Lipid Nanoparticle Compositions

Abstract

Provided herein are lipids that can be used in combination with other lipid components, such as neutral lipids, cholesterol, and polymer-conjugated lipids, to form lipid nanoparticles for the delivery of therapeutic agents (e.g., nucleic acid molecules) for therapeutic or prophylactic purposes, including vaccination.

Description

[Technical field]

[0001] This application claims priority to Chinese Patent Application No. 202010275664.4, filed on April 9, 2020, U.S. Provisional Patent Application No. 63 / 011,140, ​​filed on April 16, 2020, and Chinese Patent Application No. 202110299761.1, filed on March 19, 2021, all of which are incorporated by reference in their entireties.

[0002] The present disclosure relates generally to lipids that can be used in combination with other lipid components, such as neutral lipids, cholesterol, and polymer-conjugated lipids, to form lipid nanoparticles for delivery of therapeutic agents (e.g., nucleic acid molecules, including nucleic acid mimetics such as locked nucleic acids (LNA), peptide nucleic acids (PNAs), and morpholinos) both in vitro and in vivo for therapeutic or prophylactic purposes, including vaccination. [Background technology]

[0003] Therapeutic nucleic acids have the potential to revolutionize vaccination, gene therapy, protein replacement therapy, and other treatments for genetic diseases. Since the first clinical studies on therapeutic nucleic acids began in the 2000s, great progress has been made through the design of nucleic acid molecules and their delivery methods. However, nucleic acid therapeutics still face several challenges, including low cell permeability and high susceptibility to degradation of certain nucleic acid molecules, including RNA. Thus, there is a need to develop new nucleic acid molecules and related methods and compositions that facilitate their delivery in vitro or in vivo for therapeutic and / or prophylactic purposes. Summary of the Invention

[0004] In one embodiment, provided herein are lipid compounds, including pharma- ceutically acceptable salts, prodrugs, or stereoisomers thereof, that can be used alone or in combination with other lipid components and / or polymers, such as neutral lipids, charged lipids, steroids (including, for example, all sterols) and / or their analogs, and / or polymer-conjugated lipids, to form lipid nanoparticles for delivery of therapeutic agents (e.g., nucleic acid molecules, including nucleic acid mimetics such as locked nucleic acids (LNA), peptide nucleic acids (PNAs), and morpholinos). In some examples, the lipid nanoparticles are used to deliver nucleic acids, such as antisense RNA and / or messenger RNA. Methods are also provided for the use of such lipid nanoparticles for the treatment of various diseases or conditions, such as those caused by infectious entities and / or protein deficiencies.

[0005] In one embodiment, provided herein is a compound of formula (I): [ka] or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof, wherein G 1 , G 2 , G 3 , L 1 , L 2 , and R 3 is as defined herein or elsewhere.

[0006] In one embodiment, provided herein is a compound of formula (II): [ka] or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof, wherein G 1 , G 2 , G 4 , L 1 , L 2 , and R 3 is as defined herein or elsewhere.

[0007] In one embodiment, provided herein is a nanoparticle composition comprising a compound provided herein and a therapeutic or prophylactic agent. In one embodiment, the therapeutic or prophylactic agent comprises at least one mRNA encoding an antigen or a fragment or epitope thereof.

[0008] Further features of the present disclosure will become apparent to those skilled in the art upon consideration of the following detailed description of specific embodiments. [Brief description of the drawings]

[0009] [Figure 1] 1 shows an example of the formation of lipid nanoparticles involving the use of cationic lipids. [Diagram 2] 1 shows the effect of various lipid compounds on hEPO expression levels in animal studies. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0010] 5.1 General techniques The techniques and procedures described or referenced herein generally include those understood and / or commonly used by those of skill in the art using conventional methodologies such as those widely used methodologies described in, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual (3d ed. 2001), Current Protocols in Molecular Biology (Ausubel et al. eds., 2003).

[0011] 5.2 Terminology Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. For the purpose of interpreting this specification, the following explanation of terms shall apply, and where appropriate, terms used in the singular form shall also include the plural form, and vice versa. All patents, applications, published applications and other publications are incorporated herein by reference. In the event that the explanation of any term described herein contradicts any document incorporated herein by reference, the explanation of the term described below shall prevail.

[0012] As used herein, unless otherwise specified, the term "lipid" refers to a group of organic compounds, including but not limited to esters of fatty acids, which are generally characterized by being poorly soluble in water, but soluble in many non-polar organic solvents. Lipids are generally poorly soluble in water, but there are certain categories of lipids that have limited water solubility and can be dissolved in water under certain conditions (e.g., lipids modified by polar groups, e.g., DMG-PEG2000). Known types of lipids include fatty acids, waxes, sterols, fat-soluble vitamins, monoglycerides, diglycerides, triglycerides, and biomolecules such as phospholipids. Lipids can be divided into at least three classes: (1) "simple lipids," including fats and oils, as well as waxes; (2) "complex lipids," including phospholipids and glycolipids (e.g., DMPE-PEG2000); and (3) "derived lipids," such as steroids. Additionally, as used herein, lipids also encompass lipidoid compounds. The term "lipidoid compound", also simply "lipidoid", refers to a lipid-like compound (eg, an amphipathic compound that has lipid-like physical properties).

[0013] The term "lipid nanoparticle" or "LNP" refers to a particle having at least one dimension on the order of nanometers (nm) (e.g., 1-1,000 nm) that contains one or more lipid molecules. The LNPs provided herein may further contain at least one non-lipid payload molecule (e.g., one or more nucleic acid molecules). In some embodiments, the LNPs include a non-lipid payload molecule that is either partially or completely encapsulated inside the lipid shell. In particular, in some embodiments, the payload is a negatively charged molecule (e.g., an mRNA encoding a viral protein) and the lipid component of the LNP includes at least one cationic lipid. Without being bound by theory, it is believed that the cationic lipid can interact with the negatively charged payload molecule and facilitate the incorporation and / or encapsulation of the payload into the LNP during LNP formation. Other lipids that may form part of the LNPs provided herein include, but are not limited to, neutral and charged lipids such as steroids, polymer-conjugated lipids, and various zwitterionic lipids. In certain embodiments, LNPs according to the present disclosure comprise one or more lipids of formulas (I)-(IV) (and subformulas thereof) described herein.

[0014] The term "cationic lipid" refers to a lipid that is either positively charged at any pH value or hydrogen ion activity of its environment, or can be positively charged in response to the pH value or hydrogen ion activity of its environment (e.g., the environment of its intended use). Thus, the term "cationic" encompasses both "permanently cationic" and "cationizable". In certain embodiments, the positive charge in a cationic lipid arises from the presence of a quaternary nitrogen atom. In certain embodiments, a cationic lipid includes a zwitterionic lipid that is positively charged in its intended environment of use (e.g., at physiological pH). In certain embodiments, the cationic lipid is one or more lipids of formula (I)-(IV) (and subformulas thereof) described herein.

[0015] The term "polymer-conjugated lipid" refers to a molecule that includes both a lipid moiety and a polymer moiety. An example of a polymer-conjugated lipid is a pegylated lipid (PEG-lipid) in which the polymer moiety includes polyethylene glycol.

[0016] The term "neutral lipid" encompasses any lipid molecule that exists in an uncharged or neutral zwitterionic form at a selected pH value or within a selected pH range. In some embodiments, the selected useful pH value or range corresponds to the pH conditions in the environment of the intended use of the lipid, such as physiological pH. By way of non-limiting example, neutral lipids that may be used in connection with the present disclosure include phosphatidylcholines such as 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), phosphatidylethanolamines such as 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 2-((2,3-bis(oleoyloxy)propyl)dimethylammonio)ethyl hydrogen phosphate (DOCP), sphingomyelin (SM), steroids such as ceramide, sterol and their derivatives, but are not limited thereto. The neutral lipids provided herein can be synthesized or derived (isolated or modified) from natural sources or compounds.

[0017] The term "charged lipid" encompasses any lipid molecule that exists in either a positively or negatively charged form at a selected pH or within a selected pH range. In some embodiments, the selected pH value or range corresponds to the pH conditions in the environment of the lipid's intended use, such as physiological pH. As non-limiting examples, neutral lipids that can be used in connection with the present disclosure include, but are not limited to, phosphatidylserine, phosphatidic acid, phosphatidylglycerol, phosphatidylinositol, sterol hemisuccinate, dialkyltrimethylaluminum-propane (e.g., DOTAP, DOTMA), dialkyldimethylaminopropane, ethylphosphocholine, dimethylaminoethane carbamoyl sterol (e.g., DC-Chol), 1,2-dioleoyl-sn-glycero-3-phospho-L-serine sodium salt (DOPS-Na), 1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol) sodium salt (DOPG-Na), and 1,2-dioleoyl-sn-glycero-3-phosphate sodium salt (DOPA-Na). The charged lipids provided herein can be synthesized or derived (isolated or modified) from natural sources or compounds.

[0018] As used herein, unless otherwise specified, the term "alkyl" refers to a straight or branched hydrocarbon chain radical consisting solely of saturated carbon and hydrogen atoms. In one embodiment, an alkyl group is, for example, an alkyl group having 1 to 24 carbon atoms (C 1 -C 24 alkyl), 4 to 20 carbon atoms (C 4 -C 20 alkyl), 6 to 16 carbon atoms (C 6 -C 16 alkyl), 6 to 9 carbon atoms (C 6 -C 9 alkyl), 1 to 15 carbon atoms (C 1 -C 15 alkyl), 1 to 12 carbon atoms (C 1 -C 12 alkyl), 1 to 8 carbon atoms (C 1 -C 8alkyl) or 1 to 6 carbon atoms (C 1 -C 6 alkyl), which are attached to the remainder of the molecule by a single bond. Examples of alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, 1-methylethyl (isopropyl), n-butyl, n-pentyl, 1,1-dimethylethyl (t-butyl), 3-methylhexyl, 2-methylhexyl, and the like. Unless otherwise specified, alkyl groups are optionally substituted.

[0019] As used herein, unless otherwise specified, the term "alkenyl" refers to a straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms containing one or more carbon-carbon double bonds. The term "alkenyl" also embraces radicals having "cis" and "trans" configurations, or alternatively, "E" and "Z" configurations, as will be understood by one of ordinary skill in the art. In one embodiment, an alkyl group is an alkyl group having, for example, 2 to 24 carbon atoms (C 2 -C 24 alkenyl, 4 to 20 carbon atoms (C 4 -C 20 alkenyl, 6 to 16 carbon atoms (C 6 -C 16 alkenyl), 6 to 9 carbon atoms (C 6 -C 9 alkenyl), 2 to 15 carbon atoms (C 2 -C 15 alkenyl), 2 to 12 carbon atoms (C 2 -C 12 alkenyl), 2 to 8 carbon atoms (C 2 -C 8 alkenyl) or 2 to 6 carbon atoms (C 2 -C 6 alkenyl), which is attached to the remainder of the molecule by a single bond. Examples of alkenyl groups include, but are not limited to, ethenyl, prop-1-enyl, but-1-enyl, pent-1-enyl, penta-1,4-dienyl, and the like. Unless otherwise specified, alkenyl groups are optionally substituted.

[0020] As used herein, unless otherwise specified, the term "alkynyl" refers to a straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms containing one or more carbon-carbon triple bonds. In one embodiment, an alkyl group can be, for example, an alkyl group having 2 to 24 carbon atoms (C 2 -C 24 alkynyl, 4 to 20 carbon atoms (C 4 -C 20 alkynyl, 6 to 16 carbon atoms (C 6 -C 16 alkynyl), 6 to 9 carbon atoms (C 6 -C 9 alkynyl), 2 to 15 carbon atoms (C 2 -C 15 alkynyl), 2 to 12 carbon atoms (C 2 -C 12 alkynyl), 2 to 8 carbon atoms (C 2 -C 8 alkynyl) or 2 to 6 carbon atoms (C 2 -C 6 alkynyl), which is attached to the remainder of the molecule by a single bond. Examples of alkynyl groups include, but are not limited to, ethynyl, propynyl, butynyl, pentynyl, and the like. Unless otherwise specified, alkynyl groups are optionally substituted.

[0021] As used herein, unless otherwise specified, the term "alkylene" or "alkylene chain" refers to a straight or branched divalent hydrocarbon chain, consisting solely of saturated carbon and hydrogen atoms, linking the remainder of the molecule to a radical group. In one embodiment, an alkylene is, for example, an alkylene having 1 to 24 carbon atoms (C 1 -C 24 alkylene), 1 to 15 carbon atoms (C 1 -C 15 alkylene), 1 to 12 carbon atoms (C 1 -C 12 alkylene), 1 to 8 carbon atoms (C 1 -C 8 alkylene), 1 to 6 carbon atoms (C 1 -C6 Alkylene, 2 to 4 carbon atoms (C 2 -C 4 alkylene), 1-2 carbon atoms (C 1 -C 2 Examples of alkylene groups include, but are not limited to, methylene, ethylene, propylene, and the like. The alkylene chain is attached to the rest of the molecule through a single bond and to the radical group through a single bond. The points of attachment of the alkylene chain to the rest of the molecule and to the radical group can be through one carbon or any two carbons within the chain. Unless otherwise specified, an alkylene chain is optionally substituted.

[0022] As used herein, unless otherwise specified, the term "alkenylene" refers to a straight or branched divalent hydrocarbon chain, consisting solely of carbon and hydrogen atoms, containing one or more carbon-carbon double bonds, linking the remainder of the molecule to a radical group. In one embodiment, an alkylene is, for example, an alkylene having 2 to 24 carbon atoms (C 2 -C 24 Alkenylene, 2 to 15 carbon atoms (C 2 -C 15 Alkenylene, 2 to 12 carbon atoms (C 2 -C 12 Alkenylene, 2 to 8 carbon atoms (C 2 -C 8 Alkenylene, 2 to 6 carbon atoms (C 2 -C 6 alkenylene), or 2 to 4 carbon atoms (C 2 -C 4 Alkenylene). Examples of alkenylene include, but are not limited to, ethenylene, propenylene, n-butenylene, and the like. The alkenylene is attached to the rest of the molecule through a single or double bond and to the radical group through a single or double bond. The points of attachment of the alkenylene to the rest of the molecule and to the radical group can be through one carbon or any two carbons within the chain. Unless otherwise specified, the alkenylene is optionally substituted.

[0023] As used herein, unless otherwise specified, the term "cycloalkyl" refers to a saturated non-aromatic monocyclic or polycyclic hydrocarbon radical consisting solely of carbon and hydrogen atoms. Cycloalkyl groups can include fused or bridged ring systems. In one embodiment, cycloalkyl is an alkyl group having, for example, 3 to 15 ring carbon atoms (C 3 -C 15 Cycloalkyl), 3 to 10 ring carbon atoms (C 3 -C 10 cycloalkyl), or 3 to 8 ring carbon atoms (C 3 -C 8 Cycloalkyl) is attached to the remainder of the molecule by a single bond. Examples of monocyclic cycloalkyl radicals include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Examples of polycyclic cycloalkyl radicals include, but are not limited to, adamantyl, norbornyl, decalinyl, 7,7-dimethyl-bicyclo[2.2.1]heptanyl, and the like. Unless otherwise specified, cycloalkyl groups are optionally substituted.

[0024] As used herein, unless otherwise specified, the term "cycloalkylene" is a divalent cycloalkyl group. Unless otherwise specified, a cycloalkylene group is optionally substituted.

[0025] As used herein, unless otherwise specified, the term "cycloalkenyl" refers to a non-aromatic monocyclic or polycyclic hydrocarbon radical consisting solely of carbon and hydrogen atoms and containing one or more carbon-carbon double bonds. Cycloalkenyls can include fused or bridged ring systems. In one embodiment, cycloalkyl is, for example, a cycloalkyl group having 3 to 15 ring carbon atoms (C 3 -C 15 Cycloalkenyl, 3 to 10 ring carbon atoms (C 3 -C 10 cycloalkenyl), or 3 to 8 ring carbon atoms (C 3 -C 8Cycloalkenyls are attached to the remainder of the molecule by a single bond. Examples of monocyclic cycloalkenyl radicals include, but are not limited to, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclooctenyl, and the like. Unless otherwise specified, cycloalkenyl groups are optionally substituted.

[0026] As used herein, unless otherwise specified, the term "cycloalkenylene" is a divalent cycloalkenyl group. Unless otherwise specified, a cycloalkenylene group is optionally substituted.

[0027] As used herein, unless otherwise specified, the term "heterocyclyl" refers to a non-aromatic radical monocyclic or polycyclic moiety containing one or more (e.g., 1, 1 or 2, 1-3, or 1-4) heteroatoms independently selected from nitrogen, oxygen, phosphorus, and sulfur. The heterocyclyl may be attached to the main structure at any heteroatom or carbon atom. Heterocyclyl groups may be monocyclic, bicyclic, tricyclic, tetracyclic, or other polycyclic ring systems, and polycyclic ring systems may be fused, bridged, or spirocyclic ring systems. Heterocyclyl polycyclic ring systems may contain one or more heteroatoms in one or more rings. Heterocyclyl groups may be saturated or partially unsaturated. Saturated heterocycloalkyl groups may be referred to as "heterocycloalkyls." Partially unsaturated heterocycloalkyl groups can be referred to as "heterocycloalkenyls" if the heterocyclyl contains at least one double bond, or "heterocycloalkynyls" if the heterocyclyl contains at least one triple bond. In one embodiment, the heterocyclyl has, for example, 3 to 18 ring atoms (3-18 membered heterocyclyls), 4 to 18 ring atoms (4-18 membered heterocyclyls), 5 to 18 ring atoms (3-18 membered heterocyclyls), 4 to 8 ring atoms (4-8 membered heterocyclyls), or 5 to 8 ring atoms (5-8 membered heterocyclyls). Whenever it appears herein, a numerical range such as "3 to 18" refers to each integer within the given range, for example, "3 to 18 ring atoms" means that the heterocyclyl group can contain 3 ring atoms, 4 ring atoms, 5 ring atoms, 6 ring atoms, 7 ring atoms, 8 ring atoms, 9 ring atoms, 10 ring atoms, etc., up to and including 18 ring atoms. Examples of heterocyclyl groups include, but are not limited to, imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furyl, tetrahydrofuryl, thiophenyl, pyridinyl, piperidinyl, quinolyl, and isoquinolyl. Unless otherwise specified, a heterocyclyl group is optionally substituted.

[0028] As used herein, unless otherwise specified, the term "heterocyclylene" is a divalent heterocyclyl group. Unless otherwise specified, a heterocyclylene group is optionally substituted.

[0029] As used herein, unless otherwise specified, the term "aryl" refers to a monocyclic aromatic group and / or a polycyclic monovalent aromatic group containing at least one aromatic hydrocarbon ring. In certain embodiments, an aryl is an aromatic ring having 6 to 18 ring carbon atoms (C 6 -C 18 Aryl), 6 to 14 cyclic carbon atoms (C 6 -C 14 aryl), or 6 to 10 cyclic carbon atoms (C 6 -C 10 aryl). Examples of aryl groups include, but are not limited to, phenyl, naphthyl, fluorenyl, azulenyl, anthryl, phenanthryl, pyrenyl, biphenyl, and terphenyl. The term "aryl" also refers to bicyclic, tricyclic, or other polycyclic hydrocarbon rings in which at least one of the rings is aromatic and the others can be saturated, partially unsaturated, or aromatic, such as dihydronaphthyl, indenyl, indanyl, or tetrahydronaphthyl (tetralinyl). Unless otherwise specified, aryl groups are optionally substituted.

[0030] As used herein, unless otherwise specified, the term "arylene" is a divalent aryl group. Unless otherwise specified, an arylene group is optionally substituted.

[0031] As used herein, unless otherwise specified, the term "heteroaryl" refers to monocyclic aromatic and / or polycyclic aromatic groups containing at least one aromatic ring, where at least one aromatic ring contains one or more (e.g., 1, 1 or 2, 1-3, or 1-4) heteroatoms independently selected from O, S, and N. Heteroaryls may be attached to the main structure at any heteroatom or carbon atom. In certain embodiments, heteroaryls have 5-20, 5-15, or 5-10 ring atoms. The term "heteroaryl" also refers to bicyclic, tricyclic, or other polycyclic rings, where at least one of the rings is aromatic and the others may be saturated, partially unsaturated, or aromatic, and where at least one aromatic ring contains one or more heteroatoms independently selected from O, S, and N. Examples of monocyclic heteroaryl groups include, but are not limited to, pyrrolyl, pyrazolyl, pyrazolinyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, thiadiazolyl, isothiazolyl, furanyl, thienyl, oxadiazolyl, pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, and triazinyl. Examples of bicyclic heteroaryl groups include, but are not limited to, indolyl, benzothiazolyl, benzoxazolyl, benzothienyl, quinolinyl, tetrahydroisoquinolinyl, isoquinolinyl, benzimidazolyl, benzopyranyl, indolizinyl, benzofuranyl, isobenzofuranyl, chromonyl, coumarinyl, cinnolinyl, quinoxalinyl, indazolyl, purinyl, pyrrolopyridinyl, furopyridinyl, thienopyridinyl, dihydroisoindolyl, and tetrahydroquinolinyl. Examples of tricyclic heteroaryl groups include, but are not limited to, carbazolyl, benzindolyl, phenanthrolinyl, acridinyl, phenanthridinyl, and xanthenyl.Unless otherwise specified, a heteroaryl group is optionally substituted.

