide group further includes caproic acid to form maleimidocaproyl (mc). In some cases, the linker comprises maleimidocaproyl (mc). In some cases, the linker is maleimidocaproyl (mc). In other examples, the maleimide group comprises a maleimidomethyl group, such as succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sMCC) or sulfosuccinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sulfo-sMCC), as described above.

[0264] In some embodiments, the maleimide group is a self-stabilizing maleimide. In some examples, the self-stabilizing maleimide utilizes diaminopropionic acid (DPR) to incorporate a basic amino group adjacent to the maleimide to provide intramolecular catalysis of thiosuccinimide ring hydrolysis, thereby preventing the maleimide from undergoing elimination via a retro-Michael reaction. In some examples, the self-stabilizing maleimide is a maleimide group described in Lyon, et al., "Self-hydrolyzing maleimides improve the stability and pharmacological properties of antibody-drug conjugates," Nat. Biotechnol. 32(10):1059-1062 (2014). In some examples, the linker comprises a self-stabilizing maleimide. In some examples, the linker is a self-stabilizing maleimide.

[0265] In some embodiments, the linker comprises a peptide moiety. In some examples, the peptide comprises at least 1, 2, 3, 4, 5, 6, 7, 8 or more amino acid residues. In some examples, the peptide moiety is a cleavable peptide moiety (e.g., enzymatically or chemically). In some examples, the peptide moiety is a non-cleavable peptide moiety. In some examples, the peptide moiety comprises Val-Cit (valine-citrulline), Gly-Gly-Phe-Gly (SEQ ID NO: 973), Phe-Lys, Val-Lys, Gly-Phe-Lys, Phe-Phe-Lys, Ala-Lys, Val-Arg, Phe-Cit, Phe-Arg, Leu-Cit, Ile-Cit, Trp-Cit, Phe-Ala, Ala-Leu-Ala-Leu (SEQ ID NO: 974), or Gly-Phe-Leu-Gly (SEQ ID NO: 975). In some examples, the linker comprises a peptide moiety such as: Val-Cit (valine-citrulline), Gly-Gly-Phe-Gly (SEQ ID NO: 973), Phe-Lys, Val-Lys, Gly-Phe-Lys, Phe-Phe-Lys, Ala-Lys, Val-Arg, Phe-Cit, Phe-Arg, Leu-Cit, Ile-Cit, Trp-Cit, Phe-Ala, Ala-Leu-Ala-Leu (SEQ ID NO: 974), or Gly-Phe-Leu-Gly (SEQ ID NO: 975). In some cases, the linker comprises Val-Cit. In some cases, the linker is Val-Cit.

[0266] In some embodiments, the linker comprises a benzoic acid group or a derivative thereof. In some examples, the benzoic acid group or a derivative thereof comprises para-aminobenzoic acid (PABA). In some examples, the benzoic acid group or a derivative thereof comprises gamma-aminobutyric acid (GABA).

[0267] In some embodiments, the linker comprises one or more of a maleimide group, a peptide moiety, and / or a benzoic acid group, in any combination. In some embodiments, the linker comprises a combination of a maleimide group, a peptide moiety, and / or a benzoic acid group. In some examples, the maleimide group is maleimidocaproyl (mc). In some examples, the peptide group is val-cit. In some examples, the benzoic acid group is PABA. In some examples, the linker comprises a mc-val-cit group. In some cases, the linker comprises a val-cit-PABA group. In further cases, the linker comprises a mc-val-cit-PABA group.

[0268] In some embodiments, the linker is a self-immolative linker or a self-eliminating linker. In some cases, the linker is a self-immolative linker. In other cases, the linker is a self-eliminating linker (e.g., a cyclized self-eliminating linker). In some examples, the linker includes a linker described in U.S. Pat. No. 9,089,614 or PCT Publication WO2015038426.

[0269] In some embodiments, the linker is a dendritic linker. In some examples, the dendritic linker comprises a branched multifunctional linker moiety. In some examples, the dendritic linker is used to increase the molar ratio of polynucleotide B to binding moiety A. In some examples, the dendritic linker comprises a PAMAM dendrimer.

[0270] In some embodiments, the linker is a traceless linker or a linker that does not leave a linker moiety (e.g., an atom or a linker group) to the binding moiety A, the polynucleotide B, the polymer C, or the endosomolytic moiety D after cleavage. Exemplary traceless linkers include, but are not limited to, a germanium linker, a silicon linker, a sulfur linker, a selenium linker, a nitrogen linker, a phosphorus linker, a boron linker, a chromium linker, or a phenylhydrazide linker. In some cases, the linker is a traceless aryl-triazene linker as described in Hejesen, et al., "A traceless aryl-triazene linker for DNA-directed chemistry," Org Biomol Chem 11(15): 2493-2497 (2013). In some examples, the linker is a traceless linker as described in Blaney, et al., "Traceless solid-phase organic synthesis," Chem. Rev. 102: 2607-2024 (2002). In some examples, the linker is a traceless linker as described in U.S. Patent No. 6,821,783.

[0271] In some examples, the lincoln is a linker described in U.S. Patent Nos. 6,884,869; 7,498,298; 8,288,352; 8,609,105; or 8,697,688; U.S. Patent Publication Nos. 2014 / 0127239; 2013 / 028919; 2014 / 286970; 2013 / 0309256; 2015 / 037360; or 2014 / 0294851; or PCT Publication Nos. WO2015057699; WO2014080251; WO2014197854; WO2014145090; or WO2014177042.

[0272] In some embodiments, X, Y, and L are independently a single bond or a linker. In some examples, X, Y, and L are independently a single bond. In some cases, X, Y, and L are independently a linker.

[0273] In some examples, X is a single bond or a linker, e.g., a non-polymeric linker. In some examples, X is a single bond. In some examples, X is a non-polymeric linker. In some examples, the non-polymeric linker is a C1-C6 alkyl group. In some cases, X is a C1-C6 alkyl group, e.g., a C5, C4, C3, C2, or C1 alkyl group. In some cases, the C1-C6 alkyl group is an unsubstituted C1-C6 alkyl group. In the context of a non-polymeric linker, and particularly as used in the context of X, alkyl means a saturated, straight or branched chain hydrocarbon radical containing up to six carbon atoms. In some examples, X includes a homobifunctional linker or a heterobifunctional linker as described above. In some cases, X includes a heterobifunctional linker. In some cases, X includes an sMCC. In other examples, X includes a heterobifunctional linker optionally conjugated to a C1-C6 alkyl group. In other examples, X includes an sMCC optionally conjugated to a C1-C6 alkyl group. In additional examples, X does not include a polymer encompassed by polymer moiety C, for example, X does not include a polyalkylene oxide (eg, a PEG molecule).

