Conjugates and their uses

Abstract

The present invention relates to conjugates formed from cell-penetrating peptide carriers linked to therapeutic molecules, where the peptide carriers are defined by specific domains and the therapeutic molecules are nucleic acids in the form of trinucleotide repeats. The invention further relates to the use of such conjugates in therapy or as pharmaceuticals, particularly in the treatment of triplet repeat diseases, such as myotonic dystrophy (DM1).

Description

[Technical field]

[0001] The present invention relates to a complex of a peptide carrier and a therapeutic molecule, said peptide carrier being defined by a specific domain and the therapeutic molecule being a nucleic acid in the form of a trinucleotide repeat. The invention further relates to the use of such a complex in therapy or as a medicine, in particular in the treatment of triplet repeat diseases, such as myotonic dystrophy (DM1). [Background technology]

[0002] Nucleic acid therapeutics are genomic medicines that have the potential to transform human healthcare. Research has shown that such therapeutics have applications across a broad range of disease areas. In particular, the application of antisense oligonucleotide-based methods to modulate mRNA expression has become a desirable therapeutic tool at the forefront of precision medicine.

[0003] However, the development of these promising antisense therapeutics has been hindered by poor cell permeability and poor distribution properties.

[0004] Therefore, there is a strong and urgent need to improve the delivery of antisense oligonucleotides to provide more effective treatments for genetic diseases, such as the devastating triplet repeat diseases.

[0005] Triplet repeat disease is a genetic disease characterized by the presence of an abnormally large number of repeats of a specific sequence of three nucleotides in genomic DNA, also known as trinucleotide repeat expansion. Trinucleotide repeat expansion is a special type of microsatellite repeat, often also known as microsatellite expansion. Typically, in healthy subjects, there is a threshold number of repeats that are found, and when this number becomes excessive, the disease develops. The threshold number differs between diseases and disease genes. In these diseases, the number of repeats also typically represents the severity of the disease. In general, a higher number of repeats indicates a more severe condition of the disease. The number of repeats is also used to predict the age of onset of the disease, with a higher number of repeats indicating an early onset type.

[0006] Currently, 14 triplet repeat diseases that affect humans are known. These diseases are grouped in several ways, for example, by where the triplet repeat is located in the gene, whether it is in the protein coding ORF, in an exon, or in an untranslated region. Alternatively, the diseases are grouped by the sequence of the triplet repeat. In many triplet repeat diseases, the triplet repeat is "CAG", coding for glutamine, and this group of diseases is commonly known as polyglutamine diseases. However, triplet repeats with other sequences are also known and are grouped as non-polyglutamine repeat diseases.

[0007] One triplet repeat disease known as a non-glutamine repeat disease is myotonic dystrophy type 1 (DM1). DM1 is caused by a trinucleotide repeat of "CTG" present within the 3'UTR of the DMPK gene. The normal number of repeats for this gene is 5-34 repeats. Above 34 repeats, some signs of disease are present, and above 50 repeats, disease develops.

[0008] DM1 and other triplet repeat diseases typically affect the neuromuscular system and currently have no effective treatments.

[0009] Although the use of antisense oligonucleotides that can bind to repeat regions and disrupt splicing or translation has been theoretically proposed and demonstrated in vivo, the use of such antisense oligonucleotides as therapeutics has not been possible due to the difficulty in delivering these molecules to affected cells, which is the situation for a wide variety of genetic disorders, including triplet repeat diseases.

[0010] The use of viruses as delivery vehicles has been proposed, but their use is limited due to the immunotoxicity and potential carcinogenic effects of viral coat proteins. Alternatively, various non-viral delivery vectors have been developed, among which peptides have shown the greatest promise due to their small size, target specificity, and ability for transcapillary delivery of large biocargoes. Several peptides have been reported for their ability to penetrate cells or carry biocargoes.

[0011] In recent years, cell-penetrating peptides have been conjugated to antisense oligonucleotides (especially charge-neutral phosphorodiamidate morpholino oligomers (PMOs) and peptide nucleic acids (PNAs)) to enhance the cellular delivery of oligonucleotide analogs by effectively transporting them across the cell membrane and reaching their pre-mRNA target sites in the cell nucleus. It has been shown that PMO drugs conjugated to certain arginine-rich peptides (known as P-PMOs or peptide-PMOs) can effectively penetrate into appropriate cells.

[0012] In particular, PNA / PMO internalization peptides (Pips), arginine-rich CPPs consisting of two arginine-rich sequences separated by a short central hydrophobic sequence, have been developed. These "Pip" peptides were initially designed to improve serum stability while maintaining high levels of exon skipping by attachment to a PNA cargo. Furthermore, derivatives of these peptides were designated as conjugates of PMOs, which were shown to direct systemic skeletal muscle therapy (and importantly, the heart) in DMD models after systemic administration in mice.

[0013] Despite the effectiveness of these carriers, their therapeutic application has been hampered by their associated toxicity.

[0014] Other carrier peptides with a single arginine-rich domain, e.g., R6Gly, have also been generated and used to generate peptide conjugates with antisense oligonucleotides that have reduced toxicity, but these conjugates have shown reduced potency compared to the Pip peptide.

[0015] Moreover, almost all of the development of carrier peptides has been related to the treatment of DMD. Peptides with hydrophobic core domains have proven to be particularly active in the context of DMD. The use of such carrier peptides in other neuromuscular diseases with different causes and different pathologies has yet to be investigated.

[0016] Thus, currently available carrier peptides have not yet been demonstrated to be suitable for use in conjugates with nucleic acid therapeutic agents, particularly for the treatment of genetic diseases not caused by a distinct pathology, such as triplet repeat diseases. Summary of the Invention [Problem to be solved by the invention]

[0017] A challenge in the field of carrier peptide technology has been to separate efficacy from toxicity. The present inventors have identified, synthesized, and tested a novel conjugate comprising an improved carrier peptide with a specific structure covalently linked to a therapeutic nucleic acid for the treatment of triplet repeat diseases that addresses at least this challenge. [Means for solving the problem]

[0018] According to a first aspect of the present invention, there is provided a conjugate comprising a peptide carrier covalently attached to a therapeutic molecule, wherein the peptide carrier has an overall length of 40 amino acids or less and comprises two or more cationic domains (each comprising at least four amino acid residues) and one or more hydrophobic domains (each comprising at least three amino acid residues), wherein the peptide carrier does not contain any unnatural amino acid residues, and wherein the therapeutic molecule comprises a nucleic acid, the nucleic acid comprising a plurality of trinucleotide repeats.

[0019] According to a second aspect of the invention there is provided a conjugate according to the first aspect for use as a medicament.

[0020] According to a third aspect of the invention there is provided a method for treating a disease in a subject, said method comprising administering to the subject an effective amount of a conjugate according to the first aspect.

[0021] According to a fourth aspect of the present invention there is provided a conjugate according to the first aspect for use in the prevention or treatment of a triplet repeat disease.

[0022] According to a fifth aspect of the invention there is provided a method of preventing or treating a triplet repeat disease in a subject, said method comprising administering to the subject an effective amount of a conjugate according to the first aspect.

[0023] According to a sixth aspect of the present invention there is provided a pharmaceutical composition comprising a conjugate according to the first aspect.

[0024] In one embodiment of the second, third, fourth, or fifth aspect, the conjugate is formulated in a pharmaceutical composition. Further features and embodiments of the present invention are now described in the following section headings. Any feature may be combined with the above aspects or with other features in any compatible combination unless expressly noted otherwise. Individual features are not limited to any particular embodiment. The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described.

[0025] Throughout, "peptide carrier" refers to a peptide suitable for transporting a molecule attached thereto into a cell, i.e., a cell-penetrating peptide. The terms "cell-penetrating peptide" and "peptide carrier" and "peptide" are used interchangeably throughout.

[0026] Throughout, "X" refers to any form of the artificial, synthetically produced amino acid, aminohexanoic acid.

[0027] Throughout, "B" refers to the naturally occurring, but non-genetically encoded amino acid β-alanine.

[0028] Throughout, "Ac" denotes acetylation of the relevant peptide.

[0029] Throughout, "Hyp" refers to the naturally occurring, but non-genetically encoded amino acid hydroxyproline.

[0030] Throughout, other capital letters refer to the associated genetically encoded amino acid residue according to the accepted alphabetic amino acid code.

[0031] An "artificial" amino acid or residue herein means any amino acid that does not occur in nature, including synthetic amino acids, modified amino acids (e.g., sugar modified), non-natural amino acids, synthetic amino acids, spacers, and non-peptide bonded spacers. For the avoidance of doubt, aminohexanoic acid (X) is an artificial amino acid. For the avoidance of doubt, β-alanine (B) and hydroxyproline (Hyp) are natural and therefore, in the context of the present invention, natural amino acids rather than artificial amino acids. Artificial amino acids include, for example, 6-aminohexanoic acid (X), tetrahydroisoquinoline-3-carboxylic acid (TIC), 1-(amino)cyclohexanecarboxylic acid (Cy), and 3-azetidine-carboxylic acid (Az), 11-aminoundecanoic acid. Artificial amino acids include, for example, aminohexanoic acid (X).

[0032] By "cationic" herein is meant an amino acid or domain of amino acids that carries an overall negative charge at physiological pH.

[0033] By "arginine-rich" or "histidine-rich" is meant that at least 40% of the cationic domain consists of said residues.

[0034] As used herein, "hydrophobic" refers to an amino acid or domain of amino acids that repels water or does not mix with water. [Brief description of the drawings]

