Single nucleotide polymorphism editing using a programmable base editor system

JP7679311B2Active Publication Date: 2025-05-19BEAM THERAPEUTICS INC
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2021568855
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-05-21
Filing Date
2020-05-20
Publication Date
2025-05-19
Estimated Expiration
2040-05-20

AI Technical Summary

Benefits of technology

【0028】 本開示の特徴を、特に付随する請求項に示す。本発明の特徴および利点のよりよい理解は、開示の原理を利用する例示的な実施形態を示す以下の詳細な説明、および以下に示す付随する図を参照することによって得られるであろう:

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007679311000060
    Figure 0007679311000060
  • Figure 0007679311000061
    Figure 0007679311000061
  • Figure 0007679311000062
    Figure 0007679311000062
Patent Text Reader

Abstract

Disclosed are compositions and methods for modifying mutations associated with Rett syndrome (RETT). Compositions and methods are provided that use base editors (e.g., ABE8) comprising a polynucleotide-programmable nucleotide-binding domain and a nucleobase editing domain in combination with a guide polynucleotide. Base editor systems for editing nucleobases in target nucleotide sequences are also provided.
Need to check novelty before this filing date? Find Prior Art

Claims

1. 1. An in vitro or ex vivo method for editing the methyl-CpG binding protein 2 (MECP2) gene, comprising administering to a cell, tissue, or organ: (i) an adenosine base editor or a nucleic acid sequence encoding same, and (ii) a guide RNA or a nucleic acid sequence encoding the guide RNA wherein the adenosine base editor comprises a programmable DNA binding domain of Cas9 and an adenosine deaminase domain, the adenosine deaminase domain having the following amino acid sequence: MSEVEFSHEYWMRHALTLAKRARDEREVPVGAVLVLNNRVIGEGWNRAIGLHDPTAHEIMALRQGGLVMQNYRLIDATLYVTFEPCVMCAGAMIHSRIGRVVFGVRNAKTGAAGSLMDVLHYPGMNHRVEITEGILADECAALLCYFFRMPRQVFNAQKKAQSSTD or a fragment thereof lacking only the N-terminal methionine, having a combination of modifications, wherein the combination of modifications is Y147R+Q154S; V82S + Q154S; V82S+Y147R; V82S + Q154R; V82S+Y123H; I76Y+V82S; V82S+Y123H+Y147T; V82S+Y123H+Y147R; V82S+Y123H+Q154R; V82S + Y123H + Y147R + Q154R; and I76Y + V82S + Y123H + Y147R + Q154R; is selected from the group consisting of The guide RNA induces the adenosine base editor to result in an A to G nucleobase modification in an MECP2 gene comprising a single nucleotide polymorphism (SNP) associated with Rett Syndrome (RETT), wherein the A to G nucleobase modification is in the SNP associated with RETT, and the SNP results in a R133C or R306C amino acid mutation in an MECP2 polypeptide encoded by the MECP2 gene, and the spacer of the guide RNA has the following sequence: 5′-gAGAGCAAAAGGCUUUUCCCU-3′; 5′-gUAGAGCAAAAGGCUUUUCCC-3′; 5′-gUAGAGCAAAAGGCUUUUCCCU-3′; 5′-gUUUAGAGCAAAAGGCUUUUCCCU-3′; 5′-gUCUUGCACUUCUUGAUGGGG-3′; 5′-gCUUGCACUUCUUGAUGGGGAG-3′; 5′-gGUCUUGCACUUCUUGAUGGGGAG-3′; 5′-AGAGCAAAAGGCUUUUCCCU-3′; 5′-UAGAGCAAAAGGCUUUUCCC-3′; 5′-UAGAGCAAAAGGCUUUUCCCU-3′; 5′-UUUAGAGCAAAAGGCUUUUCCCU-3′; 5′-UCUUGCACUUCUUGAUGGGG-3′; 5′-CUUGCACUUCUUGAUGGGGAG-3′; and 5′-GUCUUGCACUUCUUGAUGGGGAG-3′ The sequence is selected from the group consisting of The method.

