Compositions and methods for treating ocular misfolded protein diseases - Patents.com

Abstract

A method for treating a genetic eye disorder associated with or caused by a misfolded ocular protein in a subject in need thereof comprises administering to the subject a compound that promotes clearance of the misfolded ocular protein.

Description

[Technical field]

[0001] Related Applications This application claims priority to U.S. Provisional Application No. 62 / 981,819, filed February 26, 2020, the subject matter of which is incorporated herein by reference in its entirety.

[0002] Government funding This invention was made with Government support under Grant P30 EY08098 awarded by the National Institutes of Health. The United States Government has certain rights in the invention. [Background technology]

[0003] background Protein misfolding and the unfolded protein response have been found to contribute to inherited retinal diseases such as retinitis pigmentosa (RP), a progressive retinal degeneration that affects over a million people worldwide. The disease progression of RP varies widely but can continue for decades. A gradual loss of rod photoreceptors results in night blindness, followed by a decrease in the visual field and eventually a narrowing of the visual field. Central vision in many RP patients may continue for years until secondary loss of cone photoreceptors occurs when legal blindness occurs. Over 160 mutations in the RHO gene have been associated with RP, and approximately one-third of these mutations are thought to cause rhodopsin misfolding, resulting in a dominant-negative effect that is toxic to rod photoreceptors. The RHO P23H mutation alone accounts for approximately 10-12% of all autosomal dominant (ad) RP cases in North America, so this mutation is most commonly studied as a model for adRP. As with other protein misfolding diseases, no effective treatment is currently available for RP.

[0004] The low light receptor rhodopsin is the most abundant protein present in the outer segments of rod photoreceptors and supports high visual sensitivity at night. Rhodopsin homeostasis is essential to maintain rod outer segment (OS) morphology and rod photoreceptor function. Due to the high abundance of rod OS and a daily renewal rate of 10%, rhodopsin biosynthesis is maintained at an extremely high level to keep the length of the rod OS constant. Therefore, even one allele of the RHO gene mutation can substantially disrupt rhodopsin protein homeostasis and lead to rod cell death in RP. The P23H mutation affects the structural stability of the antiparallel β-plug scaffold seated at the apex of the retinal binding site of rhodopsin, which is essential for excising the hydrophobic ligand-binding pocket from the aqueous environment. Mutant rhodopsin protein accumulates within the endoplasmic reticulum (ER) in cultured cells. An ER-associated protein degradation pathway is involved in the degradation of Rho P23H / + The fact that mutant rhodopsin protein is activated and undergoes degradation of more than 90% in the knock-in mouse retina supports the notion that the protein quality control system has difficulty maintaining rhodopsin homeostasis. P23H / + This robust proteolytic system in rods of the mouse retina is overwhelmed over time by the constant high burden of rhodopsin degradation.

[0005] To prevent rod death caused by misfolded rhodopsin in early or mid-stage adRP, experimental efforts have focused on supporting rhodopsin folding or promoting the ER-associated proteolytic system. For example, pharmacological or chemical chaperones have been reported to improve rhodopsin folding and its cellular trafficking, including vitamin A derivatives and analogs 4-phenylbutyric acid and curcumin. High-dose vitamin A supplementation has shown some level of visual protection among RP patients. However, due to the lack of genetic information of these patients, it is unclear whether the efficacy of vitamin A is due to an increased retinal supply of 11-cis-retinal as a pharmacological chaperone for rhodopsin. Summary of the Invention [Problem to be solved by the invention]

[0006] Reducing misfolded rhodopsin has been shown as an effective strategy to rescue rod photoreceptors. Long-term retinal protection has been shown in P23H transgenic rats treated by genetic delivery of a small ribozyme that specifically cleaves mutant alleles of rhodopsin mRNA. Enhancing misfolded rhodopsin degradation by transgenic overexpression of a regulatory subunit of the proteasome also showed retinal protection in rhodopsin P23H knock-in mice. These studies suggest that misfolded rhodopsin is sufficient to preserve rod photoreceptors in RHO-associated adRP. However, effective pharmacological tools are not available to remove misfolded rhodopsin and show retinal protection in vivo. [Means for solving the problem]

[0007] The embodiments described herein relate to compounds and methods for treating inherited eye disorders associated with or caused by misfolded eye proteins in subjects in need thereof. It has been found that reducing misfolded eye proteins, such as misfolded opsin proteins, can be an effective strategy for preserving or rescuing rod photoreceptors in subjects with inherited eye diseases associated with or caused by misfolded eye proteins. Using a small molecule high-throughput screening assay, compounds that selectively reduce misfolded mutant eye proteins without affecting the corresponding wild-type proteins have been identified. These compounds have been found to promote the clearance or accelerate the degradation of misfolded eye proteins, preserve visual function, and prevent photoreceptor death associated with inherited eye diseases. Effect of the Invention

[0008] Thus, in some embodiments, a method of promoting clearance of a misfolded ocular protein and / or treating an inherited ocular disorder associated with or caused by a misfolded ocular protein in a subject in need thereof comprises: [ka] The method includes administering to a subject a therapeutically effective amount of a compound selected from the following:

[0009] In other embodiments, the compound is [ka] The compound may be selected from among a pharma- ceutically acceptable salt, tautomer, or solvate thereof, or a combination thereof.

[0010] In some embodiments, the subject is predisposed to or has a genetic eye disorder associated with or caused by a misfolded ocular protein, for example, the subject may be predisposed to or have a non-syndromic retinal disorder associated with or caused by a misfolded ocular protein, such as non-syndromic autosomal dominant retinitis pigmentosa associated with or caused by a misfolded opsin protein.

[0011] In some embodiments, the misfolded eye protein is a misfolded opsin. The misfolded opsin protein can include a mutation in its amino acid sequence. For example, the misfolded mutant opsin protein can be a misfolded mutant rhodopsin, and the mutation is at least one of P23H, C110Y, D190N, T17M, P347S, or P267L.

[0012] In some embodiments, the compound can be administered by at least one of local administration, systemic administration, intravitreal injection, and intraocular delivery.Advantageously, the compound is administered to subject in the early or intermediate stage of eye disorder, such as the early or intermediate stage of non-syndromic autosomal dominant retinitis pigmentosa, to stop the development or progression of retinal degeneration.

[0013] In some embodiments, a therapeutically effective amount of a compound administered to a subject is an amount effective to accelerate the degradation of misfolded ocular proteins, improve ocular protein homeostasis, improve or preserve visual function, inhibit photoreceptor cell death, and / or improve or preserve retinal structure.

[0014] In some embodiments, the improvement or preservation in visual function includes improvement or preservation of photopic electroretinogram (ERG) response, hi other embodiments, the improvement or preservation in retinal structure is improvement or preservation of outer nuclear layer (ONL) thickness. [Brief description of the drawings]

