Combination therapy for treating hepatitis B virus infection - Patents.com

Abstract

The present invention relates to a method of treating hepatitis B virus (HBV) infection in a subject in need thereof, comprising administering to the subject a combination of a tumor necrosis factor receptor superfamily (TNFRSF) agonist (e.g., an agonistic antibody directed against the receptor, a soluble TNFRSF agonist, including but not limited to, its natural ligand, or a fragment of either thereof) and interferon (IFN) or a functional fragment thereof, thereby reducing one or more symptoms of HBV infection in the subject.

Description

[Technical field]

[0001] The present invention relates to a method of treating Hepatitis B virus (HBV) infection in a subject. [Background technology]

[0002] HBV infects over 300 million people worldwide and is a common cause of liver disease and liver cancer (Non-Patent Document 1). HBV is a small DNA virus with special features similar to retroviruses that replicate through an RNA intermediate (pregenomic RNA) and can be integrated into the host genome. Unique features of the HBV replication cycle confer a distinct ability for the virus to persist in infected cells. HBV infection results in a wide range of liver disease, from acute (including fulminant hepatic failure) to chronic hepatitis, cirrhosis, and hepatocellular carcinoma. Acute HBV infection may be asymptomatic or present with symptomatic acute hepatitis. 90-95% of children and 5-10% of adults infected with HBV fail to clear the virus and become chronically infected. Many chronically infected individuals have mild liver disease with little or no long-term morbidity or mortality. Other individuals with chronic HBV infection develop active disease and may progress to cirrhosis and liver cancer. These patients require careful monitoring and therapeutic intervention is indicated. [Prior art documents] [Non-patent literature]

[0003] [Non-Patent Document 1] Liang (2009) Hepatology 49:S13 Summary of the Invention [Problem to be solved by the invention]

[0004] New methods are needed to treat HBV infection by modulating HBV infection in cells, particularly methods that effectively disrupt HBV viral load in HBV-infected cells, reduce transcription of covalently closed circular HBV DNA in HBV-infected cells, and / or reduce the amount of pregenomic HBV RNA in HBV-infected cells. [Means for solving the problem]

[0005] The present invention is based on the discovery of a novel method for treating HBV infection in a subject using a combination of a tumor necrosis factor receptor superfamily (TNFRSF) agonist (e.g., an agonist antibody directed against a member of the TNFRSF, a soluble TNFRSF agonist including, but not limited to, its natural ligand) or a functional fragment thereof, and an interferon (IFN) agent or a functional fragment thereof. The novel method described herein is useful for reducing the transcription of covalently closed circular DNA (cccDNA) into pregenomic RNA (pgRNA) in HBV-infected cells, which reduces HBV protein production by HBV-infected cells and ultimately reduces the viral load of HBV-infected cells.

[0006] In one aspect, there is provided a combination of a tumor necrosis factor receptor superfamily (TNFRSF) agonist, or a functional fragment thereof, and an interferon (IFN) agent, or a functional fragment thereof, for use in treating HBV infection.

[0007] In certain embodiments, the TNFRSF agonist or functional fragment thereof is selected from the group consisting of lymphotoxin alpha 3 receptor agonists, lymphotoxin beta receptor agonists, herpes virus entry mediator agonists, tumor necrosis factor-like receptor weak inducer of apoptosis agonists, cluster of differentiation factor 40 agonists, CD27 agonists, CD30 agonists, 4-1BB agonists, receptor activator of nuclear factor κB agonists, Troy agonists, and OX40 receptor agonists, or functional fragments thereof.

[0008] In certain embodiments, the TNFRSF agonist or functional fragment thereof is selected from the group consisting of CD40L, LTα3, LIGHT and TWEAK or functional fragments thereof. In certain embodiments, the TNFRSF agonist or functional fragment thereof is selected from the group consisting of CD40L, LIGHT and TWEAK or functional fragments thereof.

[0009] In certain embodiments, the TNFRSF agonist or functional fragment thereof is a CD40 agonist or functional fragment thereof selected from the group consisting of CD40 ligand (CD40L) or a functional fragment thereof, an agonist anti-CD40 antibody, a functional fragment thereof or an antigen-binding fragment thereof, and a fusion protein comprising a CD40 ligand or a functional fragment thereof. In certain embodiments, the CD40L is a hexameric CD40L or a trimeric CD40L.

[0010] In certain embodiments, the TNFRSF agonist or functional fragment thereof is a polypeptide or a functional fragment thereof, an antibody or a functional fragment thereof, or an antigen-binding fragment thereof.

[0011] In certain embodiments, the TNFRSF agonist or functional fragment thereof is provided as a fusion protein comprising said TNFRSF agonist or functional fragment thereof.

[0012] In certain embodiments, the IFN agent or functional fragment thereof is selected from the group consisting of a type I IFN agent, a type II IFN agent, and a type III IFN agent or a functional fragment thereof.

[0013] In certain embodiments, the IFN agent or functional fragment thereof is IFNα, IFNβ, IFNγ or IFNλ, or a functional fragment thereof. In certain embodiments, the IFN agent or functional fragment thereof is IFNβ or IFNγ, or a functional fragment thereof. In certain embodiments, the IFN agent or functional fragment thereof is IFNβ or a functional fragment thereof. In certain embodiments, the IFN agent or functional fragment thereof is IFNα or a functional fragment thereof.

[0014] In certain embodiments, the IFN agent or functional fragment thereof is provided as a fusion protein comprising said IFN agent or functional fragment thereof.

[0015] In certain embodiments, the TNFRSF agonist or functional fragment thereof, and the IFN agent or functional fragment thereof are provided as a bifunctional immunostimulatory fusion protein comprising the TNFRSF agonist or functional fragment thereof, the IFN agent or functional fragment thereof, and a linker.

[0016] In certain embodiments, the TNFRSF agonist, or functional fragment thereof, and the IFN agent, or functional fragment thereof, are comprised in a single pharmaceutical composition.

[0017] In certain embodiments, the TNFRSF agonist, or functional fragment thereof, and the IFN agent, or functional fragment thereof, are comprised in separate pharmaceutical compositions.

[0018] In another embodiment, a pharmaceutical composition comprising a TNFRSF agonist, or a functional fragment thereof, and a type II IFN agent, a functional fragment of a type II IFN agent, a type III IFN agent, or a functional fragment of a type III IFN agent.

[0019] In another embodiment, there is provided a method of treating HBV infection and / or one or more HBV-related symptoms in a subject in need thereof, comprising administering to the subject a combination of a TNFRSF agonist (e.g., an agonist antibody directed against a member of the TNFRSF, a soluble TNFRSF agonist, including but not limited to a natural ligand thereof) or a functional fragment thereof, and an IFN agent or a functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, there is provided the combination for use in treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject. Furthermore, according to the above embodiment, there is provided a use of the combination for preparing a medicament for treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject.

[0020] In another aspect, a method of treating an HBV infection in a subject in need thereof comprises administering to the subject: (i) lymphotoxin alpha 3 (LTα3) receptor (TNFRSF1A, TNFRSF1B, or TNFRSF14) agonists (e.g., LTα3), lymphotoxin beta (LTβ) receptor (TNFRSF3) agonists (e.g., LIGHT or LTβ), herpes virus entry mediator (HVEM or TNFRSF14) agonists (e.g., LIGHT), tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonists (e.g., TNFSF12, also known as TNFSF12), TNFRSF agonists or functional fragments thereof selected from the group consisting of CD40 (TNFRSF5) agonists (e.g., CD40L), CD27 (TNFRSF7) agonists (e.g., CD70), CD30 (TNFRSF8) agonists, 4-1BB (CD137, TNFRSF9) agonists, receptor activator of nuclear factor kappa B (RANK, TNFRSF11A) agonists, Troy (TNFRSF19) agonists, and OX40 receptor (TNFRSF4) agonists; (ii) an IFN agent or a functional fragment thereof; to reduce one or more symptoms of HBV infection in a subject. According to the above embodiment, the above combination is provided for use in treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject. Furthermore, according to the above embodiment, there is provided a use of the above combination for preparing a medicament for treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject.

[0021] In another aspect, a method of treating an HBV infection in a subject in need thereof comprises administering to the subject: (i) lymphotoxin alpha 3 (LTα3) receptor (TNFRSF1A, TNFRSF1B, or TNFRSF14) agonists (e.g., LTα3), lymphotoxin beta (LTβ) receptor (TNFRSF3) agonists (e.g., LIGHT or LTβ), herpes virus entry mediator (HVEM or TNFRSF14) agonists (LIGHT), tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonists (e.g., also known as TNFSF12), a TNFRSF agonist or a functional fragment thereof selected from the group consisting of a CD40 (TNFRSF5) agonist (CD40L), a CD27 (TNFRSF7) agonist (CD70), a CD30 (TNFRSF8) agonist, a 4-1BB (CD137, TNFRSF9) agonist, a receptor activator of nuclear factor kappa B (RANK, TNFRSF11A) agonist, a Troy (TNFRSF19) agonist, and an OX40 receptor (TNFRSF4) agonist; (ii) an IFN agent or a functional fragment thereof; to reduce one or more symptoms of HBV infection in a subject. According to the above embodiment, the above combination is provided for use in treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject. Furthermore, according to the above embodiment, there is provided a use of the above combination for preparing a medicament for treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject.

[0022] In another aspect, a method of treating an HBV infection in a subject in need thereof comprises administering to the subject: (i) lymphotoxin alpha 3 (LTα3) receptor (TNFRSF1A, TNFRSF1B, or TNFRSF14) agonists (e.g., LTα3), lymphotoxin beta (LTβ) receptor (TNFRSF3) agonists (e.g., LIGHT or LTβ), herpes virus entry mediator (HVEM or TNFRSF14) agonists (e.g., LIGHT), tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonists (e.g., TNFS a TNFRSF agonist or functional fragment thereof selected from the group consisting of TWEAK (also known as F12), cluster of differentiation factor 40 (CD40, TNFRSF5) agonist (e.g., CD40L), CD27 (TNFRSF7) agonist (e.g., CD70), CD30 (TNFRSF8) agonist, receptor activator of nuclear factor kappa B (RANK, TNFRSF11A) agonist, Troy (TNFRSF19) agonist, and OX40 receptor (TNFRSF4) agonist; (ii) an IFN agent or a functional fragment thereof; to reduce one or more symptoms of HBV infection in a subject. According to the above embodiment, the above combination is provided for use in treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject. Furthermore, according to the above embodiment, there is provided a use of the above combination for preparing a medicament for treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject.

[0023] According to certain embodiments, there is provided a method of treating an HBV infection in a subject in need thereof, comprising administering to the subject: (i) lymphotoxin alpha 3 (LTα3) receptor (TNFRSF1A, TNFRSF1B, or TNFRSF14) agonists (e.g., LTα3), lymphotoxin beta (LTβ) receptor (TNFRSF3) agonists (e.g., LIGHT or LTβ), herpes virus entry mediator (HVEM or TNFRSF14) agonists (LIGHT), tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonists (e.g., TN a TNFRSF agonist or functional fragment thereof selected from the group consisting of a cluster of differentiation factor 40 (CD40, TNFRSF5) agonist (CD40L), a CD27 (TNFRSF7) agonist (CD70), a CD30 (TNFRSF8) agonist, a receptor activator of nuclear factor kappa B (RANK, TNFRSF11A) agonist, a Troy (TNFRSF19) agonist, and an OX40 receptor (TNFRSF4) agonist; (ii) an IFN agent or a functional fragment thereof; to reduce one or more symptoms of HBV infection in a subject. According to the above embodiment, the combination is provided for use in treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject. According to the above embodiment, there is provided a use of the combination for preparing a medicament for treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject.

[0024] In another aspect, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of a TNFRSF agonist or a functional fragment thereof and type I IFN, or a functional fragment of type I IFN, or a functional fragment of type II IFN, or a functional fragment of type II IFN, or a functional fragment of type III IFN, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0025] In another aspect, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of a TNFRSF agonist or a functional fragment thereof and type I IFN or a functional fragment of type I IFN to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0026] In another aspect, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of a TNFRSF agonist or a functional fragment thereof and type II IFN or a functional fragment of type II IFN, or type III IFN or a functional fragment of type III IFN, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0027] In another embodiment, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist or a functional fragment thereof selected from the group consisting of an LTα3 receptor agonist, a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, an LTβ receptor (TNFRSF3) agonist, a herpes virus entry mediator (HVEM or TNFRSF14) agonist and a differentiation factor cluster 40 (CD40, TNFRSF5) agonist, and an IFN agent or a functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, the use of the combination is provided for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0028] In a particular embodiment, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist or a functional fragment thereof selected from the group consisting of an LTα3 receptor agonist, a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, an LTβ receptor (TNFRSF3) agonist, and a cluster of differentiation factors 40 (CD40, TNFRSF5) agonist, and an IFN agent or a functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, the use of the combination is provided for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0029] In a particular embodiment, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist or a functional fragment thereof selected from the group consisting of an LTα3 receptor agonist, a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, a herpes virus entry mediator (HVEM or TNFRSF14) agonist, and a cluster of differentiation factors 40 (CD40, TNFRSF5) agonist, and an IFN agent or a functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, the use of the combination is provided for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0030] In a particular embodiment, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist or functional fragment thereof selected from the group consisting of LTα3, TWEAK, LIGHT, and CD40L, and an IFN agent or functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, the combination is provided for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection is provided.

[0031] In another embodiment, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist or a functional fragment thereof selected from the group consisting of an LTα3 receptor agonist, a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, an LTβ receptor (TNFRSF3) agonist, and a herpes virus entry mediator (HVEM or TNFRSF14) agonist, and an IFN agent or a functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, the use of the combination is provided for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0032] In a particular embodiment, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist or a functional fragment thereof selected from the group consisting of an LTα3 receptor agonist, a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and an LTβ receptor (TNFRSF3) agonist, and an IFN agent or a functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, the use of the combination for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection is provided.

[0033] In a particular embodiment, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist or a functional fragment thereof selected from the group consisting of an LTα3 receptor agonist, a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and a herpes virus entry mediator (HVEM or TNFRSF14) agonist, and an IFN agent or a functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, the use of the combination is provided for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0034] In a particular embodiment, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist or functional fragment thereof selected from the group consisting of an LTα3 receptor agonist, an LTβ receptor (TNFRSF3) agonist, a herpes virus entry mediator (HVEM or TNFRSF14) agonist, and a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and an IFN agent or functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, a use of the combination is provided for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0035] In a particular embodiment, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist or functional fragment thereof selected from the group consisting of an LTα3 receptor agonist, an LTβ receptor (TNFRSF3) agonist, and a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and an IFN agent or functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, the combination is provided for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, the use of the combination is provided for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0036] In a particular embodiment, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist or functional fragment thereof selected from the group consisting of an LTα3 receptor agonist, a herpes virus entry mediator (HVEM or TNFRSF14) agonist, and a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and an IFN agent or functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, the use of the combination is provided for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0037] In a particular embodiment, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist or functional fragment thereof selected from the group consisting of LTα3, TWEAK, and LIGHT, and an IFN agent or functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, the combination is provided for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection is provided.

[0038] In another embodiment, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist or a functional fragment thereof selected from the group consisting of an LTB receptor (TNFRSF3) agonist, a herpes virus entry mediator (HVEM or TNFRSF14) agonist, a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist and a differentiation factor cluster 40 (CD40, TNFRSF5) agonist, and an IFN agent or a functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, the use of the combination is provided for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0039] In a particular embodiment, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist or a functional fragment thereof selected from the group consisting of an LTB receptor (TNFRSF3) agonist, a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist and a differentiation factor cluster 40 (CD40, TNFRSF5) agonist, and an IFN agent or a functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, the use of the combination is provided for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0040] In a particular embodiment, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist or functional fragment thereof selected from the group consisting of a herpes virus entry mediator (HVEM or TNFRSF14) agonist, a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist and a cluster of differentiation factors 40 (CD40, TNFRSF5) agonist, and an IFN agent or functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, a use of the combination is provided for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0041] In a particular embodiment, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of a TNFRSF agonist or functional fragment thereof selected from the group consisting of CD40L, TWEAK, and LIGHT, and an IFN agent or functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0042] In another aspect, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of a cluster of differentiation factor 40 (CD40, TNFRSF5) agonist or a functional fragment thereof and an IFN agent or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0043] In certain embodiments, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of CD40L, or a functional fragment thereof, and an IFN agent, or a functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiments, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiments, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0044] In another aspect, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, particularly TWEAK, or a functional fragment thereof, and an IFN agent, or a functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the above combination for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the above combination for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0045] In another embodiment, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of an LTB receptor (TNFRSF3) agonist or a herpes virus entry mediator (HVEM or TNFRSF14) agonist, particularly LIGHT, or a functional fragment thereof, and an IFN agent or a functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, the use of the combination for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection is provided.

[0046] In a particular embodiment, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of an LTB receptor (TNFRSF3) agonist, particularly LIGHT, or a functional fragment thereof, and an IFN agent or a functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, the combination is provided for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, the use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection is provided.

[0047] In a particular embodiment, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of a herpes virus entry mediator (HVEM or TNFRSF14) agonist, particularly LIGHT, or a functional fragment thereof, and an IFN agent or a functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0048] In another aspect, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of a TNFRSF agonist or a functional fragment thereof and an IFN agent or a functional fragment thereof selected from the group consisting of IFNα, IFNβ, IFNγ and IFNλ, thereby reducing one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0049] In another aspect, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of a TNFRSF agonist or a functional fragment thereof and an IFN agent or a functional fragment thereof selected from the group consisting of IFNα and IFNβ, thereby reducing one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0050] In another aspect, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of a TNFRSF agonist or a functional fragment thereof and an IFN agent or a functional fragment thereof selected from the group consisting of IFNγ and IFNλ, thereby reducing one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0051] In another embodiment, there is provided a method of treating HBV infection and HBV-related symptoms in a subject in need thereof, comprising administering to the subject a combination of a TNFRSF agonist, or a functional fragment thereof, selected from the group consisting of an LTα3 receptor agonist, an LTβ receptor (TNFRSF3) agonist, a herpes virus entry mediator (HVEM or TNFRSF14) agonist, a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and a differentiation factor cluster 40 (CD40, TNFRSF5) agonist, and an IFN agent, or a functional fragment thereof, selected from the group consisting of IFNα, IFNβ, IFNγ, and IFNλ, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, there is provided the above combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided use of the above combination drug for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0052] In a particular embodiment, a method of treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist selected from the group consisting of an LTα3 receptor agonist, an LTβ receptor (TNFRSF3) agonist, a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and a differentiation factor cluster 40 (CD40, TNFRSF5) agonist, or a functional fragment thereof, and an IFN agent selected from the group consisting of IFNα, IFNβ, IFNγ, and IFNλ, or a functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. According to the above aspect, the use of the combination is provided for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0053] In a particular embodiment, a method of treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist or functional fragment thereof selected from the group consisting of an LTα3 receptor agonist, a herpes virus entry mediator (HVEM or TNFRSF14) agonist, a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist and a differentiation factor cluster 40 (CD40, TNFRSF5) agonist, and an IFN agent or functional fragment thereof selected from the group consisting of IFNα, IFNβ, IFNγ and IFNλ, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. According to the above aspect, the use of the combination is provided for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0054] According to a particular embodiment, there is provided a method of treating HBV infection and HBV-related symptoms in a subject in need thereof, comprising administering to the subject a combination of a TNFRSF agonist selected from the group consisting of LTα3, TWEAK, LIGHT, and CD40L, or a functional fragment thereof, and an IFN agent selected from the group consisting of IFNα, IFNβ, IFNγ, and IFNλ, or a functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0055] In another embodiment, a method of treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist or functional fragment thereof selected from the group consisting of LTα3 receptor agonist, LTβ receptor (TNFRSF3) agonist, herpes virus entry mediator (HVEM or TNFRSF14) agonist, and tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and an IFN agent or functional fragment thereof selected from the group consisting of IFNα and IFNβ, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, the use of the combination is provided for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0056] In a particular embodiment, a method for treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist or functional fragment thereof selected from the group consisting of LTα3 receptor agonists, LTβ receptor (TNFRSF3) agonists, and tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonists, and an IFN agent or functional fragment thereof selected from the group consisting of IFNα and IFNβ, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, the use of the combination is provided for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0057] In a particular embodiment, a method for treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist or functional fragment thereof selected from the group consisting of an LTα3 receptor agonist, a herpes virus entry mediator (HVEM or TNFRSF14) agonist, and a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and an IFN agent or functional fragment thereof selected from the group consisting of IFNα and IFNβ, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, the use of the combination is provided for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0058] In a particular embodiment, a method of treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist selected from the group consisting of LTα3, TWEAK, and LIGHT, or a functional fragment thereof, and an IFN agent selected from the group consisting of IFNα and IFNβ, or a functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, the combination is provided for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, the use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection is provided.

[0059] In another embodiment, a method of treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist or functional fragment thereof selected from the group consisting of an LTB receptor (TNFRSF3) agonist, a herpes virus entry mediator (HVEM or TNFRSF14) agonist, a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and a cluster of differentiation factors 40 (CD40, TNFRSF5) agonist, and an IFN agent or functional fragment thereof selected from the group consisting of IFNα and IFNβ, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, the use of the combination is provided for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0060] In a particular embodiment, a method of treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist or functional fragment thereof selected from the group consisting of an LTB receptor (TNFRSF3) agonist, a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and a cluster of differentiation factors 40 (CD40, TNFRSF5) agonist, and an IFN agent or functional fragment thereof selected from the group consisting of IFNα and IFNβ, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, the use of the combination is provided for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0061] In a particular embodiment, a method of treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist or functional fragment thereof selected from the group consisting of a herpes virus entry mediator (HVEM or TNFRSF14) agonist, a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and a cluster of differentiation factors 40 (CD40, TNFRSF5) agonist, and an IFN agent or functional fragment thereof selected from the group consisting of IFNα and IFNβ, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, the use of the combination for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection is provided.