2. The method of claim 1, wherein the A to G nucleobase modification changes the SNP associated with RETT to a wild-type nucleobase.

3. the A to G nucleobase alteration at a SNP associated with RETT changes a cysteine ​​to an arginine in the MECP2 polypeptide; and / or said A to G nucleobase alteration at the SNP associated with RETT results in expression of a MECP2 polypeptide containing an arginine at amino acid position 133 and / or 306; The method according to claim 1 or 2.

4. The method of any one of claims 1 to 3, wherein the adenosine base editor is complexed with the guide RNA.

5. (i) an adenosine base editor or a nucleic acid sequence encoding same, and (ii) a guide RNA or a nucleic acid sequence encoding the guide RNA wherein the adenosine base editor comprises a programmable DNA binding domain of Cas9 and an adenosine deaminase domain, wherein the adenosine deaminase domain has the following amino acid sequence: MSEVEFSHEYWMRHALTLAKRARDEREVPVGAVLVLNNRVIGEGWNRAIGLHDPTAHEIMALRQGGLVMQNYRLIDATLYVTFEPCVMCAGAMIHSRIGRVVFGVRNAKTGAAGSLMDVLHYPGMNHRVEITEGILADECAALLCYFFRMPRQVFNAQKKAQSSTD or a fragment thereof lacking only the N-terminal methionine, having a combination of modifications, wherein the combination of modifications is Y147R+Q154S; V82S + Q154S; V82S+Y147R; V82S + Q154R; V82S+Y123H; I76Y+V82S; V82S+Y123H+Y147T; V82S+Y123H+Y147R; V82S+Y123H+Q154R; V82S + Y123H + Y147R + Q154R; and I76Y + V82S + Y123H + Y147R + Q154R; is selected from the group consisting of wherein the guide RNA induces the adenosine base editor to result in an A to G nucleobase modification in a methyl-CpG binding protein 2 (MECP2) gene comprising a single nucleotide polymorphism (SNP) associated with Rett syndrome (RETT); wherein the A to G nucleobase modification is in the SNP associated with RETT, and the SNP results in a R133C or R306C amino acid mutation in an MECP2 polypeptide encoded by the MECP2 gene; The spacer of the guide RNA has the following sequence: 5′-gAGAGCAAAAGGCUUUUCCCU-3′; 5′-gUAGAGCAAAAGGCUUUUCCC-3′; 5′-gUAGAGCAAAAGGCUUUUCCCU-3′; 5′-gUUUAGAGCAAAAGGCUUUUCCCU-3′; 5′-gUCUUGCACUUCUUGAUGGGG-3′; 5′-gCUUGCACUUCUUGAUGGGGAG-3′; 5′-gGUCUUGCACUUCUUGAUGGGGAG-3′; 5′-AGAGCAAAAGGCUUUUCCCU-3′; 5′-UAGAGCAAAAGGCUUUUCCC-3′; 5′-UAGAGCAAAAGGCUUUUCCCU-3′; 5′-UUUAGAGCAAAAGGCUUUUCCCU-3′; 5′-UCUUGCACUUCUUGAUGGGG-3′; 5′-CUUGCACUUCUUGAUGGGGAG-3′; and 5′-GUCUUGCACUUCUUGAUGGGGAG-3′ The sequence is selected from the group consisting of The base editor system.

6. said A to G nucleobase alteration changes said SNP associated with RETT to a wild type nucleobase; and / or the A to G nucleobase modification in the SNP associated with RETT results in expression of a MECP2 polypeptide containing an arginine at amino acid position 133 and / or 306; The base editor system of claim 5.