[0015] [Figure 1]Figure 1 (AH) shows schematic images, plots, and charts illustrating high-throughput screening (HTS) of small molecules that selectively reduce misfolded P23H rhodopsin. A. Diagram of cell-based luciferase reporter assay for HTS and counterscreening. Mouse P23H or wild-type (WT) rhodopsin was fused with Renilla luciferase (Rluc) and constitutively expressed in Hek293 cells, named Hek293(RHOP23H-Rluc) or Hek293(RHOWT-Rluc), respectively. For HTS, Hek293(RHOP23H-Rluc) cells were incubated with each compound for 24 h before assaying for luciferase activity, and hits that showed activity scores lower than the mean -2SD were selected. For counterscreening, hits were tested by repeating the luciferase reporter assay in Hek293(RHOWT-Rluc) cells and those that showed favorable clearance activity in Hek293(RHOP23H-Rluc) versus Hek293(RHOWT-Rluc) cells were selected. B. Pie chart showing the compound libraries screened. The number of compounds in each library is shown in brackets. UC, University of Cincinnati Diversity Set; LOPAC, Library of pharmacologically active compounds; FDA, US Food and Drug Administration Approved Drugs; MIPE, NCATS Mechanism Inquiry Platte. C. Exemplary dose-response plots of hit compound CL-009 in Hek293(RHOP23H-Rluc) and Hek293(RHOWT-Rluc) cells shown as black squares and magenta circles, respectively. Luminescence was normalized by the average luminescence of cells treated with 0.1% DMSO and 1 mM Evans Blue as 0 and -100% controls, respectively. Data points and error bars are mean and SD. N=3. Dose-response curves were fitted by Origin software using the Hill function. D. Rhodopsin dot blot of cell lysates of untreated NIH3T3(RhoWT / GFP) and NIH3T3(RHOP23H / GFP) cells loaded at 25, 50, 75 and 100%.Rhodopsin dot blot intensity in ED was measured by Imagej and plotted as a function of the amount of cell lysate loaded. N=3. F. Rhodopsin dot blots of NIH3T3(RHOP23H / GFP) and NIH3T3(RhoWT / GFP) cells (bottom) treated with 0.1% DMSO or 10 μM CL-001-CL-009, respectively, for 24 h. Cells were loaded with the same amount as the 100% loading control in D. Rhodopsin dot blot intensity in GF was plotted as a box chart, respectively. The midline and top / bottom lines of the box in G are the mean and SD. N=3. P23H and WT rhodopsin levels in each replicate are shown as black squares and magenta circles, respectively. H. Chemical structures of CL-001-CL-009. The EC50 values ​​shown in brackets were obtained from high content image analysis quantifying immunostaining of P23H rhodopsin in response to 8-10 doses of each hit compound. [Diagram 2]Figure 2 (A-J) shows images and plots illustrating high-content imaging assays validating nine hits to selectively reduce P23H rhodopsin in vitro. For hit validation, we used NIH3T3 cells stably co-expressing GFP and P23H or GFP and WT rhodopsin, named NIH3T3(RHOP23H / GFP) or NIH3T3(RHOWT / GFP), respectively. A. High-content images of cells treated with 0.1% DMSO or 10 μM CL-001-CL-009 for 24 h. Immunostaining of rhodopsin showed that CL-001-CL-009 selectively reduced P23H rhodopsin levels but not WT rhodopsin levels. Scale bar, 50 μm. B-J. Dose-response curves of nine hit compounds from image-based analysis. Relative immunostaining intensity of rhodopsin measured from high content images of NIH3T3(RHOP23H / GFP) and NIH3T3(RHOWT / GFP) cells treated for 24 h with DMSO or 8–10 doses of CL-001–CL-009, respectively. Rhodopsin immunostaining intensity per cell was normalized to 0% for DMSO-treated cells and approximately 100% for cells stained with secondary antibody only, respectively. Data and error bars are mean and SD. N=3. Dose-response curves were fitted by a modified Hill function. The inset of each graph shows the chemical structure and EC50 of each hit compound in NIH3T3(RHOP23H / GFP). [Diagram 3]Figure 3 (A-D) shows plots, diagrams and images showing the effect of active compounds on rhodopsin transcription, degradation and clearance of other adRP causing mutations. A. Fold change of RHO transcripts in NIH3T3 (RHOP23H / GFP) and NIH3T3 (RHOWT / GFP) cells treated with 10 μM of each hit compound compared to DMSO control. Q-PCR results of RHO transcripts were first normalized by β-actin and then by DMSO control. The middle line and error bars are the mean and SD of three biological replicates shown as data points. RHOP23H and RHOWT. B. Diagram of non-radioactive pulse-chase assay. Briefly, cells were starved for 1 h in Met-free medium before pulsing for 4 h in Met-free azidohomoalanine (AHA) enriched medium to label synthesized nascent proteins with AHA. The cells were then chased for 0-24 h in medium containing 2 mM Met, and proteins synthesized during the chase period were no longer labeled with AHA. Next, AHA-incorporated proteins in cell lysates were conjugated with biotin (BTN) via a "click" reaction. Total rhodopsin was immunoprecipitated (IP) with 1D4 anti-rhodopsin antibody, and finally, BTN-labeled rhodopsin was dot blotted (IB) with HRP-streptavidin (SA). C. Percentage of nascent P23H rhodopsin from NIH3T3 (RHOP23H / GFP) cell lysates IPed with 1D4 anti-rhodopsin antibody (RHO) and IBed with SA at 24 h of the chase time. Cells were treated with 10 μM of CL-001-CL-009, or DMSO, respectively, at 0 h of the chase time. The IB intensity of each dot was normalized by the DMSO control in the same membrane (Figure 10). The three lines within each box represent the 75, 50 and 25% values ​​of the data within each group, the mean of each group is shown as a filled diamond, and error bars are SD. N=3. *, p<0.05, **, p<0.01), and ***, p<0.001 by unpaired two-tailed Student's t-test.D. Immunostaining of rhodopsin in U2OS cells stably expressing WT or six mutants of mouse rhodopsin (T4R, P23H, P53R, C110Y, D190N, P267L) that cause autosomal dominant retinitis pigmentosa under treatment with 10 μM CL-001, CL-002, CL-005 (11 μM), CL-007, and CL-009. Scale bar, 100 μm. [Figure 4]FIG. 4 (A-G) shows plots and images showing methotrexate (MTX / CL-009)-mediated P23H rhodopsin degradation via lysosomal activity in vitro. A. Immunoblots of rhodopsin in NIH3T3 (RHOP23H / GFP) and NIH3T3 (RHOWT / GFP) cells co-treated (+) or not (-) with 10 μM MTX, 100 nM bafilomycin A1 (BafA1), or 5 μM MG-132 for 24 h. β-actin was a loading control. B-A immunoblots were repeated and quantified as percentage of relative RHO levels by ImageJ. Midline and error bars are mean and SD. *p<0.05 by unpaired two-tailed Student's t-test. RHOP23H, black squares; and RHOWT, magenta circles. C. High content images of rhodopsin immunostaining in NIH3T3(RHOP23H / GFP) (top) and NIH3T3(RHOWT / GFP) (bottom) cells treated with DMSO, 10 μM MTX, 10 μM MTX + 100 nM BafA1, or 10 μM MTX + 5 μM MG-132. Scale bar, 50 μm. D. Relative immunostaining intensity (INT) of P23H rhodopsin measured from high content images of NIH3T3(RHOP23H / GFP) cells plotted as a function of MTX concentration alone or co-treatment with 100 nM BafA1 or 5 μM MG-132. P23H rhodopsin immunostaining intensity per cell normalized to 0% for DMSO-treated cells and approximately 100% for cells stained with secondary antibody alone, respectively. Data points and error bars are mean and SD. N=3. E-G. Effect of MTX on chymotrypsin-like proteasome activity in NIH3T3(RHOP23H / GFP) and NIH3T3(RHOWT / GFP) cells. Luminescent readout of proteasome activity as a function of cell number showing the cell numbers we used in EB are within the sensitivity range of the assay. F. Luminescent readout of NIH3T3 (grey), NIH3T3(RHOWT / GFP) (magenta) and NIH3T3(RHOP23H / GFP) (dark grey) cells treated with 0.1% DMSO or 5 μM MG-132 as 100% and 0% controls, respectively.The mean and SD from eight biological replicates (shown as diamonds) are shown as the middle bar and error bars. Z'=1-3×(SD100% control+SD0% control) / (mean100% control−mean0% control) in the inset demonstrates that the assay is robust. G. Normalized chymotrypsin-like proteasome activity of cells in response to 10 doses of MTX. Chymotrypsin-like proteasome activity was normalized by 100% and 0% controls, respectively. Data points and error bars are the mean and SD of three biological replicates. [Diagram 5] FIG. 5 (A-C) shows immunoblots and plots showing increased autophagic flux by MTX in retinas of RhoP23H / + mice. A. Immunoblots of SQSTM1 / p62 and LC3 in 30 μg of retinal lysates from RhoP23H / + mice at 48 hours after intravitreal injection (IVI) of 25 pmol / eye of MTX or phosphate-buffered saline (PBS) at PND15. β-actin was a loading control. Dashed boxes are samples selected for intensity analysis in B and C, excluding lanes 6 and 7 where samples may have been mixed when loaded. B and C. Ratios of band intensities of SQSTM1 / p62 to β-actin and LC3-II to β-actin, respectively, measured from the immunoblotting images in A. Left, PBS-treated retinas; right, retinas treated with 25 pmol MTX per eye. Midline and error bars are mean and SD. N=5. *p<0.05 between MTX-treated and PBS groups calculated by unpaired two-tailed Student's t-test. [Figure 6]FIG. 6 (AR) shows plots and images showing increased electroretinogram (ERG) responses and retinal rhodopsin levels upon a single intravitreal injection (IVI) of MTX in RhoP23H / + mice. Mice eyes were untreated or intravitreally injected with PBS, 25 or 100 pmol MTX on PND15, and ERG responses were recorded on PND32. Mice were euthanized and eyes enucleated on PND33 for immunohistochemistry (IHC). Age-matched Rho+ / + mice were used as normal controls. A. Dark-adapted ERG recordings stimulated by a light flash at 10 cd·s / m2. B and C. Eight-flash dark-adapted a- and b-wave amplitudes of treated mice plotted as a function of flash intensity (semi-logarithmic format), respectively. D. Six-flash light-adapted b-wave amplitudes plotted as a function of flash intensity (semi-logarithmic format). Black squares, red circles, blue triangles, and inverted magenta triangles are from untreated RhoP23H / + mice, RhoP23H / + mice treated with PBS, 25, and 100 pmol MTX, respectively. Data points and error bars are mean and SEM, respectively. N=5. *p1<0.05 between 25 pmol MTX-treated and PBS-treated groups calculated by 2-way ANOVA. Factor 1, treatment; and factor 2, flash intensity. Scale bar, 50 μm. Q. Spidergram of rhodopsin immunofluorescence EP. IHC images of untreated Rho+ / + retina and untreated, PBS-treated, or 25 pmol MTX-treated RhoP23H / + mouse retinas, from top to bottom, respectively. RHO and nuclei (Hoechst 33342) were stained red and blue, respectively. E, H, K, and N are low magnification retinal IHC images. Scale bar, 500 μm. F, I, L, and O are high-magnification retinal images taken at the sites marked in the boxes shown in E, H, K, and N on the underside of the retina, and G, J, M, and P are images of the upper retina, with intensity in the OS measured by ImageJ from high-magnification images taken at 0.6, 1, and 1.4 mm from the respective optic nerve heads (ONHs). Green squares, age-matched Rho+ / + mouse retinas. Spidergrams of the number of outer nuclear layer (ONL) nuclei per 200 μm length of retinal cross-sectional images taken at distances of 0.6, 1, and 1.4 mm R.Data points and error bars are means and SEM, respectively. N = 3. *, p<0.05 between the 25 pmol MTX group and the PBS group by unpaired two-tailed Student's t test. [Figure 7]FIG. 7 (AO) shows plots and images demonstrating improved ERG responses, preservation of rhodopsin levels and photoreceptor cell numbers with multiple IVI of MTX in RhoP23H / + mouse retinas. Eyes of RhoP23H / + mice were left untreated or administered PBS, 25 pmol MTX per treatment and 100 pmol MTX four times per week IVI starting on PND15 and ERGs were taken on PND44. Eyes were enucleated on PND46 for IHC. A. Dark-adapted ERG responses stimulated by a light flash at 10 cd·s / m2. B and C. Eight-flash dark-adapted a- and b-wave amplitudes of treated mice plotted as a function of flash intensity (semi-logarithmic format), respectively. D. Six-flash light-adapted b-wave amplitudes plotted as a function of flash intensity (semi-logarithmic format). Black squares, red circles, blue triangles, and inverted magenta triangles are from untreated RhoP23H / + mice, PBS, 25, and 100 pmol MTX-treated RhoP23H / + mice, respectively. Data points and error bars are mean and SEM, respectively. N=5. *p1<0.05 between 25 pmol MTX-treated and PBS-treated groups calculated by 2-way ANOVA. Factor 1, treatment; and factor 2, flash intensity. E–M. IHC images of untreated, PBS-treated, or 25 pmol MTX-treated RhoP23H / + mouse retinas, from top to bottom, respectively. RHO and nuclei (Hoechst 33342) were stained red and blue, respectively. E, H, and K are low magnification retinal images. Scale bar, 500 μm. F, I, and L are high-magnification retinal images taken at the sites marked as boxes in E, H, and K, respectively, and G, J, and M are upper images. Scale bar, 50 μm. N. Spidergrams of rhodopsin immunofluorescence intensity in the OS measured by ImageJ from high-magnification immunofluorescence images taken 0.6, 1, and 1.4 mm from the ONH. O. Spidergrams of the number of ONL nuclei per 200 μm length of retinal cross-sectional images taken 0.6, 1, and 1.4 mm from the ONH. Data points and error bars are mean and SEM, respectively. N=3. *, p<0.05 between 25 pmol MTX group and PBS group by unpaired two-tailed Student's t-test. [Figure 8] FIG. 8 (AE) shows immunoblots confirming rhodopsin expression in stable cells used for HTS and confirmation assays. A. Rhodopsin immunoblots showing Hek293 (RHOP23H-Rluc) and Hek293 (RHOWT-Rluc) cells expressing equivalent amounts of P23H or WT rhodopsin-Rluc fusion proteins. β-actin was used as a loading control. B-E. Rhodopsin immunoblots in U2OS stable cell single clones expressing WT, T4R, P23H, P53R, C110Y, and P267L mouse rhodopsin, each fused to Venus fluorescent protein at the C-terminus. Clones selected for high content imaging analysis under treatment of hit compounds (shown in FIG. 3) are marked by red boxes. The difference in molecular weight between WT and mutant RHO is due to premature glycosylation of RHO mutants that accumulate in the endoplasmic reticulum. [Figure 9] Figure 9 (AH) shows rhodopsin dot blots of NIH3T3 (RhoP23H / GFP) (A, C, E and G) and NIH3T3 (RhoWT / GFP) cells (B, D, F and H) treated with different compounds, including 10 or 20 μM CL-001-CL-009, respectively. Three biological replicates from cells treated with CL-002, CL-003, CL-004, CL-005 and CL-009. G-H. Four biological replicates of dot blots from cells treated with CL-001, CL-006, CL-007 and CL-008 are shown in the bottom four scans. The dot blots shown in Figure 1D&F were cropped from these original scans. Rhodopsin dot blot intensities in these replicates were measured and plotted in the curves and box charts shown in Figure 1E and G. [Figure 10]FIG. 10 (AF) shows immunoblots and plots showing the effect of nine hits on rhodopsin degradation in NIH3T3 (RHOP23H / GFP) cells using a non-radioactive pulse-chase assay. A. Dot blots of RHO at different steps of RHO immunoprecipitation (IP) from NIH3T3 (RHOWT / GFP) cells suggest high yield of rhodopsin down-precipitation. Dot blots from 5% of total cell lysate, 5% of flow-through, final wash-through, first and second elution are marked as T, FT, W, E1 and E2 from left to right, respectively. B. Chase of WT and P23H rhodopsin at 0, 4 and 24 hours after pulse with AHA, IP with anti-rhodopsin antibody (RHO) and immunoblot (IB) with streptavidin (SA). Met, cell lysate always incubated with Met as blank control. C. Percentage of decayed nascent rhodopsin as a function of chase time quantified from B by ImageJ. Grey squares, P23H rhodopsin; magenta circles, WT rhodopsin. D. NIH3T3 (RHOP23H / GFP) cells were treated with 10 μM each of CL-001-CL-009 or DMSO at 0 h of chase time. Nascent P23H rhodopsin from cell lysates IPed with RHO and IBed with SA at 24 h of chase time. E. Total P23H rhodopsin from the same batch of cell lysates IPed with RHO and IBed with RHO confirms that the activity of each hit compound indeed reduced total P23H rhodopsin protein levels. Dot blot intensities in D were quantified and are shown in Figure 3C. Dot intensities quantified from dot blot scans in FE and normalized to DMSO control. Squares and error bars are the means and SD of six biological replicates, boxes indicate 75, 50 and 25% data values. [Figure 11]FIG. 11 (AE) shows plots and immunoblots showing rhodopsin immunofluorescence intensity measured from high-content immunostaining images of U2OS cells stably expressing rhodopsin WT or six autosomal dominant retinitis pigmentosa causing mutants under treatment with CL-001 (A), CL-002 (B), CL-005 (C), CL-007 (D), and CL-009 (E). Normalized rhodopsin intensity was plotted as a function of seven doses of each compound in semi-logarithmic format. Dose-response curves were fitted by Origin software using a modified Hill function. Data points and error bars were the mean and SD from three biological replicates. The EC50 range of each compound against the different rhodopsin mutants was shown at the bottom of each graph. Data from cells expressing WT, T4R, P23H, P53R, C110Y, D190N, and P267L rhodopsin are marked as black squares, red circles, green triangles, blue inverted triangles, cyan diamonds, magenta left-pointing triangles, and olive right-pointing triangles, respectively. [Figure 12]Figure 12 (AL) shows immunoblots showing the effect of inhibiting proteasome or lysosomal activity on the effect of MTX on rhodopsin degradation. Left (A, B, C) and right (G, H, and I) immunoblots of rhodopsin from lysates of NIH3T3(RHOP23H / GFP) and NIH3T3(RHOWT / GFP) cells treated with DMSO, 10 μM methotrexate (MTX), 35.5 μM cycloheximide (CHX), 35.5 μM CHX and 10 μM MTX, 100 nM bafilomycin A1 (BafA1), 100 nM BafA1 and 10 μM MTX, 5 μM MG-132, 5 μM MG-132 and 10 μM MTX, and 100 nM BafA1 and 5 μM MG-132, respectively. D, E, and F are from NIH3T3(RHOP23H / GFP) cells treated with 0, 3, 10, or 30 μM MTX with or without co-treatment with 100 nM BafA1. J, K, and L are from NIH3T3(RHOP23H / GFP) cells treated with 0, 3, 10, or 30 μM MTX with or without co-treatment with 100 nM BafA1. Figure 4A was cropped from the immunoblot scans in A and B here, and quantification shown in Figure 4B was calculated from three biological replicates shown in A-L here. [Figure 13]FIG. 13 (AF) shows plots demonstrating improved retinal function and rhodopsin homeostasis with MTX treatment in RhoP23H / + knock-in mice. A single IVI of MTX did not affect the a-wave to b-wave ratio in vivo. RhoP23H / + knock-in mice in mice were intravitreally injected with PBS, 25 or 100 pmol MTX on PND15 and ERGs were recorded on PND32 and are shown in FIG. 6A-D. A and B are scotopic and light-adapted a-wave to b-wave ratios, respectively, plotted as a function of flash intensity in semi-log format. Data and error bars are mean and SEM, respectively. N=5. P1>0.05 by 2-way ANOVA suggests that neither 25 nor 100 pmol MTX treatment affected the scotopic or light-adapted a-wave to b-wave ratios compared to PBS controls. C-F. Effect of MTX on rhodopsin levels in RhoP23H / + mice. C&D, quantification of retinal IHC fluorescence intensity from mice treated with a single IVI, and E&F, from mice treated with 4 weekly IVIs. C&E, spidergrams of total rhodopsin immunofluorescence intensity (INTST) in the retina measured by ImageJ from high-magnification immunofluorescence images taken at 0.6, 1, and 1.4 mm from the optic nerve head (ONH). D&F, spidergrams of rhodopsin immunofluorescence intensity in the ONL from high-magnification images taken at 0.6, 1, and 1.4 mm from the ONH. Data points and error bars are mean and SEM, respectively. N=3. *, p<0.05 between 25 pmol MTX group and PBS group by unpaired two-tailed Student's t-test. [Figure 14]Figure 14 shows immunohistochemistry (IHC) images of Rho+ / + and RhoP23H / + mouse retinas treated with one intravitreal injection (IVI). RhoP23H / + mouse eyes were left untreated or treated with PBS, 25 pmol MTX via IVI on PND15 and enucleated on PND33. Untreated Rho+ / + eyes were used as normal controls. Genotype and treatment are labeled vertically on the left. N=3. RHO and nuclei (Hoechst 33342) were stained red and blue, respectively. Images were taken 0.6, 1, and 1.4 mm from the optic nerve head (ONH) inferior and superior to the retina, respectively. Scale bar, 50 μm. [Figure 15] FIG. 15 shows IHC images of RhoP23H / + mouse retinas treated with IVI four times per week. RhoP23H / + mouse eyes were left untreated or treated with IVI of PBS or 25 pmol MTX four times per week starting on PND15. Eyes were enucleated for IHC on PND46. Genotypes and treatment conditions are labeled vertically on the left. N=3. RHO and nuclei (Hoechst 33342) were stained red and blue, respectively. Images were taken 0.6, 1, and 1.4 mm from the optic nerve head (ONH) inferior and superior to the retina, respectively. Scale bar, 50 μm. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0016] Detailed Description For convenience, certain terms used in the specification, examples, and appended claims are collected here. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0017] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., at least one) for the grammatical purposes of the article. By way of example, "an element" means one element or more than one element.

[0018] The terms "comprise," "comprising," "include," "including," "have," and "having" are used in the inclusive and open sense, meaning that additional elements may be included. As used herein, the terms "such as," "for example," and "for example" are not limiting and are for illustrative purposes only. "Including" and "including but not limited to" are used interchangeably.

[0019] As used herein, the term "or" is to be understood to mean "and / or" unless the context clearly indicates otherwise.

[0020] The term "about" or "approximately" as used herein refers to a content, level, value, number, frequency, proportion, dimension, size, amount, weight or length that varies by about 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% with respect to a reference content, level, value, number, frequency, proportion, dimension, size, amount, weight or length. In one embodiment, the term "about" or "approximately" refers to a range of ±15%, ±10%, ±9%, ±8%, ±7%, ±6%, ±5%, ±4%, ±3%, ±2%, or ±1% of the content, level, value, number, frequency, proportion, dimension, size, amount, weight or length of the reference content, level, value, number, frequency, proportion, dimension, size, amount, weight or length.

[0021] It should be noted that some structures of the compounds of the present application contain asymmetric (chiral) carbon or sulfur atoms. It should therefore be understood that isomers arising from such asymmetry are included herein unless otherwise indicated. Such isomers can be obtained in substantially pure form by classical separation techniques and stereochemically controlled synthesis. The compounds of the present application may exist in stereoisomeric forms and therefore can be produced as individual stereoisomers or as mixtures.

[0022] The term "derivative" refers to compounds that have a common core structure and are substituted with various groups as described herein.

[0023] The term "bioisostere" refers to a compound resulting from the exchange of an atom or group of atoms with another broadly similar atom or group of atoms. The purpose of bioisostere replacement is to create a new compound with biological properties similar to the parent compound. Bioisostere replacement can be based on physicochemical or topology. Examples of bioisosteres of carboxylic acids include acylsulfonimides, tetrazoles, sulfonates, and phosphonates. See, e.g., Patani and LaVoie, Chem. Rev. 96, 3147-3176 (1996).

[0024] The phrases "parenteral administration" and "administered parenterally" are art-recognized terms and include modes of administration other than enteral and topical administration, such as injection, including, but not limited to, intravenous, intramuscular, intrapleural, intravascular, endocardial, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal and intrasternal injection and infusion.

[0025] The term "treating" is art-recognized and includes inhibiting a disease, disorder, or condition in a subject, e.g., slowing its progression, and alleviating a disease, disorder, or condition, e.g., causing regression of a disease, disorder, and / or condition. Treating a disease or condition includes ameliorating at least one symptom of a particular disease or condition, even if the underlying pathophysiology is not affected.

[0026] The term "preventing" is art-recognized and includes stopping a disease, disorder, or condition from occurring in a subject who is susceptible to, but has not yet been diagnosed with, the disease, disorder, and / or condition. Preventing a condition associated with a disease includes stopping the condition from occurring after the disease has been diagnosed but before the condition is diagnosed.

[0027] The term "pharmaceutical composition" refers to a formulation that contains the disclosed compound in a form suitable for administration to a subject. In a preferred embodiment, the pharmaceutical composition is in bulk or unit dosage form. The unit dosage form is any of a variety of forms, including, for example, a capsule, an IV bag, a tablet, a single pump on an aerosol inhaler, or a vial. The amount of active ingredient (e.g., a formulation of the disclosed compound or its salt) in a unit dose of the composition is an effective amount and varies according to the specific treatment involved. Those skilled in the art will understand that it is sometimes necessary to routinely modify the dosage depending on the age and condition of the patient. The dosage also depends on the route of administration. Various routes are contemplated, including oral, pulmonary, rectal, parenteral, transdermal, subcutaneous, intravenous, intramuscular, intraperitoneal, intranasal, inhalation, and the like. Dosage forms for topical or transdermal administration of the compounds described herein include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, spray compounds, and inhalants. In a preferred embodiment, the active compound is mixed under sterile conditions with a pharma- ceutical acceptable carrier and with any preservatives, buffers, or propellants that are required.