[0274] In some examples, Y is a single bond or a linker, e.g., a non-polymeric linker. In some examples, Y is a single bond. In other cases, Y is a non-polymeric linker. In some embodiments, Y is a C1-C6 alkyl group. In some examples, Y is a homobifunctional linker or a heterobifunctional linker as described above. In some examples, Y is a homobifunctional linker as described above. In some examples, Y is a heterobifunctional linker as described above. In some examples, Y comprises a maleimide group, such as maleimidocaproyl (mc), as described above, or a self-stabilizing maleimide group. In some examples, Y comprises a peptide moiety, such as Val-Cit. In some examples, Y comprises a benzoic acid group, such as PABA. In further examples, Y comprises a combination of a maleimide group, a peptide moiety, and / or a benzoic acid group. In additional examples, Y comprises a mc group. In additional examples, Y comprises a mc-val-cit group. In additional examples, Y comprises a val-cit-PABA group. In an additional example, Y includes a mc-val-cit-PABA group. In some cases, Y does not include a polymer included by polymer moiety C, e.g., Y does not include a polyalkylene oxide (e.g., a PEG molecule).

[0275] In some examples, L comprises a single bond or a linker, optionally a non-polymeric linker. In some cases, L is a single bond. In other cases, L is optionally a linker, optionally a non-polymeric linker. In some embodiments, L is a C1-C6 alkyl group. In some examples, L is a homobifunctional linker or a heterobifunctional linker as described above. In some examples, L is a homobifunctional linker as described above. In some examples, L is a heterobifunctional linker as described above. In some examples, L comprises a maleimide group, such as maleimidocaproyl (mc), as described above, or a self-stabilizing maleimide group. In some examples, L comprises a peptide moiety, such as Val-Cit. In some examples, L comprises a benzoic acid group, such as PABA. In further examples, L comprises a combination of a maleimide group, a peptide moiety, and / or a benzoic acid group. In additional examples, L comprises a mc group. In additional examples, L comprises a mc-val-cit group. In an additional example, L comprises a val-cit-PABA group. In an additional example, L comprises a mc-val-cit-PABA group. In some cases, L, optionally as a non-polymeric linker, does not include the polymer encompassed by the polymer moiety C, e.g., Y does not include a polyalkylene oxide (e.g., a PEG molecule).

[0276] Pharmaceutical preparations In some embodiments, the pharmaceutical formulations described herein are administered to a subject by multiple routes of administration, including, but not limited to, parenteral (e.g., intravenous, subcutaneous, intramuscular), oral, intranasal, buccal, topical, rectal, or transdermal routes of administration. In some examples, the pharmaceutical compositions described herein are formulated for parenteral (e.g., intravenous, subcutaneous, intramuscular, intraarterial, intraperitoneal, intrathecal, intracerebral, intraventricular, intracranial) administration. In other examples, the pharmaceutical compositions described herein are formulated for oral administration. In yet other examples, the pharmaceutical compositions described herein are formulated for nasal administration.

[0277] In some embodiments, pharmaceutical compositions include, but are not limited to, aqueous dispersions, self-emulsifying dispersions, solid solutions, liposomal dispersions, aerosols, solid dosage forms, powders, immediate release formulations, controlled release formulations, fast dissolve formulations, tablets, capsules, pills, delayed release formulations, extended release formulations, pulsatile release formulations, multiparticulate formulations (e.g., nanoparticle formulations), and combined immediate and controlled release formulations.

[0278] In some examples, the pharmaceutical formulation comprises a multiparticulate formulation. In some examples, the pharmaceutical formulation comprises a nanoparticle formulation. In some examples, the nanoparticle comprises cMAP, cyclodextrin, or lipid. In some cases, the nanoparticle comprises a solid lipid nanoparticle, a polymeric nanoparticle, a self-emulsifying nanoparticle, a liposome, a microemulsion, or a micellar solution. Further exemplary nanoparticles include, but are not limited to, paramagnetic nanoparticles, superparamagnetic nanoparticles, metal nanoparticles, fullerene-like materials, inorganic nanotubes, dendrimers (such as those with covalently bound metal chelates), nanofibers, nanohorns, nanoonions, nanorods, nanoropes, and quantum dots. In some examples, the nanoparticles are metal nanoparticles, such as nanoparticles of scandium, titanium, vanadium, chromium, manganese, iron, cobalt, nickel, copper, zinc, yttrium, zirconium, niobium, molybdenum, ruthenium, rhodium, palladium, silver, cadmium, hafnium, tantalum, tungsten, rhenium, osmium, iridium, platinum, gold, gadolinium, aluminum, gallium, indium, tin, thallium, lead, bismuth, magnesium, calcium, strontium, barium, lithium, sodium, potassium, boron, silicon, phosphorus, germanium, arsenic, antimony, and combinations, alloys or oxides thereof.

[0279] In some instances, the nanoparticles comprise a core, or alternatively, a core and a shell, such as in core-shell nanoparticles.

[0280] In some examples, the nanoparticles are further coated with molecules for attachment of functional elements (e.g., having one or more of the polynucleic acid molecules or binding moieties described herein). In some examples, the coating comprises chondroitin sulfate, dextran sulfate, carboxymethyldextran, alginic acid, pectin, carrageenan, fucoidan, agaropectin, porphyran, karaya gum, gellan gum, xanthan gum, hyaluronic acid, glucosamine, galactosamine, chitin (or chitosan), polyglutamic acid, polyaspartic acid, lysozyme, cytochrome C, ribonuclease, trypsinogen, chymotrypsinogen, α-chymotrypsin, polylysine, polyarginine, histones, protamine, ovalbumin, or dextrin or cyclodextrin. In some examples, the nanoparticles comprise graphene-coated nanoparticles.

[0281] In some cases, the nanoparticles have a dimension of at least about 500 nm, 400 nm, 300 nm, 200 nm, or less than 100 nm.

[0282] In some examples, the nanoparticle formulation comprises a paramagnetic nanoparticle, a superparamagnetic nanoparticle, a metal nanoparticle, a fullerene-like material, an inorganic nanotube, a dendrimer (such as one with a covalently bound metal chelate), a nanofiber, a nanohorn, a nanoonion, a nanorod, a nanorope, or a quantum dot. In some examples, a polynucleic acid molecule or binding moiety described herein is directly or indirectly conjugated to a nanoparticle. In some examples, at least 1, 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 or more polynucleic acid molecules or binding moieties described herein are directly or indirectly conjugated to a nanoparticle.

[0283] In some embodiments, the pharmaceutical formulation comprises a delivery vector, e.g., a recombinant vector for delivery of a polynucleic acid molecule into a cell. In some examples, the recombinant vector is a DNA plasmid. In other examples, the recombinant vector is a viral vector. Exemplary viral vectors include vectors derived from adeno-associated virus, retrovirus, adenovirus, or alphavirus. In some examples, the recombinant vector capable of expressing a polynucleic acid molecule provides stable expression in target cells. In further examples, a viral vector is used that provides transient expression of a polynucleic acid molecule.