[0062] In a particular embodiment, there is provided a method of treating HBV infection and HBV-related symptoms in a subject in need thereof, comprising administering to the subject a combination of a TNFRSF agonist selected from the group consisting of TWEAK, LIGHT and CD40L, or a functional fragment thereof, and an IFN agent selected from the group consisting of IFNα and IFNβ, or a functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0063] In another embodiment, a method of treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist or functional fragment thereof selected from the group consisting of LTα3 receptor agonists, LTβ receptor (TNFRSF3) agonists, herpes virus entry mediator (HVEM or TNFRSF14) agonists, and tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonists, and an IFN agent or functional fragment thereof selected from the group consisting of IFNγ and IFNλ, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, the use of the combination is provided for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0064] In a particular embodiment, a method for treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist or functional fragment thereof selected from the group consisting of LTα3 receptor agonists, LTβ receptor (TNFRSF3) agonists, and tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonists, and an IFN agent or functional fragment thereof selected from the group consisting of IFNγ and IFNλ, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, the use of the combination for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection is provided.

[0065] In a particular embodiment, a method for treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist or functional fragment thereof selected from the group consisting of an LTα3 receptor agonist, a herpes virus entry mediator (HVEM or TNFRSF14) agonist, and a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and an IFN agent or functional fragment thereof selected from the group consisting of IFNγ and IFNλ, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, the use of the combination is provided for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0066] According to a particular embodiment, there is provided a method of treating HBV infection and HBV-related symptoms in a subject in need thereof, comprising administering to the subject a combination of a TNFRSF agonist selected from the group consisting of LTα3, TWEAK, and LIGHT, or a functional fragment thereof, and an IFN agent selected from the group consisting of IFNγ and IFNλ, or a functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, there is provided the combination for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0067] In another embodiment, a method of treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist or functional fragment thereof selected from the group consisting of an LTB receptor (TNFRSF3) agonist, a herpes virus entry mediator (HVEM or TNFRSF14) agonist, a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and a cluster of differentiation factors 40 (CD40, TNFRSF5) agonist, and an IFN agent or functional fragment thereof selected from the group consisting of IFNγ and IFNλ, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, the use of the combination is provided for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0068] In a particular embodiment, a method of treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist or functional fragment thereof selected from the group consisting of an LTB receptor (TNFRSF3) agonist, a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and a cluster of differentiation factors 40 (CD40, TNFRSF5) agonist, and an IFN agent or functional fragment thereof selected from the group consisting of IFNγ and IFNλ, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, the use of the combination is provided for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0069] In a particular embodiment, a method of treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist or functional fragment thereof selected from the group consisting of a herpes virus entry mediator (HVEM or TNFRSF14) agonist, a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and a cluster of differentiation factors 40 (CD40, TNFRSF5) agonist, and an IFN agent or functional fragment thereof selected from the group consisting of IFNγ and IFNλ, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, the use of the combination for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection is provided.

[0070] In a particular embodiment, a method of treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist selected from the group consisting of TWEAK, LIGHT and CD40L, or a functional fragment thereof, and an IFN agent selected from the group consisting of IFNγ and IFNλ, or a functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, the combination is provided for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection is provided.

[0071] In another aspect, there is provided a method of treating HBV infection and HBV-related symptoms in a subject in need thereof, comprising administering to the subject a combination of a cluster of differentiation factor 40 (CD40, TNFRSF5) agonist or a functional fragment thereof and an IFN agent or a functional fragment thereof selected from the group consisting of IFNα and IFNβ, thereby reducing one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0072] According to certain embodiments, there is provided a method of treating HBV infection and HBV-related symptoms in a subject in need thereof, comprising administering to the subject a combination of CD40L or a functional fragment thereof and an IFN agent or a functional fragment thereof selected from the group consisting of IFNα and IFNβ, thereby reducing one or more symptoms of HBV infection in the subject. According to the above embodiments, there is provided the combination for use in treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject. Furthermore, according to the above embodiments, there is provided a use of the combination for preparing a medicament for treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject.

[0073] In another aspect, there is provided a method of treating HBV infection and HBV-related symptoms in a subject in need thereof, comprising administering to the subject a combination of a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, particularly TWEAK, or a functional fragment thereof, and an IFN agent selected from the group consisting of IFNα and IFNβ, or a functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject.

[0074] In another embodiment, a method for treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of an LTβ receptor (TNFRSF3) agonist, a herpes virus entry mediator (HVEM or TNFRSF14) agonist, particularly LIGHT, or a functional fragment thereof, and an IFN agent selected from the group consisting of IFNα and IFNβ, or a functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, the use of the combination for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection is provided.

[0075] In a particular embodiment, a method for treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of an LTB receptor (TNFRSF3) agonist, particularly LIGHT, or a functional fragment thereof, and an IFN agent or a functional fragment thereof selected from the group consisting of IFNα and IFNβ, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, the combination is provided for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, the use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection is provided.

[0076] In a particular embodiment, a method of treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of a herpes virus entry mediator (HVEM or TNFRSF14) agonist, particularly LIGHT, or a functional fragment thereof, and an IFN agent or a functional fragment thereof selected from the group consisting of IFNα and IFNβ, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, the combination is provided for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection is provided.

[0077] In another aspect, there is provided a method of treating HBV infection and HBV-related symptoms in a subject in need thereof, comprising administering to the subject a cluster of differentiation factor 40 (CD40, TNFRSF5) agonist or a functional fragment thereof and an IFN lambda agent or a functional fragment thereof selected from the group consisting of IL-28 and IL-29, thereby reducing one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the above combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the above combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0078] In certain embodiments, there is provided a method of treating HBV infection and HBV-related symptoms in a subject in need thereof, comprising administering to the subject CD40L or a functional fragment thereof and an IFNλ agent or a functional fragment thereof selected from the group consisting of IL-28 and IL-29 to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, there is provided the above combination for use in treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject. Furthermore, according to the above embodiment, there is provided a use of the above combination for preparing a medicament for treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject.

[0079] In another aspect, there is provided a method of treating HBV infection and HBV-related symptoms in a subject in need thereof, comprising administering to the subject a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, in particular TWEAK, or a functional fragment thereof, and an IFN lambda agent, or a functional fragment thereof, selected from the group consisting of IL-28 and IL-29, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the above combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the above combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0080] In another embodiment, a method for treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject an LTβ receptor (TNFRSF3) agonist, a herpes virus entry mediator (HVEM or TNFRSF14) agonist, particularly LIGHT, or a functional fragment thereof, and an IFNλ agent, or a functional fragment thereof, selected from the group consisting of IL-28 and IL-29, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, the combination is provided for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, the use of the combination is provided for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0081] In a particular embodiment, a method for treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject an LTB receptor (TNFRSF3) agonist, particularly LIGHT, or a functional fragment thereof, and an IFNλ agent, or a functional fragment thereof, selected from the group consisting of IL-28 and IL-29, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, the combination is provided for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, the use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection is provided.

[0082] In a particular embodiment, there is provided a method of treating HBV infection and HBV-related symptoms in a subject in need thereof, comprising administering to the subject a herpes virus entry mediator (HVEM or TNFRSF14) agonist, particularly LIGHT, or a functional fragment thereof, and an IFN lambda agent, or a functional fragment thereof, selected from the group consisting of IL-28 and IL-29, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the above combination for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the above combination for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0083] In another aspect, there is provided a method of treating HBV infection and HBV-related symptoms in a subject in need thereof, comprising administering to the subject a combination of a cluster of differentiation factor 40 (CD40, TNFRSF5) agonist or a functional fragment thereof and IFNγ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject.

[0084] According to certain embodiments, there is provided a method of treating HBV infection and HBV-related symptoms in a subject in need thereof, comprising administering to the subject a combination of CD40L, or a functional fragment thereof, and IFNγ, or a functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to said embodiments, there is provided said combination for use in treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject. Furthermore, according to said embodiments, there is provided a use of said combination for the preparation of a medicament for treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject.

[0085] In another aspect, there is provided a method of treating HBV infection and HBV-related symptoms in a subject in need thereof, comprising administering to the subject a combination of a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, in particular TWEAK, or a functional fragment thereof, and IFNγ, or a functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the above combination for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the above combination for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0086] In another embodiment, a method for treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of an LTB receptor (TNFRSF3) agonist, a herpes virus entry mediator (HVEM or TNFRSF14) agonist, particularly LIGHT, or a functional fragment thereof, and IFNγ or a functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, the combination is provided for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, the use of the combination for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection is provided.

[0087] In a particular embodiment, a method for treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of an LTB receptor (TNFRSF3) agonist, particularly LIGHT, or a functional fragment thereof, and IFNγ or a functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, the combination is provided for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, the use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection is provided.

[0088] In a particular embodiment, there is provided a method of treating HBV infection and HBV-related symptoms in a subject in need thereof, comprising administering to the subject a combination of a herpes virus entry mediator (HVEM or TNFRSF14) agonist, particularly LIGHT, or a functional fragment thereof, and IFNγ or a functional fragment thereof, to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0089] In another embodiment, a method for treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of an LTα3 receptor agonist or a functional fragment thereof and an IFN agent or a functional fragment thereof selected from the group consisting of IFNα and IFNβ, thereby reducing one or more symptoms of HBV infection in the subject. According to the above embodiment, the combination is provided for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, the use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection is provided.

[0090] In a particular embodiment, a method of treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of LTα3 or a functional fragment thereof and an IFN agent or a functional fragment thereof selected from the group consisting of IFNα and IFNβ, thereby reducing one or more symptoms of HBV infection in the subject. According to the above embodiment, the combination is provided for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection is provided.

[0091] In another embodiment, a method of treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of an LTα3 receptor agonist or a functional fragment thereof and an IFN agent or a functional fragment thereof selected from the group consisting of IFNγ and IFNλ, thereby reducing one or more symptoms of HBV infection in the subject. According to the above embodiment, the combination is provided for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, the use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection is provided.

[0092] In a particular embodiment, a method of treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of LTα3 or a functional fragment thereof and an IFN agent or a functional fragment thereof selected from the group consisting of IFNγ and IFNλ, thereby reducing one or more symptoms of HBV infection in the subject. According to the above embodiment, the combination is provided for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, a use of the combination is provided for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0093] In another aspect, there is provided a method of treating HBV infection and HBV-related symptoms in a subject in need thereof, comprising administering to the subject a combination of a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist or a functional fragment thereof and an IFN agent or a functional fragment thereof selected from the group consisting of IFNα and IFNβ, thereby reducing one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0094] In certain embodiments, there is provided a method of treating HBV infection and HBV-related symptoms in a subject in need thereof, comprising administering to the subject a combination of TWEAK or a functional fragment thereof and an IFN agent or a functional fragment thereof selected from the group consisting of IFNα and IFNβ, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, there is provided the combination for use in treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject. Furthermore, according to the above embodiment, there is provided a use of the combination for preparing a medicament for treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject.

[0095] In another aspect, there is provided a method of treating HBV infection and HBV-related symptoms in a subject in need thereof, comprising administering to the subject a combination of a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist or a functional fragment thereof and an IFN agent or a functional fragment thereof selected from the group consisting of IFNγ and IFNλ, thereby reducing one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0096] In certain embodiments, there is provided a method of treating HBV infection and HBV-related symptoms in a subject in need thereof, comprising administering to the subject a combination of TWEAK, or a functional fragment thereof, and an IFN agent, or a functional fragment thereof, selected from the group consisting of IFNγ and IFNλ, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, there is provided the combination for use in treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject. Furthermore, according to the above embodiment, there is provided a use of the combination for preparing a medicament for treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject.

[0097] In another embodiment, a method for treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of an LTβ receptor (TNFRSF3) agonist or a herpes virus entry mediator (HVEM or TNFRSF14) agonist or a functional fragment thereof and an IFN agent or a functional fragment thereof selected from the group consisting of IFNα and IFNβ, thereby reducing one or more symptoms of HBV infection in the subject. According to the above embodiment, the combination is provided for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, the use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection is provided.

[0098] In a particular embodiment, a method for treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of an LTβ receptor (TNFRSF3) agonist or a functional fragment thereof and an IFN agent or a functional fragment thereof selected from the group consisting of IFNα and IFNβ, thereby reducing one or more symptoms of HBV infection in the subject. According to the above aspect, the combination is provided for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection is provided.

[0099] In a particular embodiment, there is provided a method of treating HBV infection and HBV-related symptoms in a subject in need thereof, comprising administering to the subject a combination of a herpes virus entry mediator (HVEM or TNFRSF14) agonist or a functional fragment thereof and an IFN agent or a functional fragment thereof selected from the group consisting of IFNα and IFNβ, thereby reducing one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0100] In certain embodiments, there is provided a method of treating HBV infection and HBV-related symptoms in a subject in need thereof, comprising administering to the subject a combination of LIGHT, or a functional fragment thereof, and an IFN agent, or a functional fragment thereof, selected from the group consisting of IFNα and IFNβ, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, there is provided the combination for use in treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject. Furthermore, according to the above embodiment, there is provided a use of the combination for preparing a medicament for treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject.

[0101] In another embodiment, a method for treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of an LTβ receptor (TNFRSF3) agonist or a herpes virus entry mediator (HVEM or TNFRSF14) agonist or a functional fragment thereof and an IFN agent or a functional fragment thereof selected from the group consisting of IFNγ and IFNλ, thereby reducing one or more symptoms of HBV infection in the subject. According to the above embodiment, the combination is provided for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, the use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection is provided.

[0102] In a particular embodiment, a method for treating HBV infection and HBV-related symptoms in a subject in need thereof is provided, comprising administering to the subject a combination of an LTβ receptor (TNFRSF3) agonist or a functional fragment thereof and an IFN agent or a functional fragment thereof selected from the group consisting of IFNγ and IFNλ, thereby reducing one or more symptoms of HBV infection in the subject. According to the above aspect, the combination is provided for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, the use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection is provided.

[0103] In a particular embodiment, there is provided a method of treating HBV infection and HBV-related symptoms in a subject in need thereof, comprising administering to the subject a combination of a herpes virus entry mediator (HVEM or TNFRSF14) agonist or a functional fragment thereof and an IFN agent or a functional fragment thereof selected from the group consisting of IFNγ and IFNλ, thereby reducing one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0104] In certain embodiments, there is provided a method of treating HBV infection and HBV-related symptoms in a subject in need thereof, comprising administering to the subject a combination of LIGHT, or a functional fragment thereof, and an IFN agent, or a functional fragment thereof, selected from the group consisting of IFNγ and IFNλ, to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, there is provided the combination for use in treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject. Furthermore, according to the above embodiment, there is provided a use of the combination for preparing a medicament for treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject.

[0105] In another aspect, there is provided a method of treating HBV infection and HBV-related symptoms in a subject in need thereof, comprising administering to the subject a pharmaceutical composition comprising a TNFRSF agonist or a functional fragment thereof, and administering to the subject a pharmaceutical composition comprising an IFN agent or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the above combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the above combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0106] In another embodiment, there is provided a TNFRSF agonist or a functional fragment thereof for use in combination with an IFN agent or a functional fragment thereof for treating one or more symptoms of HBV infection in a subject. According to the above embodiment, there is provided a use of the above combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0107] In another embodiment, there is provided an IFN agent or a functional fragment thereof for use in combination with a TNFRSF agonist or a functional fragment thereof for treating one or more symptoms of HBV infection in a subject. According to the above embodiment, there is provided a use of the above combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0108] In another aspect, there is provided a combination of (i) at least one TNFRSF agonist or functional fragment thereof, and (ii) at least one IFN agent or functional fragment thereof, for use in treating HBV infection. According to said aspect, there is provided a use of said combination for the preparation of a medicament for treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject.

[0109] In another embodiment, there is provided a combination of (i) at least one TNFRSF agonist, or functional fragment thereof, selected from the group consisting of LTα3 receptor agonists, LTβ (TNFRSF3) agonists, herpes virus entry mediator (HVEM or TNFRSF14) agonists, tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonists, and differentiation factor cluster 40 (CD40, TNFRSF5) agonists, and (ii) an IFN agent, or functional fragment thereof, selected from the group consisting of type I IFN, type II IFN, and type III IFN, for use in treating HBV infection. According to the above embodiment, there is provided a use of the above combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0110] In another embodiment, there is provided a combination of (i) at least one TNFRSF agonist, or a functional fragment thereof, selected from the group consisting of LTα3 receptor agonists, LTβ (TNFRSF3) agonists, tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonists, and cluster of differentiation factor 40 (CD40, TNFRSF5) agonists, and (ii) an IFN agent, or a functional fragment thereof, selected from the group consisting of type I IFN, type II IFN, and type III IFN, for use in treating HBV infection. According to the above embodiment, there is provided a use of the above combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0111] In another embodiment, there is provided a combination of (i) at least one TNFRSF agonist or functional fragment thereof selected from the group consisting of LTα3 receptor agonist, herpes virus entry mediator (HVEM or TNFRSF14) agonist, tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and differentiation factor cluster 40 (CD40, TNFRSF5) agonist, and (ii) an IFN agent or functional fragment thereof selected from the group consisting of type I IFN, type II IFN, and type III IFN, for use in treating HBV infection. According to the above embodiment, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0112] In another aspect, there is provided a combination of (i) at least one TNFRSF agonist, or functional fragment thereof, selected from the group consisting of LTα3, TWEAK, LIGHT, and CD40L, and (ii) an IFN agent, or functional fragment thereof, selected from the group consisting of type I IFN, type II IFN, and type III IFN, for use in treating HBV infection. According to the above aspect, there is provided a use of the above combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0113] In another embodiment, there is provided a combination of (i) at least one TNFRSF agonist, or functional fragment thereof, selected from the group consisting of LTα3 receptor agonists, LTβ receptor (TNFRSF3) agonists, herpes virus entry mediator (HVEM or TNFRSF14) agonists, tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonists, and differentiation factor cluster 40 (CD40, TNFRSF5) agonists, and (ii) an IFN agent, or functional fragment thereof, selected from the group consisting of IFNα, IFNβ, IFNγ, and IFNλ, for use in treating HBV infection. According to the above embodiment, there is provided a use of the above combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0114] In a particular embodiment, there is provided a combination of (i) at least one TNFRSF agonist or functional fragment thereof selected from the group consisting of LTα3 receptor agonist, receptor LTβ (TNFRSF3) agonist, tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and cluster of differentiation factor 40 (CD40, TNFRSF5) agonist, and (ii) an IFN agent or functional fragment thereof selected from the group consisting of IFNα, IFNβ, IFNγ, and IFNλ, for use in treating HBV infection. According to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0115] In a particular embodiment, there is provided a combination of (i) at least one TNFRSF agonist or functional fragment thereof selected from the group consisting of LTα3 receptor agonist, herpes virus entry mediator (HVEM or TNFRSF14) agonist, tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and cluster of differentiation factor 40 (CD40, TNFRSF5) agonist, and (ii) an IFN agent or functional fragment thereof selected from the group consisting of IFNα, IFNβ, IFNγ, and IFNλ, for use in treating HBV infection. According to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0116] In certain embodiments, there is provided a combination of (i) at least one TNFRSF agonist, or functional fragment thereof, selected from the group consisting of LTα3, TWEAK, LIGHT, and CD40L, and (ii) an IFN agent, or functional fragment thereof, selected from the group consisting of IFNα, IFNβ, IFNγ, and IFNλ, for use in treating HBV infection. According to said embodiments, there is provided a use of said combination for preparing a medicament for treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject.

[0117] In another embodiment, there is provided a combination of (i) at least one TNFRSF agonist or functional fragment thereof selected from the group consisting of LTB receptor (TNFRSF3) agonist, herpes virus entry mediator (HVEM or TNFRSF14) agonist, tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and differentiation factor cluster 40 (CD40, TNFRSF5) agonist, and (ii) an IFN agent or functional fragment thereof selected from the group consisting of IFNα, IFNβ, IFNγ, and IFNλ, for use in treating HBV infection. According to the above embodiment, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0118] In a particular embodiment, there is provided a combination of (i) at least one TNFRSF agonist or functional fragment thereof selected from the group consisting of an LTB receptor (TNFRSF3) agonist, a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and a cluster of differentiation factor 40 (CD40, TNFRSF5) agonist, and (ii) an IFN agent or functional fragment thereof selected from the group consisting of IFNα, IFNβ, IFNγ, and IFNλ, for use in treating HBV infection. According to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0119] In a particular embodiment, there is provided a combination of (i) at least one TNFRSF agonist, or a functional fragment thereof, selected from the group consisting of a herpes virus entry mediator (HVEM or TNFRSF14) agonist, a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and a cluster of differentiation factor 40 (CD40, TNFRSF5) agonist, and (ii) an IFN agent, or a functional fragment thereof, selected from the group consisting of IFNα, IFNβ, IFNγ, and IFNλ, for use in treating HBV infection. According to the above aspect, there is provided a use of the above combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0120] In certain embodiments, there is provided a combination of (i) at least one TNFRSF agonist, or functional fragment thereof, selected from the group consisting of TWEAK, LIGHT, and CD40L, and (ii) an IFN agent, or functional fragment thereof, selected from the group consisting of IFNα, IFNβ, IFNγ, and IFNλ, for use in treating HBV infection. According to said embodiments, there is provided a use of said combination for preparing a medicament for treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject.

