Method for producing sedoheptulose

Abstract

To provide a method for the bacterial production of sedoheptulose, which is a saccharide falling within the categories of heptuloses and ketoses and is one of a small number of heptuloses occurring in nature; and bacteria for use in the method.SOLUTION: The present invention provides bacteria belonging to Streptomyces, where the functions of transaldolase have been deleted or attenuated.SELECTED DRAWING: None

Description

[Technical field]

[0001] Related Applications This application claims the benefit of priority from Application No. 2018-087503, filed with the Japan Patent Office on April 27, 2018. The priority application is hereby incorporated by reference in its entirety.

[0002] The present invention relates to a method for producing sedoheptulose by bacteria and a method for improving the production of sedoheptulose by bacteria, and the bacteria. [Background technology]

[0003] Sedoheptulose is a type of sugar classified as a heptose and a ketose, and is one of the few naturally occurring heptoses. Sedoheptulose is a constituent sugar of D-sedoheptulose-7-phosphate in the pentose phosphate pathway, which is a metabolic system of living organisms. A method using bacteria has been reported as a method for producing sedoheptulose. To date, bacteria capable of producing sedoheptulose have been reported to include Streptomyces naraensis (Patent Documents 1-2 and Non-Patent Document 1), Streptomyces albus (Non-Patent Document 1 and Patent Document 3), Streptomyces californicus (Non-Patent Document 1 and Patent Document 3), Streptomyces sindensis (Non-Patent Document 1), Streptomyces olivaceus (Non-Patent Document 1), Streptomyces vividochromogenus (Non-Patent Document 1), and Flavobacterium sp. TSC-A and Achromobacter sp. TSC-B (Patent Document 4). The above documents report bacteria that produce sedoheptulose in nature, but no method is known for improving the production of sedoheptulose in these bacteria. It is known that the production of sedoheptulose is improved by adding ribose to Bacillus subtilis having a mutation in transketolase (maximum production amount 25 g / L, production amount about 5 g / L in the absence of ribose) (Patent Document 5). Methods for producing sedoheptulose other than those using bacteria have been reported, including a method using transketolase (Non-Patent Documents 2 and 3) and a method using chemical synthesis (Patent Document 6). [Prior art documents] [Patent documents]

[0004] [Patent Document 1] Special Public Notice 1964-14500 [Patent Document 2] Special Public Notice 1966-4400 [Patent Document 3] Special Public Notice 41-5915 [Patent Document 4] Special Public Notice 1966-21760 [Patent Document 5] Patent Publication No. 62-126990 [Patent Document 6] SK284318 [Non-patent literature]

[0005] [Non-Patent Document 1] Accumulation of sedoheptulose by Streptomycetes.J.Biochem.1963;54(1):107-8 [Non-Patent Document 2] An efficient synthesis of sedoheptulose catalyzed by Spinach Transketolase, Tetrahedron Asymmetry.1993;4: 1169-1172 [Non-Patent Document 3] Heptulose synthesis from nonphosphorylated aldoses and ketoses by Spinach transketolase, J.Biol chem.1971 25;246(10):3126-31 [Non-Patent Document 4] Crystal structures and mutational analyzes of Acyl-CoA carboxylase β subunit of Streptomyces coelicolor. Biochemistry 2010;49(34):7367-7376 [Non-Patent Document 5] Subinhibitory concentrations of antibiotics induce phenazine production in a marine Streptomyces sp. J Nat Prod. 2008 May;71(5):824-827 Summary of the Invention [Problem to be solved by the invention]

[0006] An object of the present invention is to provide a method for producing sedoheptulose by bacteria, and a method for improving the production of sedoheptulose by bacteria, and the bacteria. [Means for solving the problem]