7. 1. An in vitro or ex vivo method of editing a MECP2 polynucleotide that contains a single nucleotide polymorphism (SNP) associated with Rett Syndrome (RETT), comprising: a) contacting the MECP2 polynucleotide with an adenosine base editor complexed with one or more guide RNAs, wherein the adenosine base editor comprises a polynucleotide-programmable DNA binding domain and an adenosine deaminase domain of Cas9, wherein the adenosine deaminase domain has the amino acid sequence: MSEVEFSHEYWMRHALTLAKRARDEREVPVGAVLVLNNRVIGEGWNRAIGLHDPTAHEIMALRQGGLVMQNYRLIDATLYVTFEPCVMCAGAMIHSRIGRVVFGVRNAKTGAAGSLMDVLHYPGMNHRVEITEGILADECAALLCYFFRMPRQVFNAQKKAQSSTD or a fragment thereof lacking only the N-terminal methionine, having a combination of modifications, wherein the combination of modifications is Y147R+Q154S; V82S + Q154S; V82S+Y147R; V82S + Q154R; V82S+Y123H; I76Y+V82S; V82S+Y123H+Y147T; V82S+Y123H+Y147R; V82S+Y123H+Q154R; V82S + Y123H + Y147R + Q154R; and I76Y + V82S + Y123H + Y147R + Q154R; is selected from the group consisting of one or more of the guide RNAs targets the base editor to result in an A to G nucleobase alteration of the SNP in an MECP2 polynucleotide associated with RETT, the SNP resulting in a R133C or a R306C amino acid mutation in an MECP2 polypeptide encoded by the MECP2 polynucleotide; The spacer of the guide RNA has the following sequence: 5′-gAGAGCAAAAGGCUUUUCCCU-3′; 5′-gUAGAGCAAAAGGCUUUUCCC-3′; 5′-gUAGAGCAAAAGGCUUUUCCCU-3′; 5′-gUUUAGAGCAAAAGGCUUUUCCCU-3′; 5′-gUCUUGCACUUCUUGAUGGGG-3′; 5′-gCUUGCACUUCUUGAUGGGGAG-3′; 5′-gGUCUUGCACUUCUUGAUGGGGAG-3′; 5′-AGAGCAAAAGGCUUUUCCCU-3′; 5′-UAGAGCAAAAGGCUUUUCCC-3′; 5′-UAGAGCAAAAGGCUUUUCCCU-3′; 5′-UUUAGAGCAAAAGGCUUUUCCCU-3′; 5′-UCUUGCACUUCUUGAUGGGG-3′; 5′-CUUGCACUUCUUGAUGGGGAG-3′; and 5′-GUCUUGCACUUCUUGAUGGGGAG-3′ The sequence is selected from the group consisting of The method.

8. The method of claim 7, wherein the contacting is in a eukaryotic cell.

9. The method of claim 8 , wherein the eukaryotic cell is a mammalian cell.

10. The method of claim 9, wherein the mammalian cell is a human cell.

11. the A to G nucleobase alteration at a SNP associated with RETT changes a cysteine ​​to an arginine in the MECP2 polypeptide; and / or said A to G nucleobase alteration at a SNP associated with RETT results in expression of a MECP2 polypeptide containing an arginine at amino acid position 133 and / or 306; The method according to any one of claims 7 to 10.

12. the polynucleotide programmable DNA binding domain is selected from Streptococcus pyogenes Cas9 (SpCas9), Staphylococcus aureus Cas9 (SaCas9), Streptococcus thermophilus 1 Cas9 (St1Cas9), or Streptococcus canis Cas9 (ScCas9); and / or the polynucleotide programmable DNA binding domain comprises a modified SpCas9 that binds to a modified protospacer adjacent motif (PAM); or the polynucleotide programmable DNA binding domain comprises a modified SpCas9 that binds to a PAM comprising a nucleic acid sequence selected from 5'-NGT-3' and 5'-NGG-3'; or the polynucleotide programmable DNA binding domain comprises a modified SpCas9 that binds to a PAM that comprises the nucleotide sequence NGT; or the polynucleotide programmable DNA binding domain comprises a modified SpCas9 that binds to a PAM comprising the nucleotide sequence NGT and comprises an amino acid substitution at, or a corresponding amino acid substitution at, one or more of residues 1335, 1337, 1135, 1136, 1218, and / or 1219 of the modified SpCas9; The method according to any one of claims 7 to 11.