[0028] The term "flash dose" refers to a compound formulation that is a rapidly dispersing dosage form.

[0029] The term "immediate release" is defined as the release of a compound from a dosage form over a relatively short period of time, generally up to about 60 minutes. The term "modified release" is defined to include delayed release, sustained release, and pulsed release. The term "pulse release" is defined as a series of releases of drug from a dosage form. The term "extended release" or "sustained release" is defined as the continuous release of a compound from a dosage form over an extended period of time.

[0030] The phrase "pharmaceutical acceptable" is art-recognized. In certain embodiments, this term includes compositions, polymers and other materials and / or dosage forms that, within the scope of sound medical judgment, are suitable for use in contact with the tissues of human beings and animals without undue toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0031] The phrase "pharmaceutical acceptable carrier" is art-recognized and includes, for example, a pharmaceutically acceptable substance, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, involved in carrying or transporting any subject composition from one organ or body part to another. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the subject composition and not harmful to the patient. In certain embodiments, pharmaceutically acceptable carriers are non-pyrogenic. Some examples of substances that can serve as pharma- ceutically acceptable carriers include: (1) sugars, such as lactose, glucose, and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository wax; (9) peanut oil, cottonseed oil, sunflower oil, sesame oil, olive oil, cocoa butter, and other oils used in pharmaceutical preparations. (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol, and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffers, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) phosphate buffers; and (21) other non-toxic compatible substances.

[0032] The compounds of the present application can further form salts, and all of these forms are also contemplated herein.

[0033] A "pharmaceutical acceptable salt" of a compound means a salt that is pharmaceutical acceptable and has the desired pharmacological activity of the parent compound. For example, the salt may be an acid addition salt. One embodiment of an acid addition salt is a hydrochloride salt. Pharmaceutically acceptable salts can be synthesized from parent compounds that contain a basic or acidic moiety by conventional chemical methods. In general, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of an appropriate base or acid in water or an organic solvent or a mixture of the two, with non-aqueous media such as ether, ethyl acetate, ethanol, isopropanol, or acetonitrile generally being preferred. A list of salts can be found in Remington's Pharmaceutical Sciences, 18th Edition (Mack Publishing Company, 1990).

[0034] The compounds described herein can also be prepared as esters, e.g., pharma- ceutical acceptable esters. For example, a carboxylic acid function in a compound can be converted to its corresponding ester, e.g., methyl, ethyl, or other ester. Also, an alcohol group in a compound can be converted to its corresponding ester, e.g., acetate, propionate, or other ester.

[0035] The compounds described herein can also be prepared as prodrugs, e.g., pharma- ceutically acceptable prodrugs. The terms "pro-drug" and "prodrug" are used interchangeably herein and refer to any compound that releases an active parent drug in vivo. Prodrugs are known to enhance many desirable qualities of drugs (e.g., solubility, bioavailability, manufacture, etc.), and therefore, the compounds can be delivered in prodrug form. Thus, the compounds described herein are intended to include prodrugs of the claimed compounds, methods of delivering same, and compositions containing same. "Prodrugs" are intended to include any covalently bonded carriers that release the active parent drug in vivo when such prodrugs are administered to a subject. Prodrugs are prepared by modifying functional groups present in the compound such that the modifications are cleaved to the parent compound, either in routine manipulation or in vivo. Prodrugs include compounds in which a hydroxy, amino, sulfhydryl, carboxy, or carbonyl group is bonded to any group that is cleaved in vivo to form a free hydroxyl, free amino, free sulfhydryl, free carboxy, or free carbonyl group, respectively.

[0036] Examples of prodrugs include, but are not limited to, esters (e.g., acetate, dialkylaminoacetate, formate, phosphate, sulfate, and benzoate derivatives) and carbamates (e.g., N,N-dimethylaminocarbonyl) of hydroxy functional groups, ester groups (e.g., ethyl ester, morpholinoethanol ester) of carboxyl functional groups, N-acyl derivatives (e.g., N-acetyl), N-Mannich bases, Schiff bases, and enaminones of amino functional groups, oximes, acetals, ketals, and enol esters of ketone and aldehyde functional groups in compounds of formula I, and the like; see Bundegaard, H., "Design of Prodrugs," p. 1-92, Elesevier, New York-Oxford (1985).

[0037] Additionally, the salts of the compounds described herein may exist in either hydrated or non-hydrated (anhydrous) form, or as solvates with other solvent molecules. Non-limiting examples of hydrates include monohydrates, dihydrates, etc. Non-limiting examples of solvates include ethanol solvates, acetone solvates, etc.

[0038] The term "solvate" refers to a solvent addition form that contains either a stoichiometric or non-stoichiometric amount of solvent. Some compounds have a tendency to trap a fixed molar ratio of solvent molecules in the crystalline solid state, thus forming a solvate. When the solvent is water, the solvate formed is a hydrate, and when the solvent is alcohol, the solvate formed is an alcoholate. Hydrates are formed by the combination of one or more water molecules with one of the substances, where the water retains its molecular state as H2O, and such combinations can form one or more hydrates.

[0039] The compounds, salts and prodrugs described herein may exist in several tautomeric forms, including enol and imine forms, keto and enamine forms, and geometric isomers and mixtures thereof. Tautomers exist as a mixture of tautomeric sets in solution. In solid form, one tautomer usually predominates. Although one tautomer may be described, the present application includes all tautomers of the compounds of the present invention. A tautomer is one of two or more structural isomers that exist in equilibrium and are easily converted from one isomeric form to another. This reaction results in the geometrical shift of hydrogen atoms with the alternation of adjacent conjugated double bonds. In solutions where tautomerization is possible, a chemical equilibrium of tautomers is reached. The exact ratio of tautomers depends on several factors, including temperature, solvent, and pH. The concept of interconvertible tautomers by tautomerization is called tautomerism.

[0040] The term "analog" refers to a chemical compound that is structurally similar to another compound but differs slightly in composition (such as in the replacement of one atom with an atom of a different element or in the presence of a particular functional group, or in the replacement of one functional group with another). Thus, an analog is a compound that is similar or identical in function and appearance to the reference compound, but differs in structure or origin.

[0041] A "patient," "subject," or "host" treated by the present methods can mean either a human or a non-human animal, such as a mammal, fish, bird, reptile, or amphibian. Thus, the subject of the methods disclosed herein can be a human, a non-human primate, a horse, a pig, a rabbit, a dog, a sheep, a goat, a cow, a cat, a guinea pig, or a rodent. The term does not denote a particular age or sex. Thus, it is intended to include adult and newborn subjects, as well as fetuses, regardless of male or female. In one aspect, the subject is a mammal. A patient refers to a subject suffering from a disease or disorder.

[0042] The terms "prophylactic" or "therapeutic" treatment are art-recognized and include administration of one or more of the present compositions to a host. When administered prior to clinical signs of an undesirable condition, the treatment is prophylactic, i.e., it protects the host against the onset of the undesirable condition, whereas when administered after signs of an undesirable condition, the treatment is therapeutic (i.e., intended to reduce, ameliorate, or stabilize an existing undesirable condition or its side effects).

[0043] By "decreasing" or "increasing" is meant a negative or positive change of at least 10%, 25%, 50%, 75%, or 100%, respectively.

[0044] The terms "therapeutic agent," "drug," "pharmaceutical product," and "bioactive substance" are art-recognized and include molecules and other agents that are biologically, physiologically, or pharmacologically active substances that act locally or systemically in a patient or subject to treat a disease or condition. This term includes, but is not limited to, pharma- ceutically acceptable salts and prodrugs thereof. Such agents may be acidic, basic, or salts; they may be neutral molecules, polar molecules, or molecular complexes capable of hydrogen bonding; they may be prodrugs in the form of ethers, esters, amides, and the like, that become biologically activated when administered to a patient or subject.

[0045] The phrases "therapeutically effective amount" or "pharmaceutical effective amount" are art-recognized terms. In certain embodiments, the term refers to an amount of a therapeutic agent that produces some desired effect at a reasonable benefit / risk ratio applicable to any medical treatment. In certain embodiments, the term refers to that amount necessary or sufficient to eliminate, reduce or maintain the target of a particular therapeutic regimen. An effective amount may vary depending on factors such as the disease or condition being treated, the particular targeting construct being administered, the size of the subject or the severity of the disease or condition. Those skilled in the art may empirically determine the effective amount of a particular compound without undue experimentation. In certain embodiments, a therapeutically effective amount of a therapeutic agent for in vivo use may depend on a number of factors, including the release rate of the agent from the polymer matrix, which depends in part on the chemical and physical properties of the polymer; the identity of the agent; the mode and method of administration; and any other materials incorporated into the polymer matrix in addition to the agent.

[0046] Throughout this specification, when a composition is described as having, including, or comprising certain components, it is contemplated that the composition also consists essentially of or consists of the recited components. Similarly, when a method or process is described as having, including, or comprising certain process steps, the process also consists essentially of or consists of the recited process steps. Furthermore, it should be understood that the order of steps or order for performing certain actions is not critical so long as the compositions and methods described herein remain operable. Moreover, two or more steps or actions can be performed simultaneously.

[0047] The term "small molecule" is an art-recognized term. In certain embodiments, the term refers to a molecule having a molecular weight of less than about 2000 amu, or less than about 1000 amu, or even less than about 500 amu.

[0048] The term "wild-type" or "wild-type conformation" refers to the three-dimensional structure or shape of a protein that does not contain mutations present in the amino acid sequence that affect the conformation or shape of the protein such that the protein function is altered relative to the wild-type protein function. For opsin, the wild-type conformation is a conformation that does not contain a mutation that causes misfolding, such as the mutation designated P23H (P23H opsin) (see, e.g., Genbank Accession Nos. NM000539 and NP000530), which means that a proline is replaced by a histidine at residue 23 beginning at the N-terminus. Opsin in the "wild-type conformation" is capable of the biological functions of opsin, including, but not limited to, retinoid binding, visual cycle function, and insertion into the photoreceptor membrane.

[0049] By "misfolded opsin protein" is meant a protein whose tertiary structure differs from the conformation of the wild-type protein such that the misfolded protein lacks one or more biological activities associated with the wild-type protein.

[0050] "P23H rhodopsin" means any nucleic acid or protein of P23H rhodopsin.

[0051] Unless otherwise indicated, all parts and ratios used herein are by weight.

[0052] The embodiments described herein relate to compounds and methods for treating inherited eye disorders associated with or caused by misfolded eye proteins in subjects in need thereof. It has been found that reducing misfolded eye proteins, such as misfolded opsin proteins, can be an effective strategy for preserving or rescuing rod photoreceptors in subjects with inherited eye disorders associated with or caused by misfolded eye proteins. Using a small molecule high-throughput screening assay, compounds that selectively reduce misfolded mutant eye proteins without affecting the corresponding wild-type protein have been identified. These compounds have been found to promote the clearance or accelerate the degradation of misfolded eye proteins, preserve visual function, and prevent photoreceptor death associated with inherited eye disorders.

[0053] In some embodiments, a method of treating an inherited eye disorder associated with or caused by a misfolded ocular protein in a subject in need thereof comprises administering to the subject a therapeutically effective amount of a compound that promotes clearance of the misfolded ocular protein in a subject in need thereof. In some embodiments, compounds that promoted degradation of a misfolded mutant ocular protein (e.g., a misfolded mutant opsin or rhodopsin) but not the corresponding wild-type ocular protein in a cell may be selected. Compounds identified as promoting degradation of a misfolded mutant ocular protein (e.g., a misfolded mutant opsin or rhodopsin) but not the corresponding wild-type ocular protein in a cell using the high-throughput screening assays described herein, their pharma- ceutically acceptable salts, tautomers, or solvates, or combinations thereof, may be selected for use in treating an inherited eye disorder associated with or caused by a misfolded ocular protein in a subject in need thereof. [ka] is selected from.

[0054] In some embodiments, the genetic eye disorder is a non-syndromic retinal disorder associated with or caused by a misfolded ocular protein. For example, the non-syndromic retinal disorder can be non-syndromic autosomal dominant retinitis pigmentosa (adRP) associated with or caused by a misfolded ocular protein.

[0055] In other embodiments, the compound, a pharma- ceutically acceptable salt, tautomer, or solvate thereof, or a combination thereof is [ka] may be selected from:

[0056] Advantageously, the compound comprises: [ka] Or it may be a pharma- ceutically acceptable salt, tautomer, or solvate thereof. The compound having this formula is also called methotrexate. Methotrexate is a non-naturally occurring chemical compound also known as N-[4-[(2,4-diamino-6-pteridinyl)methyl]methylamino]benzoyl]-L-glutamic acid.

[0057] In certain embodiments, the compounds described herein can be used in a method of treating, preventing, ameliorating, or delaying the progression of retinitis pigmentosa (RP) or autosomal dominant retinitis pigmentosa (AdRP) in a subject. The method can include treating, preventing, ameliorating, or delaying the progression of retinitis pigmentosa (RP) or autosomal dominant retinitis pigmentosa (AdRP) in a subject by administering a compound described herein to the subject.

[0058] In other embodiments, the compounds described herein can be used in a method of improving or preserving visual function, visual field, photoreceptor cell function, ERG response, or visual acuity in a subject having a P23H rhodopsin mutant allele or having retinitis pigmentosa (RP), such as autosomal dominant retinitis pigmentosa (AdRP). The method can include administering a compound described herein to the subject. In certain embodiments, a method of inhibiting, preventing, or slowing the progression of photoreceptor cell loss and / or deterioration of the outer retinal nuclear layer (ONL) in a subject having a P23H rhodopsin mutant allele or having retinitis pigmentosa (RP), such as autosomal dominant retinitis pigmentosa (AdRP), includes administering a compound described herein to the subject.

[0059] In some embodiments, the misfolded ocular protein is a misfolded opsin. The method can be performed in vitro or in vivo, and the opsin protein can be present in a medium, such as a buffer, or can be contained within a cell. Such cells are generally mammalian cells, such as human cells, and can be part of a recombinant cell or cell line with selected biochemical or physiological properties. In one embodiment, the cell is an ocular cell, such as a retinal cell. The cell can be a vertebrate or mammalian (e.g., human) photoreceptor cell (e.g., rod cell, cone cell). In one embodiment, the rod cell is present in a mammalian eye, such as a human eye.

[0060] In specific embodiments, the misfolded opsin protein can include a mutation in its amino acid sequence, for example, the misfolded mutant opsin protein can be a misfolded mutant rhodopsin, where the mutation is at least one of P23H, C110Y, D190N, T17M, P347S, or P267L.

[0061] Other embodiments described herein relate to a method of ameliorating loss of photoreceptor function in the eye of a mammal by administering to the mammal afflicted with a mutant opsin protein having reduced affinity for 11-cis-retinal a therapeutically effective amount of a compound described herein that promotes clearance of the mutant opsin protein, hi one embodiment, the contacting occurs by administering to the mammal afflicted with reduced photoreceptor function a compound described herein.

[0062] In some embodiments, such loss of photoreceptor function can be partial or complete, with partial loss being anywhere between 1% loss and 99% loss. Additionally, such loss can be due to the presence of a mutation that causes opsin misfolding, such as the P23H mutation.

[0063] In another embodiment, the opsin binding agent can be administered to improve ocular pathologies associated with mislocalization of misfolded opsin proteins. In one embodiment, administering the compounds described herein to a subject with mislocalized opsin proteins promotes the clearance of the mislocalized opsin proteins. Thus, the methods and compounds described herein are useful for preventing or treating ocular pathologies associated with mislocalization of opsin associated with misfolded opsin proteins.

[0064] Optionally, the compounds described herein can be administered together with another therapeutic agent.For example, the compounds described herein can be used in combination with synthetic retinoids (e.g., as disclosed in US Patent Publication No. 2004-0242704), and can be used in combination with other active compounds (e.g., as described herein).In yet another embodiment, the compounds described herein can be administered in combination with any other agent that can promote the clearance of mutant P23H opsin protein.

[0065] The compounds used in the methods described herein can be administered to subjects using standard delivery methods, including local and systemic delivery methods such as ocular, parenteral, subcutaneous, intravenous, intraarticular, intrathecal, intramuscular, intraperitoneal, and intradermal injections, or by intravitreal, intraocular, or periocular injections.The specific method and dosage used for a particular subject depends on several factors, including, for example, the general health, weight, and age of the subject.Based on factors such as these, medical practitioners can select the appropriate method for treatment.