[0284] In some embodiments, the pharmaceutical formulation comprises a carrier or carrier material selected based on its compatibility with the compositions disclosed herein and the release profile characteristics of the desired dosage form. Exemplary carrier substances include, for example, binders, suspending agents, disintegrants, fillers, surfactants, solubilizers, stabilizers, lubricants, humectants, diluents, etc. Pharmaceutically compatible carrier materials include, but are not limited to, acacia, gelatin, colloidal silicon dioxide, calcium glycerophosphate, calcium lactate, maltodextrin, glycerin, magnesium silicate, polyvinylpyrrolidone (PVP), cholesterol, cholesterol esters, sodium caseinate, soy lecithin, taurocholic acid, phosphatidylcholine, sodium chloride, tricalcium phosphate, dipotassium phosphate, cellulose and cellulose conjugates, sugars sodium stearoyl lactylate, carrageenan, monoglycerides, diglycerides, pregelatinized starch, etc. See (e.g., Remington): The Science and Practice of Pharmacy, Nineteenth Ed (Easton, Pa.: Mack Publishing Company, 1995); Hoover, John E., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975; Liberman, HA and Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, NY, 1980; and Pharmaceutical Dosage Forms and Drug Delivery Systems, Seventh Ed. (Lippincott Williams & Wilkins 1999).

[0285] In some examples, the pharmaceutical formulation further comprises a pH adjusting or buffering agent, including acids such as acetic acid, boric acid, citric acid, lactic acid, phosphoric acid, and hydrochloric acid; bases such as sodium hydroxide, sodium phosphate, sodium borate, sodium citrate, sodium acetate, sodium lactate, and trishydroxymethylaminomethane, and buffers such as citrate / dextrose, sodium bicarbonate, and ammonium chloride. Such acids, bases, and buffers are included in the amount required to maintain the pH of the composition in an acceptable range.

[0286] In some examples, the pharmaceutical formulation includes one or more salts in an amount necessary to bring the osmolality of the composition into an acceptable range. Such salts include sodium, potassium, or ammonium cations and chloride, citrate, ascorbate, borate, phosphate, bicarbonate, sulfate, thiosulfate, or bisulfite anions, with suitable salts including sodium chloride, potassium chloride, sodium thiosulfate, sodium bisulfite, and ammonium sulfate.

[0287] In some instances, pharmaceutical formulations further include diluents that are used to stabilize the compound by providing a more stable environment. Salts dissolved in buffers (which also control or maintain pH) are utilized as diluents in the art, including, but not limited to, phosphate buffered saline. In certain instances, diluents increase the size of the composition to facilitate compression or create sufficient bulk for homogenous mixing for capsule filling. Such compounds include, for example, lactose, starch, mannitol, sorbitol, dextrose, microcrystalline cellulose such as Avicel®; calcium hydrogen phosphate, calcium phosphate dihydrate; tricalcium phosphate, calcium phosphate; anhydrous lactose, spray dried lactose; pregelatinized starch, compressible sugars such as Di-Pac® (Amstar); mannitol, hydroxypropyl methylcellulose, hydroxypropyl methylcellulose acetate stearate, sucrose-based diluents, powdered sugar; monobasic calcium sulfate monohydrate, calcium sulfate dihydrate; calcium lactate trihydrate, dextrates; hydrolyzed cereal solids, amylose; powdered cellulose, calcium carbonate; glycine, kaolin; mannitol, sodium chloride; inositol, bentonite, and the like.

[0288] In some cases, pharmaceutical formulations include disintegration agents or disintegrants to facilitate the breakup or disintegration of materials. The term "disintegrate" includes both dissolution and dispersion of the dosage form upon contact with gastrointestinal fluids. Examples of disintegrants are starches, such as natural starches, such as corn starch or potato starch, pregelatinized starches, such as National 1551 or Amijel®, or sodium starch glycolate, such as Promogel® or Explotab®, cellulose, such as wood products, methyl crystalline cellulose, such as Avicel®, Avicel® PH101, Avicel® PH102, Avicel® PH105, Elcema® P100, EmcoCel®, Vivacel®, Min. Tia®, and Solka-Fl°C®), methylcellulose, croscarmellose, or crosslinked cellulose, such as crosslinked sodium carboxymethylcellulose (Ac-Di-Sol®), crosslinked carboxymethylcellulose, or crosslinked croscarmellose, crosslinked starches, such as sodium starch glycolate, crosslinked polymers such as crospovidone, crosslinked polyvinylpyrrolidone, alginates, such as alginic acid or salts of alginic acid, such as sodium alginate, clays, such as Veegum® HV (magnesium aluminum silicate), gums, such as agar, guar, locust bean, karaya, pectin, or tragacanth, sodium starch glycolate, bentonite, natural sponges, surfactants, resins, such as cation exchange resins, citrus pulp, sodium lauryl sulfate, sodium lauryl sulfate in combination with starch, etc.

[0289] In some examples, the pharmaceutical formulation comprises a filler such as lactose, calcium carbonate, calcium phosphate, dibasic calcium phosphate, calcium sulfate, microcrystalline cellulose, cellulose powder, dextrose, dextrates, dextran, starch, pregelatinized starch, sucrose, xylitol, lactitol, mannitol, sorbitol, sodium chloride, polyethylene glycol, and the like.

[0290] Lubricants and glidants are also optionally included in the pharmaceutical formulations described herein to prevent, reduce, or inhibit adhesion or friction of materials. Typical lubricants include, for example, stearic acid, calcium hydroxide, talc, sodium stearyl fumarate, hydrocarbons such as mineral oil, hydrogenated vegetable oils such as hydrogenated soybean oil (Sterotex®), higher fatty acids, and alkali metal and alkaline earth metal salts such as aluminum, calcium, magnesium, zinc, stearic acid, sodium stearate, glycerol, talc, wax, Stearowet®, boric acid, sodium benzoate, sodium acetate, sodium chloride, leucine, polyethylene glycol (e.g., PEG-4000) or methoxypolyethylene glycol, such as Carbowax™, sodium oleate, sodium benzoate, glyceryl behenate, polyethylene glycol, magnesium lauryl sulfate or sodium lauryl sulfate, colloidal silica such as Syloid™, starches such as Cab-O-Sil®, corn starch, silicone oils, surfactants, and the like.

[0291] Plasticizers include compounds used to soften microencapsulation materials or film coatings, making them less brittle. Suitable plasticizers include, for example, polyethylene glycols such as PEG300, PEG400, PEG600, PEG1450, PEG3350, and PEG800, stearic acid, propylene glycol, oleic acid, triethylcellulose, triacetin. Plasticizers also function as dispersing or wetting agents.

[0292] Solubilizers include compounds such as triacetin, triethyl citrate, ethyl oleate, ethyl caprylate, sodium lauryl sulfate, sodium docusate, vitamin E TPGS, dimethylacetamide, N-methylpyrrolidone, N-hydroxyethylpyrrolidone, polyvinylpyrrolidone, hydroxypropyl methylcellulose, hydroxypropyl cyclodextrin, ethanol, n-butanol, isopropyl alcohol, cholesterol, bile salts, polyethylene glycol 200-600, glycofurol, transcutol, propylene glycol, and dimethyl isosorbide.