13. The polynucleotide programmable DNA binding domain is selected from the group consisting of the amino acid substitutions L1111R, D1135V, G1218R, E1219F, A1322R, R1335V, T1337R or a modified SpCas9 comprising one or more of the following amino acid substitutions: L1111, D1135L, S1136R, G1218S, E1219V, D1332A, D1332S, D1332T, D1332V, D1332L, D1332K, D1332R, R1335Q, T1337, T1337L, T1337Q, T1337I, T1337V, T1337F, T1337S, T1337N, T1337K, T1337H, T1337Q, and T1337M, or the corresponding amino acid substitutions; or the polynucleotide-programmable DNA-binding domain comprises a modified SpCas9 comprising the amino acid substitutions D1135L, S1136R, G1218S, E1219V, A1322R, R1335Q, and T1337, as well as one or more of L1111R, G1218R, E1219F, D1332A, D1332S, D1332T, D1332V, D1332L, D1332K, D1332R, T1337L, T1337I, T1337V, T1337F, T1337S, T1337N, T1337K, T1337R, T1337H, T1337Q, and T1337M, or the amino acid substitutions corresponding thereto; The method of claim 12.

14. the polynucleotide programmable DNA binding domain is nuclease inactive or a nickase; and / or The polynucleotide-programmable DNA binding domain is a nickase containing the amino acid substitution D10A or a corresponding amino acid substitution. The method according to any one of claims 1 to 4 and 7 to 13.

15. the polynucleotide programmable DNA binding domain is nuclease inactive or a nickase; and / or The polynucleotide-programmable DNA binding domain is a nickase containing the amino acid substitution D10A or a corresponding amino acid substitution. The base editor system of claim 5 or 6.

16. The adenosine deaminase domain MSEVEFSHEYWMRHALTLAKRARDEREVPVGAVLVLNNRVIGEGWNRAIGLHDPTAHEIMALRQGGLVMQNYRLIDATLYVTFEPCVMCAGAMIHSRIGRVVFGVRNAKTGAAGSLMDVLHYPGMNHRVEITEGILADECAALLCYFFRMPRQVFNAQKKAQSSTD or comprising an alteration at amino acid position 82 and / or 166 of the adenosine deaminase domain contains alterations at amino acid positions 82 and 166, or and / or the adenosine deaminase domain comprises a modification selected from the V82S modification, the T166R modification, or both the V82S and the T166R modifications; and / or and / or the adenosine deaminase domain further comprises one or more of the following modifications: I76Y, Y147T, Y147R, Q154S, Y123H, and Q154R; and / or The adenosine deaminase domain: Y147T + Q154R; Y147T + Q154S; Y147R + Q154S; V82S + Q154S; V82S + Y147R; V82S + Q154R; V82S + Y123H; I76Y + V82S; V82S + Y123H + Y147T; V82S + Y123H + Y147R; V82S + Y123H + Q154R; Y147R + Q154R +Y123H; Y147R + Q154R + I76Y; Y147R + Q154R + T166R; Y123H + Y147R + Q154R + I76Y; V82S + Y123H + Y147R + Q154R; and I76Y + V82S + Y123H + Y147R + Q154R The modification includes a modification selected from the group consisting of: The method according to any one of claims 7 to 14.

17. the adenosine base editor comprises only one adenosine deaminase domain, and the adenosine deaminase domain comprises the V82S and T166R modifications; or the adenosine deaminase domain comprises a V82S and a T166R modification, and further comprises a modification selected from the group consisting of Y147T, Y147R, Q154S, Y123H, V82S, T166R, and Q154R; The method according to any one of claims 7 to 14 and 16.