[0032] As used herein, unless otherwise specified, the term "heteroarylene" is a divalent heteroaryl group. Unless otherwise specified, a heteroarylene group is optionally substituted.

[0033] When groups described herein are said to be "substituted," they may be substituted with any suitable substituent or substituents. Illustrative examples of substituents include those found in the exemplary compounds and embodiments provided herein, as well as halogen atoms such as F, Cl, Br, or I, cyano, oxo (=O), hydroxyl (-OH), alkyl, alkenyl, alkynyl, cycloalkyl, aryl, -(C=O)OR', -O(C=O)R', -C(=O)R', -OR', -S(O) x R', -S-SR', -C(=O)SR', -SC(=O)R', -NR'R', -NR'C(=O)R', -C(=O)NR'R', -NR'C(=O)NR'R', -OC(=O)NR'R', -NR'C(=O)OR', -NR'S(O) x NR'R', -NR'S(O) x R', and -S(O) x Examples include, but are not limited to, NR′R′, where R′, at each occurrence, is independently selected from H, C, 1 -C 15 alkyl, or cycloalkyl, and x is 0, 1, or 2. In some embodiments, the substituent is 1 -C 12 In another embodiment, the substituent is an alkyl group. In another embodiment, the substituent is a cycloalkyl group. In another embodiment, the substituent is a halo group, such as fluoro. In another embodiment, the substituent is an oxo group. In another embodiment, the substituent is a hydroxyl group. In another embodiment, the substituent is an alkoxy group (-OR'). In another embodiment, the substituent is a carboxyl group. In another embodiment, the substituent is an amino group (-NR'R').

[0034] As used herein, unless otherwise specified, the term "optionally" or "optionally" (e.g., optionally substituted) means that the subsequently described event or circumstance may or may not occur, and that the description includes cases where the event or circumstance occurs and cases where it does not occur. For example, "optionally substituted alkyl" means that the alkyl radical may or may not be substituted, and that the description includes both substituted alkyl radicals and alkyl radicals that have no substitution.

[0035] As used herein, unless otherwise specified, the term "prodrug" of a biologically active compound refers to a compound that can be converted into a biologically active compound under physiological conditions or by dissolution. In one embodiment, the term "prodrug" refers to a metabolic precursor of a biologically active compound that is pharma- ceutically acceptable. A prodrug may be inactive when administered to a subject in need thereof, but is converted into a biologically active compound in vivo. Prodrugs are typically rapidly converted in vivo, e.g., by hydrolysis in blood, to produce the original biologically active compound. Prodrug compounds often offer advantages of solubility, tissue compatibility, or delayed release in mammalian organisms (see Bundgard, H., Design of Prodrugs (1985), pp. 7-9, 21-24 (Elsevier, Amsterdam)). A discussion of prodrugs is provided in Higuchi, T., et al., ACS Symposium Series, Vol. 14, and in Bioreversible Carriers in Drug Design, Ed. Edward B. Roche, American Pharmaceutical Association and Pergamon Press, 1987.

[0036] In one embodiment, the term "prodrug" is also meant to include any covalently bonded carrier that releases an active compound in vivo when such prodrug is administered to a mammalian subject. Prodrugs of a compound can be prepared by modifying functional groups present in the compound in such a way that the modification is cleaved to the original compound, either in routine manipulation or in vivo. Prodrugs include compounds in which a hydroxyl group, an amino group, or a mercapto group is bonded to any group that is cleaved to form a free hydroxyl group, a free amino group, or a free mercapto group, respectively, when a prodrug of the compound is administered to a mammalian subject.

[0037] Examples of prodrugs include, but are not limited to, acetate, formate and benzoate derivatives of alcohol or amide derivatives of amine functional groups in the compounds provided herein.

[0038] As used herein, unless otherwise specified, the term "pharmaceutically acceptable salts" includes both acid and base addition salts.

[0039] Examples of pharma- ceutically acceptable acid addition salts include those of hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like, as well as, but not limited to, those of acetic acid, 2,2-dichloroacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetamidobenzoic acid, camphoric acid, camphor-10-sulfonic acid, capric acid, caproic acid, caprylic acid, carbonic acid, cinnamic acid, citric acid, cyclamic acid, dodecylsulfuric acid, ethane-1,2-disulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, formic acid, fumaric acid, galactaric acid, gentisic acid, glucoheptonic acid, gluconic acid, glucuronic acid, glutamine acid, and the like. Acid, glutaric acid, 2-oxo-glutaric acid, glycerophosphoric acid, glycolic acid, hippuric acid, isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, mucic acid, naphthalene-1,5-disulfonic acid, naphthalene-2-sulfonic acid, 1-hydroxy-2-naphthoic acid, nicotinic acid, oleic acid, orotic acid, oxalic acid, palmitic acid, pamoic acid, propionic acid, pyroglutamic acid, pyruvic acid, salicylic acid, 4-aminosalicylic acid, sebacic acid, stearic acid, succinic acid, tartaric acid, thiocyanic acid, p-toluenesulfonic acid, trifluoroacetic acid, undecylenic acid and other organic acids.

[0040] Examples of pharma-ceutically acceptable base addition include, but are not limited to, salts prepared from the addition of an inorganic or organic base to a free acid compound. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts, etc. In one embodiment, the inorganic salts are ammonium, sodium, potassium, calcium, and magnesium salts. Salts derived from organic bases include, but are not limited to, salts of primary, secondary and tertiary amines, including ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, diethanolamine, ethanolamine, deanol, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, benethamine, benzathine, ethylenediamine, glucosamine, methylglucamine, theobromine, triethanolamine, tromethamine, purine, piperazine, piperidine, N-ethylpiperidine, polyamine resins, substituted amines including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins. In one embodiment, the organic base is isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline and caffeine.

[0041] The compounds provided herein may contain one or more chiral centers and, therefore, can give rise to enantiomers, diastereomers, and other stereoisomeric forms that can be defined as (R)- or (S)- from the perspective of absolute stereochemistry, or as (D)- or (L)- for amino acids. Unless otherwise specified, the compounds provided herein are meant to include all such possible isomers, as well as their racemic and optically pure forms. Optically active (+) and (-), (R)- and (S)-, or (D)- and (L)- isomers can be prepared using a chiral synthon or chiral reagent or can be resolved using conventional techniques such as chromatography and fractional crystallization. Conventional techniques for the preparation / isolation of individual enantiomers include chiral synthesis from a suitable optically pure precursor or resolution of a racemate (or a racemate of a salt or derivative), for example, using chiral high performance liquid chromatography (HPLC). When the compounds described herein contain an olefinic double bond or other geometrically chiral centers, unless otherwise specified, the compounds are intended to include both E and Z geometric isomers. Similarly, all tautomeric forms are also intended to be included.

[0042] As used herein, unless otherwise specified, the term "isomer" refers to different compounds having the same molecular formula. "Stereoisomers" are isomers that differ only in the manner in which the atoms are arranged in space. "Atropisomers" are stereoisomers resulting from hindrance to rotation about a single bond. "Enantiomers" are a pair of stereoisomers that are non-superimposable mirror images of each other. A mixture of a pair of enantiomers in any proportion can be known as a "racemic" mixture. "Diastereoisomers" are stereoisomers that have at least two chiral atoms but are not mirror images of each other.

[0043] "Stereoisomer" may also include E and Z isomers, or mixtures thereof, as well as cis and trans isomers, or mixtures thereof. In certain embodiments, the compounds described herein are isolated as either the E or Z isomer. In other embodiments, the compounds described herein are a mixture of E and Z isomers.

[0044] "Tautomers" refer to isomeric forms of a compound that are in equilibrium with each other. The concentrations of isomeric forms depend on the environment in which the compound is found, and can vary depending on, for example, whether the compound is a solid or in an organic or aqueous solution.

[0045] It should also be noted that the compounds described herein may contain unnatural proportions of atomic isotopes at one or more of the atoms. For example, the compounds may contain, for example, tritium ( 3 H), Iodine-125( 125 I), Sulfur 35( 35 S), or carbon-14 ( 14 It can be radiolabeled with a radioisotope such as C, or it can be radiolabeled with deuterium ( 2 H), Carbon 13 ( 13 C), or nitrogen-15 ( 15As used herein, an "isotopically enriched" is an isotopically enriched compound. The term "isotopically enriched" refers to an atom having an isotopic composition other than the natural isotopic composition of that atom. "Isotopically enriched" can also refer to a compound containing at least one atom having an isotopic composition other than the natural isotopic composition of that atom. The term "isotopic composition" refers to the amount of each isotope present for a given atom. Radiolabeled and isotopically enriched compounds are useful as therapeutic agents, e.g., cancer therapeutic agents, research reagents, e.g., binding assay reagents, and diagnostic agents, e.g., in vivo imaging agents. All isotopic variations of the compounds described herein, whether radioactive or not, are intended to be encompassed within the scope of the embodiments provided herein. In some embodiments, isotopic species of the compounds described herein are provided, e.g., isotopic species enriched in deuterium, carbon-13, and / or nitrogen-15. As used herein, "deuterated" means that at least one hydrogen (H) has been replaced with a deuterium (D or 2 H), meaning that the compound is enriched with deuterium at at least one position.

[0046] It should be noted that where there is a discrepancy between a depicted structure and a name for that structure, the depicted structure is given weight.

[0047] As used herein, unless otherwise specified, the term "pharmaceutically acceptable carrier, diluent or excipient" includes, but is not limited to, any adjuvant, carrier, excipient, lubricant, sweetener, diluent, preservative, dye / colorant, flavor enhancer, surfactant, wetting agent, dispersing agent, suspending agent, stabilizer, isotonic agent, solvent, or emulsifier approved by the United States Food and Drug Administration as acceptable for use in humans or veterinary medicine.

[0048] The term "composition" is intended to encompass products that contain specified components (e.g., mRNA molecules provided herein), optionally in specified amounts.

[0049] The term "polynucleotide" or "nucleic acid", used interchangeably herein, refers to a polymer of nucleotides of any length, including, for example, DNA and RNA. Nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and / or their analogs, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase or by a synthetic reaction. Polynucleotides can include modified nucleotides, such as methylated nucleotides and their analogs. Nucleic acids can be in either single-stranded or double-stranded form. As used herein, unless otherwise specified, "nucleic acid" also includes nucleic acid mimetics such as locked nucleic acid (LNA), peptide nucleic acid (PNA), and morpholino. "Oligonucleotide", as used herein, generally, but not necessarily, refers to short synthetic polynucleotides that are less than about 200 nucleotides in length. The terms "oligonucleotide" and "polynucleotide" are not mutually exclusive. The above description of polynucleotides is equally fully applicable to oligonucleotides. Unless otherwise specified, the left-hand end of any single-stranded polynucleotide sequence disclosed herein is the 5' end, and the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5' direction. The direction of 5' to 3' addition of the nascent RNA transcript is referred to as the transcription direction, and the region of sequence on the DNA strand that is at the 5' to 5' end of the RNA transcript and has the same sequence as the RNA transcript is referred to as the "upstream sequence," and the region of sequence on the DNA strand that is at the 3' to 3' end of the RNA transcript and has the same sequence as the RNA transcript is referred to as the "downstream sequence."

[0050] An "isolated nucleic acid" is a nucleic acid, e.g., RNA, DNA, or mixed nucleic acid, that is substantially separated from other genomic DNA sequences and proteins or complexes, such as ribosomes and polymerases, that naturally accompany the natural sequence. An "isolated" nucleic acid molecule is a nucleic acid molecule that is separated from other nucleic acid molecules that are present in the natural source of the nucleic acid molecule. Furthermore, an "isolated" nucleic acid molecule, such as an mRNA, may be substantially free of other cellular material or culture medium when produced by recombinant techniques, or may be substantially free of chemical precursors or other chemicals when chemically synthesized. In certain embodiments, one or more nucleic acid molecules encoding the antigens described herein are isolated or purified. The term encompasses a nucleic acid sequence that has been removed from its naturally occurring environment, including recombinant or cloned DNA or RNA isolates, and chemically synthesized analogs or analogs biologically synthesized by heterologous systems. A substantially pure molecule may include an isolated form of a molecule.

[0051] When used in reference to a nucleic acid molecule, the term "encoding nucleic acid" or its grammatical equivalents encompasses (a) a nucleic acid molecule that can be transcribed in its natural state or when manipulated by methods well known to those skilled in the art to produce an mRNA that is then translated into a peptide and / or polypeptide, as well as (b) the mRNA molecule itself. The antisense strand is the complement of such a nucleic acid molecule from which a coding sequence can be derived. The term "coding region" refers to the portion within a coding nucleic acid sequence that is translated into a peptide or polypeptide. The term "untranslated region" or "UTR" refers to the portion of a coding nucleic acid that is not translated into a peptide or polypeptide. Depending on the orientation of the UTR with respect to the coding region of a nucleic acid molecule, the UTR is referred to as a 5'-UTR if it is located at the 5' end of the coding region, and as a 3'-UTR if it is located at the 3' end of the coding region.

[0052] The term "mRNA" as used herein refers to a message RNA molecule that contains one or more open reading frames (ORFs) that can be translated by a cell or organism with which the mRNA is provided to produce one or more peptide or protein products. The region that contains one or more ORFs is referred to as the coding region of the mRNA molecule. In some embodiments, the mRNA molecule further contains one or more untranslated regions (UTRs).

[0053] In certain embodiments, the mRNA is a monocistronic mRNA that contains only one ORF. In certain embodiments, the monocistronic mRNA encodes a peptide or protein that contains at least one epitope of a selected antigen (e.g., a pathogenic antigen or a tumor-associated antigen). In other embodiments, the mRNA is a multicistronic mRNA that contains two or more ORFs. In certain embodiments, the multicistronic mRNA encodes two or more peptides or proteins that may be the same or different from each other. In certain embodiments, each peptide or protein encoded by the multicistronic mRNA contains at least one epitope of a selected antigen. In certain embodiments, the different peptides or proteins encoded by the multicistronic mRNA each contain at least one epitope of a different antigen. In any of the embodiments described herein, the at least one epitope may be at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten epitopes of an antigen.

[0054] The term "nucleobase" encompasses purines and pyrimidines, including the natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and their natural or synthetic analogues or derivatives.

[0055] The term "functional nucleotide analog" as used herein refers to a modified version of the standard nucleotides A, G, C, U, or T that (a) retains the base pairing properties of the corresponding standard nucleotide and (b) contains at least one chemical modification to (i) the nucleobase, (ii) the sugar group, (iii) the phosphate group, or (iv) any combination of (i)-(iii) of the corresponding natural nucleotide. As used herein, base pairing encompasses not only standard Watson-Crick adenine-thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between a standard nucleotide and a functional nucleotide analog or between a pair of functional nucleotide analogs, where the arrangement of hydrogen bond donors and hydrogen bond acceptors allows hydrogen bonding between a modified nucleobase and a standard nucleobase or between two complementary nucleobase structures. For example, a functional analog of guanosine (G) retains the ability to base pair with cytosine (C) or a functional analog of cytosine. An example of such non-standard base pairing is the base pairing between the modified nucleotide inosine and adenine, cytosine, or uracil.As described herein, functional nucleotide analogs can be either naturally occurring or non-naturally occurring.Thus, nucleic acid molecules containing functional nucleotide analogs can have at least one modified nucleobase, sugar group, and / or internucleoside linkage.Exemplary chemical modifications to the nucleobase, sugar group, or internucleoside linkage of nucleic acid molecules are provided herein.

[0056] The terms "translation enhancer element", "TEE" and "translation enhancer" as used herein refer to a region in a nucleic acid molecule that functions to enhance the translation of a coding sequence of the nucleic acid into a protein or peptide product, such as through cap-dependent or cap-independent translation. TEEs are typically located in the UTR region of a nucleic acid molecule (e.g., mRNA) and enhance the translation level of a coding sequence located either upstream or downstream. For example, a TEE in the 5'UTR of a nucleic acid molecule can be located between the promoter and the start codon of the nucleic acid molecule. Various TEE sequences are known in the art (Wellensiek et al. Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, 2013 Aug;10(8):747-750; Chappell et al. PNAS June 29, 2004 101(26)9590-9594). Some TEEs are known to be conserved across multiple species (Panek et al. Nucleic Acids Research, Volume 41, Issue 16, 1 September 2013, Pages 7625-7634).

[0057] As used herein, the term "stem-loop sequence" refers to a single-stranded polynucleotide sequence having at least two regions that are complementary or substantially complementary to each other when read in opposite directions, and thus can base-pair with each other to form at least one double helix and an unpaired loop. The resulting structure is known as a stem-loop structure, hairpin, or hairpin loop, which is a secondary structure found in many RNA molecules.

[0058] The term "peptide" as used herein refers to a polymer containing 2 to 50 amino acid residues linked by one or more covalent peptide bond(s). The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally occurring amino acids (e.g., amino acid analogs or unnatural amino acids).

[0059] The terms "polypeptide" and "protein" are used interchangeably herein to refer to polymers of more than 50 amino acid residues linked by covalent peptide bonds. That is, a description of a polypeptide applies equally to a description of a protein, and vice versa. The terms apply to naturally occurring amino acid polymers and to amino acid polymers in which one or more amino acid residues are non-naturally occurring amino acids (e.g., amino acid analogs). As used herein, the terms encompass amino acid chains of any length, including full-length proteins (e.g., antigens).

[0060] The term "antigen" refers to a substance that can be recognized by a subject's immune system (including the adaptive immune system) and induce an immune response (including an antigen-specific immune response) after the subject comes into contact with the antigen. In certain embodiments, an antigen is a protein associated with a diseased cell, such as a cell infected by a pathogen or a neoplastic cell (e.g., a tumor-associated antigen (TAA)).

[0061] In the context of a peptide or polypeptide, the term "fragment" as used herein refers to a peptide or polypeptide that comprises an amino acid sequence that is less than full length. Such fragments can arise, for example, from cleavage at the amino terminus, cleavage at the carboxy terminus, and / or internal deletions of residue(s) from the amino acid sequence. Fragments can arise, for example, from alternative RNA splicing, or from in vivo protease activity. In certain embodiments, a fragment refers to a polypeptide that comprises an amino acid sequence of at least 5 contiguous amino acid residues, at least 10 contiguous amino acid residues, at least 15 contiguous amino acid residues, at least 20 contiguous amino acid residues, at least 25 contiguous amino acid residues, at least 30 contiguous amino acid residues, at least 40 contiguous amino acid residues, at least 50 contiguous amino acid residues, at least 60 contiguous amino acid residues, at least 70 contiguous amino acid residues, at least 80 contiguous amino acid residues, at least 90 contiguous amino acid residues, at least 100 contiguous amino acid residues, at least 125 contiguous amino acid residues, at least 150 contiguous amino acid residues, at least 175 contiguous amino acid residues, at least 200 contiguous amino acid residues, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, or at least 950 contiguous amino acid residues of the amino acid sequence of the polypeptide. In certain embodiments, a fragment of a polypeptide retains at least one, at least two, at least three, or more functions of the polypeptide.

[0062] An "epitope" is a site on the surface of an antigen molecule to which a single antibody molecule binds, such as a site on the surface of an antigen that has antigenic or immunogenic activity in an animal, such as a mammal (e.g., human), that can bind to one or more antigen-binding regions of an antibody and elicit an immune response. An epitope with immunogenic activity is a portion of a polypeptide that elicits an antibody response in an animal. An epitope with antigenic activity is a portion of a polypeptide to which an antibody binds, as determined by any method known in the art, including, for example, immunoassays. An antigenic epitope is not necessarily immunogenic. Epitopes often consist of chemically active surface groupings of molecules, such as amino acids or sugar side chains, and have specific three-dimensional structural characteristics and specific charge characteristics. Antibody epitopes can be linear or conformational epitopes. Linear epitopes are formed by a contiguous sequence of amino acids in a protein. Conformational epitopes are formed from amino acids that are discontinuous in the protein sequence, but come together when the protein folds into its three-dimensional structure. Induced epitopes are formed when the three-dimensional structure of a protein is in an altered conformation, such as following activation or binding of another protein or ligand. In certain embodiments, an epitope is a three-dimensional surface feature of a polypeptide. In other embodiments, an epitope is a linear feature of a polypeptide. Generally, an antigen has several or many different epitopes and can react with many different antibodies.

