Compositions and methods for improving mitochondrial function and treating neurodegenerative diseases and cognitive disorders

Abstract

Compositions are provided that include compounds or precursors of said compounds that can be used for a variety of therapeutic applications, including treating and / or preventing diseases or disorders associated with reduced or insufficient mitochondrial activity, including, for example, aging or stress, diabetes, obesity, and neurodegenerative diseases. The compounds generally relate to urolithins and their precursors, including, but not limited to, ellagitannins and urolithin A. In some embodiments, the compositions are provided in or as a food or nutritional supplement. These compounds and compositions can also be advantageously used in generally healthy individuals to increase or maintain metabolic rate, reduce body fat percentage, increase or maintain muscle mass, manage weight, improve or maintain mental performance (including memory), improve or maintain muscle function, improve or maintain mood, and manage stress.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority under 35 U.S.C. §119(e) to U.S. Provisional Application No. 61 / 426,957, filed December 23, 2010. [Technical field]

[0002] The present invention relates to compositions and methods for enhancing mitochondrial function and treating neurodegenerative diseases and cognitive disorders. [Background technology]

[0003] Ellagitannins are monomeric, oligomeric and polymeric polyphenols that are abundant in some fruits, berries and nuts, such as pomegranates, raspberries, strawberries, black raspberries, walnuts and almonds. Fruits and berries are widely consumed fresh and as beverages, such as juices, which have been reported to promote health.

[0004] In commercial juice processing, ellagitannins, which are particularly abundant in some fruit skins, are extracted in large quantities into the juice. Ellagitannins belong to a chemical class of hydrolyzable tannins that release ellagic acid upon hydrolysis. In vitro studies suggest that ellagitannins may have antioxidant, antiatherogenic, antithrombotic, anti-inflammatory and antiangiogenic effects at concentrations ranging from 10 to 100 micromolar (μM). Fruits may have different predominant ellagitannins; for example, in juice prepared from pomegranate, the predominant ellagitannin is punicalagin [2,3 hexahydroxydiphenoyl-4,6-gallagylglucose], which exists as a mixture of isomers. Strong antioxidant properties of pomegranate juice have been reported, due to the high content of punicalagin isomers, which may reach levels of >2 g per liter of juice. Ellagitannins have also been identified as active antiatherogenic compounds in pomegranate juice. It has also been suggested that pomegranate ellagitannins and pomegranate fruit extract inhibit the proliferation of human cancer cells and regulate inflammatory intracellular signaling pathways and apoptosis. For example, see Non-Patent Documents 1-5. It has also been reported that pomegranate fruit extract suppresses the growth of prostate tumors and reduces prostate serum antigen (PSA) levels in athymic nude mice transplanted with CWR22Rv1 prostate cells (Non-Patent Document 5).

[0005] Unfortunately, for the most part, ellagitannins are poorly absorbed in the human gastrointestinal tract, however, many metabolites derived from ellagitannins are absorbed by the human gastrointestinal tract, including certain metabolites ultimately produced in the gastrointestinal tract by commensal microorganisms (i.e., the gut microbiota).

[0006] Ellagitannins release ellagic acid under physiological conditions in vivo, which is then gradually metabolized by the gut microbiota in the intestine to produce urolithin D, urolithin C, urolithin A (UA) and urolithin B (UB). When the metabolites are absorbed, they are glucuronidated, and in the liver they are further metabolized to produce glucuronides and / or sulfates, and a combination of the metabolites is secreted in the bile duct.

[0007] Urolithins are metabolic products of ellagitannins such as ellagic acid, punicalagin (PA), punicalin (PB), tellimagrandin (TL), and others (Non-Patent Documents 6 and 7). Ellagic acid (EA) is abundant in pomegranate juice (Non-Patent Document 8). The ellagitannin tellimagrandin (TL) has been previously isolated and characterized from pomegranate and other plant sources (Non-Patent Documents 9-11). The structural formulas of UA, PA, PB, EA, and TL are shown in Figure 1.

[0008] Enormous efforts have been made to understand the mechanisms of metabolic disease, neurodegeneration and cognitive decline so that therapeutic modalities, including those based on natural products, can be better designed. One central observation is the role of mitochondria in reducing energy production, which corresponds with oxidative stress and increased apoptosis, and plays a key role in degenerative diseases and the aging process. Various degenerative diseases have now been shown to be caused by mutations in mitochondrial genes encoded by mitochondrial DNA (mtDNA) or nuclear DNA (nDNA). Importantly, somatic mtDNA mutations accumulate with age in postmitotic tissues in association with aging-related mitochondrial dysfunction and are considered to be important factors in aging and senescence. Genetic diseases can arise as a result of mtDNA base substitution and rearrangement mutations and can affect the CNS, heart and skeletal muscles and kidneys, endocrine and blood systems.

[0009] Mitochondria produce most of the cellular energy through oxidative phosphorylation (OXPHOS) and most of the toxic reactive oxygen species (ROS) as by-products. Genetic abnormalities that inhibit OXPHOS also cause the redirection of OXPHOS electrons into ROS production, thus increasing oxidative stress. Reduced mitochondrial energy production and increased oxidative stress can affect the mitochondrial permeability transition pore (mtPTP) and initiate programmed cell death (apoptosis). The interplay of these three factors is thought to play a major role in the pathophysiology of degenerative diseases and the aging process, which affect all tissues of the body.

[0010] In normal brain, optimal cognitive function mainly depends on neuronal activity and communication between neurons, which are very complex cells that can transmit electrical signals and induce chemical neurotransmission. Neuronal function depends on long and complex cell processes that can extend over centimeters or even meters to connect neurons or target cells, and can make more than 100,000 synaptic contacts. As such, neurons are highly dependent on energy supply and therefore subject to oxidative stress damage. Cognitive function depends on the delicate balance of intracellular signaling that occurs within complex neuronal networks. Optimal cognitive function can be impaired by many factors, such as aging, cellular stress, chronic stress and neurodegenerative disorders. Cognitive decline can be characterized by a decline in ability in thinking, learning, memory, attention and / or psychological skills, as well as depression and anxiety.

[0011] Mitochondrial function has also been shown to be important in metabolic diseases. Diabetes and obesity have been linked to mitochondrial dysfunction. Mitochondrial coupling efficiency or the rate of oxygen consumption required to generate ATP is related to obesity level, suggesting that higher coupling efficiency may result in greater accumulation of fat accumulation (Non-Patent Document 12). In diabetes, recent studies have suggested that mitochondrial dysfunction, as a result of insufficient energy supply or impaired insulin signaling pathway, causes insulin insensitivity in muscle cells and fat cells (Non-Patent Document 13). [Prior art documents] [Non-patent literature]

[0012] [Non-Patent Document 1] Seeram et al. (2005) J. Nutr. Biochem. 16:360-7 [Non-Patent Document 2] Adams et al.(2006)J.Agric.Food Chem.54:980-85 [Non-Patent Document 3] Afaq et al.(2005)Photochem.Photobiol.81:38-45 [Non-Patent Document 4] Afaq et al.(2005)Int.J.Cancer.113:423-33 [Non-Patent Document 5] Malik et al.(2005)Proc.Natl.Acad.Sci.102:14813-8 [Non-Patent Document 6] Cerda, Espin et al. (2004) Eur.J.Nutr.43:205-20 [Non-Patent Document 7] Cerda, Periago et al. (2005) J.Agric.Food Chem.53:5571-6 [Non-Patent Document 8] Gil, Tomas-Barberan et al. (2000) J.Agric.Food Chem.48:4581-9 [Non-Patent Document 9] Tanaka, Nonaka et al. (1986)Chem.Pharm.Bull.34:650-655 [Non-Patent Document 10] Tanaka, Nonaka et al. (1986)Chem.Pharm.Bull.34:656-663 [Non-Patent Document 11] Satomi, Umemura et al. (1993) Biol.Pharm.Bull.16:787-90 [Non-Patent Document 12] Harper, Green et al. (2008) Annu.Rev.Nutr.28:13-33 [Non-Patent Document 13] Wang,Wang et al.(2010)Ann.NYAcad.Sci.1201:157-65 Summary of the Invention

[0013] The present invention provides compositions that contain compounds or precursors of said compounds that can be used for various therapeutic applications, including treating and / or preventing diseases or disorders associated with reduced or insufficient mitochondrial activity, including, for example, aging or stress, diabetes, obesity and neurodegenerative diseases.These above-mentioned compounds and compositions can also be advantageously used in generally healthy people to improve or maintain metabolic rate, reduce body fat percentage, increase or maintain muscle mass, control body weight, improve or maintain mental performance (including memory), improve or maintain muscle function, improve or maintain mood, and manage stress.

[0014] It is an object of the present invention to provide a plant extract, an active fraction thereof, or one or more active components or metabolites isolatable therefrom or synthesized, for use in the prevention or treatment of disease conditions caused by or characterized by: (i) insufficient mitochondrial activity; (ii) metabolic diseases such as diabetes and obesity; (iii) cognitive decline; or (iv) mood disorders.

[0015] Thus, in a first aspect, the present invention provides a fruit extract, an active fraction thereof, or one or more active ingredients isolatable therefrom, for use as an inducer of mitochondrial function.

[0016] As used herein, the term "fraction" refers to a purified or partially purified extract.

[0017] In another aspect, the present invention provides a fruit extract, an active fraction thereof or one or more active ingredients isolatable therefrom, for use in the prevention or treatment of a disease condition caused by or characterised by mitochondrial dysfunction.

[0018] In another aspect, the present invention provides the use of a fruit, an extract, an active fraction thereof, or one or more active ingredients isolatable therefrom, as defined herein below, for the manufacture of a medicament for use in (i) the prevention or treatment of disease conditions caused by or characterized by mitochondrial dysfunction; (ii) the enhancement of cognitive or muscular function. Such disease conditions may include, but are not limited to, neurodegenerative diseases, cognitive disorders, mood disorders, anxiety disorders, metabolic diseases, diabetes and obesity.

[0019] In another aspect, the present invention provides a method for the manufacture of a medicament for use in (i) the prevention or treatment of a disease condition caused or characterized by mitochondrial dysfunction; (ii) the enhancement of cognitive or muscular function, characterized in that the method comprises the use of the fruit, or an extract thereof, or an active fraction thereof, or one or more active ingredients isolatable therefrom, as an essential ingredient of the medicament, as defined herein above.

[0020] In a still further aspect, the present invention provides a pharmaceutical composition comprising an active ingredient derived from, or isolatable from, the fruit, an extract, an active fraction, or one or more active ingredients isolatable therefrom, as previously defined herein, and a pharma- ceutically acceptable carrier.

[0021] It is an object of the present invention to provide a plant extract, an active fraction thereof, or one or more active components or metabolites isolatable therefrom or synthesized, for use in treating a disease or disorder in a subject that would benefit from increased mitochondrial activity to improve (i) brain function, (ii) metabolic function including diabetes or obesity, (iii) muscle function and (iv) elevated tissue ATP levels.

[0022] It is an object of the present invention to provide extracts, compositions and compounds that are neuroprotective, neurotrophic and / or promote neurite outgrowth, resulting in improved cognitive function, and methods of using these compounds and compositions.

[0023] The object of the present invention is to provide compounds and compositions that improve, protect and maintain brain function and cognition. Another object of the present invention is to improve, prevent and manage mood disorders. Another object of the present invention is to prevent disorders or conditions that are stress-induced or associated with stress.

[0024] The object of the present invention is to provide a neuroprotective compound for protecting the brain from damage and improving cognitive ability and memory in healthy adults.Another object of the present invention is to provide a novel compound that stimulates neuroplasticity.It is well known that neuroplasticity is a central process required for memory and cognitive function.Such compounds can affect neurite extension, the number of branches per cell, the average process per cell, and also the number of synapses formed.

[0025] The present invention also relates to a number of polyphenolic compounds related to ellagitannins and their derivatives as bioactive natural compounds found in pomegranate and other fruits, and to bioactive natural extracts containing these compounds. These compounds include ellagitannins, punicalagins and ellagic acid, all found in pomegranate but also isolated from other fruits and berries, and metabolites of these compounds. As disclosed herein, these compounds have now been shown to have beneficial effects on (i) mitochondrial function, (ii) cellular metabolism, and (iii) neuroplasticity.

[0026] Using in vitro models of neurite outgrowth and neurite formation in neuronal culture and primary culture cells, various compounds were investigated for their beneficial effects.As mentioned above, aging, neurodegeneration and chronic stress have a negative effect on neurite outgrowth.Notably, it was found that the compounds of the present invention have neuroprotective properties, show strong stimulatory activity in PC-12 cells and primary culture midbrain neurons, and improve cognitive function and memory in animal models.

[0027] In one aspect, the present invention relates to a composition, such as a medicine, a medical food, a functional food, a food additive or a dietary supplement, that contains the compound of the present invention or a mixture thereof.The composition may optionally also contain an additional therapeutic agent or may be administered in combination with another therapeutic compound.Also provided is a packaged product that contains the above-mentioned composition and a label and / or instructions for use in improving memory and cognitive ability and / or for treating diseases or conditions that involve damage to the brain that are typical for conditions found in the elderly.

[0028] One aspect of the present invention is a food product or nutritional supplement comprising an effective amount of pomegranate extract for the treatment or prevention of a condition selected from the group consisting of obesity, reduced metabolic rate, metabolic syndrome, diabetes, cardiovascular disease, hyperlipidemia, neurodegenerative disease, cognitive disorders, mood disorders, stress and anxiety disorders; for weight management; or for improving muscle function or mental performance.

[0029] One aspect of the invention is a food product or nutritional supplement comprising an effective amount of ellagitannins for the treatment or prevention of a condition selected from the group consisting of obesity, reduced metabolic rate, metabolic syndrome, diabetes, cardiovascular disease, hyperlipidemia, neurodegenerative disease, cognitive disorders, mood disorders, stress and anxiety disorders; for weight management; or for improving muscle function or mental performance.

[0030] One aspect of the invention is a food or nutritional supplement comprising an effective amount of punicalagin for the treatment or prevention of a condition selected from the group consisting of obesity, reduced metabolic rate, metabolic syndrome, diabetes, cardiovascular disease, hyperlipidemia, neurodegenerative disease, cognitive disorders, mood disorders, stress and anxiety disorders; for weight management; or for improving muscle function or mental performance.

[0031] One aspect of the invention is a food product or nutritional supplement comprising an effective amount of ellagic acid for the treatment or prevention of a condition selected from the group consisting of obesity, reduced metabolic rate, metabolic syndrome, diabetes, cardiovascular disease, hyperlipidemia, neurodegenerative disease, cognitive disorders, mood disorders, stress and anxiety disorders; for weight management; or for improving muscle function or mental performance.

[0032] One aspect of the invention is a food product or nutritional supplement comprising an effective amount of a urolithin for: treating or preventing a condition selected from the group consisting of obesity, reduced metabolic rate, metabolic syndrome, diabetes, cardiovascular disease, hyperlipidemia, neurodegenerative disease, cognitive disorders, mood disorders, stress and anxiety disorders; for weight management; or for improving muscle function or mental performance.

[0033] In each of the foregoing, in one embodiment the condition is obesity.

[0034] In each of the foregoing, in one embodiment the symptom is a reduced metabolic rate.

[0035] In each of the foregoing, in one embodiment the condition is metabolic syndrome.

[0036] In each of the foregoing, in one embodiment the condition is diabetes.

[0037] In each of the foregoing, in one embodiment the condition is cardiovascular disease.

[0038] In each of the foregoing, in one embodiment the condition is hyperlipidemia.

[0039] In each of the foregoing, in one embodiment the condition is a neurodegenerative disease.

[0040] In each of the foregoing, in one embodiment the symptom is cognitive impairment.

[0041] In each of the foregoing, in one embodiment the condition is a mood disorder.

[0042] In each of the foregoing, in one embodiment the symptom is stress.

[0043] In each of the foregoing, in one embodiment the condition is an anxiety disorder.

[0044] In each of the foregoing, in one embodiment the food product or nutritional supplement is for weight management.

[0045] In each of the foregoing, in one embodiment the food product or nutritional supplement is for improving muscle function.

[0046] In each of the foregoing, in one embodiment the food product or nutritional supplement is for enhancing mental performance.

[0047] One aspect of the invention is a method of improving or maintaining mitochondrial function comprising contacting a cell with an effective amount of a urolithin or a precursor thereof to improve mitochondrial function.

[0048] One aspect of the invention is a method of treating, preventing or managing a mitochondrial-associated disease or condition associated with altered mitochondrial function or reduced mitochondrial density, comprising administering to a subject in need thereof a therapeutically effective amount of a urolithin or a precursor thereof to treat the disease or condition associated with altered mitochondrial function or reduced mitochondrial density.

[0049] One aspect of the invention is a method of increasing metabolic rate comprising administering to a subject in need thereof an effective amount of a urolithin or a precursor thereof to increase metabolic rate.

[0050] One aspect of the invention is a method of preventing or treating metabolic syndrome, the method comprising administering to a subject in need thereof an effective amount of a urolithin or a precursor thereof to prevent or treat metabolic syndrome.

[0051] One aspect of the invention is a method of preventing or treating obesity, the method comprising administering to a subject in need thereof an effective amount of a urolithin or a precursor thereof to prevent or treat obesity.

[0052] One aspect of the invention is a method of preventing or treating cardiovascular disease comprising administering to a subject in need thereof an effective amount of a urolithin or a precursor thereof to prevent or treat cardiovascular disease.

[0053] One aspect of the invention is a method of treating hyperlipidemia. The method comprises administering to a subject in need thereof an effective amount of a urolithin or a precursor thereof to treat hyperlipidemia. In one embodiment, the hyperlipidemia is hypertriglyceridemia. In one embodiment, the hyperlipidemia is increased free fatty acids.

[0054] One aspect of the invention is a method of treating a metabolic disease. The method comprises administering to a subject in need thereof a therapeutically effective amount of a urolithin or a precursor thereof to treat the metabolic disease. In one embodiment, the metabolic disease is diabetes. In one embodiment, the metabolic disease is obesity.

[0055] One aspect of the invention is a method of treating a neurodegenerative disease. The method comprises administering to a subject in need thereof a therapeutically effective amount of a urolithin or a precursor thereof to treat the neurodegenerative disease. In one embodiment, the neurodegenerative disease is AIDS dementia, Alzheimer's disease, amyotrophic lateral sclerosis, adrenoleukodystrophy, Alexander disease, Alpers disease, ataxia telangiectasia, Batten disease, bovine spongiform encephalopathy (BSE), Canavan disease, corticobasal degeneration, Creutzfeldt-Jakob disease, dementia with Lewy bodies, fatal familial insomnia, frontotemporal lobar degeneration, Huntington's disease, Kennedy disease, The neurodegenerative disease is selected from the group consisting of Krabbe disease, Lyme disease, Machado-Joseph disease, multiple sclerosis, multiple system atrophy, neuroacanthocytosis, Niemann-Pick disease, Parkinson's disease, Pick's disease, primary lateral sclerosis, progressive supranuclear palsy, Refsum's disease, Sandhoff's disease, myelolytic diffuse sclerosis, spinocerebellar ataxia, subacute combined spinal degeneration, tabes dorsalis, Tay-Sachs disease, toxic encephalopathy, transmissible spongiform encephalopathy, and wobbly hedgehog syndrome. In one embodiment, the neurodegenerative disease is selected from the group consisting of Alzheimer's disease, amyotrophic lateral sclerosis, Huntington's disease, and Parkinson's disease. In one embodiment, the neurodegenerative disease is Alzheimer's disease.

[0056] One aspect of the present invention is a method for improving cognitive function. The method comprises administering an effective amount of a urolithin or a precursor thereof to a subject in need thereof to improve cognitive function. In one embodiment, the cognitive function is selected from the group consisting of perception, memory, attention, speech comprehension, speech generation, reading comprehension, image generation, learning, and reasoning. In one embodiment, the cognitive function is selected from the group consisting of perception, memory, attention, and reasoning. In one embodiment, the cognitive function is memory.

[0057] One aspect of the present invention is a method for treating cognitive impairment. The method comprises administering a therapeutically effective amount of a urolithin or a precursor thereof to a subject in need thereof to treat the cognitive impairment. In one embodiment, the cognitive impairment is selected from the group consisting of delirium, dementia, learning disability, attention deficit disorder (ADD) and attention deficit hyperactivity disorder (ADHD). In one embodiment, the cognitive impairment is a learning disability. In one embodiment, the cognitive impairment is an attention deficit disorder (ADD). In one embodiment, the cognitive impairment is an attention deficit hyperactivity disorder (ADHD).

[0058] One aspect of the invention is a method of treating a stress-induced or stress-related cognitive disorder comprising administering to a subject in need thereof a therapeutically effective amount of a urolithin or a precursor thereof to treat the stress-induced or stress-related disorder.

[0059] One aspect of the present invention is a method for treating a mood disorder. The method comprises administering a therapeutically effective amount of a urolithin or a precursor thereof to a subject in need thereof to treat the mood disorder. In one embodiment, the mood disorder is selected from the group consisting of depression, postpartum depression, dysthymia, and bipolar disorder. In one embodiment, the mood disorder is depression. In one embodiment, the mood disorder is dysthymia.

[0060] One aspect of the invention is a method of treating a stress-induced or stress-related mood disorder, such as dysthymia, comprising administering to a subject in need thereof a therapeutically effective amount of a urolithin or a precursor thereof to treat the stress-induced or stress-related mood disorder.

[0061] One aspect of the present invention is a method for treating anxiety disorder.The method comprises administering a therapeutically effective amount of urolithin or its precursor to a subject in need thereof to treat anxiety disorder.In one embodiment, the anxiety disorder is selected from the group consisting of generalized anxiety disorder, panic disorder, panic disorder with agoraphobia, agoraphobia, social anxiety disorder, obsessive-compulsive disorder and post-traumatic stress disorder.In one embodiment, the anxiety disorder is generalized anxiety disorder.In one embodiment, the anxiety disorder is post-traumatic stress disorder.

[0062] One aspect of the invention is a method of treating stress-induced or stress-related anxiety comprising administering to a subject in need thereof a therapeutically effective amount of a urolithin or a precursor thereof to treat stress-induced or stress-related anxiety.

[0063] One aspect of the invention is a method of enhancing muscle function, comprising administering to a subject in need thereof a therapeutically effective amount of a urolithin or a precursor thereof to improve muscle function. In one embodiment, the muscle function is selected from the group consisting of strength, speed and endurance.

[0064] One aspect of the present invention is a method for treating a muscle or neuromuscular disease. The method comprises administering a therapeutically effective amount of a urolithin or a precursor thereof to a subject in need thereof to treat the muscle or neuromuscular disease. In one embodiment, the muscle or neuromuscular disease is a myopathy. In one embodiment, the muscle or neuromuscular disease is a muscular dystrophy. In one embodiment, the muscle or neuromuscular disease is a Duchenne muscular dystrophy.

[0065] One aspect of the invention is a method of promoting neurite outgrowth, the method comprising contacting a neuronal cell with an effective amount of a urolithin or a precursor thereof to promote neurite outgrowth. In one embodiment, the contacting comprises administering a therapeutically effective amount of a urolithin or a precursor thereof to a subject in need of such treatment to promote neurite outgrowth.

[0066] The following embodiments may relate to each of the aspects and embodiments of the invention described herein, and may relate to each other where appropriate.

[0067] In one embodiment, the urolithin or precursor thereof is an isolated urolithin.

[0068] In one embodiment, the urolithin or precursor thereof is an isolated urolithin precursor.

[0069] In one embodiment, the urolithin is selected from the group consisting of urolithin A, urolithin B, urolithin C, urolithin D, and metabolites thereof, including, for example, their glucuronidated, methylated, and sulfated forms, and combinations of these urolithins.

[0070] In one embodiment, the urolithin or precursor thereof is administered in a whole food source selected from the group consisting of berries, grapes, pomegranate, rose hips and nuts.

[0071] In one embodiment, the urolithin or precursor thereof is administered as a processed food product based on a natural food selected from the group consisting of berries, grapes, pomegranate, rose hips and nuts, e.g., comprising a fruit juice, concentrate or extract.

[0072] In one embodiment, the urolithin or precursor thereof is administered as pomegranate juice, concentrate, or extract.

[0073] In one embodiment, the urolithin or precursor thereof is administered as an ellagitannin.

[0074] In one embodiment, the urolithin or precursor thereof is administered as punicalagin.

[0075] In one embodiment, the urolithin or precursor thereof is administered as ellagic acid.

[0076] In one embodiment, the urolithin or precursor thereof is administered as a urolithin.

[0077] In one embodiment, the urolithin or precursor thereof is administered orally.

[0078] In one embodiment, the urolithin or precursor thereof is administered parenterally.

[0079] In one embodiment, the urolithin or precursor thereof is administered at least once a week. In various embodiments, the urolithin or precursor thereof is administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 times a week.

[0080] In one embodiment, the urolithin or precursor thereof is administered at least once daily, in various embodiments, the urolithin or precursor thereof is administered 1, 2, 3, 4, 5, 6, 7, or 8 times daily.

[0081] In one embodiment, the urolithin or precursor thereof is administered in a dose equal to or equivalent to 0.1-150 milligrams (mg) of urolithin per kilogram (kg) of body weight. In one embodiment, the urolithin or precursor thereof is administered in a dose equal to or equivalent to 2-120 mg urolithin per kg of body weight. In one embodiment, the urolithin or precursor thereof is administered in a dose equal to or equivalent to 4-90 mg urolithin per kg of body weight. In one embodiment, the urolithin or precursor thereof is administered in a dose equal to or equivalent to 8-30 mg urolithin per kg of body weight.

[0082] In one embodiment, the urolithin or precursor thereof is administered at a dose sufficient to achieve a peak serum level of at least 0.001 micromolar (μM). In one embodiment, the urolithin or precursor thereof is administered at a dose sufficient to achieve a peak serum level of at least 0.01 μM. In one embodiment, the urolithin or precursor thereof is administered at a dose sufficient to achieve a peak serum level of at least 0.1 μM. In one embodiment, the urolithin or precursor thereof is administered at a dose sufficient to achieve a peak serum level of at least 1 μM. In one embodiment, the urolithin or precursor thereof is administered at a dose sufficient to achieve a peak serum level of at least 10 μM.

[0083] In one embodiment, the urolithin or precursor thereof is administered at a dose sufficient to achieve a sustained serum level of at least 0.001 micromolar (μM). In one embodiment, the urolithin or precursor thereof is administered at a dose sufficient to achieve a sustained serum level of at least 0.01 μM. In one embodiment, the urolithin or precursor thereof is administered at a dose sufficient to achieve a sustained serum level of at least 0.1 μM. In one embodiment, the urolithin or precursor thereof is administered at a dose sufficient to achieve a sustained serum level of at least 1 μM. In one embodiment, the urolithin or precursor thereof is administered at a dose sufficient to achieve a sustained serum level of at least 10 μM.