[0007] The present invention provides the following: (1) A method for producing sedoheptulose, comprising a step of culturing a bacterium in which the transaldolase function has been lost or attenuated; (2) The method according to (1), wherein the bacterium is a bacterium in which the function of propionyl-CoA carboxylase or the function of trehalose synthase is further lost or attenuated; (3) The method according to (1) or (2), wherein the bacterium is a bacterium belonging to the genus Actinomycetes, Bacillus subtilis, Flavobacterium, or Achromobacter. (4) The method according to (3), wherein the bacterium is an actinomycete; (5) The method according to (4), wherein the actinomycete is a bacterium belonging to the genus Streptomyces; (6) The method according to (5), wherein the bacterium belonging to the genus Streptomyces is Streptomyces lividans or Streptomyces avermilis; (7) Bacteria in which the transaldolase function, and the propionyl-CoA carboxylase function or the trehalose synthase function have been lost or attenuated; (8) The bacterium according to (7), which is a bacterium belonging to the genus Actinomycetes, Bacillus subtilis, Flavobacterium, or Achromobacter; (9) The bacterium according to (8), which is an actinomycete; (10) The bacterium according to (9), which is a bacterium belonging to the genus Streptomyces; or (11) The bacterium according to (10), which is Streptomyces lividans or Streptomyces evermiltus. Effect of the Invention

[0008] According to the present invention, there are provided a method for producing sedoheptulose using bacteria, a method for improving the production of sedoheptulose using bacteria, and the bacteria. [Brief description of the drawings]

[0009] [Figure 1] FIG. 1 is a graph showing the results of sedoheptulose production using Streptomyces lividans strain 1326. [Diagram 2] FIG. 2 is a graph showing the results of sedoheptulose production using Streptomyces avermectis MA-4680 strain. [Diagram 3] FIG. 3 is a graph showing the change in the amount of sedoheptulose produced after the Streptomyces lividans 1326ΔSLI_2249ΔSLI_5198 strain was cultured for a long period of time and the supplemental addition of glucose was stopped. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0010] In one embodiment, the present invention relates to a method for producing sedoheptulose, comprising culturing a bacterium in which transaldolase function has been lost or attenuated.

[0011] In another embodiment, the present invention relates to a bacterium in which transaldolase function has been eliminated or attenuated.

[0012] In yet another aspect, the present invention relates to a method for improving sedoheptulose production, comprising the step of culturing a bacterium in which transaldolase function has been lost or attenuated.

[0013] In the present disclosure, sedoheptulose has the molecular formula CH 14 It refers to sedoheptulose represented by O7. There is no particular limitation on the D-type or L-type, but preferably the sedoheptulose is D-sedoheptulose.

[0014] In the present disclosure, the transaldolase can catalyze the conversion of sedoheptulose-7-phosphate and glyceraldehyde-3-phosphate to erythrose-4-phosphate and fructose-6-phosphate, and the reaction is reversible. Examples of the transaldolase include SLI_2249 (SEQ ID NO: 1) and SLI_7007 (SEQ ID NO: 2) from Streptomyces lividans and sav6314 (SEQ ID NO: 3) and sav1767 (SEQ ID NO: 4) from Streptomyces evermei. [ka] [ka] [ka] [ka]

[0015] In the present disclosure, propionyl-CoA carboxylase can catalyze the carboxylation reaction of propionyl-CoA to produce methylmalonyl-CoA. Examples of propionyl-CoA carboxylases are SLI_5198 (SEQ ID NO: 5) and sav_3331 (SEQ ID NO: 6). Propionyl-CoA carboxylases are also known as enzymes involved in the synthesis of secondary metabolites (Non-Patent Document 4). [ka] [ka]

[0016] In the present disclosure, trehalose synthase can synthesize trehalose from glucose, for example, SLI_7555 (SEQ ID NO: 7), sav_7396 (SEQ ID NO: 8), SLI_5710 (SEQ ID NO: 9), sav_2803 (SEQ ID NO: 10), and SLI_6475 (SEQ ID NO: 11) and sav_2151 (SEQ ID NO: 12). [ka] [ka] [ka] [ka] [ka] [ka] As specific examples, the DNA sequences encoding SEQ ID NOs: 1-12 are SEQ ID NOs: 13-24, respectively. [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka]