[0063] The term "genetic vaccine" as used herein refers to a therapeutic or prophylactic composition that includes at least one nucleic acid molecule that encodes an antigen associated with a target disease (e.g., an infectious disease or a neoplastic disease). Administration of the vaccine to a subject ("vaccination") allows for the production of the encoded peptide or protein, thereby eliciting an immune response in the subject against the target disease. In certain embodiments, the immune response includes an adaptive immune response, such as the production of antibodies against the encoded antigen, and / or the activation and proliferation of immune cells that can specifically eliminate disease cells expressing the antigen. In certain embodiments, the immune response further includes an innate immune response. In accordance with the present disclosure, the vaccine may be administered to a subject either before or after the onset of clinical symptoms of the target disease. In some embodiments, vaccination of a healthy or asymptomatic subject immunizes or reduces the susceptibility of the vaccinated subject to the development of the target disease. In some embodiments, vaccination of a subject exhibiting symptoms of the disease improves or treats the condition of the disease in the vaccinated subject.

[0064] "Innate immune response" and "innate immunity" are recognized in the art and refer to the non-specific defense mechanism that the body's immune system initiates upon recognition of pathogen-associated molecular patterns, involving different forms of cellular activity, including cytokine production and cell death via various pathways. As used herein, innate immune responses include, but are not limited to, increased production of inflammatory cytokines (e.g., type I interferon or IL-10 production), activation of the NFκB pathway, increased proliferation, maturation, differentiation and / or survival of immune cells, and in some cases, induction of cell apoptosis. Activation of innate immunity can be detected using methods known in the art, such as measuring (NF)-κB activation.

[0065] The terms "adaptive immune response" and "adaptive immunity" are art-recognized and refer to antigen-specific defense mechanisms initiated by the body's immune system upon recognition of a particular antigen, including both humoral and cell-mediated responses. As used herein, adaptive immune responses include cellular responses elicited and / or augmented by vaccine compositions, such as the genetic compositions described herein. In some embodiments, the vaccine composition includes an antigen that is the target of an antigen-specific adaptive immune response. In other embodiments, the vaccine composition, upon administration, enables the production in an immunized subject of an antigen that is the target of an antigen-specific adaptive immune response. Activation of an adaptive immune response can be detected using methods known in the art, such as measuring the level of antigen-specific antibody production, or antigen-specific cell-mediated cytotoxicity.

[0066] The term "antibody" is intended to include a polypeptide product of B cells within the immunoglobulin class of polypeptides capable of binding to a specific molecular antigen and consisting of two identical pairs of polypeptide chains, each pair having one heavy chain (about 50-70 kDa) and one light chain (about 25 kDa), each amino-terminal portion of each chain containing a variable region of about 100 to about 130 or more amino acids, and each carboxy-terminal portion of each chain containing a constant region. See, e.g., Antibody Engineering (Borrebaeck ed., 2d ed. 1995), and Kuby, Immunology (3d ed. 1997). In certain embodiments, a specific molecular antigen can be bound by an antibody provided herein, including a polypeptide, fragment thereof, or epitope. Antibodies also include, but are not limited to, synthetic antibodies, recombinantly produced antibodies, camelized antibodies, intrabodies, anti-idiotypic (anti-Id) antibodies, and functional fragments of any of the above, where a functional fragment refers to a portion of an antibody heavy or light chain polypeptide that retains some or all of the binding activity of the antibody from which the fragment is derived. Non-limiting examples of functional fragments include single chain Fvs (scFvs) (including, e.g., monospecific, bispecific, etc.), Fab fragments, F(ab') fragments, F(ab) 2 Fragment, F(ab') 2Antibody fragments include Fv fragments, disulfide-linked Fv (dsFv), Fd fragments, Fv fragments, diabodies, triabodies, tetrabodies, and minibodies. In particular, the antibodies provided herein include immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, such as molecules containing an antigen-binding domain or site (e.g., one or more CDRs of an antibody). Such antibody fragments can be found, for example, in Harlow and Lane, Antibodies: A Laboratory Manual (1989), Mol. Biology and Biotechnology: A Comprehensive Desk Reference (Myers ed., 1995), Huston et al., 1993, Cell Biophysics 22:189-224, Pluckthun and Skerra, 1989, Meth. Enzymol. 178:497-515, and Day, Advanced Immunochemistry (2d ed. 1990). The antibodies provided herein can be of any class of immunoglobulin molecule (e.g., IgG, IgE, IgM, IgD, and IgA), any subclass (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2).

[0067] The term "administering" or "administration" refers to the act of injecting or otherwise physically delivering an exogenous substance (e.g., a lipid nanoparticle composition described herein) to a patient, such as by mucosal, intradermal, intravenous, intramuscular delivery, and / or any other physical delivery method described herein or known in the art. When a disease, disorder, condition, or symptom thereof is being treated, administration of the substance typically occurs after the onset of the disease, disorder, condition, or symptom thereof. When a disease, disorder, condition, or symptom thereof is being prevented, administration of the substance typically occurs before the onset of the disease, disorder, condition, or symptom thereof.

[0068] "Chronic" administration refers to administration of an agent(s) in a continuous mode (e.g., over a period of days, weeks, months, or years, etc.) in order to maintain an initial therapeutic effect (activity) over an extended period of time, as opposed to an acute mode. "Intermittent" administration is cyclical rather than continuous without interruption.

[0069] The term "targeted delivery" or the verb form "targeting" as used herein refers to a process that facilitates the delivery of a delivery agent (such as a therapeutic payload molecule in a lipid nanoparticle composition described herein) to a particular organ, tissue, cell, and / or subcellular component (referred to as a targeted location) over any other organ, tissue, cell, or subcellular component (referred to as a non-targeted location). Targeted delivery can be detected using methods known in the art, for example, by comparing the concentration of the delivery agent in a targeted cell population following systemic administration to the concentration of the delivery agent in a non-targeted cell population. In certain embodiments, targeted delivery results in at least a two-fold higher concentration in the targeted location compared to the non-targeted location.

[0070] An "effective amount" is generally an amount sufficient to reduce the severity and / or frequency of a symptom, eliminate the symptom and / or its underlying cause, prevent the occurrence of the symptom and / or its underlying cause, and / or ameliorate or correct damage caused by or associated with a disease, disorder or condition, including, for example, infection and tumors. In some embodiments, the effective amount is a therapeutically effective amount or a prophylactically effective amount.

[0071] As used herein, the term "therapeutically effective amount" refers to an amount of an agent (e.g., a vaccine composition) sufficient to reduce and / or ameliorate the severity and / or duration of a given disease, disorder, or condition, and / or symptoms associated therewith (e.g., an infectious disease, such as caused by a viral infection, or a neoplastic disease, such as cancer). The "therapeutically effective amount" of a substance / molecule / agent of the present disclosure (e.g., a lipid nanoparticle composition described herein) may vary according to factors such as the disease state, age, sex, and weight of an individual, and the ability of the substance / molecule / agent to elicit a desired response in an individual. A therapeutically effective amount encompasses an amount in which the toxic or detrimental effects of the substance / molecule / agent are outweighed by the therapeutically beneficial effects. In certain embodiments, the term "therapeutically effective amount" refers to an amount of a lipid nanoparticle composition described herein or a therapeutic or prophylactic agent (e.g., a therapeutic mRNA) contained therein that is effective to "treat" a disease, disorder, or condition in a subject or mammal.

[0072] A "prophylactically effective amount" is an amount of a pharmaceutical composition that, when administered to a subject, will have an intended prophylactic effect, e.g., prevent, delay, or reduce the likelihood of onset (or recurrence) of a disease, disorder, condition, or associated symptom(s) (e.g., an infectious disease, such as caused by a viral infection, or a neoplastic disease, such as cancer). Typically, a prophylactically effective amount may be less than a therapeutically effective amount, although this is not necessarily the case, since a prophylactic dose is used in a subject before or at an early stage of a disease, disorder, or condition. A complete therapeutic or prophylactic effect does not necessarily occur by administration of one dose, and may occur only after administration of a series of doses. Thus, a therapeutically or prophylactically effective amount can be administered in one or more administrations.

[0073] The terms "prevent", "preventing", and "prevention" refer to reducing the likelihood of onset (or recurrence) of a disease, disorder, condition, or associated symptom(s) (e.g., an infectious disease, such as caused by a viral infection, or a neoplastic disease, such as cancer).

[0074] The terms "manage," "managing," and "management" refer to the beneficial effects a subject derives from a therapy (e.g., a prophylactic or therapeutic agent) that does not result in a cure of the disease. In certain embodiments, a subject is administered one or more therapies (e.g., a prophylactic or therapeutic agent, such as a lipid nanoparticle composition described herein) to prevent progression or worsening of the disease, thereby "managing" an infectious or neoplastic disease, or one or more symptoms thereof.

[0075] The term "prophylactic agent" refers to any agent that can completely or partially inhibit the onset, recurrence, development, or spread of a disease and / or its associated symptoms in a subject.

[0076] The term "therapeutic agent" refers to any agent that can be used to treat, prevent, or alleviate a disease, disorder, or condition, including the treatment, prevention, or alleviation of one or more symptoms of the disease, disorder, or condition, and / or symptoms associated therewith.

[0077] The term "therapy" refers to any protocol, method, and / or agent that may be used in the prevention, management, treatment, and / or amelioration of a disease, disorder, or condition. In certain embodiments, the terms "therapy" and "therapy" refer to biologic, supportive, and / or other therapies known to those of skill in the art, such as health care practitioners, that are useful in the prevention, management, treatment, and / or amelioration of a disease, disorder, or condition.

[0078] As used herein, a "prophylactically effective serum titer" is a serum titer of antibodies in a subject (e.g., a human) that completely or partially inhibits the onset, recurrence, onset, or spread of a disease, disorder, or condition, and / or symptoms associated therewith, in the subject.

[0079] In certain embodiments, a "therapeutically effective serum titer" is a serum titer of antibodies in a subject (e.g., a human) that reduces the severity, duration, and / or symptoms associated with a disease, disorder, or condition in the subject.

[0080] The term "serum titer" refers to the average serum titer from multiple samples (e.g., at multiple time points) in a subject, or in a population of at least 10, at least 20, at least 40 subjects, up to about 100, 1000, or more.

[0081] The term "side effects" encompasses undesirable and / or harmful effects of a therapy (e.g., a prophylactic or therapeutic agent). Undesirable effects are not necessarily harmful. Side effects from a therapy (e.g., a prophylactic or therapeutic agent) can be harmful, uncomfortable, or dangerous. Examples of side effects include diarrhea, cough, gastroenteritis, wheezing, nausea, vomiting, anorexia, abdominal cramps, fever, pain, weight loss, dehydration, hair loss, difficulty breathing, insomnia, dizziness, mucositis, nerve and muscle effects, fatigue, dry mouth, loss of appetite, rash or swelling at the site of administration, flu-like symptoms such as fever, chills, fatigue, digestive problems, and allergic reactions. Additional undesirable effects experienced by patients are numerous and known in the art. Many are described in the Physician's Desk Reference (68th ed.2014).

[0082] The terms "subject" and "patient" may be used interchangeably. As used herein, in certain embodiments, a subject is a mammal, such as a non-primate (e.g., cows, pigs, horses, cats, dogs, rats, etc.) or a primate (e.g., monkeys and humans). In certain embodiments, a subject is a human. In one embodiment, a subject is a mammal (e.g., a human) with an infectious or neoplastic disease. In another embodiment, a subject is a mammal (e.g., a human) at risk of developing an infectious or neoplastic disease.

[0083] The term "detectable probe" refers to a composition that provides a detectable signal. The term includes, but is not limited to, any fluorophore, chromophore, radiolabel, enzyme, antibody or antibody fragment, etc. that provides a detectable signal through its activity.

[0084] The term "detectable agent" refers to a substance that can be used to confirm the existence or presence of a desired molecule, such as an antigen encoded by an mRNA molecule described herein, in a sample or subject. A detectable agent can be a substance that can be visualized or that can otherwise be determined and / or measured (e.g., by quantification).

[0085] "Substantially all" refers to at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or about 100%.

[0086] As used herein, unless otherwise indicated, the term "about" or "approximately" refers to the tolerance of a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined. In certain embodiments, the term "about" or "approximately" means within 1, 2, 3, or 4 standard deviations. In certain embodiments, the term "about" or "approximately" means within 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.05% of a given value or range.

[0087] As used herein, the singular terms "a," "an," and "the" include plural references unless the context clearly dictates otherwise.

[0088] All publications, patent applications, accession numbers, and other references cited herein are incorporated herein by reference in their entirety as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. The publications discussed herein are provided solely for their disclosure prior to the filing date of this application. Nothing herein should be construed as an admission that the present invention is not entitled to antedate such publications by virtue of prior invention. Further, the publication dates provided may be different from the actual publication dates, which may need to be independently confirmed.

[0089] Numerous embodiments of the present invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the present invention. Accordingly, the description in the experimental section and examples are intended to be illustrative, but not limiting, of the scope of the invention as set forth in the claims.

[0090] 5.3 Lipid compounds In one embodiment, provided herein is a compound of formula (I): [ka] or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof, wherein: G 1 and G 2 each independently represents a bond, C 2 -C 12 Alkylene, or C 2 -C 12 Alkenylene, and one or more -CH 2 - is optionally replaced by -O-; L 1 But -OC(=O)R 1 , -C(=O)OR 1 , -OC(=O)OR 1 , -C(=O)R 1 , -OR 1 , -S(O) x R1 , -S-SR 1 , -C(=O)SR 1 , -SC(=O)R 1 , -NR a C(=O)R 1 , -C(=O)NR b R c , -NR a C(=O)NR b R c , -OC(=O)NR b R c , -NR a C(=O)OR 1 , -SC(=S)R 1 , -C(=S)SR 1 , -C(=S)R 1 , -CH(OH)R 1 , -P(=O)(OR b )(OR c ), -(C 6 -C 10 Arylene)-R 1 , -(6 to 10 membered heteroarylene)-R 1 , or R 1 and L 2 But -OC(=O)R 2 , -C(=O)OR 2 , -OC(=O)OR 2 , -C(=O)R 2 , -OR 2 , -S(O) x R 2 , -S-SR 2 , -C(=O)SR 2 , -SC(=O)R 2 , -NR d C(=O)R 2 , -C(=O)NR e R f , -NR d C(=O)NR e R f , -OC(=O)NR e R f , -NR d C(=O)OR 2 , -SC(=S)R 2 , -C(=S)SR 2 , -C(=S)R 2, -CH(OH)R 2 , -P(=O)(OR e )(OR f ), -(C 6 -C 10 Arylene)-R 2 , -(6 to 10 membered heteroarylene)-R 2 , or R 2 and R 1 and R 2 However, each independently, C 6 -C 32 Alkyl or C 6 -C 32 alkenyl, R a , R b , R d , and R e However, each independently, H, C 1 -C 24 Alkyl, or C 2 -C 24 alkenyl, R c and R f However, each independently, C 1 -C 32 Alkyl or C 2 -C 32 alkenyl, G 3 But, C 2 -C 24 Alkylene, C 2 -C 24 Alkenylene, C 3 -C 8 Cycloalkylene, or C 3 -C 8 is cycloalkenylene, R 3 But -N(R 4 )R 5 and R 4 But, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, 4-8 membered heterocyclyl, or C 6 -C 10 aryl or R4 , G 3 or G 3 a part of which, together with the nitrogen to which they are attached, forms a cyclic moiety, R 5 is C 1 -C 12 alkyl or C 3 -C 8 cycloalkyl, or R 4 , R 5 together with the nitrogen to which they are attached, forms a cyclic moiety, x is 0, 1, or 2, each alkyl, alkenyl, cycloalkyl, cycloalkenyl, heterocyclyl, aryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, arylene, heteroarylene, and cyclic moiety is independently optionally substituted.

[0091] In one embodiment, provided herein is a compound of formula (I),

Chemical formula

[0092] In one embodiment, provided herein is a compound of formula (II): [ka] or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof, wherein: [ka] is a single bond or a double bond, G 1 and G 2 each independently represents a bond, C 2 -C 12 Alkylene, or C 2 -C 12 Alkenylene, and one or more -CH 2 - is optionally replaced by -O-; L 1 But -OC(=O)R 1 , -C(=O)OR 1 , -OC(=O)OR 1 , -C(=O)R 1 , -OR 1 , -S(O) x R 1 , -S-SR 1 , -C(=O)SR 1 , -SC(=O)R 1 , -NR a C(=O)R 1 , -C(=O)NR b R c , -NR a C(=O)NR b R c , -OC(=O)NR b R c , -NR a C(=O)OR 1 , -SC(=S)R 1, -C(=S)SR 1 , -C(=S)R 1 , -CH(OH)R 1 , -P(=O)(OR b )(OR c ), -(C 6 -C 10 Arylene)-R 1 , -(6 to 10 membered heteroarylene)-R 1 , or R 1 and L 2 But -OC(=O)R 2 , -C(=O)OR 2 , -OC(=O)OR 2 , -C(=O)R 2 , -OR 2 , -S(O) x R 2 , -S-SR 2 , -C(=O)SR 2 , -SC(=O)R 2 , -NR d C(=O)R 2 , -C(=O)NR e R f , -NR d C(=O)NR e R f , -OC(=O)NR e R f , -NR d C(=O)OR 2 , -SC(=S)R 2 , -C(=S)SR 2 , -C(=S)R 2 , -CH(OH)R 2 , -P(=O)(OR e )(OR f ), -(C 6 -C 10 Arylene)-R 2 , -(6 to 10 membered heteroarylene)-R 2 , or R 2 and R 1 and R 2 However, each independently, C 6 -C 32 Alkyl or C 6 -C 32 alkenyl, R a , R b , R d , and R e However, each independently, H, C 1 -C 24 Alkyl, or C 2 -C 24 alkenyl, R c and R f However, each independently, C 1 -C 32 Alkyl or C 2 -C 32 alkenyl, G 4 But, bond, C 1 -C 23 Alkylene, C 2 -C 23 Alkenylene, C 3 -C 8 Cycloalkylene, or C 3 -C 8 is cycloalkenylene, R 3 But -N(R 4 )R 5 and R 4 But, C 1 -C 12 Alkyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, 4-8 membered heterocyclyl, or C 6 -C 10 aryl or R 4 , G 3 Or G 3 form a cyclic moiety together with the nitrogen to which they are attached, R 5 But, C 1 -C 12 Alkyl or C 3 -C 8 cycloalkyl or R 4 , R 5 form a cyclic moiety together with the nitrogen to which they are attached, x is 0, 1, or 2; Each alkyl, alkenyl, cycloalkyl, cycloalkenyl, heterocyclyl, aryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, arylene, heteroarylene, and cyclic moiety is independently optionally substituted.

[0093] In one embodiment, provided herein is a compound of formula (II): [ka] or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof, wherein: [ka] is a single bond or a double bond, G 1 and G 2 However, each independently, C 2 -C 12 Alkylene, or C 2 -C 12 alkenylene, L 1 But -OC(=O)R 1 , -C(=O)OR 1 , -OC(=O)OR 1 , -C(=O)R 1 , -OR 1 , -S(O) x R 1 , -S-SR 1 , -C(=O)SR 1 , -SC(=O)R 1 , -NR a C(=O)R 1 , -C(=O)NR b R c , -NR a C(=O)NR b R c , -OC(=O)NR b R c , -NR a C(=O)OR 1 , -SC(=S)R 1 , -C(=S)SR 1, -C(=S)R 1 , -CH(OH)R 1 , -P(=O)(OR b )(OR c ), -(C 6 -C 10 Arylene)-R 1 , -(6 to 10 membered heteroarylene)-R 1 , or R 1 and L 2 But -OC(=O)R 2 , -C(=O)OR 2 , -OC(=O)OR 2 , -C(=O)R 2 , -OR 2 , -S(O) x R 2 , -S-SR 2 , -C(=O)SR 2 , -SC(=O)R 2 , -NR d C(=O)R 2 , -C(=O)NR e R f , -NR d C(=O)NR e R f , -OC(=O)NR e R f , -NR d C(=O)OR 2 , -SC(=S)R 2 , -C(=S)SR 2 , -C(=S)R 2 , -CH(OH)R 2 , -P(=O)(OR e )(OR f ), -(C 6 -C 10 Arylene)-R 2 , -(6 to 10 membered heteroarylene)-R 2 , or R 2 and R 1 and R 2 However, each independently, C 6 -C 24 Alkyl or C 6 -C 24 alkenyl, Ra , R b , R d , and R e However, each independently, H, C 1 -C 12 Alkyl, or C 2 -C 12 alkenyl, R c and R f However, each independently, C 1 -C 12 Alkyl or C 2 -C 12 alkenyl, G 4 But, bond, C 1 -C 23 Alkylene, C 2 -C 23 Alkenylene, C 3 -C 8 Cycloalkylene, or C 3 -C 8 is cycloalkenylene, R 3 But -N(R 4 )R 5 and R 4 But, C 1 -C 12 Alkyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, or C 6 -C 10 is aryl, R 5 But, C 1 -C 12 is alkyl, x is 0, 1, or 2; Each alkyl, alkenyl, cycloalkyl, cycloalkenyl, aryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, arylene, and cyclic moiety is independently optionally substituted.