18. wherein the adenosine base editor comprises the adenosine deaminase domain, the adenosine deaminase domain is Y147T + Q154R; Y147T + Q154S; Y147R + Q154S; V82S + Q154S; V82S + Y147R; V82S + Q154R; V82S + Y123H; I76Y + V82S; V82S + Y123H + Y147T; V82S + Y123H + Y147R; V82S + Y123H + Q154R; Y147R + Q154R +Y123H; Y147R + Q154R + I76Y; Y147R + Q154R + T166R; Y123H + Y147R + Q154R + 8. The method of claim 7, wherein the adenosine base editor comprises a combination of modifications selected from the group consisting of: I76Y; V82S + Y123H + Y147R + Q154R; and I76Y + V82S + Y123H + Y147R + Q154R, and wherein the adenosine base editor further comprises a wild-type TadA domain.

19. 8. The method of claim 7, wherein the adenosine deaminase is selected from the group consisting of TadA*8.14, TadA*8.15, TadA*8.16, TadA*8.17, TadA*8.18, TadA*8.19, TadA*8.20, TadA*8.21, TadA*8.22, TadA*8.23, and TadA*8.

24.

20. 20. The adenosine base editor comprising: ABE8.14-m, ABE8.15-m, ABE8.16-m, ABE8.17-m, ABE8.18-m, ABE8.19-m, ABE8.20-m, ABE8.21-m, ABE8.22-m, ABE8.23-m, ABE8.24-m, ABE8.14-d, ABE8.15-d, ABE8.16-d, ABE8.17-d, ABE8.18-d, ABE8.19-d, ABE8.20-d, ABE8.21-d, ABE8.22-d, ABE8.23-d, and ABE8.24 The method of claim 7, wherein the compound is selected from the group consisting of:

21. 5′-AGAGCAAAAGGCUUUUCCCU-3′, 5′-UAGAGCAAAAGGCUUUUCCC-3′, 5′-UAGAGCAAAAGGCUUUUCCCU-3′, 5′-UUUAGAGCAAAAGGCUUUUCCCU-3′, 5′-UCUUGCACUUCUUGAUGGGG-3′, 5′-CUUGCACUUCUUGAUGGGGAG-3′, or 5′-GUCUUGCACUUCUUGAUGGGGAG-3′ A composition comprising a guide RNA comprising a nucleic acid sequence selected from the group consisting of:

1. A composition for use in an in vitro or ex vivo method of editing the methyl-CpG binding protein 2 (MECP2) gene, the method comprising administering to a cell, tissue, or organ: (i) an adenosine base editor or a nucleic acid sequence encoding same, and (ii) the guide RNA wherein the adenosine base editor comprises a programmable DNA binding domain of Cas9 and an adenosine deaminase domain, wherein the adenosine deaminase domain has the following amino acid sequence: MSEVEFSHEYWMRHALTLAKRARDEREVPVGAVLVLNNRVIGEGWNRAIGLHDPTAHEIMALRQGGLVMQNYRLIDATLYVTFEPCVMCAGAMIHSRIGRVVFGVRNAKTGAAGSLMDVLHYPGMNHRVEITEGILADECAALLCYFFRMPRQVFNAQKKAQSSTD or a fragment thereof lacking only the N-terminal methionine, having a combination of modifications, wherein the combination of modifications is Y147R+Q154S; V82S + Q154S; V82S+Y147R; V82S + Q154R; V82S+Y123H; I76Y+V82S; V82S+Y123H+Y147T; V82S+Y123H+Y147R; V82S+Y123H+Q154R; V82S + Y123H + Y147R + Q154R; and I76Y + V82S + Y123H + Y147R + Q154R; is selected from the group consisting of the guide RNA induces the adenosine base editor to result in an A to G nucleobase modification in an MECP2 gene that contains a single nucleotide polymorphism (SNP) associated with Rett Syndrome (RETT), wherein the A to G nucleobase modification is in the SNP associated with RETT, and the SNP results in a R133C or R306C amino acid mutation in an MECP2 polypeptide encoded by the MECP2 gene. The composition.