[0121] In another embodiment, there is provided a combination of (i) at least one TNFRSF agonist, or functional fragment thereof, selected from the group consisting of LTα3 receptor agonists, receptor LTβ (TNFRSF3) agonists, herpes virus entry mediator (HVEM or TNFRSF14) agonists, and tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonists, and (ii) an IFN agent, or functional fragment thereof, selected from the group consisting of IFNα and IFNβ, for use in treating HBV infection. According to the above embodiment, there is provided a use of the above combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0122] In a particular embodiment, there is provided a combination of (i) at least one TNFRSF agonist, or a functional fragment thereof, selected from the group consisting of LTα3 receptor agonists, receptor LTβ (TNFRSF3) agonists, and tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonists, and (ii) an IFN agent, or a functional fragment thereof, selected from the group consisting of IFNα and IFNβ, for use in treating HBV infection. According to the above aspect, there is provided a use of the above combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0123] In a particular embodiment, there is provided a combination of (i) at least one TNFRSF agonist or functional fragment thereof selected from the group consisting of LTα3 receptor agonists, herpes virus entry mediator (HVEM or TNFRSF14) agonists, and tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonists, and (ii) an IFN agent or functional fragment thereof selected from the group consisting of IFNα and IFNβ, for use in treating HBV infection. According to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0124] In certain embodiments, there is provided a combination of (i) at least one TNFRSF agonist, or functional fragment thereof, selected from the group consisting of LTα3, TWEAK, and LIGHT, and (ii) an IFN agent, or functional fragment thereof, selected from the group consisting of IFNα and IFNβ, for use in treating HBV infection. According to said embodiments, there is provided a use of said combination for preparing a medicament for treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject.

[0125] In another embodiment, there is provided a combination of (i) at least one TNFRSF agonist or functional fragment thereof selected from the group consisting of LTβ receptor (TNFRSF3) agonist, herpes virus entry mediator (HVEM or TNFRSF14) agonist, tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and differentiation factor cluster 40 (CD40, TNFRSF5) agonist, and (ii) an IFN agent or functional fragment thereof selected from the group consisting of IFNα and IFNβ, for use in treating HBV infection. According to the above embodiment, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0126] In a particular embodiment, there is provided a combination of (i) at least one TNFRSF agonist or functional fragment thereof selected from the group consisting of an LTβ receptor (TNFRSF3) agonist, a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and an agonist of differentiation factor cluster 40 (CD40, TNFRSF5), and (ii) an IFN agent or functional fragment thereof selected from the group consisting of IFNα and IFNβ, for use in treating HBV infection. According to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0127] In a particular embodiment, there is provided a combination of (i) at least one TNFRSF agonist or functional fragment thereof selected from the group consisting of a herpes virus entry mediator (HVEM or TNFRSF14) agonist, a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and an agonist of differentiation factor cluster 40 (CD40, TNFRSF5), and (ii) an IFN agent or functional fragment thereof selected from the group consisting of IFNα and IFNβ, for use in treating HBV infection. According to the above aspect, there is provided a use of the above combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0128] In certain embodiments, there is provided a combination of (i) at least one TNFRSF agonist, or functional fragment thereof, selected from the group consisting of TWEAK, LIGHT, and CD40L, and (ii) an IFN agent, or functional fragment thereof, selected from the group consisting of IFNα and IFNβ, for use in treating HBV infection. According to said embodiments, there is provided a use of said combination for preparing a medicament for treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject.

[0129] In another embodiment, there is provided a combination of (i) at least one TNFRSF agonist, or functional fragment thereof, selected from the group consisting of LTα3 receptor agonists, LTβ receptor (TNFRSF3) agonists, herpes virus entry mediator (HVEM or TNFRSF14) agonists, and tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonists, and (ii) an IFN agent, or functional fragment thereof, selected from the group consisting of IFNγ and IFNλ, for use in treating HBV infection. According to the above embodiment, there is provided a use of the above combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0130] In a particular embodiment, there is provided a combination of (i) at least one TNFRSF agonist, or a functional fragment thereof, selected from the group consisting of LTα3 receptor agonists, LTβ receptor (TNFRSF3) agonists, and tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonists, and (ii) an IFN agent, or a functional fragment thereof, selected from the group consisting of IFNγ and IFNλ, for use in treating HBV infection. According to the above aspect, there is provided a use of the above combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0131] In a particular embodiment, there is provided a combination of (i) at least one TNFRSF agonist or functional fragment thereof selected from the group consisting of LTα3 receptor agonist, herpes virus entry mediator (HVEM or TNFRSF14) agonist, and tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and (ii) an IFN agent or functional fragment thereof selected from the group consisting of IFNγ and IFNλ, for use in treating HBV infection. According to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0132] In certain embodiments, there is provided a combination of (i) at least one TNFRSF agonist, or functional fragment thereof, selected from the group consisting of LTα3, TWEAK, and LIGHT, and (ii) an IFN agent, or functional fragment thereof, selected from the group consisting of IFNγ and IFNλ, for use in treating HBV infection. According to said embodiments, there is provided a use of said combination for preparing a medicament for treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject.

[0133] In another embodiment, there is provided a combination of (i) at least one TNFRSF agonist or functional fragment thereof selected from the group consisting of LTB receptor (TNFRSF3) agonist, herpes virus entry mediator (HVEM or TNFRSF14) agonist, tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and differentiation factor cluster 40 (CD40, TNFRSF5) agonist, and (ii) an IFN agent or functional fragment thereof selected from the group consisting of IFNγ and IFNλ, for use in treating HBV infection. According to the above embodiment, there is provided a use of the above combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0134] In a particular embodiment, there is provided a combination of (i) at least one TNFRSF agonist or functional fragment thereof selected from the group consisting of an LTB receptor (TNFRSF3) agonist, a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and a cluster of differentiation factor 40 (CD40, TNFRSF5) agonist, and (ii) an IFN agent or functional fragment thereof selected from the group consisting of IFNγ and IFNλ, for use in treating HBV infection. According to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0135] In a particular embodiment, there is provided a combination of (i) at least one TNFRSF agonist, or a functional fragment thereof, selected from the group consisting of a herpes virus entry mediator (HVEM or TNFRSF14) agonist, a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, and a cluster of differentiation factor 40 (CD40, TNFRSF5) agonist, and (ii) an IFN agent, or a functional fragment thereof, selected from the group consisting of IFNγ and IFNλ, for use in treating HBV infection. According to the above aspect, there is provided a use of the above combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0136] In certain embodiments, there is provided a combination of (i) at least one TNFRSF agonist, or functional fragment thereof, selected from the group consisting of TWEAK, LIGHT, and CD40L, and (ii) an IFN agent, or functional fragment thereof, selected from the group consisting of IFNγ and IFNλ, for use in treating HBV infection. According to said embodiments, there is provided a use of said combination for preparing a medicament for treating HBV infection and / or reducing one or more symptoms of HBV infection in a subject.

[0137] In another aspect, there is provided a combination of (i) at least one TNFRSF agonist or functional fragment thereof and (ii) at least one IFN agent or functional fragment thereof for use in treating HBV infection by reducing the amount of pregenomic HBV RNA in HBV-infected cells. According to the above aspect, there is provided a use of the above combination for preparing a medicament for treating HBV infection in a subject and / or for reducing one or more symptoms of HBV infection.

[0138] In another aspect, a method for treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist and an IFN agent or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject.

[0139] In one embodiment of any one of the aspects of the invention, or in combination with any other embodiment of the invention, transcription of covalently closed circular (ccc) DNA to generate pregenomic (pg) RNA is inhibited in infected cells of the subject.

[0140] In one embodiment of any one of the aspects of the invention, or in combination with any other embodiment of the invention, the combination of a TNFRSF agonist and an IFN agent or functional fragment thereof synergistically inhibits transcription of pgRNA in infected cells of a subject.

[0141] In one embodiment of any one of the aspects of the invention, or in combination with any other embodiment of the invention, Hepatitis B e-antigen (HBeAg) release from HBV infected cells in a subject is inhibited.

[0142] In one embodiment of any one of the aspects of the invention, or in combination with any other embodiment of the invention, the combination of a TNFRSF agonist and an IFN agent or functional fragment thereof synergistically inhibits HBeAg release from infected cells.

[0143] In one embodiment of any one of the aspects of the invention, or in combination with any other embodiment of the invention, the combination of a TNFRSF agonist and an IFN agent or functional fragment thereof stimulates the IFN pathway in a subject.

[0144] In one embodiment of any one of the aspects of the invention, the level of an IFN pathway biomarker is increased in the subject, and the biomarker is selected from the group consisting of C-X-C motif chemokine 9 (CXCL9), C-X-C motif chemokine 10 (CXCL10) and C-X-C motif chemokine 11 (CXCL11).

[0145] In certain embodiments, the combination of a TNFRSF agonist and an IFN agent or functional fragment thereof synergistically increases IFN pathway biomarker levels in a subject.

[0146] In an embodiment of any one of the aspects of the invention, the biomarker is C-X-C motif chemokine 10 (CXCL10).

[0147] In certain embodiments, the combination of a TNFRSF agonist and an IFN agent or functional fragment thereof synergistically increases CXCL10 biomarker levels in a subject.

[0148] In an embodiment of any one of the aspects of the invention, the combination of a TNFRSF agonist and an IFN agent, or a functional fragment thereof, synergistically stimulates CXCL10 release in a subject.

[0149] In an embodiment of any one of the aspects of the invention, the infected cell is a hepatocyte.

[0150] In one embodiment of any one of the aspects of the invention, the TNFRSF agonist is an LTα3 receptor (TNFRSF1A, TNFRSF1B, or TNFRSF14) agonist (e.g., LTα3), an LTβ receptor (TNFRSF3) agonist (e.g., LIGHT or LTβ), a herpes virus entry mediator (HVEM or TNFRSF14) agonist (e.g., LIGHT), a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist (e.g., TNFS F12), cluster of differentiation factor 40 (CD40, TNFRSF5) agonists (e.g., CD40L), CD27 (TNFRSF7) agonists (e.g., CD70), CD30 (TNFRSF8) agonists, 4-1BB (CD137, TNFRSF9) agonists, receptor activator of nuclear factor kappa B (RANK, TNFRSF11A) agonists, Troy (TNFRSF19) agonists, and OX40 receptor (TNFRSF4) agonists.

[0151] In one embodiment of any one of the aspects of the invention, the TNFRSF agonist is a lymphotoxin alpha 3 (LTα3) receptor (TNFRSF1A, TNFRSF1B, or TNFRSF14) agonist, a lymphotoxin beta LTβ receptor (TNFRSF3) agonist (e.g., LIGHT or LTβ), a herpes virus entry mediator (HVEM or TNFRSF14) agonist (LIGHT), a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist, or a combination thereof. The agonist is selected from the group consisting of a CD40 agonist (e.g., TWEAK, also known as TNFSF12), a cluster of differentiation factor 40 (CD40, TNFRSF5) agonist (CD40L), a CD27 (TNFRSF7) agonist, a CD30 (TNFRSF8) agonist, a 4-1BB (CD137, TNFRSF9) agonist, a receptor activator of nuclear factor kappa B (RANK, TNFRSF11A) agonist, a Troy (TNFRSF19) agonist, and an OX40 receptor (TNFRSF4) agonist.

[0152] In one embodiment of any one of the aspects of the invention, the TNFRSF agonist is a lymphotoxin alpha 3 (LTα3) receptor (TNFRSF1A, TNFRSF1B, or TNFRSF14) agonist (e.g., LTα3), a lymphotoxin beta LTβ receptor (TNFRSF3) agonist (e.g., LIGHT or LTβ), a herpes virus entry mediator (HVEM or TNFRSF14) agonist (e.g., LIGHT), a tumor necrosis factor-like receptor weak inducer of apoptosis (TNF-α3) agonist (TNF- ... lymphotoxin beta LTβ receptor (TNFRSF3) agonist (e.g., LIGHT or LTβ), a lymphotoxin beta LTβ receptor (TNFRSF3) agonist (e.g., LIGHT), a lymphotoxin beta LTβ receptor (TNFRSF3) agonist (e.g., LIGHT), a lymphotoxin beta LTβ receptor (TNFRSF3) agonist (e.g., LIGHT), a lymphotoxin beta LTβ receptor (TNFRSF3) agonist (e.g., LIGHT), a lymphotoxin beta LTβ receptor (TNFRSF3) agonist (e.g., LIGHT), a lymphotoxin beta LTβ receptor (TNFRSF3) agonist (e.g., LIGHT), (TNFRSF12A) agonists (e.g., TWEAK, also known as TNFSF12), cluster of differentiation factor 40 (CD40, TNFRSF5) agonists (e.g., CD40L), CD27 (TNFRSF7) agonists (e.g., CD70), CD30 (TNFRSF8) agonists, receptor activator of nuclear factor kappa B (RANK, TNFRSF11A) agonists, Troy (TNFRSF19) agonists, and OX40 receptor (TNFRSF4) agonists.

[0153] In one embodiment of any one of the aspects of the invention, the TNFRSF agonist is a lymphotoxin alpha 3 (LTα3) receptor (TNFRSF1A, TNFRSF1B, or TNFRSF14) agonist, a lymphotoxin beta LTβ receptor (TNFRSF3) agonist (e.g., LIGHT or LTβ), a herpes virus entry mediator (HVEM or TNFRSF14) agonist (LIGHT), a tumor necrosis factor-like receptor weak inducer of apoptosis (TNF-α3) agonist (TNFRSF1A, TNFRSF1B, or TNFRSF14) agonist (LIGHT), a lymphotoxin beta LTβ receptor (TNFRSF3) agonist (e.g., LIGHT or LTβ), a lymphotoxin beta LTβ receptor (TNFRSF3) agonist (LIGHT ... (TNFRSF12A) agonists (e.g., TWEAK, also known as TNFSF12), cluster of differentiation factor 40 (CD40, TNFRSF5) agonists (CD40L), CD27 (TNFRSF7) agonists, CD30 (TNFRSF8) agonists, receptor activator of nuclear factor kappa B (RANK, TNFRSF11A) agonists, Troy (TNFRSF19) agonists, and OX40 receptor (TNFRSF4) agonists.

[0154] The TNFRSF agonist or a functional fragment thereof according to the present invention is provided as a fusion protein comprising the above-mentioned TNFRSF agonist or a functional fragment thereof.

[0155] In one embodiment of any one of the aspects of the invention, the TNFRSF agonist is a CD40 agonist selected from the group consisting of CD40 ligand (CD40L) or a functional fragment thereof, an agonist anti-CD40 antibody or an antigen-binding fragment thereof, and a fusion protein comprising a CD40 ligand or a functional fragment thereof.

[0156] In one embodiment of any one of the aspects of the invention, the TNFRSF agonist comprises or consists of TWEAK or a functional fragment thereof. In particular, the TNFRSF agonist is a fusion protein comprising TWEAK or a functional fragment thereof.

[0157] In an embodiment of any one of the aspects of the invention, the TNFRSF agonist comprises or consists of LIGHT or a functional fragment thereof. In particular, the TNFRSF agonist is a fusion protein comprising LIGHT or a functional fragment thereof.

[0158] In one embodiment of any one of the aspects of the invention, the TNFRSF agonist comprises or consists of CD40L or a functional fragment thereof. In particular, the TNFRSF agonist is a fusion protein comprising CD40L or a functional fragment thereof.

[0159] In an embodiment of any one of the aspects of the invention, CD40L is hexameric CD40L or trimeric CD40L.

[0160] In one embodiment of any of the aspects of the invention, the fusion protein is a bifunctional immunostimulatory fusion protein comprising a TNFRSF agonist or a functional fragment thereof, an IFN agent or a functional fragment thereof, and a linker.

[0161] According to certain embodiments, the TNFRSF agonist or functional fragment thereof, and the IFN agent or functional fragment thereof are provided as a bifunctional immunostimulatory fusion protein comprising the TNFRSF agonist or functional fragment thereof, the IFN agent or functional fragment thereof, and a linker.

[0162] In an embodiment of any one of the aspects of the invention, the IFN agent or functional fragment thereof is selected from the group consisting of type I IFN, type II IFN, and type III IFN.

[0163] In an embodiment of any one of the aspects of the invention, the IFN agent or functional fragment thereof is IFNα, IFNβ, IFNγ or IFNλ.

[0164] In an embodiment of any one of the aspects of the invention, the IFN agent or functional fragment thereof is IFNβ or IFNγ.

[0165] According to certain embodiments, the IFN agent or functional fragment thereof is provided as a fusion protein comprising said IFN agent or functional fragment thereof.

[0166] In an embodiment of any one of the aspects of the invention, the IFN agent or functional fragment thereof is IFNβ. In particular, the IFNβ is provided as a fusion protein comprising IFNβ or a functional fragment thereof.

[0167] In an embodiment of any one of the aspects of the invention, the IFN agent or functional fragment thereof is IFNα. In particular, the IFNα is provided as a fusion protein comprising IFNα or a functional fragment thereof.

[0168] In an embodiment of any one of the aspects of the invention, the IFN agent or functional fragment thereof is IFNλ. In particular, the IFNλ is provided as a fusion protein comprising IFNλ or a functional fragment thereof.

[0169] In an embodiment of any one of the aspects of the invention, the IFN agent or functional fragment thereof is IFNγ. In particular, the IFNγ is provided as a fusion protein comprising IFNγ or a functional fragment thereof.

[0170] In an embodiment of any one of the aspects of the invention, the IFN agent is provided as a fusion protein.

[0171] In an embodiment of any one of the aspects of the invention, the fusion protein is a bifunctional immunostimulatory fusion protein.

[0172] In an embodiment of any one of the aspects of the invention, the bifunctional immunostimulatory fusion protein further comprises a TNFRSF agonist or a functional fragment thereof.

[0173] In an embodiment of any one of the aspects of the invention, the TNFRSF agonist or functional fragment thereof is selected from the group consisting of CD40L, LTα3, LIGHT and / or TWEAK.

[0174] In an embodiment of any one of the aspects of the invention, the TNFRSF agonist or functional fragment thereof is selected from the group consisting of CD40L, LIGHT and / or TWEAK.

[0175] In an embodiment of any one of the aspects of the invention, the TNFRSF agonist is a polypeptide, an antibody, or an antigen-binding fragment thereof.

[0176] In an embodiment of any one of the aspects of the invention, the TNFRSF polypeptide, antibody or antigen-binding fragment thereof is provided directly to the subject.

[0177] In one embodiment of any one of the aspects of the invention, the TNFRSF polypeptide, antibody or antigen-binding fragment thereof is provided as a bifunctional immunostimulatory fusion protein.

[0178] In an embodiment of any one of the aspects of the invention, the TNFRSF polypeptide, antibody or antigen-binding fragment thereof is expressed from a polynucleotide provided to the subject.

[0179] In an embodiment of any one of the aspects of the invention, the IFN agent or functional fragment thereof is provided directly to the subject.

[0180] In an embodiment of any one of the aspects of the invention, the IFN agent or functional fragment thereof is provided as a bifunctional immunostimulatory fusion protein.

[0181] In an embodiment of any one of the aspects of the invention, the IFN agent, or functional fragment thereof, is expressed from a polynucleotide that is provided to the subject.

[0182] In another embodiment, there is provided a method of treating an HBV infection in a subject in need thereof, comprising administering to the subject (i) an anti-HBV antibody to a lymphotoxin alpha 3 (LTα3) receptor (TNFRSF1A, TNFRSF1B, or TNFRSF14) agonist, a lymphotoxin beta (LTβ) receptor (TNFRSF3) agonist (e.g., LIGHT or LTβ), a herpes virus entry mediator (HVEM or TNFRSF14) agonist (LIGHT), a tumor necrosis factor-like receptor weak inducer of apoptosis (e.g., TNFRSF12A) agonist (e.g., TNFSF12, also known as TNFSF12), or a combination of these agonists. WEAK), cluster of differentiation factor 40 (CD40, TNFRSF5) agonist (CD40L), CD27 (TNFRSF7) agonist (CD70), CD30 (TNFRSF8) agonist, 4-1BB (CD137, TNFRSF9) agonist, receptor activator of nuclear factor kappa B (RANK, TNFRSF11A) agonist, Troy (TNFRSF19) agonist, and OX40 receptor (TNFRSF4) agonist, and (ii) an IFN agent or functional fragment thereof, to reduce one or more symptoms of HBV infection in a subject.

[0183] In another aspect, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist and type I IFN or a functional fragment of type I IFN to reduce one or more symptoms of HBV infection in the subject.

[0184] In another aspect, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist and type II IFN, a functional fragment of type II IFN, type III IFN, or a functional fragment of type III IFN, to reduce one or more symptoms of HBV infection in the subject.

[0185] In another aspect, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of LTα3, LIGHT and / or TWEAK and an IFN agent or functional fragment thereof to reduce one or more symptoms of HBV infection in the subject.

[0186] In another aspect, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of CD40L and an IFN agent or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject.

[0187] In another aspect, a method for treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist and IFNα or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject.

[0188] In another aspect, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of LTα3, LIGHT and / or TWEAK and IFNα or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject.

[0189] In another aspect, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of CD40L and IFNα or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject.

[0190] In another aspect, a method for treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist and IFNβ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject.

[0191] In another aspect, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of LTα3, LIGHT and / or TWEAK and IFNβ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject.

[0192] In another aspect, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of CD40L and IFNβ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject.

[0193] In another aspect, a method for treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist and IFNγ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject.

[0194] In another aspect, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of LTα3, LIGHT and / or TWEAK and IFNγ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject.

[0195] In another aspect, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of CD40L and IFNγ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject.

[0196] In another aspect, a method for treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of a TNFRSF agonist and IFNλ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject.

[0197] In another aspect, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of LTα3, LIGHT and / or TWEAK and IFNλ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject.

[0198] In another aspect, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of CD40L and IFNλ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject.