[0035] [Figure 1] Figure 1 shows the reduction in the number of pathogenic nuclear foci and MBNL redistribution in myoblasts from a DM1 patient with 2600 CTG repeats. The results show that 48 hours after transfection, various doses of the DPEP1 / 3-[CAG]7 PMO complexes did not reduce cell viability in myoblasts or hepatocytes (shown at 10 μM). [Diagram 2]Figures 2A, B, C, D, and E show that, compared with complexes formed with conventional peptide carriers Pip6a and Pip9b2, various DPEP1 / 3-[CAG]7 PMO complexes at various concentrations correct the splicing defect of Mbnl-dependent transcripts in DM1 patient myoblasts derived from a DM1 patient carrying 2600 repeats in the DMPK gene. [Diagram 3] Figures 3A, B, C, and D show that, compared with complexes formed with conventional peptide carriers Pip6a and Pip9b2, various DPEP1 / 3-[CAG]7 PMO complexes at various concentrations correct the splicing defect of Mbnl-dependent transcripts in DM1 patient myoblasts derived from a DM1 patient carrying 2600 repeats in the DMPK gene. [Figure 4] FIG. 4 shows that systemic delivery (IV, tail vein) of various DPEP1 / 3-[CAG]7 PMO complexes at 30 mg / kg corrects splicing defects of Mbnl-dependent transcripts in the gastrocnemius (gast.) and quadriceps (quad.) muscles of HSA-LR mice. RT-PCR analysis of splicing of clcn1 exon 7a, serca exon 22, and mbnl1 exon 5 (the most widely used DM1 biomarkers) shows normalization of splicing to wild-type levels for DPEP1 and 3-based complexes. Data from six HSA-LR mice per peptide-PMO compared to untreated HSA-LR mice were analyzed by analysis of variance (ANOVA) and Tukey post-hoc test. Data are mean ± SEM (*p<0.05, **p<0.01, ***p<0.001, ns: not significant). [Diagram 5] Figure 5 shows the viability of DM1 patient myoblasts with 2600 CTG repeats 48 hours after transfection with various doses of various DPEP1 / 3-[CAG]7 PMO complexes. The concentration of DPEP1 / 3-[CAG]7 PMO complexes is increased several-fold from therapeutic levels that do not cause cell death in myoblasts, compared to complexes formed with conventional peptide carriers: Pip6a and Pip9b2. [Figure 6]Figure 6 shows the viability of hepatocytes from a DM1 patient with 2600 CTG repeats 48 hours after transfection with various DPEP1 / 3-[CAG]7 PMO complexes and control complexes. The concentration of DPEP1 / 3-[CAG]7 PMO complexes is increased several-fold from therapeutic levels that do not cause cell death in hepatocytes, compared to complexes formed with conventional peptide carriers: Pip6a and Pip9b2. [Figure 7] Figure 7 shows electromyographic measurements of myotonia in the gastrocnemius muscle of HSA-LR mice 2 weeks after a single administration of various DPEP1 / 3-[CAG]7 PMO complexes (30 mg / kg, n=6, IV, tail vein). Data were analyzed by ANOVA and Tukey post-hoc test compared to untreated HSA-LR mice and comparison complexes with DPEP5.7. Data were analyzed by ANOVA and Tukey post-hoc test compared to untreated HSA-LR mice. Data are mean ± SEM (*p<0.05, **p<0.01, ***p<0.001, ns: not significant). [Figure 8] Figure 8 shows the corresponding myotonia grade measurements for the data in Figures 8 and 10 in HSA-LR mice 2 weeks after a single administration of various DPEP1 / 3-[CAG]7 PMO complexes (30 mg / kg, n=6, IV, tail vein). Data were analyzed by unpaired Student's t-test compared to untreated HSA-LR mice and control complexes with DPEP5.7. Data are means ± SEM. [Figure 9] Figure 9 shows electromyographic measurements of myotonia in the gastrocnemius muscle of HSA-LR mice 2 weeks after a single administration of various DPEP1 / 3-[CAG]7 PMO complexes (30 mg / kg, n=6, IV, tail vein). Data were analyzed by ANOVA and Tukey post-hoc test compared to untreated HSA-LR mice and comparison complexes with DPEP5.7. Data were analyzed by ANOVA and Tukey post-hoc test compared to untreated HSA-LR mice. Data are mean ± SEM (*p<0.05, **p<0.01, ***p<0.001, ns: not significant). [Figure 10] Figure 10 shows detailed data for each individual tested. Figure 10A, B, and C show ALP, ALT, and AST levels assessed in serum collected on day 7 post-injection from C57BL6 female mice (age 8-10 weeks, n=5 / group) administered a bolus IV (tail vein) injection of various DPEP1 / 3-[CAG]7 PMO conjugates compared to saline. ALP, ALT, and AST levels were similar to saline control injections compared to the doubling induced by a conventional Pip series of peptide carriers. [Figure 11] FIG. 11A shows KIM-1 levels assessed in serum and urine collected on day 2 and day 7 after injection of various DPEP1 / 3-[CAG]7 PMO complexes into C57BL6 female mice, measured by ELISA (R&D cat# MKM100) with samples diluted to fit within the standard curve. Values ​​were normalized to urinary creatinine levels to account for urinary protein concentration (Harwell). KIM-1 levels were similar to saline control injections compared to the fold increase induced by the conventional Pip series of peptide carriers. FIG. 11B and C show BUN and creatinine levels assessed in serum collected on day 7 after injection of various DPEP1 / 3-[CAG]7 PMO complexes into C57BL6 female mice (Harwell), compared to saline. BUN and creatinine levels were similar to saline control injections compared to the fold increase induced by the conventional Pip series of peptide carriers. [Figure 12] Figure 12 shows the ratio of KIM-1 / creatinine levels assessed in urine collected on days 2, 7, and 14 after administration of the DPEP1 / 3-[CAG]7 PMO complex by injection at 30 mg / kg to C57BL6 female mice compared to saline. Creatinine and KIM-1 levels were similar to saline control injections compared to the doubling induced by the conventional Pip series of peptide carriers. [Figure 13]Figure 13 shows the ratio of KIM-1 / creatinine levels assessed in urine collected on days 2 and 7 following administration of DPEP1 / 3-[CAG]7 PMO complex by injection at 5 mg / kg x 6 to C57BL6 female mice compared to saline. Creatinine and KIM-1 levels were similar to saline control injections compared to the doubling induced by the conventional Pip series of peptide carriers. [Figure 14] Figure 14A, B, C, and D show the levels of sodium, potassium, chloride, urea, creatinine, calcium, phosphorus, glucose, uric acid, magnesium, and protein in urine after injection of various DPEP1 / 3-[CAG]7 PMO conjugates at 5, 7.5, and 30 mg / kg in C57BL6 female mice (age 8-12 weeks, n=5 / group) compared to saline. Error bars indicate SEM. [Figure 15] Figure 15 shows the body weight of HSA-LR mice after DPEP3.8-[CAG]7 PMO complex treatment. The long-term body weight of five HSA-LR mice injected with a single dose of 30 mg / kg did not show any significant decrease when compared to five HSA-LR mice injected with saline. [Figure 16] FIG. 16 shows biodistribution delivery analysis of various DPEP1 / 3-[CAG]7 PMO conjugates measured by ELISA 2 weeks after administration of 30 mg / kg conjugate or 3×200 mg / kg neat PMO in HSA-LR mice (IV). Biodistribution evaluation of DPEP1.9 and DPEP3.8 conjugates revealed optimal delivery to clinically affected tissues in DM1. PMO was detected by a custom ELISA assay using digoxigenin and biotin labeled probes. After 2 weeks of treatment, the concentration of PMO in muscle tissue was still >1 nM, whereas low pM was detected after injection of neat PMO (despite a >20-fold difference in molar concentration of neat PMO treatment versus DPEP-PMO conjugate treatment) (n=4). Data are presented as mean±SEM. Statistics: One-way ANOVA with Tukey post-hoc test. [Figure 17] Figure 17 shows the pharmacokinetic properties of various DPEP1 / 3-[CAG]7 PMO conjugates measured in serum after administration of a single dose at 5 mg / kg. Concentrations in serum were quantified using a custom ELISA, reaching 500-800 nM 5 minutes after IV injection at 5 mg / kg, decreasing to 100 nM at 1 hour and 10 nM at 3 hours. At 6 hours post-treatment, concentrations were ∼1 nM, and much of the compound had already been cleared or delivered to the tissue of interest. [Figure 18] Figure 18A, B, C, and D show in more detail that systemic delivery of various DPEP1 / 3-[CAG]7 PMO complexes corrects splicing defects of Mbnl-dependent transcripts in the splenogastric muscle of HSA-LR mice. RT-PCR analysis of splicing of Clcn1 exon 7a, Serca exon 22, Mbnl1 exon 5, and Ldb3 exon 11 showed that 30 and 40 mg / kg of DPEP1.9- and DPEP3.8-based complexes normalized splicing to wild-type levels. Correction of splicing persisted for at least 3 months after treatment and was significant even after a single low dose (5 and 7.5 mg / kg) (boxes indicate distribution of data into quartiles; mean values ​​are highlighted; error bars indicate variability outside the upper and lower quartiles; n=5 / group). [Figure 19] Figure 19A, B, and C show that after administration of a single dose of 30 or 40 mg / kg of DPEP3.8-based and DPEP1.9-based complexes, the grade of myotonia in HSA-LR mice is corrected to wild-type levels (from 4 to 0). This correction persists for at least 3 months after treatment (A). When the dose is administered in four injections (4 x 7.5 mg / kg), myotonia is reduced to 50% (B), whereas when the dose is reduced to 4 x 5 mg / kg, a reduction of 20-25% occurs 2 weeks after the last injection (C) (error bars indicate SEM); (n=6, IV, tail vein). [Figure 20]Figure 20 shows the serum and urine toxicity screening of various DPEP1 / 3-[CAG]7 PMO complexes in HSA-LR mice (age: 8-12 weeks, n=5 / group) at 2 days and 1 week after IV administration, and the results showed that there were no significant changes at doses that could normalize the phenotype of HSA-LR mice. Significant changes were observed in KIM1 levels compared to saline-treated HSA-LR mice only after treatment with DPEP1.9, DPEP3.8, DPEP3.1, and DPEP3.1b at 30 mg / kg or 40 mg / kg, and only on the second day after treatment (error bars indicate SEM). [Figure 21] 21 shows the correction of the DM1 phenotype (myotonia) in HSA-LR mice over a period of several weeks following the first administration of various dosing regimens including four doses of DPEP3.8-[CAG]7 PMO complex at a dose of 5 mg / kg, four doses of DPEP3.8-[CAG]7 PMO complex at a dose of 7.5 mg / kg, a single dose of DPEP3.8-[CAG]7 PMO complex at a dose of 7.5 mg / kg, a single dose of DPEP3.8-[CAG]7 PMO complex at a dose of 30 mg / kg, or a single dose of DPEP3.8-[CAG]7 PMO complex at a dose of 40 mg / kg. Reduction of myotonia is achieved following treatment with low doses (5-7.5 mg / kg) of DPEP3.8-[CAG]7 PMO complex that are not associated with any toxicity. [Figure 22] 22 shows the correction of DM1 phenotype (myotonia) in HSA-LR mice over a period of several weeks following the first dose of various dosing regimens including four doses of DPEP1.9-[CAG]7 PMO complex at a dose of 5 mg / kg, four doses of DPEP1.9-[CAG]7 PMO complex at a dose of 7.5 mg / kg, a single dose of DPEP1.9-[CAG]7 PMO complex at a dose of 7.5 mg / kg, or a single dose of DPEP1.9-[CAG]7 PMO complex at a dose of 40 mg / kg. Reduction of myotonia is achieved following treatment with low doses (5-7.5 mg / kg) of DPEP1.9-[CAG]7 PMO complex that are not associated with any toxicity. [Figure 23]Figure 23 shows the PMO concentrations (pM) in various tissues 2 weeks after IV administration of neat PMO (200 mg / kg dose x 3), DPEP3.8-[CAG]7 PMO complex at 30 mg / kg, DPEP3.8b-[CAG]7 PMO complex at 30 mg / kg, DPEP3.8-[CAG]7 PMO complex at 7.5 mg / kg, and DPEP3.8-[CAG]7 PMO complex at 40 mg / kg to HSA-LR mice. Both peptides (DPEP3.8 and DPEP3.8b) were able to successfully deliver PMO to muscle, reaching concentrations of >6 nM in skeletal muscle. [Figure 24] Figure 24 shows the PMO concentrations (pM) in various tissues after 2 weeks IV administration to HSA-LR mice of neat PMO (200 mg / kg dose x 3), DPEP1.9-[CAG]7 PMO complex 30 mg / kg, DPEP1.9b-[CAG]7 PMO complex 30 mg / kg, DPEP1.9-[CAG]7 PMO complex 7.5 mg / kg, and DPEP1.9-[CAG]7 PMO complex 40 mg / kg. Both peptides (DPEP1.9 and DPEP1.9b) can successfully deliver PMO to muscle. DPEP1.9b-[CAG]7 PMO reaches the diaphragm particularly well (>15 nM 2 weeks after a single IV injection of 30 mg / kg). [Diagram 25] Figure 25 shows the PMO concentrations (pM) in various tissues 2 weeks after IV administration of neat PMO (200 mg / kg dose x 3), DPEP3.1-[CAG]7 PMO complex at 30 mg / kg, DPEP3.1a-[CAG]7 PMO complex at 30 mg / kg, and DPEP3.1b-[CAG]7 PMO complex at 30 mg / kg to HSA-LR mice. Three peptides (DPEP3.1, DPEP3.1a, and DPEP3.1b) were able to deliver PMO to both skeletal and cardiac muscle (>1 nM). [Figure 26]Figure 26 shows a toxicology screen of KIM-1 on creatinine levels measured in urine at various time points after systemic IV administration of various peptide-[CAG]7 PMO complexes of the present invention at different doses to HSA-LR mice compared to saline. The DPEP peptide-[CAG]7 PMO complexes of the present invention retain low toxicity even at higher doses, especially compared to the Pip6a-[CAG]7 PMO complex. The DPEP complexes do not affect toxicity biomarkers when using a dose regimen that can reverse the DM1 phenotype to healthy levels. [Figure 27] Figure 27 shows a toxicology screen of KIM-1 on creatinine levels measured in urine at various time points after systemic IV administration of DPEP3.8 of the present invention to HSA-LR mice at different doses, compared to plain [CAG]7 PMO and Pip peptide-[CAG]7 PMO. The DPEP peptide-[CAG]7 PMO complex of the present invention retains low toxicity at higher doses, especially compared to the Pip6a-[CAG]7 PMO complex. The DPEP complex does not affect toxicity biomarkers when using a dose regimen that can reverse the DM1 phenotype to healthy levels. [Figure 28] Figure 28 shows a toxicology screen of KIM-1 relative to creatinine levels measured in urine at various time points after systemic IV administration of DPEP1.9 of the present invention to HSA-LR mice at different doses, compared to Pip peptide-[CAG]7 PMO. The DPEP peptide-[CAG]7 PMO complex of the present invention maintains low toxicity at higher doses, especially compared to Pip6a-[CAG]7 PMO complex. The DPEP complex does not affect toxicity biomarkers when using a dose regimen that can reverse the DM1 phenotype to healthy levels. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0036] The present invention is based on the finding that by attaching a special peptide carrier to a nucleic acid suitable for the prevention and treatment of triplet repeat diseases, the nucleic acid is able to effectively penetrate and bind to the target cell and target the trinucleotide repeat expansion present in the gene of the affected subject. This activity reduces the level of the repeat expansion transcript and / or protein present in the cell, thereby blocking the pathological interaction with the cellular splicing machinery, normalizing splicing and improving the physiological condition of said subject.

[0037] Advantageously, the peptide carriers described herein appear to increase the ability of therapeutic nucleic acids to resist degradation, penetrate target cells, reach target trinucleotide repeat expansions, and provide therapy. Furthermore, the complexes of the present invention have significantly lower toxicity than complexes formed with known peptide carriers. Thus, the complexes provide an effective means of delivery of nucleic acid therapeutics for triplet repeat diseases while remaining non-toxic to the subject.

[0038] The inventors believe that this is the first time that any peptide carrier with a hydrophobic core has been shown to be effective in treating a neuromuscular disease other than DMD. Previous studies have focused on using peptide carriers for the delivery of therapeutic agents to treat DMD. Compared to the pathology of triplet repeat diseases, the pathology of DMD is quite different. In particular, DMD involves active muscle degeneration including inflammation and muscle replacement and repair, whereas triplet repeat diseases, such as myotonic dystrophy type 1 (DM1), involve muscle dysfunction without obvious degeneration. The inventors believe that peptide carriers interact with muscle membrane to enable effective delivery of therapeutic molecules, and therefore the type of membrane they interact with is very different between degenerative and non-degenerative muscles, i.e., between DMD and triplet repeat diseases. Contrary to degenerative diseases, such as DMD, in DM1, the muscle membrane is not destroyed, and therefore it was expected that penetration of the complex into muscle tissue would be inhibited and very difficult to achieve. However, based on the data reported here, a peptide carrier has not only been shown for the first time to be effective in delivery to non-degenerative muscles to treat DM1, but also, unexpectedly, to work more effectively for DM1 than for DMD.

[0039] The data presented herein show that the complexes of the present invention maintain good levels of potency and delivery to key target tissues affected by triplet repeat diseases, such as the splenogastrocnemius and quadriceps skeletal muscle. Moreover, these complexes show improved potency compared to previously available carrier peptides when using the same complexes. The complexes of the present invention target the mutant CUG expansion-DMPK transcripts to prevent the formation of nuclear foci, thereby preventing the deleterious sequestration of MBNL1 splicing factors by nuclear RNA foci, thereby mitigating the functional loss of MBNL1, which is responsible for a variety of gene and muscle dysfunctions.

[0040] This is evidenced here by a reduction in the number of nuclear foci formed by DMPK transcripts containing the expansion after administration of the complex of the invention, and by correction of splicing of genes (genes typically misspliced ​​in DM1 due to reduced availability of MBNL1 sequestered by trinucleotide repeat expansion transcripts) after administration of the complex of the invention. Specifically, the complex demonstrated here shows 50-90% splicing correction relative to healthy controls excluding clicn1 exon 7a and mblnl1 exon 5 and including serca exon 22 compared to untreated cells / subjects. This is further evidenced by an improvement in the physiological state of triplet repeat disease, as shown in the DM1 model (muscle tone in mice is normalized and corrected to full recovery even after a single injection of the complex described here).

[0041] Surprisingly, the inventors found that the peptide carriers used in the complexes effectively deliver therapeutic molecules to the nuclear fraction and to intranuclear aggregates of DMPK transcripts at concentrations sufficient to allow favorable stoichiometric interaction with the CUG mutations.

[0042] At the same time, the complexes of the present invention act effectively in vivo, showing reduced clinical signs and low toxicity following systemic injection, as observed via the measurement of biochemical markers. Importantly, the complexes of the present invention have been shown to show surprisingly reduced toxicity following similar systemic injection into mice, as compared to conventional carrier peptides in the same complexes. As demonstrated herein, the complexes of the present invention do not produce any significant increase in toxicity markers and maintain cell viability compared to a therapeutically relevant dose of saline, whereas complexes using conventional peptide carriers show significant cell death. When the complexes are administered to mice, the mice show a much faster rapid recovery time than after administration of complexes formed with previously available peptides.

[0043] Thus, the conjugates of the invention offer improved suitability for use as safe and effective therapeutics for triplet repeat diseases in humans, providing an avenue for the treatment of these otherwise untreatable serious diseases.

[0044] Artificial amino acids The present invention relates to conjugates comprising carrier peptides with specific structures, in which no artificial amino acid residues are present. Preferably the peptide does not contain any aminohexanoic acid residues. Preferably the peptide does not contain any form of aminohexanoic acid residues. Preferably the peptide does not contain any 6-aminohexanoic acid residues. Suitably, the peptide contains only, and therefore consists of, naturally occurring amino acid residues. Preferably, an artificial amino acid commonly used in cell-penetrating peptides, such as 6-aminohexanoic acid, is replaced by a natural amino acid. Preferably, an artificial amino acid commonly used in cell-penetrating peptides, such as 6-aminohexanoic acid, is replaced by a natural amino acid selected from β-alanine, serine, proline, arginine, and histidine or hydroxyproline. In one embodiment, aminohexanoic acid is replaced by β-alanine. Preferably, 6-aminohexanoic acid is replaced by β-alanine. In one embodiment, aminohexanoic acid is replaced by histidine. Preferably, 6-aminohexanoic acid is replaced by histidine. In one embodiment, aminohexanoic acid is replaced by hydroxyproline. Preferably, 6-aminohexanoic acid is replaced by hydroxyproline. Preferably, the artificial amino acids commonly used in cell-penetrating peptides, such as 6-aminohexanoic acid, are replaced by natural amino acids. Preferably, the artificial amino acids commonly used in cell-penetrating peptides, such as 6-aminohexanoic acid, are replaced by any combination of β-alanine, serine, proline, arginine, and histidine or hydroxyproline, preferably any combination of β-alanine, histidine, and hydroxyproline. In one embodiment, the peptide carrier has an overall length of 40 amino acid residues or less and the peptide comprises two or more cationic domains, each comprising at least four amino acid residues; and one or more hydrophobic domains, each comprising at least three amino acid residues wherein at least one of the cationic domains comprises a histidine residue. Preferably, at least one cationic domain is histidine-rich. Suitably, the meaning of "histidine-rich" is as defined for the cationic domain.