[0066] The term "treat" or "treatment" as used herein refers to reducing the severity and / or frequency of symptoms, removing symptoms and / or underlying causes, preventing the onset of symptoms and / or their underlying causes, and improving or remediating the disease. Such treatment does not necessarily have to completely improve the disease. For example, treating a subject with retinal degeneration by administering a compound described herein can include suppressing the disease or causing regression of the disease. Furthermore, such treatment can be used in combination with other traditional treatments for retinal degeneration known to those skilled in the art.

[0067] Treatment according to the methods described herein can be changed, stopped, or started again in subjects depending on the state of eye disorder.Treatment can be performed at intervals that are determined by those skilled in the art to be appropriate.For example, administration can be performed once, twice, three times, or four times a day.In some embodiments, the compound can be administered after the induction of retinal degeneration has occurred.

[0068] The treatment method can include administering to a subject a therapeutically effective amount of a compound described herein. For example, a pharmaceutical composition for use in the methods described herein can have a therapeutically effective amount of the compound or a salt thereof in a dosage range of 0.01-1,000 mg / kg of subject body weight, more preferably about 10-100 mg / kg of patient body weight.

[0069] Formulations of pharmaceutical compounds for use in the above (and other) modes of administration are known in the art and are described, for example, in Remington's Pharmaceutical Sciences (18th ed.), A. Gennaro (ed.), 1990, Mack Publishing Company, Easton, Pa. (see, e.g., M. J. Rathbone (ed.), Oral Mucosal Drug Delivery, Drugs and the Pharmaceutical Sciences Series, Marcel Dekker, Inc., NY, USA, 1996; M. J. Rathbone et al. (eds.), Modified-Release Drug Delivery Technology, Drugs and the Pharmaceutical Sciences Series, Marcel Dekker, Inc., NY, USA, 2003; Ghosh et al. (eds.), Drug Delivery to the Oral Cavity, Drugs and the Pharmaceutical Sciences Series, Marcel Dekker, Inc., NY, USA, 2005; and Mathiowitz et al. (eds.), Bioadhesive Drug Delivery Systems, Drugs and the Pharmaceutical Sciences Series, Marcel Dekker, Inc., NY, USA, 1999). The compounds of the present invention can be formulated into pharmaceutical compositions that include pharma- ceutical acceptable non-toxic excipients and carriers. Excipients are all ingredients present in a pharmaceutical formulation other than the active ingredient or ingredients. Suitable excipients and carriers can be composed of substances that are considered safe and effective and that can be administered to an individual without causing undesirable biological side effects or undesirable interactions with other drugs. Suitable excipients and carriers are those that are composed of substances that do not affect the bioavailability and performance of the drug.As generally used herein, "excipient" includes, but is not limited to, surfactants, emulsifiers, emulsion stabilizers, emollients, buffers, solvents, dyes, flavorings, binders, fillers, lubricants, and preservatives. Suitable excipients include those commonly known in the art, such as those described in "Handbook of Pharmaceutical Excipients", 4th Edition, Pharmaceutical Press, 2003.

[0070] The pharmaceutical composition may optionally further comprise one or more additional proteins, including plasma proteins, proteases, and other biological substances, as long as they do not adversely affect administration to a subject. Suitable proteins or biological substances may be obtained from human or mammalian plasma by any of the purification methods known and available to those skilled in the art; from supernatants, extracts, or recombinant tissue culture lysates, viruses, yeasts, bacteria, etc., containing genes expressing human or mammalian plasma proteins introduced according to standard recombinant DNA techniques; or from fluids (e.g., blood, milk, lymph, urine, etc.) or transgenic animals containing genes expressing human plasma proteins introduced according to standard transgenic techniques.

[0071] The pharmaceutical composition may include one or more pH buffer compounds to maintain the pH of the formulation at a predetermined level that reflects physiological pH, such as in the range of about 5.0 to about 8.0. The pH buffer compound used in the aqueous liquid formulation may be an amino acid or mixture of amino acids such as histidine or a mixture of amino acids such as histidine and glycine. Alternatively, the pH buffer compound is preferably an agent that maintains the pH of the formulation at a predetermined level, such as in the range of about 5.0 to about 8.0, but does not chelate calcium ions. Illustrative examples of such pH buffer compounds include, but are not limited to, imidazole and acetate ions. The pH buffer compound may be present in any amount suitable for maintaining the pH of the formulation at a predetermined level.

[0072] The pharmaceutical composition may also include one or more osmolality modifiers, i.e., compounds that adjust the osmolality (e.g., tonicity, osmolality, and / or osmotic pressure) of the formulation to a level acceptable to the bloodstream and blood cells of the recipient individual. The osmolality modifier may be an agent that does not chelate calcium ions. The osmolality modifier may be any compound known or available to one skilled in the art that adjusts the osmolality of the formulation. One skilled in the art may empirically determine the suitability of a given osmolality modifier for use in the formulations of the present invention. Representative examples of suitable types of osmolality modifiers include, but are not limited to, salts such as sodium chloride and sodium acetate; sugars such as sucrose, dextrose, and mannitol; amino acids such as glycine; and mixtures of one or more of these agents and / or types of agents. The osmolality modifier(s) may be present in any concentration sufficient to adjust the osmolality of the formulation.

[0073] The composition comprising the compound described herein can comprise polyvalent metal ions, such as calcium ion, magnesium ion and / or manganese ion. Any polyvalent metal ion that stabilizes the composition and does not adversely affect the recipient individual can be used. Those skilled in the art can empirically determine suitable metal ions based on these two criteria, and suitable sources of such metal ions are known and include inorganic and organic salts.

[0074] Other delivery systems may include time-release, delayed release or sustained release delivery systems. Such systems may avoid repeated administration of the composition and may increase convenience for the subject and the physician. Many types of release delivery systems are available and known to those skilled in the art. These include polymer base systems such as polylactide (U.S. Pat. No. 3,773,919; European Patent No. 58,481), poly(lactide-glycolide), copolyoxalates polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyrates such as poly-D-(-)-3-hydroxybutyrate (European Patent No. 133,988), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman, K R. et al., Biopolymers 22:547-556), poly(2-hydroxyethyl methacrylate) or ethylene vinyl acetate (Langer, ft. et al., J. Biomed. Mater. Res. 15:267-277; Langer, B. Chem. Tech. 12:98-105), and polyanhydrides.

[0075] Other examples of sustained release compositions include semipermeable polymer matrices in the form of shaped articles, e.g., films, or microcapsules.Delivery systems also include non-polymeric systems such as lipids, including sterols, such as cholesterol, cholesterol esters, and fatty acids, or neutral fats, such as mono-, di-, and triglycerides; hydrogel release systems, such as biologically derived bioresorbable hydrogels (i.e., chitin hydrogels or chitosan hydrogels); silastic systems; peptide-based systems; wax coatings; compressed tablets with conventional binders and excipients; partially micronized implants. Specific examples include, but are not limited to, (a) erosion systems in which the drug is contained in a form within a matrix such as those described in 13.5. U.S. Patent Nos. 4,452,775, 4,667,014, 4,748,034 and 5,239,660, and (b) diffusion systems in which the active ingredient permeates at a controlled rate through a polymer such as those described in U.S. Patent Nos. 3,832,253 and 3,854,480.

[0076] Compositions containing the compounds described herein are particularly suited for the treatment of ophthalmic diseases or conditions, such as retinitis pigmentosa.

[0077] In one approach, the composition can be administered through an ocular device suitable for direct injection into the vitreous of the eye. The composition can be provided in a sustained release composition, such as those described in U.S. Pat. Nos. 5,672,659 and 5,595,760. Such devices have been found to provide sustained controlled release of various compositions for treating the eye without the risk of adverse local and systemic side effects. The goal of the ocular delivery method is to maximize the amount of drug contained in the intraocular device or implant while minimizing its size in order to extend the duration of the implant. See, for example, U.S. Pat. Nos. 5,378,475, 6,375,972, and 6,756,058 and U.S. Patent Publication Nos. 20050096290 and 200501269448. Such implants can be biodegradable and / or biocompatible implants, or non-biodegradable implants.

[0078] Biodegradable ocular implants are described, for example, in US Patent Publication No. 20050048099. The implants may be permeable or impermeable to the active agent and may be inserted into an ocular chamber, such as the anterior or posterior chamber, or may be implanted into the sclera, transchoroidal space, or an avascular area outside the vitreous. Alternatively, contact lenses may be used for drug delivery, acting as a depot for the compositions of the present invention.

[0079] In some embodiments, the implant can be placed on an avascular area, such as on the sclera, to allow transscleral diffusion of the drug to the desired site of treatment, for example, the intraocular space and the macula of the eye.Furthermore, the site of transscleral diffusion is preferably close to the macula.Examples of implants for delivery of the compositions of the present invention include U.S. Pat. Nos. 3,416,530, 3,828,777, 4,014,335, 4,300,557, 4,327,725, 4,853,224, 4,946,450, 4,997,652, 5,147,653, 5,151,652, 5,200,2 ... No. 47, No. 164,188, No. 5,178,635, No. 5,300,114, No. 5,322,691, No. 5,403,901, No. 5,443,505, No. 5,466,466, No. 5,476,511, No. 5,516,522, No. 5,632,984, No. 5,679,666, No. 5,710,165, No. No. 5,725,493, No. 5,743,274, No. 5,766,242, No. 5,766,619, No. 5,770,592, No. 5,773,019, No. 5, No. 824,072, No. 5,824,073, No. 5,830,173, No. 5,836,935, No. 5,869,079, No. 5,902,598, No. 5,90 Nos. 4,144, 5,916,584, 6,001,386, 6,074,661, 6,110,485, 6,126,687, 6,146.366, 6,251,090, and 6,299,895, as well as the devices described in WO01 / 30323 and WO01 / 28474.

[0080] Other approaches for ocular delivery include the use of liposomes to target the compounds described herein to retinal pigment epithelial cells and / or Bruch's membrane. For example, the compounds can be complexed with liposomes in the manner described above, and the compound / liposome complex can be injected using intravenous injection into patients with ocular disorders, such as retinitis pigmentosa, to target the compounds to the desired ocular tissue or cells. Direct injection of liposome complexes in the vicinity of retinal pigment epithelial cells or Bruch's membrane can also provide targeting of the complex to some forms of ocular disorders, such as retinitis pigmentosa. In a specific embodiment, the compounds are administered via intraocular sustained delivery (VITRASERT or ENVISION). In a specific embodiment, the compounds are delivered by posterior subtenon injection. In another specific embodiment, microemulsion particles comprising the compositions of the present invention are delivered to ocular tissues to take lipids from Bruch's membrane, retinal pigment epithelial cells, or both.

[0081] The composition comprising the compound described herein can be delivered locally.For local delivery, the composition is provided in any medicament acceptable excipient approved for ocular delivery.Preferably, the composition is delivered to the surface of the eye in the form of eye drops.In some applications, the delivery of the composition relies on the diffusion of the compound through the cornea into the interior of the eye.

[0082] In one embodiment, the compounds described herein can be provided in an ophthalmic formulation that can be administered to the eye of a subject. The ophthalmic formulation can include the compound in a medicamentously acceptable solution, suspension, or ointment. Some variation in concentration will necessarily occur depending on the specific compound used, the condition of the subject being treated, etc., and the person responsible for treatment will determine the most suitable concentration for each individual subject. The ophthalmic formulation can be in the form of a sterile aqueous solution, if desired, containing additional components, such as preservatives, buffers, tonicity agents, osmotic agents, antioxidants, stabilizers, non-ionic wetting or clarifying agents, and thickeners.

[0083] In some embodiments, the compositions used in the methods described herein can include methotrexate. Compositions that include methotrexate can be formulated for repeated injections.

[0084] In some embodiments, methotrexate is formulated for sustained release. Many sustained release formulations of methotrexate are known in the art, including biodegradable implants such as lipid encapsulation formulations, e.g., "Depo / Methotrexate" as described in Bonetti et al., Cancer Chemother Pharmacol 33:303-306 (1994) and Chatelut et al., J Pharm Sci. 1994 March;83(3):429-32; multivesicular liposome (MVL) formulations of methotrexate (MTX), e.g., as described in WO2011143484; nano- or microparticles, e.g., α-lactalbumin microparticles as described in Vijayaragavan et al., Int J Pharm Res 3(1):39-44 (2011) or Taheri et al., J Nanomaterials Nanoparticles of conjugated methotrexate to human serum albumin as described in US Pat. No. 6,2011 (dx.doi.org / 10.1155 / 2011 / 768201); polyion complex (PIC) micelles; bioadhesive polymers such as hydroxypropylmethylcellulose (HPMC), carboxymethylcellulose (CMC) and polyacrylic acid (PAA) derivatives, and hyaluronic acid (HA), e.g., Lacrisert (Aton Pharma), a soluble hydroxypropylcellulose ophthalmic insert.

[0085] Alternatively, or in addition, sustained release can be achieved using sustained release devices, such as those described in, for example, Palakurthi et al., Current Eye Research, 35(12):1105-1115 (2010), or intravitreal implants similar to Retisert (Bausch & Lomb), Ozurdex (Allergan); or non-biodegradable implants, for example, similar to Iluvien (Alimera) or Vitrasert (Bausch & Lomb) implants; the I-vation platform (SurModics Inc.). See also Lee et al., Pharm Res. 27(10):2043-53 (2010); Haghjou et al., J Ophthalmic Vis Res. 6(4):317-329 (2011); Kim et al., Invest. Ophthalmol. Vis. Sci. 45(8):2722-2731 (2004); and Velez and Whitcup, Br J Ophthalmol 83:1225-1229 (1999).

[0086] The composition comprising the compound described herein above can be administered in a therapeutically effective amount or effective amount. The term "therapeutically effective amount" refers to an amount (dosage) effective for treating a subject with, for example, a retinal degeneration-related disease or disorder (e.g., retinitis pigmentosa). The therapeutically effective amount depends on the mode or administration, the particular condition being treated, and the desired result. It may also depend on the stage of the disease state, age and physical condition of the subject, the nature of concurrent treatment, if any, and similar factors well known to medical practitioners. In therapeutic applications, it is an amount sufficient to achieve a medically desired result.

[0087] For a subject suffering from retinitis pigmentosa, an effective amount is sufficient to promote clearance of misfolded opsin protein in cells. For a subject having a disease or disorder associated with misfolded proteins, an effective amount is an amount sufficient to stabilize, slow, or reduce symptoms associated with a pathology such as retinitis pigmentosa.

[0088] In some embodiments, the therapeutically effective amount of a compound administered to a subject is an amount effective to accelerate the degradation of misfolded ocular proteins, improve ocular protein homeostasis, improve or preserve visual function, inhibit photoreceptor cell death, and / or improve or preserve retinal structure.

[0089] In some embodiments, the improvement or preservation in visual function includes improvement or preservation of photopic electroretinogram (ERG) response, hi other embodiments, the improvement or preservation in retinal structure is improvement or preservation of outer nuclear layer (ONL) thickness.

[0090] In general, the dose of the compound of the present invention is from about 0.01 mg / kg per day to about 1000 mg / kg per day (e.g., 0.01, 0.05, 0.1, 0.25, 0.5, 1.0, 5, 10, 15, 20, 25). It is expected that doses ranging from about 50 to about 2000 mg / kg (e.g., 50, 100, 200, 250, 500, 750, 1000, 1250, 1500, 1750, 2000) will be suitable. Lower doses will result from certain forms of administration, such as intravenous administration. If the response in the subject is inadequate with the initial dose applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be used to the extent tolerated by the patient's habits. Multiple doses per day are contemplated to achieve adequate systemic levels of the compositions containing the compounds described herein.