[0017] In one embodiment, the bacterium is a bacterium in which the transaldolase function has been lost or attenuated. In another embodiment, the bacterium is a bacterium in which the propionyl-CoA carboxylase function has been lost or attenuated. In yet another embodiment, the bacterium is a bacterium in which the trehalose synthase function has been lost or attenuated. In another embodiment, the bacterium is a bacterium in which at least one or more of the above functions have been lost or attenuated, such as a bacterium in which the transaldolase and propionyl-CoA carboxylase functions have been lost or attenuated, a bacterium in which the transaldolase and trehalose synthase functions have been lost or attenuated, or a bacterium in which the transaldolase, propionyl-CoA carboxylase, and trehalose synthase functions have been lost or attenuated.

[0018] In one embodiment, the function of the enzyme may be controlled by the DNA sequence encoding the protein, at the transcriptional level of the protein, at the translational level of the protein, or at the post-translational level of the protein. Preferably, the function of the enzyme is controlled by the DNA sequence encoding the protein.

[0019] In one embodiment, the function of the enzyme may be controlled by the DNA sequence encoding the protein and may, for example, be lost or attenuated by a mutation in the DNA sequence encoding the protein.

[0020] In one embodiment, the function of the enzyme may be controlled at the transcriptional level of the protein, for example it may be lost or attenuated by altering the function of cis or trans elements of the DNA sequence encoding the protein.

[0021] In one embodiment, the function of the enzyme may be regulated at the translational level of the protein, for example, it may be lost or attenuated by mutation of the Shine-Dalgarno sequence for the translation of the protein.

[0022] In one embodiment, the function of the enzyme may be regulated at a post-translational level of the protein, for example, it may be lost or attenuated by treatment of the protein with an inhibitor.

[0023] In this disclosure, a mutation includes a substitution, addition, deletion, or recombination.

[0024] A person skilled in the art can confirm that the function of the enzyme has been lost or attenuated by, but not limited to, confirming a mutation in the gene encoding the protein, confirming the transcription of the protein, or confirming the activity or abundance of the protein in accordance with known techniques.

[0025] The enzyme function may be lost or attenuated under the conditions in which the bacteria are used to produce sedoheptulose. Loss of enzyme function refers to a state in which the function of the enzyme of the bacteria used in the present invention cannot be confirmed by a person skilled in the art based on known techniques. Attenuation of enzyme function refers to a state in which the function of the enzyme of the bacteria used in the present invention is attenuated compared to normal. More specifically, for example, the function may be less than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 2.5% or 1% compared to the function when the wild-type bacteria is cultured under normal culture conditions. For example, in the case of attenuation due to the introduction of a mutation, comparison may be made under the same culture conditions as the wild-type, and in the case of attenuation due to an inhibitor, comparison may be made under the same conditions other than the inhibitor.

[0026] Examples of bacteria in the present disclosure include, but are not limited to, actinomycetes, Escherichia coli and Bacillus subtilis, bacteria belonging to the genus Flavobacterium, and bacteria belonging to the genus Achromobacter. In preferred embodiments, the bacteria is actinomycetes, Bacillus subtilis, bacteria belonging to the genus Flavobacterium, or bacteria belonging to the genus Achromobacter. In further preferred embodiments, the bacteria is actinomycetes.