[0045] Cationic Domain The present invention relates to a complex comprising a short peptide carrier with a specific structure in which there are at least two cationic domains with specific lengths.

[0046] Suitably, the peptide comprises no more than four cationic domains, no more than three cationic domains.

[0047] Suitably, the peptide comprises two cationic domains.

[0048] As defined above, the peptide comprises two or more cationic domains, each having a length of at least four amino acid residues.

[0049] Preferably, each cationic domain has a length of from 4 to 12 amino acid residues, preferably from 4 to 7 amino acid residues.

[0050] Suitably, each cationic domain has a length of 4, 5, 6 or 7 amino acid residues.

[0051] Preferably, each cationic domain is of similar length, and preferably the cationic domains are the same length.

[0052] Suitably, each cationic domain comprises cationic amino acids and may also contain polar or non-polar amino acids.

[0053] The non-polar amino acids are selected from alanine, β-alanine, proline, glycine, cysteine, valine, leucine, isoleucine, methionine, tryptophan, and phenylalanine. Preferably, the non-polar amino acids are uncharged.

[0054] The polar amino acids are selected from serine, asparagine, hydroxyproline, histidine, arginine, threonine, tyrosine, and glutamine. Preferably, the polar amino acids selected do not carry a negative charge.

[0055] The cationic amino acid is selected from arginine, histidine, and lysine. Preferably, the cationic amino acid has a positive charge at physiological pH.

[0056] Preferably, each amino acid does not include an anionic or negatively charged amino acid residue.

[0057] Suitably, each cationic domain comprises residues of arginine, histidine, β-alanine, hydroxyproline and / or serine.

[0058] Suitably, each cationic domain consists of arginine, histidine, β-alanine, hydroxyproline and / or serine residues.

[0059] Suitably, each cationic domain comprises at least 40%, at least 45%, at least 50% cationic amino acids.

[0060] Preferably, each cationic domain comprises a majority of cationic amino acids, preferably at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% cationic amino acids.

[0061] Suitably, each cationic domain has an isoelectric point (pI) of at least 7.5, at least 8.0, at least 8.5, at least 9.0, at least 9.5, at least 10.0, at least 10.5, at least 11.0, at least 11.5, at least 12.0.

[0062] Suitably, each cationic domain has an isoelectric point (pI) of at least 10.0.

[0063] Preferably, each cationic domain has an isoelectric point (pI) of 10.0 to 13.0.

[0064] In one embodiment, each cationic domain has an isoelectric point (pI) between 10.4 and 12.5.

[0065] Preferably, the isoelectric point of the cationic domain is calculated at physiological pH by any suitable means available in the art, preferably by using the IPC (www.isoelectric.org) web-based algorithm developed by Lukasz Kozlowski (Biol Direct. 2016; 11: 55. DOI: 10.1186 / s13062-016-0159-9 a).

[0066] Suitably, each cationic domain comprises at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70% arginine and / or histidine residues.

[0067] Suitably, each cationic domain comprises at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70% arginine residues.

[0068] Suitably, each cationic domain comprises at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70% histidine residues.

[0069] Preferably, the cationic domain may comprise 1 to 5 histidine residues and 1 to 5 arginine residues. Preferably, the cationic domain may comprise 1 to 5 arginine residues. Preferably, the cationic domain may comprise 1 to 5 histidine residues. Preferably, the cationic domain may comprise a total of 2 to 5 histidine residues and 3 to 5 arginine residues. Preferably, the cationic domain may comprise 3 to 5 arginine residues. Preferably, the cationic domain may comprise 2 to 5 histidine residues.

[0070] Preferably, each cationic domain comprises one or more β-alanine residues. Preferably, each cationic domain comprises a total of 2 to 5 β-alanine residues, preferably a total of 2 or 3 β-alanine residues.

[0071] Suitably, the cationic domain may comprise one or more hydroxyproline or serine residues.

[0072] Suitably, the cationic domain may comprise 1 to 2 hydroxyproline residues.

[0073] Suitably, the cationic domain may comprise 1 to 2 serine residues.

[0074] Preferably, all of the cationic amino acids in a given cationic domain are histidines, or, preferably, all of the cationic amino acids in a given cationic domain are arginines.

[0075] Preferably, the peptide comprises at least one histidine-rich cationic domain.Preferably, the peptide comprises at least one arginine-rich cationic domain.

[0076] Suitably, the peptide may comprise at least one arginine-rich cationic domain and at least one histidine-rich cationic domain.

[0077] In one embodiment, the peptide comprises two arginine-rich cationic domains.

[0078] In one embodiment, the peptide comprises two histidine-rich cationic domains.

[0079] In one embodiment, the peptide comprises two arginine-rich cationic domains and a histidine-rich cationic domain.

[0080] In one embodiment, the peptide comprises one arginine-rich cationic domain and one histidine-rich cationic domain.

[0081] Preferably, each cationic domain comprises no more than 3 adjacent arginine residues, preferably no more than 2 adjacent arginine residues.

[0082] Preferably, each cationic domain does not contain adjacent histidine residues.

[0083] Preferably, each cationic domain comprises arginine, histidine and / or β-alanine residues. Preferably, each cationic domain comprises a majority of arginine, histidine and / or β-alanine residues. Preferably, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100% of the amino acid residues in each cationic domain are arginine, histidine and / or β-alanine residues.

[0084] In one embodiment, the peptide comprises a first cationic domain comprising an arginine residue and a β-alanine residue, and a second cationic domain comprising an arginine residue and a β-alanine residue.

[0085] In one embodiment, the peptide comprises a first cationic domain comprising an arginine residue and a β-alanine residue, and a second cationic domain comprising a histidine residue, a β-alanine residue, and optionally an arginine residue.

[0086] In one embodiment, the peptide comprises a first cationic domain consisting of an arginine residue and a β-alanine residue, and a second cationic domain consisting of a histidine residue and a β-alanine residue.

[0087] In one embodiment, the peptide comprises a first cationic domain consisting of arginine and β-alanine residues, and a second cationic domain consisting of arginine and β-alanine residues.

[0088] In one embodiment, the peptide comprises a first cationic domain consisting of arginine and β-alanine residues, and a second cationic domain consisting of arginine, histidine, and β-alanine residues.

[0089] Preferably, the peptide comprises at least two cationic domains, preferably these cationic domains form arms of the peptide. Preferably, the cationic domains are located at the N- and C-termini of the peptide. Therefore, preferably, the cationic domains are known as cationic arm domains.

[0090] In one embodiment, the peptide comprises two cationic domains, one located at the N-terminus of the peptide and one located at the C-terminus of the peptide. Preferably at either terminus of the peptide. Preferably, there are no further amino acids or domains at the N-terminus and C-terminus of the peptide, except for other groups, e.g. terminal modification groups, linkers, and / or therapeutic molecules. For the avoidance of doubt, such other groups may be present in addition to the "peptide" as described herein. Thus, preferably, each cationic domain forms a terminus of the peptide. Preferably, this does not preclude the presence of further linker groups, as described herein.

[0091] Suitably, the peptide may comprise up to 4 cationic domains. Suitably, the peptide comprises 2 cationic domains.

[0092] In one embodiment, the peptide comprises two cationic domains that are both arginine-rich.

[0093] In one embodiment, the peptide comprises one cationic domain that is arginine-rich. So it is.

[0094] In one embodiment, the peptide comprises two cationic domains, one that is arginine-rich and one that is histidine-rich.

[0095] In one embodiment, the peptide comprises one cationic domain that is arginine-rich and one cationic domain that is histidine-rich.

[0096] Suitably, the cationic domain comprises amino acid units selected from among R, H, B, RR, HH, BB, RH, HR, RB, BR, HB, BH, RBR, RBB, BRR, BBR, BRB, RBH, RHB, HRB, BRH, HRR, RRH, HRH, HBB, BBH, RHR, BHB, HBH, or any combination thereof.

[0097] Suitably, the cationic domain may also comprise serine, proline and / or hydroxyproline residues. Suitably, the cationic domain may further comprise an amino acid unit selected from RP, PR, RPR, RRP, PRR, PRP, Hyp;R[Hyp]R, RR[Hyp], [Hyp]RR, [Hyp]R[Hyp], [Hyp][Hyp]R, R[Hyp][Hyp], SB, BS, or any combination thereof, or any combination with the above mentioned amino acid units.

[0098] Suitably, each cationic domain comprises any of the following sequences; RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRR (SEQ ID NO:3), RBRRBR (SEQ ID NO:4), RRBRBR (SEQ ID NO:5), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9), RBRHBHR (SEQ ID NO:10), RBRBBHR (SEQ ID NO:11), RBRRBH (SEQ ID NO:12), HBRRBR (SEQ ID NO:13), HBHBH (SEQ ID NO:14), BHBH (SEQ ID NO:15), BRBSB (SEQ ID NO:16), BRB[Hyp]B (SEQ ID NO:17), R[Hyp]H[Hyp]HB (SEQ ID NO:18), R[Hyp]RR[Hyp]R (SEQ ID NO:19), or any combination thereof.

[0099] Suitably, each cationic domain consists of any of the following sequences: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRR (SEQ ID NO:3), RBRRBR (SEQ ID NO:4), RRBRBR (SEQ ID NO:5), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9), RBRHBHR (SEQ ID NO:10), RBRBBHR (SEQ ID NO:11), RBRRBH (SEQ ID NO:12), HBRRBR (SEQ ID NO:13), HBHBH (SEQ ID NO:14), BHBH (SEQ ID NO:15), BRBSB (SEQ ID NO:16), BRB[Hyp]B, R[Hyp]H[Hyp]HB, R[Hyp]RR[Hyp]R (SEQ ID NO:19), or any combination thereof.

[0100] Suitably, each cationic domain consists of one of the following sequences; RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRRBR (SEQ ID NO:4), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9).

[0101] Preferably, each cationic domain in the peptide is the same or different. Preferably, each cationic domain in the peptide is different.

[0102] Hydrophobic domain The present invention relates to a complex comprising a short peptide carrier with a specific structure in which there is at least one hydrophobic domain with a specific length.

[0103] Suitably the peptide comprises no more than 3 hydrophobic domains, no more than 2 hydrophobic domains.

[0104] Suitably, the peptide comprises one hydrophobic domain.

[0105] As defined above, a peptide comprises one or more hydrophobic domains, each having a length of at least three amino acid residues.

[0106] Preferably, each cationic domain has a length of 3 to 6 amino acids. Preferably, each hydrophobic domain has a length of 5 amino acids.

[0107] Preferably, each hydrophobic domain may comprise non-polar, polar and hydrophobic amino acid residues.

[0108] The hydrophobic amino acid residues are selected from alanine, valine, leucine, isoleucine, phenylalanine, tyrosine, methionine, and tryptophan.

[0109] The non-polar amino acid residue is selected from proline, glycine, cysteine, alanine, valine, leucine, isoleucine, tryptophan, phenylalanine, and methionine.

[0110] The polar amino acid residue is selected from serine, asparagine, hydroxyproline, histidine, arginine, threonine, tyrosine, and glutamine.

[0111] Preferably, the hydrophobic domain does not contain any hydrophilic amino acid residues.

[0112] Preferably, each hydrophobic domain comprises a majority of hydrophobic amino acid residues. Preferably, each hydrophobic domain comprises at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100% hydrophobic amino acid residues. Preferably, each hydrophobic domain consists of hydrophobic amino acid residues.

[0113] Suitably, each hydrophobic domain has a hydrophobicity of at least 0.3, at least 0.4, at least 0.5, at least 0.6, at least 0.7, at least 0.8, at least 0.8, at least 1.0, at least 1.1, at least 1.2, at least 1.3.

[0114] Suitably, each hydrophobic domain has a hydrophobicity of at least 0.3, at least 0.35, at least 0.4, at least 0.45.

[0115] Suitably, each hydrophobic domain has a hydrophobicity of at least 1.2, at least 1.25, at least 1.3, at least 1.35.

[0116] Preferably, each hydrophobic domain has a hydrophobicity of 0.4 to 1.4.

[0117] In one embodiment, each hydrophobic domain has a hydrophobicity between 0.45 and 0.48. In one embodiment, each hydrophobic domain has a hydrophobicity between 1.27 and 1.39.

[0118] Preferably, hydrophobicity is measured by White and Wimley: WC Wimley and SH White, "Experimentally determined hydrophobicity scale for proteins at membrane interfaces," Nature Struct Biol 3: 842 (1996).

[0119] Suitably, each hydrophobic domain comprises at least three, at least four hydrophobic amino acid residues.

[0120] Preferably, each hydrophobic domain comprises phenylalanine, leucine, isoleucine, tyrosine, tryptophan, proline and glutamine residues.Preferably, each hydrophobic domain consists of phenylalanine, leucine, isoleucine, tyrosine, tryptophan, proline and / or glutamine residues.

[0121] In one embodiment, each hydrophobic domain consists of phenylalanine, leucine, isoleucine, tyrosine, and / or glutamine residues.

[0122] In one embodiment, each hydrophobic domain consists of tryptophan and / or proline residues.

[0123] Suitably the peptide comprises one hydrophobic domain. Suitably the, or each hydrophobic domain is located in the centre of the peptide. Suitably the hydrophobic domain is therefore known as the core hydrophobic domain. Suitably the, or each hydrophobic domain is flanked on either side by arm domains. Suitably the arm domain may comprise one or more cationic domains and further one or more hydrophobic domains. Suitably each arm domain comprises a cationic domain.

[0124] In one embodiment, the peptide comprises two arms flanking a core hydrophobic domain, with each arm domain comprising a cationic domain.

[0125] In one embodiment, the peptide consists of two arms flanking a core hydrophobic domain.

[0126] Suitably, the or each hydrophobic domain comprises one of the following sequences: YQFLI (SEQ ID NO:20), FQILY (SEQ ID NO:21), ILFQY (SEQ ID NO:22), FQIY (SEQ ID NO:23), WWW, WWPWW (SEQ ID NO:24), WPWW (SEQ ID NO:25), WWPW (SEQ ID NO:26), or any combination thereof.

[0127] Suitably, the or each hydrophobic domain consists of one of the following sequences: YQFLI (SEQ ID NO:20), FQILY (SEQ ID NO:21), ILFQY (SEQ ID NO:22), FQIY (SEQ ID NO:23), WWW, WWPWW (SEQ ID NO:24), WPWW (SEQ ID NO:25), WWPW (SEQ ID NO:26), or any combination thereof.

[0128] Suitably the, or each, hydrophobic domain consists of one of the following sequences: FQILY (SEQ ID NO: 21), WWW, WWPWW (SEQ ID NO: 24).