[0199] In another aspect of the present invention, there is provided a method for treating HBV infection in a subject in need thereof, comprising administering to the subject a pharmaceutical composition comprising a TNFRSF agonist and administering to the subject a pharmaceutical composition comprising an IFN agent or a functional fragment thereof, thereby reducing one or more symptoms of HBV infection in the subject.

[0200] In an embodiment of any one of the aspects of the invention, the pharmaceutical composition is administered continuously.

[0201] In an embodiment of any one of the aspects of the invention, the pharmaceutical compositions are administered simultaneously.

[0202] In an embodiment of any one of the aspects of the invention, the TNFRSF agonist and the IFN agent, or functional fragment thereof, are administered in a single pharmaceutical composition.

[0203] In an embodiment of any one of the aspects of the invention, the TNFRSF agonist and the IFN agent, or functional fragment thereof, are comprised in separate pharmaceutical compositions.

[0204] In another aspect of the invention there is provided a TNFRSF agonist in combination with an IFN agent, or a functional fragment thereof, for use in treating one or more symptoms of HBV infection in a subject.

[0205] In another aspect of the invention there is provided an IFN agent or functional fragment thereof for use in combination with a TNFRSF agonist for the treatment of one or more symptoms of HBV infection in a subject.

[0206] In another aspect of the present invention, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of a cluster of differentiation factor 40 (CD40, TNFRSF5) agonist and IFNα or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0207] In certain embodiments, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of CD40L and IFNα or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above embodiments, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. According to the above embodiments, there is further provided a use of the combination for the preparation of a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0208] In another aspect of the present invention, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of a cluster of differentiation factor 40 (CD40, TNFRSF5) agonist and IFNβ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the above combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the above combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0209] In certain embodiments, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of CD40L and IFNβ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above embodiments, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. According to the above embodiments, there is further provided a use of the combination for the preparation of a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0210] In another aspect of the present invention, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of a cluster of differentiation factor 40 (CD40, TNFRSF5) agonist and IFNγ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the above combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the above combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0211] In certain embodiments, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of a cluster of differentiation factor 40 (CD40, TNFRSF5) agonist and IL28 or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. According to the above embodiment, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0212] In certain embodiments, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of CD40L and IL28 or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. According to the above embodiment, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0213] In certain embodiments, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of a cluster of differentiation factor 40 (CD40, TNFRSF5) agonist and IL29 or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. According to the above embodiment, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0214] In certain embodiments, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of CD40L and IL29 or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above embodiments, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. According to the above embodiments, there is provided a use of the combination for the preparation of a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0215] In another aspect of the present invention, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of an LTα3 receptor agonist and IFNα or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0216] In a particular embodiment, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of LTα3 and IFNα or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0217] In another aspect of the present invention, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist and IFNα or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0218] In certain embodiments, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of TWEAK and IFNα or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. According to the above embodiment, there is further provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0219] In another aspect of the present invention, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of an LTB receptor (TNFRSF3) agonist or a herpes virus entry mediator (HVEM or TNFRSF14) agonist and IFNα or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0220] In a particular embodiment, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of an LTB receptor (TNFRSF3) agonist and IFNα or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, the combination is provided for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection is provided.

[0221] In a particular embodiment, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of a herpes virus entry mediator (HVEM or TNFRSF14) agonist and IFNα or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0222] In certain embodiments, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of LIGHT and IFNα or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above embodiments, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. According to the above embodiments, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0223] In another aspect of the present invention, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of an LTα3 receptor agonist and IFNβ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0224] In a particular embodiment, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of LTα3 and IFNβ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0225] In another aspect of the present invention, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist and IFNβ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the above combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the above combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0226] In certain embodiments, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of TWEAK and IFNβ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above embodiments, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. According to the above embodiments, there is further provided a use of the combination for the preparation of a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0227] In another aspect of the present invention, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of an LTβ receptor (TNFRSF3) agonist or a herpes virus entry mediator (HVEM or TNFRSF14) agonist and IFNβ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0228] In a particular embodiment, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of an LTβ receptor (TNFRSF3) agonist and IFNβ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, the combination is provided for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection is provided.

[0229] In a particular embodiment, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of a herpes virus entry mediator (HVEM or TNFRSF14) agonist and IFNβ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0230] In certain embodiments, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of LIGHT and IFNβ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above embodiments, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. According to the above embodiments, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0231] In another aspect of the present invention, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of an LTα3 receptor agonist and IFNγ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0232] In a particular embodiment, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of LTα3 and IFNγ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above embodiment, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above embodiment, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0233] In another aspect of the present invention, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist and IFNγ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the above combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the above combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0234] In certain embodiments, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of TWEAK and IFNγ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above embodiments, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. According to the above embodiments, there is further provided a use of the combination for the preparation of a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0235] In another aspect of the present invention, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of an LTB receptor (TNFRSF3) agonist or a herpes virus entry mediator (HVEM or TNFRSF14) agonist and IFNγ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0236] In a particular embodiment, a method of treating HBV infection in a subject in need thereof is provided, comprising administering to the subject a combination of an LTB receptor (TNFRSF3) agonist and IFNγ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, the combination is provided for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection is provided.

[0237] In a particular embodiment, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of a herpes virus entry mediator (HVEM or TNFRSF14) agonist and IFNγ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0238] In certain embodiments, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of LIGHT and IFNγ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above embodiments, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. According to the above embodiments, there is provided a use of the combination for the preparation of a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0239] In another aspect of the present invention, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of Ig-TWEAK and IFNβ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0240] In another aspect of the present invention, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of Ig-CD40L and IFNβ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0241] In another aspect of the present invention, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of Ig-LTα3 and IFNβ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0242] In another aspect of the present invention, there is provided a method of treating HBV infection in a subject in need thereof, comprising administering to the subject a combination of Ig-LIGHT and IFNβ or a functional fragment thereof to reduce one or more symptoms of HBV infection in the subject. According to the above aspect, there is provided the combination for use in treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection. Furthermore, according to the above aspect, there is provided a use of the combination for preparing a medicament for treating HBV infection in a subject and / or reducing one or more symptoms of HBV infection.

[0243] In another aspect of the invention, a pharmaceutical composition is provided comprising a TNFRSF agonist and type II IFN, a functional fragment of type II IFN, type III IFN, or a functional fragment of type III IFN.

[0244] In another aspect of the invention, a pharmaceutical composition is provided comprising a TNFRSF agonist and type I IFN or a functional fragment of type I IFN.

[0245] In another aspect of the invention, there is provided a pharmaceutical composition comprising LTα3, LIGHT and / or TWEAK and an IFN agent or a functional fragment thereof.

[0246] In another aspect of the invention, there is provided a pharmaceutical composition comprising a TNFRSF agonist and IFNα, or a functional fragment thereof.

[0247] In another aspect of the invention, there is provided a pharmaceutical composition comprising LTα3, LIGHT and / or TWEAK and IFNα or a functional fragment thereof.

[0248] In another aspect of the invention, there is provided a pharmaceutical composition comprising CD40L and IFNα, or a functional fragment thereof.

[0249] In another aspect of the invention, there is provided a pharmaceutical composition comprising a TNFRSF agonist and IFNβ, or a functional fragment thereof.

[0250] In another aspect of the invention, there is provided a pharmaceutical composition comprising LTα3, LIGHT and / or TWEAK and IFNβ or a functional fragment thereof.

[0251] In another aspect of the invention, there is provided a pharmaceutical composition comprising CD40L and IFNβ, or a functional fragment thereof.

[0252] In another aspect of the invention, there is provided a pharmaceutical composition comprising a TNFRSF agonist and IFNγ, or a functional fragment thereof.

[0253] In another aspect of the invention, there is provided a pharmaceutical composition comprising LTα3, LIGHT and / or TWEAK and IFNγ or a functional fragment thereof.

[0254] In another aspect of the invention, there is provided a pharmaceutical composition comprising CD40L and IFNγ, or a functional fragment thereof.

[0255] In another aspect of the invention, there is provided a pharmaceutical composition comprising a TNFRSF agonist and IFNλ, or a functional fragment thereof.

[0256] In another aspect of the invention, there is provided a pharmaceutical composition comprising LTα3, LIGHT and / or TWEAK and IFNλ or a functional fragment thereof.

[0257] In another aspect of the invention, there is provided a pharmaceutical composition comprising CD40L and IFNλ, or a functional fragment thereof.

[0258] The above and other features and advantages of the present invention will be more fully understood from the following detailed description of illustrative embodiments taken in connection with the accompanying drawings. [Brief description of the drawings]

[0259] [Figure 1] 1A-1B are graphical representations of synergistic reduction of Hepatitis B e antigen (HBeAg) release using combinations of interferon beta (IFNβ) and cluster of differentiation 40 ligand (CD40L) or interferon alpha (IFNα) and cluster of differentiation 40 ligand (CD40L) in primary human hepatocytes infected with Hepatitis B Virus (HBV). Primary human hepatocytes were assayed 8 days post-infection and treated with IFNα, IFNβ and / or CD40L on days 2 and 6. IFNα, 1000U; IFNβ, 100U; CD40L, 150ng / mL. FIG. 1A shows a schematic of the experimental timeline. FIG. 1B shows a graphical representation of HbeAg levels with different agents. [Diagram 2] 2A-B show the effects of IFNβ and CD40L on the transcription of closed circular DNA (cccDNA) into pregenomic RNA (pgRNA) in HBV-infected primary hepatocytes. FIG. 2A shows a schematic overview of the assay. FIG. 2B graphically shows that short-term stimulation is sufficient to significantly reduce pgRNA transcription. [Diagram 3]Figures 3A-B show the effect of IFNβ and CD40L on signal transduction pathways. Figure 3A shows a graph of CXCL10 release in the IFN pathway, and shows that the combination of IFNβ and CD40L synergistically enhances the IFN pathway. Figure 3B shows a graph of IL8 release in the inflammatory pathway, and shows that IFNβ and CD40L do not synergistically enhance the inflammatory pathway. [Figure 4A] Figures 4A-B show the effect of different IFN types on CXCL10 release. Figure 4A graphically illustrates the effect of different TNF family members in combination with different IFN types. Figure 4B graphically illustrates the synergistic effect of co-stimulation of hepatocytes with CD40L and type III interferons (IL28 and IL29). [Figure 4B] Figures 4A-B show the effect of different IFN types on CXCL10 release. Figure 4A graphically illustrates the effect of different TNF family members in combination with different IFN types. Figure 4B graphically illustrates the synergistic effect of co-stimulation of hepatocytes with CD40L and type III interferons (IL28 and IL29). [Diagram 5] Figure 5 is a graphical representation of the synergistic effect mediated by various CD40 agonists in combination with IFNβ on CXCL10 release. Specifically, Figure 5 shows the effect of hexameric CD40L (hCD40L), trimeric CD40L (tCD40L) and an anti-CD40 agonist antibody (α-CD40) on CXCL10 release. [Figure 6] Figures 6A-B are graphs showing the potency of synergy of CD40L with IFNβ. Figure 6A shows the effect of CD40L with IFNβ on CXCL10 release, with the hashed box indicating the saturation point. Figure 6B shows the effect of CD40L with IFNβ on IL8 release. [Figure 7-1]7A-7F are graphical representations of the synergistic effect of CD40L with IFNβ measured by transcriptome analysis at selected time points, expressed as Fragments Per Kilobase of Exon Per Million Fragments Mapped (FPKM). FIG. 7A shows the effect of CD40L with IFNβ on CXCL10 mRNA expression. FIG. 7B shows the effect of CD40L with IFNβ on CXCL8 / IL8 mRNA expression. FIG. 7C shows the effect of CD40L with IFNβ on CXCL9 mRNA expression. FIG. 7D shows the effect of CD40L with IFNβ on mRNA CXCL11 expression. FIG. 7E shows the effect of CD40L with IFNβ on CXCL3 mRNA expression. FIG. 7F shows the effect of CD40L with IFNβ on CCL20 mRNA expression. [Figure 7-2] Continued from Figure 7-1. [Figure 8] 8 is a graphical representation of the synergistic effect of CD40L in combination with IFNβ on CXCL10 release from primary human hepatocytes. CXCL10 release was assayed on days 3 and 7 after stimulation of primary human hepatocytes (PHH) infected or uninfected with HBV. [Figure 9-1] Figures 9A-9B are graphs showing the synergistic effect of Ig-Tweak (Figure 9A) and Ig-LIGHT (Figure 9B) in combination with IFNβ on CXCL10 release in hepatocytes (HepaRG cells). Figures 9C-9D are graphs showing the functional effect of Ig-Tweak (Figure 9C) and Ig-LIGHT (Figure 9D) on the NFκB pathway in A549 cells. Figures 9E-9F are graphs showing the enhancement of IFNb (interferon β)-induced antiviral effect in primary hepatocytes infected with HBV by Ig-Tweak (Figure 9E) and Ig-LIGHT (Figure 9F). NS: no stimulation, NT: no treatment. [Figure 9-2] Continued from Figure 9-1. [Figure 9-3]Continued from Figure 9-2. [Figure 10] 10A-10B are graphs showing the effect of three Duokine molecules on activation of the CD40L-mediated NFκB pathway (FIG. 10A) and type I IFN-mediated JAK / STAT pathway reporter assays (FIG. 10B). Duokine includes an IFNβ-IgG1 Fc-CD40L fusion (IFNb-Ig-CD40L), an IFNβ-CD40L fusion with a single linker (IFNb-CD40L), and an IFNβ-leucine zipper (LZ)-CD40L fusion (IFNb-LZ-CD40L). [Figure 11] Figures 11A-11B are graphs showing the effect of Duokine molecules on CXCL10 release from liver cells (hepaRG cells). Figure 11A shows the effect of three different Duokine molecules alone on CXCL10 release. Figure 11B shows the effect of Duokine in combination with an anti-CD40L antagonist antibody. [Figure 12] Figure 12 is a graph showing the effect of Duokine molecule on CXCL10 release from liver cells (HepaRG cells). Duokine is an IFNβ-IgG1 Fc-Tweak fusion (IFNb-Ig-Tweak). Vvide: empty vector. [Figure 13] Figure 13 is a graph showing the effect of Duokine molecules on CXCL10 release from hepatocytes. Duokine includes IFNβ-IgG1 Fc-Light fusion (IFNb-Ig-Light) and IFNβ-leucine zipper (LZ)-Light fusion (IFNb-LZ-Light). Vvide: empty vector. [Figure 14A] 14A-B are graphical representations of viremia and viral antigen persistence at various time points up to 49 days after adeno-associated virus (AAV) / HBV injection in mice. FIG. 14A shows serum HBV DNA levels. FIG. 14B shows serum HBV antigen levels. [Figure 14B]Figures 14A-B are graphical representations of viremia and viral antigen persistence at various time points up to 49 days after adeno-associated virus (AAV) / HBV injection in mice. Figure 14B shows serum HBV antigen levels. [Figure 15] FIG. 15 shows cccDNA formation in the AAV / HBV model. [Figure 16] Figure 16 is a graphical representation of the synergistic effect of mCD40L in combination with mIFNβ on CXCL10 release in an in vivo mouse model. "MIX-mCD40L": combination of mIFNb and mCD40L. [Figure 17-1] Figure 17A graphically depicts the activity of recombinant mouse mIFNb-Fc-mIgG1 in the interferon pathway using IFN-reporter Raw-Dual cells. Figure 17B graphically depicts the activity of recombinant mouse Fc-mIgG1-mCD40L in the CD40-induced NFκB pathway in HEK-CD40 reporter cells. Figure 17C graphically depicts the ELISA dosage of mIFNb-Fc-mIgG1 in the serum of mice administered 0.84 μg of recombinant protein. Figure 17D graphically depicts the dosage of Fc-mIgG1-mCD40L in the serum sampled at different times after administration of 30 μg of recombinant protein to mice. [Figure 17-2] Continued from Figure 17-1. [Figure 18-1] Figure 18 shows the antiviral activity of mouse fusion proteins containing interferon beta (mIFNb-Fc-mIgG1) and CD40L alone (Fc-mIgG1-mCD40L) or in combination in an AAV / HBV transduced mouse model. The study design and study groups (Figure 18A) as well as viral parameters at each sampling time are shown. Peripheral blood viral protein HBe-Ag (Figure 18B), viremia: peripheral blood HBV DNA levels (Figure 18C) and liver HBV DNA levels (Figure 18D) are expressed as mean ± sem as individual values. Liver HBV pgRNA (Figure 18E) is expressed as geometric mean as fold change of individual data. [Figure 18-2]Continued from Figure 18-1. [Figure 18-3] Continued from Figure 18-2. [Figure 19-1] Figures 19A-C graphically depict the functional activity of the fusion protein IFNa-huIgG1-huCD40L in HEK-Blue-CD40 cells (Figure 19A), HEK-Blue-IFNa / b cells (Figure 19B) and HBV infection (Hbe shedding) of primary hepatocytes (Figure 19C). IFNa: interferon alpha. [Figure 19-2] Continued from Figure 19-1. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0260] The present invention is based in part on the discovery of a combination therapy that synergistically inhibits the transcription of Hepatitis B Virus (HBV) covalently closed circular DNA (cccDNA) into pregenomic RNA (pgRNA) in HBV-infected cells, synergistically inhibits the release of Hepatitis B e antigen (HBeAg) from HBV-infected cells, and synergistically enhances the IFN pathway in uninfected and HBV-infected hepatocytes, particularly in uninfected and HBV-infected primary human hepatocytes. A combination therapy is provided that includes administering a TNFRSF agonist (e.g., an agonist antibody directed against a member of the TNFRSF, a soluble TNFRSF agonist, including but not limited to its natural ligand), or a functional fragment thereof, and an interferon (IFN) agent or a functional fragment thereof to HBV-infected cells or a subject infected with HBV.

[0261] The present disclosure will be more readily understood in light of selected terms defined below.

[0262] As used herein, "TNFRSF agonist" refers to a compound (e.g., a protein, a fusion protein, a polypeptide, an antibody, an antigen-binding fragment of an antibody, etc.) that activates TNFRSF. For example, a TNFRSF agonist can be an agonist antibody directed against a member of the TNFRSF, a soluble TNFRSF agonist, including but not limited to, its natural ligand or a functional fragment thereof.

[0263] As used herein, the term "antibody" refers to an immunoglobulin molecule that comprises four polypeptide chains, two heavy (H) and two light (L) chains interconnected by disulfide bonds, and multimers thereof (e.g., IgM). Each heavy chain contains a heavy chain variable region (abbreviated VH or V H ) and the heavy chain constant region (CH or C H The heavy chain constant region contains three domains, CH1, CH2 and CH3. Each light chain contains a light chain variable region (abbreviated VL) and a light chain constant region (CL or C L ). The light chain constant region contains one domain (CL1). The VH and VL regions can be further subdivided into regions of hypervariability called complementarity determining regions (CDRs), interspersed with more conserved regions called framework regions (FRs). Each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0264] As used herein, the term "ligand" refers to any substance that can bind or be bound to another substance. A ligand can be a peptide, polypeptide, protein, aptamer, polysaccharide, sugar molecule, carbohydrate, lipid, oligonucleotide, polynucleotide, synthetic molecule, inorganic molecule, organic molecule, and any combination thereof.

[0265] As used herein, the term "functional fragment" refers to a fragment of a substance that retains one or more functional activities of the original substance.For example, the functional fragment of a TNFRSF agonist refers to a fragment of a TNFRSF agonist that retains the function of the TNFRSF agonist described herein, for example, it activates target TNFRSF.The functional fragment of an interferon refers to a fragment of an interferon that retains the IFN function described herein, for example, it mediates IFN pathway signaling.

[0266] As used herein, "hepatitis B virus" or "HBV" refers to the double-stranded DNA virus that causes hepatitis B, which belongs to a family of closely related DNA viruses called hepadnaviruses. Hepadnaviruses have a strong preference for infecting liver cells, but small amounts of hepadnavirus DNA can be found in kidney, pancreas, and mononuclear cells. However, infection at these sites is not associated with extrahepatic disease.

[0267] HBV virions, or Dane particles, consist of an outer lipid envelope and an icosahedral nucleocapsid core composed of proteins. The nucleocapsid contains the viral DNA, and a DNA polymerase with reverse transcriptase activity similar to retroviruses. The outer envelope contains embedded proteins involved in viral binding and entry of susceptible cells. The virus is one of the smallest enveloped animal viruses with a virion diameter of 42 nm, but pleomorphic forms exist, including filamentous and spherical bodies lacking a core. These particles are not infectious and are composed of lipids and proteins that form part of the virion surface, called surface antigens (HBsAg), which are produced in excess during the viral life cycle. HBV contains HBsAg, HBcAg (and its splice variant HBeAg), DNA polymerase and Hbx. HBV is one of the few known non-retroviral viruses that utilizes reverse transcription as part of its replication process.

[0268] The HBV nucleocapsid contains a relatively small, partially double-stranded circular DNA of 3.2 kb, viral polymerase and core protein. The genome has only four long open reading frames. The pre-SS (pre-surface-surface) region of the genome encodes three viral surface antigens by differential initiation of translation at each of three in-frame start codons.

[0269] The most abundant protein of HBV is the 24 kD S protein (known as HBsAg). The pre-CC (precore-core) region encodes HBcAg (HBV core antigen) and HBeAg (HBVe antigen). HBeAg is not required for viral replication and plays no role in viral assembly. The P coding region is specific for the viral polymerase, a multifunctional enzyme involved in DNA synthesis and RNA capsid formation. The X open reading frame encodes the viral X protein (HBx), which regulates host cell signaling and can directly and indirectly affect host and viral gene expression.

[0270] The HBV life cycle is thought to begin with the virus attaching to the host cell membrane via its envelope protein. It has been suggested that HBV binds to a receptor on the plasma membrane that is primarily expressed on human hepatocytes via the pre-S1 domain of the large envelope protein as an early step in HBV infection. However, the nature of the receptor remains controversial. The viral membrane then fuses with the cell membrane, releasing the viral genome into the cell.