[0293] Stabilizers include compounds such as any antioxidant, buffer, acid, preservative, etc.

[0294] Suspending agents include polyvinylpyrrolidone, e.g., polyvinylpyrrolidone K12, polyvinylpyrrolidone K17, polyvinylpyrrolidone K25, or polyvinylpyrrolidone K30, vinylpyrrolidone / vinyl acetate copolymer (S630), polyethylene glycol (e.g., the polyethylene glycol has a molecular weight of from about 300 to about 6000, from about 3350 to about 4000, or from about 7000 to about 5400), sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, hydroxymethylcellulose stearate, acetate, polysorbate 80, hydroxyethylcellulose, sodium alginate, gums such as tragacanth, gum arabic, guar gum, xanthan including xanthan gum, sugars, cellulosics such as sodium carboxymethylcellulose, methylcellulose, sodium carboxymethylcellulose, hydroxypropyl methylcellulose, hydroxyethylcellulose, polysorbate 80, sodium alginate, polyethoxylated sorbitan monolaurate, polyethoxylated sorbitan monolaurate, povidone, and the like.

[0295] Surfactants include compounds such as sodium lauryl sulfate, sodium docusate, Tween 60 or 80, triacetin, vitamin E TPGS, sorbitan monooleate, polyoxyethylene sorbitan monooleate, polysorbates, polaxomers, bile salts, glyceryl monostearate, copolymers of ethylene oxide and propylene oxide, e.g., Pluronic® (BASF). Additional surfactants include polyoxyethylene fatty acid glycerides and vegetable oils (e.g., polyoxyethylene (60) hydrogenated castor oil); and polyoxyethylene alkyl ethers and alkyl phenyl ethers, e.g., Octoxynol 10, Octoxynol 40, and the like. Often surfactants are included to enhance physical stability or for other purposes.

[0296] Viscosity enhancing agents include, for example, methylcellulose, xanthan gum, carboxymethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, hydroxypropylmethylcellulose acetate stearate, hydroxypropylmethylcellulose phthalate, carbomer, polyvinyl alcohol, alginates, acacia, chitosan, and combinations thereof.

[0297] Wetting agents include compounds such as oleic acid, glyceryl monostearate, sorbitan monooleate, sorbitan monolaurate, triethanolamine oleate, polyoxyethylene sorbitan monooleate, polyoxyethylene sorbitan monolaurate, docusate sodium, sodium oleate, sodium lauryl sulfate, docusate sodium, triacetin, Tween 80, Vitamin E TPGS, ammonium salts, and the like.

[0298] Treatment regimen In some embodiments, the pharmaceutical composition described herein is administered for therapeutic use. In some embodiments, the pharmaceutical composition is administered once a day, twice a day, three times a day, or more. The pharmaceutical composition is administered every day, every other day, five days a week, once a week, every other week, two weeks a month, three weeks a month, once a month, twice a month, three times a month, or more. The pharmaceutical composition is administered for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 2 years, 3 years, or more.

[0299] In some embodiments, one or more pharmaceutical compositions are administered simultaneously, sequentially, or at an interval of time. In some embodiments, one or more pharmaceutical compositions are administered simultaneously. In some cases, one or more pharmaceutical compositions are administered sequentially. In further cases, one or more pharmaceutical compositions are administered at an interval of time (e.g., a first administration of a first pharmaceutical composition is on day 1, followed by at least 1, 2, 3, 4, 5 or more days before administration of at least a second pharmaceutical composition).

[0300] In some embodiments, two or more different pharmaceutical compositions are administered simultaneously. In some examples, two or more different pharmaceutical compositions are administered simultaneously. In some cases, two or more different pharmaceutical compositions are administered consecutively at the same time with no interval between administrations. In other cases, two or more different pharmaceutical compositions are administered consecutively with an interval of about 0.5 hours, 1 hour, 2 hours, 3 hours, 12 hours, 1 day, 2 days between administrations.

[0301] If, at the discretion of the physician, the patient's condition improves, administration of the composition may continue; alternatively, the dose of the composition being administered may be temporarily reduced or temporarily suspended for a particular period of time (i.e., a "drug holiday"). In some cases, the length of the drug holiday may vary between 2 days and 1 year, including, by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, 35 days, 50 days, 70 days, 100 days, 120 days, 150 days, 180 days, 200 days, 250 days, 280 days, 300 days, 320 days, 350 days, or 365 days. Dose reductions during drug holidays can be, by way of example only, 10%-100%, including 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.

[0302] Once the patient's condition has improved, a maintenance dose is administered if necessary, after which the dosage or frequency of administration, or both, can be reduced, depending on the symptoms, to a level at which the improved disease, disorder, or condition is maintained.

[0303] In some embodiments, the amount of a given agent that corresponds to such an amount will depend on factors such as the particular compound, the severity of the disease, the nature (e.g., body weight) of the subject or host in need of treatment, and the like, but will nevertheless be routinely determined in a manner known in the art according to the particular circumstances surrounding the case, including, for example, the specific agent being administered, the route of administration, and the subject or host being treated. In some instances, the desired dosage is conveniently presented as a single dose or as divided doses administered simultaneously (or over a short period of time) or at appropriate intervals, e.g., as two, three, four or more subdoses per day.

[0304] Because of the large number of variables associated with any particular treatment regimen, the foregoing ranges are merely suggestive, and significant deviations from these recommendations are not uncommon. Such dosages will vary depending on many variables, including, but not limited to, the activity of the compound being used, the disease or condition being treated, the mode of administration, the requirements of the particular subject, the severity of the disease or condition being treated, and the judgment of the physician.

[0305] In some embodiments, the toxicity and therapeutic efficacy of such treatment regimens are determined by standard pharmaceutical procedures in cell cultures or experimental animals, including, but not limited to, determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index, which is expressed as the ratio between LD50 and ED50. Compounds that exhibit high therapeutic indices are preferred. The data obtained from cell culture assays and animal studies are used to formulate a range of dosages for use in humans. The dosage of such compounds preferably lies within a range of circulating concentrations that include the ED50 with minimal toxicity. Dosages vary within this range depending on the dosage form used and the route of administration utilized.

[0306] Kits / Products In some embodiments, kits and products are disclosed herein for use with one or more compositions and methods described herein.Such kits include a carrier, package or container that is partitioned to accommodate one or more containers, such as vials, tubes, etc., each container comprising one of the separate elements for using the methods described herein.Suitable containers include, for example, bottles, vials, syringes, and test tubes.In other embodiments, containers are formed from various materials, such as glass or plastic.

[0307] The products provided herein include packaging materials. Examples of pharmaceutical packaging materials include, but are not limited to, blister packs, bottles, tubes, bags, containers, bottles, and any packaging material suitable for the selected formulation and intended mode of administration and treatment.