[0129] Suitably the or each hydrophobic domain consists of FQILY (SEQ ID NO: 21).

[0130] Suitably, each hydrophobic domain may have the same sequence or different sequences.

[0131] Peptide Carrier The present invention relates to conjugates comprising peptide carriers for use in the delivery of therapeutic molecules made of trinucleotide repeats in the treatment of medical conditions.

[0132] A peptide has a sequence which is a contiguous single molecule, therefore the domains of the peptide are contiguous. Preferably, the peptide comprises several domains linearly arranged between the N-terminus and the C-terminus. Preferably, the domains are selected from the cationic and hydrophobic domains described above. Preferably, the peptide consists of a cationic domain and a hydrophobic domain (domains as defined above).

[0133] Each domain has common sequence features as described in the appropriate section above, however, the exact sequence of each domain can be varied and modified. Thus, a variety of sequences are possible for each domain. Combinations of each possible domain sequence result in a variety of peptide structures, each of which forms part of the present invention. Structural features of the peptides are described below.

[0134] Preferably, a hydrophobic domain separates any two of the domains. Preferably, each hydrophobic domain is flanked on either side by a cationic domain.

[0135] The cationic domains are not adjacent to other cationic domains. In one embodiment, the peptide comprises one hydrophobic domain and has the following configuration: [cationic domain]-[hydrophobic domain]-[cationic domain] As shown, two cationic domains are located on its sides.

[0136] Thus, preferably the hydrophobic domain is known as a core domain and each cationic domain is known as an arm domain. Preferably the hydrophobic core domain is flanked on either side by a cationic arm domain.

[0137] In one embodiment, the peptide consists of two cationic domains and one hydrophobic domain.

[0138] In one embodiment, the peptide consists of one hydrophobic domain flanked by two cationic arm domains.

[0139] In one embodiment, the peptides each have the sequence RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRR (SEQ ID NO:3), RBRRBR (SEQ ID NO:4), RRBRBR (SEQ ID NO:5), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9), RBRHBHR (SEQ ID NO:10), RBRBBHR (SEQ ID NO:11), RBRRBH (SEQ ID NO:12), HBRRBR (SEQ ID NO:13), HB It consists of one hydrophobic core domain comprising a sequence selected from YQFLI (SEQ ID NO:20), FQILY (SEQ ID NO:21), ILFQY (SEQ ID NO:22), FQIY (SEQ ID NO:23), WWW, WWPWW (SEQ ID NO:24), WPWW (SEQ ID NO:25), and WWPW (SEQ ID NO:26), flanked by two cationic arm domains comprising a sequence selected from HBH (SEQ ID NO:14), BHBH (SEQ ID NO:15), BRBSB (SEQ ID NO:16), BRB[Hyp]B (SEQ ID NO:17), R[Hyp]H[Hyp]HB (SEQ ID NO:18), and R[Hyp]RR[Hyp]R (SEQ ID NO:19).

[0140] In one embodiment, the peptide consists of one hydrophobic core domain comprising a sequence selected from FQILY (SEQ ID NO:21), WWW, WWPWW (SEQ ID NO:24), flanked by two cationic arm domains each comprising a sequence selected from RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRRBR (SEQ ID NO:4), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), and RBHBH (SEQ ID NO:8).

[0141] In one embodiment, the peptide consists of one hydrophobic core domain comprising the sequence of FQILY (SEQ ID NO:21) flanked by two cationic arm domains each comprising a sequence selected from RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRRBR (SEQ ID NO:4), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), and RBHBH (SEQ ID NO:8).

[0142] In any such embodiment, additional groups can be present, such as linkers, terminal modifications, and / or therapeutic molecules.

[0143] Preferably, the peptide is N-terminally modified.

[0144] Preferably, the peptide is N-acetylated, N-methylated, N-trifluoroacetylated, N-trifluoromethylsulfonylated, or N-methylsulfonylated. Preferably, the peptide is N-acetylated.

[0145] Optionally, the N-terminus of the peptide may be unmodified.

[0146] In one embodiment, the peptide is N-acetylated.

[0147] Suitably, the peptide comprises a C-terminal modification selected from a carboxy-, thioazido-, aminooxy-, hydrazino-, thioester-, azide, strained alkyne, strained alkene, aldehyde-, thiol, or alloacetyl group.

[0148] Advantageously, the C- or N-terminal modifications provide a means for linking the peptide to a therapeutic molecule.

[0149] Thus, the C-terminal modification or the N-terminal modification may comprise a linker, and vice versa. Preferably, the C-terminal modification or the N-terminal modification consists of a linker, and vice versa. Suitable linkers are described herein and elsewhere.

[0150] Suitably, the peptide comprises a C-terminal carboxyl group.

[0151] Suitably, the C-terminal carboxyl group is provided by a residue of glycine, β-alanine, glutamic acid, or γ-aminobutyric acid.

[0152] In one embodiment, the C-terminal carboxyl group is provided by a β-alanine residue.

[0153] Preferably the C-terminal residue is the linker. Preferably the C-terminal β-alanine residue is the linker.

[0154] Thus, preferably, each cationic domain may further comprise an N- or C-terminal modification. Preferably, the cationic domain comprises a C-terminal modification at the C-terminus. Preferably, the cationic domain comprises an N-terminal modification at the N-terminus. Preferably, the cationic domain comprises a linker group at the C-terminus, and preferably, the cationic domain comprises a C-terminal β-alanine at the C-terminus. Preferably, the cationic domain is N-acetylated at the N-terminus.

[0155] The peptides of the present invention are defined as having a total length of 40 or less amino acid residues. Therefore, the peptides are considered to be oligopeptides.

[0156] Suitably, the peptide has a total length of 3 to 30 amino acid residues, preferably 5 to 25 amino acid residues, 10 to 25 amino acid residues, 13 to 23 amino acid residues, 15 to 20 amino acid residues.

[0157] Suitably, the peptides have an overall length of at least 12, at least 13, at least 15, at least 15, at least 16, at least 17 amino acid residues.

[0158] Advantageously, the peptide is capable of penetrating cells, and therefore the peptide is considered to be a cell penetrating peptide.

[0159] Preferably, the peptide is for attachment to a therapeutic molecule. Preferably, the peptide is for transporting a therapeutic molecule to a target cell. Preferably, the peptide is for delivery of a therapeutic molecule to a target cell. Hence, the peptide is considered a peptide carrier.

[0160] Preferably, the peptide carrier is capable of penetrating cells and tissues, preferably into the nucleus of cells, preferably into muscle tissue.

[0161] Preferably, the peptide carrier is selected from the following sequences: RBRRBRRFQILYRBRBR (SEQ ID NO:27) RBRRBRRFQILYRBRR (SEQ ID NO:28) RBRRBRFQILYRRBRBR (SEQ ID NO:29) RBRBRFQILYRBRRBRR (SEQ ID NO:30) RBRRBRRYQFLIRBRBR (SEQ ID NO:31) RBRRBRRILFQYRBRBR (SEQ ID NO:32) RBRRBRFQILYRBRBR (SEQ ID NO:33) RBRRBFQILYRBRRBR (SEQ ID NO:34) RBRRBRFQILYBRBR (SEQ ID NO:35) RBRRBFQILYRBRBR (SEQ ID NO:36) RBRRBRRFQILYRBHBH (SEQ ID NO:37) RBRRBRRFQILYHBHBR (SEQ ID NO:38) RBRRBRRFQILYHBRBH (SEQ ID NO:39) RBRRBRRYQFLIRBHBH (SEQ ID NO:40) RBRRBRRILFQYRBHBH (SEQ ID NO:41) RBRHBHRFQILYRBRBR (SEQ ID NO:42) RBRBBHRFQILYRBHBH (SEQ ID NO:43) RBRRBRFQILYRBHBH (SEQ ID NO:44) RBRRBRFQILYHBHBH (SEQ ID NO:45) RBRRBHFQILYRBHBH (SEQ ID NO:46) HBRRBRFQILYRBHBH (SEQ ID NO:47) RBRRBFQILYRBHBH (SEQ ID NO:48) RBRRBRFQILYBHBH (SEQ ID NO:49) RBRRBRYQFLIHBHBH (SEQ ID NO:50) RBRRBRILFQYHBHBH (SEQ ID NO:51) RBRRBRRFQILYHBHBH (sequence number 52).

[0162] Preferably, the peptide is selected from the following additional sequences: RBRRBRFQILYBRBS (SEQ ID NO:53) RBRRBRFQILYBRB[Hyp] (SEQ ID NO:54) RBRRBRFQILYBR[Hyp]R (SEQ ID NO:55) RRBRRBRFQILYBRBR (SEQ ID NO:56) BRRBRRFQILYBRBR (SEQ ID NO:57) RBRRBRWWWBRBR (SEQ ID NO:58) RBRRBRWWPWWBRBR (SEQ ID NO:59) RBRRBRWPWWBRBR (SEQ ID NO:60) RBRRBRWWPWBRBR (SEQ ID NO:61) RBRRBRRWWWRBRBR (SEQ ID NO:62) RBRRBRRWWPWWRBRBR (SEQ ID NO:63) RBRRBRRWPWWRBRBR (SEQ ID NO:64) RBRRBRRWWPWRBRBR (SEQ ID NO:65) RBRRBRRFQILYBRBR (SEQ ID NO:66) RBRRBRRFQILYRBR (SEQ ID NO:67) BRBRBWWPWWRBRRBR (SEQ ID NO:68) RBRRBRRFQILYBHBH (SEQ ID NO:69) RBRRBRRFQIYRBHBH (SEQ ID NO:70) RBRRBRFQILYBRBH (SEQ ID NO:71) RBRRBRFQILYR[Hyp]H[Hyp]H (SEQ ID NO: 72) R[Hyp]RR[Hyp]RFQILYRBHBH (SEQ ID NO:73) R[Hyp]RR[Hyp]RFQILYR[Hyp]H[Hyp]H (SEQ ID NO: 74) RBRRBRWWWRBHBH (SEQ ID NO:75) RBRRBRWWPRBHBH (SEQ ID NO:76) RBRRBRPWWRBHBH (SEQ ID NO:77) RBRRBRWWPWWRBHBH (SEQ ID NO:78) RBRRBRWWPWRBHBH (SEQ ID NO:79) RBRRBRWPWWRBHBH (SEQ ID NO:80) RBRRBRRWWWRBHBH (SEQ ID NO:81) RBRRBRRWWPWWRBHBH (SEQ ID NO:82) RBRRBRRWPWWRBHBH (SEQ ID NO:83) RBRRBRRWWPWRBHBH (SEQ ID NO:84) RRBRRBRFQILYRBHBH (SEQ ID NO:85) BRRBRRFQILYRBHBH (SEQ ID NO:86) RRBRRBRFQILYBHBH (SEQ ID NO:87) BRRBRRFQILYBHBH (SEQ ID NO:88) RBRRBHRFQILYRBHBH (SEQ ID NO:89) RBRRBRFQILY[Hyp]R[Hyp]R (SEQ ID NO: 90) R[Hyp]RR[Hyp]RFQILYBRBR (SEQ ID NO:91) R[Hyp]RR[Hyp]RFQILY[Hyp]R[Hyp]R (SEQ ID NO: 92) RBRRBRWWWBRBR (SEQ ID NO: 93) RBRRBRWWPWWBRBR (sequence number 94).

[0163] Suitably, the peptide consists of one of the following sequences: Suitably the peptide consists of one of the following sequences: RBRRBRRFQILYRBRBR (SEQ ID NO:27) RBRRBRRYQFLIRBRBR (SEQ ID NO:31) RBRRBRRILFQYRBRBR (SEQ ID NO:32) RBRRBRFQILYBRBR (SEQ ID NO:35) RBRRBRRFQILYRBHBH (SEQ ID NO:37) RBRRBRRFQILYHBHBR (SEQ ID NO:38) RBRRBRFQILYRBHBH (sequence number 44).

[0164] In one embodiment, the peptide comprises the sequence: RBRRBRFQILYBRBR (sequence number 35). In one embodiment, the peptide comprises the sequence: RBRRBRRFQILYRBHBH (sequence number 37). In one embodiment, the peptide comprises the sequence: RBRRBRFQILYRBHBH (sequence number 44).

[0165] therapeutic molecules The peptide carrier is covalently attached to a therapeutic molecule to provide a conjugate of the invention, where the therapeutic molecule is a nucleic acid comprising a plurality of trinucleotide repeats.

[0166] Suitably, the nucleic acid is selected from antisense oligonucleotides (e.g. PNA, PMO), mRNA, gRNA (e.g. using CRISPR / Cas9 technology), short interfering RNA, microRNA, and antagonist RNA.

[0167] Preferably, the nucleic acid is an antisense oligonucleotide.

[0168] Preferably, the antisense oligonucleotide is a phosphorodiamidate morpholino oligonucleotide (PMO).

[0169] Alternatively, the antisense oligonucleotide is a modified PMO or other charge neutral antisense oligonucleotide, such as a peptide nucleic acid (PNA), a chemically modified PNA, e.g., γ-PNA (Bahal, Nat. Comm. 2016), an oligonucleotide phosphoramidate (wherein the non-bridging oxygen of the phosphate is an amine or alkylamine, e.g., those described in WO 2016 / 028187), or a partially or completely charge neutralized oligonucleotide.

[0170] Preferably, the nucleic acid consists of a plurality of trinucleotide repeats.

[0171] Preferably, the nucleic acid comprises any trinucleotide repeat. Preferably, the nucleic acid comprises a trinucleotide repeat selected from GTC, CAG, GCC, GGC, CTT, and CCG repeats. Preferably, the nucleic acid consists of a trinucleotide repeat selected from GTC, CAG, GCC, GGC, CTT, and CCG repeats.

[0172] Suitably, the nucleic acid comprises a CAG repeat. Suitably, the nucleic acid consists of a CAG repeat.

[0173] In one embodiment, the nucleic acid is an antisense oligonucleotide comprising a CAG repeat. In one embodiment, the nucleic acid is an antisense oligonucleotide consisting of a CAG repeat.

[0174] Suitably the nucleic acid comprises or consists of a plurality of trinucleotide repeats.

[0175] Preferably, the nucleic acid comprises or consists of at least 2 trinucleotide repeats. Preferably, the nucleic acid comprises or consists of 5 to 50 trinucleotide repeats. Preferably, the nucleic acid comprises or consists of 5 to 40 trinucleotide repeats. Preferably, the nucleic acid comprises or consists of 5 to 30 trinucleotide repeats. Preferably, the nucleic acid comprises or consists of 5 to 20 trinucleotide repeats. Preferably, the nucleic acid comprises or consists of 5 to 10 trinucleotide repeats. Preferably, the nucleic acid comprises or consists of 7 trinucleotide repeats.

[0176] In one embodiment, the nucleic acid is an antisense oligonucleotide comprising heptad repeats. In one embodiment, the nucleic acid is an antisense oligonucleotide consisting of heptad repeats. Suitably, in one embodiment, the nucleic acid is an antisense oligonucleotide consisting of [CAG]7.

[0177] Preferably the nucleic acid is complementary to a microsatellite region, preferably a repeat expansion, preferably a trinucleotide repeat expansion.

[0178] Preferably the nucleic acid targets and binds to a microsatellite region, preferably the microsatellite region comprises a repeat expansion, preferably a trinucleotide repeat expansion.