[0094] In one embodiment, [ka] is a single bond. In one embodiment, [ka] is a double bond. In one embodiment, [ka] is a double bond and the compound has the (Z)-configuration. [ka] is a double bond and the compound has the (E)-configuration.

[0095] In one embodiment, provided herein is a compound of formula (III): [ka] or a pharma- ceutically acceptable salt, solvate or stereoisomer thereof.

[0096] In one embodiment, provided herein is a compound of formula (IV): [ka] or a pharma- ceutically acceptable salt, solvate or stereoisomer thereof.

[0097] In one embodiment, G 1 is a bond. In one embodiment, G 2 is a bond. In one embodiment, G 1 and G 2 are both bonds.

[0098] In one embodiment, G 1 and G 2 are each independently 2 -C 12 Alkylene, or C 2 -C 12 In one embodiment, G is an alkenylene.1 and G 2 is, independently of each other, C 2 -C 12 alkylene. In one embodiment, G 1 and G 2 is, independently of each other, C 2 -C 12 alkenylene. In one embodiment, G 1 and G 2 is, independently of each other, C 3 -C 7 alkylene. In one embodiment, G 1 and G 2 is, independently of each other, C 5 alkylene.

[0099] In one embodiment, G 1 is unsubstituted. In one embodiment, G 1 is substituted. In one embodiment, G 1 is substituted with -OH. In one embodiment, G 1 is substituted with (a second) L 1 (i.e., G 1 is connected to two L 1 ). In one embodiment, G 1 is substituted with -O-(C 6 -C 24 alkyl). In one embodiment, G 1 is substituted with -O-(C 6 -C 24 alkenyl). In one embodiment, G 1 is substituted with -C(=O)-(C 6 -C 24 alkyl). In one embodiment, G 1 is substituted with -C(=O)-(C 6 -C 24 alkenyl).

[0100] In one embodiment, G 2 is unsubstituted. In one embodiment, G 2 is substituted. In one embodiment, G 2 is substituted with -OH. In one embodiment, G2 is the (second) L 2 (i.e., G 2 There are two L 2 In one embodiment, G 2 is -O-(C 6 -C 24 In one embodiment, G is substituted with 2 is -O-(C 6 -C 24 alkenyl). In one embodiment, G 2 is -C(=O)-(C 6 -C 24 In one embodiment, G is substituted with 2 is -C(=O)-(C 6 -C 24 alkenyl).

[0101] In one embodiment, G 1 and / or G 2 In the alkylene or alkenylene, one or more -CH 2 - is optionally replaced by -O-. 1 and G 2 are each independently 5 -C 9 alkylene, wherein one or more -CH 2 - is optionally replaced by -O-. 1 and G 2 are each independently 5 -C 7 alkylene, wherein one or more -CH 2 - is optionally replaced by -O-. 1 and G 2 are both -CH 2 -CH 2 -O-CH 2 -CH 2 In one embodiment, G 1 and G 2 are both -CH 2 -CH 2-O-CH 2 -CH 2 -O-CH 2 -It is.

[0102] In one embodiment, the compound is a compound of formula (IA): [ka] A compound in which y and z are each independently an integer of 2 to 12. or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.

[0103] In one embodiment, the compound is a compound of formula (II-A): [ka] A compound in which y and z are each independently an integer of 2 to 12. or a pharma- ceutically acceptable salt, solvate or stereoisomer thereof.

[0104] In one embodiment, the compound is a compound of formula (III-A): [ka] A compound in which y and z are each independently an integer of 2 to 12. or a pharma- ceutically acceptable salt, solvate or stereoisomer thereof.

[0105] In one embodiment, the compound is a compound of formula (IV-A): [ka] A compound in which y and z are each independently an integer of 2 to 12. or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.

[0106] In one embodiment, y and z are each independently an integer from 2 to 10. In one embodiment, y and z are each independently an integer from 2 to 6. In one embodiment, y and z are each independently an integer from 4 to 10.

[0107] In one embodiment, y and z are different. In one embodiment, y and z are the same. In one embodiment, y and z are the same and are selected from 4, 5, 6, 7, 8, and 9. In one embodiment, y is 5 and z is 5.

[0108] In one embodiment, L 1 is -OC(=O)R 1 , -C(=O)OR 1 , -OC(=O)OR 1 , -C(=O)R 1 , -OR 1 , -S(O) x R 1 , -S-SR 1 , -C(=O)SR 1 , -SC(=O)R 1 , -NR a C(=O)R 1 , -C(=O)NR b R c , -NR a C(=O)NR b R c , -OC(=O)NR b R c , -NR a C(=O)OR 1 , -SC(=S)R 1 , -C(=S)SR 1 , -C(=S)R 1 , -CH(OH)R 1 , or -P(=O)(OR b )(OR c In one embodiment, L 1 is -(C 6 -C 10 Arylene)-R 1 In one embodiment, L 1 is -(6-10 membered heteroarylene)-R 1 In one embodiment, L 1 is R1 It is.

[0109] In one embodiment, L 1 is -OC(=O)R 1 , -C(=O)OR 1 , -C(=O)SR 1 , -SC(=O)R 1 , -NR a C(=O)R 1 or -C(=O)NR b R c In one embodiment, L 1 is -OC(=O)R 1 , -C(=O)OR 1 , -NR a C(=O)R 1 or -C(=O)NR b R c In one embodiment, L 1 is -OC(=O)R 1 In one embodiment, L 1 is -C(=O)OR 1 In one embodiment, L 1 -NR a C(=O)R 1 In one embodiment, L 1 is -C(=O)NR b R c In one embodiment, L 1 -NR a C(=O)NR b R c In one embodiment, L 1 is -OC(=O)NR b R c In one embodiment, L 1 -NR a C(=O)OR 1 It is.

[0110] In one embodiment, L 2 is -OC(=O)R 2 , -C(=O)OR 2 , -OC(=O)OR 2 , -C(=O)R 2 , -OR 2 , -S(O)x R 2 , -S-SR 2 , -C(=O)SR 2 , -SC(=O)R 2 , -NR d C(=O)R 2 , -C(=O)NR e R f , -NR d C(=O)NR e R f , -OC(=O)NR e R f , -NR d C(=O)OR 2 , -SC(=S)R 2 , -C(=S)SR 2 , -C(=S)R 2 , -CH(OH)R 2 , or -P(=O)(OR e )(OR f In one embodiment, L 2 is -(C 6 -C 10 Arylene)-R 2 In one embodiment, L 2 is -(6-10 membered heteroarylene)-R 2 In one embodiment, L 2 is R 2 It is.

[0111] In one embodiment, L 2 is -OC(=O)R 2 , -C(=O)OR 2 , -C(=O)SR 2 , -SC(=O)R 2 , -NR d C(=O)R 2 or -C(=O)NR e R f In one embodiment, L 2 is -OC(=O)R 2 , -C(=O)OR 2 , -NR d C(=O)R 2 or -C(=O)NR e R f In one embodiment, L 2is -OC(=O)R 2 In one embodiment, L 2 is -C(=O)OR 2 In one embodiment, L 2 -NR d C(=O)R 2 In one embodiment, L 2 is -C(=O)NR e R f In one embodiment, L 2 -NR d C(=O)NR e R f In one embodiment, L 2 is -OC(=O)NR e R f In one embodiment, L 2 -NR d C(=O)OR 2 It is.

[0112] In one embodiment, L 1 is -OC(=O)R 1 , -NR a C(=O)R 1 , -C(=O)OR 1 or -C(=O)NR b R c And L 2 is -OC(=O)R 2 , -NR d C(=O)R 2 , -C(=O)OR 2 or -C(=O)NR e R f In one embodiment, L 1 is -OC(=O)R 1 , -C(=O)OR 1 or -C(=O)NR b R c And L 2 is -OC(=O)R 2 , -C(=O)OR 2 or -C(=O)NR e R f In one embodiment, L 1 is -OC(=O)R 1 And L2 is -OC(=O)R 2 In one embodiment, L 1 is -OC(=O)R 1 And L 2 -NR d C(=O)R 2 In one embodiment, L 1 -NR a C(=O)R 1 And L 2 -NR d C(=O)R 2 In one embodiment, L 1 is -C(=O)OR 1 And L 2 is -C(=O)OR 2 In one embodiment, L 1 is -C(=O)OR 1 And L 2 is -C(=O)NR e R f In one embodiment, L 1 is -C(=O)NR b R c And L 2 is -C(=O)NR e R f It is.

[0113] In one embodiment, L 1 -NR a C(=O)NR b R c And L 2 -NR d C(=O)NR e R f In one embodiment, L 1 is -OC(=O)NR b R c And L 2 is -OC(=O)NR e R f In one embodiment, L 1 -NR a C(=O)OR 1 And L 2 -NR d C(=O)OR 2 It is.

[0114] In one embodiment, the compound is a compound of formula (IB), (I-B'), (IB"), (IC), (ID), or (IE): [ka] or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.

[0115] In one embodiment, the compound is a compound of formula (II-B), (II-B'), (II-B"), (II-C), (II-D), or (II-E): [ka] or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.

[0116] In one embodiment, the compound is a compound of formula (III-B), (III-B'), (III-B"), (III-C), (III-D), or (III-E): [ka] or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.

[0117] In one embodiment, the compound is a compound of formula (IV-B), (IV-B'), (IV-B"), (IV-C), (IV-D), or (IV-E): [ka] or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.

[0118] In one embodiment, the compound is of formula (IF), (I-F'), (IF"), (IG), (IH), or (II): [ka] A compound in which y and z are each independently an integer of 2 to 12. or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.

[0119] In one embodiment, the compound is of formula (II-F), (II-F'), (II-F"), (II-G), (II-H), or (II-I): [ka] A compound in which y and z are each independently an integer of 2 to 12. or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.

[0120] In one embodiment, the compound is of formula (III-F), (III-F'), (III-F"), (III-G), (III-H), or (III-I): [ka] In the formula, y and z are each independently an integer of 2 to 12, or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.

[0121] In one embodiment, the compound is of formula (IV-F), (IV-F'), (IV-F"), (IV-G), (IV-H), or (IV-I), [ka] A compound in which y and z are each independently an integer of 2 to 12. or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.

[0122] In one embodiment, y and z are each independently an integer from 2 to 10. In one embodiment, y and z are each independently an integer from 2 to 6. In one embodiment, y and z are each independently an integer from 4 to 10.

[0123] In one embodiment, y and z are different. In one embodiment, y and z are the same. In one embodiment, y and z are the same and are selected from 4, 5, 6, 7, 8, and 9. In one embodiment, y is 5 and z is 5.

[0124] In one embodiment, G 3 is C 2 -C 24 In one embodiment, G is an alkylene. 3 is C 2 -C 12 In one embodiment, G is an alkylene. 3 is C 2 -C 8 In one embodiment, G is an alkylene. 3 is C 2 -C 6 In one embodiment, G is an alkylene. 3 is C 2 -C 4 In one embodiment, G is an alkylene. 3 is C 2 In one embodiment, G is an alkylene. 3 is C 4 It is alkylene.

[0125] In one embodiment, G 3 is substituted with one or more oxo. 3 is -(C 1 -C 23 In one embodiment, G is an alkylene-C(=O)-. 3 is -(C 1 -C 11 In one embodiment, G is an alkylene-C(=O)-. 3 is -(C 1 -C 7 In one embodiment, G is an alkylene-C(=O)-. 3is -(C 1 -C 5 In one embodiment, G is an alkylene-C(=O)-. 3 is -(C 1 -C 3 In one embodiment, G is an alkylene-C(=O)-. 3 -CH 2 In one embodiment, G 3 -CH 2 -CH 2 -CH 2 In one embodiment, the -C(=O)- is connected to a nitrogen atom and the alkylene is R 3 is connected to.

[0126] In one embodiment, the compound is of formula (IJ), (I-J'), (IJ"), (IK), (IL), or (IM), [ka] In the formula, y and z each independently represent an integer of 2 to 12, A compound in which s is an integer from 2 to 24; or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.

[0127] In one embodiment, y and z are each independently an integer from 2 to 10. In one embodiment, y and z are each independently an integer from 2 to 6. In one embodiment, y and z are each independently an integer from 4 to 10.

[0128] In one embodiment, y and z are different. In one embodiment, y and z are the same. In one embodiment, y and z are the same and are selected from 4, 5, 6, 7, 8, and 9. In one embodiment, y is 5 and z is 5.

[0129] In one embodiment, s is an integer from 2 to 12. In one embodiment, s is an integer from 2 to 8. In one embodiment, s is an integer from 2 to 6. In one embodiment, s is an integer from 2 to 4. In one embodiment, s is 2. In one embodiment, s is 4.

[0130] In one embodiment, y is 5, z is 5 and s is 2.

[0131] In one embodiment, y is 5, z is 5 and s is 4.

[0132] In one embodiment, G 3 is C 2 -C 24 In one embodiment, G is an alkenylene. 3 is C 2 -C 12 In one embodiment, G is an alkenylene. 3 is C 2 -C 8 In one embodiment, G is an alkenylene. 3 is C 2 -C 6 In one embodiment, G is an alkenylene. 3 is C 2 -C 4 It is alkenylene.

[0133] In one embodiment, G 3 is C 3 -C 8 In one embodiment, G is a cycloalkylene. 3 is C 5 -C 6 It is a cycloalkylene.

[0134] In one embodiment, G 3 is C 3 -C 8 In one embodiment, G is cycloalkenylene. 3 is C 5 -C 6 It is a cycloalkenylene.

[0135] In one embodiment, G4 is a bond.

[0136] In one embodiment, G 4 is C 1 -C 23 In one embodiment, G is an alkylene. 4 is C 1 -C 11 In one embodiment, G is an alkylene. 4 is C 1 -C 7 In one embodiment, G is an alkylene. 4 is C 1 -C 5 In one embodiment, G is an alkylene. 4 is C 1 -C 3 In one embodiment, G is an alkylene. 4 is C 1 In one embodiment, G is an alkylene. 4 is C 2 In one embodiment, G is an alkylene. 4 is C 3 In one embodiment, G is an alkylene. 4 is C 4 It is alkylene.

[0137] In one embodiment, the compound is of formula (II-J), (II-J'), (II-J"), (II-K), (II-L), or (II-M): [ka] In the formula, y and z each independently represent an integer of 2 to 12, A compound in which u is an integer from 0 to 23. or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.

[0138] In one embodiment, the compound is of formula (III-J), (III-J'), (III-J"), (III-K), (III-L), or (III-M): [ka] In the formula, y and z each independently represent an integer of 2 to 12, A compound in which u is an integer from 0 to 23. or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.

[0139] In one embodiment, the compound is of formula (IV-J), (IV-J'), (IV-J"), (IV-K), (IV-L), or (IV-M), [ka] In the formula, y and z each independently represent an integer of 2 to 12, A compound in which u is an integer from 0 to 23. or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.

[0140] In one embodiment, y and z are each independently an integer from 2 to 10. In one embodiment, y and z are each independently an integer from 2 to 6. In one embodiment, y and z are each independently an integer from 4 to 10.

[0141] In one embodiment, y and z are different. In one embodiment, y and z are the same. In one embodiment, y and z are the same and are selected from 4, 5, 6, 7, 8, and 9. In one embodiment, y is 5 and z is 5.

[0142] In one embodiment, u is an integer from 0 to 12. In one embodiment, u is an integer from 0 to 8. In one embodiment, u is an integer from 0 to 6. In one embodiment, u is an integer from 0 to 4. In one embodiment, u is 0. In one embodiment, u is 1. In one embodiment, u is 2. In one embodiment, u is 3. In one embodiment, u is 4.

[0143] In one embodiment, y is 5, z is 5 and u is 0.

[0144] In one embodiment, y is 5, z is 5 and u is 2.

[0145] In one embodiment, G 4 is C 2 -C 23 In one embodiment, G is an alkenylene. 4 is C 2 -C 12 In one embodiment, G is an alkenylene. 4 is C 2 -C 8 In one embodiment, G is an alkenylene. 4 is C 2 -C 6 In one embodiment, G is an alkenylene. 4 is C 2 -C 4 It is alkenylene.

[0146] In one embodiment, G 4 is C 3 -C 8 In one embodiment, G is a cycloalkylene. 4 is C 5 -C 6 It is a cycloalkylene.

[0147] In one embodiment, G 4 is C 3 -C 8 In one embodiment, G is cycloalkenylene. 4 is C 5 -C 6 It is a cycloalkenylene.

[0148] In one embodiment, R 5 is C 1 -C 12 In one embodiment, R 5 is C 1 -C 10 In one embodiment, R 5 is C 1 -C 8 In one embodiment, R 5 is C 1 -C6 In one embodiment, R 5 is C 1 -C 4 In one embodiment, R 5 is C 1 -C 2 In one embodiment, R 5 is methyl. In one embodiment, R 5 is ethyl. In one embodiment, R 5 is propyl. In one embodiment, R 5 is n-butyl. In one embodiment, R 5 is n-hexyl. In one embodiment, R 5 is n-octyl. In one embodiment, R 5 is n-nonyl.

[0149] In one embodiment, R 5 is C 3 -C 8 In one embodiment, R 5 is cyclopropyl. In one embodiment, R 5 is cyclobutyl. In one embodiment, R 5 is cyclopentyl. In one embodiment, R 5 is cyclohexyl. In one embodiment, R 5 is cycloheptyl. In one embodiment, R 5 is cyclooctyl.

[0150] In one embodiment, R 4 , R 5 together with the nitrogen to which they are attached form a cyclic moiety.

[0151] In one embodiment, the cyclic moiety (R 4 and R 5(formed together with the nitrogen to which they are attached by) is heterocyclyl. In one embodiment, the cyclic moiety is a heterocycloalkyl. In one embodiment, the cyclic moiety is a 4- to 8-membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 4-membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 5-membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 6-membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 7-membered heterocycloalkyl. In one embodiment, the cyclic moiety is an 8-membered heterocycloalkyl.

[0152] In one embodiment, the cyclic moiety (R 4 and R 5 (formed together with the nitrogen to which they are attached by) is azetidin-1-yl. In one embodiment, the cyclic moiety is pyrrolidin-1-yl. In one embodiment, the cyclic moiety is piperidin-1-yl. In one embodiment, the cyclic moiety is azepan-1-yl. In one embodiment, the cyclic moiety is azocan-1-yl. In one embodiment, the cyclic moiety is morpholinyl. In one embodiment, the cyclic moiety is piperazin-1-yl. The points of attachment in these groups are G 3 In contrast to.

[0153] As described herein, unless otherwise specified, R 5 The substitution pattern for 4 and R 5 also applies to the cyclic moiety formed by taking together with the nitrogen to which they are attached.

[0154] In one embodiment, R 5 is non-substituted.

[0155] In one embodiment, R 5 is oxo, -OR g , -NR g C(=O)R h , -C(=O)NR g R h , -C(=O)R h , -OC(=O)R h, -C(=O)OR h -OR i -OH; R g is, independently for each occurrence, H or C 1 -C 6 is alkyl, R h independently for each occurrence, C 1 -C 6 is alkyl, R i independently for each occurrence, C 1 -C 6 It is alkylene.

[0156] In one embodiment, R 5 is substituted with one or more hydroxyls. In one embodiment, R 5 is substituted with one hydroxyl.

[0157] In one embodiment, R 5 is substituted with one or more hydroxyl and one or more oxo. In one embodiment, R 5 is substituted with one hydroxyl and one oxo. In one embodiment, R 5 -CH 2 CH 2 It is OH.

[0158] In one embodiment, R 5 is -(CH 2 ) p Q, -(CH 2 ) p CHQR, -CHQR, or -CQ(R) 2 and Q is C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 3 -C 8 Cycloalkynyl, 4-8 membered heterocyclyl, C 6 -C 10 Aryl, 5-10 membered heteroaryl, -OR, -O(CH 2 )p N(R) 2 、 -C(O)OR, -OC(O)R, -CX 3 、 -CX 2 H, -CXH 2 、 -CN, -N(R) 2 、 -C(O)N(R) 2 、 -N(R)C(O)R, -N(R)S(O) 2 R, -N(R)C(O)N(R) 2 、 -N(R)C(S)N(R) 2 、 -N(R)R 22 、 -O(CH 2 ) p OR, -N(R)C(=NR 23 )N(R) 2 、 -N(R)C(=CHR 23 )N(R) 2 、 -OC(O)N(R) 2 、 -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O) 2 R, -N(OR)C(O)OR, -N(OR)C(O)N(R) 2 、 -N(OR)C(S)N(R) 2 、 -N(OR)C(=NR 23 )N(R) 2 、 -N(OR)C(=CHR 23 )N(R) 2 、 -C(=NR 23 )N(R) 2 、 -C(=NR 23 )R, -C(O)N(R)OR, or -C(R)N(R) 2 C(O)OR, where each p is independently 1, 2, 3, 4, or 5, R 22 is C 3 -C 8 cycloalkyl, C 3 -C 8 cycloalkenyl, C 3 -C 8 cycloalkynyl, 4 - to 8 - membered heterocyclyl, C 6 -C 10 aryl, or 5 - to 10 - membered heteroaryl, R 23 is H, -CN, -NO 2 、 C1 -C 6 Alkyl, -OR, -S(O) 2 R, -S(O) 2 N(R) 2 , C 2 -C 6 Alkenyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 3 -C 8 Cycloalkynyl, 4-8 membered heterocyclyl, C 6 -C 10 aryl, or 5-10 membered heteroaryl; Each R is independently H, C 1 -C 3 Alkyl or C 2 -C 3 alkenyl or N(R) 2 two R's in the moiety together with the nitrogen to which they are attached form a cyclic moiety, Each X is independently F, CI, Br, or I.