[0084] In one embodiment, the subject is not being administered a urolithin or its precursor to treat another condition requiring administration of a urolithin or its precursor or metabolite, selected from the group consisting of atherosclerosis, thrombosis, cancer, unwanted angiogenesis, infection and inflammation. [Brief description of the drawings]

[0085] [Figure 1] Structural formulas of urolithin A (UA), ellagic acid (EA), tellimagrandin (TL), punicalagin (PA), and punicalin (PB). [Diagram 2] Ellagic acid (EA) and its metabolites urolithin D (UD), urolithin C (UC), urolithin A (UA) and urolithin B (UB) are produced by the intestinal microbiota of animals, including humans. [Diagram 3] A pair of bar graphs showing mitochondrial gene expression levels in response to the indicated concentrations of ellagic acid (upper panel) and urolithin A (lower panel). [Figure 4] Bar graph showing citrate synthase (CS) activity measured in vitro in the presence of the indicated concentrations of punicalagin, ellagic acid, urolithin A or negative control. [Diagram 5](A) Combined immunoblots (IB) showing the effect of the indicated concentrations of ellagic acid (EA) and urolithin A (UA) on levels of AMP-activated protein kinase (AMPK) and activated phosphorylated AMPK (P-AMPK). P-AMPK: phosphorylated AMPK. Control: negative control; RSV: resveratrol positive control. (B) Bar graph showing densitometric analysis of bands in (A) showing the relative levels of activated P-AMPK after treatment compared to control treated cells. [Figure 6] Bar graph showing total cell number for cultures of PC-12 cells following treatment with 0.5 μM of the indicated compounds. PA, punicalagin; PB, punicalin; UA, urolithin A; EA, ellagic acid; Tl, tellimagrandin. [Figure 7] Bar graph showing average neurite outgrowth (μm) in PC-12 cells following 0.5 μM treatment with the indicated compounds. Outgrowth is shown per cell. SP, SP600125; dbcAMP, dibutyryl cyclic AMP; PA, punicalagin; PB, punicalin; UA, urolithin A; EA, ellagic acid; Tl, tellimagrandin. [Figure 8] Bar graph showing the percentage of PC-12 cells exhibiting extensive neurite outgrowth (>20 μM) following 0.5 μM treatment with the indicated compounds. SP, SP600125; dbcAMP, dibutyryl cyclic AMP; PA, punicalagin; PB, punicalin; UA, urolithin A; EA, ellagic acid; Tl, tellimagrandin. [Figure 9] Bar graph showing average process formation in PC-12 cells following treatment with 0.5 μM of the indicated compounds. SP, SP600125; dbcAMP, dibutyryl cyclic AMP; PA, punicalagin; PB, punicalin; UA, urolithin A; EA, ellagic acid; Tl, tellimagrandin. [Figure 10] Bar graph showing the average outgrowth per cell of dopaminergic tyrosine hydroxylase (TH)-positive primary cultured neurons following treatment with 0.1 μM of the indicated compounds. SP, SP600125; dbcAMP, dibutyryl cyclic AMP; UA, urolithin A; EA, ellagic acid; Tl, tellimagrandin. [Figure 11]Bar graph showing the % of dopaminergic TH-positive primary cultured neurons exhibiting extensive neurite outgrowth (>20 μM) following 0.1 μM treatment with the indicated compounds. SP, SP600125; dbcAMP, dibutyryl cyclic AMP; UA, urolithin A; EA, ellagic acid; Tl, tellimagrandin. [Figure 12] Bar graph showing the mean number of processes formed in dopaminergic TH-positive cultured primary neurons following treatment with 0.1 μM of the indicated compounds. SP, SP600125; dbcAMP, dibutyryl cyclic AMP; UA, urolithin A; EA, ellagic acid; Tl, tellimagrandin. [Figure 13] Bar graph showing maximum process length in dopaminergic TH-positive cultured primary neurons following treatment with 0.1 μM of the indicated compounds. SP, SP600125; dbcAMP, dibutyryl cyclic AMP; UA, urolithin A; EA, ellagic acid; Tl, tellimagrandin. [Figure 14] Bar graph showing the average number of branches per dopaminergic TH-positive primary cultured neurons following treatment with 0.1 μM of the indicated compounds. SP, SP600125; dbcAMP, dibutyryl cyclic AMP; UA, urolithin A; EA, ellagic acid; Tl, tellimagrandin. [Figure 15] Bar graph showing the mean number of dendrites per dopaminergic TH-positive primary cultured neurons following treatment with 0.1 μM of the indicated compounds. SP, SP600125; dbcAMP, dibutyryl cyclic AMP; UA, urolithin A; EA, ellagic acid; Tl, tellimagrandin. [Figure 16] Bar graph showing the average dendritic length per dopaminergic TH-positive primary cultured neurons following treatment with 0.1 μM of the indicated compounds. SP, SP600125; dbcAMP, dibutyryl cyclic AMP; UA, urolithin A; EA, ellagic acid; Tl, tellimagrandin. [Figure 17A]Triplicate bar graph showing the effect of Urolithin A, Punicalagin and Pomegranate Extract (PE) treatment during the development of obesity in high-fat-fed (HFD) mice. Urolithin A was administered as a food admix; PE and Punicalagin were administered by gavage. Body weight follow-up was expressed as percentage gain compared to initial body weight. Group composition: HFD control (food admix): n=10; HFD control (gavage): n=10; HFD+Urolithin A (food admix): n=9; HFD+Punicalagin (gavage): n=8; HFD+PE (gavage): n=7. Results are expressed as mean ± SEM. For panel A, results were analyzed by 2-way ANOVA. p-values ​​as indicated. [Figure 17B] Triplicate bar graph showing the effect of Urolithin A, Punicalagin and Pomegranate Extract (PE) treatment on the development of obesity in high-fat-fed (HFD) mice. Urolithin A was administered as a diet admix; PE and Punicalagin were administered by gavage. Percentage of fat mass measured by EchoMRI after 5 weeks of treatment. Group composition: HFD control (diet admix): n=10; HFD control (gavage): n=10; HFD+Urolithin A (diet admix): n=9; HFD+Punicalagin (gavage): n=8; HFD+PE (gavage): n=7. Results are expressed as mean ± SEM. *p<0.05 (Student's t-test). [Figure 17C] Triplicate bar graph showing the effect of Urolithin A, Punicalagin and Pomegranate Extract (PE) treatment on the development of obesity in high-fat-fed (HFD) mice. Urolithin A was administered as a diet admix; PE and Punicalagin were administered by gavage. Percentage of lean mass measured by EchoMRI after 5 weeks of treatment. Group composition: HFD control (diet admix): n=10; HFD control (gavage): n=10; HFD+Urolithin A (diet admix): n=9; HFD+Punicalagin (gavage): n=8; HFD+PE (gavage): n=7. Results are expressed as mean ± SEM. *p<0.05 (Student's t-test). [Figure 18]Two pairs of bar graphs showing the effect of ellagic acid and urolithin A on lean mass and fat mass in mice fed a standard chow diet. (A) Percentage of lean mass (muscle) measured by EchoMRI after 2 weeks of treatment. (B) Percentage of fat mass (muscle) measured by EchoMRI after 2 weeks of treatment. Group composition: chow control (diet mix): n=8; chow + ellagic acid (diet mix): n=7; chow + urolithin A (diet mix): n=7. Results are expressed as mean ± SEM. *p<0.05 (Student's t-test). [Figure 19] A pair of line graphs and a corresponding pair of bar graphs showing the effect of ellagic acid and urolithin A on oxygen consumption in standard mice fed a standard diet. (A) Follow-up of oxygen consumption over 20 hours. The black bars correspond to the dark phase (7 am to 7 pm). The rest correspond to the light phase. (B) Oxygen consumption was expressed as the area under the curve (AUC). Group composition: diet control (diet mix): n=8; diet + ellagic acid (diet mix): n=7; diet + urolithin A (diet mix): n=7. Results are expressed as mean ± SEM. *p<0.05 (Student's t-test). For panel A, the results were analyzed with a two-way ANOVA. p-values ​​are indicated (diet control vs. diet + treatment). [Figure 20] A series of graphs and corresponding series of bar graphs showing the effect of Urolithin A, Punicalagin and Pomegranate Extract (PE) on oxygen consumption in mice fed a high fat diet (HFD). Follow-up of oxygen consumption over 20 hours. The black bars correspond to the dark phase (7 am to 7 pm). The rest correspond to the light phase. (B) Oxygen consumption was expressed as area under the curve (AUC). Group composition: HFD control (food mixture): n=10; HFD control (gavage): n=10; HFD+Urolithin A (food mixture): n=9; HFD+Punicalagin (gavage): n=8; HFD+PE (gavage): n=7. Results are expressed as mean ± SEM. *p<0.05 (Student's t-test). For panel A, results were analyzed with 2-way ANOVA. [Figure 21]A pair of graphs and a corresponding pair of bar graphs showing the effect of ellagic acid and urolithin A on the respiratory exchange ratio (RER) in mice fed a standard diet. (A) Follow-up of RER over 20 hours. The black bars correspond to the dark phase (7 am to 7 pm). The remainder corresponds to the light phase. (B) RER expressed as the mean RER. Group composition: diet control (diet mix): n=8; diet + ellagic acid (diet mix): n=7; diet + urolithin A (diet mix): n=7. Results are expressed as mean ± SEM. *p<0.05 (Student's t-test). For panel A, the results were analyzed by two-way ANOVA. p-values ​​are indicated (diet control vs diet + treatment). [Figure 22] A series of graphs and corresponding series of bar graphs showing the effect of Urolithin A, Punicalagins and Pomegranate Extract (PE) on the respiratory exchange ratio (RER) in mice fed a high fat diet (HFD). (A) Follow-up of RER over 20 hours. (B) RER expressed as mean RER. Group composition: HFD control (diet mixture): n=10; HFD+Urolithin A (diet mixture): n=9; HFD+Punicalagins (diet mixture): n=10; HFD+PE (diet mixture): n=10. Results are expressed as mean ± SEM. *p<0.05 (Student's t-test). For panel A, results were analyzed by two-way ANOVA. [Figure 23] Two sets of graphs showing the effect of Urolithin A, Punicalagins and Pomegranate Extract (PE) on triglycerides and free fatty acids in high fat diet (HFD) fed mice. (A) Plasma levels of triglycerides in HFD fed mice treated for 14 weeks. (B) Plasma levels of free fatty acids in HFD fed mice treated for 14 weeks. Group composition: HFD control (food mixture): n=10; HFD control (gavage): n=10; HFD+Urolithin A (food mixture): n=9; HFD+Punicalagins (gavage): n=8; HFD+PE (gavage): n=7. Results are expressed as mean ± SEM. *p<0.05 (Student's t-test). [Figure 24]A series of graphs showing the effect of urolithin A, ellagic acid and punicalagins on blood glucose in high fat diet (HFD)-fed mice. (A) Glucose tolerance test in HFD-fed mice treated with a food mix containing urolithin A for 10 weeks. (B) Glucose tolerance test in HFD-fed mice treated with a food mix containing ellagic acid for 10 weeks. (C) Glucose tolerance test in HFD-fed mice treated with a food mix containing punicalagins for 10 weeks. Group composition: HFD control (food mix): n=10; HFD+urolithin A (food mix): n=9; HFD+punicalagins (food mix): n=10. Results are expressed as mean ± SEM. *p<0.05 (Student's t-test). [Diagram 25] Line and bar graphs showing the effect of UA on basal and uncoupled respiration (oxygen consumption) in aged (10-day-old) C. elegans. (A) Basal and uncoupled respiration (FCCP) in 10-day-old control worms treated with 0.1% DMSO and 10-day-old worms treated with 30 μM Urolithin A in 0.1% DMSO. (B) Representative area under the curve (AUC) of uncoupled (FCCP) respiration in 10-day-old control worms treated with vehicle (0.1% DMSO) or 30 μM Urolithin A in 0.1% DMSO. Results are expressed as mean ± SEM. *p<0.05 (Student's t-test). OCR, oxygen consumption rate. [Figure 26] Bar graph showing the effect of urolithin A on mitochondria in C. elegans muscle. The transgenic C. elegans strain SJ4103 shows fluorescence due to muscle-specific expression of green fluorescent protein (GFP) targeted to the mitochondrial membrane. The presence or absence of mitochondria in C. elegans muscle is indicated by increased fluorescence. Results are expressed as mean ± SEM. *p=0.0014 (Student's t-test). [Figure 27] Bar graph showing the motility of mice exposed to chronic stress with or without treatment with pomegranate extract. [Figure 28] A bar graph showing the extent of the "freezing" response of mice in an anxiety-inducing context with or without treatment with pomegranate extract. [Figure 29] 1 is a bar graph showing the effect of pomegranate extract administration in mice on anxiety-induced rearing inhibition. [Diagram 30] 13 is a bar graph showing the effect of pomegranate extract administration on anxiety-induced inhibition of grooming in mice. [Diagram 31] Line graph showing memory extinction for a particular noxious situation upon repeated exposure to a situation without noxious effects. Data are shown for early-life stressed mice, normally housed control mice and mice that were early-life stressed but treated with the ellagitannin punicalagin. Freezing (%) is expressed as the percentage of time freezing during the first exposure to the situation. [Diagram 32] Graph showing the effect of chronic stress on mice on effective learning in the Morris Water Maze. [Diagram 33] Bar graph showing the effect of pomegranate extract administration in chronically stressed mice on learning ability in the Morris water maze. [Diagram 34] Graph showing cumulative distance from the hidden platform over several trials during training in the Morris water maze, a measure of cognitive learning. Data are shown for mice subjected to early-life stress, control mice housed normally, and mice subjected to early-life stress but treated with the ellagitannin punicalagin. Distance to platform is the sum of the cumulative distance between the mouse and the hidden platform over all measured intervals (25 intervals / s) during the observation period (60 s). [Diagram 35] FIG. 1 is a bar graph showing memory of aged rats in the social recognition test when treated with either pomegranate extract 1108 or control (Ctrl). [Diagram 36] 1 is a bar graph showing the results of the Morris Water Maze test for aged rats treated with pomegranate extract 1108 or control. [Figure 37]Bar graph showing the percentage of correct alternations in the Y-maze for both treated and untreated Alzheimer's disease mouse model 5XFAD and normal control mice. Significance: **p<0.01, *p<0.05, 1-way ANOVA. [Figure 38] 1 is a bar graph showing the results of the Morris Water Maze test for transgenic mice (hAPP-Tg) modeling Alzheimer's disease treated with pomegranate-derived extracts 31008, 61109, 71109 or a control (vehicle). Results for wild-type mice (Non-Tg) treated with a control (vehicle) are also shown. [Figure 39] Bar graph showing the results of light / dark boxes for early-life stressed mice versus normally housed control mice and early-life stressed mice treated with the ellagitannin punicalagin. Results are expressed as mean ± SEM. Significance: *p<0.05 (Student's t-test). [Diagram 40] Bar graph showing elevated O-maze results for early-life stressed mice versus normally housed control mice and early-life stressed mice treated with the ellagitannin punicalagin. Results are expressed as mean ± SEM. Significance: *p<0.05 (Student's t-test). [Diagram 41] Bar graph showing the results for the forced swim test for early-life stressed mice, normally reared control mice, and early-life stressed mice treated with the ellagitannin punicalagin. Results are expressed as mean ± SEM. Significance: *p<0.05, **p<0.01 (Student's t-test). [Diagram 42] Bar graph showing results for training in a contextual fear conditioning paradigm during the first mild shock at 4 minutes. Results are shown for early-life stressed mice versus normally housed control mice and early-life stressed mice treated with the ellagitannin punicalagin. Results are expressed as mean ± SEM. [Diagram 43]Bar graph showing memory extinction for a particular adverse context when repeatedly exposed to the same context without adverse effects. Data are shown for early-life stressed mice, normal raised non-stressed control mice, and early-life stressed mice treated with the ellagitannin punicalagin. Results are expressed as mean ± SEM. Significance: *p<0.05, #p=0.05 (Student's t-test). Normal non-stressed animals were compared to early-life stressed mice (i.e., maternal separation). Punicalagin-treated early-life stressed animals were compared to untreated early-life stressed animals. [Diagram 44] Line graph showing the level of motor learning as measured by the latency to fall from a rotating rod in seconds. Data are shown for early-life stressed mice, normally housed control mice, and early-life stressed mice treated with the ellagitannin punicalagin. Results are expressed as mean ± SEM. [Diagram 45] Graph showing escape latency in seconds from the Morris water maze during the training period, a measure of cognitive learning. Data are shown for early-life stressed mice, normally housed control mice, and early-life stressed mice treated with the ellagitannin punicalagin. Results are expressed as mean ± SEM. Significance: *p<0.05 (Student's t-test). [Figure 46] Bar graph showing the effect of pomegranate-derived compounds on contextual recognition in normal mice either untreated or treated with punicalagin or urolithin A. Results are expressed as mean ± SEM. Significance: *p<0.05 (Student's t-test). [Figure 47] Bar graph showing the effect of pomegranate-derived compounds on memory retention for a specific context in normal mice either untreated or treated with punicalagin or urolithin A. Results are expressed as mean ± SEM. Significance: Data were analyzed using either one-way or repeated measures ANOVA followed by Fisher's post-hoc LSD multiple comparison test. *p<0.05. [Figure 48]Line graph showing muscle function and motor skill as measured by the time to fall from a rotating rotarod in seconds. Data are shown for normally housed untreated control mice and mice treated with the ellagitannin punicalagin. Significance: *p<0.05 by ANOVA analysis. [Figure 49] Line graph showing levels of muscle function and endurance as measured by mice's ability to run on a treadmill at increasing speeds. Data are shown for untreated control mice kept normally and for mice treated with Urolithin A. Significance: *p<0.05, **p<0.01 (Student's t-test). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0086] In biology and psychology, the term "stress" refers to the failure of humans or other animals to respond appropriately to a real or imagined psychological, emotional, or physical threat. The term "stress" was first used in a biological context by endocrinologist Hans Selye in the 1930s. Hans Selye later broadened and popularized the concept to include an inappropriate physiological response to any demand. This encompasses a wide range of phenomena, from mild irritability to dramatic dysfunction that can cause serious health breakdowns.

[0087] All these psychobiological stress characteristics may represent a manifestation of oxidative stress, an imbalance between the production and appearance of reactive oxygen species and the ability of the biological system to readily detoxify the reactive intermediates or repair the damage that has been caused. Disturbance of the normal redox state of tissues may cause toxic effects through the production of peroxides and free radicals that damage all components of the cell, including proteins, lipids, and DNA. Through a phenomenon called "redox signaling," some reactive oxidative species may also act as messengers.

[0088] In humans, oxidative stress is involved in many diseases, including atherosclerosis, Parkinson's disease, heart failure, myocardial infarction, Alzheimer's disease, schizophrenia, bipolar disorder, fragile X syndrome, and chronic fatigue syndrome.

[0089] One source of reactive oxygen species under normal conditions in humans is the leakage of reactive oxygen species from mitochondria during oxidative phosphorylation.

[0090] Superoxide (O 2 - Other enzymes capable of producing oxidative stress are xanthine oxidase, NADPH oxidase and cytochrome P450. Another powerful oxidant, hydrogen peroxide, is produced by a wide range of enzymes, including several oxidases. Reactive oxygen species play an important role in cell signaling in a process called redox signaling. Therefore, a good balance must be struck between reactive oxygen production and consumption to maintain proper cellular homeostasis.

[0091] The best studied cellular antioxidants are the enzymes superoxide dismutase (SOD), catalase and glutathione peroxidase. Less well investigated enzymatic antioxidants include peroxiredoxins and the more recently discovered sulfiredoxins. Other enzymes with antioxidant properties (although not primarily in this role) include paraoxonase, glutathione-S-transferase and aldehyde dehydrogenase.

[0092] Oxidative stress is involved in tissue damage after irradiation and hyperoxia. It is suspected to be important in neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), and Huntington's disease. Oxidative stress is also thought to lead to certain cardiovascular diseases, as oxidation of low-density lipoprotein (LDL) in the vascular endothelium is a precursor to plaque formation. Oxidative stress is also involved in the ischemic cascade that results from oxygen-reperfusion injury after hypoxia. This cascade includes both stroke and heart attack. Oxidative stress has also been speculated to be involved in chronic fatigue syndrome.

[0093] Notably, the inventors have discovered that certain compounds derived from ellagitannins are useful in the treatment and prevention of physiological and psychological symptoms of stress, including oxidative stress. Without being bound to any particular mechanism of action, it is believed that the compounds exert beneficial effects on mitochondria, promoting and restoring critical mitochondrial function and reversing stress-induced mitochondrial dysfunction. These compounds have been found, according to the present invention, to be useful in the treatment and prevention of any of a variety of symptoms, diseases and disorders related to mitochondrial dysfunction, including, but not limited to, neurodegenerative and cognitive disorders, metabolic diseases, including, but not limited to, insulin resistance, mood disorders, and anxiety disorders.

[0094] Ellagitannins (ETs) are polyphenols found in the so-called "hydrolyzable tannins" in which hexahydroxydiphenic acid forms diesters with sugars, most often β-D-glucose. ETs may exist as complex polymers with molecular weights reaching 4000 or more. These polymers may be hydrolyzed with acid or base to recover ellagic acid (EA), which can be used to indirectly quantify ET. EAs, in turn, are a source of further metabolites, including urolithins.

[0095] Many plant species containing ellagitannins have been used for the treatment of diseases, especially in Asia ( Okuda et al., 2009 ). These include, among others, Agrimonia pilosa (agrimonyin), Camellia japonica (camellia tannin A), Cornus officinalis (cornussin A), Geranium thunbergii (geraniin), Geum japonicum (gemin-A), Liquidambar formosana (casaricin), Mallotus japonicus (malotusinic acid), Oenothera erythrosepala (oenothein B), Punica granatum (punica granatum), and others. These include Pomegranate (Granatum) (Granatin B), Rosa rugosa (Rugosin) and Terminalia chebula (Chebulinic acid). The major uses of these herbs are related to their antioxidant, antidiarrheal, antibacterial and immunomodulatory activities.

[0096] Ellagitannins are also present in very large amounts in many berries, including strawberries, red and black raspberries (Zafrilla et al., 2001), blueberries and blackberries. Ellagitannins are also present in apples, cherries, cloudberries, cranberries, currants, grapes, limes, mangoes, pineapples, pomegranates, prunes and rhubarb. Serrano et al. (2009) Mol Nutr Food Res. 53:S310-29. Ellagitannins Rubus suavissimus C can be isolated from the leaves of the sweet potato plant Rubus suavissimus S. Lee. Ellagitannins have also been identified in significant amounts in nuts, including walnuts (Fukuda et al., 2003), pistachios, cashews, chestnuts, acorns (Cantos et al., 2003), pecans (Villarreal-Lozoya et al., 2007), and peanuts.

[0097] They are also present in large amounts in pomegranates (Gil et al., 2000) and muscadine grapes (Lee and Talcott, 2002) and are important constituents of wood, especially oak (Glabasnia and Hofmann, 2006). Ellagitannins may be incorporated into foods such as wine and whiskey through transfer from the wood into the food matrix during various aging processes. Ellagic acid is also found in some types of honey and has been proposed as a floral marker for healthier honeys (Ferreres et al., 1996). Free ellagic acid and various glycosidic derivatives, including glucosides, rhamnosides, arabinosides and the corresponding acetyl esters, are also present in these foods (Zafrilla et al., 2001).

[0098] Many studies have shown that the ellagitannin content of some foods can be very high (Table 1). For example, one cup of pomegranate juice (200 mL) can provide about 1 g of ellagitannins and ellagic acid combined, raspberries (100 g) can provide around 300 mg, strawberries can provide 70 mg, and four walnuts can provide about 400 mg.

[0099] Representative dietary ellagitannins include punicalagin in pomegranate, sanguiine-H-6 in strawberries and raspberries, and pedunculagin in walnuts. Other metabolic products are also produced, and although individual ellagitannins (e.g., gallagic acid and ter-gallagic acids) can be unique, all of these release ellagic acid upon hydrolysis.

[0100] [Table 1]

[0101] Ellagitannins have a great structural diversity, forming dimeric and oligomeric derivatives. They are also more widely distributed than gallotannins. Further ellagitannins and their reported sources are listed in Table 2.

[0102] [Table 2-1]

[0103] [Table 2-2]

[0104] Many potentially active ellagitannins can be isolated from various species of Terminalia plants. In particular, both punicalagin and punicalin have been identified in several Terminalia species, including, for example, T. catappa, T. chebula Retz, T. myriocarpa, and T. citrine. Punicalagin has also been isolated from Cistus salvifolius (a Mediterranean shrub) and Combretum molle (an African shrub).

[0105] Ellagic acid is usually found in relatively small amounts in plant tissues. It is believed to be derived from ellagitannins, which are naturally converted to ellagic acid when ellagitannins are degraded from hexahydroxydiphenic acid. Some additional sources of ellagic acid are listed in Table 3.

[0106] [Table 3]

[0107] Pomegranate (Punica granatum) fruits are an ancient medicinal food that has been used for centuries in folk medicine. They are consumed fresh and as juice and are an excellent source of ellagitannins and ellagic acid. The ellagitannins in pomegranate fruit shell and juice include punicalin, punicalagin, corilagin, casuarinin, terminarin / gallagyldilactone, pedunculagin, tellimagrandin, granatin A and granatin B. Other parts of the pomegranate plant contain further ellagitannins including punicaforin, punicacortein A, punicacortein B, punicacortein C, punicacortein D and punigluconin. Commercially available juice contains ellagitannins of the gallagin type, including punicalagin isomers (1500-1900 mg / L), unspecified hydrolyzable tannins (400-500 mg / L), and ellagic acid and its glycosides (120-260 mg / L) (Gil et al., 2000). Punicalagin, an ellagitannin in which gallaginic acid and ellagic acid are linked to a glucose molecule, is abundant in pomegranate peel. Punicalagin isomers and ellagic acid derivatives are absent from aril juice, but during industrial juice production they are extracted from the rind and membrane surrounding the aril and released in large quantities into the juice.

[0108] The extract of the present invention can be prepared by first squeezing the juice from the fruit, for example, the pomegranate can be squeezed using standard industrial juicing methods known in the art, which may include squeezing the whole fruit by pressing the whole fruit or by first removing the pomegranate husk and then pressing the remaining part, which is composed of the arils, the membranous material that encases the arils, and the husk material that is generated when the husk is removed. Alternatively, the husk, which is a rich source of ellagitannins, especially punicalagins, may be subjected to a juicing process that includes aqueous extraction. Alternative non-aqueous extraction methods may utilize other solvents, such as ethanol, acetone, or methanol.

[0109] Typically, the extract is an aqueous extract, which may consist essentially of fruit juice, with the addition of additional water in some cases. Such aqueous extracts can be concentrated, thickened or condensed, for example, by standard techniques, such as vacuum evaporation and filtration. Examples of concentrates are those that are at least 2-fold concentrated, more typically at least 4-fold, for example at least 8-fold, at least 40-fold, at least 100-fold, at least 200-fold or at least 1000-fold concentrated.

[0110] For example, the extract can be fractionated to isolate one or more active components in the extract by molecular weight filtration, chromatography on a suitable solid support such as Sepharose gel (for size exclusion chromatography), ion exchange columns using HPLC on appropriately treated silica or alumina, e.g., ODS-coated silica, or solvent extraction.

[0111] In vitro digestion mimicking experiments have shown that, in general, ellagitannins are very stable under physiological conditions in the stomach. Acidic conditions (HCl, pH 1.8-2.0) and gastric enzymes do not hydrolyze the parent ellagitannins to release free ellagic acid (EA), and no degradation of ellagitannins has been observed (Tomas-Barberan et al., 2009). The stomach appears to be the first important site for the absorption of free EA, whereas ellagitannins are not absorbed. However, under physiological conditions in the small intestine, free EA is released from ellagitannins. This hydrolysis appears to be due to the pH conditions (neutral to slightly alkaline pH, 7.0-7.3) rather than the effect of pancreatic enzymes and bile salts (Larrosa et al., 2006).

[0112] Animal studies have also been used to evaluate the bioavailability and metabolism of EA and ellagitannins. Doyle and Griffiths (1980) reported rapid absorption and metabolism of EA in rats. These authors detected urolithin A (UA) and another metabolite, most likely urolithin B (UB), in feces and urine. Both UA and UB were not found in germ-free animals, indicating that they are of microflora origin. No unchanged EA was detected in urine or feces. These urolithins are absorbed in large quantities by enterocytes and glucuronidated. In this case, UA and UB do not have an ortho-dihydroxy group in their molecules, so methyl ethers are not generated and therefore are not substrates for catechol-O-methyltransferase (COMT). In the case of UB, an additional hydroxyl can be introduced by cytochrome P450, which increases the possibility of glucuronidation and promotes the excretion of the metabolite. Teel and Martin (1988) found that both free EA and several conjugates (sulfate ester, glucuronide and glutathione conjugates) were detected in mouse urine, bile and blood. 3 Most of the absorption of H-EA occurred within 2 hours of oral administration. Blood, bile, and tissue levels were low, and the absorbed compound was excreted in the urine. 3 More than half of the H-EA remained in the gastrointestinal tract after 24 hours.

[0113] The metabolism of various dietary ET and EA derivatives has been evaluated in humans. In a study involving 40 healthy volunteers, divided into four groups, was fed various ET-containing foods including strawberries (250 g), red raspberries (225 g), walnuts (35 g) and oak barrel-aged red wine (300 mL). Both strawberries and raspberries contained the ET sanguiine H-6; walnuts contained the ET pedunculagin; and oak barrel-aged wine contained the ET vescalagin. Five urinary fractions were collected at 8, 16, 32, 40 and 56 hours after ingestion. Neither ET nor EA was detected in the urine using LC-MS / MS analysis. However, regardless of the food ingested, the glucuronidated bacterial metabolite 3,8-dihydroxy-6H-dibenzo[b,d]pyran-6-one (urolithin B) was detected in the fractions starting from 32 h and up to 56 h in all subjects. The obtained results showed that urolithin B derivatives were excreted independently of the ingested ET. The common monomeric moiety in the ingested ET was EA (m / z- at 301), which means that this subunit belonging to the ET molecule was a crucial molecule for generating urolithin B derivatives. A similar metabolic conversion to ellagic acid and urolithins was observed for ellagitannins in humans ingesting pomegranate juice (Cerda, Espin et al. 2004; Cerda, Periago et al. 2005).

[0114] One of the major factors in the metabolism and bioavailability of ellagitannins is their microbial conversion to give a series of urolithin derivatives (Figure 2). Among them, the best characterized and known are urolithins A and B, but intermediates with 3 and 4 hydroxyls are also generated in the small intestine, absorbed, and excreted in the bile after conjugation with methyl ethers and glucuronides (Esp▲i with accent▼n et al., 2007). Animal studies have shown that these metabolites start to form in the small intestine, suggesting that anaerobic bacteria may be involved. Metabolism continues along the gastrointestinal tract, starting with urolithins D and C and ending with the production of urolithins A and B. The differences in the production of these metabolites by human volunteers indicate that they may be produced by the activity of specific microorganisms present in the digestive tract.

[0115] In the gastrointestinal tract and other tissues (mainly the liver), EA and ellagitannin microbial metabolites are further metabolized by either phase I (hydroxylation) and phase II (methylation, glucuronidation, and sulfation) enzymes to more soluble metabolites that can be distributed in tissues and then excreted in the urine.

[0116] Thus, UB is hydroxylated to produce UA, which can be further hydroxylated to produce the trihydroxy derivative.