[0308] For example, a container contains a target nucleic acid molecule as described herein. Such kits optionally include identifying descriptions or labels, or instructions for use in the methods described herein.

[0309] The kit typically includes a label listing the contents and / or instructions for use, and a package insert with instructions for use. A set of instructions is also typically included.

[0310] In one embodiment, a label is on or associated with the container. In one embodiment, a label is attached to a container when letters, numbers or other indicia forming the label are affixed, molded or engraved into the container itself. A label is associated with a container when it is present in a receptacle or carrier that holds the container, for example as a package insert. In one embodiment, a label is used to indicate that the contents are to be used for a particular therapeutic application. A label may be used to indicate instructions for using the contents, for example, in the methods described herein.

[0311] In some embodiments, the pharmaceutical compositions are presented in a pack or dispenser device containing one or more unit dosage forms comprising a compound provided herein. In embodiments, the pack comprises, for example, metal or plastic foil, such as a blister pack. In further embodiments, the pack or dispenser device is accompanied by instructions for administration. In another embodiment, the pack or dispenser is accompanied by a notice attached to the container in a form prescribed by a governmental agency regulating the manufacture, use, or sale of pharmaceuticals, which notice reflects the agency's approval of the drug form for human or animal administration. In embodiments, such notice is, for example, a label approved by the U.S. Food and Drug Administration for prescription drugs or an approved product insert. In one embodiment, a composition comprising a compound provided herein formulated in a compatible pharmaceutical carrier is prepared, placed in an appropriate container, and labeled for the treatment of an indicated disease.

[0312] Specific Terms Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter belongs. It is to be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not intended to be limiting of any subject matter. In this application, the use of the singular includes the plural unless specifically stated otherwise. As used in the specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. In this application, the use of "or" means "and / or" unless specifically stated otherwise. Furthermore, the use of the term "including" is not limiting, as are other forms such as "include," "includes," and "included."

[0313] As used herein, ranges and amounts can be expressed as "about" a particular value or range. "About" includes the exact amount. Thus, "about 5 μL" also means "about 5 μL" and "5 μL." In general, the term "about" includes amounts that are expected to be within experimental error.

[0314] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described.

[0315] As used herein, the terms "individual," "subject," and "patient" refer to any mammal. In some embodiments, the mammal is a human. In some embodiments, the mammal is a non-human. No term is limited to situations characterized by the supervision (e.g., full-time or intermittent) of a health care worker (e.g., a physician, registered nurse, bedside nurse, physician assistant, nursing assistant, or hospice worker).

[0316] As used herein, the term "DMD", "DMD gene" and its equivalents refer to the DMD gene that encodes the protein dystrophin. In addition, the terms "DMD" and "DMD gene" are used interchangeably, and both terms refer to the dystrophin gene. EXAMPLES

[0317] These examples are provided for illustrative purposes only and are not intended to limit the scope of the claims.

[0318] Example 1. Antisense Oligonucleotide Sequences and Synthesis

[0319] Phosphorodiamidate morpholino oligomers (PMOs), phosphorothioate antisense oligonucleotides (PS ASOs), and antisense oligonucleotides (ASOs) were synthesized.

[0320] The PMO sequence is 5'GGCCAAACCTCGGCTTACCTGAAAT3' primary amine (SEQ ID NO:28) and can be seen in FIG. 1 with the terminal nucleotide extended. The PMO contains a C3-NH2 conjugate handle at the 3' end of the conjugated molecule. The PMO was fully assembled on solid phase using standard solid phase synthesis protocols and purified by HPLC.

[0321] The PS ASO sequence was amine-C6-GGCCAAACCUCGGCUUACCU (SEQ ID NO:29) and can be seen in Figures 2A-2B with the terminal nucleotides extended. The PS ASO structure contained a phosphate backbone that was 100% phosphorothioate linked and all ribose sugars contained 2'2'OMe modifications. The PS ASO contained a C6-NH2 conjugate handle at the 5' end of the conjugated molecule. The PMO was fully assembled on the solid phase using standard solid phase phosphoramidite chemistry and purified by HPLC.

[0322] The ASOs were fully assembled on the solid phase using standard solid-phase phosphoramidite chemistry and purified by HPLC. The ASOs contained a C6-NH2 conjugate handle at the 5' end of the conjugated molecule.

[0323] Example 2: Detection of DMD exon skipping

[0324] Methods for assessing DMD exon 23 skipping in differentiated C1C12 cells

[0325] Mouse myoblast C2C12 cells were plated at 50,000-100,000 / well in 24-well plates in 0.5mL 10% FBS RPMI 1640 medium and incubated overnight at 37 °C with 5% CO2. On day 2, cells were transferred to differentiation medium (2% horse serum RPMI 1640 and 1 μM insulin) and incubated for 3-5 days. After incubation, samples were added and incubated for 24 hours. After sample treatment, 1mL of fresh medium (without compound) was changed daily for 2 days. Cells were harvested 72 hours after treatment initiation. RNA was isolated using the InviTrap RNA Cell HTS 96 Kit (B-Bridge International #7061300400) and reverse transcribed using the High Capacity cDNA Reverse Transcription Kit (ThermoFisher #4368813). PCR reactions were performed using DreamTaq™ PCR Master Mix (ThermoFisher #K1072). Primary PCR used primers in exon 20 (Ex20F 5'-CAGAATTCTGCCAATTGCTGAG) (SEQ ID NO:30) and exon 26 (Ex26R 5'-TTCTTCAGCTTGTGTCATCC) (SEQ ID NO:31) to amplify skipped and non-skipped molecules using the protocol in Table 2.

[0326] [Table 2]

[0327] For nested PCR, the primary PCR reaction was diluted 100X with water and 5 μl was used for the nested PCR reaction (50 μl total reaction volume). Using the protocol in Table 3, the nested PCR used primers in exon 20 (Ex20F2: 5'- ACCCAGTCTACCACCCTATC) (SEQ ID NO:32) and exon 25 (Ex25R: 5'- CTCTTTATCTTCTGCCCACCTT) (SEQ ID NO:33) to amplify skipped and non-skipped molecules.

[0328] [Table 3]

[0329] PCR reactions were analyzed using a 4% TAE agarose gel. The wild-type (WT) DMD product had the expected size of 788 base pairs and the skipped DMDΔ23 of 575 base pairs.

[0330] animal

[0331] Animal studies were performed according to protocols under the Institutional Animal Care and Use Committee (IACUC) at Explora BioLabs, which adheres to regulations outlined in the USDA Animal Welfare Act as well as the "Guide for the Care and Use of Laboratory Animals." All mice were obtained from either Charles River Laboratories or Harlan Laboratories.