[0271] HBV replication is regulated by various factors, including hormones, growth factors, and cytokines. After the viral genome reaches the nucleus, the viral polymerase converts the partial double-stranded DNA (dsDNA) genome into covalently closed circular DNA (cccDNA). This DNA is transcribed by the host RNA Pol-II, and the resulting DNA serves as a template for further propagation of pregenomic and subgenomic RNAs.

[0272] The pregenomic RNA is bifunctional, serving both as a template for viral DNA synthesis and as a messenger for preC, C, and P translation. The subgenomic RNA functions only in the translation of the envelope and X proteins. All viral RNA is transported to the cytoplasm, where its translation gives rise to the viral envelope, core, and polymerase proteins, as well as HBx and HBcAg.

[0273] HBV core particles assemble in the cytoplasm, during which one molecule of pregenomic RNA is incorporated into the assembling viral core. Once the viral RNA is encapsidated, reverse transcription begins. Synthesis of the two viral DNA strands is continuous. The first DNA strand is made from the encapsidated RNA template; during or after the synthesis of this strand, the RNA template is degraded and synthesis of the second DNA strand proceeds using the newly made first DNA strand as a template. Some of the cores with mature genomes are transported back to the nucleus, where their newly made DNA genomes are converted to cccDNA, maintaining a stable intranuclear pool of transcription templates.

[0274] HBV surface antigen (HBsAg) proteins are initially synthesized and polymerized in the rough endoplasmic reticulum. These proteins are transported to the posterior endoplasmic reticulum and anterior Golgi, followed by budding of the nucleocapsid. Assembled HBV virions and subviral particles are transported to the Golgi apparatus for further modification of the glycans of the surface proteins and then secreted from the host cell, completing the life cycle.

[0275] In certain embodiments, the methods and compositions described herein are used to synergistically inhibit the release of HBeAg from HBV-infected cells and / or synergistically enhance the IFN pathway in HBV-infected cells (e.g., hepatocytes). As used herein, the terms "synergistically" and "synergistic" refer to an effect mediated by two or more components (e.g., a TNFRSF agonist and an IFN or functional fragment thereof) that is greater than the additive effect of each component used separately. The synergistic effect can be about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% or more greater than the additive effect of the individual components.

[0276] In certain embodiments, the methods and compositions described herein are used to treat HBV infection.As used herein, "treat HBV infection" and "treat HBV infection" refer to one or more of the following: (i) reduce HBV viral load / viral titer (i.e., reduce the number of infectious viral particles per mL); (ii) reduce cccDNA transcription; (iii) reduce the level of pregenomic RNA in cells; (iv) reduce one or more HBV-related disorders; and (v) reduce one or more HBV-related symptoms in a subject.

[0277] In certain embodiments, the methods and compositions described herein are used to reduce the HBV viral load / viral titer of HBV-infected cells. The HBV viral load / viral titer can be reduced by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to untreated HBV-infected cells.

[0278] In certain embodiments, the methods and compositions described herein are used to reduce HBV cccDNA transcription in HBV-infected cells. The cccDNA transcription can be reduced by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to untreated HBV-infected cells.

[0279] In certain embodiments, the methods and compositions described herein are used to reduce the level of pregenomic HBV RNA in HBV-infected cells. The pregenomic HBV RNA level can be reduced by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to untreated HBV-infected cells.

[0280] As used herein, "HBV-related disorder" refers to a disorder resulting from the infection of a subject with HBV. HBV-related disorders include, but are not limited to, acute hepatitis, chronic hepatitis, icteric hepatitis, fulminant hepatitis, subfulminant hepatitis, and symptoms and / or complications resulting from any of these disorders.

[0281] As used herein, "HBV-associated condition," "symptoms of HBV infection," or "HBV-associated complications" include one or more physical impairments associated with HBV infection. Symptoms and complications of HBV include, but are not limited to, cirrhosis, hepatocellular carcinoma (HCC), membranous glomerulonephritis (MGN), death, acute necrotizing vasculitis (polyarteritis nodosa), membranous glomerulonephritis, papular dermatitis of childhood (Gianotti-Crosti syndrome), HBV-associated nephropathy (e.g., membranous glomerulonephritis), immune-mediated hematopoietic disorders (e.g., essential mixed cryoglobulinemia, aplastic anemia), portal hypertension, ascites, encephalopathy, jaundice, pruritus, pale stools, steatorrhea, arteritis nodosa, glomerular disease, abnormal ALT levels, abnormal AST levels, abnormal alkaline phosphatase levels, elevated bilirubin levels, loss of appetite, nausea, fever, nausea, vomiting, etc.

[0282] As used herein, "interferon agent" or "IFN" refers to a cytokine or derivative thereof that is typically produced and released by cells in response to the presence of a pathogen or tumor cell. IFN includes type I IFN (e.g., IFNα, IFNβ, IFNε, IFNκ, IFNτ, IFNζ, IFNω), type II IFN (e.g., IFNγ), and type III IFN (e.g., IFNλ1, IFNλ2, and IFNλ3).

[0283] According to certain exemplary embodiments, the combination therapies described herein utilize one or more of full-length IFN, modified variants thereof (e.g., chemically (e.g., PEGylated) modified variants or muteins), or biologically active fragments thereof that retain one or more signaling activities of full-length IFN. In certain embodiments, the IFN agent is a human IFN agent.

[0284] In certain embodiments, the combination therapies described herein utilize one or more of IFNα, an IFNα fragment, IFNβ, an IFNβ fragment, IFNγ, an IFNγ fragment, IFNλ, or an IFNλ fragment.

[0285] In other exemplary embodiments, the combination therapy described herein utilizes one or more of IFNα, IFNα fragments, IFNβ, IFNβ fragments, IFNγ, IFNγ fragments, IFNλ, or IFNλ fragments that are part of a fusion protein, e.g., a bifunctional immune stimulatory fusion protein (e.g., TNFRSF agonist / IFN Duokine). In yet other exemplary embodiments, the combination therapy described herein utilizes one or more of IFNα, IFNα fragments, IFNβ, IFNβ fragments, IFNγ, IFNγ fragments, IFNλ, or IFNλ fragments expressed by a nucleic acid sequence.

[0286] In certain embodiments, the expression levels of one or more IFN signaling pathway biomarkers are altered, i.e., upregulated or downregulated, in HBV-infected cells treated with a combination therapy described herein (e.g., a combination of a TNFRSF agonist and an IFN agent or a fragment thereof). According to certain exemplary embodiments, the expression levels of one or more IFN pathway biomarkers are upregulated in HBV-infected cells treated with a combination therapy described herein (e.g., a combination of a TNFRSF agonist or a fragment thereof and an IFN or a fragment thereof).

[0287] According to certain embodiments, suitable IFN pathway biomarkers characterized herein are chemokines, e.g., CXC chemokines, selected from the group consisting of CXCL9, CXCL10, and CXCL11. In certain exemplary embodiments, suitable biomarkers induced by the IFN pathway are CXCL9, CXCL10, and / or CXCL11, and also the interferon stimulated gene ISG20.

[0288] As used herein, tumor necrosis factor (ligand) superfamily members (or TNFSF) refer to proteins belonging to a superfamily of protein ligands that share a prominent extracellular TNF homology domain (THD) (Bremer ISRN Oncology (2013), Article ID 371854, page 25, online access: dx.doi.org / 10.1155 / 2013 / 371854). The THD induces the formation of non-covalent homotrimers. TNF ligands are typically expressed as type II transmembrane proteins, but the majority can undergo proteolytic processing to soluble ligands. TNF ligands exert their biological functions by binding to and activating members of the TNFRSF. TNFRSFs are typically expressed as trimeric type I transmembrane proteins and contain one to six cysteine-rich domains (CRDs) in their extracellular domains. An important function of the TNF superfamily is the provision of costimulatory signals at distinct stages of the immune response. Some ligands have the ability to bind and activate different receptors (e.g., LTα3 binds and activates TNFRSF1A, TNFRSF1B and TNFRSF14, LIGHT binds and activates TNFRSF3 and TNFRSF14 (TNFSF14)). Exemplary TNFSF gene family members are listed in Table 1 below and are derived from the HUGO Gene Nomenclature Committee (HGNC) (see Gray et al., Nucleic Acids Res. vol. 43:D1079-1085 (2015); HGNC database, HUGO Gene Nomenclature Committee (HGNC), EMBL Outstation-Hinxton, European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridgeshire, CB10 1SD, UK www.genenames.org). The approved symbol indicates the HGNC symbol that applies to a particular gene, and the approved name corresponds to the full spelling of the gene. Previous symbols refer to any previous symbols used by HGNC to refer to particular genes.Synonyms refer to alternative, synonymous names for a particular gene.

[0289] [Table 1] [Table 2]

[0290] [Table 3] [Table 4]

[0291] As used herein, "TNFRSF agonist" refers to a compound (e.g., a protein, fusion protein, polypeptide, antibody, antigen-binding fragment of an antibody, etc.) that activates the TNFRSF, e.g., a TNFRSF listed in Table 2. Table 2, like Table 1 above, is derived from HGNC. For example, the TNFRSF agonist can be an agonist antibody directed against a member of the TNFRSF, a soluble TNFRSF agonist, including but not limited to, a natural ligand thereof or a functional fragment thereof.

[0292] In certain exemplary embodiments, the TNFRSF agonist includes, but is not limited to, an LTα3 receptor (TNFRSF1A, TNFRSF1B, or TNFRSF14) agonist, an LTβ receptor (TNFRSF3) agonist (e.g., LIGHT or LTβ), a herpes virus entry mediator (HVEM or TNFRSF14) agonist (LIGHT), a tumor necrosis factor-like receptor weak inducer of apoptosis (TNFRSF12A) agonist (e.g., TN These include TWEAK (also known as FSF12), cluster of differentiation factor 40 (CD40, TNFRSF5) agonist (CD40L), CD27 (TNFRSF7) agonist (CD70), CD30 (TNFRSF8) agonist, 4-1BB (CD137, TNFRSF9) agonist, receptor activator of nuclear factor kappa B (RANK, TNFRSF11A) agonist, Troy (TNFRSF19) agonist, and OX40 receptor (TNFRSF4) agonist.

[0293] According to certain exemplary embodiments, the combination therapies described herein utilize one or more of an agonistic antibody directed against a TNF receptor, a soluble TNFRSF agonist, such as, but not limited to, its natural ligand, or any modified variant (e.g., mutein) or biologically active fragment thereof that retains one or more signaling activities of the full-length or soluble TNFRSF agonist.

[0294] In certain embodiments, the combination therapy described herein utilizes one or more TNFRSF agonists. According to certain exemplary embodiments, the TNFRSF agonist is provided as a multimer (e.g., dimer, trimer, tetramer, pentamer, hexamer, heptamer, octamer, etc.) or as a fusion protein, for example, a fusion protein comprising a TNFRSF agonist and an IFN agent or a biologically active fragment of an IFN agent (e.g., see Table 3 for examples of suitable fusion proteins). In other embodiments, the TNFRSF agonist is provided as an agonist antibody or an antigen-binding fragment thereof.

[0295] In certain embodiments, the combination therapies described herein utilize one or more TNFRSF agonists selected from CD40L, TWEAK, LIGHT, and LTα3. In certain exemplary embodiments, the combination therapies described herein utilize one or more CD40 agonists that are multimeric CD40L, e.g., hexameric CD40L, trimeric CD40L, etc. In other exemplary embodiments, the combination therapies described herein utilize one or more anti-CD40 agonist antibodies. Examples of suitable anti-CD40 agonist antibodies include, but are not limited to, CP-870,893 (Pfizer / Roche), SGN-40 (Seattle Genetics), ADC-1013 (Janssen / Alligator BioSciences), Chi Lob 7 / 4 (University of Southampton), dacetumumab (Seattle Genetics), APX005M (Apexigen, Inc.), 3G5 (Celldex) and CDX-1140 (Celldex). In yet other exemplary embodiments, the combination therapy described herein utilizes one or more CD40 agonists, such as CD40L / IFNb fusion proteins, e.g., bifunctional immune stimulatory fusion proteins (e.g., CD40L / IFN Duokines (see, e.g., International Publication No. WO2016 / 113395, which is incorporated by reference in its entirety for all purposes)). In yet another exemplary embodiment, the combination therapy described herein utilizes one or more CD40 agonists expressed by nucleic acid sequences. The term "fusion protein" as used herein generally refers to a protein made by connecting two or more separate peptides or proteins, resulting in a single protein with one or more functional properties derived from each of the original proteins. Fusion proteins include, for example, complexes of monomers and multimers, such as dimers, trimers, tetramers, etc., of separate fusion proteins.

[0296] In certain exemplary embodiments, the fusion protein has the following general formula: A n -LB m (Formula I) wherein A is a TNFRSF agonist or a functional fragment thereof, B is an IFN agent or a functional fragment thereof, and L comprises or consists of a linker. In certain embodiments, two or more fusion proteins of formula I are linked to each other via one or more additional linkers "L".

[0297] A n "n" as used herein refers to 1, 2, 3, 4, 5, 6, 7, 8 or more TNFRSF agonists or functional fragments thereof linked with one or more linkers "L". In certain embodiments, two or more TNFRSF agonists or functional fragments thereof are linked with a single linker. In other embodiments, two or more TNFRSF agonists or functional fragments thereof are complexed to one another (e.g., as an oligomer), and one or more complexed TNFRSF agonists or functional fragments thereof are linked with one or more linkers. In yet other embodiments, individual TNFRSF agonists or functional fragments thereof are linked with a single linker.

[0298] B m"m" as used herein refers to 1, 2, 3, 4, 5, 6, 7, 8 or more IFN agents or functional fragments thereof, where "m" is linked to two or more ligands or fragments or variants thereof linked to one or more linkers "L". In certain embodiments, two or more ligands or fragments or variants thereof are linked to a single linker. In other embodiments, two or more ligands or fragments or variants thereof are complexed to one another (e.g., as an oligomer), where one or more of the complexed ligands or fragments or variants thereof are linked to one or more linkers. In yet other embodiments, each ligand or fragment or variant thereof is linked to a single linker.

[0299] The term "linker" or "L" as used herein refers to one or more A n one or more B m The term "peptide linker" refers to any moiety that covalently connects two or more ligands or fragments or variants thereof. In an exemplary embodiment, the linker is a peptide linker. The term "peptide linker" as used herein refers to a peptide adapted to link two or more ligands or fragments or variants thereof. The peptide linker may have any length, i.e., may contain any number of amino acid residues. The linker is typically long enough to provide the proper degree of flexibility to prevent the linked moieties from interfering with each other's activities, e.g., the ability of the ligand to multimerize and / or bind to the receptor. In an exemplary embodiment, the linker is or includes an Fc domain (e.g., a human IgG1 or IgG3 Fc domain) or a fragment thereof. In other embodiments, the linker is a Gly-Ser or Gly-Ser-Thr linker composed of multiple glycine, serine, and, where applicable, threonine residues. In other embodiments, the linker is a combination of an Fc domain or a fragment thereof and a Gly-Ser linker or a Gly-Ser-Thr linker. Sequences of peptide linkers according to certain exemplary embodiments are shown in Table 3.

[0300] L may further comprise a multimerization domain that allows the multimerization of the fusion protein. In such a case, L may comprise a peptide linker into which the multimerization domain is inserted. In an alternative embodiment, L may comprise two peptide linkers, and the two peptide linkers can be the same or different. In yet another embodiment, the multimerization domain represents the peptide linker constituted by L.

[0301] Multimerization can occur through non-covalent and / or covalent interactions, in particular via one or more disulfide bonds, or by aligning multiple coding sequences of the same molecule between multiple (e.g., 2, 3, 4 or more) multimerization domains.

[0302] Suitable multimerization domains are known to those skilled in the art and include, for example, the tenascin trimerization motif, the collectin trimerization domain and streptavidin, as well as dimerization domains such as IgE heavy chain domain 2 (EHD2), IgM heavy chain domain 2 (MHD2), IgG heavy chain domain 3 (GHD3), IgA heavy chain domain 3 (AHD2), IgD heavy chain domain 3 (DHD3), IgE heavy chain domain 4 (EHD4), IgM heavy chain domain 4 (MHD4), Fc domain, uteroglobin dimerization domain and leucine zipper (LZ) domain.

[0303] In certain embodiments, the fusion protein can be a bifunctional immunostimulatory fusion protein comprising a TNFRSF agonist or a functional fragment thereof, an IFN agent or a functional fragment thereof, and a linker.

[0304] In an embodiment of any one of the aspects of the invention, the bifunctional immunostimulatory fusion protein is a protein comprising a TNFRSF agonist or a functional fragment thereof, an IFN agent or a functional fragment thereof, and a linker.

[0305] In an embodiment of any one of the aspects of the invention, the bifunctional immunostimulatory fusion protein is a protein comprising CD40L or a functional fragment thereof, IFNα or a functional fragment thereof, and a linker.

[0306] In an embodiment of any one of the aspects of the invention, the bifunctional immunostimulatory fusion protein is a protein comprising CD40L or a functional fragment thereof, IFNβ or a functional fragment thereof, and a linker.

[0307] In an embodiment of any one of the aspects of the invention, the bifunctional immunostimulatory fusion protein is a protein comprising CD40L, or a functional fragment thereof, IFNγ, or a functional fragment thereof, and a linker.

[0308] In an embodiment of any one of the aspects of the invention, the bifunctional immunostimulatory fusion protein is a protein comprising CD40L, or a functional fragment thereof, IFNλ, or a functional fragment thereof, and a linker.

[0309] In an embodiment of any one of the aspects of the invention, the bifunctional immunostimulatory fusion protein is a protein comprising TWEAK, or a functional fragment thereof, IFNα, or a functional fragment thereof, and a linker.

[0310] In an embodiment of any one of the aspects of the invention, the bifunctional immunostimulatory fusion protein is a protein comprising TWEAK or a functional fragment thereof, IFNβ or a functional fragment thereof, and a linker.

[0311] In an embodiment of any one of the aspects of the invention, the bifunctional immunostimulatory fusion protein is a protein comprising TWEAK, or a functional fragment thereof, IFNγ, or a functional fragment thereof, and a linker.

[0312] In an embodiment of any one of the aspects of the invention, the bifunctional immunostimulatory fusion protein is a protein comprising TWEAK, or a functional fragment thereof, IFNλ, or a functional fragment thereof, and a linker.

[0313] In an embodiment of any one of the aspects of the invention, the bifunctional immunostimulatory fusion protein is a protein comprising LIGHT, or a functional fragment thereof, IFNα, or a functional fragment thereof, and a linker.

[0314] In an embodiment of any one of the aspects of the invention, the bifunctional immunostimulatory fusion protein is a protein comprising LIGHT, or a functional fragment thereof, IFNβ, or a functional fragment thereof, and a linker.

[0315] In an embodiment of any one of the aspects of the invention, the bifunctional immunostimulatory fusion protein is a protein comprising LIGHT, or a functional fragment thereof, IFNγ, or a functional fragment thereof, and a linker.

[0316] In an embodiment of any one of the aspects of the invention, the bifunctional immunostimulatory fusion protein is a protein comprising LIGHT, or a functional fragment thereof, IFNλ, or a functional fragment thereof, and a linker.

[0317] As used herein, "Duokine" refers to a fusion protein that includes one, two or more cytokines. The sequences of Duokine and its components according to certain exemplary embodiments are shown in Table 3.

[0318] [Table 5] [Table 6] [Table 7] [Table 8] [Table 9] [Table 10] [Table 11]

[0319] The ingredients shown in Table 3 above are used to prepare the medicaments or pharmaceutical compositions disclosed herein.

[0320] In a preferred embodiment, the active agent consists of a polypeptide derived from those identified in Table 3 above, in particular SEQ ID NOs: 1, 2, 3, 4, 5, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 and 33 above, and lacks any signal peptide when used for the treatment of HBV infection. Indeed, signal peptides present early in the sequence of the polypeptides are cleaved off as they are synthesized.

[0321] [Table 12]

[0322] Nucleic acids and expression vectors In one embodiment, a combination of a polynucleotide encoding a TNFRSF agonist or a functional fragment thereof and an IFN agent or a functional fragment thereof is provided. Also provided is a method of producing a combination of a TNFRSF agonist or a functional fragment thereof and an IFN agent or a functional fragment thereof, comprising expressing these polynucleotides.

[0323] Polynucleotides encoding the TNFRSF agonists or functional fragments thereof, IFN agents or functional fragments of IFN agents disclosed herein are typically inserted into expression vectors for introduction into host cells used to produce desired amounts of the claimed antibodies or immunoadhesins.Thus, in certain embodiments, the invention provides expression vectors comprising the polynucleotides disclosed herein, as well as host cells comprising these vectors and polynucleotides.

[0324] The term "vector" or "expression vector" is used herein for the purpose of the present specification and claims to mean a vector used according to the present invention as a vehicle for introducing and expressing a desired gene in a cell. As known to those skilled in the art, such vectors can be easily selected from the group consisting of plasmids, phages, viruses and retroviruses. In general, vectors compatible with the present invention include a selection marker, an appropriate restriction site to facilitate cloning of the desired gene, and the ability to enter and / or replicate in eukaryotic or prokaryotic cells.

[0325] A number of expression vector systems can be used for the purposes of the present invention. For example, one class of vectors utilizes DNA elements derived from animal viruses such as bovine papilloma virus, polyoma virus, adenovirus, vaccinia virus, baculovirus, retrovirus (RSV, MMTV or MOMLV), or SV40 virus. Others involve the use of polycistronic systems with internal ribosome binding sites. Additionally, cells that have integrated the DNA into their chromosomes are selected by introducing one or more markers that allow for the selection of transfected host cells. Markers can provide prototrophy for auxotrophic hosts, biocide resistance (e.g., antibiotics) or resistance to heavy metals such as copper. The selectable marker gene is either directly linked to the DNA sequence to be expressed or introduced into the same cell by cotransformation. Additional elements may be required to optimize the synthesis of mRNA. These elements may include signal sequences, splice signals, as well as transcription promoters, enhancers, and termination signals. In some embodiments, the cloned variable region genes are inserted into an expression vector along with the synthetic heavy and light chain constant region genes (such as human genes) discussed above.