[0091] One of skill in the art will recognize that it is routine in the art to calibrate human dosages compared to animal models, so a human dosage can initially be determined by extrapolating from the amount of compound used in mice. In certain embodiments, the dosage is about 10 to 1000 mg (e.g., about 20 mg to 1,000 mg, 30 mg to 1,000 mg, 40 mg to 1,000 mg, 50 mg to 1,000 mg, 60 mg to 1,000 mg, 70 mg to 1,000 mg, 80 mg to 1,000 mg, 90 mg to 1,000 mg, about 10 to 900 mg, 10 to 800 mg, 10 to 700 mg, 10 to 600 mg, 10 to 500 mg, 100 to 1,000 mg, 100 to 900 mg, 100 to 800 mg, 100 to 700 mg, 100 to 600 mg, 100 to 500 mg, 100 to 400 mg, It is envisioned that the amount may vary in the ranges of 100-300mg, 200-1000mg, 200-900mg, 200-800mg, 200-700mg, 200-600mg, 200-500mg, 200-400mg, 300-1000mg, 300-900mg, 300-800mg, 300-700mg, 300-600mg, 300-500mg, 400mg-1,000mg, 500mg-1,000mg, 100mg-900mg, 200mg-800mg, 300mg-700mg, 400mg-700mg, and 500mg-600mg). In some embodiments, the compound is present in an amount of about 10 mg, 50 mg, 100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg or more. In some embodiments, the 15-PGDH inhibitor is present in an amount of about 1000 mg, 950 mg, 900 mg, 850 mg, 800 mg, 750 mg, 700 mg, 650 mg, 600 mg, 550 mg, 500 mg, 450 mg, 400 mg, 350 mg, 300 mg, 250 mg, 200 mg, 150 mg, or 100 mg or less.

[0092] In other embodiments, a therapeutically effective dosage of the compound may be, for example, about 0.001 mg / kg body weight to 500 mg / kg body weight, e.g., about 0.001 mg / kg body weight to 400 mg / kg body weight, about 0.001 mg / kg body weight to 300 mg / kg body weight, about 0.001 mg / kg body weight to 200 mg / kg body weight, about 0.001 mg / kg body weight to 100 mg / kg body weight, about 0.001 mg / kg body weight to 90 mg / kg body weight, about 0.001 mg / kg body weight to 80 mg / kg body weight, about 0.001 mg / kg body weight to 10 ... The amount of the compound may be about 0.001 mg / kg body weight to 70 mg / kg body weight, about 0.001 mg / kg body weight to 60 mg / kg body weight, about 0.001 mg / kg body weight to 50 mg / kg body weight, about 0.001 mg / kg body weight to 40 mg / kg body weight, about 0.001 mg / kg body weight to 30 mg / kg body weight, about 0.001 mg / kg body weight to 25 mg / kg body weight, about 0.001 mg / kg body weight to 20 mg / kg body weight, about 0.001 mg / kg body weight to 15 mg / kg body weight, or about 0.001 mg / kg body weight to 10 mg / kg body weight.

[0093] In yet other embodiments, the therapeutically effective dose is, for example, about 0.0001 mg / kg body weight to 0.1 mg / kg body weight, for example, about 0.0001 mg / kg body weight to 0.09 mg / kg body weight, about 0.0001 mg / kg body weight to 0.08 mg / kg body weight, about 0.0001 mg / kg body weight to 0.07 mg / kg body weight, about 0.0001 mg / kg body weight to 0.06 mg / kg body weight, about 0.0001 mg / kg body weight to 0.05 mg / kg body weight, about 0.0 0.001mg / kg body weight to 0.04mg / kg body weight, about 0.0001mg / kg body weight to 0.03mg / kg body weight, about 0.0001mg / kg body weight to 0.02mg / kg body weight, about 0.0001mg / kg body weight to 0.019mg / kg body weight, about 0.0001mg / kg body weight to 0.018mg / kg body weight, about 0.0001mg / kg body weight to 0.017mg / kg body weight, about 0.0001mg / kg body weight to 0.016mg / kg body weight, about 0.000 1mg / kg body weight to 0.015mg / kg body weight, about 0.0001mg / kg body weight to 0.014mg / kg body weight, about 0.0001mg / kg body weight to 0.013mg / kg body weight, about 0.0001mg / kg body weight to 0.012mg / kg body weight, about 0.0001mg / kg body weight to 0.011mg / kg body weight, about 0.0001mg / kg body weight to 0.01mg / kg body weight, about 0.0001mg / kg body weight to 0.009mg / kg body weight, about 0.000 It may be 1 mg / kg body weight to 0.008 mg / kg body weight, about 0.0001 mg / kg body weight to 0.007 mg / kg body weight, about 0.0001 mg / kg body weight to 0.006 mg / kg body weight, about 0.0001 mg / kg body weight to 0.005 mg / kg body weight, about 0.0001 mg / kg body weight to 0.004 mg / kg body weight, about 0.0001 mg / kg body weight to 0.003 mg / kg body weight, or about 0.0001 mg / kg body weight to 0.002 mg / kg body weight.In some embodiments, a therapeutically effective dose is 0.0001 mg / kg body weight, 0.0002 mg / kg body weight, 0.0003 mg / kg body weight, 0.0004 mg / kg body weight, 0.0005 mg / kg body weight, 0.0006 mg / kg body weight, 0.0007 mg / kg body weight, 0.0008 mg / kg body weight, 0.0009 mg / kg body weight, 0.001 mg / kg body weight, 0.002 mg / kg body weight, 0.003 mg / kg body weight, 0. ... g body weight, 0.005 mg / kg body weight, 0.006 mg / kg body weight, 0.007 mg / kg body weight, 0.008 mg / kg body weight, 0.009 mg / kg body weight, 0.01 mg / kg body weight, 0.02 mg / kg body weight, 0.03 mg / kg body weight, 0.04 mg / kg body weight, 0.05 mg / kg body weight, 0.06 mg / kg body weight, 0.07 mg / kg body weight, 0.08 mg / kg body weight, 0.09 mg / kg body weight, or 0.1 mg / kg body weight. The effective dose for a particular individual can be varied (e.g., increased or decreased) over time depending on the needs of the individual.

[0094] In some embodiments, a therapeutically effective dose may be 10 μg / kg / day, 50 μg / kg / day, 100 μg / kg / day, 250 μg / kg / day, 500 μg / kg / day, 1000 μg / kg / day or more. In various embodiments, the amount of the 15-PGDH inhibitor or pharmaceutical salt thereof is sufficient to provide the patient with a dosage of between 0.01 μg / kg and 10 μg / kg, between 0.1 μg / kg and 5 μg / kg, between 0.1 μg / kg and 1000 μg / kg, between 0.1 μg / kg and 900 μg / kg, between 0.1 μg / kg and 900 μg / kg, between 0.1 μg / kg and 800 μg / kg, between 0.1 μg / kg and 700 μg / kg, between 0.1 μg / kg and 600 μg / kg, between 0.1 μg / kg and 500 μg / kg, or between 0.1 μg / kg and 400 μg / kg.

[0095] In one embodiment, the pharmaceutical composition comprising an effective amount of the compound is administered at least twice. In another embodiment, the pharmaceutical composition is administered at least 5 times. In yet another embodiment, the pharmaceutical composition is administered at least 10 times. Those skilled in the art can determine the frequency of administering the composition based on the particular disease or disorder being treated, or how the subject has responded to previous treatments.

[0096] In some embodiments, the compounds described herein can be administered to a subject at the early or intermediate stages of non-syndromic autosomal dominant retinitis pigmentosa. The course of retinitis pigmentosa disease can be conveniently divided into three stages: early stage, intermediate stage, and final stage.

[0097] In the early stages, nighttime blindness is the main symptom. It may be present from the first year of life or may appear in the second decade or later. At this stage, peripheral visual field defects may be present in dim light. However, these defects are absent or minimal during the day, so the patient may have a normal lifestyle and the disease may appear stable. It is difficult to establish the diagnosis at this stage, especially in the absence of a family history (about half of the cases). Visual acuity is normal or subnormal. Fundus examination may appear normal, as spicule-like pigment deposits are absent or rare. In addition, retinal arteriolar attenuation is moderate and the optic disc is normal. The electroretinogram (ERG) is the key test. In most cases, it shows a reduced amplitude of the b-wave, which predominates in dark-adapted conditions. However, the ERG may appear normal, despite a reduced maximum ERG amplitude, only when the retina is partially affected.

[0098] In the intermediate stage, the clinical picture is complete. Nighttime blindness is evident, with difficulty driving at night and walking in the evening and on dark stairs. The patient becomes aware of losses in the peripheral vision in daytime light conditions through stereotypic situations. While driving, they do not notice pedestrians or cars approaching from the side, they are unable to hold their hands when shaking hands, and they frequently bump into various objects. As a result, the patient adapts himself by avoiding night driving and cycling in unfamiliar places. Color deficiency for pale colors (especially blue and yellow hues) is often present. In addition, the patient becomes photopic, especially in diffuse light (white cloudy weather). This makes reading difficult in the narrow window between insufficient light and too bright light. The inability to read is due in part to reduced vision due to macular involvement (macular edema or mild foveomacular atrophy) and posterior subcortical cataracts. Fundus examination reveals the presence of spicule-like pigment deposits in the mid-periphery, along with retinal atrophy. Retinal vascular narrowing is evident, and the optic disc is moderately thin. In contrast, extreme peripheral and macular regions appear relatively poorly, although mild macular involvement is frequent. ERGs are usually not recordable under dark-adapted conditions (rods), and cone responses (30H Z Flicker, bright lights) has been significantly reduced.

[0099] In the final stage, the patient is unable to move autonomously as a result of peripheral vision loss (classical tunnel vision) and only a small degree of remaining visual field around the fixation point. Reading is difficult and requires magnifying glasses. Photophobia is intense. Fundus examination reveals extensive pigmentation reaching the macular region. The blood vessels are thin and the optic disc has a waxy pallor. Fluorescein angiography detects retinal-choroidal atrophy also in the peripheral and foveomacular regions. ERG cannot be recorded.

[0100] In one embodiment, the disclosed compound is administered once the subject is diagnosed with symptoms of retinitis pigmentosa (such as impaired vision, nighttime blindness, light sensitivity, tunnel vision, and loss of peripheral vision to total loss of vision). In another embodiment, the disclosed compound is administered once the subject may be identified as at risk for developing retinitis pigmentosa (risk factors may include family history or test positive for rhodopsin mutations). In yet another embodiment, the disclosed compound is administered once the subject may be diagnosed with retinitis pigmentosa. In another embodiment, the compound is administered once the subject is diagnosed with symptoms of other forms of retinal degeneration whose etiology involves a rhodopsin mutation in the subject's photoreceptor cells (e.g., P23H rod opsin mutation). In another embodiment, the disclosed compound is administered once the subject is identified as at risk for developing other forms of retinal degeneration whose etiology involves a rhodopsin mutation in the subject's photoreceptor cells. In some embodiments, the compound is administered prophylactically. In some embodiments, the subject is diagnosed with the disease before retinal damage is evident. In some embodiments, a human subject may know that he or she is in need of retinogenesis treatment or prevention.

[0101] In some embodiments, the subject may be monitored for the extent of retinal degeneration. The subject may be monitored in various ways, such as eye examination, dilated eye examination, fundus examination, visual acuity test, and / or biopsy. Monitoring may be performed at various times. For example, the subject may be monitored after the compound is administered. Monitoring may occur, for example, 1 day, 1 week, 2 weeks, 1 month, 2 months, 6 months, 1 year, 2 years, 5 years, or any other time point after the first administration of the compound. The subject may be monitored repeatedly. In some embodiments, the dose of the compound may be altered in response to the monitoring.

[0102] Another method for treating a subject suffering from retinal degeneration is to administer a therapeutically effective amount of a compound described herein with a therapeutically effective amount of an additional compound that acts as a chaperone for rhodopsin and / or an anti-retinal degeneration agent or therapy. Examples of anti-retinal degeneration agents or therapies include, but are not limited to, supplements such as vitamin A, DHA, and lutein, as well as optical prosthetic devices, gene therapy mechanisms, and retinal sheet transplants.

[0103] Those skilled in the art will recognize that the best treatment regimen for using any of the compounds of the present invention to treat retinitis pigmentosa can be determined directly.This is not a matter of experimentation, but rather one of the optimizations routinely performed in medical technology.In vivo studies in nude mice often provide a starting point for starting to optimize the dosage and delivery schedule.The frequency of injection is initially once a week, as is done in some mouse studies.However, this frequency can be optimally adjusted from 1 day to every 2 weeks, every 2 weeks to every month, depending on the results obtained before the first clinical trial and the needs of a particular patient.

[0104] Working Example In this example, we target rhodopsin homeostasis in rod cells expressing mutant rhodopsin with small molecules for preventive treatment of RHO-associated adPR, which is the first cellular event to be disrupted and leads to rod stress and death. We identified the approved drug methotrexate (MTX) by high-throughput screening (HTS) using a cell-based assay that selectively accelerates P23H rhodopsin degradation via lysosomal activity. Importantly, MTX inhibits Rho P23H / + A single intravitreal injection (IVI) improved rhodopsin homeostasis and enhanced visual function in knock-in mice. Furthermore, multiple weekly IVIs of MTX improved Rho dopsin homeostasis and enhanced visual function compared to vehicle controls. P23H / +The knock-in mice had a higher number of photoreceptor cells on the upper retina. The activity of MTX in inducing the clearance of misfolded rhodopsin suggests its potential in the treatment of inherited retinal degenerations caused by protein misfolding.

[0105] Materials and Methods stable cell line Two Hek293 stable cell lines, Hek293 (Rho), stably expressing WT and P23H mutant mouse rhodopsin, each fused with Renilla luciferase (Rluc) for luciferase reporter assays, were established as previously described. WT -Rluc) and Hek293 (RHO P23H Briefly, Hek293 cells (ATCC, Manassas, VA, USA) were transfected with pcDNA3.1 Zeo containing mouse WT or P23H rhodopsin cDNA fused with Rluc 8 (a gift from Dr. Navine Lambert, Augusta University, Augusta, GA USA), and the transfected cells were incubated for 48 h in Dulbecco's modified Eagle's medium (DMEM, Genesee Scientific, El Cajon, CA USA) supplemented with 10% fetal bovine blood (FBS, Gibco Laboratories, Gaithersburg, MD USA), and 400 μg / mL Zeocin (InvivoGen, San Diego, CA USA) was added for positive clone selection. Colonies of cells surviving one week of Zeocin selection were collected, and expression of WT and P23H rhodopsin was confirmed by luciferase assay and rhodopsin immunoblotting, with the positive band of monomer at approximately 70 kD (Figure 8). The difference in molecular weight between WT and P23H rhodopsin proteins is due to the difference in glycosylation, which is also seen in NIH3T3 cells expressing WT and P23H rhodopsin proteins.

[0106] Two NIH3T3 stable cell lines, NIH3T3(RHO WT / GFP) and NIH3T3 (RHOP23H pMiLRO23 and pMiLRO23H rhodopsin (GFP) were generated by introducing pMiLRO23 and pMiLRO DNA constructs, respectively, into NIH3T3 cells via viral transduction (24, 33) and shared with the laboratory of Dr. Krzysztof Palczewski. GFP was coexpressed with rhodopsin for positive clone selection. Expression of WT and P23H rhodopsin proteins was confirmed by immunoblotting and immunostaining.

[0107] Seven U2OS stable cell lines expressing WT mouse rhodopsin and six mutant mouse rhodopsins (T4R, P23H, P53R, C110Y, D190N, P267L) fused with Venus fluorescent protein were generated. Briefly, U2OS cells (ATCC, Manassas, VA, USA) were transfected with pcDNA3.1 Zeo containing cDNAs of WT or T4R, P23H, P53R, C110Y, D190N, P267L rhodopsin fused with Venus mouse, transfected cells were incubated in DMEM with 10% FBS for 48 h, and 400 μg / mL Zeocin was added for positive clone selection. Colonies of cells surviving one week of Zeocin selection were collected, and the expression of WT and six mutant rhodopsins was confirmed by Venus fluorescence and rhodopsin immunoblotting.

[0108] Cell culture and media Cells were cultured in complete medium containing DMEM with 10% FBS and 5 μg / mL plasmocin (InvivoGen, San Diego, CA USA) at 37°C, 5% CO2 and >95% humidity, and subcultured as indicated in the ATCC Guide to Animal Cell Culture (www.atcc.org).