[0332] In vivo mouse model

[0333] WT CD-1 mice (4-6 weeks old) were dosed by intravenous (iv) injection with the indicated antisense conjugate (ASC) and dose. Naked PMO or ASO were dosed by intramuscular injection at the indicated dose. After 4, 7, or 14 days, heart and gastrocnemius tissues were harvested and snap frozen in liquid nitrogen. RNA was isolated with Trizol and RNeasy Plus 96 Kit (Qiagen, #74192) and reverse transcribed using the High Capacity cDNA Reverse transcription Kit (ThermoFisher #4368813). Nested PCR reactions were performed as described. PCR reactions were analyzed in 4% (or 1%) TAE agarose gels quantified by densitometry.

[0334] To confirm exon 23 skipping in treated mice, DNA fragments were isolated from 4% agarose gels and sequenced.

[0335] To quantitatively determine the copy number of skipped DMD mRNA, qPCR primer / probe sets were designed to quantify skipped and WT DMD mRNA (Figure 3). qPCR quantification standards were designed and generated by PCR using the designed PCR primers as seen in Table 4. For the qPCR standards for WT and DMD, after PCR, a 733 base pair fragment was isolated from an agarose gel. For the qPCR standard for skipped DMD, nested primers were used.

[0336] The amplification efficiency of the qPCR primers / probes was determined to be within 10% of the expected efficiency. qPCR reactions were performed with a QuantStudio 7 and Taqman™ PCR Universal Mastermix II (ThermoFisher #4440041) according to the manufacturer's instructions.

[0337] [Table 4]

[0338] Example 3: Conjugate synthesis

[0339] Analytical and purification methods

[0340] Analytical and purification methods were performed according to Tables 5-11.

[0341] [Table 5]

[0342] [Table 6]

[0343] [Table 7]

[0344] [Table 8]

[0345] [Table 9]

[0346] [Table 10]

[0347] [Table 11]

[0348] Anti-transferrin receptor antibody

[0349] The anti-mouse transferrin receptor antibody, or anti-CD71 mAb, used was a rat IgG2a subclass monoclonal antibody that binds to mouse CD71, or mouse transferrin receptor 1 (mTfR1). The antibody was produced by BioXcell and is commercially available (catalog # BE0175).

[0350] Anti-CD71 antibody morpholino antisense oligonucleotide conjugate (anti-CD71 mAb-PMO)

[0351] Anti-CD71 mAb-PMO conjugate

[0352] Anti-CD71 antibody (10 mg / mL) in borate buffer (25 mM sodium tetraborate, 25 mM NaCl, 1 mM diethylenetriaminepentaacetic acid, pH 8.0) was reduced by adding 4 equivalents of tris(2-carboxyethyl)phosphine (TCEP) in water and incubating at 37 °C for 4 h. 4(N-maleimidomethyl)cyclohexane carboxylic acid N-hydroxysuccinimide ester (SMCC) was conjugated to the primary amine at the 3' end of phosphorodiamidate morpholino oligomer (PMO) by incubating PMO (50 mg / mL) in DMSO with 10 equivalents of SMCC (10 mg / mL) in DMSO for 1 h. Unconjugated SMCC was removed by ultrafiltration using an Amicon Ultra-15 centrifugal filter unit with a MWCO of 3 kDa. The PMO-SMCC was washed three times with a buffered acetate solution (10 mM sodium acetate, pH 6.0) and used immediately. The reduced antibody was mixed with 2.25 equivalents of PMO-SMCC and incubated overnight at 4 °C. The pH of the reaction mixture was then reduced to 7.5 and 8 equivalents of N-ethylmaleimide were added to the mixture for 30 min at room temperature to quench the unreacted cysteines. Analysis of the reaction mixture by hydrophobic interaction chromatography (HIC) method 2 showed the antibody-PMO conjugate along with unreacted antibody and PMO (Figure 4). Figure 4 shows the chromatogram of the anti-CD71 mAb-PMO reaction mixture produced by HIC method 2, showing the free antibody peak (1), free PMO (2), DAR 1 (3), DAR 2 (4), DAR 3 (5), and DAR>3 (6). "DAR" refers to the drug-to-antibody ratio. The numbers in brackets refer to the peaks in the chromatogram.

[0353] purification

[0354] The reaction mixture was purified on an AKTA Explorer FPLC using HIC method 1. Fractions containing conjugates with drug-to-antibody ratios of 1 (DAR1) and 2 (DAR2) were combined and concentrated on an Amicon Ultra15 centrifugal filter unit with a MWCO of 50 kDa, separate from conjugates with a DAR greater than 2. The concentrated conjugates were buffer exchanged into PBS (pH 7.4) using an Amicon Ultra15 centrifugal filter unit prior to analysis.

[0355] Analysis of purified conjugates

[0356] The isolated conjugates were characterized by steric exclusion chromatography (SEC) and HIC. SEC method 1 was used to confirm the absence of polymeric aggregates and unconjugated PMO (Figures 5A-5C). Figure 5A shows a chromatogram of anti-CD71 mAb produced using SEC method 1. Figure 5B shows a chromatogram of anti-CD71 mAb-PMO DAR 1 and 2 produced using SEC method 1. Figure 5C shows a chromatogram of two or more anti-CD71 mAb-PMO DARs produced using SEC method 1. "DAR" refers to the drug-to-antibody ratio.

[0357] The purity of the conjugates was assessed by analytical HPLC using HIC method 2 (Figures 6A-6C). Figure 6A shows a chromatogram of anti-CD71 mAb produced using HIC method 2. Figure 6B shows a chromatogram of anti-CD71 mAb-PMO DAR 1 and 2 conjugates produced using HIC method 2. Figure 6C shows a chromatogram of anti-CD71 mAb-PMO DAR>2 conjugates produced using HIC method 2. The 260 / 280 nm UV absorbance ratio of each sample was compared to a standard curve of known ratios of PMO to antibody to confirm the DAR. Samples with DAR 1 and 2 had an average DAR of ~1.6, while samples with a DAR above 2 had an average DAR of ~3.7. "DAR" refers to the drug-to-antibody ratio.

[0358] Anti-CD71 Fab morpholino antisense oligonucleotide conjugate (anti-CD71 Fab-PMO)

[0359] Antibody digestion with pepsin

[0360] Anti-CD71 antibody (5 mg / mL) in 20 mM acetate buffer (pH 4.0) was incubated with immobilized pepsin for 3 hours at 37°C. The resin was removed and the reaction mixture was washed with PBS (pH 7.4) using an Amicon Ultra15 centrifugal filter unit with a MWCO of 30 kDa. The retentate was collected and purified using size exclusion chromatography (SEC) method 2 to isolate the F(ab')2 fragment.