[0117] Phase II products are also produced, and methyl ethers (products of COMT) as well as various glucuronide conjugates are detected in various tissues and urine. Sulfate conjugates of ellagitannin metabolites are less abundant than the glucuronide conjugates in animals and humans. These conjugates are produced initially in the enterocytes and are further metabolized in the liver before being excreted in the urine or bile.

[0118] In summary, ellagitannins are generally not absorbed in the gastrointestinal tract. Rather, they release EA in the gastrointestinal tract, which is only poorly absorbed in the stomach and small intestine. EA is primarily metabolized by unidentified bacteria in the intestinal lumen to produce urolithins. Bacterial metabolism begins in the small intestine, producing the first metabolites that retain four phenolic hydroxyl groups (urolithin D, four hydroxyl groups), which are further metabolized along the intestinal tract with removal of hydroxy units to give urolithin C (three hydroxyl groups), urolithin A (two hydroxyl groups), and, in the distal colon, B (one hydroxyl group) (Figure 2). The absorbed metabolites are conjugated with glucuronic acid (one or two units) and / or methyl ethers (if an ortho-dihydroxyl group is present). Urolithin A and B conjugates are the major metabolites detected in plasma and urine, although some trihydroxy derivatives (hydroxy-UA) or EA-dimethyl ether glucuronide have also been detected in small amounts. Tetrahydroxy-urolithins, trihydroxy-urolithins and EA derivatives are generally not detected in peripheral plasma, but they are absorbed in the small intestine, transported to the liver where they are further metabolized and excreted with bile back into the small intestine, establishing an enterohepatic circulation responsible for the relatively long-lived urolithins in plasma and urine.

[0119] In addition to natural food sources, many papers have appeared in the last two decades on the biosynthesis, isolation and biological activity of tannins, especially ellagitannins (e.g., Xie et al., 1995; Yoshida et al., 1982, 1984, 1985, 1986, 1989, 1990a / b, 1991a-d, 1992a / b, 1995; Nonaka et al., 1980, 1984, 1989a-c, 1990; Tanaka et al., 1986a / b, 1990, 1992a / b, 2001; Hatano et al., 1988, 1989, 1990a-c, 1991, 1995; Lin et al., 1990; Nishizawa et al., 1982, 1983; Haddock et al., 1997; al., 1982a / b, Kashiwada et al., 1992a / b, 1993, Kadota et al., 1990, Okuda et al., 1982a-e, 1983a / b, El-Mekkawy et al., 1995, Tsai et al., 1992, Han et al., 1995, Chen et al., 1995, Morimoto et al., 1986a / b, Saijo et al., 1989). Obtaining pure ellagitannins by isolation from natural sources is complicated, and only relatively small amounts of the pure natural product can be recovered. See, e.g., Okuda et al., (1982) Chem Pharm Bull. 30:4230-4233; Okuda et al. (1982) Chem Pharm Bull. 30:234-4236. It is therefore noteworthy that methods for the total synthesis of many ellagitannins are known. For example, for the synthesis of ellagitannins, see Khanbabaee, K. Strategies for the synthesis of ellagitannins, In: Chemistry and Biology of Ellagitannins, Ed. S. Quideau, World Scientific Publishing, Singapore, 2009, pp. 152-202 (including references cited therein).

[0120] Using various in vitro assays, ellagitannin-rich food extracts have been investigated for antioxidant activity and have been widely reported to be highly active in strawberries (Meyers et al., 2003, Aaby et al., 2005, 2007), raspberries (Liu et al., 2002, Beekwilder et al., 2005), cloudberries (Ka▲a with umlaut▼hk▲o with umlaut▼nen et al., 2001), other Rubus berries (Wada and Ou, 2002), pomegranates (Gil et al., 2000), and walnuts (Anderson et al., 2001) and their ellagitannins. These foods also rank highly when compared to other plant-based foods.

[0121] Little is known about the effect of ellagitannin-rich food consumption on antioxidant status in vivo. In elderly women, the total serum antioxidant capacity increased by about 10% for 4 h after ingestion of 240 g strawberries (Cao et al., 1998). A single dose of standardized pomegranate extract (Mertens-Talcott et al., 2006) and chronic consumption of pomegranate juice (Rosenblat et al., 2006) also improved some antioxidant parameters in human volunteers. However, daily consumption of walnuts for 3 weeks had no effect on antioxidant status in subjects with metabolic syndrome (Davis et al., 2007).

[0122] Cancer cell growth depends on the balance between proliferation and apoptosis. Unregulated cell proliferation and suppression of apoptosis are key steps in the development and progression of cancer. There is growing evidence that ellagitannin-rich food extracts suppress cancer cell growth in vitro by inhibiting cell proliferation, inducing apoptotic cell death, and modulating cell cycle kinetics and signaling pathways.

[0123] In vitro studies carried out with cancer cell lines have shown that strawberry (Meyers et al., 2003, Olsson et al., 2004, Ramos et al., 2005, Wang et al., 2005, Wu et al., 2007), raspberry (Liu et al., 2002, Olsson et al., 2004, Wu et al., 2007), cloudberry (Wu et al., 2007) and rosehip (Olsson et al., 2004) inhibit cell proliferation, induce apoptosis and cause cell cycle arrest in human colon, liver, lung, breast or cervical cancer cells. In these experiments, the involvement of ellagitannins in the activity of the berry extracts was not evaluated. However, recent experiments (Ross et al., 2007) suggest that the antiproliferative activity of raspberry is mainly mediated by ellagitannins.

[0124] It has also been reported that pomegranate juice and its ellagitannins inhibit proliferation, induce apoptosis, and suppress inflammatory cell signaling in colon cancer cell lines (Seeram et al., 2005, Adams et al., 2006, Larrosa et al., 2006). Similarly, polyphenols in muscadine grape peel inhibit growth and induce apoptosis in colon cancer cells (Yi et al., 2005). Fractions isolated from red muscadine grapes, rich in ellagic acid, ellagic acid glycosides, and ellagitannins, induce apoptosis, reduce cell number, and cause changes in cell cycle kinetics in colon carcinoma cells (Mertens-Talcott et al., 2006).

[0125] Pomegranate juice is effective against prostate cancer cells in vitro, but has no effect on normal prostate epithelial cells. Treatment of aggressive human prostate cancer cells with pomegranate fruit extract resulted in inhibition of cell growth and viability and induction of apoptosis (Malik et al., 2005; Malik and Mukhtar, 2006).

[0126] According to the present invention, it has now been unexpectedly discovered that ellagitannins and their metabolites, including ellagic acid and, in particular, urolithins, exhibit protective and restorative effects on mitochondria.Without being limited to any particular mechanism, it is believed that various types of stress result in stress damage to mitochondria, thereby reducing their ability to perform many functions that are essential to overall cellular function.The methods of the present invention are useful for treating conditions that involve stress damage to mitochondria, and these damages may be manifested in any of a number of ways, including, but not limited to, mitochondrial diseases.

[0127] Mitochondria are the "power plants" of cells. These double-membrane organelles play a key role in producing the majority of cellular energy (ATP) through oxidative phosphorylation. Mitochondria are essential for other important metabolic functions, such as fatty acid β-oxidation, amino acid catabolism, ketogenesis and reactive oxygen species (ROS) generation, as well as important signaling functions and regulating calcium homeostasis.

[0128] The mitochondrial matrix contains the enzymatic machinery for fatty acid β-oxidation, which produces acetyl-CoA from the acyl chains, and for the reduction of equivalents in the form of reduced nicotinamide adenine dinucleotide (NADH) and reduced flavin adenine dinucleotide (FADH2) in this process. Acetyl-CoA drives the tricarboxylic acid (TCA) cycle, also known as the citric acid cycle or Krebs cycle, which also produces NADH and FADH2. These products donate electrons to the electron transport chain (ETC), which creates a proton gradient across the inner mitochondrial membrane. Resolution of this gradient through mitochondrial ATP synthase produces energy in the form of ATP.

[0129] The ETC is composed of four large multisubunit complexes (complexes I to IV) that transport electrons generated by the TCA cycle to the final acceptor, molecular oxygen (O 2) and transported to H at complex IV. 2 O is formed. The transport of electrons is accompanied by the release of a large amount of free energy, most of which is released as protons (H + ) rearrangement (proton motive force), and the remainder is dissipated as heat. Next, the H + The energy contained in the electrochemical gradient is transferred to the matrix via mitochondrial ATP synthase. + Thus, electron transport, proton gradient generation, and subsequently, proton flux coupled to mitochondrial ATP synthase results in oxidative phosphorylation.

[0130] ROS can also activate uncoupling proteins (UCPs) that allow the proton gradient to dissipate without the production of ATP. UCPs are thought to be natural regulators of this process, responding to and controlling ROS production by mitigating the formation of large proton gradients. Furthermore, UCPs and respiratory uncoupling are involved in many important physiological and pathological processes, including adaptive thermogenesis, control of fatty acid oxidation, involvement in inflammation, blocking ROS generation, glucose homeostasis, weight control, and aging.

[0131] Citrate synthase is the first enzyme in the mitochondrial TCA cycle. This enzyme catalyzes the reaction between acetyl coenzyme A (acetyl-CoA) and oxaloacetate to produce citrate. The activity of this enzyme reflects both mitochondrial biogenesis and mitochondrial oxidative phosphorylation, as its activity increases in proportion to mitochondrial density (number of mitochondria per cell) and mitochondrial respiratory activity. As a result, the measurement of citrate synthase allows a global assessment of mitochondrial functional status, with higher activity indicating improved oxidative phosphorylation and ATP synthesis and lower activity indicating the opposite.

[0132] To gain a more detailed understanding of the underlying molecular mechanisms leading to improved mitochondrial function, key mitochondrial genes (encoding mitochondrial DNA and genomic DNA) may be profiled, including oxidative phosphorylation, mitochondrial chain complex, TCA cycle, uncoupling proteins, transcription factors, cofactors and ROS scavenging proteins.

[0133] The conventional teaching in biology and medicine is that mitochondria function only as "energy factories" for cells. However, over 95% (2900 out of 3000) of the genes that code for mitochondrial proteins are involved in other functions that are linked to the special roles of the differentiated cells in which they reside. These roles develop during embryonic to adult development, and mature and adapt to the postnatal environment as the tissues grow. These other non-ATP-related functions are intimately involved with most of the major metabolic pathways used by cells to build, break down, and recycle their molecular building blocks. Without mitochondria, cells cannot even produce the RNA and DNA they need to grow and function. The building blocks of RNA and DNA are purines and pyrimidines. Mitochondria contain the rate-limiting enzymes for pyrimidine biosynthesis (dihydroorotate dehydrogenase) and heme synthesis (d-aminolevulinic acid synthetase) that are required for hemoglobin production. In the liver, mitochondria are specialized to detoxify ammonia in the urea cycle. Mitochondria are also required for cholesterol metabolism, estrogen and testosterone synthesis, neurotransmitter metabolism, and free radical production and detoxification -- all in addition to oxidizing fats, proteins, and carbohydrates ingested in the diet.

[0134] Mitochondrial diseases are the result of either inherited or spontaneous mutations in mitochondrial or nuclear DNA that lead to altered function of proteins or RNA molecules normally present in mitochondria. However, problems with mitochondrial function can only affect certain tissues as a result of factors occurring during development and growth that are not fully understood. Even considering tissue-specific isoforms of mitochondrial proteins, it is difficult to explain the diverse patterns of affected organ systems in mitochondrial disease syndromes seen in the clinic.

[0135] Mitochondrial diseases are caused by the malfunction of mitochondria, specialized compartments present in all cells of the body except red blood cells. Mitochondria are responsible for producing over 90% of the energy required by the body to sustain life and support growth. When mitochondria fail, very little energy is produced within the cells. This leads to cell damage and even cell death. When this process is repeated throughout the body, the entire system begins to malfunction, which is very life threatening when this occurs. Mitochondrial diseases occur primarily in children, but adult onset is becoming more recognized.

[0136] Mitochondrial diseases appear to cause most severe damage to cells of the brain, heart, liver, skeletal muscle, kidneys and the endocrine and respiratory systems.

[0137] Many symptoms of mitochondrial disorders are non-specific. The symptoms may also show an episodic course with periodic exacerbations. Review articles on mitochondrial medicine refer to migraine episodes, myalgia, gastrointestinal symptoms, tinnitus, depression, chronic fatigue and diabetes among other phenomena of mitochondrial disorders (Chinnery and Turnbull (1997) QJM 90:657-67; Finsterer (2004) Eur J Neurol. 11:163-86). In patients with mitochondrial disorders, clinical symptoms usually occur during higher energy demands associated with physiological stressors, such as illness, starvation, excessive exercise and extreme environmental temperatures. In addition, psychological stressors often induce symptoms, probably because patients cannot produce enough ATP to meet higher brain energy demands.

[0138] Depending on which cells are affected, symptoms may include loss of motor control, muscle weakness and pain, gastrointestinal problems and swallowing difficulties, failure to thrive, heart disease, liver disease, diabetes, respiratory complications, seizures, vision / hearing problems, lactic acidosis, developmental delay and susceptibility to infections.

[0139] Mitochondrial diseases include Alpers disease; Barth syndrome; beta-oxidation deficiency; carnitine deficiency; carnitine-acyl-carnitine deficiency; chronic progressive external ophthalmoplegia syndrome; coenzyme Q10 deficiency; complex I deficiency; complex II deficiency; complex III deficiency; complex IV deficiency; complex V deficiency; CPT I deficiency; CPT II deficiency; creatine deficiency syndrome; cytochrome c oxidase deficiency; type II glutaric aciduria; Kearns-Sayre syndrome; lactic acidosis; LCHAD (long-chain acyl-CoA dehydrogenase deficiency); Leber's hereditary optic neuropathy; Leigh's disease; fatal childhood cardiomyopathies; Luft's disease; MAD (medium-chain acyl-CoA dehydrogenase deficiency); mitochondrial cytopathies; mitochondrial DNA deficiency; mitochondrial encephalomyopathy, lactic acidosis and stroke-like symptoms; ...cytopathies; mitochondrial DNA deficiency; mitochondrial cytopathies; mitochondrial DNA deficiency; mit These include, but are not limited to, endorhizopathies; mitochondrial myopathies; mitochondrial recessive ataxia syndromes; muscular dystrophy, myoclonic epilepsy and ragged-red fiber disease; myoneurogastrointestinal encephalopathy; neuropathy, ataxia, retinitis pigmentosa and ptosis; Pearson syndrome; POLG mutations; pyruvate carboxylase deficiency; pyruvate dehydrogenase deficiency; SCHAD (short-chain acyl-CoA dehydrogenase deficiency); and very long-chain acyl-CoA dehydrogenase deficiency.

[0140] One aspect of the invention is a food product or nutritional supplement comprising an effective amount of pomegranate extract for the treatment or prevention of a condition selected from the group consisting of obesity, slow metabolic rate, metabolic syndrome, diabetes, cardiovascular disease, hyperlipidemia, neurodegenerative disease, cognitive disorders, mood disorders, stress and anxiety disorders; for weight management; or for improving muscle function or mental performance.

[0141] As used herein, "food" refers to a product prepared from natural foods. Non-limiting examples of food include juices, wines, concentrates, jams, jellies, preserves, pastes and extracts. As used herein, "nutritional supplement" refers to a product suitable for ingestion or other administration primarily for its health-promoting properties rather than its caloric content.

[0142] As used herein, the term "metabolic syndrome" refers to a combination of medical disorders that, when occurring together, increase the risk of developing cardiovascular disease and diabetes. It affects one in five people in the United States, with prevalence increasing with age. Some studies indicate that the prevalence in the United States is estimated at 25% of the population. According to the International Diabetes Foundation consensus worldwide definition (2006), metabolic syndrome refers to central obesity plus any two of the following: High triglycerides: >150 mg / dL (1.7 mmol / L) or specific treatment for this lipid abnormality; Low HDL cholesterol: <40 mg / dL (1.03 mmol / L) for men, <50 mg / dL (1.29 mmol / L) for women or treatment for this lipid abnormality; Hypertension: systolic BP > 130 or diastolic BP > 85 mmHg or treatment of previously diagnosed hypertension; and High fasting plasma glucose (FPG) >100 mg / dL (5.6 mmol / L) or diagnosed type 2 diabetes.

[0143] One aspect of the invention is a food product or nutritional supplement comprising an effective amount of ellagitannins for the treatment or prevention of a condition selected from the group consisting of obesity, reduced metabolic rate, metabolic syndrome, diabetes, cardiovascular disease, hyperlipidemia, neurodegenerative disease, cognitive disorders, mood disorders, stress and anxiety disorders; for weight management; or for improving muscle function or mental performance.

[0144] In some embodiments, according to this and other aspects of the invention, the ellagitannins are selected from the group consisting of 2-O-galloyl-punicalin, casaurictin, castalagin and vecalagin, castalin, casuarictin, casuarin, casuarinin, chebulaginic acid, chebulinic acid, corilagin, cornucinin E, epipunicacortein A, furosine B, gemin D, granatin A, granatin B, grandinin, lagerstroemin, lambertianin C, pedunculagin, punicacortein A, punicacortein B, punicacortein C, punicacortein D ... The ellagitannins are selected from the group consisting of cacortein B, punicacortein C, punicacortein C, punicacortein D, punicaforin, punicalagin, punicalin, punigluconin, lobulin A, lobulin B, lobulin C, lobulin D, lobulin E, rubusabiin C, sanguiin H-4, sanguiin H-5, sanguiin H-6, sanguiin H-10, stachyurin, strictinin, tellimagrandin I, tellimigrandin II, terkebrin, terflavin A, terflavin B, tergallagin and terminarin / gallagyldilactone. Needless to say, additional ellagitannins are contemplated by the present invention.

[0145] One aspect of the invention is a food or nutritional supplement comprising an effective amount of punicalagin for the treatment or prevention of a condition selected from the group consisting of obesity, reduced metabolic rate, metabolic syndrome, diabetes, cardiovascular disease, hyperlipidemia, neurodegenerative disease, cognitive disorders, mood disorders, stress and anxiety disorders; for weight management; or for improving muscle function or mental performance.

[0146] One aspect of the invention is a food product or nutritional supplement comprising an effective amount of ellagic acid for the treatment or prevention of a condition selected from the group consisting of obesity, reduced metabolic rate, metabolic syndrome, diabetes, cardiovascular disease, hyperlipidemia, neurodegenerative disease, cognitive disorders, mood disorders, stress and anxiety disorders; for weight management; or for improving muscle function or mental performance.

[0147] One aspect of the invention is a food product or nutritional supplement comprising an effective amount of a urolithin for the treatment or prevention of a condition selected from the group consisting of obesity, slow metabolic rate, metabolic syndrome, diabetes, cardiovascular disease, hyperlipidemia, neurodegenerative disease, cognitive disorders, mood disorders, stress and anxiety disorders; for weight management; or for improving muscle function or mental performance.

[0148] In some embodiments, according to this and other aspects of the invention, the urolithin is urolithin A. In some embodiments, according to this and other aspects of the invention, the urolithin is urolithin B. In some embodiments, according to this and other aspects of the invention, the urolithin is urolithin C. In some embodiments, according to this and other aspects of the invention, the urolithin is urolithin D.

[0149] In each of the foregoing, in one embodiment the condition is obesity.

[0150] In each of the foregoing, in one embodiment the symptom is a slowed metabolic rate.

[0151] In each of the foregoing, in one embodiment the condition is metabolic syndrome.

[0152] In each of the foregoing, in one embodiment the condition is diabetes.

[0153] In each of the foregoing, in one embodiment the condition is cardiovascular disease.

[0154] In each of the foregoing, in one embodiment the condition is hyperlipidemia.

[0155] In each of the foregoing, in one embodiment the condition is a neurodegenerative disease.

[0156] In each of the foregoing, in one embodiment the symptom is cognitive impairment.

[0157] In each of the foregoing, in one embodiment the condition is a mood disorder.

[0158] In each of the foregoing, in one embodiment the symptom is stress.

[0159] In each of the foregoing, in one embodiment the condition is an anxiety disorder.

[0160] In each of the foregoing, in one embodiment the food product or nutritional supplement is for weight management.

[0161] In each of the foregoing, in one embodiment the food product or nutritional supplement is for improving muscle function.

[0162] In each of the foregoing, in one embodiment the food product or nutritional supplement is for improving mental performance.

[0163] One aspect of the invention is a method of improving or maintaining mitochondrial function comprising contacting a cell with an effective amount of a urolithin or a precursor thereof to improve mitochondrial function.

[0164] One aspect of the invention is a method of treating, preventing or managing a mitochondrial-associated disease or condition associated with altered mitochondrial function or reduced mitochondrial density, comprising administering to a subject in need thereof a therapeutically effective amount of a urolithin or a precursor thereof to treat the disease or condition associated with altered mitochondrial function or reduced mitochondrial density.

[0165] One aspect of the invention is a method of increasing metabolic rate, comprising administering to a subject in need thereof an effective amount of a urolithin or a precursor thereof to increase metabolic rate. As described elsewhere herein, precursors of urolithins may include, but are not limited to, ellagitannins, punicalagins, and ellagic acid.

[0166] One aspect of the invention is a method of preventing or treating metabolic syndrome, the method comprising administering to a subject in need thereof an effective amount of a urolithin or a precursor thereof to prevent or treat metabolic syndrome.

[0167] One aspect of the invention is a method of preventing or treating obesity, the method comprising administering to a subject in need thereof an effective amount of a urolithin or a precursor thereof to prevent or treat obesity.

[0168] One aspect of the invention is a method of preventing or treating cardiovascular disease comprising administering to a subject in need thereof an effective amount of a urolithin or a precursor thereof to prevent or treat cardiovascular disease.

[0169] One aspect of the present invention is a method for treating hyperlipidemia. The method comprises administering to a subject in need thereof an effective amount of a urolithin or a precursor thereof to treat hyperlipidemia. In one embodiment, the hyperlipidemia is hypertriglyceridemia. In one embodiment, the hyperlipidemia is increased free fatty acids.

[0170] One aspect of the invention is a method of treating a metabolic disease. The method comprises administering to a subject in need thereof a therapeutically effective amount of a urolithin or a precursor thereof to treat the metabolic disease. In one embodiment, the metabolic disease is diabetes. In one embodiment, the metabolic disease is obesity.

[0171] aging Aging is by far the largest risk factor for neurodegenerative diseases such as Alzheimer's disease (AD), Parkinson's disease (PD) and amyotrophic lateral sclerosis (ALS). Mitochondria are thought to be involved in aging through the accumulation of mitochondrial DNA (mtDNA) mutations and the net production of reactive oxygen species (ROS). Although most mitochondrial proteins are encoded by the nuclear genome, mitochondria contain many copies of their own DNA. Human mtDNA is a 16,569 base pair circular molecule that encodes 13 polypeptide components of the respiratory chain and the rRNA and tRNA required to support intramitochondrial protein synthesis using the mitochondria's own genetic code. Inherited mutations in mtDNA are known to cause a variety of diseases, most of which affect the brain and muscles, tissues with high energy demands. It has been hypothesized that somatic mtDNA mutations acquired with aging contribute to the physiological decline that occurs with aging and to the neurodegeneration associated with aging. It is well established that mtDNA accumulates mutations with aging, particularly large deletions and point mutations. In mtDNA regulatory regions, point mutations at specific sites, such as T414G in cultured fibroblasts, A189G and T408A in muscle, and C150T in white blood cells, can accumulate at high levels in some tissues. However, these regulatory region "hot spots" have not been observed in the brain. Although the overall levels may be high, the occurrence of point mutations at individual nucleotides appears to be at low levels in the brain. Using a polymerase chain reaction (PCR)-cloning-sequencing strategy, the average level of point mutations in two protein-coding regions of brain mtDNA from aged subjects was found to be ~2 mutations per 10 kb. Noncoding regions, which may be under lower selective pressure, can accumulate two- to four-fold more. The accumulation of these deletions and point mutations with aging correlates with mitochondrial function decline. For example, an inverse correlation was found between brain cytochrome oxidase activity and elevated levels of point mutations in the cytochrome oxidase gene (CO1).

[0172] Net production of ROS is another important mechanism by which mitochondria are thought to play a role in aging. Mitochondria contain multiple electron carriers capable of producing ROS as well as an extensive network of antioxidant defenses. Mitochondrial damage, including oxidative damage itself, can cause an imbalance between ROS production and removal, resulting in net ROS generation. The importance of net mitochondrial ROS generation to aging is supported by the observation that promoting mitochondrial antioxidant defenses can extend lifespan. In Drosophila, overexpression of the mitochondrial antioxidant enzymes manganese superoxide dismutase (MnSOD) and methionine sulfoxide reductase extends lifespan. This strategy is most effective in short-lived strains of Drosophila and is ineffective in already long-lived strains. However, it has recently been shown that experimentally targeted overexpression of catalase to the mitochondria extends lifespan in an already long-lived mouse strain.

[0173] Cognitive decline during aging has been observed to occur in aged animals and is believed to occur as a result of changes in the synaptic physiology of aged neurons. These changes are believed to lead to a comprehensive global loss of integrated function of neural signaling in the brain (Bishop, Lu et al. 2010) and increased susceptibility to the long-term effects of oxidative stress and inflammation (Joseph, Shukitt-Hale et al. 2005). Cell loss during normal aging is believed to occur primarily due to oxidative stress caused by free radicals produced by inefficient and partially uncoupled oxidative pathways. Indeed, evidence of mitochondrial dysfunction has been shown to be a common hallmark of aging across a variety of species (C. elegans, Drosophila, mouse, rat, chimpanzee, and human). This interpretation is further supported by the observation that significant impairment of mitochondrial function shortens lifespan in both C. elegans (Rea, Ventura et al. 2007) and mice (Trifunovic, Wredenberg et al. 2004; Kujoth, Hiona et al. 2005). Improving mitochondrial function through overexpression of catalase in mice results in increased lifespan (Schriner, Linford et al. 2005).

[0174] With aging and declining mitochondrial function, brain neurons become more susceptible to age-related pathologies and cell death. This results in loss of connections between neurons and reduced neuronal function (loss of neurotransmitters, lack of firing). There is also increasing evidence that neurons respond to unrepaired DNA damage by silencing gene expression through epigenetic mechanisms, which leads to further suppression of cellular function. Furthermore, aged neural cells show increased expression of genes involved in stress response pathways in all species.

[0175] Many of these changes hallmarks are observed in in vitro cultures of aged neural cells, which show a decrease in neurite outgrowth and process formation that can be reversed by nerve growth factor (Rozovsky, Wei et al. 2005).

[0176] Neurodegenerative disorders Neurodegenerative diseases are a heterogeneous group of disorders characterized by the slowly progressive selective loss of anatomically or physiologically relevant parts of the nervous system. Prototypical examples include Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis (ALS) and Huntington's disease (HD).

[0177] The early stages of neurodegeneration share many of the same hallmarks as the decline seen in aging. Interestingly, the incidence of diseases such as Alzheimer's increases with age, with over 50% of adults over 85 years of age affected by the disease (Hebert, Scherr et al. 2003). As explained above, a decline in mitochondrial function appears to be a hallmark of aging. This decline in neuronal function appears to have a pronounced effect on neuronal populations with large bioenergetic demands, one set of neurons being the large pyramidal neurons that degenerate in Alzheimer's disease (Bishop, Lu et al. 2010). The decline in function of these classes of neurons in response to mitochondrial dysfunction may play a role in the development of neurodegenerative diseases. The effects of neurodegenerative disorders on neuronal survival can be mimicked in vitro. Incubation of N2 neuronal cells with A-β (Aβ) peptide, a peptide believed to be the causative agent of Alzheimer's disease, has a pronounced effect on neurite outgrowth that can be reversed by antioxidants. Manczak et al. (2010) J Alzheimers Dis.20 Suppl 2:S609-31.

[0178] The most common mode of cell death in neurodegeneration is via the intrinsic mitochondrial apoptotic pathway. This pathway regulates the activation of caspase-9 by controlling the release of cytochrome c from the mitochondrial intermembrane space. The concentration of ROS, a normal by-product of mitochondrial respiratory chain activity, is mediated in part by mitochondrial antioxidants such as manganese superoxide dismutase (SOD2) and glutathione peroxidase. Overproduction of ROS (oxidative stress) is a major feature of all neurodegenerative disorders. In addition to ROS generation, mitochondria are also involved in vital functions, including calcium homeostasis, mitochondrial fission and fusion, mitochondrial membrane lipid concentration, and mitochondrial permeability transition (MPT). Mitochondrial diseases leading to neurodegeneration may involve all of these functions, at least at some level (DiMauro and Schon, 2008).

[0179] There is evidence that mitochondrial dysfunction and oxidative stress are causally linked to the pathology of neurodegenerative diseases, including four of the more well-known diseases: Alzheimer's disease, Parkinson's disease, Huntington's disease, and amyotrophic lateral sclerosis (also known as Lou Gehrig's disease).