[0326] In other embodiments, the TNFRSF agonist or functional fragment thereof, IFN agent or functional fragment of IFN agent described herein can be expressed using a polycistronic construct. In such expression systems, multiple gene products of interest, such as TNFRSF agonist or functional fragment thereof, IFN or functional fragment of IFN, are produced from a single polycistronic construct. These systems advantageously use internal ribosome entry sites (IRES) to provide relatively high levels of polypeptides in eukaryotic host cells. Compatible IRES sequences are disclosed in U.S. Patent No. 6,193,980, which is incorporated herein by reference. Those skilled in the art will understand that such expression systems can be used to effectively produce the full range of polypeptides disclosed in this application.

[0327] More generally, once a vector or DNA sequence encoding the TNFRSF agonist or functional fragment thereof, IFN agent or functional fragment of an IFN agent of the present disclosure has been prepared, the expression vector can be introduced into a suitable host cell. That is, the host cell is transformed. Introduction of the plasmid into the host cell can be accomplished by a variety of techniques well known to those skilled in the art. These include, but are not limited to, transfection (including electrophoresis and electroporation), protoplast fusion, calcium phosphate precipitation, cell fusion with enveloped DNA, microinjection, and infection with intact virus. See, for example, Ridgway, AAG, "Mammalian Expression Vectors," Chapter 24.2, pp. 470-472, Vectors, edited by Rodriguez and Denhardt, (Butterworths, Boston, MA 1988). The transformed cells are grown under conditions suitable for the production of light and heavy chains, and assayed for heavy and / or light chain protein synthesis. Exemplary assay techniques include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), or fluorescence activated cell sorting analysis (FACS), immunohistochemistry, and the like.

[0328] As used herein, the term "transformation" is used broadly to refer to the introduction of DNA into a recipient host cell, altering the genotype and resulting in a change in the recipient cell.

[0329] Along these same lines, "host cells" refer to cells that have been transformed with a vector constructed using recombinant DNA technology and encoding at least one heterologous gene. In describing methods for isolating polypeptides from recombinant hosts, the terms "cells" and "cell culture" are used interchangeably to indicate the source of the antibody, unless otherwise clearly specified. In other words, recovery of polypeptides from "cells" can mean either from whole cells or from the cell culture, including both the medium and the suspended cells.

[0330] In one embodiment, the host cell line used for expressing the TNFRSF agonist or its functional fragment, IFN agent or functional fragment of an IFN agent is of eukaryotic or prokaryotic origin. In one embodiment, the host cell line used for expressing the TNFRSF agonist or its functional fragment, IFN agent or functional fragment of an IFN agent is of bacterial origin. In one embodiment, the host cell line used for expressing the TNFRSF agonist or its functional fragment, IFN agent or functional fragment of an IFN agent is of mammalian origin; one skilled in the art can determine the particular host cell line that is most suitable for the desired gene product to be expressed therein. Exemplary host cell lines include, but are not limited to, DG44 and DUXB11 (Chinese hamster ovary lines, DHFR minus), HELA (human cervical carcinoma), CVI (monkey kidney line), COS (derivative of CVI with SV40 T antigen), R1610 (Chinese hamster fibroblasts), BALBC / 3T3 (mouse fibroblasts), HAK (hamster kidney line), SP2 / O (mouse myeloma), BFA-1c1BPT (bovine endothelial cells), RAJI (human lymphocytes), 293 (human kidney). In one embodiment, the cell line provides modified glycosylation, e.g., afucosylation, of the antibody expressed therefrom (e.g., PER.C6® (Crucell) or a FUT8 knockout CHO cell line (POTELLIGENT™ cells) (Biowa, Princeton, NJ)). In one embodiment, NS0 cells can be used. Host cell lines are typically available from commercial services, the American Tissue Culture Collection, or from published literature.

[0331] In vitro production allows for the scale-up of the desired TNFRSF agonist or functional fragment thereof, IFN or functional fragment of IFN to be produced in large quantities. Techniques for mammalian cell culture under tissue culture conditions are known in the art and include homogenous suspension culture in, for example, airlift reactors or continuous stirring reactors, or immobilized or entrapped cell culture in, for example, hollow fibers, microcapsules, agarose microbeads or ceramic cartridges. If necessary and / or desired, the solution of the TNFRSF agonist or functional fragment thereof, IFN agent or functional fragment of IFN agent can be purified by conventional chromatographic methods, for example, gel filtration, ion exchange chromatography, chromatography on DEAE-cellulose and / or (immuno) affinity chromatography.

[0332] One or more genes encoding the TNFRSF agonist or its functional fragment, IFN or functional fragment of IFN can also be expressed in non-mammalian cells, such as bacteria or yeast or plant cells. In this regard, it is understood that various unicellular non-mammalian microorganisms, such as bacteria, can also be transformed; i.e., those that can grow in culture or fermentation. Bacteria susceptible to transformation include bacteria of the Enterobacteriaceae family, such as Escherichia coli or Salmonella; Bacillaceae, such as Bacillus subtilis; Pneumococcus; Streptococcus; and Haemophilus influenzae. Furthermore, it is understood that when expressed in bacteria, the TNFRSF agonist or its functional fragment, IFN or functional fragment of IFN can be part of inclusion bodies. It is necessary to isolate and purify the TNFRSF agonist or its functional fragment, IFN or functional fragment of IFN.

[0333] In addition to prokaryotes, eukaryotic microbes can also be used. Saccharomyces cerevisiae, or common baker's yeast, is the most commonly used of the eukaryotic microorganisms, although many other strains are commonly available. For expression in Saccharomyces, plasmids such as YRp7 (Stinchcomb et al., Nature 282:39 (1979); Kingsman et al., Gene 7:141 (1979); Tschemper et al., Gene 10:157 (1980)) are commonly used. This plasmid already contains the TRP1 gene, which provides a selection marker for mutant strains of yeast lacking the ability to grow on tryptophan, e.g., ATCC No. 44076 or PEP4-1 (Jones, Genetics 85:12 (1977)). The presence of the trp1 lesion as a feature of the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.

[0334] Therapeutic Vector A nucleic acid sequence encoding a TNFRSF agonist or a functional fragment thereof, an IFN agent or a functional fragment of an IFN agent can be inserted into a vector and used as a therapeutic vector, e.g., a vector expressing a TNFRSF agonist or a functional fragment thereof, an IFN agent or a functional fragment of an IFN agent. The construction of suitable functional expression constructs and therapeutic expression vectors is known to those of skill in the art.

[0335] Therapeutic vectors can be delivered to a subject, for example, by intravenous injection, local administration (see U.S. Pat. No. 5,328,470), or by stereotactic injection (e.g., Chen et al., PNAS 91:3054-3057 (1994)). Pharmaceutical preparations of the therapeutic vector can include the vector in an acceptable diluent.

[0336] Nucleic acids encoding the TNFRSF agonist or functional fragment thereof, IFN agent or functional fragment of an IFN agent can be incorporated into genetic constructs used as part of a therapeutic protocol to deliver the nucleic acid encoding the TNFRSF agonist or functional fragment thereof, IFN agent or functional fragment of an IFN agent. Expression vectors are provided for in vivo transfection and expression of the TNFRSF agonist or functional fragment thereof, IFN agent or functional fragment of an IFN agent.

[0337] Such component expression constructs can be administered in any biologically effective carrier, e.g., any formulation or composition capable of effectively delivering the component nucleic acid sequences to cells in vivo, as known to those of skill in the art. Approaches include, but are not limited to, the insertion of the nucleic acid sequences of the invention into viral vectors, including, but not limited to, recombinant retroviruses, adenoviruses, adeno-associated viruses and herpes simplex virus-1, recombinant bacterial or eukaryotic plasmids, and the like.

[0338] Retrovirus vectors and adeno-associated virus vectors can be used as recombinant delivery systems for the transfer of exogenous nucleic acid sequences in vivo, particularly to humans. Such vectors provide efficient delivery of genes into cells, and the transferred nucleic acid is stably integrated into the host's chromosomal DNA.

[0339] The development of specialized cell lines (called "packaging cells") that produce only replication-defective retroviruses has increased the utility of retroviruses for gene therapy, and defective retroviruses are characterized for use in gene transfer for gene therapy purposes (for a review, see, e.g., Miller, Blood 76:271-78 (1990)). Replication-defective retroviruses can be packaged into virions that can be used to infect target cells using helper viruses by standard techniques. Protocols for producing recombinant retroviruses and infecting cells in vitro or in vivo with such viruses can be found in Current Protocols in Molecular Biology, Ausubel et al. (eds.) Greene Publishing Associates (1989), sections 9.10-9.14, and other standard laboratory manuals. Non-limiting examples of suitable retroviruses include pLJ, pZIP, pWE and pEM, which are known to those skilled in the art. Examples of suitable packaging virus lines include: * Crip, * Cre, * 2 and *Am (e.g., Eglitis et al., Science 230:1395-1398 (1985); Danos and Mulligan, Proc. Natl. Acad. Sci. USA 85:6460-6464 (1988); Wilson et al., Proc. Natl. Acad. Sci. USA 85:3014-3018 (1988); Armentano et al., Proc. Natl. Acad. Sci. USA 87:6141-6145 (1990); Huber et al., Proc. Natl. Acad. Sci. USA 88:8039-8043 (1991); Ferry et al., Proc. Natl. Acad. Sci. USA 89:1011-1012 (1992)). 88:8377-8381 (1991); Chowdhury et al., Science 254:1802-1805 (1991); van Beusechem et al., Proc. Acad. Sci. USA 89:7640-7644 (1992); Kay et al., Human Gene Therapy 3:641-647 (1992); Dai et al., Proc. Natl. Acad. Sci. USA 89:10892-10895 (1992); Hwu et al., J. Immunol. 150:4104-4115 (1993); U.S. Patent No. 4,868,116; U.S. Patent No. 4,980,286; PCT Publication No. WO89 / 07136; PCT Publication No. WO89 / 02468; PCT Publication No. WO89 / 05345; PCT Publication No. WO92 / 07573).

[0340] In another embodiment, an adenovirus-derived delivery vector is provided. The genome of adenovirus can be engineered to encode and express a gene product of interest, but inactivated in terms of its ability to replicate in a normal lytic viral life cycle. See, for example, Berkner et al., BioTechniques 6:616 (1988); Rosenfeld et al., 252:431-434 (1991); and Rosenfeld et al., Cell 68:143-155 (1992). Suitable adenovirus vectors derived from the adenovirus strain Ad type 5 d1324 or other strains of adenovirus (e.g., Ad2, Ad3, Ad7, etc.) are known to those skilled in the art. Recombinant adenoviruses can be advantageous in certain situations in that they cannot infect non-dividing cells and can be used to infect a wide variety of cell types, including epithelial cells (Rosenfeld et al. (1992), supra). Furthermore, viral particles are relatively stable, amenable to purification and concentration, and can be modified to affect the spectrum of infectivity, as described above. In addition, the introduced adenoviral DNA (and the foreign DNA contained therein) is not integrated into the genome of the host cell, but remains episomal, thereby avoiding problems that may arise as a result of in situ insertional mutagenesis, in which the introduced DNA becomes integrated into the host genome (e.g., retroviral DNA). Furthermore, the capacity of the adenoviral genome for foreign DNA is large (up to 8 kilobases) compared to other delivery vectors (Berkner et al. (1998), supra; Haj-Ahmand and Graham, J. Virol. 57:267 (1986)).

[0341] Yet another viral vector system useful for delivery of the nucleic acid sequence encoding TNFRSF agonist or its functional fragment, IFN agent or functional fragment of IFN agent is adeno-associated virus (AAV). AAV is a naturally occurring defective virus that requires another virus, such as adenovirus or herpes virus, as a helper virus for efficient replication and productive life cycle (for review, see Muzyczka et al., Curr. Topics in Micro. and Immunol. vol. 158: 97-129 (1992)). It is also one of the few viruses that integrates DNA into non-dividing cells and shows a high frequency of stable integration (see, e.g., Flotte et al., Am. J. Respir. Cell. Mol. Biol. 7:349-356 (1992); Samulski et al., J. Virol. 63:3822-3828 (1989); and McLaughlin et al., J. Virol. 62:1963-1973 (1989)). Vectors containing as little as 300 base pairs of AAV can be packaged and integrated. Space for exogenous DNA is limited to approximately 4.5 kb. AAV vectors such as those described in Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985) can be used to introduce DNA into cells. A variety of nucleic acids have been introduced into different cell types using AAV vectors (see, e.g., Hermonat et al., Proc. Natl. Acad. Sci. USA 81:6466-6470 (1984); Tratschin et al., Mol. Cell. Biol. 4:2072-2081 (1985); Wondisford et al., Mol. Endocrinol. 2:32-39 (1988); Tratschin et al., J. Virol. 51:611-619 (1984); and Flotte et al., J. Biol. Chem. 268:3781-3790 (1993)).

[0342] In addition to viral transfer methods, non-viral methods can also be used to express the nucleic acid sequence encoding the TNFRSF agonist or functional fragment thereof, IFN agent or functional fragment of IFN agent in tissues of a subject. Most non-viral gene transfer methods rely on normal mechanisms used by mammalian cells for the uptake and intracellular transport of macromolecules. In some embodiments, the non-viral delivery system relies on endocytic pathways for the uptake of the gene by the target cell. Exemplary delivery systems of this type include liposome-guided systems, polylysine conjugates, and artificial viral envelopes. Other embodiments include plasmid injection systems such as those described in Meuli et al., J. Invest. Dermatol. 116(1):131-135 (2001); Cohen et al., Gene Ther 7(22):1896-905 (2000); or Tam et al., Gene Ther. 7(21):1867-74 (2000).

[0343] In a clinical setting, the delivery system can be introduced into a subject by any of a number of methods, each of which is well known in the art. For example, the pharmaceutical preparation of the delivery system can be introduced systemically, for example, by intravenous injection. Specific transduction of the protein in the target cell results primarily from the specificity of transfection provided by the delivery vehicle, cell type or tissue type expression, due to the transcriptional regulatory sequences that control the expression of the receptor gene, or a combination thereof. In other embodiments, the initial delivery of the recombinant gene is more limited, where the introduction into the animal is highly localized. For example, the delivery vehicle can be introduced by a catheter (see U.S. Pat. No. 5,328,470) or by stereotactic injection (e.g., Chen et al., PNAS 91:3054-3057 (1994)).

[0344] The pharmaceutical preparation of the therapeutic construct can consist essentially of the delivery system in an acceptable diluent, or can comprise a slow release matrix in which the delivery vehicle is imbedded. Alternatively, where the complete delivery system can be produced intact from recombinant cells, e.g., retroviral vectors, the pharmaceutical preparation can include one or more cells which produce the delivery system.

[0345] Treatment method In one aspect, the present invention provides a method of treating a patient in need thereof (e.g., a patient infected with HBV), comprising administering an effective amount of a TNFRSF agonist or a functional fragment thereof, or a nucleic acid sequence (e.g., mRNA) encoding a TNFRSF agonist or a functional fragment thereof, and an effective amount of an IFN agent or a functional fragment of an IFN agent, or a nucleic acid sequence (e.g., mRNA) encoding an IFN agent or a functional fragment of an IFN agent, as disclosed herein. In certain embodiments, the present disclosure provides kits and methods for treating disorders and / or conditions, e.g., HBV-associated disorders and / or HBV-associated conditions, in a mammalian subject in need of such treatment. In certain exemplary embodiments, the subject is a human.

[0346] The TNFRSF agonist or its functional fragment, IFN or functional fragment of IFN, or the nucleic acid sequence that encodes it of the present disclosure is useful in many different applications.For example, in one embodiment, the TNFRSF agonist or its functional fragment, IFN or functional fragment of IFN, or the nucleic acid sequence that encodes it is useful for reducing HBeAg release from HBV-infected cells.In another embodiment, the TNFRSF agonist or its functional fragment, IFN or functional fragment of IFN, or the nucleic acid sequence that encodes it is useful for reducing the pgRNA transcription of cccDNA in HBV-infected cells.

[0347] In another embodiment, the TNFRSF agonist or functional fragment thereof, IFN or functional fragment of IFN, or nucleic acid sequences encoding them, are useful for reducing one or more symptoms and / or complications associated with HBV infection, as described herein (below).

[0348] In certain embodiments, the TNFRSF agonists or functional fragments thereof, IFN or functional fragments of IFN, or nucleic acid sequences encoding them, are useful for reducing one or more disorders, symptoms and / or complications associated with chronic HBV infection, such as chronic inflammation of the liver that over the course of several years leads to cirrhosis (chronic hepatitis); hepatocellular carcinoma (HCC); development of membranous glomerulonephritis (MGN); risk of mortality; acute necrotizing vasculitis (polyarteritis nodosa), membranous glomerulonephritis, and childhood papular dermatitis (Gianotti-Crosti syndrome); HBV-associated nephropathy (e.g., membranous glomerulonephritis); immune-mediated hematopoietic disorders (e.g., essential mixed cryoglobulinemia, aplastic anemia), etc.

[0349] In certain embodiments, the TNFRSF agonists or functional fragments thereof, IFN or functional fragments thereof, or nucleic acid sequences encoding them are useful for reducing one or more symptoms and / or complications associated with acute HBV infection, such as acute viral hepatitis (which begins with general ill health, loss of appetite, nausea, vomiting, body aches, mild fever, dark urine, then progresses to jaundice, fulminant hepatic failure, and / or a serum sickness-like syndrome); loss of appetite; joint and muscle pain; low-grade fever; stomach pain; nausea; vomiting; jaundice; distended stomach, etc.

[0350] Thus, the present disclosure also relates to a method of treating one or more disorders, symptoms and / or complications associated with HBV infection in a human or other animal by administering to such human or animal an effective, non-toxic amount of a TNFRSF agonist or functional fragment thereof, and an IFN agent or functional fragment of an IFN agent, or a nucleic acid sequence encoding the same. Those skilled in the art can determine by routine experimentation whether an effective, non-toxic amount of a TNFRSF agonist or functional fragment thereof, and an IFN agent or functional fragment of an IFN agent, or a nucleic acid sequence encoding the same, is for the purpose of treating HBV infection.

[0351] For example, the therapeutically active amount of the TNFRSF agonist or functional fragment thereof, IFN agent or functional fragment of the IFN agent of the present disclosure may vary according to factors such as the stage of the disease (e.g., acute vs. chronic), age, sex, medical complications (e.g., HIV co-infection, immunosuppressive condition or disease) and weight of the subject, as well as the ability of the TNFRSF agonist or functional fragment thereof and IFN agent or functional fragment of the IFN agent to induce a desired response in the subject. Dosage regimens can be adjusted to provide optimal therapeutic response. For example, several divided doses can be administered daily, or the dose can be proportionally reduced as indicated by the exigencies of the therapeutic situation.

[0352] In general, the compositions provided in the present disclosure can be used to prophylactically treat non-infected cells or to therapeutically treat any HBV-infected cells that contain a TNFRSF agonist or a functional fragment thereof and an antigenic marker that allows targeting of HBV-infected cells with an IFN agent or a functional fragment of an IFN agent.

[0353] Pharmaceutical Compositions and Their Administration Methods for preparing and administering the disclosed TNFRSF agonist or functional fragment thereof, IFN or functional fragment of IFN, or nucleic acid sequences encoding the same to a subject are well known or can be easily determined by those skilled in the art using the present disclosure and knowledge in the art as a guide. The route of administration of the disclosed TNFRSF agonist or functional fragment thereof, IFN or functional fragment of IFN, or nucleic acid sequences encoding the same can be oral, parenteral, inhalation or topical. The term "parenteral" as used herein includes intravenous, intraarterial, intraperitoneal, intramuscular, subcutaneous, rectal or vaginal administration. All of these administration forms are expressly intended to be within the scope of the present disclosure, however, the administration form is a solution for injection, particularly a solution for intravenous or intraarterial injection or infusion. Typically, pharmaceutical compositions suitable for injection may include buffers (e.g., acetate, phosphate or citrate buffers), surfactants (e.g., polysorbates), and optionally stabilizers (e.g., human albumin), etc. In some embodiments, a TNFRSF agonist or a functional fragment thereof, IFN or a functional fragment of IFN, or a nucleic acid sequence encoding them, can be delivered directly to the site of a harmful cell population (e.g., the liver), thereby increasing exposure of the diseased tissue to the therapeutic agent.

[0354] In certain embodiments, the administration of the TNFRSF agonist or functional fragment thereof, IFN or a functional fragment of IFN, or the nucleic acid sequences encoding them, as described herein, is sequential, e.g., administration of a dose of the TNFRSF agonist or a functional fragment thereof, or a nucleic acid sequence encoding same, followed by administration of an IFN agent or a functional fragment of an IFN agent, or a nucleic acid sequence encoding same, or administration of a dose of an IFN agent or a functional fragment of an IFN agent, or a nucleic acid sequence encoding same, followed by administration of the TNFRSF agonist or a functional fragment thereof, or a nucleic acid sequence encoding same.

[0355] In certain embodiments, a dose of a TNFRSF agonist or functional fragment thereof and a dose of an IFN agent or functional fragment of an IFN agent, or a nucleic acid sequence encoding them, are administered simultaneously, e.g., in separate doses, at about the same time, or in the same dose (e.g., as a mixture or as Duokine).