[0159] In one embodiment, the compound is of formula (IN), (I-N'), (IN"), (IO), (IP), or (IQ), [ka] In the formula, y and z each independently represent an integer of 2 to 12, s is an integer from 2 to 24; t is an integer from 1 to 12; R 6 is hydrogen or hydroxyl, or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.

[0160] In one embodiment, the compound is of formula (II-N), (II-N'), (II-N"), (II-O), (II-P), or (II-Q), [ka] In the formula, y and z each independently represent an integer of 2 to 12, u is an integer from 0 to 23; t is an integer from 1 to 12; R 6 is hydrogen or hydroxyl, or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.

[0161] In one embodiment, the compound is of formula (III-N), (III-N'), (III-N"), (III-O), (III-P), or (III-Q): [ka] In the formula, y and z each independently represent an integer of 2 to 12, u is an integer from 0 to 23; t is an integer from 1 to 12; R 6 is hydrogen or hydroxyl, or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.

[0162] In one embodiment, the compound is of formula (IV-N), (IV-N'), (IV-N"), (IV-O), (IV-P), or (IV-Q), [ka] In the formula, y and z each independently represent an integer of 2 to 12, u is an integer from 0 to 23; t is an integer from 1 to 12; R 6 is hydrogen or hydroxyl, or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.

[0163] In one embodiment, the compound is of formula (IR), (I-R'), (IR"), (IS), (IT), or (IU): [ka] In the formula, y and z each independently represent an integer of 2 to 12, s is an integer from 2 to 24; t is an integer from 1 to 12; R 6 is hydrogen or hydroxyl, or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.

[0164] In one embodiment, the compound is of formula (II-R), (II-R'), (II-R"), (II-S), (II-T), or (II-U): [ka] In the formula, y and z each independently represent an integer of 2 to 12, u is an integer from 0 to 23; t is an integer from 1 to 12; R 6 is hydrogen or hydroxyl, or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.

[0165] In one embodiment, the compound is of formula (III-R), (III-R'), (III-R"), (III-S), (III-T), or (III-U): [ka] In the formula, y and z each independently represent an integer of 2 to 12, u is an integer from 0 to 23; t is an integer from 1 to 12; R 6 is hydrogen or hydroxyl, or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.

[0166] In one embodiment, the compound is of formula (IV-R), (IV-R'), (IV-R"), (IV-S), (IV-T), or (IV-U), [ka] In the formula, y and z each independently represent an integer of 2 to 12, u is an integer from 0 to 23; t is an integer from 1 to 12; R 6 is hydrogen or hydroxyl, or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.

[0167] In one embodiment, y and z are each independently an integer from 2 to 10. In one embodiment, y and z are each independently an integer from 2 to 6. In one embodiment, y and z are each independently an integer from 4 to 10.

[0168] In one embodiment, y and z are different. In one embodiment, y and z are the same. In one embodiment, y and z are the same and are selected from 4, 5, 6, 7, 8, and 9. In one embodiment, y is 5 and z is 5.

[0169] In one embodiment, s is an integer from 2 to 12. In one embodiment, s is an integer from 2 to 8. In one embodiment, s is an integer from 2 to 6. In one embodiment, s is an integer from 2 to 4. In one embodiment, s is 2. In one embodiment, s is 4.

[0170] In one embodiment, y is 5, z is 5 and s is 2.

[0171] In one embodiment, y is 5, z is 5 and s is 4.

[0172] In one embodiment, u is an integer from 0 to 12. In one embodiment, u is an integer from 0 to 8. In one embodiment, u is an integer from 0 to 6. In one embodiment, u is an integer from 0 to 4. In one embodiment, u is 0. In one embodiment, u is 1. In one embodiment, u is 2. In one embodiment, u is 3. In one embodiment, u is 4.

[0173] In one embodiment, y is 5, z is 5 and u is 0.

[0174] In one embodiment, y is 5, z is 5 and u is 2.

[0175] In one embodiment, t is an integer from 1 to 10. In one embodiment, t is an integer from 1 to 8. In one embodiment, t is an integer from 1 to 6. In one embodiment, t is an integer from 1 to 4. In one embodiment, t is an integer from 1 to 3. In one embodiment, t is an integer from 1 to 2. In one embodiment, t is 1. In one embodiment, t is 2. In one embodiment, t is 3. In one embodiment, t is 4. In one embodiment, t is 5. In one embodiment, t is 6. In one embodiment, t is 7.

[0176] In one embodiment, R 4 is C 1 -C 12 In one embodiment, R 4 is C 1 -C 8 In one embodiment, R 4 is C 1 -C 6 In one embodiment, R 4 is C 1 -C 4 In one embodiment, R 4 is methyl. In one embodiment, R 4 is ethyl. In one embodiment, R 4 is n-propyl. In one embodiment, R 4is n-butyl. In one embodiment, R 4 is n-pentyl. In one embodiment, R 4 is n-hexyl. In one embodiment, R 4 is n-octyl. In one embodiment, R 4 is n-nonyl.

[0177] In one embodiment, R 4 is C 3 -C 8 In one embodiment, R 4 is cyclopropyl. In one embodiment, R 4 is cyclobutyl. In one embodiment, R 4 is cyclopentyl. In one embodiment, R 4 is cyclohexyl. In one embodiment, R 4 is cycloheptyl. In one embodiment, R 4 is cyclooctyl.

[0178] In one embodiment, R 4 is C 3 -C 8 In one embodiment, R 4 is cyclopropenyl. In one embodiment, R 4 is cyclobutenyl. In one embodiment, R 4 is cyclopentenyl. In one embodiment, R 4 is cyclohexenyl. In one embodiment, R 4 is cycloheptenyl. In one embodiment, R 4 is cyclooctenyl.

[0179] In one embodiment, R 4 is C 6 -C 10 In one embodiment, R 4 is phenyl.

[0180] In one embodiment, R 4 is 4-8 membered heterocyclyl. In one embodiment, R4 is 4-8 membered heterocycloalkyl. In one embodiment, R 4 is oxetanyl. In one embodiment, R 4 is tetrahydrofuranyl. In one embodiment, R 4 is tetrahydropyranyl. In one embodiment, R 4 is tetrahydrothiopyranyl. In one embodiment, R 4 is N-methylpiperidinyl.

[0181] In one embodiment, R 4 , G 3 , or G 3 Some of the following, taken together with the nitrogen to which they are attached, form a cyclic moiety.

[0182] In one embodiment, the cyclic moiety (R 4 , G 3 or G 3 (formed by a portion of, together with the nitrogen to which they are attached) is heterocyclyl. In one embodiment, the cyclic moiety is a heterocycloalkyl. In one embodiment, the cyclic moiety is a 4-8 membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 4 membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 5 membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 6 membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 7 membered heterocycloalkyl. In one embodiment, the cyclic moiety is an 8 membered heterocycloalkyl.

[0183] In one embodiment, the cyclic moiety (R 4 , G 3 or G 3 (formed by a portion of, together with the nitrogen to which they are attached) is azetidin-3-yl. In one embodiment, the cyclic moiety is pyrrolidin-3-yl. In one embodiment, the cyclic moiety is piperidin-4-yl. In one embodiment, the cyclic moiety is azepan-4-yl. In one embodiment, the cyclic moiety is azocan-5-yl. The points of attachment of these groups are G 1 and G 2This is the direction of the nitrogen connected to the

[0184] As described herein, unless otherwise specified, R 4 The substitution pattern for 4 , G 3 , or G 3 also applies to the cyclic moiety formed by some of the radicals together with the nitrogen to which they are attached.

[0185] In one embodiment, R 4 is non-substituted.

[0186] In one embodiment, R 4 is oxo, -OR g , -NR g C(=O)R h , -C(=O)NR g R h , -C(=O)R h , -OC(=O)R h , -C(=O)OR h -OR i -OH; R g is, independently for each occurrence, H or C 1 -C 6 is alkyl, R h independently for each occurrence, C 1 -C 6 is alkyl, R i independently for each occurrence, C 1 -C 6 It is alkylene.

[0187] In one embodiment, R 4 is substituted with one or more hydroxyls. In one embodiment, R 4 is substituted with one hydroxyl.

[0188] In one embodiment, R 4 is substituted with one or more hydroxyl and one or more oxo. In one embodiment, R4 is substituted with one hydroxyl and one oxo.

[0189] In one embodiment, R 3 has one of the following structures: [ka]

[0190] In one embodiment, R 3 teeth, [ka] It has the structure:

[0191] In one embodiment, R 3 teeth, [ka] It has the structure:

[0192] In one embodiment, R 1 and R 2 each independently represents a branch C 6 -C 32 Alkyl or branched C 6 -C 32 In one embodiment, R is an alkenyl. 1 and R 2 each independently represents a branch C 6 -C 24 Alkyl or branched C 6 -C 24 It is alkenyl.

[0193] In one embodiment, R 1 and R 2 are each independently -R 7 -CH(R 8 )(R 9 ) and R 7 But, C 1 -C 5 alkylene, R 8 and R 9 But independently, C 2 -C10 Alkyl or C 2 -C 10 It is alkenyl.

[0194] In one embodiment, R 1 is a linear C 6 -C 32 In one embodiment, R 1 is a linear C 6 -C 24 In one embodiment, R 1 is a linear C 7 -C 15 In one embodiment, R 1 is a linear C 7 In one embodiment, R 1 is a linear C 8 In one embodiment, R 1 is a linear C 9 In one embodiment, R 1 is a linear C 10 In one embodiment, R 1 is a linear C 11 In one embodiment, R 1 is a linear C 12 In one embodiment, R 1 is a linear C 13 In one embodiment, R 1 is a linear C 14 In one embodiment, R 1 is a linear C 15 It is an alkyl.

[0195] In one embodiment, R 1 is a linear C 6 -C 32 In one embodiment, R is an alkenyl. 1 is a linear C 6 -C 24 In one embodiment, R is an alkenyl. 1 is a linear C 7 -C 17 In one embodiment, R is an alkenyl. 1 is a linear C 7In one embodiment, R is an alkenyl. 1 is a linear C 8 In one embodiment, R is an alkenyl. 1 is a linear C 9 In one embodiment, R is an alkenyl. 1 is a linear C 10 In one embodiment, R is an alkenyl. 1 is a linear C 11 In one embodiment, R is an alkenyl. 1 is a linear C 12 In one embodiment, R is an alkenyl. 1 is a linear C 13 In one embodiment, R is an alkenyl. 1 is a linear C 14 In one embodiment, R is an alkenyl. 1 is a linear C 15 In one embodiment, R is an alkenyl. 1 is a linear C 16 In one embodiment, R is an alkenyl. 1 is a linear C 17 It is alkenyl.

[0196] In one embodiment, R 1 is branch C 6 -C 32 In one embodiment, R 1 is branch C 6 -C 24 In one embodiment, R 1 -R 7 -CH(R 8 )(R 9 ) and R 7 is C 0 -C 5 alkylene, R 8 and R 9 is independently 2 -C 10 In one embodiment, R 1 -R 7 -CH(R 8 )(R 9 ) and R 7 is C 0 -C 1alkylene, R 8 and R 9 is independently 4 -C 8 It is an alkyl.

[0197] In one embodiment, R 1 is branch C 6 -C 32 In one embodiment, R is an alkenyl. 1 is branch C 6 -C 24 In one embodiment, R is an alkenyl. 1 -R 7 -CH(R 8 )(R 9 ) and R 7 is C 0 -C 5 alkylene, R 8 and R 9 is independently 2 -C 10 In one embodiment, R is an alkenyl. 1 -R 7 -CH(R 8 )(R 9 ) and R 7 is C 0 -C 1 alkylene, R 8 and R 9 is independently 6 -C 10 It is alkenyl.

[0198] In one embodiment, R 2 is a linear C 6 -C 32 In one embodiment, R 2 is a linear C 6 -C 24 In one embodiment, R 2 is a linear C 7 -C 15 In one embodiment, R 2 is a linear C 7 In one embodiment, R 2 is a linear C 8 In one embodiment, R2 is a linear C 9 In one embodiment, R 2 is a linear C 10 In one embodiment, R 2 is a linear C 11 In one embodiment, R 2 is a linear C 12 In one embodiment, R 2 is a linear C 13 In one embodiment, R 2 is a linear C 14 In one embodiment, R 2 is a linear C 15 It is an alkyl.

[0199] In one embodiment, R 2 is a linear C 6 -C 32 In one embodiment, R is an alkenyl. 2 is a linear C 6 -C 24 In one embodiment, R is an alkenyl. 2 is a linear C 7 -C 17 In one embodiment, R is an alkenyl. 2 is a linear C 7 In one embodiment, R is an alkenyl. 2 is a linear C 8 In one embodiment, R is an alkenyl. 2 is a linear C 9 In one embodiment, R is an alkenyl. 2 is a linear C 10 In one embodiment, R is an alkenyl. 2 is a linear C 11 In one embodiment, R is an alkenyl. 2 is a linear C 12 In one embodiment, R is an alkenyl. 2 is a linear C 13 In one embodiment, R is an alkenyl. 2 is a linear C 14 In one embodiment, R is an alkenyl. 2 is a linear C 15In one embodiment, R is an alkenyl. 2 is a linear C 16 In one embodiment, R is an alkenyl. 2 is a linear C 17 It is alkenyl.

[0200] In one embodiment, R 2 is branch C 6 -C 32 In one embodiment, R 2 is branch C 6 -C 24 In one embodiment, R 2 -R 7 -CH(R 8 )(R 9 ) and R 7 is C 0 -C 5 alkylene, R 8 and R 9 is independently 2 -C 10 In one embodiment, R 2 -R 7 -CH(R 8 )(R 9 ) and R 7 is C 0 -C 1 alkylene, R 8 and R 9 is independently 4 -C 8 It is an alkyl.

[0201] In one embodiment, R 2 is branch C 6 -C 32 In one embodiment, R is an alkenyl. 2 is branch C 6 -C 24 In one embodiment, R is an alkenyl. 2 -R 7 -CH(R 8 )(R 9 ) and R 7 is C 0 -C 5 alkylene, R 8 and R9 is independently 2 -C 10 In one embodiment, R is an alkenyl. 2 -R 7 -CH(R 8 )(R 9 ) and R 7 is C 0 -C 1 alkylene, R 8 and R 9 is independently 6 -C 10 It is alkenyl.

[0202] In one embodiment, R c is a linear C 6 -C 32 In one embodiment, R c is a linear C 6 -C 24 In one embodiment, R c is a linear C 7 -C 15 In one embodiment, R c is a linear C 7 In one embodiment, R c is a linear C 8 In one embodiment, R c is a linear C 9 In one embodiment, R c is a linear C 10 In one embodiment, R c is a linear C 11 In one embodiment, R c is a linear C 12 In one embodiment, R c is a linear C 13 In one embodiment, R c is a linear C 14 In one embodiment, R c is a linear C 15 It is an alkyl.

[0203] In one embodiment, R c is a linear C 6-C 32 In one embodiment, R is an alkenyl. c is a linear C 6 -C 24 In one embodiment, R is an alkenyl. c is a linear C 7 -C 17 In one embodiment, R is an alkenyl. c is a linear C 7 In one embodiment, R is an alkenyl. c is a linear C 8 In one embodiment, R is an alkenyl. c is a linear C 9 In one embodiment, R is an alkenyl. c is a linear C 10 In one embodiment, R is an alkenyl. c is a linear C 11 In one embodiment, R is an alkenyl. c is a linear C 12 In one embodiment, R is an alkenyl. c is a linear C 13 In one embodiment, R is an alkenyl. c is a linear C 14 In one embodiment, R is an alkenyl. c is a linear C 15 In one embodiment, R is an alkenyl. c is a linear C 16 In one embodiment, R is an alkenyl. c is a linear C 17 It is alkenyl.

[0204] In one embodiment, R c is branch C 6 -C 32 In one embodiment, R c is branch C 6 -C 24 In one embodiment, R c -R 7 -CH(R 8 )(R 9 ) and R 7 is C 0 -C 5 alkylene, R 8and R 9 is independently 2 -C 10 In one embodiment, R c -R 7 -CH(R 8 )(R 9 ) and R 7 is C 0 -C 1 alkylene, R 8 and R 9 is independently 4 -C 8 It is an alkyl.

[0205] In one embodiment, R c is branch C 6 -C 32 In one embodiment, R is an alkenyl. c is branch C 6 -C 24 In one embodiment, R is an alkenyl. c -R 7 -CH(R 8 )(R 9 ) and R 7 is C 0 -C 5 alkylene, R 8 and R 9 is independently 2 -C 10 In one embodiment, R is an alkenyl. c -R 7 -CH(R 8 )(R 9 ) and R 7 is C 0 -C 1 alkylene, R 8 and R 9 is independently 6 -C 10 It is alkenyl.

[0206] In one embodiment, R f is a linear C 6 -C 32 In one embodiment, R f is a linear C 6 -C24 In one embodiment, R f is a linear C 7 -C 15 In one embodiment, R f is a linear C 7 In one embodiment, R f is a linear C 8 In one embodiment, R f is a linear C 9 In one embodiment, R f is a linear C 10 In one embodiment, R f is a linear C 11 In one embodiment, R f is a linear C 12 In one embodiment, R f is a linear C 13 In one embodiment, R f is a linear C 14 In one embodiment, R f is a linear C 15 It is an alkyl.

[0207] In one embodiment, R f is a linear C 6 -C 32 alkenyl. In one embodiment, R f is a linear C 6 -C 24 alkenyl. In one embodiment, R f is a linear C 7 -C 17 alkenyl. In one embodiment, R f is a linear C 7 alkenyl. In one embodiment, R f is a linear C 8 alkenyl. In one embodiment, R f is a linear C 9 alkenyl. In one embodiment, R f is a linear C 10 alkenyl. In one embodiment, R f is a linear C 11 alkenyl. In one embodiment, Rf is a linear C 12 alkenyl. In one embodiment, R f is a linear C 13 alkenyl. In one embodiment, R f is a linear C 14 alkenyl. In one embodiment, R f is a linear C 15 alkenyl. In one embodiment, R f is a linear C 16 alkenyl. In one embodiment, R f is a linear C 17 alkenyl.

[0208] In one embodiment, R f is a branched C 6 -C 32 alkyl. In one embodiment, R f is a branched C 6 -C 24 alkyl. In one embodiment, R f is -R 7 -CH(R 8 )(R 9 ), where R 7 is C 0 -C 5 alkylene, and R 8 and R 9 are independently C 2 -C 10 alkyl. In one embodiment, R f is -R 7 -CH(R 8 )(R 9 ), where R 7 is C 0 -C 1 alkylene, and R 8 and R 9 are independently C 4 -C 8 alkyl.

[0209] In one embodiment, R f is a branched C 6 -C 32 alkenyl. In one embodiment, R f is a branched C 6-C 24 In one embodiment, R is an alkenyl. f -R 7 -CH(R 8 )(R 9 ) and R 7 is C 0 -C 5 alkylene, R 8 and R 9 is independently 2 -C 10 In one embodiment, R is an alkenyl. f -R 7 -CH(R 8 )(R 9 ) and R 7 is C 0 -C 1 alkylene, R 8 and R 9 is independently 6 -C 10 It is alkenyl.

[0210] In one embodiment, R 1 , R 2 , R c , and R f are each independently a linear C 6 -C 18 Alkyl, linear C 6 -C 18 Alkenyl, or -R 7 -CH(R 8 )(R 9 ) and R 7 is C 0 -C 5 alkylene, R 8 and R 9 is independently 2 -C 10 Alkyl or C 2 -C 10 It is alkenyl.

[0211] In one embodiment, R 1 , R 2 , R c , and R f are each independently a linear C 7 -C 15Alkyl, linear C 7 -C 15 Alkenyl, or -R 7 -CH(R 8 )(R 9 ) and R 7 is C 0 -C 1 alkylene, R 8 and R 9 is independently 4 -C 8 Alkyl or C 6 -C 10 It is alkenyl.