[0180] Alzheimer's disease (AD) is characterized clinically by progressive cognitive decline and pathologically by the presence of senile plaques composed primarily of amyloid-β peptides (Aβ) and neurofibrillary tangles composed primarily of hyperphosphorylated tau. Approximately 5-10% of cases are familial, have early onset, and are inherited in an autosomal dominant manner. Three proteins are known to be associated with such familial cases: amyloid precursor protein (APP) - which is sequentially cleaved by β- and γ-secretases to generate Aβ - and presenilin 1 and 2 (PS1 and PS2), one or the other of which is a component of each γ-secretase complex. Extensive literature supports a role for mitochondrial dysfunction and oxidative damage in AD pathology. Oxidative damage occurs early in the AD brain, prior to the development of significant plaque pathology. Oxidative damage also precedes Aβ deposition in transgenic APP mice and occurs even earlier, with upregulation of genes related to mitochondrial metabolism and apoptosis that colocalize with neurons undergoing oxidative damage.

[0181] Multiple pathways linking oxidative stress and AD pathology have recently emerged. Oxidative stress may activate signaling pathways that alter APP or tau processing. For example, oxidative stress increases the expression of β-secretase through activation of c-Jun amino-terminal kinase and p38 mitogen-activated protein kinase (MAPK), and increases abnormal tau phosphorylation by activation of glycogen synthase kinase 3. Oxidant-induced inactivation of key molecules may also be important. Proteomic studies have found that the prolyl isomerase PIN1 is particularly sensitive to oxidative damage. PIN1 catalyzes protein conformational changes that affect both APP and tau processing. Knockout of Pin1 increases amyloidogenic APP processing and intracellular Aβ levels in mice. Pin1-knockout mice also show tau hyperphosphorylation, motor and behavioral impairments, and neurodegeneration. Thus, oxidative-induced damage to PIN1 and similarly sensitive proteins may be important in promoting the neurodegenerative process.

[0182] Mitochondria also play an important role in Parkinson's disease (PD), which is characterized clinically by progressive rigidity, bradykinesia and tremor and pathologically by loss of pigmented neurons in the substantia nigra and the presence of Lewy bodies, characteristic cytoplasmic inclusions that immunostain for α-synuclein and ubiquitin.

[0183] Mitochondria were first implicated in PD because MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine), whose metabolite MPP+ inhibits complex I of the mitochondrial electron transport chain, caused parkinsonism in synthetic opioid abusers. This model has been refined in experimental animals, where continuous infusion of rotenone -- another complex-I inhibitor -- or MPTP results in clinically parkinsonian phenotypes and pathologically in nigral degeneration with cytoplasmic inclusions immunoreactive for α-synuclein and ubiquitin. The mechanism of toxicity in these models of complex-I inhibition likely involves oxidative stress. Complex-I inhibition and oxidative stress have been shown to be relevant in spontaneous PD when complex-I deficiency and glutathione deficiency were found in the substantia nigra of patients with idiopathic PD and pre-PD patients.

[0184] Many of the genes associated with PD also suggest a link to mitochondrial disease pathogenesis. So far, mutations or polymorphisms in mtDNA and at least nine named nuclear genes have been identified as causing PD or influencing PD risk: α-synuclein, parkin, ubiquitin carboxy-terminal hydrolase L1, DJ-1, phosphatase and tensin homolog (PTEN)-inducible kinase 1 (PINK1), leucine-rich repeat kinase 2 (LRRK2), nuclear receptor NURR1, HTRA2, and tau. Of the nuclear genes, α-synuclein, parkin, DJ-1, PINK1, LRRK2, and HTRA2 are directly or indirectly linked to mitochondria. In a minority of cases, inherited mtDNA mutations result in parkinsonism, usually as one feature of a larger syndrome. In one family, the Leber optic atrophy G11778A mutation was associated with l-DOPA-responsive parkinsonism, which variably co-occurred with dementia, dystonia, ophthalmoplegia, and ataxia. Notably, the mutation is in a subunit of complex I. Mutations in the nuclear-encoded mtDNA polymerase gamma (POLG) gene impair mtDNA replication, resulting in multiple mtDNA deletions that usually cause chronic progressive external ophthalmoplegia and myopathy. In these families, POLG mutations also co-segregate with parkinsonism.

[0185] Amyotrophic lateral sclerosis (ALS) is clinically characterized by progressive weakness, atrophy and spasticity of muscle tissue, reflecting the degeneration of upper and lower motor neurons in the cortex, brainstem and spinal cord. Approximately 90% of cases are sporadic (SALS) and 10% are familial (FALS). Approximately 20% of familial cases are caused by mutations in Cu / Zn-superoxide dismutase (SOD1). In both SALS and FALS, postmortem and biopsy samples from spinal cord, nerve and muscle show abnormalities in mitochondrial structure, number and localization. Insufficient activity of respiratory chain complexes has also been detected in muscle and spinal cord.

[0186] Huntington's disease (HD) is clinically characterized by chorea, psychiatric disorders and dementia, and pathologically by loss of long projection neurons in the cortex and striatum. HD is inherited in an autosomal dominant manner and is due to an expansion of CAG trinucleotide repeats in the huntingtin (HTT) gene, resulting in an expanded polyglutamine stretch in the corresponding protein. The normal number of CAG(Q) repeats is less than 36, whereas repeats greater than 40 are associated with human disease. Various lines of evidence implicate mitochondrial dysfunction in HD. Nuclear magnetic resonance spectroscopy reveals increased lactate in the cortex and basal nuclei. Biochemical studies show reduced activity of complexes II and III of the electron transport chain in human HD brains. Mitochondrial respiration and ATP production are significantly impaired in striatal cells derived from mutant Htt-knock-in mouse embryos.

[0187] One aspect of the present invention is a method of treating neurodegenerative diseases, age-related neuronal cell death or dysfunction. As used herein, "neurodegenerative disease" or, equivalently, "neurodegenerative disorder" refers to any condition involving progressive loss of functional neurons in the central nervous system. In one embodiment, the neurodegenerative disease is associated with age-related cell death. Representative neurodegenerative diseases include Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis (also known as ALS and Lou Gehrig's disease), as well as AIDS dementia, adrenoleukodystrophy, Alexander disease, Alpers disease, ataxia telangiectasia, Batten disease, bovine spongiform encephalopathy (BSE), Canavan disease, corticobasal degeneration, Creutzfeldt-Jakob disease, dementia with Lewy bodies, and fatal familial insomnia. , frontotemporal lobar degeneration, Kennedy disease, Krabbe disease, Lyme disease, Machado-Joseph disease, multiple sclerosis, multiple system atrophy, neuroacanthocytosis, Niemann-Pick disease, Pick's disease, primary lateral sclerosis, progressive supranuclear palsy, Refsum disease, Sandhoff disease, myelolytic diffuse sclerosis, spinocerebellar ataxia, subacute combined spinal degeneration, tabes dorsalis, Tay-Sachs disease, toxic encephalopathy, transmissible spongiform encephalopathy and wobbly hedgehog syndrome.

[0188] In one embodiment, the method is used to treat age-related neuronal cell death or dysfunction.Such method is directed to the neurodegeneration that is not the cause of specific neurodegenerative diseases, such as Alzheimer's disease, amyotrophic lateral sclerosis, Huntington's disease and Parkinson's disease.

[0189] In one embodiment, the neurodegenerative disease is selected from the group consisting of Alzheimer's disease, amyotrophic lateral sclerosis, Huntington's disease and Parkinson's disease.

[0190] In one embodiment, the neurodegenerative disease is Alzheimer's disease.

[0191] The method includes the step of administering to a subject in need of treatment for a neurodegenerative disease a therapeutically effective amount of a urolithin or a precursor thereof, thereby treating the neurodegenerative disease.

[0192] In accordance with this and other methods of the invention, "urolithin" as used herein refers to any one or combination of urolithin A, urolithin B, urolithin C, and urolithin D (see, e.g., Figures 1 and 2). In one embodiment, the urolithin is urolithin A, urolithin B, urolithin C, urolithin D, or any combination of urolithin A, urolithin B, urolithin C, and urolithin D. In one embodiment, the urolithin is urolithin A, urolithin B, or a combination of urolithin A and urolithin B. In one embodiment, the urolithin is urolithin A. In one embodiment, the urolithin is provided as an isolated urolithin, e.g., isolated from a natural source or prepared by total synthesis. Isolated urolithins may be synthesized de novo. See, e.g., U.S. Patent Application Publication No. 2008 / 0031862 by Ghosal, the entire contents of which are incorporated herein by reference.

[0193] In one embodiment, urolithin A (3,8-dihydroxydibenzo-α-pyrone) was synthesized in a two-step synthesis as follows: The first step is a copper-catalyzed reaction (Hartley reaction) in the presence of base in which the starting materials 2-bromo-5-methoxybenzoic acid and resorcinol are reacted together to produce the dihydro-dibenzopyrone scaffold. In the second step, BBr 3 Demethylation of benzopyrone using urolithin A yields 3,8-dihydroxydibenzo-α-pyrone (urolithin A).

[0194] A mixture of 2-bromo-5-methoxybenzoic acid 1 (27.6 g), resorcinol 2 (26.3 g), and sodium hydroxide (10.5 g) in water (120 mL) is heated to reflux for 1 h. Then, a 5% aqueous solution of copper sulfate (3.88 g of CuSO in 50 mL water) is added. 4 , 5H 2 0) was added and the mixture was refluxed for an additional 30 min. The mixture was cooled to room temperature and the solid was filtered on a Buchner funnel. The residue was washed with cold water (50 mL) to give a pale red solid (38.0 g) which was triturated in hot MeOH (200 mL). The suspension was allowed to stand at 4° C. overnight. The resulting pale red precipitate was filtered and washed with cold MeOH (75 mL) to give the title compound 3 as a pale brown solid. 1 H NMR is in accordance with the structure of 3.

[0195] A suspension of 3 (10.0 g; 41 mmol; 1.0 eq.) in dry dichloromethane (100 mL) was diluted with a 1 M solution of boron tribromide in dry dichloromethane (11.93 mL of pure BBr in 110 mL anhydrous dichloromethane). 3 ) was added at 0° C. The mixture was allowed to stand at 0° C. for 1 h and then warmed to room temperature. The solution was stirred at that temperature for 17 h. The yellow precipitate was filtered and washed with cold water (50 mL) to give a yellow solid which was heated to reflux in acetic acid (400 mL) for 3 h. The hot solution was quickly filtered and the precipitate was washed with acetic acid (50 mL) and then diethyl ether (100 mL) to give the title compound 4 as a yellow solid. 1 H and 13 The structure and purity were investigated by C-NMR.

[0196] [ka]

[0197] In one embodiment, "urolithin" as used herein may be or include a glucuronidated, methylated, or sulfated urolithin.

[0198] According to this and other methods of the invention, "urolithin precursor" as used herein refers to an ellagitannin or an ellagitannin metabolite, including but not limited to ellagic acid (EA). In one embodiment, the urolithin precursor is punicalagin (PA). In one embodiment, the urolithin precursor is punicalin (PB). See, e.g., FIG. 1. In one embodiment, the urolithin precursor is ellagic acid (EA). In one embodiment, the urolithin precursor is provided as an isolated urolithin precursor, e.g., isolated from natural food sources or prepared by total synthesis. Isolated urolithin precursors are typically purified from natural sources or synthesized de novo; some urolithin precursors, including EA, are commercially available from suppliers such as Sigma Aldrich.

[0199] According to this and other methods of the invention, precursors of urolithins also include natural foods containing ellagitannins and ellagic acid, particularly natural foods rich in ellagitannins, ellagic acid, or both ellagitannins and ellagic acid. Such foods include some berries, grapes, pomegranate, rose hips, and nuts. In one embodiment, the natural food is pomegranate.

[0200] Additionally, precursors of urolithins include processed foods and beverages prepared from such natural foods. The processed foods can be in any form including, for example, jams, jellies, preserves, pastes, spreads, juices, wines, extracts, concentrates, etc. In one embodiment, the processed food is pomegranate juice.

[0201] In one embodiment, the urolithin precursor is provided as an extract, e.g., a fruit extract.

[0202] In one embodiment, the urolithin precursor is provided as a concentrate, such as a fruit concentrate or a fruit juice concentrate.

[0203] The method of the present invention may be used alone or in combination with any method or compound known to be useful for treating neurodegenerative diseases.For example, in one embodiment, the method of the present invention may be combined with the use of any one or more of acetylcholinesterase inhibitors such as donezepil (Aricept®), galantamine (Razadyne®) and rivastigmine (Exelon®), and N-methyl D-aspartate (NMDA) receptor antagonists such as memantine (Namenda®).

[0204] One aspect of the present invention is a method for improving cognitive function. As used herein, "cognitive function" refers to any mental function, including symbolic operations, such as perception, memory, attention, conversational comprehension, speech generation, reading comprehension, image generation, learning and reasoning. In one embodiment, "cognitive function" refers to any one or more of perception, memory, attention and reasoning. In one embodiment, "cognitive function" refers to memory.

[0205] The method includes the step of administering to a subject in need of improved cognition a therapeutically effective amount of a urolithin or a precursor thereof, thereby improving cognitive function.

[0206] Methods for measuring cognitive function are well known and may include, for example, individual or comprehensive tests for any aspect of cognitive function. One such test is the Prudhoe Cognitive Test. Margallo-Lana et al.(2003)J Intellect Disability Res.47:488-492. Another such test is the Mini Mental State Exam (MMSE), which is designed to assess orientation to time and place, registration, attention and calculation, recall, language use and comprehension, repetitive and complex operational abilities. Folstein et al.(1975)J Psych Res.12:189-198. Other tests useful for measuring cognitive function include the Alzheimer Disease Assessment Scale-Cognitive (ADAS-Cog) (Rosen et al. (1984) Am J Psychiatry. 141(11):1356-64) and the Cambridge Neuropsychological Test Automated Battery (CANTAB) (Robbins et al. (1994) Dementia. 5(5):266-81). Such tests can be used to assess cognitive function in an objective manner, such that changes in cognitive function, e.g., in response to treatment with the methods of the invention, can be measured and compared.

[0207] The method of the present invention can be used alone or in combination with any method or compound known to improve cognitive function.For example, in one embodiment, the method of the present invention is combined with the use of caffeine, nicotine, or both.

[0208] In one embodiment, the subject does not have cognitive impairment. For example, the method can be used to enhance cognitive function in subjects with normal cognitive function.

[0209] One aspect of the present invention is a method for treating cognitive disorder. As used herein, cognitive disorder refers to any condition in which cognitive function is impaired. In one embodiment, "cognitive disorder" refers to one or more of delirium, dementia, learning disorder, attention deficit disorder (ADD) and attention deficit hyperactivity disorder (ADHD). In one embodiment, cognitive disorder is learning disorder. In one embodiment, cognitive disorder is attention deficit disorder (ADD). In one embodiment, cognitive disorder is attention deficit hyperactivity disorder (ADHD).

[0210] The method includes the step of administering to a subject in need of treatment for a cognitive disorder a therapeutically effective amount of a urolithin or a precursor thereof to treat the cognitive disorder.

[0211] The method of the present invention can be used alone or in combination with any method or compound known to be useful for treating cognitive impairment.For example, in one embodiment, the method of the present invention is combined with the use of stimulants such as methylphenidate (e.g. Ritalin®), dextroamphetamine (Dexedrine®), mixed amphetamine salts (Adderall®), dextromethamphetamine (Desoxin®) and lisdexamfetamine (Vybanase®).

[0212] One aspect of the present invention is a method for treating or preventing stress-induced or stress-related cognitive dysfunction. As used herein, "stress-induced or stress-related cognitive dysfunction" refers to stress-induced or stress-related disturbance of cognitive function. The method includes administering a therapeutically effective amount of a urolithin or a precursor thereof to a subject in need of treatment or prevention of stress-induced or stress-related cognitive dysfunction to treat or prevent the stress-induced or stress-related cognitive dysfunction.

[0213] Mood disorders Brain tissue requires high levels of energy for its metabolism, including maintenance of membrane potential, signal transduction and synaptic remodeling. In patients with mitochondrial disorders, there appears to be an exacerbation of psychiatric symptoms and disorders, particularly depression.

[0214] Mitochondrial structure and function, measured by a variety of different techniques, have been shown to be abnormal in patients with mood disorders, including major depression, and other affective spectrum disorders.

[0215] Two studies have shown that a several-fold increased likelihood of developing depression can be maternally inherited along with mtDNA, strongly suggesting that mtDNA sequence variants can induce mitochondrial dysfunction, which may predispose individuals to developing depression (Boles et al., 2005; Burnett et al., 2005).

[0216] The relationship between mitochondrial dysfunction and unipolar depression has been explored in several studies. Studies of postmortem brains from subjects with possible or diagnosed major depression, most of whom were (presumably) medicated, failed to detect an increase in the common 5 kb mtDNA deletion (Kato et al., 1997; Sabunciyan et al., 2007; Shao et al., 2008, Stine et al., 1993). Changes in translation products linked to mitochondrial function were found in the frontal, prefrontal and tertiary visual cortices (Karry et al., 2004; Whatley et al., 1996). Changes in four mitochondrially localized proteins have been reported in the anterior cingulate cortex (Beasley et al., 2006). Decreased gene expression for 6 of 13 mtDNA-encoded transcripts in frontal cortex tissue (Brodmann brain atlas areas (BA) 9 and 46) (Shao et al., 2008) and in the cerebellum for nDNA-encoded mitochondrial mRNA and protein have also been reported in major depression (Ben-Shachar and Karry, 2008). A recent study found that in half of the cases of major depressive disorder, levels of electron transport chain complex I subunit (NDUFS7) and complex I activity in postmortem prefrontal cortex were below the lowest range of normal controls (Andreazza et al., 2010). In the two latter studies, the authors were unable to detect any effect of medication on the outcome.

[0217] Decreased respiratory chain enzyme ratios and ATP production rates, as well as an increased prevalence of small mtDNA deletions (but not the common 5 kb mtDNA deletion) were found in muscle from patients with a life-threatening diagnosis of unipolar major depression comorbid with somatic symptoms. Medication did not appear to affect the results (Gardner et al., 2003b). Clinical relevance was suggested by the finding that biopsied muscle from essentially all depressed subjects with a high degree of somatic pathology revealed low ATP production rates (Gardner and Boles, 2008a).

[0218] One aspect of the present invention is a method for treating mood disorders (also known as affective disorders). As used herein, "mood disorder" refers to a disturbance of emotional state, as described in the Diagnostic and Statistical Manual of Mental Disorders published by the American Psychiatric Association. Mood disorders include, but are not limited to, major depression, postpartum depression, dysthymia, and bipolar disorder. In one embodiment, the mood disorder is major depression.

[0219] The method includes the step of administering to a subject in need of treatment for a mood disorder a therapeutically effective amount of a urolithin or a precursor thereof to treat the mood disorder.

[0220] The method of the present invention can be used alone or in combination with any method or compound known to be useful for treating mood disorders.For example, in one embodiment, the method of the present invention is combined with the use of antidepressants.Antidepressants are well known in the art and include selective serotonin reuptake inhibitors (SSRIs), serotonin-norepinephrine reuptake inhibitors (SNRIs), noradrenergic and selective serotonergic antidepressants, norepinephrine reuptake inhibitors, norepinephrine-dopamine reuptake inhibitors, selective serotonin reuptake inhibitors, norepinephrine-dopamine disinhibitors, tricyclic antidepressants and monoamine oxidase inhibitors.

[0221] One aspect of the present invention is a method for treating or preventing stress-induced or stress-related mood disorders. As used herein, "stress-induced or stress-related mood disorders" refers to stress-induced or stress-related emotional state disturbances. Such mood disorders may be called reactive mood disorders and should be distinguished from other mood disorders, such as so-called organic mood disorders. The method includes administering an effective amount of a urolithin or a precursor thereof to a subject in need of treatment or prevention of stress-induced or stress-related mood disorders to treat or prevent stress-induced or stress-related mood disorders.

[0222] One aspect of the present invention is a method for treating anxiety disorder.As used herein, "anxiety disorder" refers to a dysfunctional state of fear and anxiety, for example, disproportionate to stressful situations or the expectation of stressful situations.In one embodiment, the anxiety disorder is any one of generalized anxiety disorder, panic disorder, panic disorder with agoraphobia, agoraphobia, social anxiety disorder, obsessive-compulsive disorder, and post-traumatic stress disorder, or a combination thereof.In one embodiment, the anxiety disorder is any one of generalized anxiety disorder, obsessive-compulsive disorder, panic disorder, post-traumatic stress disorder, and social anxiety disorder, or a combination thereof.In one embodiment, the anxiety disorder is generalized stress disorder.In one embodiment, the anxiety disorder is post-traumatic stress disorder.In one embodiment, the anxiety disorder is stress-induced anxiety disorder.

[0223] The method includes the step of administering to a subject in need of treatment for an anxiety disorder a therapeutically effective amount of a urolithin or a precursor thereof to treat the anxiety disorder.

[0224] The method of the present invention can be used alone or in combination with any method or compound known to be useful for treating anxiety disorders.For example, in one embodiment, the method of the present invention is combined with the use of psychotherapy, benzodiazepines, buspirone (Buspar®) or beta-blockers, either alone or in combination. Benzodiazepines are well known in the art and include, but are not limited to, clonazepam (Klonopin®), lorazepam (Ativan®) and alprazolam (Xanax®).Additional drugs that can be used in combination with the method of the present invention include imipramine (Tofranil®) and venlafaxine (Effexor®).

[0225] One aspect of the present invention is a method for treating or preventing stress-induced or stress-related anxiety disorder.As used herein, "stress-induced or stress-related anxiety disorder" refers to a dysfunctional state of fear and anxiety that is stress-induced or stress-related.Such anxiety disorder may be called reactive anxiety disorder, and should be distinguished from other anxiety disorders, such as so-called organic anxiety disorder.The method includes administering an effective amount of urolithin or its precursor to a subject in need of treatment or prevention of stress-induced or stress-related anxiety disorder, so as to treat or prevent stress-induced or stress-related anxiety disorder.

[0226] An aspect of the present invention is a method for promoting neurite outgrowth. In one embodiment, the method is an in vitro method. In one embodiment, the method is an in vivo method. As used herein, "neurite" refers to any process from the cell body of a neuron. In one embodiment, such a process is an axon. In one embodiment, such a process is a dendrite. This term is often used to refer to immature or developing neurons, especially cells in culture, since it can be difficult to distinguish between dendrites and axons before differentiation is complete. Neurites are often packed with microtubule bundles, and their growth is stimulated by nerve growth factor (NGF) and tau protein, microtubule-associated protein 1 (MAP1) and microtubule-associated protein 2 (MAP2). Neural cell adhesion molecule N-CAM simultaneously combines with another N-CAM and fibroblast growth factor receptor to stimulate the tyrosine kinase activity of the receptor to induce neurite outgrowth.

[0227] Neurite outgrowth can be measured morphologically or functionally. Morphological measurements usually involve microscopic examination to measure the length and / or number of neurites.

[0228] As used herein, "promoting" refers to enhancing or inducing. In one embodiment, "promoting" means inducing. For example, neurite outgrowth in a negative control sample may be negligible, while neurite outgrowth in an experimental or treated sample may not be negligible. In one embodiment, "promoting" means enhancing. For example, neurite outgrowth in an experimental or treated sample may be statistically significantly greater than the negative control, while neurite outgrowth in a negative control sample may not be negligible. Needless to say, "promoting" as used herein may encompass both enhancing and inducing.

[0229] In one embodiment, the method includes contacting a neuronal cell with an effective amount of a urolithin or a precursor thereof to promote neurite outgrowth.

[0230] In one embodiment, the method comprises administering to a subject in need thereof a therapeutically effective amount of a urolithin or a precursor thereof to promote neurite outgrowth.

[0231] The method of the present invention can be used alone or in combination with any method or compound known to be useful for promoting neurite outgrowth.For example, in one embodiment, the method of the present invention can be combined with the use of any one or more of NGF, tau protein, MAP1, MAP2, N-CAM, or agents that induce the expression of any one or more of NGF, tau protein, MAP1, MAP2, N-CAM, or fibroblast growth factor receptor.

[0232] Use of Neuronal Cells In Vitro to Screen Compounds for Neuroprotective Activity During aging and neurodegeneration, the progressive decline of cognitive function is essentially due to the loss of the parts that maintain neuronal connections. These parts are essentially composed of the neuronal cell body, the neurites, and the synaptic connections that link them to target cells. Neurons exhibit a highly complex morphology. The most complex neuronal cell types, such as motor neurons that extend axonal processes up to one meter or nigral dopaminergic neurons that make more than 150,000 synaptic connections, are often the most vulnerable in normal aging or disease. To maintain such complex structures and efficiently transport electrical and neurochemical signals, neurons are highly dependent on energy supply. Thus, axonal transport, synaptic activity, and maintenance of iron gradients are highly dependent on mitochondrial function. To continue these demanding cellular functions, neurons are subjected to a long and challenging period of maintaining a delicate balance between mitochondrial activity and the associated oxidative stress. Such an imbalance is often considered the cause of neuronal dysfunction or early degeneration.

[0233] Therefore, any treatment that promotes neuronal survival or the formation of neuronal processes and synaptic connections that build the complex neuronal architecture is expected to have a positive effect on neuronal function. Measurement of compounds that affect neuronal function usually relies on laborious monitoring of treatment outcomes on animal behavior, which is not amenable to medium- or high-throughput screening of biological activity. In vitro models based on neuroblastoma cell lines or primary cultured neurons are recognized as surrogates for evaluating the effect of compounds on crucial morphological parameters that reflect the ability of neurons to maintain normal function in the mammalian brain. Indices such as the number of processes, their length or complexity reveal the effect of compounds on critical steps of intracellular signaling. Although it must be noted that such parameters only indirectly reflect the performance of higher brain functions, they allow a useful evaluation of the efficacy of compounds that may lead to improved cognitive or motor function in normal or diseased states.

[0234] metabolic disease Mitochondrial function in key metabolic tissues (liver, muscle, adipose tissue, pancreas) is involved in the development of metabolic diseases. In each of these tissues, mitochondrial oxidative activity must be adequate to completely oxidize the nutritional load, especially fatty acids. Failure to do so can lead to the accumulation of lipid intermediates, incomplete fatty acid oxidation products, and ROS. Altogether, these cellular events are involved in fat accumulation, insulin resistance, altered insulin secretion, low-grade inflammation, and oxidative stress, all of which are components of type II diabetes and obesity.

[0235] The importance of mitochondrial activity in the pathology of metabolic diseases has been demonstrated in several human studies. For example, a lack of mitochondrial oxidative phosphorylation is involved in insulin resistance in skeletal muscle, and a 30% decrease in mitochondrial activity is observed in insulin-resistant offspring of type 2 diabetic patients when compared to controls. Petersen KF,et al.(2004)New Engl J Med.350:664-71. A 20% decrease in mitochondrial activity and a 35% reduction in mitochondrial size have also been observed in obese patients compared to healthy lean subjects. Petersen KF,et al.(2003)Science 300:1140-2. Finally, age-related decline in mitochondrial function is involved in insulin resistance in the elderly. Correspondingly, a 40% decrease in mitochondrial oxidation and phosphorylation activity has been reported in the elderly compared to young subjects. These observations link disturbances in mitochondrial function to metabolic disease, particularly diabetic obesity (Kelley DE, et al. (2002) Diabetes 51:2944-50).

[0236] Mitochondrial oxidative activity, also called oxidative phosphorylation, may be considered a key determinant behind the risk of metabolic diseases. Decreasing mitochondrial activity may be mediated by genetic factors (e.g., family history, ethnicity), epigenetic mechanisms, developmental exposures, feeding behavior and aging.

[0237] When persistent nutrient excess (e.g., from overeating or impaired fat storage) exceeds energy demands and / or oxidative capacity and / or appropriate compensatory mechanisms are insufficient (e.g., due to mitochondrial inactivity and inability of mitochondria to adapt to higher cellular oxidative demands), the risk of metabolic disease increases. The resulting lipid accumulation and oxidative stress can alter transcriptional responses, damage mitochondria, and further reduce oxidative phosphorylation capacity, exacerbating the deleterious effects of nutrient excess in increasing metabolic disease risk.

[0238] Sufficiency for complete oxidation of fatty acids is a balance between (i) net mitochondrial oxidative activity (determined by the need for energy production to meet cellular demands, e.g., contraction and ion transport) and (ii) nutrient availability (determined by food intake, adiposity and fat storage capacity). Equilibrium is achieved when oxidative activity equals or exceeds the nutrient load.

[0239] Under normal homeostatic conditions, both oxidative activity and cellular nutrient availability can be altered to ensure that mitochondrial function is adequate to the surrounding metabolic environment. For example, cellular energy requirements can be increased through exercise, and nutrient availability can be decreased through weight loss and / or reduced food intake. In this context, individual differences in oxidative capacity and / or activity, nutrient loading or ability to regulate mitochondrial activity (acute response), enhanced mitochondrial capacity (chronic response) or oxidative stress relief can determine the set point of metabolic balance. Such differences may be particularly prevalent in obesogenic environments (characterized by an environment that promotes overall food intake, consumption of unhealthy foods, and physical inactivity). Thus, individuals with high oxidative capacity or adaptive response are more tolerant to large nutrient loads. Conversely, individuals with reduced oxidative capacity and / or poor adaptive response are less tolerant to regulating high nutrient loads, leading to lipid accumulation, incomplete oxidation, ROS production, and insulin resistance.