[0356] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions or suspensions, including saline and buffered media. In the compositions and methods of the present disclosure, pharma- ceutically acceptable carriers include, but are not limited to, 0.01-0.1M, e.g., 0.05M phosphate buffer, or 0.8% saline. Other common parenteral vehicles include sodium phosphate solutions, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers, e.g., those based on Ringer's dextrose, and the like. Preservatives and other additives may also be present, such as, for example, antimicrobials, antioxidants, chelating agents, and inert gases and the like. More specifically, pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (if water soluble) or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In such cases, the composition must be sterile and must be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage, and is typically preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be, for example, a solvent or dispersion medium containing water, ethanol, polyol (for example, glycerin, propylene glycol, and liquid polyethylene glycol, etc.), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.

[0357] Prevention of microbial action can be achieved by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. In many cases, isotonic agents, such as sugars, polyalcohols, such as mannitol, sorbitol, or sodium chloride, are included in the composition. Prolonged absorption of the injectable composition can be achieved by including in the composition an agent that delays absorption, such as aluminum monostearate and gelatin.

[0358] In any case, a sterile injectable solution can be prepared by incorporating the required amount of active compound (e.g., TNFRSF agonist or functional fragment thereof, IFN agent or functional fragment of IFN agent, or nucleic acid sequence encoding any of them, either by itself or in combination with other active agents) into a suitable solvent containing one or a combination of ingredients as listed herein, if necessary, and then filter sterilization. In general, dispersions are prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and other ingredients as required from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, exemplary methods of preparation include vacuum drying and freeze-drying, which produces a powder of the active ingredient and any additional desired ingredients from the solution previously sterile-filtered. The preparations for injection are processed and filled into containers such as ampoules, bags, bottles, syringes or vials, and sealed under aseptic conditions according to methods known in the art. In addition, the preparations are packaged and sold in the form of a kit. Such articles of manufacture typically bear a label or package insert indicating that the associated composition is useful for treating a subject suffering from an HBV infection.

[0359] The effective dose of the composition of the present disclosure varies depending on many different factors, including administration means, target site, physiological condition of the patient, whether the patient is human or animal, other drugs administered, and whether the treatment is preventive or therapeutic, in the treatment of the above-mentioned HBV infection-related conditions.Usually, the patient is a human, but non-human mammals, including transgenic mammals, can also be treated.The treatment dosage can be titrated using routine methods known to those skilled in the art to optimize safety and efficacy.

[0360] For passive immunization with a TNFRSF agonist or functional fragment thereof, an IFN agent or a functional fragment of an IFN agent, the dosage can be in the range of, for example, about 0.0001 to about 100 mg / kg, more usually about 0.01 to about 5 mg / kg (e.g., about 0.02 mg / kg, about 0.25 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, etc.) of host body weight. For example, the dosage can be about 1 mg / kg body weight or about 10 mg / kg body weight, or in the range of about 1 to about 10 mg / kg, e.g., at least about 1 mg / kg. Intermediate doses in the above ranges are also contemplated to be within the scope of the present disclosure. Subjects are administered such doses daily, every other day, weekly, or according to other schedules determined by empirical analysis. An exemplary treatment entails administration in multiple dosages over an extended period of, for example, at least six months. Further exemplary treatment regimens entail administration about once every two weeks, or about once a month, or about once every 3 to 6 months. Exemplary dosing schedules include about 1 to about 10 mg / kg or about 15 mg / kg on consecutive days, about 30 mg / kg on alternate days, or about 60 mg / kg / week.

[0361] The TNFRSF agonist or its functional fragment, IFN or functional fragment of IFN, or nucleic acid sequence expressing any of these may be administered multiple times. The interval between single doses may be weekly, monthly, or yearly. The interval may also be irregular as indicated by measuring the blood level of the TNFRSF agonist or its functional fragment, IFN or functional fragment of IFN in the patient. Alternatively, the TNFRSF agonist or its functional fragment, IFN or functional fragment of IFN, or nucleic acid sequence expressing any of these may be administered as a sustained release formulation, in which case less frequent administration is required. The dosage and frequency vary depending on the half-life of the TNFRSF agonist or its functional fragment, IFN or functional fragment of IFN in the patient.

[0362] As previously discussed, the disclosed TNFRSF agonist or functional fragment thereof, IFN agent or functional fragment of an IFN agent can be administered in a pharma- ceutical effective amount for the in vivo treatment of a mammalian disorder. In this regard, as disclosed, it is understood that the TNFRSF agonist or functional fragment thereof, IFN agent or functional fragment of an IFN agent is formulated to facilitate administration and promote stability of the active agent.

[0363] The pharmaceutical composition according to the present disclosure may include a pharma- ceutical acceptable non-toxic sterile carrier, such as saline, non-toxic buffer, preservative, etc. The pharma- ceutical effective amount of the TNFRSF agonist or functional fragment thereof, IFN agent or functional fragment of IFN agent is sufficient to mediate one or more of the following: reducing HBeAg release from HBV-infected cells; reducing pgRNA transcription in HBV-infected cells; and stimulating IFN agent signaling pathway in infected cells. Of course, the pharmaceutical composition of the present disclosure may be administered in a single or multiple doses to provide a pharma-ceutical effective amount of the TNFRSF agonist or functional fragment thereof, IFN agent or functional fragment of IFN agent.

[0364] In accordance with the scope of the present disclosure, a TNFRSF agonist (e.g., an agonist antibody directed against a member of the TNFRSF, a soluble TNFRSF agonist, including but not limited to, its natural ligand), or a functional fragment thereof, IFN or a functional fragment of IFN, or a nucleic acid sequence expressing any of them, can be administered to a human or other animal in accordance with the treatment methods described above in an amount sufficient to produce a therapeutic effect. A TNFRSF agonist or a functional fragment thereof, IFN or a functional fragment of IFN, or a nucleic acid sequence expressing any of them can be administered to such a human or other animal in a conventional dosage form prepared by combining a TNFRSF agonist (e.g., an agonist antibody directed against a member of the TNFRSF, a soluble TNFRSF agonist, including but not limited to, its natural ligand), or a functional fragment thereof, IFN or a functional fragment of IFN, or a nucleic acid sequence expressing any of them, with a conventional pharma- ceutically acceptable carrier or diluent, in accordance with known techniques. Those skilled in the art will recognize that the form and nature of the pharma- ceutically acceptable carrier or diluent will be determined by the amount of active ingredient to be combined, the route of administration, and other well-known variables.Furthermore, those skilled in the art will appreciate that cocktails containing one or more of the TNFRSF agonists or functional fragments thereof, IFN or functional fragments of IFN, or nucleic acid sequences expressing any of them, as described in this disclosure, may prove to be effective.

[0365] It is to be understood that the methods described in this disclosure are not limited to the particular methods and experimental conditions disclosed herein, as such methods and conditions may vary. It is also to be understood that the terminology used herein is used for the purpose of describing particular embodiments only, and is not intended to be limiting.

[0366] Moreover, the experiments described herein use conventional molecular and cell biological and immunological techniques within the scope of those skilled in the art, unless otherwise specified.Such techniques are well known to those skilled in the art and are fully described in the literature.See, for example, Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., NY, NY (1987-2008) (including all supplements), Molecular Cloning: A Laboratory Manual (4th Edition); MR Green and J. Sambrook and Harlow et al., Antibodies: A Laboratory Manual, Chapter 14, Cold Spring Harbor Laboratory, Cold Spring Harbor (2013, 2nd Edition).

[0367] Unless otherwise defined, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In case of any potential ambiguity, the definitions provided herein take precedence over any dictionary or exogenous definitions. Unless otherwise required by context, singular terms shall include the plural and plural terms shall include the singular. The use of "or" means "and / or" unless otherwise specified. The use of the term "comprising" as well as other forms such as "including" and "included" is not limiting.

[0368] In general, the nomenclature used in connection with cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization described herein is well known and commonly used in the art. The methods and techniques provided herein are generally performed according to conventional methods well known in the art and as described in various general and more specific references cited and discussed throughout this specification, unless otherwise indicated. Enzymatic reactions and purification techniques are performed according to manufacturer's specifications as commonly accomplished in the art or as described herein. The nomenclature used in connection with analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein, as well as experimental procedures and techniques, are well known and commonly used in the art. Standard techniques are used for chemical synthesis, chemical analysis, pharmaceutical preparation, formulation, and delivery, and treatment of patients.

[0369] The contents of the articles, patents and patent applications, and all other written and electronically available information mentioned or cited in this specification are incorporated herein by reference in their entirety to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference. Applicant reserves the right to physically incorporate into this application all materials and information from any such articles, patents, patent applications, or other physical and electronic documents.

[0370] Although the present invention has been described with reference to specific embodiments thereof, those skilled in the art should understand that, guided by this disclosure, various modifications can be made and equivalents can be substituted without departing from the true spirit and scope of the present invention. Although certain embodiments have been described in detail herein, the present specification will be more clearly understood by reference to the following examples, which are included for illustrative purposes only and are not intended to be limiting.

[0371] Example I Synergistic control of HBV infection by cytokines HBeAg release The effect of IFNβ and CD40L on HBV infection in primary hepatocytes was investigated. Primary human hepatocyte (PHH) cells were plated in 24-well plates (approximately 350000 cells / well) in William's E GlutaMAX medium supplemented with 10% fetal calf serum (FCS), insulin and hydrocortisone + penicillin / streptomycin. After 4 h, cells were rinsed and the medium was changed again the next day. After 24 h, cells were infected with 1,000 viral genome equivalents (vge) / cell in the presence of 4% PEG 8000. 16 h after infection, cells were washed three times with PBS. Two days after infection, cells were kept unstimulated and stimulated with IFNα (Pbl assay Science #11100-1, 1000U / ml), IFNβ (Pbl assay Science #1349872, 100U / ml), CD40L (Enzo #ALX-522-110, 150ng / ml), or a combination of IFNα or IFNβ with CD40L. After 4 days, the medium was removed and cells were stimulated again under the same conditions. Two days after the second stimulation, culture supernatants were harvested and kept at -80°C. HBV e antigen (HBeAg) levels in cell culture supernatants were measured using ELISA as described by the manufacturer, and the results were expressed as National Chinese Units (HBeAg CLIA 96T / K:CL0312-2 Autobio).

[0372] IFNα was used as a reference and reduced secreted HBe levels by approximately 60%. IFNβ was more potent, reducing released HBe by 85%. Interestingly, CD40L alone was less active but augmented the effect of either IFNα or IFNβ. The CD40L-IFNβ combination reached 95% inhibition (Figures 1A and 1B). Thus, the combination of IFNβ and CD40L synergistically reduced HBeAg release.

[0373] Transcription of pgRNA HBV pregenomic RNA (pgRNA) is transcribed from cccDNA and subsequently reverse transcribed to form relaxed circular DNA (RcDNA), which is encapsidated to form new virions, thus representing a key intermediate in the viral life cycle.

[0374] The effects of IFNβ and CD40L on pgRNA transcription from cccDNA were evaluated in PHH cells (Figures 2A and 2B).

[0375] Six days after infection, PHH cells were maintained unstimulated or stimulated with IFNb (pblassay #13498723, 100U / ml), CD40L (Enzo #ALX-522-110, 150ng / ml) or a combination of CD40L and IFNb.

[0376] Two days after stimulation, total RNA was extracted from HBV-infected PHH cells using the NucleoSpin® 96 RNA Kit (Macherey-Nagel, 740741.4) according to the manufacturer's instructions. cDNA templates were synthesized using the SuperScript® VILO™ cDNA Synthesis Kit (Invitrogen) and obtained after reverse transcription. qPCR was performed using the following primers and probe for pgRNA: (forward: GCCTTAGAGTCTCCTGAGCA (SEQ ID NO: 34) and reverse: GAGGGAGTTCTTCTTCTAGG (SEQ ID NO: 35), and AGTGTGGATTCGCACTCCTCCAGC (SEQ ID NO: 36)) using TaqMan® Fast Universal PCR MasterMix (Applied Biosystems). The GUSB gene (Hs99999908-m1) was selected as the housekeeping gene for the assay. Plates were run on a QuantStudio 12K Flex (Applied Biosystems). Results are expressed as fold change RQ [2-ΔΔCt]. RQ: relative quantification value.

[0377] The results show that a 2-day treatment with IFNβ was sufficient to reduce the amount of pgRNA in cells by 64%. Under these conditions, CD40L alone had no effect. Surprisingly, however, CD40L increased the effect of IFNβ, reaching 88% inhibition.

[0378] Synergistic effects in signal transduction pathways The effects of IFNβ and CD40L on signaling pathways were determined in PHH cells (Figures 3A and 3B). The effect on the IFN signaling pathway was assayed by detecting CXCL10 biomarker release (Figure 3A), and the effect on the inflammatory pathway was assayed by detecting IL8 release (Figure 3B). IFNβ and CD40L were determined to synergistically enhance signaling in the IFN pathway, but not in the inflammatory pathway.

[0379] Other TNF family members were assayed with various IFNs (Figures 4A and 4B). HepaRG hepatoma cells were seeded in 24-well plates (approximately 250,000 cells / well) in William's E GlutaMAX medium supplemented with 10% FCS, insulin and hydrocortisone + P / S. After 6 hours, cells were rinsed and either left unstimulated or stimulated overnight with the indicated cytokines (TWEAK (Enzo, ALX-522-021, 1 μg / ml final) + mouse monoclonal anti-Flag-M2 (Sigma, F-3165, 1 μg / ml final), LTα3 (Enzo, ALX-522-034, 1 μg / ml final), CD40L (Enzo #ALX-522-110, 150 ng / ml final), CD137L (Enzo, ALX-522-111, 1 μg / ml final); IFNβ-1a (pblassay #13498723, 100 U / ml final), IFNγ (Millipore #IF-002, 20 ng / ml), IL28 and IL29 R&D). Supernatants were then harvested and CXCL10 was quantified by ELISA as described by the manufacturer (BioLegend 439904).

[0380] The results show that, like CD40L, LTα3 and Tweak (but not 4-1-BB / CD137L, which is a negative control since the receptor is not expressed) synergistically enhance CXCL10 release induced not only by IFNβ but also by type II interferon (IFNγ) (Figure 4A). Furthermore, co-stimulation of hepatocytes with CD40L and type III interferons (IL28 and IL29) could also synergistically increase the interferon pathway (Figure 4B).

[0381] Taken together, these results indicate that the synergy results from activation of a pathway common to TNFRSF and IFN receptors.

[0382] CD40 is stimulated in different ways by soluble CD40L (trimeric form - 1 μg / ml), by membrane CD40L (here mimicked by the hexameric form of CD40L - 1 μg / ml) and by an agonistic anti-CD40 antibody (CP-870,893, Pfizer / Roche - 1 μg / ml).

[0383] To understand whether synergy was induced, HepaRG cells were either left unstimulated or stimulated overnight with the indicated cytokines or antibodies alone or in the presence of IFNβ. Supernatants were then harvested after overnight stimulation and CXCL10 was quantified by ELISA as previously described.

[0384] The results showed that, except for IFNβ, none of the stimuli were able to induce CXCL10 as single agents. However, the addition of IFNβ to trimeric CD40L, hexameric CD40L, or an agonistic anti-CD40 antibody enhanced the release of CXCL10 (Figure 5). These results indicate that several mechanisms of CD40 activation lead to enhanced IFNβ pathway.

[0385] The synergistic effect of CD40L and IFNβ may have various effects on different signaling pathways. HepaRG hepatoma cells were seeded in 24-well plates (approximately 250,000 cells / well) in William's E GlutaMAX medium supplemented with 10% FCS, insulin and hydrocortisone + P / S. After 6 hours, cells were rinsed and either maintained unstimulated or stimulated with an effective amount of CD40L in the presence or absence of IFNβ (100 U / ml). CXCL10 and IL8 were quantified by ELISA from supernatants collected after overnight stimulation. Quantification of CXCL10 and IL8 was performed as described by the manufacturer. For CXCL10: BioLegend 439904-For IL8: Ready-Set ELISA human iL8: eBiosciences Ref 88-8086-88.

[0386] The results showed that CD40L increased the IFN pathway, starting from 1 ng / ml CD40L (Figure 6A). Interestingly, IL8 was induced by CD40L in a dose-dependent manner and was not increased but rather decreased by IFNβ (Figure 6B). These results indicate that costimulation of hepatocytes with CD40L and IFNβ synergistically increased the IFN pathway while decreasing the release of the inflammatory cytokine IL8.

[0387] The synergy between CD40L and IFNβ was further assayed to determine whether the synergy occurred at the mRNA or post-translational level and whether other interferon-stimulated genes were also increased by the combination agent (other than CXCL10).

[0388] To this end, RNAseq analysis was performed in HepaRG cells. HepaRG cells were stimulated with CD40L, IFNβ, or a combination of both cytokines in a kinetic manner for 30 min to 24 h. Cells were harvested, washed, and pelleted. Cell pellets were lysed by addition of QIAzol buffer. RNA was extracted with the RNeasy kit (Qiagen), quantified with Xpose (ng / μl), and quality, integrity (RIN) was controlled with an Agilent bioanalyzer. Libraries were created with the TruSeq Stranded Total RNA LT (Ribo-Zero Gold) kit from Illumina, and RNA sequencing was performed on a NextSeq 500 instrument using the NextSeq 500 High Output kit.

[0389] Analysis of CXCL10 mRNA showed that its expression was induced by IFNβ and synergistically by the combination starting 2 h post-stimulation (Figure 7A). Interestingly, synergistic effects were observed for other interferon-stimulated genes, such as CXCL9 and CXCL11 (Figures 7C and 7D).

[0390] Analysis of CXCL8 / IL8 mRNA showed that it was induced exclusively by CD40L and that the combination reduced its expression (Figure 7B), a reduction that was also observed for other chemokines induced by CD40L, such as CXCL3 or CCL20 (Figures 7E and 7F).

[0391] Taken together, these results confirm that costimulation of hepatocytes with CD40L and IFNβ enhances the IFN pathway but not the CD40L-induced inflammatory pathway.

[0392] An increase in the IFN pathway was also observed in PHH cells. Cells were plated in 96-well plates (approximately 350,000 cells / well) in William's E GlutaMAX medium supplemented with 10% FCS, insulin and hydrocortisone + P / S. After 24 hours, cells were rinsed, medium was replaced and matrigel was added. The next day, cells were infected or not infected with 1,000 viral genome equivalents (vge) / cell in the presence of 4% PEG 8000. 16 hours after infection, cells were washed three times with PBS and kept unstimulated (NS) and stimulated with IFNβ (pbl assay #1349872, 100U), CD40L (Enzo #ALX-522-110, 150ng / ml) or a combination of CD40L and IFNβ. After 3 days (d3), medium was collected and cells were stimulated again under the same conditions. Four days after the second stimulation (d7), culture supernatants were collected again and CXCL10 release was assessed by AlphaLISA hCXCL10:Perkin Elmer:AL259F.

[0393] The results showed that IFNβ, but not CD40L, induced CXCL10 in primary hepatocytes, and costimulation with CD40L ligand enhanced its release after one or two stimulations and in either HBV-infected or noninfected cells (Fig. 8 ).

[0394] TNF family members other than CD40L may act synergistically with IFNβ. Constructs were designed to express the extracellular portion of human Tweak or human LIGHT fused to the Fc region of human IgG1 (Ig-Tweak, SEQ ID NO: 18, and Ig-Light, SEQ ID NO: 19, respectively). These fusions were cloned into expression vectors. After transfection in HEK cells, the supernatants were collected and used to stimulate HepaRG cells as described above. As controls, cells were transfected with an empty vector or a plasmid encoding IFNβ. After overnight stimulation, the supernatants were collected for CXCL10 evaluation. The results showed that IFNβ alone, but not LIGHT or TWEAK alone, could induce CXCL10 release. This release was increased when cells were co-stimulated with IFNβ and TWEAK (Figure 9A) or LIGHT (Figure 9B). These results also indicated that such combinations may play an important role in synergistically increasing the anti-HBV innate immune response in hepatocytes.

[0395] To generate proteins used to further demonstrate the synergistic effect of TNFR agonism and IFN treatment in HBV-infected cells, Ig-Tweak (SEQ ID NO: 18) and Ig-Light (SEQ ID NO: 19) were generated. After purification on a Protein A column, the activity of these proteins was evaluated in a dose-effect manner in A549 dual cells (InvivoGen, catalog number a549d-nfis) that naturally express LTbR and TweakR. These cells were designed to monitor the activation of the NFκB pathway by quantifying the activity of the reporter gene SEAP secreted into the supernatant using QUANTI-Blue™ (SEAP detection reagent (QUANTI-Blue™ rep-qb1 InvivoGen)). The results show that both molecules activate the NFκB pathway in a dose-dependent manner (Figure 9C and Figure 9D).

[0396] Next, Ig-Tweak (SEQ ID NO: 18) and Ig-Light (SEQ ID NO: 19) proteins were evaluated in combination with IFNb in primary hepatocytes infected with HBV as previously described. Cells were infected, kept untreated (NT), and treated with IFNb (100U), Ig-Light (1 μg / ml) or Ig-Tweak (1 μg / ml), or the combination IFNb (100U) + Ig-Light (1 μg / ml) or IFNb (100U) + Ig-Tweak (1 μg / ml). The results show that both Ig-Tweak (Figure 9E) and Ig-Light (Figure 9F) are able to enhance the IFNb-induced antiviral effect.