[0109] Chemicals and Reagents ViviRen was purchased from Promega (Madison, WI, USA), dissolved in dimethyl sulfoxide (DMSO) as 60 mM stock aliquots, and stored at -80°C in amber tubes. The UC 10k diversity set was provided by the University of Cincinnati Drug Discovery Center (UCDDC, Cincinnati, OH USA) in 384-well format at 10 mM per compound, the Spectrum collection (MicroSource, Gaylordsville, CT USA) and Life Chemicals 50K diversity set (Life Chemicals USA, Woodbridge, CT USA) were provided by Dr. Krzysztof Palczewski in 384-well format at 10 mM per compound, and the Library of FDA-approved drugs, pharmacologically active compounds (LOPAC, Millipore Sigma, St. Louis, MO USA) and Mechanism Inquiry PlattE (MIPE) collection were provided by NCATS in 1536-well format with 7 or 11 dose series for each compound. All compounds in these compound libraries were dissolved in DMSO and stored at -80°C and sealed with adhesive foil film. Hit compounds were handpicked from compound stocks in powder or ordered from chemical vendors for triplicate dose-response studies and confirmation and counterscreening. CL-001 (Pubchem CID: 11715767), CL-006 (CID: 11338033), CL-007 (CID: 5330790), and CL-008 (CID: 16747683) were purchased from Selleckchem (Houston, TX USA); CL-002 (CID: 6224422), CL-003 (CID: 4438424), and CL-004 (CID: 6624030) were ordered from Life Chemicals, CL-005 (CID: 10091681) was provided by UCDDC, and CL-009 / MTX (CID: 126941) was purchased from Cayman Chemical (Ann Arbor, MI USA). DMSO and L-methionine were from MilliporeSigma (St. Louis, MO USA).Anti-rhodopsin antibodies 1D4 and B630 were shared with the laboratory of Dr. Krzysztof Palczewski. Anti-microtubule-associated protein light chain 3 (LC3) antibody was purchased from Cell Signaling Technology (4108S, Danvers, MA USA). Anti-sequestosome 1 (SQSTM1 / p62) antibody was purchased from Novus Biologicals (NBP1-42821, Centennial, CO USA). Cy3-conjugated goat anti-mouse IgG (A10521), horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (32230), HRP-conjugated goat anti-rabbit IgG (32260), HRP-streptavidin (SA) (434323), L-azidohomoalanine (AHA, C10102), biotin (BTN)-sDIBO (C20023), and Dynabeads™ Protein G (10004D), BCA Protein Assay (23225), paraformaldehyde (28908), Hoechst 33342 (H3570), and Supersignal™ West Pico PLUS chemiluminescent substrate (34580) were obtained from ThermoFisher (Waltham, MA USA).

[0110] HTS and counterscreening procedures HTS was performed at three facilities, including the University of Cincinnati (UC), Case Western Reserve University, and the National Center for Advancing Translational Sciences (NCATS), testing a total of six compound collections. These compound collections included: 1) the UC 10k diversity set (10,011 compounds), 2) the Life Chemicals 50K collection (50,560), 3) the Spectral collection (2,400 compounds), 4) the LOPAC collection (1,280 compounds), 5) the FDA collection (2,816 compounds), and 6) the NCATS MIPE collection (1,912 compounds). The procedures for the HTS assays and the confirmatory assays differed slightly to adapt to the equipment at the different facilities (Table 4), despite the quality control parameters (signal-to-noise ratio and Z' factor), demonstrating that these assays are robust (Table 1). For compound collections 1), 2) and 3), we first tested each compound in a 384-well format using a P23H rhodopsin luciferase reporter assay at one single dose (9.93-16.13 μM) and identified 2072 compounds with activity scores below the cutoff at mean -2 SD. Activity scores were normalized using DMSO-treated cells as 0% control and 1 mM Evans Blue-treated cells as approximately 100% control. From these hit compounds, we excluded those reported to have luciferase inhibitory activity and handpicked the rest for hit confirmation. We again tested Hek293 (RHO) rhodopsin luciferase reporter assays in triplicate. P23H Each hit was tested at 10 μM in Hek293 (RHO-Rluc) cells, and confirmed hits with activity scores below about 50% were then analyzed for their effect on Rluc activity by recombinant Rluc activity assay, and ... WT Each compound was counter-screened for its effect on WT rhodopsin levels by luciferase reporter assay at 10 μM in triplicate in Hek293 (RHO-Rluc) cells. We identified 52 compounds that did not significantly affect Rluc activity or WT rhodopsin-Rluc reporter activity (activity score greater than about 50%). P23H-Rluc) cells and Hek293 (RHO WT We tested the dose response of these confirmed hits in both Hek293 (RHO-Rluc) cells and identified compounds that selectively favored the clearance of P23H over WT rhodopsin in a dose-dependent manner (Table 4). For compound collections 4)-6), we cultured Hek293 (RHO-Rluc) cells in a 1536-well format. P23H Each compound was directly tested at 7 or 11 doses using a luciferase reporter assay in IgG-Rluc cells, with efficacy of less than about 50% and an EC 50 We then selected these 128 compounds and used them to measure the activity of Hek293 (RHO P23H -Rluc) and Hek293 (Rho WT We tested them by luciferase reporter assay at 7 or 11 doses in triplicate in both rhodopsin- and rhodopsin-Rluc) cells and selected 34 compounds that showed higher potency for the clearance of P23H than WT rhodopsin.

[0111] Table 1 - Quality control parameters for HTS of each compound collection using luciferase reporter assay [Table 1]

[0112] Rluc reporter assay The Rluc reporter assay has been described previously. HTS was performed in 384-well format for the UC 10K diversity set, Spectral collection, and Life Chemicals 50K diversity set, and in 1536-well format for the FDA, LOPAC, and MIPE collections. Using the 384-well format as an example, 3 × 10 5 / mL Hek(RHO) P23H-Rluc) cells were seeded at 40 μL per well of a 384-well white-walled, clear-bottom plate (assay plate) by an 8-channel Multiflo liquid dispenser (Bioteck, Winooski, VT USA). The assay plate was centrifuged at 300×g for 30 seconds and incubated overnight at 37°C, 5% CO2. The next day, compounds were transferred from the 384-well compound plate to the 384-well assay plate containing cultured cells by a 50 nL 384 pin tool operated by a JANUS MDT automated workstation (PerkinElmer, Waltham, MA USA). Compound plates containing 50 μL / well of compound solution were dissolved in DMSO in columns 3-22. Controls were loaded in columns 1, 2, 23, and 24 in a control plate containing 50 μL each of DMEM, DMSO, DMSO, and Evans Blue (606 mM in DMSO). Controls were transferred from the compound plate to the assay plate using a 50 nL pin tool. Before reuse, the pin tools were washed thoroughly by sequentially immersing in wash wells containing 100 mL DMSO, wash water, and 100 mL ethanol, and air-dried for 30 seconds. The treated assay plates were centrifuged at 300×g for 30 seconds and incubated at 37° C., 5% CO2 for 24 hours. On the third day, 5 μL / well of 2% n-dodecyl-β-D-maltopyranoside (DDM) was added to the assay plate, followed by shaking for 5 seconds. The assay plate was incubated at room temperature for 5 minutes, and 5 μL / well of 50 μM ViviREN solution diluted in phosphate-buffered saline (PBS) was added, followed by shaking for 5 seconds. The assay plate was incubated at room temperature in dim light for 1 hour. The luminescence of each well was read by an Enspire plate reader (PerkinElmer) with an integration time of 0.1 seconds. For the 1536-well format of the HTS assay, cells were seeded at 3000 cells / well in 5 μL per well of white-walled, clear-bottom 1536-well plates; the procedure was the same as for the 384-well assay, with the exception that compounds were transferred using a 23 nL 1536 pin tool, and 0.5 μL / well of DDM and 1 μL / well of 30 μM ViviREN solution were added sequentially to the assay plate.For counterscreening assays, Hek293(Rho. WT The assay was repeated as an HTS assay using (RLU-Rluc) cells. Activity score (%) = (RLU 化合物 -RLU DMSO ) / (RLU DMSO -RLU エバンスブルー ) × 100. RLU, relative luminescence units.

[0113] Recombinant Rluc activity assay Recombinant Rluc (RayBiotech, Peachtree Corners, GA USA) was dissolved in PBS and diluted to 0.3 μg / mL. Each compound was diluted to 10× final concentration in PBS as compound working solution. In a 384-well plate, 16 μL / well of diluted Rluc was mixed with 4 μL / well of compound working solution. Using a Molecular Devices SpectraMax XL microplate reader, luminescence in each well was read for 2.5 seconds after injection of 20 μL per well of 5 μM coelenterazine h substrate (Nanolight Technologies, Pinetop, AZ USA). Each compound was tested at a final concentration of 10 μM and repeated three times. Luciferase activity was normalized by DMSO and 1 mM Evans Blue as controls of 0% and approximately 100%, respectively.

[0114] Dot Blot NIH3T3(RHO P23H / GFP) or NIH3T3(RHO WT / GFP) cells were cultured at 2.5 × 10 in 100 µL / well of complete medium in a 96-well plate. 4Cells / well were seeded and incubated at 37°C, 5% CO2 for 4 hours. Cells were then treated with 100 μL / well of complete medium containing test compound at 2× final concentration. After further incubation at 37°C, 5% CO2 for 24 hours, medium was aspirated and cells were washed once with PBS. Cell lysis buffer containing radioimmunoprecipitation assay (RIPA) buffer and complete protease inhibitor cocktail (Roche Diagnostics, Basel, Switzerland) was added to cells at 200 μL / well, followed by sonication for 6 seconds. RHO WT The cellular protein levels of RHO P23H Since the NIH3T3 (RHO WT 5% of the / GFP cell sample and 1 well of NIH3T3 (RHO P23H 90% of the (GFP) cell samples were loaded onto nitrocellulose membranes and air-dried. Opsin proteins were immunostained with 0.1 μg / mL HRP-conjugated 1D4 anti-rhodopsin antibody. Densitometry of the bands was measured by ImageJ software and normalized to DMSO-treated controls.

[0115] Western blot 5 x 10 cells 5 Cells were seeded in 6-well plates at a density of 100 cells / well and cultured at 37°C, 5% CO2 for 17 h. The medium was replaced with fresh medium containing the corresponding concentrations of compounds. After 24 h of treatment, cells were collected and lysed in 150 μL PBS containing 0.1% SDS and complete protease inhibitor cocktail with 12 s sonication on ice. Retinal samples were lysed in 300 μL / retina of PBS containing 0.1% SDS and complete protease inhibitor cocktail with 24 s sonication on ice. Protein concentration was measured using a Nanodrop spectrometer by OD analysis. 280nm The rhodopsin was determined by measuring the amount of P23H 100 μg of total protein per well for NIH3T3 (RHO WTFor IgG (IgG1 / GFP) cells, 20 μg of total protein was loaded on SDS-PAGE gels. For detection of other proteins, 50 μg of total protein was loaded per well. After separation by electrophoresis on 10% and 16% SDS-PAGE gels, proteins were transferred to nitrocellulose membranes using a wet membrane electrotransfer cassette, followed by blocking with 5% bovine serum albumin in PBS containing 0.05% Tween 20 for 1 h. Membranes were incubated with primary antibodies overnight at 4° C., followed by incubation with appropriate secondary antibodies for 1 h at room temperature. Blots were visualized using SuperSignal™ West Pico PLUS chemiluminescent substrate and scanned with a BioRad gel imager.

[0116] High Content Imaging To evaluate the effect of active compounds on P23H rhodopsin clearance in mammalian cells, NIH3T3 (RHO WT / GFP) and NIH3T3 (RHO P23HImage-based assays were performed using 100-fold increase in chromatin concentration (100-fold increase) and 100-fold increase in chromatin concentration (100-fold increase) in 384-well plates. Briefly, cells were seeded at 5000 cells per well in 384-well plates and incubated at 37°C, 5% CO2 for 4 hours until the cells attached to the bottom of the plate. The attached cells were treated with compounds for 24 hours. The assay medium was aspirated and the cells were fixed with 20 μL of 4% paraformaldehyde per well for 20 minutes at room temperature. The cell membrane was permeabilized with PBS containing 0.1% Triton X-100 (PBST) and then incubated with 15 μL / well of 50 μg / mL of 1D4 anti-rhodopsin antibody for 1 hour at room temperature. After washing three times with 50 μL / well of PBST, the cells were incubated with 15 μL / well of Cy3-conjugated goat anti-mouse IgG antibody for 1 hour at room temperature. After washing three times with 50 μL / well PBST, cells were incubated in 50 μL / well PBS containing 2 μg / mL Hoechst 33342 to stain the nuclei. Finally, immunostained cells were imaged by ImageExpress high content imaging system (Molecular Devices). Rhodopsin immunofluorescence was measured by MetaXpress software using the average of the total fluorescence of Cy3 channel per well, per cell, acquired from five fields containing 600-1000 intact cells per well. After normalizing the fluorescence intensity of rhodopsin to DMSO-treated cells as 0% and cells immunostained with secondary antibody only as approximately 100%, dose-response curves for each compound were plotted and fitted by modified Hill function using Origin software. High content imaging experiments for hit confirmation were performed at CWRU Drug Discovery Institute, and high content imaging analysis for MTX co-treatment with BafA1 and MG-132 was performed at University of Pittsburgh Drug Discovery Institute. Therefore, small differences due to experimental variations were observed in CL-009 / MTX activity.

[0117] qPCR NIH3T3(RHO WT / GFP) and NIH3T3 (RHO P23H / GFP) cells were placed in a 24-well plate at 2.5 × 105 Cells were seeded at a density of 100 cells / well and cultured overnight at 37°C, 5% CO2. The cells were then incubated with compound-containing medium for 24 hours. After aspirating the medium, the cells were collected and dissolved in 300 μL / well of TRIzol (ThermoFisher, 15596026, Waltham, MA USA) for 5 minutes. The samples were mixed vigorously with 60 μL of chloroform for 30 seconds and then centrifuged at 12,000×g for 15 minutes at 4°C. The upper aqueous phase containing RNA was removed and mixed with 150 μL of isopropanol by vigorous shaking. After settling for 10 minutes, the samples were centrifuged at 12,000×g for 10 minutes at 4°C. The pellet was washed with 300 μL of 75% ethanol and centrifuged at 7,500×g for 5 minutes at 4°C. The RNA pellet was air-dried for 15 min and dissolved in 30 μL of nuclease-free water (Fisher Scientific, BP2484-100, Houston, TX USA). RNA yield and purity were assessed by NanoDrop spectrometer. cDNA was generated from 1 μg of RNA using the High-Capacity RNA-to-cDNA kit (ThermoFisher, 4387406, Waltham, MA USA). qPCR amplification was performed using PowerUp SYBR Green master mix (ThermoFisher, A25741, Waltham, MA USA) with cDNA template and primers, and the reaction was controlled by a QuantStudio3 thermocycler (ThermoFisher, Waltham, MA USA). The primer sequences were as follows: RHO, forward 5'-CCCTTCTCCAACGTCACAGG-3' (SEQ ID NO:1), reverse 5'-TGAGGAAGTTGATGGGGAAGC-3' (SEQ ID NO:2); β-actin, forward 5'-ACCTTCTACAATGAGCTGCG-3' (SEQ ID NO:3), reverse 5'-CTGGATGGCTACGTACATGG-3' (SEQ ID NO:4).

[0118] Pulse-chase assay To quantify the degradation of rhodopsin, a "click" reaction was used in a non-radioactive pulse-chase assay. P23H / GFP) or NIH3T3(Rho WT / GFP) cells were cultured at 3 × 10 in complete medium containing 10% FBS in 24-well plates. 5 Cells / well were cultured. After overnight culture, the medium was aspirated and the cells were gently washed once with 1 mL / well PBS. The cells were incubated with L-methionine-free DMEM (Gibco, 21013-024, Gaithersburg, MD USA) for 1 h to expel intracellular methionine. The cells were then pulsed with L-AHA at a final concentration of 50 μM for 4 h. Meanwhile, cells treated with 50 μM L-methionine were used as a negative control. After labeling, the cells were replaced with complete DMEM medium with 2 mM L-methionine in the presence or absence of active compounds for various chase times. The cells were then lysed with PBS containing 0.1% SDS, 1% DDM and complete protease inhibitor cocktail. Total protein concentration was measured by BCA assay. Cell lysates containing 200 μg total protein were mixed with 5 μM BTN-sDIBO and allowed to "click" at 37°C for 1 h. Samples were incubated with Dynabeads™ Protein G conjugated with 1D4 anti-rhodopsin antibody for 15 min at room temperature, followed by washing three times with PBS containing 0.02% Tween 20. Proteins were eluted with 50 mM glycine, pH 2.8 for 10 min at room temperature, then loaded onto nitrocellulose membranes. After air drying, membranes were blocked with 5% milk and immunoblotted with 0.25 μg / mL HRP-conjugated SA.