[0027] In the present disclosure, "actinomycetes" refers to gram-positive eubacteria belonging to the phylum Actinobacteria. "Actinomycetes" includes, but is not limited to, the genus Streptomyces, such as Streptomyces lividans, Streptomyces violaceoruber, Streptomyces coelicolor, Streptomyces avermitilis, and Streptomyces griseus; the genus Actinosynnema, such as Actinosynnema pretiosum and Actinosynnema mirum; the genus Pseudonocardia autotrophica, Pseudonocardia thermophila, and the like; Examples of the actinomycete include the genus Pseudonocardia, such as Pseudonocardia thermophila, and the genus Corynebacterium, such as Corynebacterium glutamicum. In a preferred embodiment, the actinomycete is a bacterium of the genus Streptomyces or Corynebacterium, more preferably a bacterium of the genus Streptomyces, and even more preferably, the bacterium of the genus Streptomyces is Streptomyces lividans or Streptomyces avermitilis. There is no particular limitation on the route of obtaining the actinomycete, and for example, it can be isolated from soil or obtained from a microorganism depository organization.

[0028] In the present disclosure, the bacteria used for the production of sedoheptulose are bacteria capable of biosynthesizing sedoheptulose. For example, bacteria having a sedoheptulose biosynthetic enzyme gene can be mentioned. The bacteria used for the production of sedoheptulose can be a wild-type strain or a strain that has been artificially mutated. Examples of the artificial mutation treatment include genetic recombination, UV irradiation, X-ray irradiation, and treatment with a mutagen. The bacteria used for the production of sedoheptulose can also be a naturally occurring mutant strain. The bacteria used for the production of sedoheptulose can also include bacteria having a sedoheptulose biosynthetic enzyme gene of the same or a different species. For example, the bacteria can be bacteria into which a sedoheptulose biosynthetic enzyme gene of a different species has been introduced by genetic recombination. A method widely known in the art can be used to introduce a heterologous gene into the above-mentioned bacteria.

[0029] In the present disclosure, sedoheptulose may be produced intracellularly or extracellularly, and is preferably produced extracellularly. In the present disclosure, "bacterial cells" refers to bacterial cells. In addition, in the present disclosure, "extracellular culture solution" refers to a portion of the culture solution obtained by culturing bacteria, from which bacterial cells have been removed. In other words, the extracellular culture solution contains various components contained in the medium used for the culture, substances produced by the bacteria during the culture, and the like.

[0030] In the present disclosure, a method for separating the bacterial cells and the extracellular culture fluid can be appropriately selected by a person skilled in the art. For example, the bacterial cells and the extracellular culture fluid can be separated by subjecting the culture fluid obtained by culturing the bacteria to centrifugation. The centrifugation conditions, such as temperature, time, and speed, can be those well known to a person skilled in the art depending on the type of bacteria used. Alternatively, the bacterial cells and the extracellular culture fluid can be separated by filtering the culture fluid obtained by culturing the bacteria using an appropriate filtration membrane.

[0031] In the present disclosure, the separated extracellular culture solution may be used as it is or after drying as a composition containing sedoheptulose, or the produced sedoheptulose may be recovered. "Recovery" refers to removing various components and / or bacterial components contained in the medium used for the culture to obtain a solution mainly containing sedoheptulose. The proportion of sedoheptulose in a solution mainly containing sedoheptulose can be appropriately determined by those skilled in the art depending on the purpose. The produced sedoheptulose can also be recovered as sedoheptulosan by acid treatment (Patent Document 5).

[0032] The produced sedoheptulose can be appropriately converted intracellularly or extracellularly to achieve the intended purpose by those skilled in the art according to known techniques. Sedoheptulose may be converted chemically, enzymatically, or physicochemically, for example, by phosphorylation, isomerization, cyclization, polymerization, acylation, galloylation, and dehydration cyclization. The converted sedoheptulose is, for example, sedoheptulose-7-phosphate, 7-O-galloyl-D-sedoheptulose, and sedoheptulosan.

[0033] In one embodiment, a specific example of the amount of sedoheptulose produced is, for example, preferably 3 g / L or more, more preferably 5 g / L or more, in 7 days, and preferably 5 g / L or more, more preferably 10 g / L or more, in 9 days. Yet another specific example is the maximum amount of sedoheptulose produced during culture is preferably 5 g / L or more, more preferably 10 g / L or more, and even more preferably 25 g / L or more.