[0179] In some embodiments, the repeat expansion can comprise higher repeats, such as tetra-, penta-, hexa-, hepta-, octa-, nona-, or deca-repeat expansions (comprising 4, 5, 6, 7, 8, 9, or 10 nucleotides per repeat, respectively).

[0180] Thus, in some embodiments, the therapeutic molecule is a nucleic acid comprising a plurality of tetra-, penta-, hexa-, hepta-, octa-, nona-, or deca-repeat stretches.Thus, in some embodiments, the therapeutic molecule is a nucleic acid consisting of a plurality of tetra-, penta-, hexa-, hepta-, octa-, nona-, or deca-repeat stretches.

[0181] Statements made regarding nucleic acids comprising trinucleotide repeat extensions apply equally to nucleic acids comprising higher nucleotide repeat extensions.

[0182] Preferably the nucleic acid binds to a complementary microsatellite region, preferably to the complementary region of a repeat expansion, preferably to the complementary region of a trinucleotide repeat expansion.

[0183] Preferably, the microsatellite region is present in DNA or RNA. Preferably, the microsatellite region is present in RNA.

[0184] Preferably, the microsatellite region is present in a coding or non-coding sequence. Preferably, the microsatellite region is present in a non-coding sequence, for example, in the 3' or 5' UTR. Preferably, the microsatellite region is present in a non-coding sequence, for example, in the 3' UTR.

[0185] Suitably the nucleic acid is formed from trinucleotide repeats which bind to complementary trinucleotide repeat stretches.

[0186] Suitably the nucleic acid is formed from trinucleotide repeats which bind to complementary trinucleotide repeat stretches in RNA.

[0187] Suitably, the nucleic acid is formed from trinucleotide repeats which bind to complementary trinucleotide repeat stretches in the non-coding sequence of the RNA.

[0188] Suitably, the nucleic acid is formed from trinucleotide repeats which bind to complementary trinucleotide repeat stretches in the untranslated sequence of the RNA.

[0189] In one embodiment, the nucleic acid is formed from trinucleotide repeats that bind to complementary trinucleotide repeat stretches in the 3'UTR of an RNA.

[0190] Optionally, lysine residues are added to one or both ends of the nucleic acid prior to conjugation to the peptide carrier to improve water solubility.

[0191] Triplet repeat disease The conjugate of the present invention is preferably for use as a medicament in the prevention or treatment of a triplet repeat disease.

[0192] Preferably, the trinucleotide repeat disease is a genetic disorder caused by a trinucleotide repeat expansion, also known as a triplet repeat disease.

[0193] Preferably, the trinucleotide repeat expansion is present in a gene. Preferably, the trinucleotide repeat expansion is present in a gene selected from ATN1, HTT, AR, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, TBP, FMR1, AFF2, FXN, DMPK, SCA8, JPH3, and PPP2R2B.

[0194] Suitably, the trinucleotide repeat expansion is present in the AR, SCA8, or DMPK gene.

[0195] In one embodiment, the trinucleotide repeat expansion is present in the DMPK gene.

[0196] Suitably, the trinucleotide repeat expansion is formed from repeats selected from CAG, CTG, CGG, CCG, GAA, TTC, and GGC.

[0197] Suitably the trinucleotide repeat expansion is formed from the repeats CAG or CTG.

[0198] In one embodiment, the trinucleotide repeat expansion is formed from the repeat CTG.

[0199] Typically, triplet repeat diseases result from the presence of particular trinucleotide repeat expansions found in particular genes. Typically, the number of trinucleotide repeats present in a gene is greater than the number of trinucleotide repeats present in the same gene in healthy subjects.

[0200] Suitably, the trinucleotide repeat expansion is a CAG repeat in a gene selected from ATN1, HTT, AR, ATXN1, ATXN, ATXN3, CACNA1A, ATXN7, JPH3, and TBP.

[0201] Preferably, triplet repeat diseases caused by CAG repeats are named "polyglutamine diseases". Therefore, preferably, the triplet repeat disease is a polyglutamine disease. Preferably, the polyglutamine disease is selected from DRPLA (dentatorubral-pallidoluysian atrophy), HD (Huntington's disease), HDL2 (Huntington's disease-like syndrome 2), SBMA (spinal-bulbar muscular atrophy), SCA1 (spinocerebellar ataxia type 1), SCA2 (spinocerebellar ataxia type 2), SCA3 (spinocerebellar ataxia type 3 or Machado-Joseph disease), SCA6 (spinocerebellar ataxia type 6), SCA7 (spinocerebellar ataxia type 73), and SCA17 (spinocerebellar ataxia type 17).

[0202] Suitably, the trinucleotide repeat expansion is a CGG repeat in a gene selected from FMR1.

[0203] Suitably, the trinucleotide repeat expansion is a CCG repeat in a gene selected from AFF2.

[0204] Suitably, the trinucleotide repeat expansion is a GAA repeat in a gene selected from FXN.

[0205] Suitably, the trinucleotide repeat expansion is a CTG repeat in a gene selected from DMPK and ATXN8AFF2.

[0206] Suitably, the trinucleotide repeat expansion is a GTC repeat in a gene selected from JPH3.

[0207] Preferably, trinucleotide repeat expansions resulting from trinucleotide repeats other than CAG repeats are termed "non-polyglutamine diseases". Therefore, preferably, the triplet repeat disease is a non-polyglutamine disease. Preferably, the non-polyglutamine disease is selected from HDL2 (Huntington's disease-like syndrome 2), FRAXA (Fragile X syndrome), FXTAS (Fragile X-associated tremor / ataxia syndrome), FRAXE (Fragile XE mental retardation), FRDA (Friedreich's ataxia), DM1 (Myotonic dystrophy type 1), SCA8 (Spinocerebellar ataxia type 8), and SCA12 (Spinocerebellar ataxia type 12).

[0208] Preferably, the triplet repeat disease results from an increase in the number of trinucleotide repeats compared to a healthy subject, preferably an increase in the number of trinucleotide repeats in a gene compared to the same gene in a healthy subject. Preferably, the number of trinucleotide repeats in the trinucleotide repeat expansion is increased compared to the number of trinucleotide repeats in a healthy subject.

[0209] Suitably, the number of repeats in the trinucleotide repeat expansion is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 times the number of repeats in a healthy subject.

[0210] Suitably, the triplet repeat disease results from an increase in the number of repeats in the trinucleotide repeat expansion of at least 1.5 times the number of repeats in a healthy subject.

[0211] Suitably, the triplet repeat disease results from an increase in the number of repeats in a trinucleotide repeat expansion of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50-fold the number of repeats in a healthy subject.

[0212] Suitably, the number of repeats in the trinucleotide repeat expansion is 1.5 to 15 times the number of repeats in a healthy subject.

[0213] Suitably, the triplet repeat disease results from a trinucleotide repeat expansion that is 1.5 to 15 times the repeat present in a healthy subject.

[0214] Suitably the number of repeats in the trinucleotide repeat extension is 50 or more, 75 or more, 100 or more, 125 or more, 150 or more, 175 or more, 200 or more, 225 or more, 250 or more.

[0215] Suitably the triplet repeat disease results from a trinucleotide repeat expansion comprising 50 or more, 75 or more, 100 or more, 125 or more, 150 or more, 175 or more, 200 or more, 225 or more, 250 or more repeats.

[0216] Suitably, the number of repeats in the trinucleotide repeat extension is 50 or more.

[0217] Suitably, the triplet repeat disease results from a trinucleotide repeat expansion comprising 50 or more repeats.

[0218] Preferably, the number of repeats in the trinucleotide repeat extension is 50-250.

[0219] Preferably, the triplet repeat disease is caused by a trinucleotide repeat expansion comprising 50 to 250 repeats.

[0220] Preferably, the triplet repeat disease is a non-polyglutamine disease.

[0221] Preferably, the triplet repeat disease is DM1 or SCA8.

[0222] In one embodiment, the triplet repeat disease is DM1.

[0223] In one embodiment, when the triplet repeat disease is DM1, the number of repeats in the trinucleotide repeat expansion is greater than or equal to 50. In one embodiment, when the triplet repeat disease is DM1, the number of CTG repeats in the trinucleotide repeat expansion is greater than or equal to 50. In one embodiment, when the triplet repeat disease is DM1, the number of CTG repeats in the trinucleotide repeat expansion of the DMPK gene is greater than or equal to 50.

[0224] In one specific example, when the triplet repeat disease is SCA8, the number of repeats in the trinucleotide repeat expansion is 110 to 250. In one specific example, when the triplet repeat disease is SCA8, the number of CTG repeats in the trinucleotide repeat expansion is 110 to 250. In one specific example, when the triplet repeat disease is SCA8, the number of CTG repeats in the trinucleotide repeat expansion of the ATXN8 gene is 110 to 250.

[0225] In some embodiments, the complexes of the invention are preferably for use as a medicament in the prevention and / or treatment of a nucleotide repeat disease.

[0226] Preferably, the nucleotide repeat disease is a genetic disorder caused by a nucleotide repeat expansion (otherwise known as a repeat expansion or a microsatellite repeat expansion).

[0227] Preferably, the nucleotide repeat disease results from a tetra-, penta-, hexa-, hepta-, octa-, nona-, or deca-nucleotide repeat expansion.

[0228] Preferably, the nucleotide repeat extension is a higher repeat extension, as discussed above, such as a tetra-, penta-, hexa-, hepta-, octa-, nona-, or deca-nucleotide repeat extension.

[0229] Therefore, preferably the conjugate of the present invention is for use as a medicament in the prevention and / or treatment of a tetra-, penta-, hexa-, hepta-, octa-, nona-, or deca-nucleotide repeat disease.

[0230] Preferably the nucleotide repeat extension is a tetranucleotide repeat, preferably the tetranucleotide repeat is a CCTG repeat.

[0231] Suitably therefore, the conjugate of the present invention is preferably for use as a medicament in the prevention and / or treatment of DM2 (myotonic dystrophy type 2).

[0232] Preferably the nucleotide repeat extension is a pentanucleotide repeat, preferably the pentanucleotide repeat is an ATTCT repeat.

[0233] Therefore, suitably, the complex of the present invention is preferably for use as a medicament in the prevention and / or treatment of SCA10 (Spinocerebellar Ataxia Type 10).

[0234] Therefore, suitably, the conjugate of the present invention is preferably for use as a medicament in the prevention and / or treatment of SCA31 (Spinocerebellar Ataxia Type 31).

[0235] Preferably the nucleotide repeat extension is a hexanucleotide repeat, preferably the hexanucleotide repeat is a GGCCTG repeat or a GGGGCC repeat.

[0236] Therefore, suitably, the conjugate of the present invention is preferably for use as a medicament in the prevention and / or treatment of SCA36 (Spinocerebellar Ataxia Type 36).

[0237] Therefore, suitably, the complex of the present invention is preferably for use as a medicament in the prevention and / or treatment of C9ORF72-ALS (amyotrophic lateral sclerosis).

[0238] Statements relating to the treatment of triplet repeat diseases apply equally to the treatment of higher nucleotide repeat diseases, such as tetra-, penta-, hexa-, hepta-, octa-, nona-, or deca-nucleotide repeat diseases.

[0239] covalent bond The peptide carrier present in the complex of the present invention is covalently attached to a therapeutic molecule.

[0240] Preferably, the peptide carrier is covalently attached to the therapeutic molecule at the C-terminus or N-terminus. Preferably, the peptide carrier is covalently attached to the therapeutic molecule at the C-terminus.

[0241] Preferably, the peptide carrier is covalently attached to the therapeutic molecule via a linker, if necessary, which acts as a spacer to separate the peptide sequence from the therapeutic molecule.

[0242] The linker is selected from any suitable sequence.

[0243] Preferably, a linker is present between the peptide and the therapeutic molecule. Preferably, the linker is a separating group for the peptide and the therapeutic molecule. Thus, the linker may comprise an artificial amino acid residue.

[0244] In one embodiment, the conjugate comprises a peptide carrier covalently attached to a therapeutic molecule via a linker.

[0245] In one embodiment, the complex has the following structure: [Peptide]-[Linker]-[Therapeutic molecule] The present invention relates to a method for producing a semiconductor device comprising the steps of:

[0246] In one embodiment, the complex has the following structure: [Peptide]-[Linker]-[Therapeutic molecule] It consists of:

[0247] Suitably, the conjugates according to the invention use any of the peptides listed herein. In one embodiment, the conjugates comprise a peptide carrier selected from the sequences RBRRBRFQILYBRBR (SEQ ID NO: 35), RBRRBRRFQILYRBHBH (SEQ ID NO: 37) and RBRRBRFQILYRBHBH (SEQ ID NO: 44).

[0248] Suitably, in either case, the peptide comprises an N-terminal modification, as described above.

[0249] Suitable linkers include, for example, a C-terminal cysteine ​​that allows for the formation of a disulfide, thioether, or thiol-maleimide bond, a C-terminal aldehyde that allows for a click reaction or the formation of a morpholino bond with a basic amino acid on the peptide to form an oxime, or a carboxylic acid moiety on the peptide covalently bonded to an amino group that forms a carboxamide bond.

[0250] Preferably, the linker is 1 to 5 amino acids in length. Preferably, the linker comprises any linker known in the art.

[0251] Preferably, the linker is selected from the following sequences: G, BC, XC, C, GGC, BBC, BXC, XBC, X, XX, B, BB, BX, XB, succinic acid, GABA, and E. Preferably, X is 6-aminohexanoic acid.

[0252] Suitably the linker may be a polymer, for example PEG.

[0253] Suitably, the linker is selected from β-alanine (B), succinic acid (Succ), GABA (Ab), and glutamic acid (E).

[0254] In one embodiment, it is β-alanine (B).

[0255] In one embodiment, the peptide carrier is attached to the therapeutic molecule via a carboxamide bond.

[0256] The linker of the conjugate may form part of the therapeutic molecule to which the peptide is attached. Alternatively, the therapeutic molecule may be attached directly to the C-terminus or N-terminus of the peptide carrier. Preferably, in such embodiments, no linker is required.

[0257] Alternatively, the peptide carrier is chemically coupled to the therapeutic molecule, for example via a disulfide, alkenyl, alkynyl, aryl, ether, thioether, triazole, amide, carboxamide, urea, thiourea, semicarbazide, carbazide, hydrazine, oxime, phosphate, phosphoramidate, thiophosphate, boranophosphate, iminophosphate, or thiol-maleimide bond.

[0258] Optionally, a cysteine ​​is added at the N-terminus of the therapeutic molecule to allow for disulfide linkage to the peptide carrier, or the N-terminus is bromoacetylated for thioether linkage to the peptide carrier.

[0259] In one embodiment, the conjugate comprises a peptide carrier selected from the following sequences: RBRRBRFQILYBRBR (SEQ ID NO: 35), RBRRBRRFQILYRBHBH (SEQ ID NO: 37) and RBRRBRFQILYRBHBH (SEQ ID NO: 44), covalently attached by a linker to an antisense oligonucleotide comprising a CAG repeat, wherein the linker is selected from β-alanine (B), GABA (Ab), and glutamic acid (E).