[0119] Proteasome activity assay NIH3T3(RHO P23H / GFP), NIH3T3(RHO WTGFP (P < 0.01 / GFP) and NIH3T3 cells were seeded in white-walled, clear-bottom 384-well plates at 2500 cells / well in 20 μL of complete medium. After 3 h of incubation, 5 μL / well of complete medium containing MTX was added to the cells to treat the cells with a final concentration of 0.0195–10 μM for 24 h. Cells treated with complete medium containing 0.1% DMSO were used as 100% control, and cells treated with 5 μM MG-132 for 8 h were used as 0% control. For end-point proteasome activity measurements, 25 μL of Proteasome-Glo™ Reagent containing Suc-LLVY-Glo™ Substrate (Promega, G8660, Madison, WI USA) was added to each well. The 384-well plate was shaken for 2 min to mix the solution, followed by incubation at room temperature for 24 min. Luminescence in each well was detected by a SpectraMax I3X microplate reader (Molecular Devices). Chymotrypsin-like proteasome activity was normalized by 100% and 0% controls, respectively.

[0120] animal C57BL / 6J (Rho + / + ) Mouse and Rho P23H / P23H Mice were purchased from Jackson Laboratory (stock number 017628). P23H / P23H Mice were bred with wild-type C57BL / 6J mice to generate P23H heterozygous mice. Genotyping of all strains was performed as indicated using forward and reverse primers: 1) GGTAGCACTGTTGGGCATCT (SEQ ID NO: 5); and 2) GACCCCACAGAGACAAGCTC (SEQ ID NO: 6), respectively. PCR products of 573 and 399 bp indicated the P23H knockout mutant and WT alleles of the RHO gene, respectively. Mice were bred and housed under standard 12-h light / 12-h dark conditions in the University of Pittsburgh Animal Facility. All animal experiments were approved by the University of Pittsburgh Institutional Animal Care and Use Committee (IACUC) in accordance with the Guide for Animal Welfare Act and regulations.

[0121] Intravitreal injection (IVI) To determine the effect of the compounds on the retina in vivo, we administered the compounds directly into the vitreous space. Briefly, mice were treated with 1% tropicamide eye drops (Akorn, Lake Forest, IL USA) to dilate the pupils, and then anesthetized with an intraperitoneal injection of 80 mg / kg body weight (bw) ketamine (Henry Schein, Dublin, OH USA) and 7 mg / kg bw xylazine (Bimeda, Le Sueur, MN USA). One drop of 0.5% tetracaine hydrochloride (TCI, Tokyo, Japan) was applied to the mouse eye as a local anesthetic before injection. During the injection, the eye was lubricated with 0.3% hypromellose gel for eyes (Alcon, Fort Worth, TX USA). A heating pad was used to maintain body temperature. The mouse was positioned to expose the sclera of the eye. A hole was drilled through the sclera posterior to the cornea at a 45° angle using a 30-gauge needle (Medline, Northfield, IL USA). A 33-gauge blunt-tip needle (Hamilton, Reno, NV USA) was used to insert into the hole and a total of 0.5 μL of sterile PBS or MTX in PBS was slowly injected into the posterior chamber, the needle was held in place for approximately 30 seconds, and the needle was slowly removed. A small amount of avian antibiotic ointment (Medline, Northfield, IL USA) was applied to the injection site to prevent infection. On postnatal day (PND) 15, each Rho P23H / + Mice received a single IVI dose of 25 or 100 pmol MTX in one eye and PBS was injected into the other eye as a vehicle control. P23H / + A second group of mice received IVI of MTX or PBS four times per week.

[0122] Electroretinogram (ERG) ERG was performed using a Celeris system (Diagnosys, Lowell, MA, USA) as previously described. Before each test, mice were kept in darkness overnight. Pupils were dilated with 1% tropicamide eye drops (Akorn, Lake Forest, IL USA). Mice were anesthetized with an intraperitoneal injection of 80 mg / kg bw ketamine and 7 mg / kg bw xylazine. Eyes were lubricated with ophthalmic 0.3% hypromellose gel (Alcon, Fort Worth, TX USA). A heating pad was used to maintain body temperature at 37°C. 0.01 cd·s / m 2 ~30cd·s / m 2 Dark-adapted ERG responses of the dark-adapted eye to 10 flashes of 10 cd / m 2 for 5 min were recorded and averaged from three sweeps per flash intensity with a 10–30 s sweep interval. 2 After exposure to lighting, 10cd / m 2 of background light plus 0.01 cd s / m 2 ~30cd·s / m 2 Photopic ERG responses were recorded from the light-adapted eye in response to a flash of 1000 Hz. To determine statistical significance between response amplitudes in the MTX-treated and vehicle (PBS) groups, P values ​​were calculated by two-way ANOVA. Factor 1, treatment condition; and factor 2, flash intensity.

[0123] Tissue collection and immunohistochemistry (IHC) Mice were euthanized and the upper side of each eye was labeled with a burn mark made by a cautery pen. Eyes were enucleated by a pair of curved tip forceps and fixed in freshly prepared 4% paraformaldehyde for 2 hours. Fixed eyes were dehydrated successively in 5, 10, 20 and 40% sucrose solutions in PBS for 30 minutes each at room temperature. Finally, eyes were incubated in a mixture of 40% sucrose in PBS and OCT compound (FisherScientific, Houston, TX USA) at a volume ratio of 1:1 overnight at 4°C, after which they were orientation-specifically embedded in the same mixed solution and frozen in a liquid nitrogen bath isobutene. Twelve micron retinal cross sections were made by microtome at -16°C, and those containing the optic nerve head were applied onto SuperFrost glass slides (FisherScientific, Houston, TX USA). These slides were then used for IHC. After rehydration and permeabilization in PBST for 15 min, retinal sections were incubated in 5% goat serum for 30 min and then incubated with mouse 1D4 anti-rhodopsin antibody (20 μg / mL) in PBS in a humidified chamber for 2 h at room temperature. Retinal sections were washed four times with PBST and incubated with Cy3-conjugated goat anti-mouse antibody (5 μg / mL) for 1 h at room temperature. Hoechst 33342 (1:10000 dilution) was applied to stain the nuclei for 5 min. Sections were mounted with ProlongGold mounting solution (ThermoFisher, Waltham, MA USA). Immunofluorescence images were then taken by fluorescence microscopy for low magnification images and confocal microscopy for high magnification images. A total of six high magnification images were acquired with a 60× objective lens with oil per retinal cryosection, at 0.6, 1.0, and 1.4 mm close to the optical nerve head (ONH). The immunofluorescence intensity of rhodopsin in the OS and outer nuclear layer (ONL) was measured using ImageJ by selecting the corresponding layers with a magic wand and measuring the fluorescence intensity within the selected areas. The number of nuclei in the ONL was calculated by counting Hoechst 33343 positive objects in the ONL in each high-magnification image spanning 200 μm along the retina.

[0124] statistical analysis HTS and high content imaging assays were performed with each assay plate containing 16 replicates of 0% and approximately 100% controls, and Z' was calculated for each plate to ensure that Z'>0.5 for HTS and Z'>0 for high content imaging assays, indicating that the results for each plate were robust activity scores properly calculated with controls. Z'=1-3×(SD 0%対照 +SD 約100%対照 ) / (average 0%対照 -average 約100%対照 ).

[0125] Because ERG responses can be influenced by two factors, compound treatment (Factor 1) and flash intensity (Factor 2), ERG recordings were analyzed by two-way analysis of variance (ANOVA). p1 and p2 determine whether compound treatment and flash intensity significantly affect ERG responses, respectively, while p 1-2 determined whether the two factors interacted with each other. Other assays were analyzed by unpaired two-tailed Student's t test. The criteria for significance were p>0.05 for non-significant; * p<00.5), ** p<00.1), *** p<0.001; **** p<0.0001. Sample size was determined as a function of: 1)

number

number

[0126] result HTS identified 46 compounds that selectively reduced P23H rhodopsin To identify small molecules that reveal misfolded P23H rhodopsin mutant proteins, we developed a Hek293 cell line (Hek293(RHO)) that stably expresses bright Rluc as a reporter fused to P23H rhodopsin. P23H We developed a cell-based HTS assay using Hek293 cells (Figure 1A and Figure 8). Since photoreceptor cell lines are not available for culture, we chose one of the most commonly used cells for HTS, Hek293 cells. To quantify P23H rhodopsin in response to compound treatment for 24 h using this luciferase reporter assay, we performed HTS of 68,979 small molecules in a total of six compound collections (Figure 1B, Table 4). We identified 2072 compounds from three compound collections with activity scores below the cutoff at the mean -2SD (Table 1) tested at one dose (9.96-16.13 μM) and EC50- ... 50 We identified 128 hits with a β-amyloid ... WT We performed a counterscreen to select only compounds that did not reduce luminescence in Hek293 (RHO-Rluc) cells, suggesting that these selected compounds selectively favor the clearance of mutant rhodopsin. We then demonstrated that the clearance of mutant rhodopsin was reduced by luciferase reporter assays. P23H -Rluc) and Hek293 (RHO WT The dose-response effects of these compounds in rhodopsin-Rluc (P23H) cells were examined to determine the potency and efficacy of these compounds to selectively reduce P23H rhodopsin (Figure 1C). Together, 46 compounds with mutant rhodopsin selectivity were identified from the HTS of this 68,979 compound set.

[0127] Hit validation confirmed 9 hits. To exclude false positives related to cell lines or Rluc fusions and to confirm the selective activity of the 46 hits for the clearance of P23H over WT rhodopsin, we performed a 10-fold increase in the activity of P23H rhodopsin (NIH3T3 (RHO P23H / GFP)) and WT rhodopsin (NIH3T3(RHO WT We tested these compounds in two NIH3T3 cell lines stably expressing rhodopsin-positive (RH)-associated rhodopsin (P23H / GFP). Different cell lines derived from Hek293 used for HTS were used to select compounds with non-cell type specific activity. We also found that NIH3T3 (RH)-associated rhodopsin-positive (P23H / GFP) cells treated with 10 μM of each compound showed selective reduction of P23H compared to WT rhodopsin. P23H / GFP) and NIH3T3 (RHO WT Rhodopsin levels were determined using dot blots of cell lysates from (P23H / GFP) cells (Figures 1D-G and 9). We used high content imaging analysis of rhodopsin immunofluorescence to quantify P23H and WT rhodopsin in these cells after 24 h of treatment with these compounds (Figures 1H and 2). As a result, we validated nine compounds that selectively remove misfolded P23H rhodopsin in mammalian cells (Figure 1H and Table 2).

[0128] Table 2 - Pharmacological activity of confirmed compounds that selectively remove P23H rhodopsin [Table 2]

[0129] Cheminformatics of nine mutant rhodopsin selective hits Among the nine hits, only two compounds (CL-002 and CL-004) had no previously known pharmacological activity. Four of them (CL-001, CL-006, CL-007, and CL-008) were pan-cyclin-dependent kinase inhibitors (Figure 1H). CL-003 has demonstrated activity in multiple assays targeting different proteins containing nucleotide-binding oligomerization domains, including NOD1, NOD2, huntingtin, tumor necrosis factor α, glycogen synthase kinase 3, and others, and may be a pan-assay interference compound that interacts nonselectively with many targets. CL-005 is an inhibitor of prolyl hydroxylases and a stabilizer of heat shock inducible factor 1α, with suggested activity in inducing hypoxic responses. CL-009, MTX, is an approved drug for the treatment of cancer and rheumatoid arthritis. However, the molecular mechanism of action by which these compounds mediate P23H rhodopsin clearance requires further investigation.

[0130] Effects of nine identified compounds on rhodopsin transcription and biodegradation To determine whether the effect of selective clearance of P23H rhodopsin was due to either a decrease in rhodopsin biosynthesis or an increase in its degradation, we investigated the effect of selective clearance of P23H rhodopsin in NIH3T3 (RHO) cells treated or not with each hit compound for 24 hours. P23H / GFP) and NIH3T3 (RHO WT qPCR and non-radioactive pulse-chase assays were performed in NIH3T3 (RHO / GFP) cells. qPCR showed that both WT and P23H rhodopsin transcripts were non-selectively reduced by CL-001, CL-002, CL-003, CL-004, CL-006, CL-007 and CL-008 compared to the DMSO control (Figure 3A). Surprisingly, CL-005 did not selectively reduce NIH3T3 (RHO) rhodopsin transcripts compared to the DMSO control (Figure 3B). P23H / GFP) and NIH3T3(RHO WT CL-009 / MTX increased rhodopsin transcripts two-fold in both WT and P23H rhodopsin (GFP) cells, whereas CL-009 / MTX had no effect on the transcription of both WT and P23H rhodopsin.

[0131] In a non-radioactive pulse-chase assay, we used NIH3T3 (RHO WT / GFP) and NIH3T3 (RHO P23H We transiently labeled nascent proteins for 4 hours by substituting AHA for methionine (Met) and an analog of Met with an azide group in the side chain in the medium of (GFP) cells, followed by adding Met to the medium and chasing for 24 hours. We attached BTN to the AHA-incorporated proteins via a "click" reaction and measured remaining AHA-labeled rhodopsin by immunoprecipitating cell lysates with 1D4 anti-rhodopsin antibody and dot blotting with SA (Figure 3B). We found that BTN-AHA-labeled P23H rhodopsin was significantly reduced by treatment with 10 μM CL-001, CL-002, CL-005, CL-007 and CL-009 (MTX) for 24 hours chase compared to DMSO control (Figure 3C and Figure 10). Pull-down levels of total P23H rhodopsin were reduced by all nine hits tested, confirming the previously verified activity (Figure 10F). This result suggests that only these five compounds (CL-001, CL-002, CL-005, CL-007, and CL-009 / MTX) accelerated the degradation of misfolded rhodopsin. Together, the results of the rhodopsin dot blot, qPCR, and pulse-chase assays (Table 3) showed that the hit compounds reduced P23H rhodopsin by 1) only reducing rhodopsin transcription (CL-003, CL-004, CL-006, and CL-008), 2) only increasing degradation (CL-005 and CL-009), or 3) both reducing transcription and increasing degradation of P23H rhodopsin (CL-001, CL-002, and CL-007). Because transcription of rhodopsin in stable cells is driven by the cytomegalovirus (CMV) promoter rather than the rhodopsin promoter, group 1) compounds may not affect P23H rhodopsin levels in vivo and were therefore not included for further investigation in this study. Only five compounds (CL-001, CL-002, CL-005, CL-007, and CL-009) remained for further study.

[0132] Table 3 - Effects of nine identified compounds on rhodopsin transcription and degradation

Table 3

[0133] Table 4 - Workflow of HTS and confirmatory assays performed for each compound library

Table 4

[0134] Activity of five compounds in the clearance of other misfolded rhodopsin mutants To determine whether these five confirmed compounds affect the clearance of other RP-causing rhodopsin mutants in vitro, we measured the protein levels of six rhodopsin mutants (T4R, P23H, P53R, C110Y, D190N and P237L, FIG. 8) stably expressed in U2OS cells that cause adRP when treated with these compounds. These class II mutants were previously reported to cause rhodopsin misfolding (www.hgmd.cf.ac.uk). The U2OS cells used herein were previously used to quantify the effect of small molecule chaperones in rescuing rhodopsin trafficking. Using immunofluorescence and high-content imaging to quantify the levels of rhodopsin, we found that none of the five compounds affected the cellular localization of rhodopsin mutants, but the immunofluorescence intensity of these rhodopsin mutants was reduced by CL-001, CL-002, CL-005, and CL-007 (Figure 3D and Figure 11). CL-009 (MTX) treatment alone showed a dose-dependent reduction in cells expressing P23H, C110Y, D190N, and P267L mutants, but not T4R and P53R mutants. The slightly different pharmacological activities of these compounds on P23H rhodopsin clearance in NIH3T3 (Figure 2A) and U2OS cells (Figure 3D) are due to differences in cell type and expression levels of P23H rhodopsin in the two stable cell lines. We then focused on CL-009(MTX) for mechanism of action and in vivo efficacy studies, as it is the only compound that accelerates mutant rhodopsin degradation without affecting transcription.