[0240] Over time, insufficient compensation results in chronic insulin resistance and metabolic disease. Insufficient oxidative capacity can be resolved by compensatory mechanisms that improve oxidative capacity (e.g., exercise) or reduce nutritional load (weight loss). However, these lifestyle changes are usually insufficient or unattainable for most overweight / obese and type 2 diabetic or prediabetic subjects.

[0241] Mitochondria are particularly important for skeletal muscle function given the high oxidative demands imposed on this tissue by intermittent contractions. Mitochondria play a critical role in ensuring the correct level of ATP required for contraction by muscle sarcomeres. This high level of demand for ATP by sarcomeres appears to involve distinct subsarcolemmal and sarcomere-associated populations of mitochondria in muscle. Furthermore, muscle cells must maintain metabolic flexibility, i.e., the ability to rapidly regulate substrate oxidation in response to the surrounding hormonal and energy status. For example, healthy muscle tissue oxidizes lipids primarily in starvation conditions, as manifested by a low respiratory quotient (RQ) and subsequent shift to carbohydrate oxidation during fed conditions (elevated RQ). The availability of nutrients, especially lipids, and their oxidative capacity within mitochondria are also crucial for sustained exercise. Thus, mitochondrial functional capacity appears to have a pronounced impact on whole-body metabolism, as it directly impacts muscle metabolic function and contributes significantly to total body weight. This possibility is supported by findings of increased mitochondrial content in skeletal muscle in individuals resistant to hypermetabolism and weight gain (Luft syndrome).

[0242] Insulin Resistance and Diabetes Skeletal muscle is the largest insulin-sensitive organ in humans, accounting for over 80% of insulin-stimulated glucose disposal. Thus, insulin resistance in this tissue has a major impact on whole-body glucose homeostasis. Indeed, multiple metabolic dysfunctions have been observed in muscle from insulin-resistant but normoglycemic subjects at high risk for developing diabetes, including (i) reduced insulin-stimulated glycogen synthesis; (ii) altered insulin signaling; and (iii) increased muscle lipid accumulation. Currently, it remains unclear whether any of these dysfunctions play a causative role in insulin resistance, but lipid excess in muscle cells strongly correlates with the severity of insulin resistance, even after correction for obesity, and this has been observed in muscles of multiple fiber types. Furthermore, experiments have linked lipid excess to the induction of insulin resistance and altered insulin signaling. Thus, a possible mechanism by which mitochondrial dysfunction may contribute to insulin resistance is via altered fatty acid metabolism. Similar to obesity, increased tissue lipid load and / or sustained inactivity can lead to accumulation of fatty acyl-coenzyme A (CoA), diacylglycerol, ceramide, products of incomplete oxidation, and ROS, all of which have been experimentally associated with impaired insulin signaling and action. Additional mechanisms that may link insulin resistance to mitochondrial oxidative dysfunction include: (i) reduced ATP synthesis for energy-demanding functions such as insulin-stimulated glucose uptake; (ii) abnormalities in calcium homeostasis (required for exercise-induced glucose uptake); and (iii) reduced ATP production during exercise, possibly contributing to increased aerobic capacity, muscle fatigue, and reduced prolonged locomotor activity (further adding to the vicious cycle of inactivity promoting insulin resistance).

[0243] Mitochondrial capacity is central to the key functions of pancreatic beta (β) cells controlling insulin secretion. Both rapid (phase 1) and more prolonged (phase 2) insulin secretion depend on glucose metabolism and mitochondrial oxidative capacity, where glucose oxidation increases the ATP / ADP ratio, inhibits plasma membrane K-ATP channels and opens voltage-dependent calcium channels. Elevated cytoplasmic calcium then induces exocytosis of plasma membrane-bound insulin granules (phase 1). Subsequent recruitment of granules to the plasma membrane (phase 2) appears to depend on mitochondrial metabolites produced by the recruitment response. Mitochondrial metabolism also requires the transient regulated production of ROS, which is required for the mitochondrial signaling pathway that induces granule exocytosis. Mitochondrial diabetes develops exclusively during aging, with a mean age of onset of 35 to 40 years in maternally inherited diabetes with deafness (MIDD) and 48 years in maternally inherited type 2 diabetes with the 14577T / C mitochondrial DNA missense mutation. This contrasts with early childhood onset diabetes in syndromes such as maturity onset diabetes of the young 2 (MODY2), in which glucose-stimulated ATP production and insulin secretion are attenuated as a result of mutations in glucokinase, the first step in glycolysis. These data suggest that mitochondrial diabetes is more likely to be the result of a gradual deterioration of β-cell function rather than an acute dysfunction due to insufficient ATP production.

[0244] Mitochondrial function in tissues involved in diabetic pathology (liver, muscle, adipose tissue and pancreatic β-cells) is critical for multiple aspects of cellular metabolism. In each of these tissues, mitochondrial oxidative activity must be adequate to fully oxidize the nutritional load, especially fatty acids. Failure to do so can lead to the accumulation of lipid intermediates, incomplete fatty acid oxidation products and ROS, including both insulin resistance (muscle, liver, adipose) and secretory alterations (β-cells).

[0245] Mild mitochondrial activity impairment and / or inability to increase activity and capacity in response to cellular energy demands may explain the reduced exercise capacity seen in individuals with a family history of diabetes. This phenomenon may contribute to reduced locomotor activity over time, raising the possibility of an imbalance between mitochondrial activity and fatty acid loading. Secondly, chronic imbalance in energy metabolism due to overnutrition, obesity and inactivity may directly contribute to increased cellular and mitochondrial ROS production. Similarly, excess ROS can induce both insulin resistance and mitochondrial dysfunction. For example, a high-fat, high-sucrose diet in diabetes-prone C57BL6 mice causes mitochondrial changes in parallel with enhanced ROS production and impaired insulin sensitivity. Similarly, exposure of muscle cells to saturated fatty acids in vitro or feeding a high-fat diet in mice results in changes in mitochondrial structure and insulin resistance, both of which can be reversed by antioxidants. Thus, oxidative stress may induce mitochondrial dysfunction in parallel with insulin resistance (presumably an adaptive response aimed at limiting further oxidative damage). Importantly, resolving oxidative stress can reverse insulin resistance.

[0246] Muscle function In other embodiments, the present invention provides a method for promoting muscle function by administering a therapeutically effective amount of mitochondrial promoting or activating extract, preparation or compound.For example, extracts containing ellagitannins or ellagic acid or compositions containing ellagitannins, ellagic acid or urolithin act to activate mitochondria and can be useful for improving physical endurance (e.g., the ability to perform physical tasks such as exercise, physical labor, sports activities, etc.), suppressing or delaying physical fatigue, enhancing blood oxygen levels, enhancing energy in healthy individuals, enhancing work capacity and endurance, reducing muscle fatigue, reducing stress, promoting heart and cardiovascular function, improving sexual function, increasing muscle ATP levels and / or reducing blood lactate.In some embodiments, the method includes administering an amount of ellagitannins or ellagic acid-containing natural extracts or compositions containing ellagitannins, ellagic acid or urolithin that increases mitochondrial activity, increases mitochondrial biogenesis, and / or increases mitochondrial mass.

[0247] Sports performance refers to the ability of an athlete's muscles to perform when participating in sports activities. Improvements in sports performance, strength, speed and endurance are measured by increasing muscle contraction strength, increasing muscle contraction amplitude or shortening muscle reaction time between stimulation and contraction. Athletes are people who participate in sports at any level and aim to achieve improved levels of strength, speed or endurance in their performance, such as bodybuilders, cyclists, long-distance runners and sprinters. Sports performance enhancement is manifested by the ability of muscles to overcome fatigue, remain active for longer periods of time and perform more effective exercises.

[0248] It is contemplated that the compositions and methods of the present invention will also be effective in treating muscle-related pathological conditions, including myopathies, neuromuscular diseases, such as Duchenne muscular dystrophy, acute sarcopenia, muscle wasting and / or cachexia associated with burns, bed rest, limb immobilization, or large chest, abdominal and / or orthopedic surgery.

[0249] Chronic stress Chronic stress has also been reported to have a significant effect on cognitive performance, more precisely on learning and memory processes (Sandi 2004; Sandi and Pinelo-Nava 2007). Several factors are determinants for the effect chronic stress has on cognitive function. The level of stress is important in determining whether stress promotes or is detrimental to cognitive function. In response to stressful situations, the body induces stress hormones, which are thought to produce an inverted U-shaped effect on learning, memory and plasticity. Baldi et al.(2005)Nonlinearity Biol Toxicol Med.3(1)9-21;Joels(2006)Trends Pharmacol Sci.27(5):244-50. Thus, stress levels have a profound effect on cognitive function, with high levels of stress resulting in high levels of stress hormones and reduced performance.

[0250] The duration of stress, whether chronic or acute, has also been shown to play a role, with differential effects on cognitive function, as well as brain structure and function (Sandi and Loscertales 1999; Pinnock and Herbert 2001). Stress also acts on memory formation, with different outcomes, with consolidation (memory storage) being promoted by acute stress and retrieval (memory recall) being inhibited (Roozendaal 2003). Furthermore, the predictability of stress also plays a role in the magnitude of the effects observed on cognitive performance (Maier and Watkins 2005).

[0251] Furthermore, the context in which chronic stress occurs and individual and gender-specific differences in stress responses are important factors in determining the ultimate cognitive impact of chronic stress (Bowman, Beck et al. 2003; Shors 2004; Joels, Pu et al. 2006).

[0252] The biological basis for the effects of chronic stress has yet to be defined in detail. However, a commonly accepted feature is the important role of glucocorticoids in mediating both the enhancing and attenuating effects of stress on various memory processes and phases. Although the mechanism of glucocorticoid action is still unclear, it has been shown in vitro to impair neuronal outgrowth induced by nerve growth factor (NGF). Unsicker et al. (1978) Proc Natl Acad Sci USA. 75:3498-502. Furthermore, neuronal structure and neurite outgrowth induced by factors such as NGF strongly correlate with their neuroprotective activity, again suggesting that neuronal structure is important for cognition.

[0253] Stress and structural remodeling Initially, the hippocampus was a brain region that received close observation due to many reports suggesting the impairing effects of chronic stress on hippocampus-dependent memory tasks. However, intensive studies are now providing evidence for a more integrative effect of chronic stress throughout the brain, with major changes reported also in the prefrontal cortex and amygdala. Changes in dendritic arborization and synaptogenesis occurring in the amygdala are plausible candidates involved in stress-induced mood alterations. Changes occurring at the level of the hippocampus and prefrontal cortex are also likely to significantly affect stress-induced mood alterations.

[0254] Hippocampus. The hippocampus is well known for its important role in memory processes. Hippocampus-dependent tasks are commonly affected by both acute and chronic stress manipulations. In humans, neuroimaging studies have reported hippocampal atrophy associated with stress- and glucocorticoid-related cognitive and neuropsychiatric alterations, including depression.

[0255] In rodents, a prominent and recurrent effect is dendritic atrophy of the apical dendrites from CA3 pyramidal neurons. This dendritic branching reduction is associated with (i) a decrease in synaptic density at excitatory glutamatergic synapses; (ii) a reduction in the volume of the complex dendritic spines, called dendrites, located on the proximal apical dendrites and somas of CA3 pyramidal cells, which serve as postsynaptic targets for mossy fiber synaptic inputs; and (iii) a reorganization of synaptic vesicles and mitochondria in afferent mossy fiber terminals. Evidence for synaptic remodeling (in terms of altered synaptic properties) has also been reported for the CA1 region of the hippocampus.

[0256] Prefrontal cortex. The prefrontal cortex (PFC) and especially its medial part (mPFC) play a key role in higher cognitive processes (including executive functions, working memory, attention) and in the integration of cognitively and emotionally relevant information. Of note, the mPFC contains high levels of glucocorticoid receptors and is involved in the regulation of stress-induced hypothalamic-pituitary-adrenal (HPA) activity. As mentioned above, clinical evidence highlights the mPFC as a region where prominent alterations occur in a wide variety of neuropsychiatric disorders, including depression.

[0257] There is substantial evidence from rodent studies for stress-induced dendritic shrinkage in the PFC. In particular, extensive neuronal remodeling has been described in layers II / III of the mPFC as a result of repeated exposure to chronic stress or repeated glucocorticoid treatment. The major changes described in this region are (i) dendritic atrophy, including both a shortening of the total length and a reduction in the number of apical dendrites from pyramidal neurons; and (ii) a reduction in apical dendritic density (loss of approximately one-third of all axospinal synapses in the apical dendrites of pyramidal neurons).

[0258] Effects of antidepressants. Treatment with the atypical (modified tricyclic) antidepressant tianeptine was shown to reverse chronic stress-induced dendritic atrophy in rat CA3 pyramidal neurons. Furthermore, it was reported that antidepressants promote axonal and dendritic sprouting. These findings suggest that antidepressants may have a profound effect on neuronal remodeling, providing evidence for the associated circuits to be reorganized during the process of recovery from depression.

[0259] Early life stress One aspect of the invention is a method for treating the mood effects of early-life stress comprising administering to a subject in need thereof a therapeutically effective amount of a urolithin or a precursor thereof to treat the effects of early-life stress on mood, depression, anxiety and risky behavior.

[0260] Early life stress has been reported to have a significant detrimental effect on cognitive performance, including psychological parameters such as a higher frequency or susceptibility to depression, anxiety, and abnormal risk behavior. Heim C, Nemeroff CB.(2001)Biol Psychiatry 49:1023-1039. Increased incidence of attention disorder / hyperactivity disorder (ADHD), post-traumatic stress disorder (PTSD), and major depression has been reported in individuals who experienced early life stress. Famularo R et al.(1992)J Am Acad Child Adolesc Psychiatry 31:863-867;Pelcovitz D et al.(1994)J Am Acad Child Adolesc Psychiatry 33:305-312. Early life stress is thought to affect the hypothalamic-pituitary-adrenal (HPA) axis. Ladd CO et al. (2000) Prog Brain Res 122:81-103. The central effector thought to regulate the responsiveness of the HPA axis to stress is central corticotropin releasing factor (CRF).

[0261] CRF is a 41 amino acid peptide distributed throughout the CNS. It contains cell bodies in the medial parvocellular region of the hypothalamic paraventricular nucleus (PVN), a central component of the HPA axis. During stress, CRF is released from the median eminence nerve endings into the hypothalamic-pituitary portal circulation and transported to the anterior pituitary where it binds to CRF receptors (CRF1 and CRF2). CRF binding to the CRF1 receptor produces effects suggestive of stress, depression and anxiety. CRF binding to the CRF2 receptor stimulates the production and release of adrenocorticotropic hormone (ACTH), which in turn stimulates the production of glucocorticoids involved in the stress response.

[0262] A consistent and long-lasting increase in CRF mRNA levels is observed in a model of early-life stress induced by maternal separation. Plotsky PM et al. (2005) Neuropsychopharmacology 30:2192-2204. Such an increase in CRF has been shown to play a role at the level of the amygdala in enhancing anxiety responses. Persistent sensitization of CRF neural circuits may contribute to the abnormal elevation of anxiety, depression, and risk behavior observed in mice exposed to early-life stress.

[0263] Current treatment regimens using antidepressants to improve psychological disorders due to early life stress Many studies have shown that antidepressants reduce CRF activity in the HPA system in rodents and primates, including humans. Banki CM et al.(1992) J Affect Disord 25:39-45; Brady LS et al.(1992) Brain Res 572:117-125; Brady LS et al.(1991) J Clin Invest 87:831-837; De Bellis MD et al.(1993) Am J Psychiatry 150:656-657; Veith RC et al.(1993) Psychiatry Res 46:1-8. Several types of antidepressants appear to reduce the activity of one or more CRF neural systems. These include selective 5-HT uptake inhibitors (SSRIs), which have been shown to be effective in treating several psychiatric disorders associated with early-life stress, such as depression and PTSD. Hidalgo RB et al.(2000)J Psychopharmacol 14:70-76. Notably, subjects who had experienced early-life stress and suffered from PTSD responded to fluoxetine in a randomized placebo-controlled trial. van der Kolk BA et al.(1994)J Clin Psychiatry 55:517-522. Furthermore, SSRIs, including fluoxetine and paroxetine, show significant efficacy compared with placebo in treating early-onset depression in children and adolescents. Martin A et al.(2000)Child Adolesc Psychiatr Clin N Am 9:135-157. Tricyclic antidepressants were also found to reverse the increased reactivity of the HPA axis to stress in adult primates exposed to maternal deprivation. Suomi SJ.(1991)Ciba Found Symp 156:171-183. Several available medications, including SSRIs, appear to be of benefit in treating children and adults exposed to early life stress. Fisher PA et al. (2000) J Am Acad Child Adolesc Psychiatry 39:1356-1364.

[0264] Further adaptations The present invention also finds application in the treatment of any of a variety of additional diseases and conditions in which mitochondrial insufficiency or reduction is involved in the pathophysiology of the disease or condition, or where improving mitochondrial function provides desired beneficial effects.As an example, the present invention further includes methods and compounds that can be used to treat male infertility associated with reduced sperm motility.Nakada et al.(2006)Proc Natl Acad Sci USA.103:15148-53.As another example, the present invention further includes methods and compounds that can be used to treat macular degeneration and certain other age-related and genetic eye disorders.Khandhadia et al.(2010)Expert Rev Mol Med.12:e34;Jarrett et al.(2010)Ophthalmic Res.44:179-90.Another example is a method for treating hearing loss, including but not limited to age-related hearing loss. In each of these other indications, the method involves administering to a subject in need of such treatment an effective amount of a urolithin, or a precursor thereof, as disclosed herein, to treat the indication.

[0265] Formulation and clinical use A "subject," as used herein, is a living vertebrate. In one embodiment, the subject is a mammal. In one embodiment, the subject is a human.

[0266] As used herein, the term "treat," when used in connection with a disease, disorder, or condition of a subject, means to reduce at least one clinical or objective phenomenon of the disease, disorder, or condition of a subject to a detectable amount. In one embodiment, the term "treat," when used in connection with a disease, disorder, or condition of a subject, means to cure the disease, disorder, or condition of the subject.

[0267] A urolithin or its precursor, alone or together with another agent, can be administered to a subject (e.g., a mammal) in a variety of ways. For example, a urolithin or its precursor can be administered orally or parenterally. Parenteral administration includes, but is not limited to, intravenous, intramuscular, intraperitoneal, subcutaneous, intraarticular, intrasynovial, intraocular, intrathecal, topical administration, or by inhalation. As such, the administration form of a urolithin or its precursor can be in a variety of forms, including whole foods, processed foods, natural juices, concentrates and extracts, injectable solutions, microcapsules, nanocapsules, liposomes, poultices, inhalation forms, nasal sprays, nose drops, eye drops, sublingual tablets, and sustained release formulations.

[0268] The compound of the present invention can be provided in isolated form.The term "isolated" as used herein means that the compound of interest is substantially removed from other compounds or components that the compound of interest may be found with, for example, as found in nature.In one embodiment, the compound is isolated when it is essentially completely removed from other compounds or components that the compound of interest may be found with.In one embodiment, the compound is isolated when it is pure.

[0269] The compound of the present invention can be incorporated into various preparations for therapeutic administration.In particular, the compound of the present invention can be formulated into pharmaceutical compositions by combining with suitable pharma-ceutically acceptable carriers or diluents, and can be formulated into preparations in solid, semi-solid, liquid or gaseous form, such as tablets, capsules, powders, granules, ointments, solutions, suppositories, injections, inhalants, gels, microspheres and aerosols.In this way, the administration of the compound can be accomplished in various ways, including oral, buccal, rectal, parenteral, intraperitoneal, intradermal, transdermal and intratracheal administration.The active agent can be distributed systemically after administration, or can be localized by topical administration, intramural administration, or by using an implant that acts to retain the active dose at the implantation site.

[0270] The compounds of the invention may also be formulated as food additives, food ingredients, functional foods, dietary supplements, medical foods, nutraceuticals or food supplements.

[0271] In pharmaceutical dosage forms, the compounds can be administered in the form of their pharma- ceutically acceptable salts.They can also be used in appropriate combination with other pharma- ceutically active compounds.The following methods and excipients are merely illustrative and not limiting.

[0272] For oral formulations, the compounds may be used alone or in combination with suitable excipients for making tablets, powders, granules or capsules, e.g., conventional excipients such as lactose, mannitol, corn starch or potato starch; binders such as crystalline cellulose, cellulose derivatives, gum arabic, corn starch or gelatin; disintegrants such as corn starch, potato starch or sodium carboxymethylcellulose; lubricants such as talc or magnesium stearate; and, optionally, diluents, buffers, wetting agents, preservatives and flavorings.

[0273] The compounds may be formulated into preparations for injection by dissolving, suspending or emulsifying them in aqueous or non-aqueous solvents such as vegetable oils or other similar oils, synthetic fatty acid glycerides, esters of higher fatty acids or propylene glycol, optionally together with conventional additives such as solubilizing agents, isotonic agents, suspending agents, emulsifying agents, stabilizers and preservatives.

[0274] The compounds can be utilized in aerosol formulations for administration via inhalation. The compounds of the present invention can be formulated into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like.

[0275] In addition, the compound can be made into suppository by mixing with various bases such as emulsifying bases or water-soluble bases.The compound of the present invention can be administered rectally through suppository.Suppository can contain a vehicle that melts at body temperature but is solid at room temperature, such as cacao butter, carbowax and polyethylene glycol.

[0276] Unit dosage forms for oral or rectal administration, such as syrups, elixirs, and suspensions, may be provided, with each dosage unit, e.g., a teaspoon, tablespoon, tablet, or suppository, containing a predetermined amount of a composition containing one or more compounds of the invention. Similarly, unit dosage forms for injection or intravenous administration may contain a compound of the invention in a composition as a solution in sterile water, saline, or another pharma- ceutical acceptable carrier, with each dosage unit, e.g., mL or L, containing a predetermined amount of a composition containing one or more compounds of the invention.

[0277] Implants for sustained release formulations are well known in the art. Implants are formulated as microspheres; slabs, etc., with biodegradable or non-biodegradable polymers. For example, polymers of lactic acid and / or glycolic acid produce erodible polymers that are well tolerated by the host. The implants containing inhibitory compounds can be placed close to the site of interest so that the local concentration of active agent is high compared to the rest of the body.

[0278] The term "unit dosage form" as used herein refers to physically discrete units suitable as unitary dosages for human and animal subjects, each unit containing a predetermined quantity of a compound of the present invention calculated in an amount sufficient to produce the desired effect, together with a pharma- ceutically acceptable diluent, carrier, or vehicle. The specifications for the novel unit dosage forms of the present invention depend on the particular compound employed and the effect to be achieved and the pharmacodynamics associated with each compound in the host.

[0279] Pharmaceutically acceptable excipients, such as vehicles, adjuvants, carriers or diluents, are readily available to the public. Moreover, pharma- ceutically acceptable auxiliary substances, such as pH adjusting and buffering agents, tonicity adjusting agents, stabilizers, wetting agents, and the like, are readily available to the public.

[0280] For clinical use, a urolithin or urolithin precursor is administered in a therapeutically effective amount. As used herein, "effective amount" refers to an amount that is sufficient to achieve a desired biological effect. As used herein, "therapeutically effective amount" refers to an amount sufficient to achieve a desired therapeutic effect in a single or multiple doses. One of skill in the art can determine a therapeutically effective amount based on in vitro, preclinical or clinical trials, or any combination thereof.

[0281] Administration is usually daily to weekly.In one embodiment, administration is at least once a week.For example, subject can be administered a dose once a week, twice a week, three times a week or every other day.In one embodiment, administration is at least once a day.For example, subject can be administered one or more times every day.

[0282] For clinical use, urolithins are typically administered in amounts ranging from about 0.2 to 150 milligrams (mg) of urolithin per kilogram (kg) of the subject's body weight. In one embodiment, the urolithin or precursor thereof is administered in a dose equal to or equivalent to 2 to 120 mg of urolithin / kg of the subject's body weight. In one embodiment, the urolithin or precursor thereof is administered in a dose equal to or equivalent to 4 to 90 mg of urolithin / kg of the subject's body weight. In one embodiment, the urolithin or precursor thereof is administered in a dose equal to or equivalent to 8 to 30 mg of urolithin / kg of the subject's body weight. When a precursor of a urolithin is administered rather than a urolithin, it is administered in an amount equivalent to the amounts of urolithin described above.

[0283] Any dose may be administered in a single dose or in divided doses.

[0284] In one embodiment, the urolithin or precursor thereof is administered at a dose sufficient to achieve a peak serum level of at least 0.001 micromolar (μM). In one embodiment, the urolithin or precursor thereof is administered at a dose sufficient to achieve a peak serum level of at least 0.01 μM. In one embodiment, the urolithin or precursor thereof is administered at a dose sufficient to achieve a peak serum level of at least 0.1 μM. In one embodiment, the urolithin or precursor thereof is administered at a dose sufficient to achieve a peak serum level of at least 1 μM. In one embodiment, the urolithin or precursor thereof is administered at a dose sufficient to achieve a peak serum level of at least 5 μM. In one embodiment, the urolithin or precursor thereof is administered at a dose sufficient to achieve a peak serum level of at least 10 μM.

[0285] In one embodiment, the urolithin or precursor thereof is administered at a dose sufficient to achieve a sustained serum level of at least 0.001 micromolar (μM). In one embodiment, the urolithin or precursor thereof is administered at a dose sufficient to achieve a sustained serum level of at least 0.01 μM. In one embodiment, the urolithin or precursor thereof is administered at a dose sufficient to achieve a sustained serum level of at least 0.1 μM. In one embodiment, the urolithin or precursor thereof is administered at a dose sufficient to achieve a sustained serum level of at least 1 μM. In one embodiment, the urolithin or precursor thereof is administered at a dose sufficient to achieve a sustained serum level of at least 5 μM. In one embodiment, the urolithin or precursor thereof is administered at a dose sufficient to achieve a sustained serum level of at least 10 μM. Sustained serum levels can be measured using any suitable method, such as, for example, high pressure liquid chromatography (HPLC) or HPLC-MS.

[0286] In one embodiment, urolithin or its precursor is administered as pomegranate juice in a volume of 25mL to 5L or an equivalent dose of ellagitannin, ellagic acid, urolithin, or any combination thereof. Table 4 shows the intake of various pomegranate compounds for various levels of pomegranate juice. This range encompasses the difference in compound concentration between different varieties of pomegranate. For the calculation of ellagic acid equivalent, it was assumed that the metabolism of each mole of punicalagin results in the release of one mole of ellagic acid, and that this conversion occurred with 100% efficiency. The urolithin level was determined assuming that all ellagic acid was present, including that derived from punicalagin and converted to urolithin with 100% efficiency. Other sources of ellagic acid besides punicalagin and ellagic acid were not considered.

[0287] [Table 4]

[0288] In one embodiment, the subject is not taking a urolithin or its precursor for any purpose other than treating a condition with the methods of the invention, hi one embodiment, the subject is not taking a urolithin or its precursor for the treatment of atherosclerosis, thrombosis, cancer, unwanted angiogenesis, infection or inflammation.

[0289] Working Example Having generally described the invention, the invention may be more readily understood by reference to the following description, which is included merely for purposes of illustration of certain aspects and embodiments and is not intended to be limiting of the invention. EXAMPLES

[0290] Preparation of functional extracts from pomegranate compounds The pomegranate extracts described herein containing specific molecules were prepared using an extraction procedure based on the adsorption of polyphenols on a column using standard polymeric adsorption, as described below. For the preparation of extracts 31008 and 1108 from pomegranate juice, pomegranates were juiced using standard juice extraction and processing procedures and adsorbed onto a polymeric chromatographic resin as pure juice. Resin Amberlite XAD-16 (Rohm & Haas) was packed into a semi-preparative column and the extracted juice was loaded. The column was washed with water and sugars were removed until complete (Brix level less than 0.1%). Polyphenols were eluted with 100% ethanol. Residual ethanol was evaporated under vacuum to obtain a concentrated extract containing 4.5 g of total polyphenols per liter, as measured using the Folin assay for total polyphenol content. Extract 1011 was prepared similarly to extracts 31008 and 1108, but the liquid extract was subsequently spray-dried using a spray dryer to obtain the final powdered extract. Using HPLC-MS for compound identification, extracts 31008, 1108 and 1011 were found to contain the molecules punicalagin, punicalin, tellimagrandin and pedunculagin.

[0291] An extract from pomegranate rind 71109 was prepared by manual peeling of the rind from the pomegranate aril pulp followed by pressing in a manual fruit press. To extract the maximum amount of polyphenols, the cake / pomace of the pressed pomegranate parts was submerged in water several times (5 min) consecutively to improve the extraction efficiency. The extracted pomegranate solution was clarified by centrifugation before being adsorbed onto a polymeric chromatographic Amberlite XAD-16 resin (Rohm & Haas) packed in a semi-preparative column and loaded with the extract water from the pomegranate rind. The column was washed with water to remove sugars until complete (Brix level less than 0.1%). Polyphenols were eluted with 100% ethanol. The residual ethanol was evaporated under vacuum to obtain a concentrated extract containing 17.1 g of total polyphenols per liter as measured using the Folin assay for total polyphenol content. This technique is a modification of methods known in the art that are described in several published methods for the purification of polyphenols from various plants and berries. Tuck, KLand PJHayball (2002) "Major phenolic compounds in olive oil: metabolism and health effects" J Nutr Biochem 13(11):636-644; and Schieber, A., P. Hilt, et al. (2003) "A new process for the combined recovery of pectin and phenolic compounds from apple pomace" Innovative Food Sci. Emerging Technol. 4:99-107.