[0212] In one embodiment, R 1 , R 2 , R c , and R f is each independently one of the following structures: [ka]

[0213] In one embodiment, R 1 , R 2 , R c , and R f are each independently optionally substituted. In one embodiment, the optional substituents are -O-(C 6 -C 24 In one embodiment, the optional substituent is -O-(C 6 -C 24 In one embodiment, the optional substituent is -C(=O)-(C alkenyl). 6 -C 24 In one embodiment, the optional substituent is -C(=O)-(C alkyl). 6 -C 24 alkenyl).

[0214] In one embodiment, R a and R d are each independently H. In one embodiment, R a , R b , R d , and Re are each independently H. In one embodiment, R a and R d are each independently 1 -C 24 In one embodiment, R a and R d are each independently 1 -C 18 In one embodiment, R a and R d are each independently 1 -C 12 In one embodiment, R a and R d are each independently 1 -C 6 It is an alkyl.

[0215] In one embodiment, R b , R c , R e , and R f are each independently n-hexyl or n-octyl.

[0216] In one embodiment, R c and R f each independently represents a branch C 6 -C 24 Alkyl or branched C 6 -C 24 alkenyl. In one embodiment, R c and R f are each independently -R 7 -CH(R 8 )(R 9 ) and R 7 But, C 1 -C 5 alkylene, R 8 and R 9 But independently, C 2 -C 10 Alkyl or C 2 -C 10 It is alkenyl.

[0217] In one embodiment, the compound is a compound of Table 1, or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7] [Table 1-8] [Table 1-9] [Table 1-10] [Table 1-11] [Table 1-12]

[0218] Any embodiment of the compounds provided in the above specification, as well as any specific substituent and / or variable in the compounds provided in the above specification, can independently combine with the substituents and / or variables of other embodiments and / or compounds to form embodiments not specifically described above. It is understood that in addition, when a list of substituents and / or variables is enumerated for any specific group or variable, each individual substituent and / or variable can be deleted from a specific embodiment and / or claim, and the remaining list of substituents and / or variables will be considered to be within the scope of the embodiments provided in this specification.

[0219] It should be understood that in this specification, combinations of substituents and / or variables of the indicated formulas are only permitted when such contributions result in stable compounds.

[0220] 5.4 Nanoparticle Compositions In one aspect, described herein are nanoparticle compositions comprising the lipid compounds described herein. In certain embodiments, the nanoparticle compositions comprise compounds of formulas (I)-(IV) (and sub-formulas thereof) described herein.

[0221] In some embodiments, the maximum dimension of the nanoparticle compositions provided herein is 1 μm or less (e.g., ≤ 1 μm, ≤ 900 nm, ≤ 800 nm, ≤ 700 nm, ≤ 600 nm, ≤ 500 nm, ≤ 400 nm, ≤ 300 nm, ≤ 200 nm, ≤ 175 nm, ≤ 150 nm, ≤ 125 nm, ≤ 100 nm, ≤ 75 nm, ≤ 50 nm, or less) when measured by dynamic light scattering (DLS), transmission electron microscopy, scanning electron microscopy, or another method. In one embodiment, the lipid nanoparticles provided herein have at least one dimension in the range of about 40 to about 200 nm. In one embodiment, at least one dimension is in the range of about 40 to about 100 nm.

[0222] Nanoparticle compositions that may be used in connection with the present disclosure include, for example, lipid nanoparticles (LNPs), nanolipoprotein particles, liposomes, lipid vesicles, and lipoplexes. In some embodiments, the nanoparticle composition is a vesicle that includes one or more lipid bilayers. In some embodiments, the nanoparticle composition includes two or more concentric bilayers separated by aqueous compartments. The lipid bilayers may be functionalized and / or cross-linked to each other. The lipid bilayers may include one or more ligands, proteins, or channels.

[0223] The properties of a nanoparticle composition may depend on its components. For example, a nanoparticle composition that contains cholesterol as a structural lipid may have different properties from a nanoparticle composition that contains a different structural lipid. Similarly, the properties of a nanoparticle composition may depend on the absolute or relative amounts of its components. For example, a nanoparticle composition that contains a higher molar fraction of phospholipids may have different properties from a nanoparticle composition that contains a lower molar fraction of phospholipids. The properties may also differ depending on the preparation method and conditions of the nanoparticle composition.

[0224] Nanoparticle compositions can be characterized by various methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of nanoparticle compositions. Dynamic light scattering or potentiometry (e.g., potentiometric titration) can be used to measure zeta potential. Dynamic light scattering can also be used to determine particle size. Instruments such as Zetasizer Nano ZS (Malvem Instruments Ltd, Malvem, and Worcestershire, UK) can also be used to measure several properties of nanoparticle compositions, such as particle size, polydispersity index, and zeta potential.

[0225] Dh (size): The average size of the nanoparticle composition can be tens of nm to hundreds of nm. For example, the average size can be about 40 nm to about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In some embodiments, the average size of the nanoparticle composition can be about 50 nm to about 100 nm, about 50 nm to about 90 nm, about 50 nm to about 80 nm, about 50 nm to about 70 nm, about 50 nm to about 60 nm, about 60 nm to about 100 nm, about 60 nm to about 90 nm, about 60 nm to about 80 nm, about 60 nm to about 70 nm, about 70 nm to about 100 nm, about 70 nm to about 90 nm, about 70 nm to about 80 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, or about 90 nm to about 100 nm. In certain embodiments, the average size of the nanoparticle composition can be about 70 nm to about 100 nm. In some embodiments, the average size can be about 80 nm. In other embodiments, the average size can be about 100 nm.

[0226] PDI: The nanoparticle composition may be relatively uniform. The polydispersity index may be used to indicate the homogeneity of the nanoparticle composition, for example, the particle size distribution of the nanoparticle composition. A small (e.g., less than 0.3) polydispersity index generally indicates a narrow particle size distribution. The nanoparticle composition may have a polydispersity index of about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of the nanoparticle composition may be about 0.10 to about 0.20.

[0227] Encapsulation efficiency: The efficiency of encapsulation of a therapeutic and / or prophylactic agent describes the amount of the therapeutic and / or prophylactic agent that is encapsulated or otherwise associated with the nanoparticle composition after preparation relative to the initial amount provided. High encapsulation efficiency is desirable (e.g., close to 100%). Encapsulation efficiency can be measured, for example, by comparing the amount of the therapeutic and / or prophylactic agent in a solution containing the nanoparticle composition before and after decomposing the nanoparticle composition with one or more organic solvents or detergents. Fluorescence can be used to measure the amount of free therapeutic and / or prophylactic agent (e.g., RNA) in solution. For the nanoparticle compositions described herein, the encapsulation efficiency of the therapeutic and / or prophylactic agent can be at least 50%, e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In certain embodiments, the encapsulation efficiency can be at least 90%.

[0228] Apparent pKa: The zeta potential of the nanoparticle composition can be used to indicate the electrokinetic potential at the interface of the composition. For example, the zeta potential can describe the surface charge of the nanoparticle composition. Nanoparticle compositions with relatively low positive or negative charge are generally desirable because higher charged species can result in undesirable interactions with cells, tissues, and other elements in the body. In some embodiments, the zeta potential of the nanoparticle composition can be from about -10 mV to about +20 mV, from about -10 mV to about +15 mV, from about -10 mV to about +10 mV, from about -10 mV to about +5 mV, from about -10 mV to about 0 mV, from about -10 mV to about -5 mV, from about -5 mV to about +20 mV, from about -5 mV to about +15 mV, from about -5 mV to about +10 mV, from about -5 mV to about +5 mV, from about -5 mV to about 0 mV, from about 0 mV to about +20 mV, from about 0 mV to about +15 mV, from about 0 mV to about +10 mV, from about 0 mV to about +5 mV, from about +5 mV to about +20 mV, from about +5 mV to about +15 mV, or from about +5 mV to about +10 mV.

[0229] In another embodiment, the self-replicating RNA can be formulated in liposome.As a non-limiting example, the self-replicating RNA can be formulated in liposome as described in International Publication No. WO20120067378, which is incorporated herein by reference in its entirety.In one aspect, the liposome can include lipids with pKa values ​​that can be favorable for the delivery of mRNA.In another aspect, the liposome can have an essentially neutral surface charge at physiological pH, and thus can be effective for immunization (see, for example, the liposome described in International Publication No. WO20120067378, which is incorporated herein by reference in its entirety).

[0230] In some embodiments, the nanoparticle compositions described include a lipid component that includes at least one lipid, such as a compound according to one of formulas (I)-(IV) (and subformulas thereof) described herein. For example, in some embodiments, the nanoparticle composition can include a lipid component that includes one of the compounds provided herein. The nanoparticle composition can also include one or more other lipid or non-lipid components described below.

[0231] 5.4.1 Cationic / Ionizable Lipids As described herein, in some embodiments, the nanoparticle compositions provided herein include one or more charged or ionizable lipids in addition to lipids according to Formulae (I)-(IV) (and subformulas thereof). Without being bound by theory, it is believed that certain charged or zwitterionic lipid components of the nanoparticle compositions resemble lipid components in cell membranes, thereby improving cellular uptake of the nanoparticles.Exemplary charged or ionizable lipids that can form part of the nanoparticle compositions include 3-(didodecylamino)-N1,N1,4-tridodecyl-1-piperazineethanamine (KL10), N1-[2-(didodecylamino)ethyl]-N1,N4,N4-tridodecyl-1,4-piperazinediethanamine (KL22), 14,25-ditridecyl-15,18,21,24-tetraaza-octatriacontane (KL25), 1,2-dilinoleyloxy-N,N-dimethylamino ... 2,2-Dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (DLin-MC3-DMA), 2,2-Dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-Dioleyloxy-N,N-dimethylaminopropane (DODMA), 2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3[(9Z,12Z)-octadeca-9,12-dien-1-[yloxy]propan-1-amine (octyl-CLinDMA), (2R)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA( 2R)), (2S)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z-,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA(2S)), (12Z,15Z)-N,N-dimethyl-2-nonylhenicosa-12,15-den-1-amine, and N,N-dimethyl-1-{(1S,2R)-2-octylcyclopropyl}heptadecan-8-amine.Further exemplary charged or ionizable lipids that can form part of the nanoparticle compositions include those lipids (e.g., lipid 5) described in Sabnis et al. “A Novel Amino Lipid Series for mRNA Delivery: Improved Endosomal Escape and Sustained Pharmacology and Safety in Non-human Primates”, Molecular Therapy Vol. 26 No 6, 2018, the entire contents of which are incorporated herein by reference.

[0232] In some embodiments, suitable cationic lipids include N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP), 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine (DOEPC), 1,2-dilauroyl-sn-glycero-3-ethylphosphocholine (DLEPC), 1,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (DMEPC), 1,2-dimyristoleoyl-sn-glycero-3-ethylphosphocholine (14:1), N1-[2-((1S)-1-[(3-aminopropyl)amino]-4-[di(3-aminopropyl)amino] ]butylcarboxamido)ethyl]-3,4-di[oleyloxy]-benzamide (MVL5), dioctadecylamido-glycylspermine (DOGS), 3b-[N-(N',N'-dimethylaminoethyl)carbamoyl]cholesterol (DC-Chol), dioctadecyldimethylammonium bromide (DDAB), SAINT-2, N-methyl-4-(dioleyl)methylpyridinium, 1,2-dimyristyloxypropyl-3-dimethylhydroxyethylammonium bromide (DMRIE), 1,2-dioleoyl-3-dimethyl-hydroxyethylammonium bromide (DORIE), 1,2-dioleoyloxypropyl-3-dimethylhydroxyethylammonium chloride (DORI), dialkylated amino acids (DILA 2)(e.g., C18:1-norArg-C16), dioleyldimethylammonium chloride (DODAC), 1-palmitoyl-2-oleoyl-sn-glycero-3-ethylphosphocholine (POEPC), 1,2-dimyristoleoyl-sn-glycero-3-ethylphosphocholine (MOEPC), (R)-5-(dimethylamino)pentane-1,2-diyl dioleate hydrochloride (DODAPen-Cl), (R)-5-guanidinopentane-1,2-diyl dioleate hydrochloride (DOPen-G), (R)-N,N,N-trimethyl-4,5-bis(oleoyloxy)pentane-1-aminium chloride (DOTAPen). Cationic lipids having a primary amine (e.g., DODAG N’,N’-dioctadecyl-N-4,8-diaza-10-aminodecanoyl glycine amide) and a guanidinium head group (e.g., guanidinium head group (e.g., bis-guanidinium-spermidine-cholesterol (BGSC), bis-guanidinium tren-cholesterol (BGTC), PONA, and (R)-5-guanidinopentane-1,2-diyl dioleate hydrochloride (DOPen-G)) charged at physiological pH are also suitable. Yet another suitable cationic lipid is (R)-5-(dimethylamino)pentane-1,2-diyl dioleate hydrochloride (DODAPen-Cl). In certain embodiments, the cationic lipid is a specific enantiomer or racemic form and includes various salt forms of the cationic lipids as described above (e.g., chloride or sulfate). For example, in some embodiments, the cationic lipid is N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP-Cl) or N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium sulfate (DOTAP-sulfate).In some embodiments, the cationic lipid is an ionizable cationic lipid, such as, for example, dioctadecyldimethylammonium bromide (DDAB), 1,2-dilinoleyloxy-3-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-(2 dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (DLin-MC3-DMA), 1,2-dioleoyloxy-3-dimethylaminopropane (DODAP), 1,2-dioleyloxy-3-dimethylaminopropane (DODMA) and morpholinocholesterol (Mo-CHOL). In certain embodiments, the lipid nanoparticles comprise a combination or two or more cationic lipids (e.g., two or more of the cationic lipids described above).

[0233] In addition, in some embodiments, the charged or ionizable lipids that can form part of the nanoparticle compositions are lipids that contain cyclic amine groups. Additional cationic lipids suitable for the formulations and methods disclosed herein include those described in WO2015199952, WO2016176330, and WO2015011633, the entire contents of each of which are incorporated herein by reference in their entirety.

[0234] 5.4.2 Polymer-conjugated lipids In some embodiments, the lipid component of the nanoparticle composition may include one or more polymer-conjugated lipids, such as PEGylated lipids (PEG lipids). Without being bound by theory, it is believed that the polymer-conjugated lipid component in the nanoparticle composition may improve colloidal stability and / or reduce protein absorption of the nanoparticles. Exemplary cationic lipids that may be used in conjunction with the present disclosure include, but are not limited to, PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, and mixtures thereof. For example, the PEG lipid may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, PEG-DSPE, ceramide-PEG2000, or Chol-PEG2000.

[0235] In one embodiment, the polymer-conjugated lipid is a PEGylated lipid. For example, some embodiments include PEGylated diacylglycerol (PEG-DAG) such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG), PEGylated phosphatidylethanolamine (PEG-PE), PEG succinate diacylglycerol (PEG-S-DAG) such as 4-O-(2',3'-di(tetradecanoyloxy)propyl-1-O-(ω-methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG), PEGylated ceramide (PEG-cer), or PEG dialkoxypropyl carbamate such as ω-methoxy(polyethoxy)ethyl-N-(2,3-di(tetradecanoyloxy)propyl)carbamate or 2,3-di(tetradecanoyloxy)propyl--N-(ω-methoxy(polyethoxy)ethyl)carbamate.

[0236] In one embodiment, the polymer-conjugated lipid is present at a concentration ranging from 1.0 to 2.5 mole percent. In one embodiment, the polymer-conjugated lipid is present at a concentration of about 1.7 mole percent. In one embodiment, the polymer-conjugated lipid is present at a concentration of about 1.5 mole percent.

[0237] In one embodiment, the molar ratio of cationic lipid to polymer-conjugated lipid ranges from about 35: 1 to about 25: 1. In one embodiment, the molar ratio of cationic lipid to polymer-conjugated lipid ranges from about 100: 1 to about 20: 1.

[0238] In one embodiment, the PEGylated lipid has the formula: [ka] or a pharma- ceutically acceptable salt, tautomer or stereoisomer thereof, wherein R 12 and R 13 are each independently a linear or branched, saturated or unsaturated alkyl chain containing 10 to 30 carbon atoms, the alkyl chain being optionally interrupted by one or more ester bonds; The value of w has an average value in the range of 30 to 60.

[0239] In one embodiment, R 12 and R 13 are each independently a linear, saturated alkyl chain containing from 12 to 16 carbon atoms. In other embodiments, the average w ranges from 42 to 55, e.g., the average w is 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55. In certain embodiments, the average w is about 49.

[0240] In one embodiment, the PEGylated lipid has the formula: [ka] where the average w is about 49.

[0241] 5.4.3 Structural lipids In some embodiments, the lipid component of the nanoparticle composition may include one or more structural lipids. Without being bound by theory, it is believed that structural lipids can stabilize the amphiphilic structure of the nanoparticle, such as, but not limited to, the lipid bilayer structure of the nanoparticle. Exemplary structural lipids that can be used in conjunction with the present disclosure include, but are not limited to, cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, α-tocopherol, and mixtures thereof. In certain embodiments, the structural lipid is cholesterol. In some embodiments, the structural lipid includes cholesterol and corticosteroids (such as prednisolone, dexamethasone, prednisone and hydrocortisone), or combinations thereof.

[0242] In one embodiment, the lipid nanoparticles provided herein comprise a steroid or steroid analog. In one embodiment, the steroid or steroid analog is cholesterol. In one embodiment, the steroid is present at a concentration ranging from 39-49 molar percent, 40-46 molar percent, 40-44 molar percent, 40-42 molar percent, 42-44 molar percent, or 44-46 molar percent. In one embodiment, the steroid is present at a concentration of 40, 41, 42, 43, 44, 45, or 46 molar percent.

[0243] In one embodiment, the molar ratio of cationic lipid to steroid ranges from 1.0:0.9 to 1.0:1.2, or 1.0:1.0 to 1.0:1.2. In one embodiment, the molar ratio of cationic lipid to cholesterol ranges from about 5:1 to 1:1. In one embodiment, the steroid is present at a concentration ranging from 32 to 40 molar percent of the steroid.

[0244] 5.4.4 Phospholipids In some embodiments, the lipid component of the nanoparticle composition may include one or more phospholipids, such as one or more (poly)unsaturated lipids. Without being bound by theory, it is believed that the phospholipids assemble into one or more lipid bilayer structures. Exemplary phospholipids that may form part of the nanoparticle composition include 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dioleo ...oleoyl-sn-glycero-3-phospho Glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME16.0PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine Examples of suitable glycerols include, but are not limited to, phosphatidylcholine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), and sphingomyelin. In certain embodiments, the nanoparticle composition comprises DSPC. In certain embodiments, the nanoparticle composition comprises DOPE.In some embodiments, the nanoparticle composition comprises both DSPC and DOPE.

[0245] Further exemplary neutral lipids include, for example, dipalmitoyl phosphatidylglycerol (DPPG), palmitoyl oleoyl-phosphatidylethanolamine (POPE) and dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1 carboxylate (DOPE-mal), dipalmitoyl phosphatidylethanolamine (DPPE), dimyristoyl phosphoethanolamine (DMPE), distearoyl phosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearyl-2-oleoyl phosphatidylethanolamine (SOPE), and 1,2-dielideyl-sn-glycero-3-phosphoethanolamine (trans-DOPE). In one embodiment, the neutral lipid is 1,2-distearoyl-sn-glycero-3 phosphocholine (DSPC). In one embodiment, the neutral lipid is selected from DSPC, DPPC, DMPC, DOPC, POPC, DOPE and SM.

[0246] In one embodiment, the neutral lipid is phosphatidylcholine (PC), phosphatidylethanolamine (PE) phosphatidylserine (PS), phosphatidic acid (PA), or phosphatidylglycerol (PG).

[0247] Additionally, phospholipids that may form part of the nanoparticle compositions include those described in WO 2017 / 112865, the entire contents of which are incorporated herein by reference in their entirety.

[0248] 5.4.5 Therapeutic payloads In accordance with the present disclosure, the nanoparticle compositions described herein may further comprise one or more therapeutic and / or prophylactic agents. These therapeutic and / or prophylactic agents may be referred to in the present disclosure as "therapeutic payloads" or "payloads." In some embodiments, the therapeutic payloads may be administered in vivo or in vitro using nanoparticles as a delivery vehicle.

[0249] In some embodiments, the nanoparticle compositions contain as a therapeutic payload antitumor agents (e.g., vincristine, doxorubicin, mitoxantrone, camptothecin, cisplatin, bleomycin, cyclophosphamide, methotrexate, and streptozotocin); agents) (e.g., actinomycin D, vincristine, vinblastine, cytosine arabinoside, anthracyclines, alkylating agents, platinum compounds, antimetabolites, and nucleoside analogues such as methotrexate and purine and pyrimidine analogues), anti-infectives, local anesthetics (e.g., dibucaine and chlorpromazine), beta-adrenergic blocking agents (e.g., propranolol, timolol, and labetalol), antihypertensives (e.g., clonidine and hydralazine), antidepressants (e.g., imipramine, amitriptyline, and doxepin), anticonvulsants (e.g., phenytoin), antihistamines (diphenhydramine, chlorpheniramine, promethazine), antibiotics / antibacterials (e.g., gentamicin, ciprofloxacin, and cefoxitin), antifungals (e.g., miconazole, terconazole, econazole, isoconazole, butaconazole, clotrimazole, itraconazole, nystatin, naftifine, and amphotericin B), antiparasitics, hormones, hormone antagonists, immunomodulators, neurotransmitter antagonists, antiglaucoma agents, vitamins, anesthetics, and small molecule compounds (e.g., small molecule drugs) such as contrast agents.