[0135] MTX-mediated P23H rhodopsin clearance via the lysosomal, but not the proteasomal, pathway Rhodopsin is degraded via both the proteasomal and lysosomal pathways. To determine which proteolytic pathway is involved in MTX-mediated P23H rhodopsin clearance, we cultured NIH3T3 (RHO)-derived rhodopsin-derived fibronectin (RHO) cells with either the ATPase inhibitor bafilomycin A1 (BafA1), which prevents lysosomal acidification and activity, or the proteasomal inhibitor MG-132, in addition to MTX. P23H / GFP) and NIH3T3 (RHO WT We treated NIH3T3 stable cells with MG-132+MTX and quantified P23H or WT rhodopsin levels in these cells by immunoblot. We found that only BafA1 treatment, but not MG-132 treatment, abolished MTX-induced P23H rhodopsin clearance, suggesting that the lysosomal pathway rather than the proteasomal pathway is involved in MTX-mediated P23H rhodopsin clearance (Figure 4A&B and Figure 12). Co-treatment of BafA1 and MTX also led to the accumulation of WT rhodopsin, whereas MG-132+MTX did not (Figure 4A&B), suggesting that both WT and P23H rhodopsin are primarily degraded via the lysosomal pathway in these NIH3T3 stable cells.

[0136] We repeated these treatments and quantified rhodopsin levels by immunofluorescence and high-content imaging (Figure 4C&D). We found that the average intensity of P23H rhodopsin immunostaining per cell was reduced in an MTX dose-dependent manner, was unaffected by the addition of MG-132, but was completely abolished by co-treatment with BafA1. This result confirmed the immunoblot data above, in which MTX selectively ameliorated the degradation of P23H rhodopsin via the lysosomal pathway.

[0137] The inventors further demonstrated that MTX treatment significantly inhibited the proliferation of NIH3T3(RHO P23H / GFP) and NIH3T3 (RHO WT We found that MTX did not affect chymotrypsin-like proteasome activity in GFP (GFP / GFP) cells (Figure 4E–G), confirming the conclusion that MTX does not affect the proteasome pathway.

[0138] MTX increased autophagic flux in vivo Autophagy is known to regulate the clearance of protein aggregates through lysosomal activity, and we therefore hypothesized that MTX treatment could be used to treat RhoA, a commonly used animal model of RP. P23H / + We investigated whether MTX affects autophagy in knock-in mice. On PND15, one eye received 25 pmol of MTX by IVI and the other eye received an equal volume of PBS as a vehicle control. To determine whether autophagic flux was affected by MTX, we immunoblotted LC3 and SQSTM1 / p62 in the retina 48 h after treatment (Figure 5). LC3-II is a lipidated form of LC3 that is incorporated into autophagosomes, and SQSTM1 / p62 is a known cargo of autophagic flux. Compared to PBS controls, MTX treatment led to a decrease in SQSTM1 / p62 levels (Figure 5B) and an increase in LC3-II (Figure 5C), suggesting that MTX increased autophagic flux in vivo.

[0139] One-time IVI of MTX was P23H / + Increased ERG responses and retinal rhodopsin levels in mice Rho P23H / + Mouse photoreceptors undergo a period of rapid degeneration from PND15 until 1 month of age, after which they die at a slower rate. P23H / + We tested the effect of MTX treatment on retinal function and structure during the early stages of retinal degeneration in mice. On PND15, these mice received 25 or 100 pmol MTX IVI into one eye and an equal volume of PBS as a vehicle control into the other eye, and dark-adapted and light-adapted full-field ERGs were recorded from these mice on PND32. These two doses were estimated based on the mouse eye volume and the effective concentration of MTX in vitro. 10 cd·s / m 2 Representative dark-adapted ERG responses in mice treated with 25 pmol of MTX. P23H / +The a-wave and b-wave of the mouse eyes were higher than those of the PBS and untreated groups (Figure 6A). Multi-flash dark-adapted ERG measurements showed that Rho P23H / + It was confirmed that both a-wave and b-wave in the Rho eyes treated with 25 pmol MTX were significantly higher than those in the PBS or untreated eyes, whereas the eyes treated with 100 pmol MTX showed no effect (Figure 6B & C). P23H / + The eyes also exhibited a higher photopic ERG response than PBS-treated or untreated eyes (Figure 6D), whereas 100 pmol MTX did not show any effect. The ratio of dark-adapted and light-adapted b-wave to a-wave amplitudes was not affected by MTX treatment, suggesting that the functional increase in b-wave with 25 pmol MTX was primarily due to increased photoreceptor function, but not an independently increased bipolar cell response (Figures 13A-B). The PBS-treated group had no difference in dark-adapted or light-adapted responses relative to the untreated group, suggesting that single IVI is safe and does not affect visual function.

[0140] To examine retinal structure and rhodopsin homeostasis, we immunostained retinal cryosections from these treated mice (euthanized on PND33) with anti-rhodopsin antibody to label the OS and Hoechst 33342 for nuclear staining. As previously reported, untreated Rho P23H / + The retina is Rho + / + Compared with the retina, the ONL showed a significantly shorter OS layer, reduced rhodopsin levels, approximately half the number of nuclei, disrupted rhodopsin homeostasis, and retinal degeneration was observed at 1 month of age. P23H / + This supported the findings in mice treated with 25 pmol of MTX (Fig. 6E-J & Q-R and Fig. 13C-D & 14). P23H / + The retina showed a significant increase in total rhodopsin levels and in rhodopsin in the OS compared to the PBS control in the upper but not the lower sections (Fig. 6K-Q and Fig. 13C-D & 14). MTX treatment increased Rho P23H / + No change in ONL nuclei number was observed on either side of the retina (Figure 6R), and a single IVI of 25 pmol MTX reduced the period of rapid retinal degeneration to Rho P23H / +These results suggest that the effect of PBS on the retinas may not be sufficient to protect mice. P23H / + There was no difference in total rhodopsin levels or localization, nor in ONL nuclei number, compared to the retina, confirming that a single IVI is safe and does not alter retinal morphology (Figures 6H-M&Q-R and Figures 13C-D). Combining the ERG and IHC results, we hypothesized that increased functional rhodopsin levels in the upper retina, not due to an increase in the number of rod photoreceptors, may be responsible for the Rho P23H / + It is concluded that a single IVI of 25 pmol MTX in the eye improved ERG responses.

[0141] Multiple IVI of MTX increases the Rho P23H / + Increased ERG responses, rhodopsin levels and photoreceptor cell numbers in mice We then restored rhodopsin homeostasis and upregulated Rho P23H / + We investigated whether multiple doses of MTX improved efficacy in preserving photoreceptors in mice (Figure 7). To this end, we administered Rho P23H / + After four weekly IVIs of MTX in mouse eyes, ERGs were recorded on PND44 and animals were euthanized on PND46 for IHC. Multi-flash dark-adapted and light-adapted b-waves in MTX-treated eyes were significantly increased compared to the PBS control group (Figure 7A-D). Rho P23H / + The photopic b-wave of the eye was also higher than the PBS group at higher flash intensities, although not as high as the 25 pmol MTX group (Figure 7D). ERG recordings showed that multiple IVI of MTX improved visual function compared to vehicle controls. However, weekly IVI of vehicle showed a decrease in both dark- and light-adapted responses compared to untreated controls (Figure 7A-D), suggesting that weekly IVI may have a role in improving Rho P23H / + This suggests that it may impair the visual function of mice.

[0142] Rho treated with four IVIs of 25 pmol MTX P23H / +IHC of the retina showed significantly higher levels of rhodopsin in the OS, lower levels of rhodopsin in the ONL, and higher number of nuclei in the ONL in the upper but not lower sides compared to the PBS group (Figure 7E-O and Figure 13E-F & 15D). The results suggested that four IVIs of 25 pmol MTX increased folded rhodopsin in the OS and reduced mislocalized rhodopsin in the ONL in the upper side of the retina, even though it could not distinguish between mutant and WT rhodopsin. Compared with one injection of 25 pmol MTX, four weekly IVIs of MTX showed higher efficacy in retinal protection, preserving more ONL nuclei number in the upper side compared to the PBS group, but not one MTX injection. However, four weekly IVIs of PBS reduced Rho in the upper side compared to the untreated control. P23H / + Side effects of multiple weekly IVI were confirmed, as seen in the ERG responses, with reduced total rhodopsin levels and lower nuclei in the ONL of the retina (Figure 7E-J and N-O). Future optimization of VI intervals or changes in treatment route are necessary for long-term MTX treatment.

[0143] Therapeutic strategies for RP at different stages vary depending on the number of surviving photoreceptors at the time of intervention. To restore vision in late RP, many efforts have been made on various techniques including stem cell therapy, optogenetics, and development of retinal prostheses to reconstruct visual responses in the retina where most photoreceptors are missing. A substantial breakthrough has been achieved in gene therapy to treat mainly autosomal recessive blindness, by local delivery of functional genes that are lost due to genetic mutations when the retinal structure is still largely preserved. Alternatively, gene delivery of neurotrophic factors by adeno-associated virus, such as ciliary neurotrophic factor and cone-rod derived neurotrophic factor, has shown protective effects in delaying rod and cone death, respectively, in animal models of RP. In complement to gene therapy, we are looking for pharmacological interventions that target early events in rods before they die, so that retinal structure and function can be preserved and vision can be maintained in the early or intermediate stages of RP. Specifically, we target adRP, where rod death is not due to gene dysfunction but rather due to the dominant-negative effect of mutant genes such as RHO. Therefore, the aim of this study is to develop preventive therapies targeting the early and intermediate stages of adRP caused by misfolded rhodopsin. Importantly, we discovered a novel activity of MTX, an FDA-approved drug, to upregulate the degradation of misfolded rhodopsin from early on in retinal degeneration in an animal model of RP, improving visual function and preserving retinal structure. Potentially, this misfolded protein degradation pathway upregulated by MTX may not be limited to the clearance of rhodopsin alone and could be applied to other misfolded protein-associated blindness, such as myocilin-associated primary open-angle glaucoma.

[0144] The molecular pathways regulating the protein homeostasis of G protein-coupled receptors are not well understood. By screening both novel and pharmacologically active small molecule compounds, we were able to explore chemical genetics and find the most relevant molecular pathways regulating rhodopsin homeostasis. Herein, in a HTS campaign of 68,979 small molecules, we identified five compounds that enhance the degradation of misfolded rhodopsin: CL-001 and CL-007 are pan-cyclin-dependent kinase inhibitors; CL-005 is a stabilizer of HIF1α; CL-009 (MTX) is an inhibitor of folate metabolism; and only CL-002 is an unknown chemical entity with no reported pharmacological activity. Although this study focused only on MTX for its mechanism of action and in vivo effects, exploring the potential role of CKD or other kinases in mediating the degradation of misfolded rhodopsin and the regulators of MIF1α could lead to an exciting future and a better understanding of membrane protein degradation.

[0145] MTX is water-soluble and has been administered intravitreally as an off-tag treatment for inflammatory eye diseases such as uveoretinitis. Therefore, we have demonstrated the novel activity of MTX in the selective clearance of P23H rhodopsin and its role in the regulation of Rho P23H / + Due to its retinal protective effect in mice, this drug with therapeutic potential can also be used to treat RHO-associated adRP.

[0146] MTX showed clear in vitro activity in the selective clearance of P23H rhodopsin. Therefore, after single or multiple IVI of MTX, Rho P23H / + It is counterintuitive to observe increased rhodopsin levels in the upper part of the mouse retina. Most of the rhodopsin immunostaining was in the MTX-treated Rho P23H / +On the OS of mouse retina (Figures 6 and 7), the increase in rhodopsin by MTX suggests that it is properly folded and transported to the target site. Considering the heterozygous background of the knock-in mice tested here and the inability of anti-rhodopsin antibodies to distinguish between WT and P23H rhodopsin, the activity of MTX in increasing folded rhodopsin levels in the OS may be due to the selective clearance of P23H rhodopsin in vivo. Indeed, the inventors have demonstrated that Rho P23H / + We observed increased autophagic flux after IVI of MTX in mice, suggesting that MTX may enhance the degradation of misfolded rhodopsin through the induction of autophagy. To test this hypothesis, we performed IVI of 25 pmol of MTX on PND15 to enhance the degradation of Rhodopsin. P23H / P23H The effect of MTX treatment on P23H rhodopsin levels in mice was determined, followed by retinal immunoblots at 24, 48 and 72 hours after treatment. P23H / P23H Low protein levels of P23H rhodopsin in mice (Rho + / + Due to approximately 200-fold less rhodopsin compared to retina) and high variability among individual animals, no consistent statistically significant differences in P23H rhodopsin were found with MTX treatment compared to PBS controls (not shown).

[0147] Although spatial differences in retinal degeneration are known in RP animal models and in RP patients, it is unclear why the inferior retina degenerates faster than the superior retina in RP. Interestingly, we found that only the superior retina expresses Rho P23H / + We observed repeated asymmetric efficacy of MTX treatment on the retina. This spatial difference in response to drug treatment has also been seen in IVI of neurotrophic factors on rodent models of RP. Differential gene expression or light exposure between the superior and inferior retina may contribute to the spatial sensitivity of MTX treatment.

[0148] The reason why MTX showed better retinal protection at 25 pmol than at 100 pmol requires further investigation. One possible explanation could be the cytotoxicity at higher doses of MTX, which may counteract its protective effect by removing misfolded rhodopsin. Retinal damage was observed in rabbits with intravitreal injection of 1.76 μmol MTX (a final concentration of about 1 mM in the vitreous, considering that the vitreous cavity of rabbits is about 1.5 mL). As the vitreous volume of mice is about 5.3 μL, 100 pmol MTX resulted in an initial vitreous concentration of 18.9 μM, while administration of 25 pmol MTX resulted in a vitreous concentration of about 4.7 μM (EC of MTX). 50 (The concentration of MTX in the retina was approximately 3.3 μM in vitro.) Although no obvious retinal degeneration was observed caused by 100 pmol of MTX, this result indicates that a thorough toxicity study of MTX is necessary in our future studies. Transcriptome analysis by RNA-seq is also an important future direction to understand the molecular pathways altered by MTX.

[0149] Our results showed that, compared with untreated controls, P23H / + We have demonstrated that IVI of sterile PBS four times a week in mice accelerated retinal degeneration, so caution should be exercised with multiple IVIs. However, retinas treated with four doses of MTX showed increased photoreceptor numbers compared to PBS controls, whereas a single injection of MTX did not have this effect, suggesting that a single injection is not sufficient for long-term retinal protection in RP. Optimized IVI intervals or the development of sustained-release formulations will be necessary in the future for long-term treatment with MTX to avoid side effects from IVI.

[0150] From the above description of the invention, those skilled in the art will recognize improvements, changes and modifications. Such improvements, changes and modifications within the scope of those skilled in the art are intended to be encompassed by the appended claims. All references, publications and patents cited herein are hereby incorporated by reference in their entirety.

Claims

1. A pharmaceutical composition for use in promoting the clearance of a misfolded ocular protein, comprising: 【Chemistry 1】 Pharmacably acceptable salts, tautomers, or solvates thereof, or combinations thereof; A pharmaceutical composition comprising a therapeutically effective amount of a compound selected from:

2. The compound is 【Chemistry 2】 Pharmacably acceptable salts, tautomers, or solvates thereof, or combinations thereof; The pharmaceutical composition of claim 1 , wherein the pharmaceutical composition is selected from the group consisting of

3. The composition, an inherited eye disorder associated with or caused by a misfolded ocular protein; or A non-syndromic retinal disorder associated with or caused by a misfolded ocular protein; or Non-syndromic autosomal dominant retinitis pigmentosa associated with or caused by misfolded ocular proteins; The pharmaceutical composition according to claim 1, which is used to treat

4. 2. The pharmaceutical composition of claim 1, wherein the misfolded ocular protein is a misfolded opsin.

5. 2. The pharmaceutical composition of claim 1, wherein the misfolded eye protein is a misfolded opsin protein comprising a mutation in its amino acid sequence.

6. 6. The pharmaceutical composition of claim 5, wherein the mutation is at least one of P23H, C110Y, D190N, T17M, P347S, or P267L.

7. 2. The pharmaceutical composition of claim 1, wherein the therapeutically effective amount is an amount effective to accelerate degradation of misfolded ocular proteins, improve ocular protein homeostasis, improve or preserve visual function, inhibit photoreceptor cell death, and / or improve or preserve retinal structure.

8. 10. The pharmaceutical composition of claim 1, wherein the compound is administered by at least one of local administration, systemic administration, intravitreal injection, and intraocular delivery.

Images