[0292] Extract 61109 was prepared by fractionating an aqueous extract of pomegranate using centrifugal partition chromatography. The isolated fractions were lyophilized to yield extract 61109, which is highly enriched (>90%) in punicalagins.

[0293] Purification of punicalagin Preparation of extracts The extract from pomegranate was dissolved in 16 mL of organic / aqueous phase mixture (1:1) and filtered on a Teflon filter (0.45 μm).

[0294] Separation of punicalagins from extracts using centrifugal partition chromatography. Separation of punicalagins from pomegranate extract was performed by utilizing centrifugal partition chromatography (CPC). The CPC device was an FCPC® 1000 device provided by Kromaton Technologies (Angers, France) with a rotor of 1000 mL capacity. Solvent was injected by a 4-way binary high-pressure gradient pump. Samples were introduced to the CPC column via a high-pressure injection valve (Rheodyne) equipped with a 20 mL sample loop. The effluent was monitored by a diode array detection (DAD) detector equipped with a preparative flow cell. Fractions were collected by a fraction collection device. The separation step was performed at room temperature.

[0295] To complete the extraction, the stationary phase was first introduced into the column without spinning in ascending mode, then the mobile phase was pumped through the stationary phase until the equilibrium stage was reached. The rotation speed was then increased from 0 to 1000 rpm, and the mobile phase was pumped into the column at a flow rate of 20 mL / min. After injection of 10 g of pomegranate extract, fractions of 20 mL per minute were collected. The content of the pumped organic phase was monitored by online UV absorption measurement at λ=260 nm.

[0296] To recover the entire compound from the column, an elution-push-out procedure was used: after 100 min of classical elution, the mobile phase was replaced by the stationary phase used as a mobile liquid until the entire contained volume (1000 mL) was pushed out of the column. Between 51 and 63 min of elution, a fraction containing punicalagin (mixture of A and B isomers) with 94-97% chromatographic purity was obtained, and a second fraction with 85-88% chromatographic purity was obtained between 64 and 79 min.

[0297] To determine the purity level, the purified samples were examined using HPLC-DAD with a detection wavelength of 260 nm. The samples were run on a Prosontil C18, 5 μm, 250 x 4 mm column. The solvent used was H2SO4 at a flow rate of 1 mL / min. 2 The reaction mixture was OmQ + 9.1% TFA / acetonitrile + 0.1% TFA. EXAMPLES

[0298] An in vitro screening assay for compounds that promote increased mitochondrial gene expression in a prototypic skeletal muscle cell line (C2C12 myotubes) Skeletal muscle plays a central role in the control of metabolic homeostasis, since it is involved in metabolic functions such as energy consumption and maintaining insulin sensitivity. These functions are tightly linked to mitochondrial activity, and mitochondrial dysfunction plays a causative role in metabolic homeostasis failure and the development of metabolic diseases such as type 2 diabetes, obesity and dyslipidemia. The gene expression profile of genes involved in mitochondrial activity in differentiated C2C12 cells (myotubes) is a suitable model for evaluating the effects of compounds on mitochondrial activity by evaluating many pathways that reflect mitochondrial activity, such as mitochondrial biogenesis, glycolysis, fatty acid β-oxidation, electron transport chain (ETC), mitochondrial dynamics.

[0299] To evaluate the effect of compounds on mitochondrial gene expression, C2C12 myoblasts were differentiated into myotubes by serum starvation for 4 days (Cant▲o et al. (2009) Nature. 458:1056-60). Myotubes were incubated for 48 hours with ellagic acid or urolithin A at final concentrations of 1, 10 or 50 μM (all dissolved in DMSO, final concentration 0.1%). DMSO was used as a control (final concentration 0.1%). At the end of the treatment, cells were washed with phosphate-buffered saline (PBS) and mRNA was immediately extracted by adding 1 mL of Trizol reagent according to the manufacturer's instructions (Trizol reagent, Invitrogen). After extraction, cDNA was generated by reverse transcription according to the manufacturer's instructions.

[0300] Evaluation of the expression levels of genes regulating mitochondrial function (PGC-1α, Tfam, PFKFB3, CPT1b, MCAD, LCAD, Ndufa2, Cyt c and Mfn2) was performed by real-time quantitative PCR (Watanabe et al. (2004) J Clin Invest. 113:1408-18) by using the following set of primers (Fwd: forward primer; Rev: reverse primer):

[0301] PGC-1α: (Fwd)AAGTGTGGAACTCTCTGGAACTG (SEQ ID NO: 1) (Rev) GGGTTATCTTGGTTGGCTTTATG (SEQ ID NO: 2) Tfam: (Fwd)AAGTGTTTTTCCAGCATGGG (SEQ ID NO: 3) (Rev) GGCTGCAATTTTTCCTAACCA (SEQ ID NO: 4) PFKFB3: (Fwd)TCATGGAATAGAGCGCC (SEQ ID NO:5) (Rev) GTGTGCTCACCGATTCTACA (SEQ ID NO: 6) CPT1b: (Fwd) CCCATGTGCTCCTACCAGAT (SEQ ID NO: 7) (Rev) CCTTGAAGAAGCGACCTTTG (SEQ ID NO: 8) MCAD: (Fwd) GATCGCAATGGGTGCTTTTGATAGAA (SEQ ID NO: 9) (Rev) AGCTGATTGGCAATGTCTCCAGCAAA (SEQ ID NO: 10) LCAD: (Fwd) GTAGCTTATGAATGTGTGCAACTC (SEQ ID NO: 11) (Rev) GTCTTGCGATCAGCTCTTTCATTA (SEQ ID NO: 12) Ndufa2: (Fwd) GCACACATTTCCCCACACTG (SEQ ID NO: 13) (Rev) CCCAACCTGCCCATTCTGAT (SEQ ID NO: 14) Cyt c: (Fwd) TCCATCAGGGTATCCTCTCC (SEQ ID NO: 15) (Rev) GGAGGCAAGCATAAGACTGG (SEQ ID NO: 16) Mfn2: (Fwd)ACGTCAAAGGGTACCTGTCCA (SEQ ID NO: 17) (Rev) CAATCCCAGATGGCAGAACTT (SEQ ID NO: 18).

[0302] PGC-1α (PPARγ-coregulator 1α) and Tfam (mitochondrial transcription factor A) are key regulators of mitochondrial function, i.e. mitochondrial biogenesis and mitochondrial phosphorylative oxidation (mOXPHOS). Their increased expression levels reveal an overall promotion of mitochondrial activity. Evaluation of other target genes involved in central mitochondrial functions allows the identification of promoted pathways. PFKFB3 (6-phosphofructo-2-kinase / fructose-2,6-biphosphatase 3) is a central enzyme in glycolysis, i.e. the use of glucose to produce energy. Under aerobic conditions (i.e. when oxygen is available), pyruvate produced from glucose via glycolysis is used by mitochondria to produce energy (ATP) through the Krebs cycle. CPT1b (carnitine O-palmitoyltransferase 1b), MCAD (medium-chain acyl-CoA dehydrogenase) and LCAD (long-chain acyl-CoA dehydrogenase) play a central role in mitochondrial fatty acid uptake and β-oxidation, two crucial steps for energy production from fatty acids. Ndufa2 (NADH dehydrogenase [ubiquinone] 1α subcomplex subunit 2) and Cyt c (cytochrome c) are subunits of complexes I and IV of the mitochondrial electron transport chain, respectively. These proteins have essential roles in energy production from reducing equivalents produced by the mitochondrial respiratory chain and the Krebs cycle. Mfn2 (mitofusin 2) is involved in mitochondrial dynamics and fusion processes. Its expression is elevated in the context of mitochondrial remodeling and / or increased mitochondrial biogenesis (increased number of mitochondria per cell).

[0303] The data presented in Figure 3 clearly demonstrate that ellagic acid and urolithin A increase mitochondrial activity in a dose-dependent manner by regulating the expression of many genes involved in several pathways of mitochondrial metabolism. EXAMPLES

[0304] An in vitro screening assay for compounds that promote enhanced mitochondrial activity in a prototypic skeletal muscle cell line (C2C12 myotubes) Citrate synthase is the first enzyme of the tricarboxylic acid (TCA) cycle and is the rate-limiting step for entering the TCA cycle.The TCA cycle produces NADH2 and FADH2, which are then used to stimulate electron transport chain to produce proton (energy) gradient, which is used in the production of ATP.In this way, citrate synthase is an exclusive marker of mitochondrial number and mitochondrial activity.By measuring the effect of a compound or formulation on citrate synthase enzyme activity, the compound's ability to stimulate mitochondrial activity (i.e. OXPHOS and ATP production) can be evaluated.

[0305] The enzyme citrate synthase catalyzes the reaction between acetyl coenzyme A (acetyl CoA) and oxaloacetate to produce citrate. Acetyl CoA donates 4 carbons from 2 carbons of oxaloacetate, resulting in 6 carbon citrate. Hydrolysis of the thioester of acetyl CoA results in the formation of CoA with a thiol group (CoA-SH). The activity of citrate synthase is measured via the reaction between the thiol of CoA-SH and DTNB in ​​the mixture to generate 5-thio-2-nitrobenzoic acid (TNB). The yellow product (TNB) is observed using a spectrophotometer by measuring the absorbance at 412 nm (Citrate Synthase Assay Kit, Cat. No. CS0720, Sigma Aldrich).

[0306] C2C12 myoblasts were differentiated into myotubes by serum starvation for 4 days (Cant▲o et al. (2009) Nature. 458:1056-60). Myotubes were incubated for 48 h with punicalagin at a final concentration of 1 or 10 μM, or with ellagic acid or urolithin at a final concentration of 1, 10 or 50 μM (all dissolved in DMSO, final concentration 0.1%). DMSO was used as a control (final concentration 0.1%). At the end of treatment, cells were washed three times with PBS and assayed for citrate synthase activity according to the manufacturer's instructions (Citrate Synthase Assay Kit, Cat. No. CS0720, Sigma Aldrich).

[0307] As shown in Figure 4, punicalagin, ellagic acid and urolithin increased citrate synthase activity in a dose-dependent manner, indicating an overall increase in mitochondrial activity and / or mitochondrial density (number of mitochondria per cell). These results confirm those obtained by gene expression profiling of mitochondrial genes (Example 1) and demonstrate enhanced mitochondrial activity and mitochondrial biogenesis in treated differentiated C2C12.

[0308] Statistics: One-way ANOVA * p<0.05. EXAMPLES

[0309] An in vitro screening assay for compounds that stimulate AMP-activated protein kinase (AMPK) activity in a prototypic skeletal muscle cell line (C2C12 myotubes) AMPK acts as a metabolic master switch that controls several intracellular systems, including cellular uptake of glucose, β-oxidation of fatty acids, and glucose transporter 4 (GLUT4) and mitochondrial biogenesis. AMPK's energy-sensing ability results from its ability to detect and respond to fluctuations in the AMP:ATP ratio that occur during rest and exercise (muscle stimulation). For example, during exercise, AMPK activity increases (phosphorylation of AMPK, P-AMPK) while in muscle cells, metabolic stress caused by extreme cellular ATP demands occurs. When active (phosphorylation of AMPK, P-AMPK), AMPK increases cellular energy levels by inhibiting anabolic energy-consuming pathways (e.g., fatty acid synthesis, protein synthesis) and stimulating energy-producing catabolic pathways (e.g., fatty acid oxidation, glucose transport). As a result, AMPK activation leads to promotion of mitochondrial function, including increased OXPHOS and mitochondrial biogenesis.

[0310] C2C12 myoblasts were differentiated into myotubes by serum starvation for 4 days (Cant▲o et al. (2009) Nature. 458:1056-60). Myotubes were incubated for 1 h with either resveratrol (RSV) as a positive control or ellagic acid or urolithin A (UL) at a final concentration of 50 μM (all dissolved in DMSO, final concentration 0.1%). DMSO was used as a control (DMSO final concentration: 0.1%). At the end of treatment, cells were washed three times with PBS and AMP-activated protein kinase (AMPK) was assessed by Western blot. After compound treatment, C2C12 cells were lysed in buffer containing phosphatase inhibitors and protein concentration was determined using a standard Bradford assay. The equivalent of 25 μg protein was used for separation on a 10% SDS-PAGE gel and subsequently transferred by standard Western blotting procedures. Antibodies against AMPK (Cell Signaling) and phosphorylated AMPK (P-AMPK, Cell Signaling) were used for detection.

[0311] As shown in Figure 5, Western blot analysis for the phosphorylated and therefore activated form of AMPK - i.e., P-AMPK - demonstrated that the phosphorylation levels of AMPK (P-AMPK) and therefore the activation of AMP-activated protein kinase (AMPK) were indeed enhanced in cells treated with ellagic acid or urolithin compared to control-treated cells. This data indicates that both ellagic acid and urolithin A are AMPK activators, further supporting the observation that ellagic acid and urolithin induce improved mitochondrial function. EXAMPLES

[0312] Screening assay for compounds that promote neurite outgrowth in PC-12 cells Neurite outgrowth and the average number of processes per cell in neuronal cultures have been shown to correspond to neuronal function. It has been shown that chronic stress results in a decrease in both dendritic length and branching number, an effect that is reversed when the stress is removed. Furthermore, this reversibility has been shown to become inhibited with age (Bloss, Janssen et al. 2010). There is further evidence that learning and novel sensory experience are accompanied by an increase in spine formation and the elimination of delayed processes. Thus, synaptic structural plasticity plays a key role in learning and memory (Yang, Pan et al. 2009). Indeed, the level of neurite outgrowth and the number of processes induced by compounds such as nerve growth factor (NGF) strongly correlate with their neuroprotective capacity. With aging, this synaptic plasticity declines, leading to increased spine loss and reduced synaptic density (Dumitriu, Hao et al. 2010). Neurodegenerative diseases also affect neurite outgrowth. A-beta (Aβ) peptide, which has a significant impact in Alzheimer's disease, inhibited neurite outgrowth in mouse neuroblastoma cells. Thus, by assaying their impact on neurite outgrowth in vitro, compounds and formulations with neuroprotective effects on neurons under chronic stress, undergoing aging, and present in neurodegenerative diseases can be identified.

[0313] The in vitro effects of various ellagitannins and their metabolites punicalagin (PA), punicalin (PB), tellimagrandin (TL), ellagic acid (EA) and urolithin (UA) on neurite outgrowth were tested in cells of the noradrenergic rat pheochromocytoma cell line (PC-12 cells), which have been shown to differentiate in response to nerve growth factor (NGF) (Greene and Tischler 1976). Neurite outgrowth in these differentiated PC-12 cells has been shown to be strongly promoted by dibutyryl cyclic AMP (dbcAMP) (Gunning, Landreth et al. 1981), and this compound was utilized as a positive control. As a negative control, SP600125, a specific Janus N-terminal kinase (JNK) inhibitor, was utilized, which has been shown to reduce differentiation parameters of neurite outgrowth (Xiao, Pradhan et al. 2006). Ellagitannins and their metabolites tested in this assay were either synthesized or purchased from sources including Funakoshi, Sigma and Chemo. Stock solutions were aliquoted and stored at -20°C.

[0314] PC-12 cells (ATCC CRL-1721) were cultured in complete medium (RPMI 1640 + 10% heat-inactivated horse serum + 5% fetal bovine serum) in poly-L-lysine-coated culture flasks at 37°C and 5% CO. 2 was cultivated in.

[0315] 24 hours after seeding, cells were differentiated in culture flasks in complete medium supplemented with 100 ng / mL NGF (2.5S NGF, Invitrogen). Differentiation was induced for 8 days by changing the NGF-supplemented medium every 3 days.

[0316] All test compounds were prepared immediately prior to the experiment as 50 mM stock solutions in dimethyl sulfoxide (DMSO). The final DMSO concentration was 0.1% in the medium for all experimental groups.

[0317] For neurite outgrowth measurements, differentiated cells were washed with phosphate-buffered saline (PBS), collected after detachment, and supplemented with 100 ng / mL NGF, 10 μM SP600125 (negative control), 1 mM dbcAMP (positive control), or 5x10 -7 The cells were replated at a density of 5,000 cells / well (Biocoat Imaging 96-well plates) in complete medium with or without the test compound of M. In the undifferentiated control group, no NGF was added after replanting.

[0318] After 72 hours in culture, PC-12 cells were washed with PBS and fixed in 1% paraformaldehyde solution for 20 minutes. After three washes with PBS, immunofluorescent labeling was performed with a Texas Red maleimide probe, which reacts with the thiol groups of protein cysteine ​​residues and visualizes the entire cell morphology, including neurites.

[0319] Immunofluorescence analysis was performed on an automated confocal microscope. Images were acquired using a BD Pathway 855 system under a X20 objective with an 8X8 field montage. Neurite outgrowth was then measured from the acquired images by the neurite module of Metamorph® software. The total and average outgrowth, the total and average number of processes per cell, and the total number and percentage of cells with extensive outgrowth (defined as outgrowth greater than 20 μm) were analyzed.

[0320] All compounds except PA and PB increased the number of PC-12 cells in the wells by more than 30% as shown in Figure 6, indicating a trophic effect for these compounds at a concentration of 0.5 μM (p<0.001 for UA, EA and TL vs. differentiated control (Control)).

[0321] Promoting neurite outgrowth As shown in Figures 7 and 8, all of the tested compounds (PA, PB, TL, EA and UA) were able to induce robust neurite outgrowth from differentiated PC-12 cells. The average outgrowth (Figure 7) was more than 30% longer than the differentiated control for all of the tested compounds. The percentage of cells showing significant outgrowth (Figure 8) was significantly greater than that observed for differentiated cells for all of the tested compounds (p<0.05 for UA and PB (26% increase), p<0.01 for PA (>26% increase), p<0.001 for EA and TL, (>37% increase)).

[0322] Promotes protrusion and branching Compounds PA, PB, UA, EA and TL all induced increased process number when added to differentiated PC-12 cells. Compounds (UA, p<0.05 (15.7% increase); PA, p<0.01 (26.3% increase); EA and TL, p<0.001 (>31% increase) were as effective or more effective than the positive control dbcAMP in promoting process formation (Figure 9).

[0323] Neurite branching was significantly greater than that observed in differentiated controls, with most compounds inducing a two-fold increase in branching. EXAMPLES

[0324] Screening assay for compounds that promote neurite outgrowth in dopaminergic TH-positive primary cultured neurons Due to their non-transformed state, primary cultured neurons provide a good in vitro model for the effects of compounds on markers of neuroplasticity and differentiation, such as neuronal outgrowth and dendrite and process formation. The effects of various ellagitannin metabolites punicalagin (PA), urolithin (UA), ellagic acid (EA) and tellimagrandin (TL) on this process were examined. Compounds tested in this assay were purchased or chemically synthesized from sources including Funakoshi and Sigma. Stock solutions were aliquoted and stored at -20°C.

[0325] Midbrain primary cultures were prepared from rat E14 embryos. The ventral midbrain was carefully dissected and excised. Cells were then seeded at a density of 100,000 cells / well (96-well plate) in DMEM F12 medium containing 10% heat-inactivated horse serum with or without the JNK-specific inhibitor SP600125 (10 μM) (as a negative control), dbcAMP (1 mM) (as a positive control), or test compounds at a dose of 0.1 μM each.

[0326] 72 hours after seeding, the effect on neurite outgrowth of dopaminergic tyrosine hydroxylase (TH)-positive neurons was measured from images covering the entire well surface taken by an automated confocal microscope (x4 objective, montage 4x4) and quantified using the neurite outgrowth module Metamorph® software. In this way, several representative parameters of neurite outgrowth were obtained, and the total and average outgrowth, the total and average number of processes per cell, and the total number and percentage of cells with extensive outgrowth (defined as those with an outgrowth of more than 20 μm) were analyzed. All experiments were performed in quadruplicate under the same conditions.

[0327] Promoting neurite outgrowth As shown in Figures 10-16, the compounds selected in the PC-12 screening assay described above were also able to induce neurite outgrowth in primary cultured midbrain neurons at a concentration of 0.1 μM. Most compounds were as effective as dbcAMP in promoting outgrowth per cell (increased outgrowth by more than 25%) as judged by the average outgrowth per cell shown in Figure 10 (p<0.001 vs. control for UA, GA, EA, TL). All tested compounds were as good as or better than dbcAMP (Figure 11).

[0328] Increased neurite and branching All tested compounds showed a significant increase in the average number of processes per cell (>10%) (Figure 12) as well as the maximum process length (>10%) (Figure 13).

[0329] Primary cells showed increased branch formation in the presence of a positive control (dbcAMP). However, the JNK inhibitor SP600125 did not inhibit primary cell branch formation in PC12 cells, but was able to promote branch formation, albeit at a lower level than dbcAMP (60% vs. 86% increase vs. dbcAMP). Compounds UA, EA, and TL were able to promote branch formation at a level similar to dbcAMP (>111% increase in branch formation, Figure 14).

[0330] Increased dendrites per cell and dendritic length UA, EA and TL significantly increased dendrite number at levels above dbcAMP, with all compounds showing an increase of >18% (FIG. 15).

[0331] Ellagic acid, urolithin A and tellimagrandin all increased dendritic cell length by more than 26%, more than that observed with dbcAMP (FIG. 16). EXAMPLES

[0332] Pomegranate extract, punicalagins, ellagic acid and urolithin A inhibited weight gain and reduced fat mass in mice fed a high-fat diet.

[0333] Male C57BL6 / J mice were purchased from Charles River Laboratory (L'Arbresle, France) at 7 weeks of age and were acclimated to the animal facility for 2 weeks before the start of the experiment. Mice were housed in 5 groups under standard housing conditions with a 12-h light / dark cycle and free access to food and water. Starting at 9 weeks of age, mice were fed a high-fat diet (HFD) (60% kcal from fat; D12492; Research Diets Inc., New Brunswick, NJ) for 14 weeks. Body weight was monitored weekly.

[0334] Mice in different treatment groups were administered (i) urolithin A at a dose of 55 mg / kg body weight per day (mkd) mixed with the diet (dietary mixture); (ii) ellagic acid at a dose of 75 mkd mixed with the diet (dietary mixture); (iii) punicalagins at a dose of 90 mkd (gavage); or (iv) pomegranate extract (PE) at a dose of 140 mkd total polyphenols (gavage). A typical pomegranate extract used in these experiments had the following composition: polyphenols, 140 mkd; punicalagins at a dose of 140 mkd; ginseng, 13.1 mkd; and ellagic acid, 13.2 mkd. For animals treated by gavage, gavage was performed daily (7 days / week) between 8:00 and 10:00 am; compounds were mixed with saline solution (0.9% NaCl) and given in a final volume of 5 mL / kg body weight. Mice in the high-fat control group were fed the same diet as the experimental animals. Mice in the corresponding different control groups were fed either high-fat diet alone or high-fat diet + vehicle (saline) by daily gavage. Another control group of mice was fed only standard chow.

[0335] Body composition was monitored by EchoMRI (Echo Medical Systems, Houston, TX, USA) 5 weeks after the start of treatment for high-fat fed mice and 2 weeks after the start of treatment for chow-fed mice. Animals were individually placed in plastic cylinders and then introduced into the EchoMRI system for approximately 2 min for body composition scans (lean and fat mass).

[0336] The results are shown in Figures 17 and 18.

[0337] Mice fed a high-fat diet (HFD) became severely obese compared to control mice fed a standard diet (CD) (Figure 17A). Weight gain in untreated high-fat fed mice was associated with an increased % fat mass (Figure 17B) and a decreased % muscle (lean) mass (Figure 17C), both measured by EchoMRI after 5 weeks of treatment. Treatment with Urolithin A (administered via dietary mix) or Punicalagin or Pomegranate Extract (PE) (both administered by gavage) prevented the development of obesity in high-fat fed mice, with treated HFD fed mice exhibiting significantly reduced weight gain compared to control HFD fed mice (Figure 17A). In addition, HFD fed mice treated with Urolithin A, Punicalagin or PE exhibited significantly reduced fat mass compared to untreated HFD fed mice (Figure 17B).

[0338] Mice fed a standard diet and treated with either ellagic acid or urolithin A also experienced an increase in muscle (lean mass) and a concomitant loss of fat mass, indicating that these treatments are favorable for the management of body weight and lean or muscular mass (Figure 18B). EXAMPLES

[0339] Pomegranate extract, punicalagins, ellagic acid and urolithin A increase muscle mass in normal and obese mice.

[0340] Male C57BL6 / J mice were divided into groups and treated as described in Example 7.

[0341] Treatment with PE, punicalagin, ellagic acid or urolithin A resulted in a statistically significant increase in the percentage of lean mass in both normal and HFD-fed mice. Mice fed a high-fat diet and treated with urolithin A, punicalagin or PE showed a concomitant increase in muscle (lean mass) and a concomitant decrease in fat mass (Figures 17B and 17C). Mice fed a diet and treated with either ellagic acid or urolithin A also showed a concomitant increase in muscle (lean mass) and a concomitant decrease in fat mass, indicating that these treatments are favorable for the management of body weight and lean or muscular mass (Figures 18A and 18B). As lean mass mainly represents muscle mass, these results illustrate how treatment with either PE, punicalagin, ellagic acid or urolithin A results in an increase in the percentage of muscle mass in both normal and obese mice with respect to total body weight. This effect was observed as early as 2 weeks after treatment. EXAMPLES

[0342] Pomegranate extract, punicalagins, ellagic acid and urolithin A increase energy expenditure in normal and obese mice.

[0343] Male C57BL6 / J mice were divided into groups and treated as described in Example 7. However, in addition, basal energy expenditure of mice was measured by indirect caloric oxygen consumption, carbon dioxide production and respiratory exchange ratio using a Comprehensive Laboratory Animal Monitoring System (CLAMS; Columbus Instruments, Columbus, OH, USA) 8 weeks after the start of treatment for HFD-fed mice and 2 weeks after the start of treatment for mice fed a standard chow diet. First, animals were acclimated to CLAMS cages (room temperature 22°C ± 1°C) for 22 hours, starting between 11:00 and 12:00 noon. Measurements were then performed under the same conditions for at least 20 hours. Measurements included a full dark cycle. Parameters measured during CLAMS were: (i) oxygen consumption (VO 2, in mL / kg / h):VO 2 (ii) carbon dioxide production (VCO 2 , in mL / kg / h); and (iii) Respiratory Exchange Ratio (RER): VCO 2 / VO 2 : RER is a measure of the utilization of energy substrates. At steady state, RER is equal to the respiratory quotient (RQ). Pure carbohydrate utilization results in RER=1, while pure fat burning results in RER=0.7. A mixed diet results in RER=0.85.

[0344] The results are shown in Figures 19 and 20.

[0345] Oxygen consumption is a physiological marker of mitochondrial activity and energy expenditure. Treatment with either PE, punicalagin, ellagic acid or urolithin A significantly increased oxygen consumption in mice. Ellagic acid and urolithin A increased energy expenditure in standard-fed mice (FIGS. 19A and 19B). This effect was observed as early as 2 hours after treatment. Pomegranate extract (PE), punicalagin and urolithin A treatment increased energy expenditure in HFD-fed mice (FIGS. 20A and 20B). EXAMPLES

[0346] Pomegranate extract, punicalagins, ellagic acid and urolithin A increase the use of fat as an energy substrate in normal and obese mice.

[0347] Male C57BL6 / J mice were divided into groups and treated as described in Example 9.

[0348] In addition to oxygen consumption, carbon dioxide production was also monitored by indirect calorimetry as described above. 2 ) and oxygen consumption (VO 2) is called the respiratory exchange ratio (RER). The RER is a good indicator of the use of energy substrates. At steady state, the RER is equal to the respiratory quotient (RQ). The preferential use of carbohydrates as an energy substrate will result in an RER approaching 1, whereas the use of fat as an energy substrate (fat burning) will result in a lower RER, approaching 0.7 when fatty acids are preferentially used.

[0349] As shown in Figures 21 and 22, treatment with PE, punicalagin, ellagic acid and urolithin A significantly reduced RER in both chow-fed and HFD-fed mice. This effect was more dramatic in mice treated with ellagic acid and urolithin A and fed a normal chow (Figure 21). These results support the changes in body composition observed following consumption of PE, punicalagin, ellagic acid or urolithin A in favor of a more muscular (lean) composition with a reduced fat composition. EXAMPLES

[0350] Pomegranate extract, punicalagin and urolithin A reduce plasma levels of triglycerides and free fatty acids in obese mice.

[0351] Male C57BL6 / J mice were divided into groups and treated as described in Example 7. In addition, plasma biochemistry was performed 14 weeks after the start of treatment using a standard automated clinical chemistry analyzer (Dimension Xpand, SIEMENS). Animals were starved for 12 hours (8 p.m. to 8 a.m. the next morning) and then blood was collected. Approximately 500 μL of blood was collected from the vena cava in anesthetized animals under isoflurane anesthesia. Blood was collected in heparinized tubes and immediately placed on wet ice. Plasma was prepared by centrifugation (1500 x g, 15 min, 4°C). Plasma samples were then transferred to clean 1.5 mL microtubes and stored at -80°C until biochemistry measurements were performed using the corresponding kits in a standard automated clinical chemistry analyzer (Dimension Xpand, SIEMENS).