[0034] According to the present disclosure, the production of sedoheptulose by bacteria can be improved. The improvement of sedoheptulose production means that the amount of sedoheptulose produced is increased due to the loss or attenuation of the function of a specific enzyme, or that the time required to reach a specific amount of sedoheptulose produced is decreased due to the loss or attenuation of the function of a specific enzyme. More specifically, for example, after 10 days of culture, the amount of sedoheptulose produced is at least two times, preferably at least three times, and more preferably at least four times, as compared to when wild-type bacteria are cultured under normal culture conditions. In addition, when wild-type bacteria do not produce sedoheptulose under normal culture conditions, they may be made to produce sedoheptulose due to the loss or attenuation of the function of a specific enzyme.

[0035] In producing sedoheptulose using bacteria, those skilled in the art can appropriately change the culture conditions of the bacteria, for example, temperature, carbon source, nitrogen source, culture time, medium, oxygen amount, pH, or additives such as antibiotics (e.g., tetracycline) (Non-Patent Document 5).

[0036] In another embodiment, the present invention provides the above-mentioned method of the present invention, further comprising the step of supplementing the medium with a carbon source. The supplementation may be carried out at any time during the culture of the bacteria, and may be added continuously or intermittently. It is preferable that the carbon source is supplemented so as not to cause lysis of the bacteria. Lysis of the bacteria can be confirmed, for example, by measuring the pH of the culture medium. In the case of actinomycetes, it is preferable to supplement the carbon source so that the pH of the medium does not exceed 8.0. It can also be confirmed by a decrease in the amount of bacteria in the medium.

[0037] The carbon source used in the present invention includes, but is not limited to, glucose, sucrose, fructose, mannitol, sorbitol, galactose, maltose, xylose, glycerol, ribose, gluconolactone, or gluconic acid or salts thereof. In a preferred embodiment, the carbon source is glucose or glycerol. In another preferred embodiment, the carbon source does not include ribose.

[0038] When the carbon source in the medium is consumed, various organic acids are produced as metabolic products, which acidify the medium. When the medium becomes acidic, the amount of sedoheptulose produced by the bacteria decreases. Therefore, an alkalizing agent may be added to the medium to prevent the medium from becoming acidic. In the case of actinomycetes, it is preferable to add an alkalizing agent to the medium so that the pH of the medium does not fall below 5.0, preferably the pH does not fall below 5.5. Examples of the alkalizing agent include, but are not limited to, carbonates such as calcium carbonate, magnesium carbonate, sodium carbonate, and sodium bicarbonate, hydroxides such as sodium hydroxide, potassium hydroxide, calcium hydroxide, and magnesium hydroxide, ammonia, urea, quicklime, and the like. In a preferred embodiment, the alkalizing agent used in the present invention is a carbonate such as calcium carbonate, magnesium carbonate, sodium carbonate, and sodium bicarbonate. The alkalizing agent may be added to the medium before the culture or during the culture. The alkalizing agent may be added continuously or intermittently. The amount of the alkalizing agent to be added can be easily determined by measuring the pH of the medium. The pH can be measured by known methods, for example, using a pH meter.

[0039] Therefore, adding a carbon source that serves as a raw material for sedoheptulose and prevents the pH of the medium from increasing, and adding an alkalizing agent that prevents the pH of the medium from decreasing, to the medium can be effective in increasing the production of sedoheptulose.

[0040] In the present invention, the medium for culturing bacteria and other culture conditions (temperature, time, pH, presence or absence of stirring, etc.) are appropriately selected by those skilled in the art depending on the type of bacteria to be cultured. More specific examples of conditions include, but are not limited to, pH 5 to 8, temperature 10 to 45°C, and time 5 to 50 days.