[0361] Anti-CD71(Fab)-PMO conjugate

[0362] F(ab')2 fragments (15 mg / mL) in borate buffer (pH 8.0) were reduced by adding 10 equivalents of TCEP in water and incubating at 37 °C for 2 h. SMCC was added to the primary amine at the 3' end of PMO by incubating PMO (50 mg / mL) in DMSO with 10 equivalents of SMCC (10 mg / mL) in DMSO for 1 h. Unconjugated SMCC was removed by ultrafiltration using an Amicon Ultra-15 centrifugal filter unit with a MWCO of 3 kDa. PMO-SMCC was washed three times with acetate buffer (pH 6.0) and used immediately. The reduced F(ab') fragments (Fab) were buffer exchanged into borate buffer (pH 8.0) using an Amicon Ultra15 centrifugal filter unit with a MWCO of 10 kDa, and 1.75 equivalents of PMO-SMCC was added and incubated at 4 °C overnight. The pH of the reaction mixture was then reduced to 7.5 and 6 equivalents of N-ethylmaleimide was added to the mixture for 30 min at room temperature to quench unreacted cysteines. Analysis of the reaction mixture by hydrophobic interaction chromatography (HIC) method 3 showed anti-CD71 (Fab)-PMO conjugate along with unreacted Fab (Figure 14a). Figure 7A shows the chromatogram of FPLC purification of anti-CD71 Fab-PMO using HIC method 3.

[0363] purification

[0364] The reaction mixture was purified on an AKTA Explorer FPLC using HIC method 3. Fractions containing conjugates with DARs of 1, 2, and 3 were combined and concentrated separately. The concentrated conjugates were buffer exchanged into PBS (pH 7.4) using 10 kDa MWCO Amicon Ultra15 centrifugal filter units prior to analysis.

[0365] Analysis of purified conjugates

[0366] The isolated conjugates were characterized by SEC and HIC. SEC method 1 was used to confirm the absence of polymeric aggregates and unconjugated PMO. See Figures 7B-7E. Figure 7B shows a chromatogram of anti-CD71 Fab produced using SEC method 1. Figure 7C shows a chromatogram of anti-CD71 Fab-PMO DAR1 conjugate produced using SEC method 1. Figure 7D shows a chromatogram of anti-CD71 Fab-PMO DAR2 conjugate produced using SEC method 1. Figure 7E shows a chromatogram of anti-CD71 Fab-PMO DAR3 conjugate produced using SEC method 1. The purity of the conjugates was assessed by analytical HPLC using HIC method 4. See Figures 7F-7I. Figure 7F shows a chromatogram of anti-CD71 Fab produced using HIC method 4. Figure 7G shows a chromatogram of anti-CD71 Fab-PMO DAR1 conjugate produced using HIC method 4. Figure 7H shows a chromatogram of anti-CD71 Fab-PMO DAR2 conjugate produced using HIC method 4. Figure 7I shows a chromatogram of anti-CD71 Fab-PMO DAR3 conjugate produced using HIC method 4. "DAR" refers to the drug to antibody ratio. The 260 / 280 nm UV absorbance ratio of each sample was compared to a standard curve of known ratios of PMO to Fab to confirm the DAR.

[0367] Anti-CD71 antibody phosphorothioate antisense oligonucleotide conjugate (anti-CD71 mAb-PS ASO)

[0368] Anti-CD71 mAb-PS ASO

[0369] Anti-CD71 (10 mg / mL) in borate buffer (pH 8.0) was reduced by adding 4 equivalents of TCEP in water and incubating at 37 °C for 4 h. 4(N-maleimidomethyl)cyclohexane carboxylic acid N-hydroxysuccinimide ester (SMCC) was added to the primary amine at the 5' end of PS-ASO by incubating PS-ASO (50 mg / mL) in a 1:1 mixture of 250 mM PB (pH 7.5) and DMSO with 10 equivalents of SMCC (10 mg / mL) in DMSO for 1 h. Unconjugated SMCC was removed by ultrafiltration using an Amicon Ultra-15 centrifugal filter unit with a MWCO of 3 kDa. PS-ASO-SMCC was washed three times with a buffered acetate solution (pH 6.0) and used immediately. The reduced antibody was mixed with 1.7 equivalents of PS-ASO-SMCC and incubated overnight at 4 °C. The pH of the reaction mixture was then reduced to 7.4, and 8 equivalents of N-ethylmaleimide were added to the mixture for 30 min at room temperature to quench unreacted cysteines. Analysis of the reaction mixture by strong anion exchange chromatography (SAX) method 2 showed antibody-PS ASO conjugates along with unreacted antibody and ASO (Figure 8A). Figure 8A shows a chromatogram of the anti-CD71 mAb-PS ASO reaction mixture produced by SAX method 2, showing a free antibody peak (1), free PS ASO (5), DAR 1 (2), DAR 2 (3), and DAR>2 (4). "DAR" refers to the drug-to-antibody ratio. The numbers in parentheses refer to the peaks.

[0370] purification

[0371] The reaction mixture was purified on an AKTA Explorer FPLC using SAX method 1. Fractions containing conjugates with drug-to-antibody ratios (DAR) of 1, 2, and 3 were combined, concentrated separately, and buffer exchanged into PBS (pH 7.4) using 50 kDa MWCO Amicon Ultra15 centrifugal filter units prior to analysis.

[0372] Analysis of purified conjugates

[0373] The isolated conjugates were characterized by steric exclusion chromatography (SEC) and SAX. Size exclusion chromatography method 1 was used to confirm the absence of polymeric aggregates and unconjugated ASO. See Figures 8B-8E. Figure 8B shows a chromatogram of anti-CD71 mAb produced using SEC method 1. Figure 8C shows a chromatogram of anti-CD71 mAb-PS ASO DAR1 conjugate produced using SEC method 1. Figure 8D shows a chromatogram of anti-CD71 mAb-PS ASO DAR2 conjugate produced using SEC method 1. Figure 8E shows a chromatogram of anti-CD71 mAb-PS ASO DAR3 conjugate produced using SEC method 1. The purity of the conjugates was assessed by analytical HPLC using SAX method 2. See Figures 8F-8H. Figure 8F shows a chromatogram of anti-CD71 mAb-PS ASO DAR1 conjugate produced using SAX method 2. Figure 8G shows a chromatogram of an anti-CD71 mAb-PS ASO DAR2 conjugate produced using SAX method 2. Figure 8H shows a chromatogram of an anti-CD71 mAb-PS ASO DAR3 conjugate produced using SAX method 2. The 260 / 280 nm UV absorbance ratio of each sample was compared to a standard curve of known ratios of ASO to antibody to confirm the drug-to-antibody ratio (DAR).

[0374] Example 4: In vitro activity of anti-CD71 mAb-PMO conjugates

[0375] Anti-CD71 mAb-PMO conjugates were made and characterized as described in Example 3. Conjugates were evaluated for their ability to mediate exon skipping in vitro in differentiated C2C12 cells utilizing nested PCR using methods similar to Example 2. Briefly, the efficacy of "naked" morpholino ASOs ("PMOs") was compared to multiple concentrations of anti-CD71 mAb-PMO conjugates with associated vehicle controls. Controls included vehicle ("Veh"), 50 uM scrambled morpholino ("Scr50"), and no antibody ("Neg-Ab"). PMO concentrations used included 50 uM, 1 uM, and 0.02 uM. Anti-CD71 mAB-PMO DAR 1 and 2 concentrations used included 200 nM, 20 nM, and 2 nM. "DAR" refers to drug-to-antibody ratio.