[0250] In some embodiments, the therapeutic payload comprises a cytotoxin, a radioactive ion, a chemotherapeutic drug, a vaccine, a compound that induces an immune response, and / or another therapeutic and / or prophylactic agent. Cytotoxins or cytotoxic agents include any agent that may be harmful to cells. Examples include, but are not limited to, taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, teniposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin, maytansinoids, such as maytansinol, rachelmycin (CC-1065), and analogs or homologs thereof. Radioactive ions include, but are not limited to, iodine (e.g., iodine-125 or iodine-131), strontium-89, phosphorus, palladium, cesium, iridium, phosphate, cobalt, yttrium-90, samarium-153, and praseodymium.

[0251] In other embodiments, the therapeutic payload of the nanoparticle composition is an antimetabolite (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil, dacarbazine), an alkylating agent (e.g., mechlorethamine, thiotepa chlorambucil, rachelmycin (CC-1065), melphalan, carmustine (BSNU), lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamineplatinum(II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and antimitotic agents (e.g., vincristine, vinblastine, taxol, and maytansinoids).

[0252] In some embodiments, the nanoparticle composition includes biological molecules, such as peptides and polypeptides, as a therapeutic payload. The biological molecules forming part of the nanoparticle composition can be either natural source or synthetic. For example, in some embodiments, the therapeutic payload of the nanoparticle composition can include, but is not limited to, gentamicin, amikacin, insulin, erythropoietin (EPO), granulocyte colony stimulating factor (G-CSF), granulocyte-macrophage colony stimulating factor (GM-CSF), factor VIR, luteinizing hormone releasing hormone (LHRH) analogs, interferons, heparin, hepatitis B surface antigen, typhoid vaccine, cholera vaccine, and peptides and polypeptides.

[0253] 5.4.5.1 Nucleic acids In some embodiments, the nanoparticle composition comprises one or more nucleic acid molecules (e.g., DNA or RNA molecules) as a therapeutic payload. Exemplary forms of nucleic acid molecules that may be included in the nanoparticle composition as a therapeutic payload include, but are not limited to, one or more of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), including messenger RNA (mRNA), hybrids thereof, RNAi inducers, RNAi agents, siRNA, shRNA, miRNA, antisense RNA, ribozymes, catalytic DNA, RNA inducing triple helix formation, aptamers, vectors, and the like. In certain embodiments, the therapeutic payload comprises RNA. RNA molecules that may be included in the nanoparticle composition as therapeutic payloads include, but are not limited to, shortmers, agomirs, antagomirs, antisense, ribozymes, small interfering RNA (siRNA), asymmetric interfering RNA (aiRNA), microRNA (miRNA), dicer substrate RNA (dsRNA), small hairpin RNA (shRNA), transfer RNA (tRNA), messenger RNA (mRNA), and other forms of RNA molecules known in the art. In certain embodiments, the RNA is mRNA.

[0254] In other embodiments, the nanoparticle composition comprises an siRNA molecule as a therapeutic payload. In particular, in some embodiments, the siRNA molecule can selectively interfere with and downregulate the expression of a gene of interest. For example, in some embodiments, the siRNA payload selectively silences a gene associated with a particular disease, disorder, or condition when administered to a subject in need of a nanoparticle composition comprising the siRNA. In some embodiments, the siRNA molecule comprises a sequence that is complementary to an mRNA sequence that codes for a protein product of interest. In some embodiments, the siRNA molecule is an immunomodulatory siRNA.

[0255] In some embodiments, the nanoparticle composition comprises an shRNA molecule or a vector encoding an shRNA molecule as a therapeutic payload. In particular, in some embodiments, the therapeutic payload produces shRNA in a target cell when administered to the target cell. The constructs and mechanisms of shRNA are well known in the relevant art.

[0256] In some embodiments, the nanoparticle composition comprises an mRNA molecule as a therapeutic payload. In particular, in some embodiments, the mRNA molecule encodes a polypeptide of interest, including any natural or non-natural or otherwise modified polypeptide. The polypeptide encoded by the mRNA can be of any size and can have any secondary structure or activity. In some embodiments, the polypeptide encoded by the mRNA payload can have a therapeutic effect when expressed in a cell.

[0257] In some embodiments, the nucleic acid molecule of the present disclosure comprises an mRNA molecule. In certain embodiments, the nucleic acid molecule comprises at least one coding region (e.g., an open reading frame (ORF)) encoding a peptide or polypeptide of interest. In some embodiments, the nucleic acid molecule further comprises at least one untranslated region (UTR). In certain embodiments, the untranslated region (UTR) is located upstream (towards the 5' end) of the coding region, referred to herein as a 5'-UTR. In certain embodiments, the untranslated region (UTR) is located downstream (towards the 3' end) of the coding region, referred to herein as a 3'-UTR. In certain embodiments, the nucleic acid molecule comprises both a 5'-UTR and a 3'-UTR. In some embodiments, the 5'-UTR comprises a 5' cap structure. In some embodiments, the nucleic acid molecule comprises a Kozak sequence (e.g., in the 5'-UTR). In some embodiments, the nucleic acid molecule comprises a polyA region (e.g., in the 3'-UTR). In some embodiments, the nucleic acid molecule comprises a polyadenylation signal (e.g., in the 3'-UTR). In some embodiments, the nucleic acid molecule comprises a stabilizing region (e.g., in the 3'-UTR). In some embodiments, the nucleic acid molecule comprises a secondary structure. In some embodiments, the secondary structure is a stem-loop. In some embodiments, the nucleic acid molecule comprises a stem-loop sequence (e.g., in the 5'-UTR and / or the 3'-UTR). In some embodiments, the nucleic acid molecule comprises one or more intron regions that can be excised during splicing. In certain embodiments, the nucleic acid molecule comprises one or more regions selected from a 5'-UTR and a coding region. In certain embodiments, the nucleic acid molecule comprises one or more regions selected from a coding region and a 3'-UTR. In certain embodiments, the nucleic acid molecule comprises one or more regions selected from a 5'-UTR, a coding region, and a 3'-UTR.

[0258] Code Region In some embodiments, the nucleic acid molecule of the present disclosure comprises at least one coding region. In some embodiments, the coding region is an open reading frame (ORF) that encodes a single peptide or protein. In some embodiments, the coding region comprises at least two ORFs, each encoding a peptide or protein. In those embodiments in which the coding region comprises two or more ORFs, the encoded peptides and / or proteins may be the same as each other or may be different. In some embodiments, the multiple ORFs in the coding region are separated by non-coding sequences. In certain embodiments, the non-coding sequences separating the two ORFs comprise an internal ribosome entry site (IRES).

[0259] Without being bound by theory, it is believed that an internal ribosome entry site (IRES) can act as the sole ribosome binding site or function as one of multiple ribosome binding sites of an mRNA. An mRNA molecule containing two or more functional ribosome binding sites can code for several peptides or polypeptides that are translated independently by ribosomes (e.g., multicistronic mRNA). Thus, in some embodiments, a nucleic acid molecule (e.g., an mRNA) of the present disclosure comprises one or more internal ribosome entry sites (IRES). Examples of IRES sequences that can be used in connection with the present disclosure include, but are not limited to, those derived from picomaviruses (e.g., FMDV), plague viruses (CFFV), polioviruses (PV), encephalomyocarditis viruses (ECMV), foot and mouth disease viruses (FMDV), hepatitis C viruses (HCV), classical swine fever viruses (CSFV), murine leukemia viruses (MLV), simian immunodeficiency viruses (SIV) or cricket paralysis viruses (CrPV).

[0260] In various embodiments, the nucleic acid molecules of the disclosure encode for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 peptides or proteins. The peptides and proteins encoded by the nucleic acid molecules may be the same or different. In some embodiments, the nucleic acid molecules of the disclosure encode for a dipeptide (e.g., camocin and anserine). In some embodiments, the nucleic acid molecules encode for a tripeptide. In some embodiments, the nucleic acid molecules encode for a tetrapeptide. In some embodiments, the nucleic acid molecules encode for a pentapeptide. In some embodiments, the nucleic acid molecules encode for a hexapeptide. In some embodiments, the nucleic acid molecules encode for a heptapeptide. In some embodiments, the nucleic acid molecules encode for an octapeptide. In some embodiments, the nucleic acid molecules encode for a nonapeptide. In some embodiments, the nucleic acid molecules encode for a decapeptide. In some embodiments, the nucleic acid molecules encode for a peptide or polypeptide having at least about 15 amino acids. In some embodiments, the nucleic acid molecules encode for a peptide or polypeptide having at least about 50 amino acids. In some embodiments, the nucleic acid molecules encode for a peptide or polypeptide having at least about 100 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 150 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 300 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 500 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 1000 amino acids.

[0261] In some embodiments, the nucleic acid molecules of the present disclosure are at least about 30 nucleotides (nt) in length. In some embodiments, the nucleic acid molecules are at least about 35 nt in length. In some embodiments, the nucleic acid molecules are at least about 40 nt in length. In some embodiments, the nucleic acid molecules are at least about 45 nt in length. In some embodiments, the nucleic acid molecules are at least about 50 nt in length. In some embodiments, the nucleic acid molecules are at least about 55 nt in length. In some embodiments, the nucleic acid molecules are at least about 60 nt in length. In some embodiments, the nucleic acid molecules are at least about 65 nt in length. In some embodiments, the nucleic acid molecules are at least about 70 nt in length. In some embodiments, the nucleic acid molecules are at least about 75 nt in length. In some embodiments, the nucleic acid molecules are at least about 80 nt in length. In some embodiments, the nucleic acid molecules are at least about 85 nt in length. In some embodiments, the nucleic acid molecules are at least about 90 nt in length. In some embodiments, the nucleic acid molecules are at least about 95 nt in length. In some embodiments, the nucleic acid molecules are at least about 100 nt in length. In some embodiments, the nucleic acid molecule is at least about 120 nt in length. In some embodiments, the nucleic acid molecule is at least about 140 nt in length. In some embodiments, the nucleic acid molecule is at least about 160 nt in length. In some embodiments, the nucleic acid molecule is at least about 180 nt in length. In some embodiments, the nucleic acid molecule is at least about 200 nt in length. In some embodiments, the nucleic acid molecule is at least about 250 nt in length. In some embodiments, the nucleic acid molecule is at least about 300 nt in length. In some embodiments, the nucleic acid molecule is at least about 400 nt in length. In some embodiments, the nucleic acid molecule is at least about 500 nt in length. In some embodiments, the nucleic acid molecule is at least about 600 nt in length. In some embodiments, the nucleic acid molecule is at least about 700 nt in length. In some embodiments, the nucleic acid molecule is at least about 800 nt in length. In some embodiments, the nucleic acid molecule is at least about 900 nt in length. In some embodiments, the nucleic acid molecule is at least about 1000 nt in length.In some embodiments, the nucleic acid molecule is at least about 1100 nt in length. In some embodiments, the nucleic acid molecule is at least about 1200 nt in length. In some embodiments, the nucleic acid molecule is at least about 1300 nt in length. In some embodiments, the nucleic acid molecule is at least about 1400 nt in length. In some embodiments, the nucleic acid molecule is at least about 1500 nt in length. In some embodiments, the nucleic acid molecule is at least about 1600 nt in length. In some embodiments, the nucleic acid molecule is at least about 1700 nt in length. In some embodiments, the nucleic acid molecule is at least about 1800 nt in length. In some embodiments, the nucleic acid molecule is at least about 1900 nt in length. In some embodiments, the nucleic acid molecule is at least about 2000 nt in length. In some embodiments, the nucleic acid molecule is at least about 2500 nt in length. In some embodiments, the nucleic acid molecule is at least about 3000 nt in length. In some embodiments, the nucleic acid molecule is at least about 3500 nt in length. In some embodiments, the nucleic acid molecule is at least about 4000 nt in length. In some embodiments, the nucleic acid molecule is at least about 4500 nt in length. In some embodiments, the nucleic acid molecule is at least about 5000 nt in length.

[0262] In certain embodiments, the therapeutic payload comprises a vaccine composition (e.g., a genetic vaccine) described herein. In some embodiments, the therapeutic payload comprises a compound capable of inducing immunity against one or more target conditions or diseases. In some embodiments, the target condition is associated with or caused by infection by a pathogen, such as coronavirus (e.g., 2019-nCoV), influenza, measles, human papillomavirus (HPV), rabies, meningitis, whooping cough, tetanus, plague, hepatitis, and tuberculosis. In some embodiments, the therapeutic payload comprises a nucleic acid sequence (e.g., mRNA) that encodes a pathogenic protein, or an antigenic fragment or epitope thereof, characteristic of the pathogen. The vaccine, when administered to a vaccinated subject, allows expression of the encoded pathogenic protein (or an antigenic fragment or epitope thereof), thereby inducing immunity in the subject against the pathogen.

[0263] In some embodiments, the target condition is associated with or caused by neoplastic proliferation of cells, such as cancer. In some embodiments, the therapeutic payload comprises a nucleic acid sequence (e.g., mRNA) that encodes a tumor-associated antigen (TAA) characteristic of the cancer, or an antigenic fragment or epitope thereof. When administered to a vaccinated subject, the vaccine allows expression of the encoded TAA (or an antigenic fragment or epitope thereof), thereby eliciting immunity in the subject against tumor cells expressing the TAA.

[0264] 5' Cap Structure Without being bound by theory, it is believed that the 5' cap structure of a polynucleotide is involved in nuclear transport and increasing polynucleotide stability, and binds to mRNA cap binding protein (CBP), which is involved in polynucleotide stability and translation competence in cells through the association of CBP with polyA binding protein to form mature circular mRNA species. The 5' cap structure further assists in 5' proximal intron removal during mRNA splicing. Thus, in some embodiments, the nucleic acid molecules of the present disclosure comprise a 5' cap structure.

[0265] Nucleic acid molecules can be capped at the 5' end by the cell's endogenous transcription machinery to generate a 5'-ppp-5'-triphosphate linkage between the terminal guanosine cap residue of the polynucleotide and the 5'-terminal transcribed sense nucleotide. This 5' guanylate cap can then be methylated to generate an N7-methyl-guanylate residue. The ribose sugar of the terminal and / or anteterminal transcribed nucleotide at the 5' end of the polynucleotide can also optionally be 2'-O-methylated. 5' decapping and cleavage of the guanylate cap structure via hydrolysis can target nucleic acid molecules, such as mRNA molecules, for degradation.

[0266] In some embodiments, the nucleic acid molecules of the present disclosure contain one or more modifications to the native 5' cap structure produced by endogenous processes. Without being bound by theory, modifications on the 5' cap may increase the stability of the polynucleotide, increase the half-life of the polynucleotide, or increase the translation efficiency of the polynucleotide.

[0267] Exemplary modifications to the native 5' cap structure include the creation of a non-hydrolyzable cap structure that prevents decapping and therefore increases polynucleotide half-life. In some embodiments, since hydrolysis of the cap structure requires cleavage of the 5'-ppp-5' phosphorodiester linkage, in some embodiments, modified nucleotides may be used during the capping reaction. For example, in some embodiments, vaccinia capping enzyme from New England Biolabs (Ipswich, Mass.) may be used with α-thio-guanosine nucleotides according to the manufacturer's instructions to create phosphorothioate linkages in the 5'-ppp-5' cap. Additional modified guanosine nucleotides, such as α-methyl-phosphonate and seleno-phosphate nucleotides, may be used.

[0268] Further exemplary modifications to the native 5' cap structure include modifications at the 2' and / or 3' positions of the capped guanosine triphosphate (GTP), the methylene moiety (CH 2 ), modifications in the triphosphate bridge portion of the cap structure, or modifications in the nucleobase (G) portion.

[0269] Further exemplary modifications to the native 5' cap structure include, but are not limited to, 2'-O-methylation of the ribose sugar of the 5'-terminus and / or pre-5'-terminal nucleotide of the polynucleotide (as described above) on the 2' hydroxy group of the sugar. Multiple distinct 5' cap structures may be used to generate the 5' cap of a polynucleotide, such as an mRNA molecule. Further exemplary 5' cap structures that may be used in connection with the present disclosure further include those described in International Patent Publication Nos. WO2008127688, WO2008016473, and WO2011015347, the contents of each of which are incorporated herein by reference in their entirety.

[0270] In various embodiments, the 5'-end cap can include a cap analog. Cap analogs, also referred to herein as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, differ in their chemical structure from the native (i.e., endogenous, wild-type, or physical) 5' cap while retaining cap function. Cap analogs can be chemically (i.e., non-enzymatically) or enzymatically synthesized and / or linked to a polynucleotide.

[0271] For example, an anti-reverse cap analog (ARCA) cap contains two guanosines linked by a 5'-5'-triphosphate group, with one guanosine containing an N7-methyl group and a 3'-O-methyl group (i.e., N7,3'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, m 7The 3'-O atom of the otherwise unmodified guanosine is linked to the 5' terminal nucleotide of the capped polynucleotide (e.g., mRNA). The N7- and 3'-O-methylated guanosine provides the terminal portion of the capped polynucleotide (e.g., mRNA). Another exemplary cap structure is mCAP, which is similar to ARCA but has a 2'-O-methyl group on the guanosine (i.e., N7,2'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, mCAP). 7 Gm-ppp-G).

[0272] In some embodiments, the cap analog can be a dinucleotide cap analog. As a non-limiting example, the dinucleotide cap analog can be modified at different phosphate positions with boranophosphate or phosphoroselenoate groups, such as the dinucleotide cap analogs described in U.S. Patent No. 8,519,110, the entire contents of which are incorporated herein by reference in their entirety.

[0273] In some embodiments, the cap analog can be an N7-(4-chlorophenoxyethyl) substituted dinucleotide cap analog known in the art and / or described herein. Non-limiting examples of N7-(4-chlorophenoxyethyl) substituted dinucleotide cap analogs include N7-(4-chlorophenoxyethyl)-G(5')ppp(5')G and N7-(4-chlorophenoxyethyl)-m3'-OG(5')ppp(5')G cap analogs (see, e.g., Kore et al. Bioorganic & Medicinal Chemistry 2013 21:4570-4574 for various cap analogs and methods of synthesizing cap analogs, the entire contents of which are incorporated herein by reference). In other embodiments, a cap analog useful in connection with the nucleic acid molecules of the present disclosure is a 4-chloro / bromophenoxyethyl analog.

[0274] In various embodiments, the cap analog may comprise a guanosine analog. Useful guanosine analogs include, but are not limited to, inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0275] Without being bound by theory, it is believed that cap analogs allow for concomitant capping of polynucleotides in in vitro transcription reactions, but that up to 20% of the transcripts remain uncapped. This, as well as the structural differences of the cap analogs from the native 5' cap structure of polynucleotides produced by the cell's endogenous transcription machinery, can lead to reduced translational competence and reduced cellular stability.

[0276] Thus, in some embodiments, the nucleic acid molecules of the present disclosure can be post-transcriptionally capped using enzymes to generate a more authentic 5' cap structure. As used herein, the phrase "more authentic" refers to a feature that closely reflects or mimics an endogenous or wild-type feature, either structurally or functionally. That is, a "more authentic" feature is one that better represents an endogenous wild-type, natural, or physiological cellular function and / or structure compared to a synthetic feature or analog of the prior art, or is superior in one or more respects to the corresponding endogenous wild-type, natural, or physiological feature. Non-limiting examples of more authentic 5' cap structures useful in connection with the nucleic acid molecules of the present disclosure include, among others, those that have enhanced cap-binding protein binding, increased half-life, reduced susceptibility to 5' endonucleases, and / or reduced 5' decapping compared to synthetic 5' cap structures (or wild-type, natural, or physiological 5' cap structures) known in the art. For example, in some embodiments, recombinant vaccinia virus capping enzyme and recombinant 2'-O-methyltransferase enzyme can create a canonical 5'-5'-triphosphate linkage between the 5'-terminal nucleotide of a polynucleotide and a guanosine cap nucleotide, where the cap guanosine comprises an N7 methylation and the 5'-terminal nucleotide of the polynucleotide comprises a 2'-O-methyl. Such a structure is referred to as a Cap 1 structure. This cap results in higher translational competence, cellular stability, and reduced activation of cellular pro-inflammatory cytokines, for example, compared to other 5' cap analog structures known in the art. Other exemplary cap structures include 7mG(5')ppp(5')N, pN2p (cap 0), 7mG(5')ppp(5')NlmpNp (cap 1), 7mG(5')-ppp(5')NlmpN2mp (cap 2), and m(7)Gpppm(3)(6,6,2')Apm(2')Apm(2')Cpm(2)(3,2')Up (cap 4).