22. The guide RNA may further comprise the following scaffold sequence: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT 22. The composition of claim 21 , comprising:

23. 1. A composition comprising an adenosine deaminase base editor and a guide RNA, wherein the adenosine deaminase base editor comprises a polynucleotide-programmable DNA binding domain and an adenosine deaminase domain of Cas9, wherein the adenosine deaminase domain has the following amino acid sequence: MSEVEFSHEYWMRHALTLAKRARDEREVPVGAVLVLNNRVIGEGWNRAIGLHDPTAHEIMALRQGGLVMQNYRLIDATLYVTFEPCVMCAGAMIHSRIGRVVFGVRNAKTGAAGSLMDVLHYPGMNHRVEITEGILADECAALLCYFFRMPRQVFNAQKKAQSSTD or a fragment thereof lacking only the N-terminal methionine, having a combination of modifications, wherein the combination of modifications is Y147R+Q154S; V82S + Q154S; V82S+Y147R; V82S + Q154R; V82S+Y123H; I76Y+V82S; V82S+Y123H+Y147T; V82S+Y123H+Y147R; V82S+Y123H+Q154R; V82S + Y123H + Y147R + Q154R; and I76Y + V82S + Y123H + Y147R + Q154R; is selected from the group consisting of wherein the guide RNA targets the adenosine deaminase base editor to effect an A to G nucleobase modification in an MECP2 polynucleotide comprising a single nucleotide polymorphism (SNP) associated with RETT syndrome, wherein the A to G nucleobase modification is in the SNP associated with RETT, and the SNP results in a R133C or R306C amino acid mutation in an MECP2 polypeptide encoded by the MECP2 gene, and wherein the spacer of the guide RNA has the following sequence: 5′-gAGAGCAAAAGGCUUUUCCCU-3′; 5′-gUAGAGCAAAAGGCUUUUCCC-3′; 5′-gUAGAGCAAAAGGCUUUUCCCU-3′; 5′-gUUUAGAGCAAAAGGCUUUUCCCU-3′; 5′-gUCUUGCACUUCUUGAUGGGG-3′; 5′-gCUUGCACUUCUUGAUGGGGAG-3′; 5′-gGUCUUGCACUUCUUGAUGGGGAG-3′; 5′-AGAGCAAAAGGCUUUUCCCU-3′; 5′-UAGAGCAAAAGGCUUUUCCC-3′; 5′-UAGAGCAAAAGGCUUUUCCCU-3′; 5′-UUUAGAGCAAAAGGCUUUUCCCU-3′; 5′-UCUUGCACUUCUUGAUGGGG-3′; 5′-CUUGCACUUCUUGAUGGGGAG-3′; and 5′-GUCUUGCACUUCUUGAUGGGGAG-3′ The sequence is selected from the group consisting of The composition.

24. an A to G nucleobase modification at the SNP associated with RETT changes a cysteine ​​to an arginine in the MECP2 polypeptide; or an A to G nucleobase modification at said SNP associated with RETT results in expression of a MECP2 polypeptide containing an arginine at amino acid position 133 and / or 306; 24. The composition of claim 23.

25. the polynucleotide programmable DNA binding domain is selected from Streptococcus pyogenes Cas9 (SpCas9), Staphylococcus aureus Cas9 (SaCas9), Streptococcus thermophilus 1 Cas9 (St1Cas9), or Streptococcus canis Cas9 (ScCas9); and / or and / or wherein the polynucleotide programmable DNA binding domain comprises a modified SpCas9 that binds to a modified protospacer adjacent motif (PAM); the polynucleotide programmable DNA binding domain is nuclease inactive or a nickase; and / or The polynucleotide-programmable DNA binding domain is a nickase containing the amino acid substitution D10A or a corresponding amino acid substitution.