[0260] In one embodiment, the conjugate comprises a peptide carrier selected from the following sequences: RBRRBRFQILYBRBR (SEQ ID NO: 35), RBRRBRRFQILYRBHBH (SEQ ID NO: 37) and RBRRBRFQILYRBHBH (SEQ ID NO: 44), covalently attached by a linker to an antisense oligonucleotide consisting of a CAG repeat, where the linker is selected from β-alanine (B), GABA (Ab), and glutamic acid (E).

[0261] In one embodiment, the conjugate comprises a peptide carrier selected from the following sequences: RBRRBRFQILYBRBR (SEQ ID NO: 35), RBRRBRRFQILYRBHBH (SEQ ID NO: 37) and RBRRBRFQILYRBHBH (SEQ ID NO: 44), covalently attached by a linker to an antisense oligonucleotide consisting of a heptad CAG repeat, where the linker is selected from β-alanine (B), GABA (Ab), and glutamic acid (E).

[0262] In one embodiment, the conjugate comprises a peptide carrier RBRRBRFQILYBRBR (SEQ ID NO:35) covalently linked by a β-alanine (B) to an antisense oligonucleotide consisting of a heptad CAG repeat (DPEP1.9).

[0263] In one embodiment, the complex comprises a peptide carrier RBRRBRFQILYBRBR (SEQ ID NO: 35) covalently linked by a glutamic acid (E) to an antisense oligonucleotide consisting of a heptad repeat of CAG (DPEP1.9b). In one embodiment, the complex has increased permeability to diaphragm tissue. Advantageously, increased permeability to the diaphragm is beneficial in the treatment of muscle diseases affecting the respiratory system, such as myotonic dystrophy.

[0264] In one embodiment, the complex comprises a peptide carrier RBRRBRRFQILYRBHBH (SEQ ID NO:37) covalently linked by a β-alanine (B) to a heptad CAG repeat antisense oligonucleotide (DPEP3.1). In one embodiment, the complex has increased permeability into muscle tissue. Advantageously, increased muscle permeability is beneficial in the treatment of muscle disorders.

[0265] In one embodiment, the complex comprises a peptide carrier RBRRBRRFQILYRBHBH (SEQ ID NO:37) covalently linked by a glutamic acid (E) to a CAG heptad antisense oligonucleotide (DPEP3.1b). In one embodiment, the complex has increased permeability into muscle tissue. Advantageously, increased muscle permeability is beneficial in the treatment of muscle disorders.

[0266] In one embodiment, the conjugate comprises the peptide carrier RBRRBRRFQILYRBHBH (SEQ ID NO: 37) covalently linked by GABA (Ab) to an antisense oligonucleotide consisting of a heptad CAG repeat (DPEP3.1a).

[0267] In one embodiment, the complex comprises a peptide carrier RBRRBRFQILYRBHBH (SEQ ID NO: 44) covalently linked by a β-alanine (B) to a heptad CAG repeat antisense oligonucleotide (DPEP3.8). In one embodiment, the complex has increased permeability into muscle tissue. Advantageously, increased muscle permeability is beneficial in the treatment of muscle disorders.

[0268] In one embodiment, the complex comprises a peptide carrier RBRRBRFQILYRBHBH (SEQ ID NO: 44) covalently linked by a glutamic acid (E) to an antisense oligonucleotide consisting of a heptad repeat of CAG (DPEP3.8b). In one embodiment, the complex has increased permeability to diaphragm tissue. Advantageously, increased permeability to the diaphragm is beneficial in the treatment of muscle diseases affecting the respiratory system, such as myotonic dystrophy.

[0269] The conjugate may be acetylated at the N-terminus.

[0270] Pharmaceutical Compositions and Administration The conjugates of the invention are formulated into pharmaceutical compositions, as described above.

[0271] According to a sixth aspect of the invention, a pharmaceutical composition comprises a conjugate of the invention.

[0272] Suitably, the pharmaceutical composition may further comprise one or more pharma- ceutically acceptable ingredients, such as one or more diluents, adjuvants, or carriers.

[0273] Suitable pharma- ceutically acceptable diluents, adjuvants, and carriers are known in the art.

[0274] As used herein, the expression "pharmacologically acceptable" refers to ligands, substances, formulations, and / or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or disturbance, commensurate with the risk-benefit ratio.

[0275] As used herein, the expression "pharmaceutical acceptable carrier" refers to a pharma-ceutically acceptable substance, formulation or vehicle, e.g., a liquid or solid filler, diluent, solvent or encapsulating material, involved in the transport or transfer of a complex from one organ or body part to another. Each peptide must be "acceptable" in the sense of being compatible with the other components of the composition, e.g., the peptide and the therapeutic molecule, and not individually deleterious.

[0276] Lyophilized compositions, which are reconstituted and administered, are also within the scope of the compositions of the present invention.

[0277] Pharmaceutically acceptable carriers are, for example, excipients, vehicles, diluents, and combinations thereof. For example, when the composition is administered orally, it is formulated as a tablet, capsule, powder, or syrup; or for parenteral administration, it is formulated as an injection, drip, or suppository. These compositions are prepared by a general method, and if necessary, the active compound (i.e., the complex) is mixed with various general additives, such as excipients, binders, disintegrants, lubricants, flavorings, solubilizers, suspension aids, emulsifiers, coating agents, or combinations thereof.

[0278] With respect to medical applications, it should be understood that the pharmaceutical compositions of the present invention can further include additional known therapeutic agents, drugs, modifications of compounds into prodrugs, and the like, for alleviating, regulating, preventing, and treating the diseases, disorders, and symptoms described herein.

[0279] Preferably, the pharmaceutical composition is for a pharmaceutical use, preferably for a pharmaceutical use similar to that described for the conjugate. All the features described for the treatment using the conjugate also apply to the pharmaceutical composition.

[0280] Thus, in a further aspect of the invention there is provided a pharmaceutical composition according to the sixth aspect for use as a medicament.In a further aspect there is provided a method of preventing or treating a medical condition in a subject comprising administering to the subject an effective amount of a pharmaceutical composition according to the sixth aspect.

[0281] Preferably, the pharmaceutical composition is for use in the prevention or treatment of a triplet repeat disease, and preferably, the prevention or treatment is in respect of a triplet repeat disease in a subject.

[0282] Prevention or treatment The conjugate of the present invention is used as a drug for the prevention or treatment of a disease, preferably a triplet repeat disease.

[0283] The medicament, as defined, is in the form of a pharmaceutical composition.

[0284] Also provided is a method of prevention or treatment of a medical condition in a subject in need of such treatment, the method comprising administering to the subject a therapeutically effective amount of the conjugate.

[0285] Suitably the conjugate is for use in the prevention or treatment of a triplet repeat disease.

[0286] Details of suitable genes comprising trinucleotide repeat expansions and triplet repeat diseases have been detailed above.

[0287] Alternatively, the conjugates are for use in the prevention or treatment of other nucleotide repeat diseases. Details of such higher repeat expansions and the resulting nucleotide repeat diseases are described in detail above.

[0288] The specific mechanism of how a nucleic acid consisting of a trinucleotide repeat functions to treat a triplet repeat disease will vary depending on the triplet repeat disease in question. Preferably, the nucleic acid binds to a trinucleotide repeat expansion in a gene or transcript. Preferably, the nucleic acid reduces the level of a transcript comprising the trinucleotide repeat expansion. Preferably, the nucleic acid prevents the pathological effects of the trinucleotide repeat expansion and thus the triplet repeat disease. The same is true for other nucleotide repeat diseases.

[0289] Therefore, preferably the conjugate improves the physiological condition of the subject.

[0290] For example, the therapeutic nucleic acid of the complex can correct a splicing defect caused by a triplet repeat disease. Advantageously, the therapeutic nucleic acid of the complex can normalize splicing in a subject with a triplet repeat disease.

[0291] Preferably, the therapeutic nucleic acid of the complex is capable of binding to a transcript of the DMPK gene. Preferably, the therapeutic nucleic acid of the complex is capable of binding to a repeat expansion present in a transcript of the DMPK gene. Preferably, the therapeutic nucleic acid of the complex is capable of binding to a CUG repeat expansion present in a transcript of the DMPK gene.

[0292] Thus, preferably the complex reduces the level of a DMPK transcript.Thus, preferably the complex reduces the level of a DMPK transcript having a CUG repeat expansion.

[0293] Thus, preferably the complex reduces the number of nuclear foci. Preferably the complex prevents nuclear foci that interact with the cellular splicing machinery. Preferably the complex prevents nuclear foci that interact with MBNL1. Preferably the complex prevents nuclear foci that sequester MBNL1.

[0294] Advantageously, these effects relate to use in the prevention or treatment of DM1.

[0295] Preferably, the complex reduces myotonia by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 100% in DM1 subjects compared to healthy subjects. Preferably, the complex reduces myotonia by at least 50% in DM1 subjects. Preferably, the complex reduces myotonia by 50-100% in DM1 subjects.

[0296] Preferably, the complex reduces nuclear foci by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90% in a DM1 subject. Preferably, the complex reduces nuclear foci by at least 50% in a DM1 subject. Preferably, the complex reduces nuclear foci by 50-90% in myoblasts of a DM1 subject.

[0297] Preferably, the conjugate corrects cardiac conduction by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% in DM1 subjects. Preferably, the conjugate improves cardiac conduction by at least 10% in DM1 subjects. Preferably, the conjugate improves cardiac conduction by 10-50% in DM1 subjects.

[0298] Preferably, the conjugate improves motor function in DM1 subjects by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%. Preferably, the conjugate improves motor function in DM1 subjects by at least 10%. Preferably, the conjugate improves motor function in DM1 subjects by 10-50%.

[0299] Preferably, the complex improves muscle strength relative to body weight by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% in DM1 subjects. Preferably, the complex improves muscle strength relative to body weight by at least 10% in DM1 subjects. Preferably, the complex improves muscle strength relative to body weight by 10-50% in DM1 subjects.

[0300] Preferably, the subject to be treated is an animal or a human. Preferably, the subject may be a non-human mammal. Preferably, the subject is male or female.

[0301] Preferably, the subjects to be treated are of various ages. Preferably, the subjects to be treated are aged between 0 and 40 years, preferably between 0 and 30 years, preferably between 0 and 25 years, preferably between 0 and 20 years.

[0302] Suitably, the conjugate is for systemic administration to a subject, for example, by intramedullary, intrathecal, intraventricular, intravitreal, enteral, parenteral, intravenous, intraarterial, intramuscular, intratumoral, subcutaneous, or intranasal routes.

[0303] In one embodiment, it is for intravenous administration to a subject.

[0304] In one embodiment, the conjugate is for intravenous administration to a subject by injection.

[0305] Preferably, the conjugates are for administration to a subject in a "therapeutically effective amount," meaning an amount sufficient to show benefit to an individual. The actual amount administered, and the route and time-course of administration, will depend on the nature and severity of the disease being treated. Decisions regarding dosage are within the responsibility of the general practitioner or other medical doctor. Examples of techniques and protocols can be found in Remington's Pharmaceutical Sciences, 20th Edition, 2000, published by Lippincott, Williams & Wilkins.

[0306] Exemplary doses are in the range of 0.01-50 mg / kg, 0.05-40 mg / kg, 0.1-30 mg / kg, 0.5-18 mg / kg, 1-16 mg / kg, 2-15 mg / kg, 5-10 mg / kg, 10-20 mg / kg, 12-18 mg / kg, 13-17 mg / kg.

[0307] Advantageously, the dose of the complex of the invention is an order of magnitude lower than the dose required for any effect to be seen with the therapeutic nucleic acid alone.

[0308] Advantageously, following administration of the conjugates of the invention, one or more toxicity markers are significantly reduced as compared to conjugates that use currently available peptide carriers.

[0309] A preferred toxicity marker is a marker of nephrotoxicity.

[0310] Suitable toxicity markers include serum KIM-1, NGAL, BUN, creatinine, alkaline phosphatase, alanine transferase, and aspartate aminotransferase levels.

[0311] Further suitable toxicity markers include urinary sodium, potassium, chloride, urea, creatinine, calcium, phosphorus, glucose, uric acid, magnesium, and protein levels.

[0312] Preferably, the levels of at least one of KIM-1, NGAL, and BUN are decreased following administration of a conjugate of the invention compared to conjugates that use currently available peptide carriers.

[0313] Advantageously, the levels of each of KIM-1, NGAL, and BUN are decreased following administration of the conjugates of the invention as compared to conjugates that use currently available peptide carriers.

[0314] Preferably, the level of the or each marker is significantly reduced compared to conjugates that use currently available peptide carriers.

[0315] Suitably, the level of the or each marker is reduced by up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% following administration of the conjugates of the invention compared to conjugates using currently available peptide carriers.

[0316] Advantageously, the toxicity of the conjugates is significantly reduced compared to conventional peptides and conjugates, in particular KIM-1 and NGAL-1, which are toxicity markers, are significantly reduced, up to 120-fold, compared to conjugates using currently available peptide carriers.

[0317] Preferably, the conjugate has negligible long term toxicity. Preferably, the conjugate has no long term toxic effects.

[0318] Preferably, the complex has no significant effect on gene extension in a subject other than the intended effect on the target trinucleotide repeat expansion. Preferably, the complex has no negative effect on gene extension in a subject.

[0319] Advantageously, following administration of the conjugates of the invention, cell viability is significantly improved compared to conjugates that use currently available peptide carriers.

[0320] Preferably, after administration of the complex of the present invention, the viability of myoblasts and hepatocytes is significantly improved compared to complexes using currently available peptide carriers. Preferably, after administration of the complex of the present invention, the viability of myoblasts and hepatocytes is increased by up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% compared to complexes using currently available peptide carriers. Advantageously, recovery time following administration of the conjugates of the invention is reduced by up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% compared to conjugates using currently available peptide carriers. Preferably, after administration of the complex of the invention, the recovery time is less than 60 minutes, less than 50 minutes, less than 40 minutes, less than 30 minutes, less than 20 minutes, less than 10 minutes, or less than 5 minutes. Preferably, after administration of the complex of the invention, there is no recovery time.

[0321] Nucleic Acids and Hosts The peptide carriers of the present invention can be produced by a variety of standard protein synthesis methods, such as chemical synthesis, semi-chemical synthesis, or through the use of an expression system.

[0322] The invention therefore relates to nucleotide sequences comprising or consisting of DNA encoding the complex, expression systems, e.g. vectors comprising said sequences together with necessary sequences for expression or control of expression, and host cells and host organisms transformed by said expression systems.

[0323] Therefore, nucleic acids encoding the complexes according to the invention are also provided.

[0324] Suitably, the nucleic acid is provided in isolated or purified form.

[0325] Also provided is a vector comprising a nucleic acid encoding a conjugate according to the invention.

[0326] Preferably, the vector is a plasmid.

[0327] Suitably, the vector comprises a control sequence, e.g. a promoter, operably linked to the nucleic acid encoding the complex according to the invention. Suitably, the expression vector is capable of expressing the complex when transfected into a suitable cell, e.g. a mammalian, bacterial or fungal cell.

[0328] A host cell comprising an expression vector of the invention is also provided.

[0329] The expression vector is selected depending on the host cell into which the nucleic acid of the present invention is inserted. Such transformation of the host cell includes common techniques, for example those taught in Sambrook et al. [Sambrook, J., Russell, D. (2001) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY, USA]. The selection of a suitable vector is within the knowledge of a person skilled in the art. Suitable vectors include plasmids, bacteriophages, cosmids, and viruses.