[0352] Circulating levels of triglycerides and free fatty acids were measured in the blood of control and treated HFD-fed mice by standard biochemistry (Figure 23). PE, punicalagin and urolithin A treatment resulted in a statistically significant increase in plasma levels of triglycerides and free fatty acids. These results indicate that PE, punicalagin and urolithin A are effective in treating dyslipidemia in obese mice, and may therefore act to improve cardiovascular function and prevent cardiovascular disease. EXAMPLES

[0353] Punicalagin, ellagic acid and urolithin A improve glucose intolerance in obese mice.

[0354] Male C57BL6 / J mice were divided into groups and treated as described in Example 7. Furthermore, glucose tolerance test (GTT) was performed on HFD-fed mice that developed glucose intolerance. Ten weeks after the start of treatment, glucose tolerance test was monitored by oral glucose tolerance test (oGTT). Before oGTT, animals were starved for 12 hours (8 pm to 8 am the next morning). On the day of oGTT, a small drop of blood (<2 μL) was collected from a lateral tail vein and blood glucose was monitored using a glucometer (AccuCheck Aviva, Roche Diagnosis). Then, each animal was orally administered D-glucose at a dose of 2 g / kg body weight at time 0. Blood glucose was then monitored at times 15, 30, 45, 60, 90, 120 and 150 minutes after oral glucose loading.

[0355] Similar to humans, high fat feeding in mice results in obesity and type 2 diabetes characterized by severe glucose intolerance as assessed by glycemic follow-up (glucose tolerance test) immediately after exposure to glucose (2 g / kg body weight) (Figure 24). As shown in Figure 24, punicalagin, ellagic acid and urolithin A treatment improve glucose tolerance in HFD-fed mice. As a result, these treatments may also be an effective therapeutic approach for the treatment of type 2 diabetes. EXAMPLES

[0356] Urolithin A improves mitochondrial function in aged C. elegans.

[0357] C. elegans strains were grown at 20°C on nematode growth medium (NGM) agar plates seeded with E. coli strain OP50. The strain used was wild-type Bristol N2, provided by the Caenorhabditis Genetics Center (University of Minnesota). Urolithin A was dissolved in DMSO. Animals were exposed to compounds from eggs on plates seeded with live OP50 bacteria. Control plates were prepared with the corresponding DMSO concentration (0.1%).

[0358] Measurement of oxygen consumption is a direct indicator of mitochondrial activity. C. elegans were treated with Urolithin A for 10 days of adulthood, at which point the effect of Urolithin A on mitochondrial activity in aging C. elegans (10 days old) was assessed by measuring oxygen consumption using a Seahorse XF24 instrument (Seahorse Bioscience Inc., North Billerica, MA). 250 10-day-old C. elegans were used for each condition. C. elegans were removed from NGM plates containing M9 medium, washed three times in 2 mL M9 to remove residual bacteria, and resuspended in 500 μL M9 medium. Worms were transferred to standard 24-well Seahorse plates (#100777-004) (50 worms per well) and oxygen consumption was measured. First, the basal oxygen consumption of the nematodes was measured at 5-minute intervals over a period of 30 minutes (0, 5, 15, 20, 25 and 30 minutes), with five repetitions for each interval. Respiration rates were normalized to the exact number of nematodes per well, which were examined using a stereomicroscope at the end of the experiment. After the basal oxygen consumption was determined, uncoupled oxygen consumption was measured by adding carbonyl cyanide-p-(trifluoromethoxy)phenylhydrazone (FCCP) to the medium at the 30 minute time point to assess maximum oxygen consumption capacity and maximum mitochondrial capacity. Uncoupled oxygen consumption was measured at 5-minute intervals (35, 40, 45, 50, 55 and 60 minutes) to allow the measurement of mitochondrial function over time. FCCP is a chemical uncoupler that abolishes the forced link between the respiratory chain and the phosphorylation system observed with intact mitochondria. This effect is due to the amphipathic properties of the molecule, which allows it to dissolve in the mitochondrial phospholipid bilayer. This dramatically increases the ionic permeability of the mitochondrial membrane, causing a dramatic proton leak and, in parallel with the proton leak, an increase in oxygen consumption due to the inactivation by oxygen of electrons fed into the respiratory chain. Because this oxygen consumption is uncoupled from ATP production (oxidative phosphorylation), FCCP increases oxygen consumption while decreasing the production of energy (ATP) by mitochondria.Fully uncoupled mitochondria, as achieved with FCCP, exhibit maximal performance of their mitochondrial respiratory chain (maximal oxygen consumption) without any "brakes" (corresponding to oxidative phosphorylation and energy production).

[0359] The results shown in Figure 25 indicate that Urolithin A increases maximum mitochondrial capacity in aged nematodes (C. elegans) as indicated by a prolonged effect on increased uncoupled respiration in Urolithin A-treated nematodes versus control (DMSO)-treated nematodes. Control, untreated nematodes showed a brief increase in uncoupled respiration that quickly returned to basal levels of oxygen consumption. Urolithin A-treated nematodes showed a longer lasting improvement in oxygen consumption. The degree of mitochondrial activity enhancement is shown by comparing the area under the curve (AUC) during the uncoupling time with the mean coupled respiration used as a baseline. It was observed that Urolithin A significantly increased uncoupled respiration in aged nematodes when compared to control untreated nematodes over the 30 minute evaluation period. EXAMPLES

[0360] Urolithin A increases mitochondrial activity in C. elegans.

[0361] HT115 bacteria were seeded and C. elegans strains were grown at 20 °C on nematode growth medium agar plates containing 50 μM urolithin A or the corresponding concentration of DMSO as a control. Worms were treated for 24 h. The strain used was SJ4103 (zcIs14[myo-3::GFP(mit)]), a stable transgenic strain expressing mitochondrially localized green fluorescent protein (GFP) with a cleavable mitochondrial export signal peptide under the regulation of the specific body wall muscle promoter myo-3. GFP expression and quantification were performed according to a previously described protocol (Durieux et al., 2011). Worms were treated with 50 μM urolithin A from eggs and GFP was monitored one day after adulthood. Fluorescence assays were performed using a Victor X4 multilabel plate reader (Perkin-Elmer Life Science). Eighty worms were randomly removed (20 worms per well of a black-walled 96-well plate), each well was read four times, and the average was calculated.

[0362] The results in Figure 26 show that treatment of nematodes with urolithin A induced expression of a mitochondrial GFP-reporter driven by the muscle-specific myo-3 promoter in C. elegans. This significant increase in GFP expression provides clear evidence that mitochondrial capacity was increased by urolithin A. To allow such an increase in GFP signal to be observed, muscle mitochondria must either increase or become more abundant in these nematodes. EXAMPLES

[0363] Effects of pomegranate-derived compounds on mood and cognition in response to chronic stress Seven-week-old C57BL / 6J wild-type male mice were exposed to chronic unpredictable stress for four weeks. Several behavioral experiments were performed before, during, or after the chronic stress period to examine the effects on mood and cognition. As previously reported, chronic stress has a negative effect on mood and cognition. These mice were administered natural compounds derived from pomegranate to examine the effect of these compounds on reducing this negative effect on mood and cognition.

[0364] Before the start of the experiment, the mice were habituated to our animal facility for 9 days. All mice were divided into 3 groups and kept in standard plastic cages under a 12-h light-dark cycle (7:00 am to 7:00 pm) with free access to food and water. All procedures were performed in accordance with the Swiss National Institutional Guidelines on Animal Experimentation and approved by the Swiss Cantonal Veterinary Office Committee for Animal Experimentation.

[0365] Animal Characteristics After acclimation to the animal facility, all mice were characterized with respect to body weight, anxiety-like behavior in the elevated zero maze (EZM), and locomotor activity and exploration in open field and novel object assays. The aim of these experiments was to match animals according to their anxiety and exploration levels in order to establish experimental and control groups that were comparable for these traits. Elevated Zero Maze Anxiety was measured in an elevated zero maze (EZM). Mice were observed for 5 min in the EZM (a 5.5-cm-wide circular passageway 46 cm in diameter and 46 cm above the ground) under dim and dispersed light conditions. Two opposing 90° sectors were enclosed by inner and outer walls 13.5 cm high. Three compartments were therefore defined: a middle compartment containing four 30° arcs at the ends of the enclosure walls, separated by two 50°-wide closed / enclosed exploration compartments and two 70°-wide open / unenclosed exploration compartments. These boundaries were used to detect entry into the open compartments only if the animal entered there with all four limbs. The trajectory of each mouse was automatically recorded by video tracking (Ethovision 3.0, Noldus, Wageningen, Netherlands). The total number of entries into all compartments was taken as an index of spontaneous locomotor activity, while the difference between the number of entries and the time spent in the open compartment was taken as an index of anxiety. Between sessions, the maze was cleaned with 4% ethanol / water.

[0366] Open field and novel object Locomotor activity and reactivity to the open field (OF) were assessed in a white quadratic box (50x50x37cm) under dim diffuse light conditions. Mice were placed in the center of the field and allowed to move freely for 10 min. Total distance traveled, frequency of entries into the center, time and % time in the center of the OF were analyzed. Avoidance of the interior or "non-enclosed" areas of the field is interpreted as anxiety-like behavior. Total distance measurements are used as an index of activity. Exploratory behavior was assessed by using a novel object (NO) test. The NO test was performed immediately after the OF test. A small metal object (3x1.5x5cm) was placed in the center of the open field while the mouse was inside. The mouse was then given 5 min to freely explore the novel object. The time spent in the center and periphery of the compartment, the number and duration of entries into the center, and the total distance traveled in the center and throughout the compartment were analyzed. The percentage of time and distance the mouse spent in the center while exploring the novel object were considered as an index of "focused" exploratory activity.

[0367] Treatment with pomegranate extract Three weeks before the start of the chronic stress protocol, mice were divided into four different groups: one group was fed with standard mouse chow (control), while the remaining three groups were fed with various doses of extract 1011, an extract from pomegranate juice: the low dose corresponds to an extract dose of 21 mg / kg / d of gallic acid equivalent of polyphenols (GAE PPE), the medium dose corresponds to an extract dose of 43 mg / kg / d of GAE PPE, and the high dose corresponds to an extract dose of 86 mg / kg / d of GAE PPE (see Table 5).

[0368] [Table 5]

[0369] Dietary treatment was initiated 3 weeks prior to the start of the chronic stress protocol and continued until the end of the experiment.

[0370] Treatment with Urolithin A, a pomegranate-derived metabolite Three weeks before the start of the chronic stress protocol, mice were divided into two groups: one group was fed standard mouse chow (control) and the other group was fed a diet containing Urolithin A delivered at a dose of 25 mg / kg / d.

[0371] Chronic and unpredictable stress The unpredictable chronic stress protocol involved exposing animals to stress conditions at unpredictable moments every day for 4 weeks (randomly distributed between 8 am and 4 pm over 28 days). The stress stimuli used were: tail suspension for 6 min; unavoidable paw shocks of 3x0.4 mA; exposure to dirty, damp sawdust for 4 h; placement on an elevated platform for 2 h; immobility in a plastic tube for 1 h; exposure to 16°C for 30 min; reversed light / dark cycle for 2 days; contact with older aggressive conspecifics for 10 min; exposure to intense light (600 lux); 2 h in crowded cages (6 mice) and 8 h in cages tilted at 40°. All animals were weighed and their fur condition was regularly evaluated (every 3 to 5 days). During the experiment, one group of mice was exposed to chronic stress, while the other group of animals was kept undisturbed and served as control.

[0372] Behavioral assays Tail suspension test The tail suspension test (TST) is used as a model to evaluate antidepressant-like activity in mice. This test is based on the fact that mice undergo a brief (6 min) and unavoidable stress of being suspended by their tail, resulting in a stationary posture. Mice were suspended on a metal bar with adhesive tape attached 20 mm from the tip of their tail. The distance of the bar from the floor was approximately 25 cm. Immobility was defined as the absence of movement initiation, including passive rocking. Test times, including immobility, striding, and climbing, were scored from the videotape.

[0373] As shown in Figure 27, chronic stress results in increased immobility in the TST, which is an indicator of worsening depression and helplessness.However, mice treated with increasing doses of pomegranate extract showed a reversal of this pattern and restored motility and paw movement to the level observed in non-stressed mice.Thus, pomegranate extract prevents the depressive response observed in chronically stressed non-treated mice.

[0374] Context Awareness Contextual fear conditioning is a measure of an animal's ability to remember a particular context. In this assay, a mouse is placed in a box and then given two mild shocks, one minute apart. In response to the shock, the mouse freezes. At a later time, the mouse is placed back in the box to test its ability to recognize the context in which it received the shock. If the mouse recognizes the context, it freezes in anticipation of receiving a shock.

[0375] In normal mice, the ability to recognize the context without any shock is a measure of contextual memory: mice with better contextual memory will better recognize the initial context and therefore will show higher levels of freezing.

[0376] This assay can also be used to measure anxiety in stressed mice. In stressed mice, increased anxiety can be observed in the increased freezing reaction time in response to the first shock as well as the increased extinction time for the memory of the context. Extinction of the contextual memory is measured by placing the mouse in the same context once a day for several days in the absence of the initial unpleasant stimulus. Over time, the mouse forgets the association between the unpleasant stimulus and the context, as evidenced by a gradual decrease in freezing. In anxious stressed mice, the extinction of this unpleasant memory takes longer.

[0377] Contextual fear conditioning was used to test the effect of pomegranate extract on anxiety induction (i.e. learned anxiety) in mice in response to contextual cognition. Training and testing were performed in a rodent conditioning chamber (20x20x28cm), placed in a Plexiglas box and illuminated by a 20-W bulb. The conditioning chamber's side walls were made of white methacrylate, and the door and top were made of Plexiglas. The floor consisted of 20 steel bars through which the shock generator could deliver scrambled shocks. A ventilator provided background noise of 68 dB (whole system: Panlab, SL, Barcelona, ​​Spain). In the stressed group, fear conditioning to the context was performed during the third week of the chronic stress protocol. On the day of fear conditioning, the mice were transported from the colony room to the adjacent behavioral laboratory and placed in the conditioning chamber. Training consisted of mice being exposed to the conditioning context for 3 min, followed by electric foot shocks (2 s, 0.4 mA) three times per minute. After the last foot shock, the animals were allowed to stay in the chamber for 30 seconds. Before each mouse was placed in the box, the fear conditioning chamber was thoroughly cleaned with 0.5% acetic acid. To investigate the effect of chronic stress and different doses of pomegranate extract on the level of anxiety induced by this contextual memory, the level of anxiety-induced behavior in response to this context was measured. The following behavioral responses known to be sensitive to anxiety levels were examined: % freezing, % rearing, and % grooming. These behavioral measurements were performed 48 hours after the mice were again exposed to the conditioning context for 8 minutes. After the training and test sessions, the animals were immediately returned to their home cage. The behavior of the animals was recorded and later scored with an in-house behavioral observation software, with the observer blinded to the treatment of the animals.

[0378] Freezing, defined as a decrease in movement excluding heart rate and respiration, was scored and used as an index of anxiety. Freezing time was converted to % freezing level. Pomegranate extract showed a dose-dependent response, with the highest dose significantly reducing % freezing (Figure 28), indicating protection against anxiety. A similar reduction in anxiety behavior was seen in rearing, where rearing was significantly and dose-dependently prevented upon pomegranate extract administration (Figure 29). Complementing these observations, anxiety-induced inhibition of grooming was strongly suppressed by the highest dose of pomegranate extract (Figure 30). These results demonstrate that pomegranate extract and compounds suppressed experience-induced anxiety in mice.

[0379] This experience-induced reduction in anxiety in chronically stressed mice was also observed with Urolithin A, a metabolite of punicalagin. In this study, anxiety levels were measured by extinction of the memory of an unpleasant context provided in the contextual fear assay described above. In this experiment, mice trained with the contextual fear paradigm were exposed to this context daily for 4 days, but no unpleasant stimuli were presented. Context recognition ability was measured by freezing during a 3-minute observation. It was shown that an increase in anxiety level increases the time for extinction of the memory of the unpleasant context. As shown in Figure 31, chronically stressed mice showed a slower extinction phase than normal mice. However, upon treatment with Urolithin A at a dose of 25 mg / kg / d, the extinction of unpleasant memories in chronically stressed mice was significantly accelerated, demonstrating that Urolithin A, like punicalagin, can reduce anxiety in chronically stressed mice.

[0380] Morris Water Maze Spatial memory and learning are affected by chronic stress. The Morris water maze apparatus consists of a large white circular pool (140 cm diameter) filled with opaque colored water (25°C + / - 1°C) and a platform (10x10 cm 2) was submerged 1 cm below the water surface. Surrounding the water maze was a grey curtain (25 cm from the pool perimeter) containing several salient visual cues. Before testing, mice were trained to learn the location of the platform. Using the salient visual cues, mice learn how to find the platform. With the aid of the habituation phase in which the mice are introduced to the room, the apparatus and the water, the learning phase begins by allowing the mice to swim freely for 2 min in the absence of the platform. Data are collected using a video camera fixed to the ceiling and linked to a video tracking system (Ethovision 3.0, Noldus, Wageningen, Netherlands).

[0381] After an habituation period (day 0), mice were subjected to different protocols to continuously evaluate their spatial learning ability (days 1-3). Spatial learning sessions were performed on three consecutive days (days 1-3), with four trials per day with an intertrial interval (ITI) of 6 min between each trial.

[0382] Mice were introduced into the maze using a cup, facing the pool wall, to begin each trial in one of four possible locations, randomly arranged to ensure no bias was observed between trials and trial days. The distance between the mouse and the platform was measured at each sampling time, with 25 sampling times collected per second. These distances were then summed over 60 seconds, giving a measurement of the distance (in cm) to the platform for each trial. If the mouse did not find the platform within 60 seconds, it was gently guided towards it. Each mouse had to remain on the platform for 20 seconds before returning to the waiting cage.

[0383] The results of this example show that chronic stress has a significant negative effect on learning and spatial memory. During the training period, the distance traveled to reach the platform was significantly increased compared to non-stressed controls, indicating that chronic stress impairs normal memory formation during learning (Figure 32). Treating mice with pomegranate extract could prevent these negative effects of chronic stress on learning and associative memory. A dose-dependent effect was observed in mice administered pomegranate extract, and the treated chronically stressed mice were able to perform at the same level as non-stressed controls (Figure 33).

[0384] Similar effects were observed for mice treated with Urolithin A, as shown in Figure 34. Mice subjected to the chronic stress protocol exhibited unstable learning, as evidenced by high variability between successive trials. Treatment of chronically stressed mice with Urolithin A at a dose of 5 mg / kg / d stabilized this variability. This highlights the fact that Urolithin A, a downstream metabolite of punicalagin, can also prevent these negative effects of chronic stress on cognition, including learning and memory.

[0385] In summary, these results taken together indicate that pomegranate extract and derived compounds such as urolithin A may act to reduce the negative effects of chronic stress on cognition, including memory and learning. Furthermore, the pomegranate extract and derived compounds have antidepressant activity as seen in the tail suspension test and reduce anxiety caused by chronic stress. The results also indicate that pomegranate extract prevents the decline in memory and learning ability and spatial recall commonly observed after chronic stress. EXAMPLES

[0386] Effects on memory and cognition in aged rat models The aging process has several effects on cognition and memory that can be recapitulated in rat models of aging. For review, see Gallagher and Rapp (1977) Annu Rev Psychol. 48:339-70. Aged rat models have been widely used to characterize the effects of aging on memory and cognition. In the experiments provided herein, improved performance was observed in the presence of pomegranate extract.

[0387] Aged Sprague-Dawley rats (starting at 19 months of age) were administered pomegranate extract (1108) in drinking water at a concentration of 0.34 mg / mL polyphenols (PPE). Polyphenol content was measured using the Folin-Ciocalteu spectrophotometric method, with phenolic content expressed as gallic acid equivalents. The control treatment consisted of 1.36% sucrose, 0.12% D-glucose and 0.12% D-fructose dissolved in water. Rats, with an average body weight of 660 g / rat, consumed on average 30 mL / day of both the control and 1108 treatments (see Table 6). This resulted in a dose of 15 mg PPE / kg / d or 1.1 mg punicalagins / kg / d for animals receiving the 1108 extract.

[0388] [Table 6]

[0389] Two and a half months after treatment, short-term working memory was assessed using the social recognition task, a standard test involving social recognition. Thor and Halloway (1981) Animal Learning Behavior. 9:561-5. In this task, each aged rat was placed in its home cage with a young male Sprague-Dawley rat (<5 weeks old) for 5 min. After 30 min, the exact same procedure was repeated with the same young rat, and the degree of interaction between the two rats was judged a second time. Since the two animals had previously interacted, less contact would be expected in the second interaction. This reduction in contact between the animals is a measure of cognitive ability and memory retention. After 30 min, a new young rat was placed with the aged rat for 5 min to see if the animals could distinguish between the two different young rats. During each contact period between the two rats, the total contact time was measured to assess the strength of the social interaction.

[0390] The results are shown in Figure 35. Control-treated aged animals did not choose the familiar object and spent equal time exploring both objects, an effect previously shown in aged rats and likely reflecting a decline in temporal order memory during aging. Hauser et al. (2009) Behav Neurosci. 123:1339-45. However, rats treated with extract 1108 spent less time with the same young rats and more time interacting with the new young rats during the second exposure period. This observed difference explains the preventive effect of extract 1108 on memory development and maintenance. EXAMPLES

[0391] Effects on spatial memory in an aged rat model Spatial memory has also been reported to be affected by aging, resulting in a decline in performance. Bergado et al. (e-pub October 29, 2010) Spatial and emotional memory in aged rats: a behavioral analysis. Neuroscience. To examine the effect of pomegranate extract on spatial memory decline during the aging process, aged Sprague-Dawley rats (starting at 19 months of age) were treated with pomegranate extract 1108 or control in drinking water as described for Example 16.

[0392] Aged rats were treated with Extract 1108 or an isocaloric control for three months, after which their learning and memory performance was assessed using the Morris Water Maze task described in Example 15.

[0393] The learning ability of each animal was evaluated through their performance in a reversal task (3 trials) test. In this task, the animals were first taught the location of the platform in the four corners (west) through three training trials. Then, the platform location was changed and the platform was placed in the opposite corner (east). The animals were given three new training periods to learn the new location of the platform. The behavior of exploring the new location of the platform was evaluated, measured by the distance traveled before learning the location of the platform. The results are shown in Figure 36. The animals treated with the extract were significantly more efficient in learning the location of the platform in the reversal test (One-way ANOVA, P<0.02; Control N=11; PJ: N=13; Extract: N=14), demonstrating the therapeutic effect of the administered extract on this aspect of spatial memory. EXAMPLES

[0394] Effects of pomegranate-derived compounds on spatial and working memory in Alzheimer's disease Alzheimer's disease (AD) has been shown to have adverse effects on spatial memory, and this effect is also observed in AD mouse models of the disease. To investigate the spatial and working memory enhancing effects of pomegranate-derived compounds in AD, various pomegranate extracts and punicalagins were tested in two behavioral assays of spatial memory, the Y-maze and the Morris water maze.

[0395] Y maze In this experiment, the 5XFAD mouse model of AD was utilized. The 5XFAD mouse model for Alzheimer's disease is based on genetic modifications (introduction of mutant human APP and PS1 genes) that lead to the production of amyloid beta peptide (Aβ) in brain tissue. These mice were found to have a significant decline in cognitive performance in the Y-maze as early as 7 months of age.

[0396] To investigate the effects of pomegranate-derived compounds, pomegranate extract (PE) from whole pomegranates was delivered by gavage at a dose of 60 mg / kg / d of polyphenols, which contains approximately 5.6 mg / kg / d of punicalagins. Mice were gavaged three times a week starting at 3 months of age until the end of treatment. After 7 months of age, mice were tested for the effect of PE on working memory in a Y-maze. Mice were placed in the Y-maze for 15 min and allowed to explore two arms, while the third arm was closed. After 4 h, the animals were placed back in the maze for 5 min, this time with the third arm open, allowing the mice to freely explore all three arms. Exploratory activity in the novel arm assessed the ability of the animals to follow spatial cues and recognize that this particular section had not yet been explored. Mice were scored as performing correct alternations during exploration if they explored each of the three arms, not just the two initially present.

[0397] As shown in FIG. 37, a significant improvement in working memory performance, as measured by the number of correct alternations, was observed in 5XFAD mice treated with PE.

[0398] Morris Water Maze Pomegranate extracts, 31008, 61109 and 71109, were tested in a second transgenic animal model of Alzheimer's disease expressing both the amyloid London mutation and the prenisilin-1 human mutation. Animals in this model develop plaques by 4 months of age and memory impairment by 6 months of age. Dense plaque burden becomes visible after 7 months.

[0399] In one set of experiments, 4-month-old APP-PS1 transgenic mice were given a fixed dose of approximately 97 mg total polyphenols / kg / day, including approximately 15 mg / kg / day punicalagins of extract 31008 from whole pomegranate, via their drinking water. In one set of experiments, 4-month-old APP-PS1 transgenic mice were given a fixed dose of approximately 468 mg total mg / kg / day of extract 61109, highly rich in punicalagins (>91%), via their drinking water. In one set of experiments, 4-month-old APP-PS1 transgenic mice were given a fixed dose of approximately 180 mg total polyphenols / kg / day of extract 71109 from pomegranate rind, via their drinking water. After 3 months of feeding, the mice (now 7 months old) were tested in the Morris water maze spatial test.

[0400] The Morris water maze was performed on days 84 to 87 of treatment. The pool (white, circular container, 1 m diameter) contained water at 20°C with titanium dioxide as an odorless, non-toxic additive, and contained a hidden escape platform (1 cm below the water surface). Swimming of each mouse was recorded on videotape and analyzed (Ethovision, Noldus information Technology, Wageningen, Netherlands). Before training, each mouse was placed on top of the platform for 15 s. For the spatial orientation test, mice were trained to locate the hidden platform in 5 blocks of 3 trials over 3 consecutive days. Each trial consisted of a forced swim test of up to 120 s, followed by a 60 s rest. To examine the learning curve for each mouse, the time required for each mouse to find the location of the platform was measured during 5 consecutive blocks of trials.

[0401] 24 hours after the final training, the platform was removed and each animal was given an exploration trial. Mice were allowed to search for the lost platform for 60 seconds, and the time spent exploring in each corner of the pool and the number of times crossing the original platform location were measured. As shown in Figure 38, mice fed with extract 31008 performed better in the exploration trial, as evidenced by an increased frequency of crossing the area where the platform was formally located. Mice fed with extracts 61109 and 71109 performed better.

[0402] The composition of the extract 61109 used in this experiment is shown in Table 7.

[0403] [Table 7] EXAMPLES

[0404] Effects of pomegranate-derived compounds on depression, anxiety, and cognition in response to early-life stress Pomegranate-derived compounds were evaluated for their ability to improve brain function, including cognition, depression, and anxiety, in an early-life stress model involving maternal-infant separation.

[0405] Early life stress has significant effects on later adulthood: (i) increased aberrant decision-making and excessive risk-taking; (ii) increased prevalence of depression and anxiety; and (iii) cognitive abilities, including impaired learning and memory.

[0406] All procedures performed were in accordance with the Swiss National Institutional Guidelines on Animal Experimentation and were approved by the Swiss Cantonal Veterinary Office Committee for Animal Experimentation.

[0407] Early life stress caused by maternal and child separation On postnatal day 1, pups were selected to have 6 pups per mother. From postnatal day 1 to 14, 3 hours of unpredictable mother-pup separation (MS) were administered daily. Separation occurred at random times (8 am to 2 pm) to avoid habituation to the mother to the procedure. The protocol consisted of pups being separated from their mother and placed in a separate cage at room temperature for 3 hours, after which the pups were returned to their original nest. These groups are labeled juvenile stress in the figures. The control group of dam / pups was not treated and is labeled normal in the figures.

[0408] Treatment with punicalagin isolated from pomegranate One week after separation, the mice were split into two groups: one control group was fed standard mouse chow (untreated), while the other group was fed the ellagitannin punicalagin mixed into their diet, delivering a dose of 90 mg / kg / day to the mice. Dietary treatment began one week after separation had ended.

[0409] Behavioral assays The effects of early-life stress on depression, anxiety and cognition were examined using the following behavioral assays performed 166 days after completion of the maternal separation protocol: Normal mice were compared with maternally separated mice (early-life stress) and maternally separated mice treated with punicalagin.

[0410] Light / dark box test In this assay, mice are placed in a PVC box (Ligna, Paris, France) that is divided into two compartments: a dark compartment (15x20x25cm, black PVC, covered on top) and a light compartment (30x20x25cm, white PVC, 200 lux illumination), both connected by an interconnecting door (5x5cm). The experiment begins by placing the animal in the dark compartment, after which a camera records the time the mouse spends in the lighted area, the number of transitions from the dark area to the lighted area, and the time it escapes from the dark area to the lighted area over a 5-minute period.