[0041] The present invention further provides the following aspects: (1) A method for improving sedoheptulose production, comprising a step of culturing a bacterium in which the function of transaldolase has been lost or attenuated; (2) The method according to (1), wherein the bacterium is a bacterium in which the propionyl-CoA carboxylase function and / or the trehalose synthase function has been further lost or attenuated; (3) The method according to (1) or (2), wherein the bacterium is a bacterium belonging to the genus Actinomycetes, Bacillus subtilis, Flavobacterium, or Achromobacter; (4) The method according to (3), wherein the bacterium is an actinomycete; (5) The method according to (4), wherein the actinomycete is a bacterium belonging to the genus Streptomyces; or (6) The method according to (5), wherein the bacterium belonging to the genus Streptomyces is Streptomyces lividans or Streptomyces avermilius;

[0042] The present invention will be specifically and in detail explained below by showing examples. However, the examples are used for illustrating the present invention and are not intended to limit the present invention. EXAMPLES

[0043] Example 1 1. Production of sedoheptulose using Streptomyces The present inventors have prepared sedoheptulose-producing strains using Streptomyces lividans and Streptomyces avermitilis as hosts, and investigated the amount of sedoheptulose in the culture medium.

[0044] 1-1. Transaldolase gene disruption 1-1-1. Disruption of the transaldolase gene in Streptomyces lividans The transaldolase gene (SLI_2249) of Streptomyces lividans strain 1326 (NITE accession number: NBRC 15675) was disrupted by homologous recombination. Transformation of Streptomyces lividans was performed according to a conventional method. Positions 1 to 1119 of SLI_2249 were disrupted, and gene disruption was confirmed using the primers AAGATCCCGGTCTTCGAGGGCGGGCAAGGGC (SEQ ID NO: 25) and GCGGCGTAGGTGTCGGTCTTCGACTTGGGG (SEQ ID NO: 26).

[0045] 1-1-2. Disruption of the trehalose synthase gene in Streptomyces lividans The trehalose synthase gene (SLI_7555) was disrupted by homologous recombination using a transaldolase gene (SLI_2249) disruptant of Streptomyces lividans 1326 as a host. Transformation of Streptomyces lividans was performed according to a conventional method. Positions 1 to 1719 of SLI_7555 were disrupted, and gene disruption was confirmed using primers CAAAGGCCGCAACAACACCCTCTCCGCC (SEQ ID NO: 27) and TAGCCCGCGCAGAACGCCTCCCGGCA (SEQ ID NO: 28).

[0046] 1-1-3. Disruption of the propionyl-CoA carboxylase gene in Streptomyces lividans The propionyl-CoA carboxylase gene (SLI_5198) was disrupted by homologous recombination using a transaldolase gene (SLI_2249) disruptant of Streptomyces lividans 1326 as a host. Transformation of Streptomyces lividans was performed according to a conventional method. Positions 1 to 1593 of SLI_5198 were disrupted, and gene disruption was confirmed using primers CCCAGGATGAGCCCCTCGAGGCGCAG (SEQ ID NO: 29) and CTGATCGTGCTGCTGCTGATGACGTACGA (SEQ ID NO: 30).

[0047] 1-1-4. Disruption of the transaldolase gene in Streptomyces avermilis The transaldolase gene (sav6314) of Streptomyces avermilis MA-4680 strain (NITE accession number: NBRC 14893) was disrupted by homologous recombination. Homologous recombination of Streptomyces avermilis was performed according to a conventional method. Positions 1 to 1119 of sav6314 were disrupted, and gene disruption was confirmed using the primers TCCGCCGACCTGGCCGGCTCGAACAACACC (SEQ ID NO: 31) and GCCAGCCGGCCGCGTACTGTCCGCGGACGG (SEQ ID NO: 32).