[0376] After cDNA synthesis, two rounds of PCR amplification (primary PCR and nested PCR) were used to detect exon skipping. The PCR reactions were analyzed in a 4% TAE agarose gel (Figure 9).

[0377] 9, anti-CD71 mAb-PMO conjugates resulted in measurable exon 23 skipping in differentiated C2C12 cells and at lower concentrations than the "naked" PMO control. The wild-type product had the expected size of 788 base pairs and a skipped DMDΔ23 of 575 base pairs.

[0378] Another experiment included anti-CD71 Fab-PMO conjugates and a PMO targeted with anti-EGFR ("Z-PMO") as a negative control (Figure 10). PMO concentrations used included 10 uM and 2 uM. Anti-CD71 mAb-PMO concentrations used included 0.2 uM and 0.04 uM. Anti-CD71 mAb-PMO had a DAR of 2. Z-PMO was used at a concentration of 0.2 uM and had a DAR of 2. Anti-CD71 Fab-PMO concentrations included 0.6 uM and 0.12 uM. DARs of 1, 2, and 3 for the 0.6 uM and 0.12 uM anti-CD71 mAb-PMO were analyzed.

[0379] With reference to Figure 10, receptor-mediated uptake utilizing the transferrin receptor, anti-CD71 mAb-PMO, and anti-CD71 Fab-PMO conjugates resulted in measurable exon 23 skipping in C2C12 cells and at concentrations lower than the "naked" PMO control. There was no measurable exon 23 skipping from Z-PMO at the concentrations tested that resulted in skipping from the anti-CD71 conjugate.

[0380] Example 5: In vitro activity of anti-CD71-ASO mAb PS conjugates

[0381] Anti-CD71 mAb-PS ASO conjugates were made and characterized as described in Example 3. The conjugates were evaluated for their ability to mediate exon skipping in vitro in differentiated C2C12 cells utilizing nested PCR using a similar method as described in Example 2. Briefly, the efficacy of "naked" phosphorothioate ASOs (PS ASOs) was compared to multiple concentrations of anti-CD71 mAb-PS ASO conjugates with relevant vehicle controls. Two rounds of PCR amplification (primary PCR and nested PCR) were performed after cDNA synthesis to detect exon skipping. PCR reactions were analyzed in 4% TAE agarose gels (Figure 11). FIG. 11 shows an agarose gel of PMO, ASO, anti-CD71 mAb-ASO conjugated to DAR1 ("ASC-DAR1"), anti-CD71 mAb-ASO conjugated to DAR2 ("ASC-DAR2"), and anti-CD71 mAb-ASO conjugated to DAR3 ("ASC-DAR3"). "PMO" and "ASO" refer to free PMO and ASO (not conjugated to antibody). "Veh" refers to vehicle only. Concentrations tested included 0.2, 1, and 5 micromolar (μM).

[0382] 11, anti-CD71 mAb-PS ASO conjugates resulted in measurable exon 23 skipping in differentiated C2C12 cells and at lower concentrations than the "naked" PS ASO control. The wild-type product had the expected size of 788 base pairs and a skipped DMDΔ23 of 575 base pairs.

[0383] Example 6: In vivo activity of anti-CD71 mAb-PMO conjugates

[0384] Anti-CD71 mAb-PMO conjugates were made and characterized as described in Example 3. Conjugates anti-CD71 mAb-PMO DAR1,2 anti-CD71 and mAb-PMO DAR>2 were evaluated for their ability to mediate exon skipping in vivo in wild-type CD-1 mice using similar methods as described in Example 2. "DAR" refers to the drug-to-antibody ratio.

[0385] Mice were administered mAb, vehicle control, and antisense conjugate (ASC) by intravenous (iv) injection at the doses provided in Table 12. "DAR" refers to the drug-to-antibody ratio. "Naked" PMO was administered by intramuscular injection into the gastrocnemius muscle at the doses provided in Table 12. After 4, 7, or 14 days, heart and gastrocnemius tissues were harvested and snap frozen in liquid nitrogen. RNA was isolated, reverse transcribed, and nested PCR reactions were performed. PCR reactions were analyzed in 4% TAE agarose gels and quantified by densitometry.

[0386] [Table 12]

[0387] Figure 12A shows gel electrophoresis of gastrocnemius muscle samples from mice administered anti-CD71 mAb-PMO DAR 1, 2, anti-CD71 mAb-PMO DAR>2, anti-CD71 mAb, PMO, and vehicle vehicle for 4, 7, or 14 days. The wild-type product had the expected size of 788 base pairs and a skipped DMDΔ23 of 575 base pairs. Anti-CD71 mA...

Claims

1. Use of a phosphorodiamidate morpholino oligomer (PMO) conjugate in the manufacture of a pharmaceutical composition for inducing exon skipping in muscle cells of a subject in need thereof, wherein the PMO conjugate is a PMO conjugated to a full-length anti-transferrin receptor antibody; wherein the PMO targets an acceptor splice site, a donor splice site, or an exon splice enhancer element of the pre-mRNA of the Duchenne muscular dystrophy (DMD) gene; the PMO, when systemically administered to the subject, induces splicing of exons in the pre-mRNA of the DMD gene to produce a truncated mRNA transcript in vivo; The truncated mRNA transcript encodes a truncated dystrophin protein.

2. 2. The use of claim 1, wherein the PMO induces skipping of exon 8, exon 23, exon 35, exon 43, exon 44, exon 45, exon 50, exon 51, exon 52, exon 53, or exon 55 in the DMD gene.

3. The use of claim 1 , wherein the full-length anti-transferrin receptor antibody comprises a humanized antibody or a monoclonal antibody.

4. 2. The use of claim 1, wherein the PMO comprises a sequence selected from SEQ ID NOs: 225-227, 252-263, 268-272, 352-427, 768-827, and 939-972.

5. The use of claim 1, wherein the PMO comprises a sequence selected from SEQ ID NOs: 352-427, and 768-827.

6. The use of claim 1 , wherein the PMO is conjugated to the full-length anti-transferrin receptor antibody via a linker.

7. The use according to claim 6 , wherein the linker is a cleavable linker.

8. The use according to claim 6 , wherein the linker is a non-polymeric linker.

9. The linker may be a heterobifunctional linker, a homobifunctional linker, a maleimide group, a dipeptide moiety, a benzoic acid group or a derivative thereof, １ -C ６ 7. The use according to claim 6, wherein the aryl group is selected from the group consisting of alkyl groups, alkyl radicals, and combinations thereof.

10. 2. The use of claim 1, wherein the PMO conjugate has a ratio of PMO to the full-length anti-transferrin receptor antibody of about 1:1, about 2:1, about 3:1, or about 4:

1.

11. The use of claim 1 , wherein the PMO comprises a sequence that hybridizes to SEQ ID NO:59.

Images