[0411] Normally, mice would avoid the illuminated area in the box. As a result of early life stress, maternally separated mice spent an abnormally long time in the illuminated compartment compared to their non-maternally separated littermates (Figure 39). This increased time spent exploring the illuminated area reflects a defect in decision-making behavior characterized by abnormal and excessive risk-taking. Punicalagin treatment of maternally separated mice reversed and normalized the observed excessive risk-taking behavior and restored decision-making processes to normal (Figure 39).

[0412] Elevated O-Maze (EOM) Another behavioral assay that measures abnormal risk behavior is the elevated O-maze (EOM). In this assay, an apparatus consisting of a ring with diameters of 41.5 / 46.5 cm (inner diameter / outer diameter) is divided into four equal parts. Two parts of the ring that face each other are surrounded by walls 5 cm high. The remaining two parts of the ring have no walls. The maze is elevated 1 m above the floor. Mice have a natural tendency to avoid open surfaces and spend more time in the closed part of the ring, which has a 5 cm wall, opposite the open area of ​​the ring.

[0413] To examine the effects of early-life stress, mice were placed at the entrance to one section of the maze with 5 cm walls, with their noses pointing towards a closed arm, and allowed to explore the EOM for 5 min, during which time the animals' behaviour was recorded by videotape. The time spent in each arm (closed and open compartments) was calculated, but an entry into an arm was considered to have occurred only if the animal placed all four paws in that arm.

[0414] Normally, mice placed in the elevated O-maze avoid the open area of ​​the ring and spend limited time exploring this area. Mice stressed by maternal separation spent an abnormally long time in the open area of ​​the O-maze compared to their non-stressed littermates (Figure 40). As also observed in the light / dark box test, this reflects impaired decision-making behavior in juvenile stressed mice, characterized by abnormal and excessive risk-taking behavior.

[0415] Punicalagin treatment of maternally separated mice reversed and normalized their abnormal and excessive risk behaviors induced by early-life stress (Figure 40).

[0416] Forced swimming test The Porsolt or forced swim test is commonly used to test antidepressant treatments (Porsolt et al., 1977a; Porsolt et al., 1977b). For this behavioral test, mice are placed in a 5 L cylinder (11 cm diameter and 25 cm height) filled 2 / 3 with water at 23°C. An animal was considered to be swimming and moving if there was any obvious movement of the body. An animal was considered to be immobile if it floated with little movement during the analysis period. Animal behavior was recorded over a 6-minute test period using a camera and a mirror behind the cylinder. For mouse swimming activity, the first 2 minutes and the last 4 minutes of swimming were analyzed separately. Increased levels of depression correlate with increased mouse immobility, especially during the last 4 minutes. Early-life stressed animals showed significantly increased immobility compared to their non-stressed littermates, suggesting increased levels of depression (Figure 41). Treatment of early-life stressed mice with punicalagin reversed this abnormal behavior (increased immobility) and increased swimming activity to levels seen in non-stressed mice. This behavioral effect of punicalagin highlights its activity as an antidepressant (Figure 41).

[0417] Contextual learning in fear conditioning Contextual fear conditioning was used to investigate the effect of the ellagitannin punicalagin on anxiety susceptibility in early-life stressed adult animals. Animals were trained in a fear conditioning chamber (Context A, WxLxH: 30cm x 24cm x 26cm) (PanLab) that contained a grid floor with stainless steel rods and was connected to a shock generator developed by Panlab. During training, animals were placed in the chamber one at a time. After 4 min of exploring the chamber, one foot shock (2 s and 0.4 mA) was administered, followed by a second foot shock (2 s and 0.4 mA) 1 min later. Thirty seconds after the second foot shock, the mouse was placed back into its home cage. Animal behavior was monitored every 2 s throughout the experiment. The time the mouse spent motionless in the chamber was considered "freezing" and was scored during these times. The time the mouse spent motionless after the first shock was recorded for 60 s and expressed as a %.

[0418] The behavior of the mice to become still and "freeze" in response to the foot shock is a measure of their anxiety level: the longer the time spent "freezing" during this behavioral test, the higher the anxiety level of the animal.

[0419] Differences in freezing after the first shock between test groups (normal non-stressed, early-life stressed and early-life stressed + punicalagin) were observed (Figure 42). Early-life stress led to increased anxiety in mice as evidenced by increased freezing time after foot shock compared to their non-stressed littermates (Figure 42). Punicalagin treatment attenuated and normalized these elevated anxiety levels resulting from early-life stress as evidenced by decreased freezing time after foot shock (Figure 42). These observations in an early-life stress model indicate an anxiolytic effect of punicalagin.

[0420] The increased anxiety that occurred in animals exposed to early-life stress was also observed in the extinction (i.e., disappearance) of contextual memory (i.e., memory that associates the environmental context with the shock) induced by this assay. To examine the intensity of anxiety generated during fear conditioning contextual learning (as described above), animals were placed in the same chamber and context for 3 min each day (same time each day, but this time without shock) for 12 days after the first test. During each of these 3 min each day, simple recognition-induced freezing behavior was measured by the animals in the chamber that received the first shock.

[0421] Animal groups (normal non-stressed, juvenile stressed and juvenile stressed + punicalagin) differed in their shock context recall impairment over 12 consecutive days (Figure 43). In this graph, the duration of freezing is expressed as a % of the immobility time on day 1 (e.g. if a mouse is immobile for 60 seconds on day 1 and 30 seconds on day 8, the % immobility is 100% on day 1 and 50% on day 8).

[0422] Normal non-stressed mice showed a cyclical decline in contextual recall over the course of 12 days (Figure 43). Early-life stressed mice had high levels of contextual recall, as indicated by higher freezing levels than their non-stressed littermates (Figure 43). This indicates prolonged and elevated anxiety levels in these maternally separated mice. Punicalagin treatment of early-life stressed mice had a clear effect on reducing anxiety, as seen by the extinction of contextual recall. Treated early-life stressed mice exhibited a faster extinction than untreated early-life stressed mice, characterized by a reduced freezing duration between days 8 and 12 (Figure 43).

[0423] Rotarod To measure the effect of pomegranate-derived compounds on the negative effects of maternal separation on cognition, the effect of motor learning was assayed using a rotarod behavioral assay. The rotarod apparatus consists of a rod with a diameter of 2 cm. Mice are placed on the rotating rod starting at an initial speed of 5 rpm. The rod speed is gradually accelerated at a rate of 8 rpm / min until the rod speed reaches 45 rpm. Fall latency was measured with a cutoff time of 300 seconds. As shown in Figure 44, early-life stressed mice had reduced motor learning function. Maternally separated mice fell off the rotarod faster than normal non-stressed mice. Treatment with punicalagin restored motor learning skills in early-life stressed animals to the performance level observed in normal non-stressed littermates.

[0424] Morris Water Maze To evaluate the effect of maternal separation on cognition, the Morris water maze behavioral assay was used. In this assay, cognitive learning is measured by the ability of mice to locate a hidden platform in an opaque pool of water. The apparatus consists of a pool (140 cm diameter) filled with water at 22°C. Mice escape from the water by swimming to a hidden circular platform (15 cm diameter) placed 1 cm below the water surface. By using visual cues placed outside the maze, mice are able to locate the platform and recall its location during the following trials. During the training period, mice were placed at two starting locations (alternating) every hour. The Morris water maze task was performed as 8 trials at T1, 6 trials at T2 and 4 trials at T3 (days 1, 2 and 3). Mice had a maximum of 60 seconds to reach the platform. The escape latency to reach the platform was measured by a video tracking system. As can be seen in Figure 45, early-life stress had a significant effect on cognitive learning, with the mice taking longer to learn the location of the hidden platform, as indicated by increased escape latency compared to normal, non-stressed mice. Treating these maternally separated mice with punicalagin reversed this negative effect of early-life stress, shortening the time to learn the location of the hidden platform to levels observed in normal, non-stressed mice. These results demonstrate the ability of punicalagin to reverse the long-term negative cognitive effects of early-life stress on learning and memory formation.

[0425] Pomegranate-derived compounds Taken together, the above data reveal that ellagitannin-derived compounds can reverse the long-term negative effects of early-life separation on depression, anxiety and cognition. EXAMPLES

[0426] Effects of pomegranate-derived compounds on memory and cognition in normal mice Treatment with pomegranate-derived compounds Beginning at 3 months of age, mice were fed either (i) a standard control diet such as AIN-93G; (ii) a diet containing punicalagin at a concentration of 0.87 mg / kg to deliver an approximate dose of 90 mg / kg / day (for 3 months); or (iii) a diet containing Urolithin A at a concentration of 0.57 mg / kg to deliver an approximate dose of 55 mg / kg / day (for 2.5 months). Actual doses will vary slightly depending on the diet intake of each individual mouse as well as the weight of the mouse. After this period, behavioral assessments of cognition were measured.

[0427] Behavioral assays to measure the effects of pomegranate-derived compounds on cognition To investigate the effects of pomegranate-derived compounds on memory and cognition, mice were examined for the improvement of contextual memory using a fear conditioning contextual learning assay. Mice were trained in a fear conditioning chamber as described in Example 19.

[0428] During training, animals were placed into the chamber one at a time. After 4 min of exploration in the chamber, one foot shock (2 s and 0.4 mA) was administered, followed by a second foot shock (2 s and 0.4 mA) 1 min later. Thirty seconds after the second foot shock, the mouse was placed back into its home cage.

[0429] One day later, the trained animals were placed back into the chamber for 3 min. During this time, the mice were monitored for movement. The amount of time they spent motionless or "freezing" under observation was scored as a % of the total time (3 min). Time spent motionless is a measure of memory strength for the mice to recall the context in which they were trained. Treatment with both the pomegranate-derived ellagitannin punicalagin and the ellagic acid metabolite urolithin A led to a significant improvement in contextual memory over untreated control mice 24 h after the training period, as judged by their contextual memory (Figure 46).

[0430] To examine the effects of these pomegranate-derived compounds on memory retention, normal mice fed either (i) control diet; (ii) punicalagin (for 3 months) or (iii) urolithin A (for 2.5 months) on days 1, 2, 3, 4 and 5 after the initial fear contextual training were examined for their memory recall.

[0431] After the first test, animals were placed in the same chamber and context for 3 min each day for 5 days (at the same time each day, but this time without shock). During each of these 3 min daily periods, simple context recognition-induced freezing behavior by the animals in the chamber that received the first shock was measured. The ability to recognize this environment in the absence of stimuli is a measure of contextual memory.

[0432] With each day, control untreated mice begin to lose their memory of this contextual stimulus as evidenced by a reduced degree of freezing (Figure 47). Mice treated with either punicalagin or urolithin A demonstrated improved memory retention when compared to control untreated mice. This is explained by their ability to remember the initial context for a longer period of time, evidenced by a significantly longer time for the extinction of the contextual memory (Figure 47).

[0433] These results demonstrate that treatment with either punicalagin or urolithin A leads to cognitive enhancement, as evidenced by significant improved contextual awareness and enhanced memory retention. EXAMPLES

[0434] Effects of pomegranate-derived compounds on improving muscle function in normal mice The ellagitannin-derived compounds punicalagin and urolithin A were evaluated for their ability to improve muscle function. To investigate the beneficial effects of punicalagin and urolithin A on improving muscle function, their effects were examined using two behavioral assays: (i) the rotarod assay, which measures muscle function and motor skills, including coordination, and (ii) the treadmill endurance test, which measures muscle function and endurance.

[0435] Behavioral assays to measure the effects of pomegranate-derived compounds on muscle function Rotarod assay Beginning at 3 months of age, mice were fed either a standard control diet such as AIN-93G or a diet containing punicalagin to deliver a dose of 90 mg / kg / day for 3 months.

[0436] To investigate the effect of pomegranate-derived compounds on muscle function and motor skills, mice were tested in a rotarod behavioral assay. The rotarod apparatus consists of a rod 2 cm in diameter with 5 compartments and 5 cm in width. Mice are placed on the rotating rod starting at an initial speed of 5 rpm. The rod speed is gradually accelerated at a rate of 8 rpm / min. The latency to fall was measured with a cutoff time of 300 seconds. Mice were tested for four trials. The latency to fall is a measure of the muscle function and motor skills of the mice, with better performance reflected by a longer latency to fall. Both control untreated and punicalagin-treated mice were tested. The ellagitannin punicalagin was able to significantly improve muscle function and motor skills compared to untreated mice. Punicalagin-treated mice were able to stay on the rotarod for a longer time and at a higher speed compared to untreated mice during the subsequent trial period (Figure 48).

[0437] Endurance Test Normal 8-week-old mice were acclimated for two weeks before the start of the study. Mice were fed either standard rodent chow or chow containing Urolithin A mixed with the chow to deliver a dose of 55 mg / kg / day to the mice. After six weeks of treatment, the mice were tested for muscle function in an endurance test.

[0438] Endurance tests were performed using a variable speed belt treadmill enclosed in a plexiglass chamber with a stimulator consisting of a shock grid attached to the back of the belt (Panlab, Barcelona, ​​Spain). Mice were made to run at 10 cm / s with a 0° incline. The speed was then increased by 2 cm / s every 5 min until the mice were exhausted. The distance traveled and the number of shocks obtained over a 5 min interval were recorded. When mice received approximately 20 shocks in 1 min, they were considered exhausted and removed from the experiment. Control untreated and Urolithin A-treated mice were tested and compared for their performance.

[0439] Improved muscle function and endurance is reflected by the ability to run at a faster speed on the treadmill. The mice will try to avoid the shock and run despite the increased speed. At a certain point, the mice will not be able to keep up with the treadmill speed and will receive a shock. After a threshold level of shock is reached, the mice are removed from the treadmill. Mice with better muscle function and greater endurance will be able to keep up with the increased treadmill speed and will receive less shock at a particular speed. Urolithin A-treated mice ran faster in this behavioral assay than untreated control mice, indicating that Urolithin A improved muscle function and endurance in this context (Figure 49).

[0440] These results demonstrate that the ellagitannin punicalagin and its metabolite urolithin A can improve muscle function and motor skills in mammals.

[0441] Other exemplary embodiments are given below. (1) A pharmaceutical composition comprising a therapeutically effective amount of a urolithin for improving cognitive function (excluding compositions comprising physiologically active metabolites of docosahexaenoic acid and eicosapentaenoic acid). (2) The pharmaceutical composition according to (1) above, wherein the cognitive function is selected from the group consisting of perception, memory, attention, comprehension of speech, speech generation, reading comprehension, imagery generation, learning and logical thinking. (3) The pharmaceutical composition according to (2) above, wherein the cognitive function is selected from the group consisting of perception, memory, attention and logical thinking. (4) The pharmaceutical composition according to (3) above, wherein the cognitive function is memory. (5) A pharmaceutical composition comprising a therapeutically effective amount of a urolithin for treating cognitive impairment (excluding compositions comprising physiologically active metabolites of docosahexaenoic acid and eicosapentaenoic acid). (6) The pharmaceutical composition according to (5) above, wherein the cognitive disorder is selected from the group consisting of delirium, dementia, learning disability, attention deficit disorder (ADD) and attention deficit hyperactivity disorder (ADHD). (7) The pharmaceutical composition according to (6) above, wherein the cognitive disorder is a learning disorder. (8) The pharmaceutical composition according to (6) above, wherein the cognitive disorder is attention deficit disorder (ADD). (9) The pharmaceutical composition according to (6) above, wherein the cognitive disorder is attention deficit hyperactivity disorder (ADHD). (10) The pharmaceutical composition according to any one of (1) to (9), which is a food for medical patients. (11) The pharmaceutical composition according to any one of (1) to (9), wherein the pharmaceutical composition is for topical administration. (12) The pharmaceutical composition according to any one of (1) to (9), wherein the pharmaceutical composition is for oral administration. (13) The pharmaceutical composition according to any one of (1) to (9), which is for parenteral administration. (14) The pharmaceutical composition according to any one of (1) to (13) above, wherein the subject is a human. (15) The pharmaceutical composition according to any one of (1) to (14), wherein the urolithin is selected from the group consisting of urolithin A, urolithin B, and a combination thereof. (16) The pharmaceutical composition according to (15) above, wherein the urolithin is urolithin A. (17) The pharmaceutical composition according to (15) above, wherein the urolithin is urolithin B. (18) A food or nutritional supplement containing an effective amount of a urolithin for improving or maintaining cognitive function (except when it contains a composition of physiologically active metabolites of docosahexaenoic acid and eicosapentaenoic acid). (19) The food or nutritional supplement according to (18) above, which improves cognitive function. (20) The food or nutritional supplement according to (18) above, which maintains cognitive function. (21) The food or nutritional supplement according to any one of (18) to (20), wherein the food is a functional food. (22) The food or nutritional supplement according to any one of (18) to (21) above, wherein the food or nutritional supplement is in the form of a food additive. (23) The food or nutritional supplement according to any one of (18) to (21) above, wherein the food or nutritional supplement is in the form of a dietary supplement. (24) The food or nutritional supplement according to any one of (18) to (23), wherein the urolithin is selected from the group consisting of urolithin A, urolithin B, and combinations thereof. (25) The food or nutritional supplement according to (24) above, wherein the urolithin is urolithin A. (26) The food or nutritional supplement according to (24), wherein the urolithin is urolithin B.

[0442] Equivalent The invention has been described broadly and generally herein. Those skilled in the art will readily envision various other procedures and / or structures for performing the functions and / or obtaining the results and / or one or more advantages described herein, and each such variation and / or modification is deemed to be within the scope of the invention. More generally, those skilled in the art will readily recognize that all parameters, dimensions, materials, and configurations described herein are representative, and that the actual parameters, dimensions, materials, and / or configurations will depend on the particular application or applications for which the teachings of the invention are used. Those skilled in the art will recognize or be able to ascertain, using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Thus, the foregoing embodiments are given by way of example only, and it will be understood that, within the scope of the appended claims and their equivalents, the invention may be practiced otherwise than as specifically described and claimed. The present invention is directed to each individual feature, system, article, material, kit, and / or method described herein. Furthermore, any combination of two or more such features, systems, articles, materials, kits and / or methods is included within the scope of the invention, provided such features, systems, articles, materials, kits and / or methods are not mutually inconsistent. Additionally, each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention, subject to any proviso or negative limitation that excludes any subject matter from the genus, regardless of whether the omitted material is specifically recited herein.

[0443] Incorporation by Reference The contents of the articles, patents and patent applications and all other documents and electronically available information mentioned or cited herein are incorporated herein by reference in their entirety to the same extent as if each individual publication was specifically and individually indicated to be individually incorporated by reference. Applicants reserve the right to incorporate into this application any and all materials and information from any and all such articles, patents, patent applications and other physical and electronic documents.

[0444] Cited References Bai,N.,K.He,et al.(2008).”Active compounds from Lagerstroemia speciosa,insulin-like glucose uptake-stimulatory / inhibitory and adipocyte differentiation-inhibitory activities in 3T3-L1 cells.”J Agric Food Chem 56(24):11668-74. Bishop,N.A.,T.Lu,et al.(2010).”Neural mechanisms of ageing and cognitive decline.”Nature 464(7288):529-35. Bloss,E.B.,W.G.Janssen,et al.(2010).”Interactive effects of stress and aging on structural plasticity in the prefrontal cortex.”J Neurosci 30(19):6726-31. Bowman,R.E.,K.D.Beck,et al.(2003).”Chronic stress effects on memory:sex differences in performance and monoaminergic activity.”Horm Behav 43(1):48-59. Cerda,B.,J.C.Espin,et al.(2004).”The potent in vitro antioxidant ellagitannins from pomegranate juice are metabolised into bioavailable but poor antioxidant hydroxy- 6H-dibenzopyran-6-one derivatives by the colonic microflora of healthy humans.”Eur J Nutr 43(4):205-20. Cerda,B.,P.Periago,et al.(2005).”Identification of urolithin a as a metabolite produced by human colon microflora from ellagic acid and related compounds.”J Agric Food Chem 53(14):5571-6. De Souza Schmidt Goncalves,A.E.,F.M.Lajolo,et al.”Chemical composition and antioxidant / antidiabetic potential of Brazilian native fruits and commercial frozen pulps.”J Agric Food Chem 58(8):4666-74. Del Pozo-Insfran,D.,C.H.Brenes,et al.(2004).”Phytochemical composition and pigment stability of Acai(Euterpe oleracea Mart.).”J Agric Food Chem 52(6):1539-45. Dumitriu,D.,J.Hao,et al.(2010).”Selective changes in thin spine density and morphology in monkey prefrontal cortex correlate with aging-related cognitive impairment.”J Neurosci 30(22):7507-15. Gasperotti,M.,D.Masuero,et al.”Profiling and accurate quantification of Rubus ellagitannins and ellagic acid conjugates using direct UPLC-Q-TOF HDMS and HPLC-DAD analysis.”J Agric Food Chem 58(8):4602-16. Gil,M.I.,F.A.Tomas-Barberan,et al.(2000).”Antioxidant activity of pomegranate juice and its relationship with phenolic composition and processing.”J Agric Food Chem 48(10):4581-9. Greene,L.A.and A.S.Tischler(1976).”Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor.”Proc Natl Acad Sci USA 73(7):2424-8. Gunning,P.W.,G.E.Landreth,et al.(1981).”Differential and synergistic actions of nerve growth factor and cyclic AMP in PC12 cells.”J Cell Biol 89(2):240-5. Harper,M.E.,K.Green,et al.(2008).”The efficiency of cellular energy transduction and its implications for obesity.”Annu Rev Nutr 28:13-33. Hebert,L.E.,P.A.Scherr,et al.(2003).”Alzheimer disease in the US population: prevalence estimates using the 2000 census.”Arch Neurol 60(8):1119-22. Joels,M.,Z.Pu,et al.(2006).”Learning under stress:how does it work?”Trends Cogn Sci 10(4):152-8. Joseph,J.A.,B.Shukitt-Hale,et al.(2005).”Reversing the deleterious effects of aging on neuronal communication and behavior:beneficial properties of fruit polyphenolic compounds.”Am J Clin Nutr 81(1 Suppl):313S-316S. Kujoth,G.C.,A.Hiona,et al.(2005).”Mitochondrial DNA mutations,oxidative stress,and apoptosis in mammalian aging.”Science 309(5733):481-4. Lee,J.H.,J.V.Johnson,et al.(2005).”Identification of ellagic acid conjugates and other polyphenolics in muscadine grapes by HPLC-ESI-MS.”J Agric Food Chem 53(15):6003-10. Maier,S.F.and L.R.Watkins(2005).”Stressor controllability and learned helplessness:the roles of the dorsal raphe nucleus,serotonin,and corticotropin-releasing factor.”Neurosci Biobehav Rev 29(4-5):829-41. Puech,J.L.,C.Mertz,et al.(1999).”Evolution of castalagin and vescalagin in ethanol solutions.Identification of new derivatives.”J Agric Food Chem 47(5):2060-6. Pinnock,S.B.and J.Herbert(2001).”Corticosterone differentially modulates expression of corticotropin releasing factor and arginine vasopressin mRNA in the hypothalamic paraventricular nucleus following either acute or repeated restraint stress.”Eur J Neurosci 13(3):576-84. Rea,S.L.,N.Ventura,et al.(2007).”Relationship between mitochondrial electron transport chain dysfunction,development,and life extension in Caenorhabditis elegans.”PLoS Biol 5(10):e259. Roozendaal,B.(2003).”Systems mediating acute glucocorticoid effects on memory consolidation and retrieval.”Prog Neuropsychopharmacol Biol Psychiatry 27(8): 1213-23. Rozovsky,I.,M.Wei,et al.(2005).”Reversible age impairments in neurite outgrowth by manipulations of astrocytic GFAP.”Neurobiol Aging 26(5):705-15. Sandi,C.(2004).”Stress,cognitive impairment and cell adhesion molecules.”Nat Rev Neurosci 5(12):917-30. Sandi,C.and M.Loscertales(1999).”Opposite effects on NCAM expression in the rat frontal cortex induced by acute vs.chronic corticosterone treatments.”Brain Res 828(1-2):127-34. Sandi,C.and M.T.Pinelo-Nava(2007).”Stress and memory:behavioral effects and neurobiological mechanisms.”Neural Plast 2007:78970. Satomi,H.,K.Umemura,et al.(1993).”Carbonic anhydrase inhibitors from the pericarps of Punica granatum L.”Biol Pharm Bull 16(8):787-90. Schriner,S.E.,N.J.Linford,et al.(2005).”Extension of murine life span by overexpression of catalase targeted to mitochondria.”Science 308(5730):1909-11. Shors,T.J.(2004).”Learning during stressful times.”Learn Mem 11(2):137-44. Tanaka,K.,G.Nonaka,et al.(1986).”Tannins and Related Compounds.XLI.1)Isolation and Charactherization of Novel Ellagitannins,Punicacorteins A,B,C,and Punigluconin from the brak of Punica granatum L.”Chem.Pharm.Bull 34(2):656-663. Tanaka,K.,G.Nonaka,et al.(1986).”Tannins and Related Compounds.XLI.1)Isolation and Charactherization of Novel Ellagitannins,Punicacorteins A,B,C,and Punigluconin from the brak of Punica granatum L.”Chem.Pharm.Bull 34(2):656-663. Tanaka,K.,G.Nonaka,et al.(1986).”Tannins and Related Compounds.XLI.1).Revision of the Structures of Punicalin and Punicalagin,and Isolation and Charactherization of 2-O-Galloylpunicalin from the Bark of Punica granatum L.”Chem.Pharm.Bull 34(2):650-655. Trifunovic,A.,A.Wredenberg,et al.(2004).”Premature ageing in mice expressing defective mitochondrial DNA polymerase.”Nature 429(6990):417-23. Vrhovsek,U.,A.Palchetti,et al.(2006).”Concentration and mean degree of polymerization of Rubus ellagitannins evaluated by optimized acid methanolysis.”J Agric Food Chem 54(12):4469-75. Wang,C.H.,C.C.Wang,et al.(2010).”Mitochondrial dysfunction in insulin insensitivity:implication of mitochondrial role in type 2 diabetes.”Ann N Y Acad Sci 1201:157-65. Xiao,J.,A.Pradhan,et al.(2006).”Functional role of JNK in neuritogenesis of PC12-N1 cells.”Neurosci Lett 392(3):231-4. Yang,G.,F.Pan,et al.(2009).”Stably maintained dendritic spines are associated with lifelong memories.”Nature 462(7275):920-4.

Claims

1. 1. A pharmaceutical composition for treating or preventing a mitochondrial-associated disease or condition involving altered mitochondrial function or reduced mitochondrial density, comprising a therapeutically effective amount of a urolithin, The pharmaceutical composition, wherein the mitochondrial-related disease or condition is a decrease in mitochondrial function due to aging.

2. The pharmaceutical composition of claim 1 , wherein mitochondrial activity is enhanced.

3. The pharmaceutical composition of claim 1 , wherein mitochondrial biogenesis is enhanced.

4. The pharmaceutical composition according to claim 1, which increases ATP levels in tissues.

5. The pharmaceutical composition of claim 4 , wherein the tissue is muscle tissue.

6. The pharmaceutical composition of any of claims 1 to 5, wherein the urolithin is selected from the group consisting of urolithin A, urolithin B, and a combination of urolithin A and urolithin B.

7. The pharmaceutical composition of any one of claims 1 to 5, wherein the urolithin is urolithin A.

8. The pharmaceutical composition according to any one of claims 1 to 7, wherein said pharmaceutical composition is for oral administration.

9. The pharmaceutical composition according to any one of claims 1 to 7, wherein said pharmaceutical composition is for topical administration.

10. The pharmaceutical composition according to any one of claims 1 to 7, wherein said pharmaceutical composition is for parenteral administration.

11. A medical food or drink, functional food or drink, food additive, or dietary supplement comprising a therapeutically effective amount of a urolithin for treating or preventing a mitochondrial-associated disease or condition accompanied by alteration in mitochondrial function or reduced mitochondrial density, wherein the mitochondrial-associated disease or condition is reduced mitochondrial function due to aging.

12. 12. A medical food or drink, functional food or drink, food additive or dietary supplement as claimed in claim 11, in which mitochondrial function is maintained.

13. 12. A medical food or drink, functional food or drink, food additive or dietary supplement as claimed in claim 11, in which mitochondrial function is improved.

14. 12. A medical food or drink, functional food or drink, food additive or dietary supplement as claimed in claim 11, in which mitochondrial activity is maintained.

15. 12. The medical food or drink, functional food or drink, food additive or dietary supplement of claim 11, in which mitochondrial activity is enhanced.

16. 12. The medical food or drink, functional food or drink, food additive or dietary supplement of claim 11, wherein the energy of a subject is enhanced.

17. 12. The medical food or drink, functional food or drink, food additive or dietary supplement of claim 11, wherein mitochondrial biogenesis is enhanced.

18. 18. The medical food or beverage, functional food or beverage, food additive, or dietary supplement of any of claims 11 to 17, wherein the urolithin is selected from the group consisting of urolithin A, urolithin B, and a combination of urolithin A and urolithin B.

19. 18. The medical food or beverage, functional food or beverage, food additive, or nutritional supplement of any one of claims 11 to 17, wherein the urolithin is urolithin A.

Images