[0330] The produced complex is isolated and purified from the host cells by any suitable method, such as precipitation or chromatographic separation, eg, affinity chromatography.

[0331] Suitable vectors, hosts, and recombinant gene techniques are known in the art.

[0332] As used herein, the term "operably linked" includes the situation where a selected nucleotide sequence and a regulatory nucleotide sequence are covalently linked in such a way that expression of the nucleotide coding sequence is under the control of the regulatory sequences, e.g., the regulatory sequences are capable of effecting transcription of the nucleotide coding sequence that forms part or all of the selected nucleotide sequence. If appropriate, the resulting transcript is then translated into the desired complex.

[0333] The invention will now be described in detail with reference to the accompanying drawings and examples.

[0334] Throughout this specification and the claims, the terms "comprise" and "contain" and variations thereof are intended to mean "including, but not limited to," and are not intended to (and do not) exclude other moieties, additives, components, integers, or steps. Throughout this specification and the claims, the singular also includes the plural, unless otherwise required. In particular, when using the indefinite article, the specification must be understood as including the plural as well as the singular, unless otherwise required.

[0335] It should be understood that features, integers, properties, compounds, chemical moieties and groups described in connection with a particular aspect, embodiment or example of the invention are applicable to any of the other aspects, embodiments or examples described herein, unless inconsistent. All features disclosed in this specification (including the claims, abstract and drawings), and / or all steps of methods and processes similarly disclosed, may be combined in any manner, except where at least some of such features and / or steps are mutually exclusive.

[0336] The invention is not limited to the details of the above-described embodiments. The invention extends to any novel one or novel combination of features disclosed in this specification (including the claims, abstract and drawings), or to any novel one or novel combination of any method or process steps similarly disclosed. The reader's attention is directed to all articles and documents filed contemporaneously or prior to this specification related to this application, or submitted for inspection together with this specification, the contents of all such articles and documents being incorporated herein by reference.

[0337] [Example] 1. Materials and Methods Synthesis and preparation of P-PMO 9-Fluorenylmethoxycarbonyl (Fmoc)-protected L-amino acids, benzotriazol-1-yl-oxy-tris-pyrrolidino-phosphonium (PyBOP), 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HBTU), and Fmoc-β-Ala-OH preloaded Wang resin (0.19 or 0.46 mmol / g) were obtained from Merck (Hohenbrunn, Germany). 1-Hydroxy-7-azabenzotriazole (HOAt) was obtained from Sigma-Aldrich. HPLC grade acetonitrile, methanol, and synthesis grade N-methyl-2-pyrrolidone (NMP) were obtained from Fisher Scientific (Loughborough, UK). Peptide synthesis grade N,N-dimethylformamide (DMF) and diethyl ether were obtained from VWR (Leicestershire, UK). Piperidine and trifluoroacetic acid (TFA) were obtained from Alfa Aesar (Heysham, UK). PMO was purchased from Gene Tools Inc. (Philomas, USA). All other reagents were obtained from Sigma-Aldrich (St. Louis, MO, USA) unless otherwise noted. MALDI-TOF mass spectrometry was performed using a Voyager DE Pro BioSpectrometry workstation. Stock solutions of 10 mg / ml α-cyano-4-hydroxycinnamic acid or sinapic acid in 50% acetonitrile in water were used as matrices. Error bars are ±0.1%.

[0338] Synthesis of P-PMO peptides for screening a) Preparation of peptide variant libraries Peptides were prepared using Fmoc-β-Ala-OH preloaded Wang resin (0.19 or 0.46 mmol / g, Merck Millipore) on a 10 μmole scale using an Intavis Parallel peptide synthesizer or on a 100 μmole scale using a CEM Liberty Blue® peptide synthesizer (Buckingham, UK) by applying Fmoc chemistry and following the manufacturer's recommendations. In the case of synthesis using an Intavis Parallel peptide synthesizer, double coupling steps with a PyBOP / NMM coupling mixture were used, followed by acetic anhydride coupling after each step. For synthesis using a CEM Liberty Blue peptide synthesizer, single standard couplings were performed for all amino acids except arginine (for arginine, it was performed by double coupling). Except for the arginine residue, couplings were performed once at 75° C. with 60 watts of microwave power for 5 minutes (for arginine residues, couplings were performed twice, respectively). Each deprotection reaction was carried out twice at 75°C, once for 30 seconds and then for 3 minutes, with a microwave power of 35 watts. After the synthesis was completed, the resin was washed with DMF (3 x 50 ml) and the N-terminus of the solid-phase bound peptide was acetylated with acetic anhydride in the presence of DIPEA at room temperature. After N-terminal acetylation, the peptide resin was washed with DMF (3 x 20 ml) and DCM (3 x 20 ml). The peptide was cleaved from the solid support by treatment with a cleavage cocktail consisting of trifluoroacetic acid (TFA):H2O:triisopropylsilane (TIPS) (95%:2.5%:2.5%; 3-10 ml) at room temperature for 3 hours. After release of the peptide, excess TFA was removed by nitrogen sparging. The crude peptide was precipitated by addition of cold diethyl ether (15-40 ml depending on the scale of synthesis) and centrifuged at 3200 rpm for 5 minutes. The crude peptide pellet was washed with cold diethyl ether (3×15 ml) and purified by RP-HPLC using a Varian 940-LC HPLC system equipped with a 445-LC scale-up module and a 440-LC fraction collector.Purification was performed by semi-preparative HPLC on a RP-C18 column (10x250 mm, Phenomenex Jupiter) using a linear gradient of CH3CN in 0.1% TFA / H2O at a flow rate of 15 ml / min. Detection was performed at 220 nm and 260 nm. Fractions containing the desired peptide were combined and lyophilized to give the peptide as a white solid (see Table 1 for yields).

[0339] [Table 1]

[0340] b) Synthesis of peptide-PMO complex library A PMO antisense sequence with a length of 21 bases (CAGCAGCAGCAGCAGCAGCAG (SEQ ID NO: 95)) (alternatively known as [CAG]7) for triplet repeat sequences was used. A PMO sequence targeting the CUG / CTG expansion repeat (5'-CAGCAGCAGCAGCAGCAGCAG-3' (SEQ ID NO: 95)) was purchased from Gene Tools LLC. Elsewhere in this specification, this is referred to as [CAG]7 PMO. The peptide was attached to the 3'-end of the PMO via the C-terminal carboxyl group. This was achieved using 2.5 and 2 equivalents of PyBOP and HOAt, respectively, in NMP in the presence of 2.5 equivalents of DIPEA, using a 2.5-fold excess over the PMO dissolved in DMSO. Typically, to a solution of peptide (2500 nmoles) in N-methylpyrrolidone (NMP, 80 μl) was added PyBOP (19.2 μl of 0.3 M NMP solution), HOAt (16.7 μl of 0.3 M NMP solution), DIPEA (1.0 ml) and PMO (180 μl of 10 mM DMSO solution). The mixture was left at 40° C. for 2.5 h and the reaction was stopped by the addition of 0.1% aqueous TFA (300 μl). The solution was purified by ion exchange chromatography using a modified Gilson HPLC system. The PMO-peptide conjugate was purified on an ion exchange column (Resource S4 ml, GE Healthcare) using a linear gradient of sodium phosphate buffer (25 mM, pH 7.0) containing 20% ​​CH3CN. To elute the conjugate from the column, sodium chloride solution (1 M) was used at a flow rate of 4 ml / min or 6 ml / min. Fractions containing the desired compound were combined and immediately desalted. Removal of excess salt from the peptide-PMO complex was performed via filtration of the fractions collected after ion exchange using an Amicon® ultra-15 3K centrifugal filter device. The complex was lyophilized and analyzed by MALDI-TOF. The complex was dissolved in sterile water and filtered through a 0.22 μm cellulose acetate membrane before use. The concentration of the peptide-PMO complex was determined by the molar absorbance of the complex at 265 nm in 0.1 N HCl solution (see Table 2 for yield). [Table 2]

[0341] Animal models and ASO injections Experiments were performed at the University of Oxford or at the "Centre d'etudes fonctionnelles" (Sorbonne University School of Medicine) in accordance with UK and French law, respectively (ethical approval 1760-2015091512001083v6). Intravenous injections in HSA-LR or C57BL / 6 mice were performed by single or multiple doses via the tail vein. 5, 7.5, 12.5, 30, or 40 mg / kg of peptide-PMO-CAG7 and 12.5 or 200 mg / kg of PMO were diluted in 0.9% saline to a volume of 5-6 μl / g body weight. Multiple injections were performed at 2-week intervals. Myotonia was assessed and tissues were harvested 2 weeks after the first injection. For long-term experiments, tissues were harvested 3 months after injection. For toxicity measurements, tissues were harvested 1 week later. Urine was tested by ELISAs (R&D cat# MKM100) using samples diluted to fit within the standard curve. Values ​​were normalized to urinary creatinine levels to account for urinary protein concentration (Harwell).

[0342] In situ myotonia / muscle relaxation measurement The isometric contractile properties of the gastrocnemius muscle were studied in situ. Mice were anesthetized with a solution of ketamine / xylazine (80 mg / kg and 15 mg / kg, respectively). The knee and foot were immobilized with clamps and pins. The distal tendon of the gastrocnemius muscle was attached to the lever arm of a servomotor system (305B, Dual-Mode Lever). Data were recorded and analyzed using a PowerLab system (4SP, ADInstruments) and software (Chart 4, ADInstruments). The sciatic nerve (lesioned proximally) was stimulated by a bipolar silver electrode using supramaximal (10-V) square-wave pulses of 0.1 ms duration. Absolute maximal isometric tetanic force (PO) was measured during isometric contractions in response to electrical stimulation (frequency 25–150 Hz, stimulus train 500 ms). Myotonia was measured as the delay in muscle relaxation after PO measurement.

[0343] Cell culture and treatment with peptide-PMO Immortalized myoblasts from healthy controls or DM1 patients with 2600 CTG repeats were cultured in growth medium consisting of M199:DMEM mix (1:4; Life technologies) supplemented with 20% FBS (Life technologies), gentamicin (Life technologies) 50 μg / ml, fetuin 25 μg / ml, bFGF 0.5 ng / ml, EGF 5 ng / ml, and dexamethasone (Sigma-Aldrich) 0.2 μg / ml. Muscle differentiation was induced by switching confluent cell cultures to DMEM supplemented with insulin (Sigma-Aldrich) 5 μg / ml for myoblasts. For treatment, WT or DM1 cells were differentiated for 4 days. The medium was then replaced with fresh differentiation medium containing peptide-PMO complexes at concentrations of 1, 2, 5, 10, 20, or 40 μM. 48 hours after treatment, cells were harvested for analysis. Two days after transfection of peptide-PMO at a concentration of 40 μM in human hepatocytes or at concentrations of 1, 2, 5, 10, 20, or 40 μM in human myoblasts, cell viability was quantified using a fluorescence-based assay (Promega).

[0344] RNA isolation, RT-PCR and qPCR analysis For mouse tissues: Muscles were disrupted in TriReagent (Sigma-Aldrich) using the Fastprep system and Lysing Matrix D tubes (MP biomedicals) prior to RNA extraction. For human cells: Cells were lysed in Proteinase K buffer (NaCl 500 mM, Tris-HCl 10 mM (pH 7.2), MgCl2 1.5 mM, EDTA 10 mM, 2% SDS and Proteinase K 0.5 mg / ml) at 55°C for 45 min prior to RNA extraction. Total RNA was isolated using TriReagent according to the manufacturer's protocol. 1 μg of RNA was reverse transcribed using the M-MLV First Strand Synthesis System (Life Technologies) in a total of 20 μl according to the manufacturer's instructions. 1 μl of cDNA preparation was subsequently used in semi-quantitative PCR analysis (ReddyMix, Thermo Scientific) according to the standard protocol. Primers are shown in Table 3.

[0345] [Table 3]

[0346] PCR amplification was performed for each gene for 25-35 cycles within the linear range of amplification. PCR products were separated on 1.5-2% agarose gels, stained with ethidium bromide, and quantified by ImageJ software. The proportion of exon inclusion was quantified as the percentage of inclusion relative to the total intensity of the isoform signal. To quantify mRNA expression, real-time PCR was performed according to the manufacturer's instructions. The PCR cycle consisted of 50 cycles, including a 15-min denaturation step, followed by 15 s of 94°C denaturation, 20 s of 58°C annealing, and 20 s of 72°C extension.

[0347] Fluorescence in situ hybridization / immunofluorescence Fluorescence in situ hybridization (FISH) experiments were performed as previously described (6) using a Cy3-labeled 2'OMe (CAG)7 probe (Eurogentec). For combined FISH-immunofluorescence, fluorescent immunostaining was performed after the final wash of FISH with rabbit polyclonal anti-MBNL1 antibody followed by secondary Alexa Fluor 488-conjugated goat anti-rabbit (1:500, Life technologies) antibody.

[0348] ELISA-based measurement of oligonucleotide concentrations in tissues A custom hybridization-based ELISA was developed to measure the concentration of PMO oligonucleotides using a phosphorothioate probe with a phosphorothioate linkage (sequence (5'->3') [DIG] C*T*G*C*T*G*C*TGCTGCT*G*C*T*G*C*T*G[BIO] (SEQ ID NO: 96)) dual-labeled with digoxigenin and biotin. The assay had a linear detection range of 5-250 pM (R2>0.99) in mouse serum and cell lysates. The probe was used to detect the concentration of peptide-PMO or intact PMO in eight tissues (brain, kidney, liver, lung, heart, diaphragm, spleen abdominal muscle, and quadriceps muscle) from treated HSA-LR mice.

[0349] result In this study, the inventors used a specific structure of arginine-rich cell-penetrating peptide, and showed that such peptides conjugated to [CAG]7 morpholino phosphorodiamidate oligomers (PMOs) dramatically increased the delivery of ASOs to striated muscle in DM1 model HSA-LR mice after systemic administration, compared to conjugated PMO and peptide carrier conjugate strategies. Thus, treatment with a low dose of the peptide-[CAG]7 PMO complex of the present invention targeting the pathogenic expansion was sufficient to reverse both splicing defects and myotonia in DM1 mice (HSA-LR), and normalized the overall disease-transcriptome. Furthermore, muscle cells (myoblasts) derived from treated DM1 patients showed that the peptide-[CAG]7 PMO complex of the present invention specifically targeted mutant CUGexp-DMPK transcripts and abrogated the deleterious sequestration of MBNL1 splicing factors by nuclear RNA foci, resulting in functional impairment of MBNL1 that causes splicing defects and muscle dysfunction.

[0350] Our results demonstrate that the peptide-[CAG]7PMO of the present invention induces highly potent and durable correction of the DM1-associated phenotype at both the molecular and functional levels, strongly supporting the use of these peptide-conjugates for systemic corrective therapy in DM1.