[0397] The use of a single molecule to tamper with the synergistic effect of a combination of CD40L and IFNβ was explored. For this purpose, three Duokines were designed and cloned into pCDNA3. IFNβ (N-terminus) was linked to the extracellular domain of CD40L (C-terminus) by a linker containing the Fc portion of human IgG1 (IFNβ-Ig-CD40L or SEQ ID NO: 9) using a Gly-Ser-Thr linker (IFNβ-CD40L or SEQ ID NO: 10), or by a linker containing a leucine zipper domain (IFNβ-LZ-CD40L or SEQ ID NO: 11) (see Table 3). The constructs were transiently transfected into HEK cells. 48 hours after transfection, the supernatant was collected and added to HEK-Blue™ CD40L cells (InvivoGen, Cat. No.: hkb-cd40) or HEK-Blue™ IFN-α / β cells (InvivoGen, Cat. No.: hkb-ifnab), which are specifically designed to monitor the activation of the NFκB pathway by CD40L or the activation of the JAK-STAT pathway induced by type I IFN, respectively. After stimulation, the expression of the reporter gene SEAP (under the control of the NFκB or JAK / STAT promoter) was detected. SEAP was secreted into the supernatant and detected using QUANTI-Blue™ (SEAP detection reagent (QUANTI-Blue™ rep-qb1 InvivoGen)).

[0398] The results showed that HEK-Blue-CD40L reporter cells (Figure 10A) could respond to recombinant CD40L, whereas HEK-Blue-IFN reporter cells (Figure 10B) could not. Only HEK-Blue-IFN reporter cells respond to IFNβ. Interestingly, stimulating these cells with medium collected from HEK-transfected cells showed that all Duokines were able to stimulate both reporter cells. As a negative control, supernatant from cells transfected with empty vector did not stimulate the cells, whereas supernatant from cells transfected with IFNβ was able to stimulate only HEK-Blue-IFN reporter cells.

[0399] The results showed that the CD40L-IFNβ fusions remained active on their respective receptors, regardless of the linker.

[0400] Next, the Duokine molecules were tested in non-reporter hepatocyte (HepaRG) cells to evaluate CXCL10 release. For this purpose, and in addition to the three Duokines mentioned above, two other Duokines were designed and cloned into pCDNA3. IFNβ (N-terminus) was linked to the extracellular domain (C-terminus) of TWEAK by a linker containing the Fc portion of human IgG1 (IFNβ-Ig-TWEAK or SEQ ID NO: 12), IFNβ (N-terminus) was linked to the extracellular domain (C-terminus) of LIGHT by a linker containing the Fc portion of human IgG1 (IFNβ-Ig-LIGHT or SEQ ID NO: 15) or by a linker containing a leucine zipper (IFNβ-LZ-LIGHT or SEQ ID NO: 17) (see Table 3). Hepatocyte (HepaRG) cells were stimulated with supernatants collected from HEK transfected cells. After overnight stimulation, CXCL10 in the supernatants was evaluated by ELISA. The results show that all Duokines can induce CXCL10 release, and this induction is enhanced compared to stimulation with IFNβ alone (Figures 11A, 12 and 13). Interestingly, when stimulation was performed in the presence of an anti-CD40L antagonist antibody (mabg-h40l-3, InvivoGen) that neutralizes the action of CD40L, CXCL10 release was highly reduced (Figure 11B). This confirms that CD40L in Duokines can still act synergistically with IFNβ to enhance the IFN pathway.

[0401] To evaluate the effect of a fusion protein containing type I interferon and CD40L, duokine was constructed encoding IFNa (amino terminus) and CD40L (carboxy terminus) linked by a linker containing a hu-IgG1-Fc portion (IFNa-huIgG1-hu-CD40L; SEQ ID NO: 25). HEK cells were transiently transfected and the protein was purified on a protein A column. As previously described, the protein was evaluated in HEK-Blue™ CD40L cells (Figure 19A; InvivoGen, Catalog No: hkb-cd40) or HEK-Blue™ IFN-α / β cells (Figure 19B; InvivoGen, Catalog No. hkb-ifnab). The results show that duokine can induce SEAP release in both CD40 (Figure 19A) and IFNa / b (Figure 19B) reporter cells in a dose-dependent manner, demonstrating that both the CD40L and IFN domains are active.

[0402] Next, duokine was evaluated on primary human hepatocytes infected with HBV as previously described (Figure 19C). Cells were infected and then maintained untreated (NS) and treated with recombinant IFNa (pblassay #11100-1, 100U), mega CD40L (Enzo #ALX-522-110, 100ng / ml), or a combination of both molecules. In parallel, cells were treated with duokine in a dose-effect manner. The results show that CD40L enhances IFNa-induced antiviral activity and that duokine is highly active against HBV infection, as it reduces Hbe release in a dose-dependent manner with an IC50 of approximately 3ng / ml.

[0403] Example II Human liver chimeric mouse model Since the only natural cellular target for HBV infection and replication is the human hepatocyte, human liver chimeric mouse models are suitable for studying HBV infection in vivo as well as for the evaluation of direct antiviral and hepatocyte-directed host agents (Dandri et al., Best Pract Res Clin Gastroenterol. 2017 June;31(3):273-279). Such models are based on two requirements: 1) endogenous mouse hepatocytes are damaged to make space for transplanted hepatocytes to reconstitute the mouse liver, and 2) the host immune response is ablated to allow survival of transplanted xenogeneic hepatocytes.

[0404] Various chimeric mice have been developed to study HBV pathogenesis and potential therapy (Giersch K et al., Sci Rep. 2017 Jun 16; 7(1):3757; Tsuge et al., Virus Antimicrob Agents Chemother. 2017 Jun; 61(6):e00183-17; Bissig et al., J Clin Invest. 2010 Mar; 120(3):924-30; and Kosaka et al., Biochem Biophys Res Commun. 2013 Nov 8; 441(1):230-5). uPA-SCID mice transplanted with human hepatocytes are commercially available (KMT Hepatech, Inc., Edmonton, Canada).

[0405] The human liver chimeric mouse model can be used to test the IFNβ-CD40L described herein. The human liver chimeric mouse model has several useful features. uPa-SCID mice are highly immunodeficient and have the mouse urokinase-type plasminogen activator (uPA) gene under the control of the mouse albumin enhancer / promoter (Giersch K et al., and Tsuge et al.). FRG mice are highly immunodeficient and have the fumarylacetoacetate hydrolase knockout Fah- / - (Bissig et al.). TK-NOG mice are highly immunodeficient and express the herpes simplex virus-1 thymidine kinase (HSVtk) transgene driven by the mouse albumin enhancer / promoter in their liver (Kosaka et al.).

[0406] Immediately after birth of uPA-SCID mice or following mouse hepatocyte injury induction (2-(2-nitro-4-trifluoro-methyl-benzoyl)-1,3 cyclohexanedione (NTBC)-based depletion in FRG mice or ganciclovir injection in TK-NOG mice), we perform intrasplenic injection of primary human hepatocytes for repopulation of the liver with human hepatocytes.

[0407] The level of chimerism can be monitored by determining human serum albumin (HSA) and / or human α1-antitrypsin (hAAT) levels, which can range from 20% to 70% depending on the model and inter-individual variability. After a period of 6-8 weeks, mice can be infected with native HBV and the complete viral life cycle takes place, including viral entry, cccDNA formation, as well as replication and spread. This human liver chimeric mouse model also allows for the study of the direct antiviral effects, due to the immunocompromised state of these mice, of human drugs, with various viral readouts including cccDNA levels and regulation.

[0408] Example III Chimeric AAV / HBV virus model The synergistic effect of CD40L in combination with IFNβ was determined in an in vivo mouse model by assaying CXCL10 release into serum. 6 Mice were injected with either 100 μg of mouse IFNβ (8234-MB / CF), 100 μg of CD40L (ALX-52-120-000) or a combination thereof. As a positive control, a group of mice was injected with 50 μg of LPS. This shows that when administered in vivo to uninfected mice, the combination synergistically increased the IFN pathway as shown by CXCL10 plasma levels (FIG. 16). CXCL10 is used as a pharmacodynamic biomarker to define optimal treatment regimens (dosage and frequency of administration).

[0409] AAV / HBV transduced mice are based on the entry of HBV into mouse hepatocytes via a viral vector. AAV viral particles are injected intravenously into immunocompetent mice, and the particles deliver the HBV genome directly to hepatocytes. Many infected cells express HBV c antigen (HBc), reflecting that HBV replication occurs in these cells. This viral replication takes place early after infection, as shown by HBV e and s antigen levels (HBe and HBs) in plasma, which are already high and reach a plateau at 21 days post-infection. The levels of circulating HBV DNA are also very high, reflecting virion production. This high and stable replication phase recapitulates the immune tolerance phase observed in patients (Dion et al. (2013) J Virol. May; 87(10): 5554-63, and Yang et al. (2014) Cell Mol Immunol. January; 11(1): 71-8). A recent study showed that all viral intermediates, including cccDNA production, are present in this model, as shown by Southern blot (Lucifora et al. (2017) Antiviral Res. September;145:14-19). Quantification of this cccDNA remains challenging, and protocols are still in the optimization phase (ibid.).

[0410] The immunocompetent AAV / HBV model described herein allows the study of both the immunomodulatory and direct antiviral effects of IFNβ-CD40L combinations, where the readout is a viral parameter and also specific HBV Ag-antibody production, the same parameter used in the clinic.

[0411] The standard protocol is as follows. All in vivo experiments are performed in accordance with French and European regulations regarding animal welfare and public health agency recommendations, and all protocols are reviewed and approved by Sanofi's Institutional Animal Care Committee. All animals are kept in a specific pathogen-free environment in Sanofi's animal facility in Marcy l'Etoile, France. Eight-week-old C57BL6 / J female mice (Charles River, Les Oncins, Saint-Germain Nuelles, France) are inoculated with 5 × 10 of AAV8-HBV viral particles. 10 Viral genomes / mouse are injected intravenously. 28 days after injection, mice are randomized into different treatment cohorts with HBs-Ag plasma levels. During the treatment period, weekly blood sampling is performed for circulating viral parameters tracking (HBV-Ag and DNA) (see Figures 14A-14B, 15). After a treatment period of usually 2-4 weeks, mice are euthanized, blood is collected, and liver pieces are flash frozen in liquid nitrogen and kept at -80 °C before further processing. HBV antigen values ​​(HBs, Hbe) are assessed by ELISA (AutoBio kit, manufacturer's instructions (AutoBio, China)). Viral load in serum and liver is assessed using PCR method. HBV pgRNA levels in liver are measured by qRT-PCR method. DNA is extracted from liver biopsies and subsequent triple digestion (XmaI, XhoI, and T5 enzymes) allows cccDNA quantification as described by Lucifora et al.

[0412] Depending on the model, AAV / HBV or HuHep mice, 4-8 weeks after infecting mice with HBV, mice are treated three times a week with vehicle, IFNβ, CD40L (or agonistic antibody anti-CD40, FKG450) and a combination of both drugs. Blood samples are collected weekly and blood and liver tissues are collected at endpoint. Various readouts are evaluated, including HBV parameters (circulating Hbe Ag, Hbs Ag, cccDNA and pgRNA in liver) as well as host parameters such as cytokine release, seroconversion and liver enzymes (e.g., AST, ALT).

[0413] Example IV Chimeric AAV / HBV virus model To perform in vivo experiments, a mouse tool compatible with chronic treatment was created. The mIFNb-Fc-mIgG1 molecule (SEQ ID NO: 20) and mIgG1-Fc-mCD40L (SEQ ID NO: 21) as well as Fc-mIgG1 (SEQ ID NO: 22) molecules were designed and cloned into an expression vector. After transient overexpression, the proteins were purified using a protein A column and then tested in a dose-dependent manner on reporter cells to demonstrate their activity. mIFNb-Fc-mIgG1 was tested on RAW-Dual™ IRF (IFN pathway) and MIP-2 (NF-kB) reporter mouse macrophages (Invivogen, catalog number rawd-ismip). After stimulation, expression of the reporter gene Lucia (under the control of the JAK / STAT promoter) was detected. Lucia was secreted into the supernatant and detected using QUANTI-luc™ (Lucia detection reagent (QUANTI-Luc™ rep-qlc1, InvivoGen)). The results show that mIFNb-Fc-mIgG1 was active and induced IRF pathway activation in a dose-dependent manner (Figure 17A). Fc-mIgG1-mCD40L molecules were tested on HEK-Blue-CD40 cells as previously described. The results show that Fc-mIgG1-mCD40L was active and induced SEAP release in a dose-dependent manner (Figure 17B).

[0414] To demonstrate their respective bioavailability, 0.84 μg mIFNb-Fc-mIgG1 and 30 μg Fc-mIgG1-mCD40L were administered IP and blood samples were collected at different time points. Circulating mIFNb-Fc-mIgG1 was quantified using an ELISA kit according to the manufacturer's instructions (Verikine Mouse IFNb Elisa Kit, 42400-1). For quantification, Fc-mIgG1-mCD40L: 96-well plates were coated overnight at 4°C with 100 μl of recombinant mouse CD40 / TNFRSF5 Fc chimeric protein consisting of the extracellular domain of mouse CD40 fused to the Fc portion of human IgG1 (rmCD40-Fc; 215-CD-050, R&D Systems) at 0.1 μg / ml in sodium carbonate (0.05 M, pH=9.6, C-3041, Sigma). After emptying by flipping, the plates were incubated with PBS-0.05% Tween 20-1% milk for 1 h at 37 °C and then washed with PBS-0.05% Tween 20. Samples and controls (100 μl of 1 / 10 dilution series) were then incubated for 90 min at 37 °C, followed by three washes (PBS-0.05% Tween 20) and incubation with secondary anti-mouse IgG1 (1 / 20,000, ab97240, Abcam) antibody (in PBS-0.05% Tween 20-1% milk). After three washes with PBS-0.05% Tween 2, TMB (tetramethylbenzidine) was added and the plates were incubated for 20 min in the dark. The reaction was stopped by adding HCl 1N. The plates were read on an Ensight (Perkin Elmer) at 450-650 nm.

[0415] Pharmacokinetic analysis showed that both mIFNb-Fc-mIgG1 (Figure 17C) and mIgG1-Fc-mCD40L (Figure 17D) molecules circulated in the blood for at least 6 hours after administration. Both molecules circulated at detectable levels for at least 6 hours after administration (Figures 17C and D).

[0416] For in vivo evaluation, mice received an intravenous injection of 5.10^10 genome equivalents / mouse of AAV8-HBV viral particles or PBS as a control for uninfected animals. 14 days post-injection (dpi), mice were randomized into different treatment cohorts using peripheral blood viral parameter (HBV DNA and antigen) levels. In total, 12 mice were used for the non-infected group and 18 mice for each treatment in the infected group to generate 5 groups: Non-infected_Fc-mIgG1 (45 μg / kg); AAV / HBV_Fc-mIgG1 (45 μg / kg); AAV / HBV_Fc-mIgG1 (0.25 μg / kg); AAV / HBV_Fc-mIgG1-mCD40L (45 μg / kg); AAV / HBV_Combi(mIFN-Fc-mIgG1 (0.25 μg / kg) + Fc-mIgG1-mCD40L (45 μg / kg). Treatments were administered twice weekly. , intraperitoneal injection (10 mL / kg). After 2 and 4 weeks of treatment, at 28 and 42 dpi, respectively, some mice from each group were euthanized and blood, liver and spleen were collected. Serum, plasma and liver pieces were flash frozen in liquid nitrogen and kept at -80 °C before further processing. HBV antigen levels (Hbe-Ag) were assessed by ELISA (Autobio kit, according to the manufacturer's instructions (AutoBio, China)). Viral load in serum and liver was assessed using ddPCR technique. Levels of HBV pgRNA in liver were measured by qRT-PCR.

[0417] Injection of AAV / HBV viral particles resulted in high and stable expression of HBV virus, as shown by tracing HBe-Ag and HBV DNA levels in peripheral blood (Figures 18B and C), and HBV nucleic acids in liver tissue (HBV DNA and pgRNA - Figures 18D and E).

[0418] mIFN-Fc-mIgG1 and Fc-mIgG1-mCD40L administered alone twice weekly reduced HBV DNA levels in both peripheral blood and liver tissue (Fig. 18C and D). These molecules alone had no detectable effect on viral protein HBe-Ag or HBV pgRNA levels (Fig. 18B and E).

[0419] The combination of mIFN-Fc-mIgG1 and Fc-mIgG1-mCD40L showed synergistic lowering effect in viral load readings, as shown by the strong reduction of HBV DNA in peripheral blood and liver tissue (Figure 18C and D). Furthermore, the combination achieved a reduction in Hbe-Ag secretion and pgRNA expression (Figure 18B and E).

[0420] Equivalent The present disclosure may be embodied in other specific forms without departing from its spirit or essential characteristics.The foregoing embodiments are therefore to be considered in all respects as illustrative rather than limiting the disclosure.Thus, the scope of the present disclosure is indicated by the appended claims rather than the foregoing description, and all changes that come within the meaning and range of equivalency of the claims are intended to be embraced therein.

Claims

1. 1. A combination of a tumor necrosis factor receptor superfamily (TNFRSF) agonist, or a functional fragment thereof, and an interferon (IFN) agent, or a functional fragment thereof, for use in the treatment of hepatitis B virus (HBV) infection, comprising: the TNFRSF agonist or functional fragment thereof is an agonist anti-CD40 antibody or functional fragment thereof, or is selected from the group consisting of CD40L, LIGHT, and a fusion protein comprising CD40L or LIGHT and the Fc region of human IgG1, or a functional fragment thereof, and the IFN agent or functional fragment thereof is selected from IFNβ or a functional fragment thereof; or The TNFRSF agonist or a functional fragment thereof is TWEAK, or a fusion protein comprising TWEAK and an Fc region of human IgG1, or a functional fragment thereof, and the IFN agent or a functional fragment thereof is IFNβ or a functional fragment thereof. The compounding agent.

2. 2. The combination of claim 1, wherein the TNFRSF agonist or a functional fragment thereof is selected from the group consisting of CD40L, LIGHT and TWEAK, or a functional fragment thereof.

3. 2. The combination of claim 1, wherein the TNFRSF agonist or a functional fragment thereof is a fusion protein comprising CD40L, LIGHT or TWEAK and the Fc region of human IgG1, or a functional fragment thereof.

4. The combination according to any one of claims 1 to 3, wherein the CD40L is a hexameric CD40L or a trimeric CD40L.

5. The combination according to any one of claims 1 to 4, wherein the IFN agent or a functional fragment thereof is provided as a fusion protein comprising said IFN agent and the Fc region of human IgG1, or a functional fragment thereof.

6. 1. A bifunctional immunostimulatory fusion protein comprising a tumor necrosis factor receptor superfamily (TNFRSF) agonist or a functional fragment thereof, an interferon (IFN) agent or a functional fragment thereof, and a linker for use in the treatment of hepatitis B virus (HBV) infection, said TNFRSF agonist or functional fragment thereof is selected from the group consisting of CD40L, LIGHT, and TWEAK, or functional fragments thereof; The IFN agent or a functional fragment thereof is IFNβ or a functional fragment thereof; The bifunctional immunostimulatory fusion protein.

7. The bifunctional immunostimulatory fusion protein of claim 6, wherein the CD40L is a hexameric CD40L or a trimeric CD40L.

8. The bifunctional immunostimulatory fusion protein of claim 6 or 7, wherein the linker is a peptide linker into which a multimerization domain is inserted.

9. 9. The bifunctional immunostimulatory fusion protein according to any one of claims 6 to 8, wherein the multimerization domain is selected from a tenascin trimerization motif, a collectin trimerization domain, streptavidin, IgE heavy chain domain 2 (EHD2), IgM heavy chain domain 2 (MHD2), IgG heavy chain domain 3 (GHD3), IgA heavy chain domain 3 (AHD2), IgD heavy chain domain 3 (DHD3), IgE heavy chain domain 4 (EHD4), IgM heavy chain domain 4 (MHD4), an Fc domain, a uteroglobin dimerization domain, and a leucine zipper (LZ) domain.

10. The combination according to any one of claims 1 to 5, wherein the TNFRSF agonist or a functional fragment thereof and the IFN agent or a functional fragment thereof are comprised in a single pharmaceutical composition.

11. The combination according to any one of claims 1 to 5, wherein the TNFRSF agonist or a functional fragment thereof and the IFN agent or a functional fragment thereof are comprised in separate pharmaceutical compositions.

12. 1. A pharmaceutical composition comprising: A tumor necrosis factor receptor superfamily (TNFRSF) agonist or a functional fragment thereof; Interferon (IFN) agents or functional fragments thereof Including, The TNFRSF agonist or a functional fragment thereof and the IFN agent or a functional fragment thereof are as defined in any one of claims 1 to 5, The pharmaceutical composition is for use in the treatment of Hepatitis B virus (HBV) infection. The pharmaceutical composition.

13. 1. A pharmaceutical composition comprising a bifunctional immunostimulatory fusion protein comprising a tumor necrosis factor receptor superfamily (TNFRSF) agonist or a functional fragment thereof, an interferon (IFN) agent or a functional fragment thereof, and a linker, The bifunctional immunostimulatory fusion protein is as defined in any one of claims 6 to 9, The pharmaceutical composition is for use in the treatment of Hepatitis B virus (HBV) infection. The pharmaceutical composition.

14. The combination of any one of claims 1 to 5, the immunostimulatory fusion protein of any one of claims 6 to 9, or the pharmaceutical composition of claim 12 or 13, wherein the TNFRSF agonist is a soluble TNFRSF agonist.

15. The combination of any one of claims 1 to 5 or 14, the immunostimulatory fusion protein of any one of claims 6 to 9 or 14, or the pharmaceutical composition of claims 12, 13 or 14, wherein the TNFRSF agonist is TWEAK or a fusion protein comprising TWEAK, or a functional fragment thereof.

16. The combination of any one of claims 1 to 5, 14 or 15, the immunostimulatory fusion protein of any one of claims 6 to 9, 14 or 15, or the pharmaceutical composition of any one of claims 12 to 15, wherein the fusion protein comprising TWEAK is Ig-TWEAK.

17. The combination of any one of claims 1 to 5, 14, 15 or 16, the immunostimulatory fusion protein of any one of claims 6 to 9, 14, 15 or 16, or the pharmaceutical composition of any one of claims 12 to 16, wherein TWEAK is represented by SEQ ID NO: 3.

Images