[0048] 1-2. Preculture of Streptomyces lividans and Streptomyces avermilisu Glycerol stocks of spores of Streptomyces lividans 1326, Streptomyces lividans 1326ΔSLI_2249, Streptomyces lividans 1326ΔSLI_2249ΔSLI_5198, Streptomyces lividans 1326ΔSLI_2249ΔSLI_7555, Streptomyces avermilithus MA-4680 or Streptomyces avermilithus MA-4680Δsav6314 strains prepared in 1-1 above were added to 5 mL of TSB medium (see Table 1 below). These actinomycetes were cultured at 28°C and 160 rpm for 72 hours with shaking.

[0049] 1-3. Main culture of Streptomyces lividans and Streptomyces avermilis A 0.1% amount of the preculture solution was added to 50 mL of TSB medium (see Table 1 below) in a 500 mL baffled flask. Note that glucose was further added to the TSB medium at the start of the culture so that the initial glucose concentration was 80 g / L. During the culture, glucose was further added so that glucose would not be depleted, and the culture was performed with shaking at 28°C and 160 rpm for 2 weeks. [Table 1]

[0050] 1-4. Measurement of sedoheptulose During the main culture, 1 mL of the culture medium was sampled at predetermined times, and the turbidity at 600 nm was measured. The sampled culture medium was centrifuged at 14,000 rpm for 20 minutes to obtain a culture medium sample. The amount of sedoheptulose produced in the culture medium sample was measured by HPLC. The HPLC measurement conditions are as shown in the table below. [Table 2]

[0051] 1-5.Results The results for S. lividans 1326 and S. avermilis MA-4680 are shown in Fig. 1 and Fig. 2, respectively. In S. lividans 1326, no sedoheptulose production was observed after 2 weeks of culture. In S. lividans 1326ΔSLI_2249, sedoheptulose was produced at a maximum of 5.7 g / L after about 9 days of culture. In S. lividans 1326ΔSLI_2249ΔSLI_5198, 28.8 g / L of sedoheptulose was produced after about 2 weeks of culture. In S. lividans 1326ΔSLI_2249ΔSLI_7555, 13.0 g / L of sedoheptulose was produced after about 11 days of culture. Sedoheptulose was produced at 0.9 g / L in the Streptomyces evermetrius MA-4680 strain after 2 weeks of culture. Sedoheptulose was produced at 9.5 g / L in the Streptomyces evermetrius MA-4680Δsav6314 strain after 2 weeks of culture. In S. lividans and S. evermetrius, disruption of the transaldolase gene significantly increased the amount of sedoheptulose produced. Furthermore, disruption of the trehalose synthase gene or propionyl-CoA carboxylase gene in addition to disruption of the transaldolase gene significantly increased the amount of sedoheptulose produced. Figure 3 shows the change in the amount of sedoheptulose produced after stopping the supplemental glucose supply during long-term culture of S. lividans 1326ΔSLI_2249ΔSLI_5198 strain. During the addition of glucose, the amount of sedoheptulose produced increased over time, reaching a maximum of 53.3 g / L at 431 hours. However, after the addition of glucose was stopped and glucose became depleted, the amount of sedoheptulose produced decreased. [Industrial Applicability]

[0052] According to the present invention, there are provided a method for producing sedoheptulose using bacteria, a method for improving the production of sedoheptulose using bacteria, and the bacteria.

Claims

1. A bacterium belonging to the genus Streptomyces, in which the transaldolase function has been lost or attenuated, wherein the bacterium belonging to the genus Streptomyces is Streptomyces lividans or Streptomyces evermetrius.

2. A bacterium belonging to the genus Streptomyces (excluding those in which ldhA is disrupted) in which the function of transaldolase has been lost or attenuated, wherein the bacterium belonging to the genus Streptomyces is Streptomyces lividans or Streptomyces evermitilis.

3. A bacterium described in claim 1 or 2, wherein the bacterium produces sedoheptulose.

Images