[0351] The inventors obtained data that conjugates comprising peptide carriers that do not contain artificial amino acids, e.g. X groups, have a wider therapeutic window and a safer toxicity profile than previous cell-penetrating peptides, and therefore constitute more promising candidates to be tested in DM1 patients. These new generations of so-called "DPEP1 and DPEP3" peptides showed high potency in reducing the number of pathogenic foci (Figure 1) and in correcting splicing defects in vitro when coupled to CAG7 repeat antisense oligonucleotide PMO (Figures 2, 3, 4, and 19). None of the tested concentrations caused a decrease in cell viability in human hepatocytes (Figure 7), contrary to similar comparative conjugates formed from known "Pip" carrier peptides: Pip6a-PMO and Pip9b2-PM, which caused significant cell death (>50%) at 40 μM. Many of the concentrations tested did not result in a decrease in cell viability in human myoblasts and compared favorably with similar comparative complexes formed from known "Pip" carrier peptides: Pip6a-PMO and Pip9b2-PM, which caused cell death at lower doses (Figures 5 and 6).

[0352] We then tested whether these novel peptides were effective to correct myotonia and splicing alterations in HSA-LR mice. For this, we tested the leading peptide carriers of the DPEP 1 and 3 series, DPEP1.9 and DPEP3.8, in comparison with the conventional peptide carrier DPEP 5.70. We were able to show that after 2 weeks of treatment with 30 mg / kg of both complexes formed with DPEP3.8 and DPEP1.9, the splicing defects (Figure 4) and myotonia (Figures 8, 9, and 10) were corrected to wild-type levels.

[0353] To provide for delivery of peptide-[CAG]7 PMO conjugates, the biodistribution of conjugates formed with carrier peptides DPEP1.9 and DPEP3.8 versus intact PMO was assessed by ELISA. Detection of PMO in clinically affected tissues in DM1, such as heart and brain, is important for drug delivery development. A single intravenous injection of peptide-[CAG]7 PMO conjugates at 30 mg / kg or three injections of intact PMO at 200 mg / kg (total 600 mg / kg) were performed in HAS-LR mice. Two weeks after injection, the splenic abdominal muscle, quadriceps, diaphragm, heart, and brain were analyzed for PMO detection. Unconjugated intact [CAG]7 PMO was detected at low to undetectable levels in all tissues tested, whereas [CAG]7 PMO conjugated to peptide carriers DPEP1.9 and DPEP3.8 was detected at high levels despite being injected at low doses (>20-fold molar concentration). In general, peptide-[CAG]7PMO complexes were detected at 1-4 nM in quadriceps, abdominal cavity, and diaphragm, and at 1 nM in heart, 2 weeks after injection of 30 mg / kg (FIG. 17).

[0354] [Table 4]

[0355] We also studied the pharmacokinetics of the peptide-[CAG]7PMO complex of the present invention, measured in serum after administration of the peptide-[CAG]7PMO complex at a low dose (5 mg / kg). Five minutes after IV injection, serum concentrations reached 500-800 nM, dropping to 100 nM after 1 hour and 10 nM after 3 hours. Six hours after treatment, concentrations were ∼1 nM, and most of the compound had already disappeared or been delivered to the tissue of interest (Figure 18). Preliminary toxicity evaluation of complexes formed with carrier peptides DPEP3.8 and DPEP1.9 in wild-type mice showed that ALP, ALT, AST, KIM-1, creatinine, BUN, and NGAL levels were similar to control saline injections, in contrast to the fold increases typically caused by currently available peptide carriers from the Pip series. With this preliminary data, we demonstrated that complexes formed from DPEP peptides with [CAG]7 PMO are as active as Pip6a in vivo, yet with a broad therapeutic window (Figures 11, 12, and 21). In addition, the body weight of five HSA-LR mice that received a single injection of the complex formed from DPEP3.8-[CAG]7 at a dose of 30 mg / kg did not show any significant trend compared with the body weight of five HSA-LR mice that received saline injection (FIG. 16). Furthermore, the recovery time of HSA-LR mice after injection of DPEP-based [CAG]7PMO conjugates was shorter than that after injection of conjugates formed with conventional peptide carriers, such as Pip6a (Table 5).

[0356] [Table 5]

[0357] The efficacy of the complex of the invention was evaluated in more detail and it was found that the splicing defect and myotonia were corrected to wild-type levels for at least 3 months after administration of the DPEP peptide-[CAG]7PMO complex (Figures 19 and 20, respectively), and a 50% reduction in mis-splicing and myotonia was measured after administration of 7.5 mg / kg.

[0358] Notably, conjugates formed with conventional peptide carriers, such as Pip6a-[CAG]7PMO, could not be tested at >20 mg / kg without causing high mortality in mice, in contrast to the conjugates of the present invention, where the concentration was increased more than 5-fold without causing any mortality. Furthermore, toxicity screening detected changes in Kim1 levels from saline levels at 2 days after treatment with doses of 30 mg / kg or higher (Figure 21).

[0359] The efficacy and toxicity data show that the complexes of the invention formed with carrier peptides of the DPEP1 and DPEP3 series are particularly active in inhibiting the sequestration of MBNL1 by the expanded CTG repeat in individuals affected by DM1, and inducing low toxicity. These complexes are able to completely correct the DM1 phenotype, both at the molecular level, by normalizing splicing, and at the muscle level, by correcting myotonia to wild-type levels. These novel complexes also have a wider therapeutic window than complexes formed with conventional peptide carriers, and therefore they are closer to clinical reality.

[0360] In summary, we have presented strong evidence supporting that (1) peptide-[CAG]7 PMO blocks the pathogenic interaction of MBNL1 with nuclear mutant CUGexp-RNA and rescues downstream effects on RNA-splicing; (2) the peptide-conjugated antisense oligonucleotide approach delivers therapy to inaccessible tissues such as the heart in the diaphragm; and (3) the strong efficacy of [CAG]7 PMO to directly target disease mutations, combined with the ability of peptide carrier technology to provide a highly potent in vivo therapy, converges with a strong reversal of the DM1 phenotype to wild-type levels in skeletal muscle DM1 mice (HSA-LR) even months after treatment was discontinued. Each of these lines of evidence strongly suggests that peptide-[CAG]7 conjugates are likely to have a strong disease-modifying effect in DM1.

[0361] Indeed, our experiments show that the effects observed in HSA-LR mice do not only prevent the progression of DM1 pathology, but actually result in a reversal of the disease phenotype. The expanded CUG-transcript is already expressed in pups, and HSA-LR mice have a pronounced myotonia that appears by 1 month of age. The animals we used to generate results in support of the present invention were treated at least 2 and 7 months of age, well beyond the time when the molecular and functional phenotype of DM1 develops.

[0362] conclusion Complexes comprising the DPEP carrier peptide and [CAG]7PMO (10 μM) were able to reduce the number of nuclear foci by 50% in DM1 patient and control myoblasts (at doses that did not reduce cell viability). None of the concentrations tested (1-40 μM) caused a decrease in cell viability, compared to comparative complexes formed with other carrier peptides that induced significant cell mortality (>50%) at 20 μM or higher concentrations. Conjugates comprising the DPEP carrier peptide and [CAG]7PMO demonstrated positive pharmacokinetics and biodistribution indicating optimal delivery to clinically affected tissues in DM1. Complexes comprising DPEP carrier peptide and [CAG]7PMO induce 50-90% splicing correction in Clcn1 exon 7a, Serca exon 22, Mbnl1 exon 5, and Ldb3 exon 11 in HSA-LR mice at a dose (30 mg / kg, IV) that is less toxic than comparative complexes formed with other carrier peptides at 12.5 mg / kg. RT-PCR analysis also shows normalization of splicing to wild-type levels using complexes comprising DPEP1.9 and DPEP3.8 at 30 and 40 mg / kg. Splicing correction persisted for at least 3 months after treatment and was significant after single low dose administration (5 and 7.5 mg / kg). Quantitative observations of myotonia and electromyographic myotonia measurements showed that a complex comprising DPEP carrier peptide and [CAG]7PMO reduced myotonia to wild-type levels after a single injection (IV) of 40 mg / kg or 30 mg / kg. A moderate correction of myotonia occurred after four injections of 7.5 mg / kg of a complex comprising DPEP3.8 or DPEP1.9. Conjugates comprising the DPEP carrier peptide and [CAG]7PMO, when injected (IV) at 30 mg / kg, caused shorter periods of lethargy (>1 hour) in wild-type mice than a single injection of 12.5 mg / kg of comparative conjugates formed with other carrier peptides. Urinary biochemistry tests for renal function and blood analysis showed no changes compared to saline in wild-type mice after doses of ≥30 mg / kg, and showed mild changes in HSA-LR Kim1 levels and urinary protein levels.

Claims

1. A conjugate comprising a peptide carrier covalently attached to a therapeutic molecule, The peptide carrier may be selected from the group consisting of RBRRBRRFQILYRBRBR (SEQ ID NO: 27), RBRRBRFQILYRRBRBR (SEQ ID NO: 29), RBRBRFQILYRBRRBRR (SEQ ID NO: 30), RBRRBRRYQFLIRBRBR (SEQ ID NO: 31), RBRRBRRILFQYRBRBR (SEQ ID NO: 32), RBRRBRFQILYRBRBR (SEQ ID NO: 33), RBRRBRFQILYBRBR (SEQ ID NO: 35), RBRRBFQILYRBRBR (SEQ ID NO: 36), RBRRBRRFQILYRBHBH (SEQ ID NO: 37), RB having a sequence selected from the group consisting of RRBRRFQILYHBHBR (SEQ ID NO:38), RBRRBRRFQILYHBRBH (SEQ ID NO:39), RBRRBRRYQFLIRBHBH (SEQ ID NO:40), RBRRBRRILFQYRBHBH (SEQ ID NO:41), RBRHBHRFQILYRBRBR (SEQ ID NO:42), RBRRBRFQILYRBHBH (SEQ ID NO:44), RBRRBRRFQILYHBHBH (SEQ ID NO:52), RBRRBRWWWBRBR (SEQ ID NO:58), and RBRRBRWWPWWBRBR (SEQ ID NO:59); and the therapeutic molecule comprises a nucleic acid, the nucleic acid comprising a plurality of trinucleotide repeats selected from one of CAG, CTG, CGG, GAA, GCC, GGC, CTT, and CCG repeats, the nucleic acid comprising 5 to 20 trinucleotide repeats; Optionally, the peptide is N-acetylated, N-methylated, N-trifluoroacetylated, N-trifluoromethylsulfonylated, or N-methylsulfonylated. A complex characterized by:

2. The complex described in claim 1, wherein the nucleic acid comprises multiple CAG repeats.

3. A complex described in claim 1 or 2, wherein the nucleic acid comprises seven trinucleotide repeats.

4. A complex described in any of claims 1 to 3, wherein the sequence is RBRRBRFQILYBRBR (sequence number 35), RBRRBRRFQILYRBHBH (sequence number 37), or RBRRBRFQILYRBHBH (sequence number 44).

5. A conjugate described in any one of claims 1 to 4, wherein the peptide carrier is covalently linked to the therapeutic molecule by a linker.

6. The complex described in claim 5, wherein the linker is selected from G, BC, XC, C, GGC, BBC, BXC, XBC, X, XX, B, BB, BX, XB, E, GABA, and succinic acid.

7. A conjugate described in claim 5 or 6, wherein the linker is at the C-terminus of the peptide or the N-terminus of the peptide. (a) a peptide carrier RBRRBRFQILYBRBR (SEQ ID NO:35) covalently linked by a β-alanine (B) to an antisense oligonucleotide consisting of 7 CAG repeats; (b) a peptide carrier RBRRBRFQILYBRBR (SEQ ID NO: 35) covalently linked by a glutamic acid (E) to an antisense oligonucleotide consisting of seven CAG repeats; (c) the peptide carrier RBRRBRFQILYBRBR (SEQ ID NO: 35) covalently linked by GABA (Ab) to an antisense oligonucleotide consisting of seven CAG repeats; (d) the peptide carrier RBRRBRRFQILYRBHBH (SEQ ID NO: 37) covalently linked by a β-alanine (B) to an antisense oligonucleotide consisting of seven CAG repeats; (e) a peptide carrier RBRRBRRFQILYRBHBH (SEQ ID NO: 37) covalently linked by a glutamic acid (E) to an antisense oligonucleotide consisting of seven CAG repeats; (f) peptide carrier RBRRBRRFQILYRBHBH (SEQ ID NO: 37) covalently linked to an antisense oligonucleotide consisting of 7 CAG repeats by GABA (Ab); (g) the peptide carrier RBRRBRFQILYRBHBH (SEQ ID NO: 44) covalently linked by a β-alanine (B) to an antisense oligonucleotide consisting of seven CAG repeats; (h) a peptide carrier RBRRBRFQILYRBHBH (SEQ ID NO: 44) covalently linked by a glutamic acid (E) to an antisense oligonucleotide consisting of seven CAG repeats; or (i) A peptide carrier RBRRBRFQILYRBHBH (SEQ ID NO: 44) covalently linked to an antisense oligonucleotide consisting of 7 CAG repeats by GABA (Ab). wherein optionally, the cell penetrating peptide of the conjugate is N-acetylated, N-methylated, N-trifluoroacetylated, N-trifluoromethylsulfonylated, or N-methylsulfonylated.

9. A complex described in any one of claims 1 to 8, wherein the peptide is N-acetylated, N-methylated, N-trifluoroacetylated, N-trifluoromethylsulfonylated, or N-methylsulfonylated.

10. The complex according to any one of claims 5 to 9, wherein the C-terminus of the peptide carrier is linked to the antisense oligonucleotide via a linker.

11. A complex described in any one of claims 1 to 10, wherein the antisense oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO).

12. The complex of claim 11, wherein the 3' end of the PMO is attached to the peptide carrier of the complex via a linker.

13. The complex of claim 1, wherein the peptide carrier is RBRRBRFQILYBRBR (sequence number 35), the peptide carrier is covalently linked at its C-terminus by glutamic acid (E) to the 3'-terminus of a PMO having a sequence consisting of seven CAG repeats, and the N-terminus of the peptide carrier is acetylated.

14. A complex according to any one of claims 1 to 13 for use as a medicine.

15. A conjugate described in any one of claims 1 to 13 for use in the prevention or treatment of a triplet repeat disease.

16. The complex according to claim 15, wherein the triplet repeat disease is selected from a polyglutamine disease or a non-polyglutamine disease.

17. The complex according to claim 15 or 16, wherein the triplet repeat disease is selected from DRPLA (dentatorubral-pallidoluysian atrophy), HD (Huntington's disease), HDL2 (Huntington's disease-like syndrome 2), SBMA (spinal-bulbar muscular atrophy), SCA1 (spinocerebellar ataxia type 1), SCA2 (spinocerebellar ataxia type 2), SCA3 (spinocerebellar ataxia type 3 or Machado-Joseph disease), SCA6 (spinocerebellar ataxia type 6), SCA7 (spinocerebellar ataxia type 73), SCA17 (spinocerebellar ataxia type 17), FRAXA (fragile X syndrome), FXTAS (fragile X-associated tremor / ataxia syndrome), FRAXE (fragile XE mental retardation), FRDA (Friedreich's ataxia), DM1 (myotonic dystrophy type 1), SCA8 (spinocerebellar ataxia type 8), and SCA12 (spinocerebellar ataxia type 12).

18. The complex described in any one of claims 15 to 17, wherein the triplet repeat disease is myotonic dystrophy type 1 (DM1).

Images