25. The composition of claim 23 or 24.

26. the adenosine deaminase domain is capable of deaminating adenosine in deoxyribonucleic acid (DNA); and / or The adenosine deaminase domain MSEVEFSHEYWMRHALTLAKRARDEREVPVGAVLVLNNRVIGEGWNRAIGLHDPTAHEIMALRQGGLVMQNYRLIDATLYVTFEPCVMCAGAMIHSRIGRVVFGVRNAKTGAAGSLMDVLHYPGMNHRVEITEGILADECAALLCYFFRMPRQVFNAQKKAQSSTD or comprising an alteration at amino acid position 82 and / or 166 of The adenosine deaminase domain comprises a modification selected from a V82S modification, a T166R modification, or both a V82S and a T166R modification; The composition according to any one of claims 23 to 25.

27. and / or the adenosine deaminase domain further comprises one or more of the following modifications: I76Y, Y147T, Y147R, Q154S, Y123H, and Q154R; and / or The adenosine deaminase domain: Y147T + Q154R; Y147T + Q154S; Y147R + Q154S; V82S + Q154S; V82S + Y147R; V82S + Q154R; V82S + Y123H; I76Y + V82S; V82S + Y123H + Y147T; V82S + Y123H + Y147R; V82S + Y123H + Q154R; Y147R + Q154R +Y123H; Y147R + Q154R + I76Y; Y147R + Q154R + T166R; Y123H + Y147R + Q154R + I76Y; V82S + Y123H + Y147R + Q154R; and I76Y + V82S + Y123H + Y147R + Q154R The modification includes a modification selected from the group consisting of:

27. The composition of claim 26.

28. the adenosine deaminase base editor comprises only one adenosine deaminase domain, and the adenosine deaminase domain comprises the V82S and T166R modifications; or the adenosine deaminase base editor further comprises a wild-type adenosine deaminase domain; or the adenosine deaminase base editor comprises a single adenosine deaminase domain, further comprising one or more modifications selected from the group consisting of Y147T, Y147R, Q154S, Y123H, V82S, T166R, and Q154R; or the adenosine deaminase base editor further comprises a wild-type TadA domain. The composition according to any one of claims 23 to 27.

29. wherein the adenosine deaminase base editor comprises the adenosine deaminase domain, the adenosine deaminase domain comprising: Y147T + Q154R; Y147T + Q154S; Y147R + Q154S; V82S + Q154S; V82S + Y147R; V82S + Q154R; V82S + Y123H; I76Y + V82S; V82S + Y123H + Y147T; V82S + Y123H + Y147R; V82S + Y123H + Q154R; Y147R + Q154R +Y123H; Y147R + Q154R + I76Y; Y147R + Q154R + T166R; Y123H + Y147R + Q154R + I76Y; V82S + Y123H + Y147R + Q154R; and I76Y + V82S + Y123H + Y147R + Q154R wherein the adenosine deaminase base editor further comprises a wild-type TadA domain.

24. The composition of claim 23.

30. the adenosine deaminase is selected from the group consisting of TadA*8.14, TadA*8.15, TadA*8.16, TadA*8.17, TadA*8.18, TadA*8.19, TadA*8.20, TadA*8.21, TadA*8.22, TadA*8.23, and TadA*8.24; 24. The composition of claim 23.

31. 4. The adenosine deaminase base editor: ABE8.14-m, ABE8.15-m, ABE8.16-m, ABE8.17-m, ABE8.18-m, ABE8.19-m, ABE8.20-m, ABE8.21-m, ABE8.22-m, ABE8.23-m, ABE8.24-m, ABE8.15-d, ABE8.16-d, ABE8.17-d, ABE8.18-d, ABE8.19-d, ABE8.20-d, ABE8.21-d, ABE8.22-d, ABE8.23-d, and ABE8.24 24. The composition of claim 23, selected from the group consisting of:

32. 25. The composition of claim 23 or 24, wherein the composition further comprises a lipid, or further comprises a lipid that is a cationic lipid.

33. 25. The composition of claim 23 or 24, further comprising a pharma- ceutically acceptable excipient or diluent.

Citation Information

Patent Citations

  • Method for obtaining artificial neuromuscular junction from pluripotent stem cells

    WO2019078263A1