[0277] Without being bound by theory, it is believed that the nucleic acid molecules of the present disclosure may be post-transcriptionally capped, and because this process is more efficient, nearly 100% of the nucleic acid molecules may be capped.

[0278] Untranslated Regions (UTRs) In some embodiments, the nucleic acid molecules of the present disclosure include one or more untranslated regions (UTRs). In some embodiments, the UTRs are located upstream of the coding region in the nucleic acid molecule and are referred to as 5'-UTRs. In some embodiments, the UTRs are located downstream of the coding region in the nucleic acid molecule and are referred to as 3'-UTRs. The sequence of the UTRs can be homologous or heterologous to the sequence of the coding region found in the nucleic acid molecule. Multiple UTRs can be included in a nucleic acid molecule and can be of the same or different sequence and / or genetic origin. According to the present disclosure, any portion (including none) of the UTRs in a nucleic acid molecule can be codon-optimized, and any can independently contain one or more different structural or chemical modifications before and / or after codon optimization.

[0279] In some embodiments, the nucleic acid molecules (e.g., mRNA) of the disclosure comprise UTRs and coding regions that are homologous with respect to each other. In other embodiments, the nucleic acid molecules (e.g., mRNA) of the disclosure comprise UTRs and coding regions that are heterologous with respect to each other. In some embodiments, to monitor the activity of a UTR sequence, a nucleic acid molecule comprising a coding sequence of a UTR and a detectable probe can be administered in vitro (e.g., to a cell or tissue culture) or in vivo (e.g., to a subject), and the effect of the UTR sequence (e.g., modulation of expression levels, cellular localization of the encoded product, or half-life of the encoded product) can be measured using methods known in the art.

[0280] In some embodiments, the UTR of a nucleic acid molecule (e.g., mRNA) of the present disclosure comprises at least one translational enhancer element (TEE) that functions to increase the amount of a polypeptide or protein produced from the nucleic acid molecule. In some embodiments, the TEE is located in the 5'-UTR of the nucleic acid molecule. In other embodiments, the TEE is located in the 3'-UTR of the nucleic acid molecule. In still other embodiments, at least two TEEs are located in the 5'-UTR and 3'-UTR of the nucleic acid molecule, respectively. In some embodiments, the nucleic acid molecule (e.g., mRNA) of the present disclosure may comprise one or more copies of a TEE sequence, or may comprise two or more different TEE sequences. In some embodiments, the different TEE sequences present in a nucleic acid molecule of the present disclosure may be homologous or heterologous with respect to each other.

[0281] Various TEE sequences known in the art can be used in connection with the present disclosure.For example, in some embodiments, TEE can be an internal ribosome entry site (IRES), HCV-IRES, or IRES element.Chappell et al.Proc.Natl.Acad.Sci.USA 101:9590-9594,2004; Zhou et al.Proc.Natl.Acad.Sci.102:6273-6278,2005. Additional internal ribosome entry sites (IRES) that may be used in connection with the present disclosure include, but are not limited to, those described in U.S. Patent No. 7,468,275, U.S. Patent Publication No. 2007 / 0048776 and U.S. Patent Publication No. 2011 / 0124100, and International Patent Publication No. WO2007 / 025008 and International Patent Publication No. WO2001 / 055369, the contents of each of which are incorporated herein by reference in their entirety. In some embodiments, the TEE may be those described in Supplementary Table 1 and Supplementary Table 2 of Wellensiek et al Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, 2013 Aug;10(8):747-750, the contents of which are incorporated by reference in their entirety.

[0282] Further exemplary TEEs that may be used in connection with the present disclosure include those disclosed in U.S. Pat. No. 6,310,197, U.S. Pat. No. 6,849,405, U.S. Pat. No. 7,456,273, U.S. Pat. No. 7,183,395, U.S. Patent Publication No. 2009 / 0226470, U.S. Patent Publication No. 2013 / 0177581, U.S. Patent Publication No. 2007 / 0048776, U.S. Patent Publication No. 2011 / 0124100, U.S. Patent Publication No. 2009 / 0093049, International Patent Publication No. WO2009 / 075886, International Patent Publication No. WO2012 / 009644, and These include, but are not limited to, the TEE sequences disclosed in International Patent Publication No. WO1999 / 024595, International Patent Publication No. WO2007 / 025008, International Patent Publication No. WO2001 / 055371, European Patent No. 2610341, and European Patent No. 2610340, the contents of each of which are incorporated herein by reference in their entirety.

[0283] In various embodiments, the nucleic acid molecule (e.g., mRNA) of the present disclosure comprises at least one UTR that comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen, at least twenty, at least twenty-one, at least twenty-two, at least twenty-three, at least twenty-four, at least twenty-five, at least thirty-five, at least thirty-five, at least forty, at least forty-five, at least fifty, at least fifty-five, or more than sixty TEE sequences. In some embodiments, the TEE sequences in the UTR of the nucleic acid molecule are copies of the same TEE sequence. In other embodiments, at least two TEE sequences in the UTR of the nucleic acid molecule are different TEE sequences. In some embodiments, the multiple different TEE sequences are arranged in one or more repeating patterns in the UTR region of the nucleic acid molecule. For illustrative purposes only, the repeating pattern can be, for example, ABABAB, AABBABBAABB, ABCABCABC, etc., where in these exemplary patterns, each capital letter (A, B, or C) represents a different TEE sequence. In some embodiments, at least two TEE sequences are contiguous with each other (i.e., there is no spacer sequence between them) in the UTR of the nucleic acid molecule. In other embodiments, at least two TEE sequences are separated by a spacer sequence. In some embodiments, the UTR can include a TEE sequence spacer sequence module that is repeated at least once, at least twice, at least three times, at least four times, at least five times, at least six times, at least seven times, at least eight times, at least nine times, or more than nine times in the UTR. In any of the embodiments described in this paragraph, the UTR can be the 5'-UTR, 3'-UTR, or both the 5'-UTR and 3'-UTR of the nucleic acid molecule.

[0284] In some embodiments, the UTR of the nucleic acid molecule (e.g., mRNA) of the present disclosure comprises at least one translational repression element that functions to reduce the amount of polypeptide or protein produced from the nucleic acid molecule. In some embodiments, the UTR of the nucleic acid molecule comprises one or more miR sequences or fragments thereof (e.g., miR seed sequences) recognized by one or more microRNAs. In some embodiments, the UTR of the nucleic acid molecule comprises one or more stem-loop structures that downregulate the translational activity of the nucleic acid molecule. Other mechanisms for repressing the translational activity associated with a nucleic acid molecule are known in the art. In any of the embodiments described in this paragraph, the UTR can be the 5'-UTR, 3'-UTR, or both the 5'-UTR and 3'-UTR of the nucleic acid molecule.

[0285] Polyadenylation (polyA) region During natural RNA processing, long chains of adenosine nucleotides (polyA regions) are typically added to messenger RNA (mRNA) molecules to increase the stability of the molecule. Immediately after transcription, the 3' end of the transcript is cleaved to release a 3'-hydroxyl. PolyA polymerase then adds chains of adenosine nucleotides to the RNA. This process, called polyadenylation, adds polyA regions between 100-250 residues in length. Without being bound by theory, it is believed that polyA regions can impart various advantages to the nucleic acid molecules of the present disclosure.

[0286] Thus, in some embodiments, a nucleic acid molecule (e.g., mRNA) of the disclosure comprises a polyadenylation signal. In some embodiments, a nucleic acid molecule (e.g., mRNA) of the disclosure comprises one or more polyadenylation (polyA) regions. In some embodiments, the polyA region consists entirely of adenine nucleotides or functional analogs thereof. In some embodiments, a nucleic acid molecule comprises at least one polyA region at its 3' end. In some embodiments, a nucleic acid molecule comprises at least one polyA region at its 5' end. In some embodiments, a nucleic acid molecule comprises at least one polyA region at its 5' end and at least one polyA region at its 3' end.

[0287] According to the present disclosure, the polyA region can vary in length in different embodiments. In particular, in some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 30 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 35 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 40 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 45 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 50 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 55 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 60 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 65 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 70 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of the present disclosure is at least 75 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 80 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 85 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 90 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 95 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 100 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 110 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 120 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 130 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 140 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 150 nucleotides in length.In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 160 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 170 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 180 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 190 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 200 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 225 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 250 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 275 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 300 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 350 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 400 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 450 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 500 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 600 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 700 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 800 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 900 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 1000 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 1100 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 1200 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 1300 nucleotides in length.In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 1400 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 1500 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 1600 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 1700 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 1800 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 1900 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 2000 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 2250 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 2500 nucleotides in length. In some embodiments, the polyA region of the nucleic acid molecule of this disclosure is at least 2750 nucleotides in length. In some embodiments, the polyA region of a nucleic acid molecule of the present disclosure is at least 3000 nucleotides in length.

[0288] In some embodiments, the length of the polyA region in a nucleic acid molecule can be selected based on the total length of the nucleic acid molecule, or a portion thereof (e.g., the length of a coding region, or the length of an open reading frame of a nucleic acid molecule, etc.) For example, in some embodiments, the polyA region comprises about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more of the total length of the nucleic acid molecule including the polyA region.

[0289] Without being bound by theory, it is believed that certain RNA binding proteins can bind to the polyA region located at the 3' end of an mRNA molecule. These polyA binding proteins (PABPs) can regulate mRNA expression, such as by interacting with the translation initiation machinery in the cell and / or protecting the 3' polyA tail from degradation. Thus, in some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure contain at least one binding site for a polyA binding protein (PABP). In other embodiments, the nucleic acid molecules are conjugated or complexed with a PABP before being loaded into a delivery vehicle (e.g., lipid nanoparticles).

[0290] In some embodiments, the nucleic acid molecule (e.g., mRNA) of the present disclosure comprises a poly-AG quartet. A G-quartet is a cyclic hydrogen-bonded array of four guanosine nucleotides that can be formed by G-rich sequences in both DNA and RNA. In this embodiment, the G-quartet is incorporated at the end of a poly-A region. The resulting polynucleotide (e.g., mRNA) can be assayed at various times for stability, protein production, and other parameters, including half-life. It has been discovered that the poly-AG quartet structure results in protein production equal to at least 75% of the protein production seen using only a 120-nucleotide poly-A region.

[0291] In some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure may contain a polyA region and may be stabilized by the addition of a 3' stabilization region. In some embodiments, the 3' stabilization region that may be used to stabilize the nucleic acid molecule (e.g., mRNA) comprises a polyA or polyAG quartet structure as described in International Patent Publication No. WO2013 / 103659, the contents of which are incorporated herein by reference in their entirety.

[0292] In other embodiments, 3’ stabilizing regions that can be used in connection with the nucleic acid molecules of the present disclosure include chain-terminating nucleosides such as 3’-deoxyadenosine (cordycepin), 3’-deoxythymidine, 3’-deoxycytidine, 3’-deoxyguanosine, 3’-deoxythymidine, 2’,3’-dideoxyadenosine, 2’,3’-dideoxyuridine, 2’,3’-dideoxycytidine, 2’,3’-dideoxyguanosine, 2’,3’-dideoxythymidine, etc., 2’-deoxynucleosides, or O-methyl nucleosides, 3’-deoxynucleosides, 2’,3’-dideoxynucleosides, 3’-O-methyl nucleosides, 3’-O-ethyl nucleosides, 3’-arabinosides, and other alternative nucleosides known in the art and / or described herein, but are not limited thereto.

[0293] Secondary structure Without being bound by theory, it is contemplated that stem-loop structures direct RNA folding, protect the structural stability of nucleic acid molecules (e.g., mRNA), provide recognition sites for RNA-binding proteins, and can function as substrates for enzymatic reactions. For example, the incorporation of miR sequences and / or TEE sequences can change the shape of stem-loop regions that can increase and / or decrease translation (Kedde et al. A Pumilio-induced RNA structure switch in p27-3’UTR controls miR-221 and miR-222 accessibility. Nat Cell Biol., 2010 Oct;12(10):1014-20, the content of which is incorporated herein by reference in its entirety).

[0294] Thus, in some embodiments, the nucleic acid molecules (e.g., mRNAs) described herein or portions thereof may adopt a stem-loop structure, such as, but not limited to, a histone stem-loop. In some embodiments, the stem-loop structure is formed from a stem-loop sequence that is about 25 or about 26 nucleotides in length, such as, but not limited to, those described in International Patent Publication No. WO2013 / 103659, the contents of which are incorporated herein by reference in their entirety. Further examples of stem-loop sequences include those described in International Patent Publication No. WO2012 / 019780 and International Patent Publication No. WO201502667, the contents of which are incorporated herein by reference. In some embodiments, the stem-loop sequence comprises a TEE as described herein. In some embodiments, the stem-loop sequence comprises a miR sequence as described herein. In certain embodiments, the stem-loop sequence may comprise a miR-122 seed sequence. In certain embodiments, the nucleic acid molecule comprises the stem-loop sequence CAAAGGCTCTTTTCAGAGCCACCA (SEQ ID NO: 1). In other embodiments, the nucleic acid molecule comprises the stem-loop sequence CAAAGGCUCUUUUCAGAGCCACCA (SEQ ID NO:2).

[0295] In some embodiments, the nucleic acid molecules (e.g., mRNA) of the disclosure comprise a stem-loop sequence located upstream (towards the 5' end) of the coding region in the nucleic acid molecule. In some embodiments, the stem-loop sequence is located within the 5'-UTR of the nucleic acid molecule. In some embodiments, the nucleic acid molecules (e.g., mRNA) of the disclosure comprise a stem-loop sequence located downstream (towards the 3' end) of the coding region in the nucleic acid molecule. In some embodiments, the stem-loop sequence is located within the 3'-UTR of the nucleic acid molecule. In some cases, the nucleic acid molecule may contain more than one stem-loop sequence. In some embodiments, the nucleic acid molecule comprises at least one stem-loop sequence in the 5'-UTR and at least one stem-loop sequence in the 3'-UTR.

[0296] In some embodiments, the nucleic acid molecule comprising the stem-loop structure further comprises a stabilizing region, in some embodiments, the stabilizing region comprises at least one chain-terminating nucleoside, which functions to retard degradation and thus increase the half-life of the nucleic acid molecule. Exemplary chain-terminating nucleosides that may be used in connection with the present disclosure include 2',3'-dideoxynucleosides such as 3'-deoxyadenosine (cordycepin), 3'-deoxyuridine, 3'-deoxycytosine, 3'-deoxyguanosine, 3'-deoxythymine, 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, 2',3'-dideoxythymine, 2'-deoxynucleosides or O-methyl nucleosides, 3'-deoxynucleosides, 2',3'-dideoxynucleosides, 3'-O-methyl nucleosides, 3'-O-ethyl nucleosides, 3'-arabinosides, as well as other alternative nucleosides known in the art and / or described herein. In other embodiments, the stem-loop structure may be stabilized by modifications to the 3' region of the polynucleotide that can prevent and / or inhibit addition of oligo(U) (International Patent Publication No. WO2013 / 103659, incorporated herein by reference in its entirety).

[0297] In some embodiments, the nucleic acid molecule of the present disclosure comprises at least one stem-loop sequence and a polyA region or a polyadenylation signal. Non-limiting examples of polynucleotide sequences comprising at least one stem-loop sequence and a polyA region or a polyadenylation signal include those described in International Patent Publication No. WO2013 / 120497, International Patent Publication No. WO2013 / 120629, International Patent Publication No. WO2013 / 120500, International Patent Publication No. WO2013 / 120627, International Patent Publication No. WO2013 / 120498, International Patent Publication No. WO2013 / 120626, International Patent Publication No. WO2013 / 120499 and International Patent Publication No. WO2013 / 120628, the contents of each of which are incorporated herein by reference in their entirety.

[0298] In some embodiments, a nucleic acid molecule comprising a stem loop sequence and a polyA region or polyadenylation signal can encode a pathogenic antigen or a fragment thereof, such as the polynucleotide sequences described in International Patent Publication Nos. WO2013 / 120499 and WO2013 / 120628, the contents of each of which are incorporated herein by reference in their entirety.

[0299] In some embodiments, a nucleic acid molecule comprising a stem loop sequence and a polyA tract or polyadenylation signal can encode a therapeutic protein, such as the polynucleotide sequences described in International Patent Publication Nos. WO2013 / 120497 and WO2013 / 120629, the contents of each of which are incorporated herein by reference in their entirety.

[0300] In some embodiments, a nucleic acid molecule comprising a stem loop sequence and a polyA tract or polyadenylation signal can encode a tumor antigen or a fragment thereof, such as the polynucleotide sequences described in International Patent Publication Nos. WO2013 / 120500 and WO2013 / 120627, the contents of each of which are incorporated herein by reference in their entirety.

[0301] In some embodiments, a nucleic acid molecule comprising a stem loop sequence and a polyA region or polyadenylation signal can encode an allergenic antigen or an autoimmune autoantigen, such as the polynucleotide sequences described in International Patent Publication Nos. WO2013 / 120498 and WO2013 / 120626, the contents of each of which are incorporated herein by reference in their entirety.

[0302] Functional Nucleotide Analogues In some embodiments, the payload nucleic acid molecules described herein contain only standard nucleotides selected from A (adenosine), G (guanosine), C (cytosine), U (uridine), and T (thymidine). Without being bound by theory, it is believed that certain functional nucleotide analogs can confer useful properties to the nucleic acid molecule. Examples of such useful properties in the context of the present disclosure include, but are not limited to, increasing the stability of the nucleic acid molecule, reducing the immunogenicity of the nucleic acid molecule in inducing an innate immune response, enhancing the production of the protein encoded by the nucleic acid molecule, increasing the intracellular delivery and / or retention of the nucleic acid molecule, and / or reducing the cytotoxicity of the nucleic acid molecule.

[0303] Thus, in some embodiments, the payload nucleic acid molecule comprises at least one functional nucleotide analogue as described herein. In some embodiments, the functional nucleotide analogue comprises at least one chemical modification to the nucleobase, sugar group, and / or phosphate group. Thus, the payload nucleic acid molecule comprising at least one functional nucleotide analogue contains at least one chemical modification to the nucleobase, sugar group, and / or internucleoside linkage. Exemplary chemical modifications to the nucleobase, sugar group, or internucleoside linkage of the nucleic acid molecule are provided herein.

[0304] As described herein, a range of 0% to 100% of all nucleotides in the payload nucleic acid molecule can be a functional nucleotide analog as described herein. For example, in various embodiments, about 1% to about 20%, about 1% to about 25%, about 1% to about 50%, about 1% to about 60%, about 1% to about 70%, about 1% to about 80%, about 1% to about 90%, about 1% to about 95%, about 10% to about 20%, about 10% to about 25%, about 10% to about 50%, about 10% to about 60%, about 10% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 95%, about 10% to about 100%, about 20% to about 25%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70% , about 20% to about 80%, about 20% to about 90%, about 20% to about 95%, about 20% to about 100%, about 50% to about 60%, about 50% to about 70%, about 50% to about 80%, about 50% to about 90%, about 50% to about 95%, about 50% to about 100%, about 70% to about 80%, about 70% to about 90%, about 70% to about 95%, about 70% to about 100%, about 80% to about 90%, about 80% to about 95%, about 80% to about 100%, about 90% to about 95%, about 90% to about 100%, or about 95% to about 100% is a functional nucleotide analog as described herein. In any of these embodiments, the functional nucleotide analogue can be present at any position(s) of the nucleic acid molecule, including at the 5' end, the 3' end, and / or at one or more internal positions. In some embodiments, a single nucleic acid molecule can contain different sugar modifications, different nucleobase modifications, and / or different types of internucleoside linkages (e.g., backbone structures).

[0305] As described herein, a range of 0% to 100% of all nucleotides of a species (e.g., all purine-containing nucleotides of a species, or all pyrimidine-containing nucleotides of a species, or all A, G, C, T, or U of a species) in a payload nucleic acid molecule can be a functional nucleotide analog as described herein. For example, in various embodiments, about 1% to about 20%, about 1% to about 25%, about 1% to about 50%, about 1% to about 60%, about 1% to about 70%, about 1% to about 80%, about 1% to about 90%, about 1% to about 95%, about 10% to about 20%, about 10% to about 25%, about 10% to about 50%, about 10% to about 60%, about 10% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 95%, about 10% to about 100%, about 20% to about 25%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70% , about 20% to about 80%, about 20% to about 90%, about 20% to about 95%, about 20% to about 100%, about 50% to about 60%, about 50% to about 70%, about 50% to about 80%, about 50% to about 90%, about 50% to about 95%, about 50% to about 100%, about 70% to about 80%, about 70% to about 90%, about 70% to about 95%, about 70% to about 100%, about 80% to about 90%, about 80% to about 95%, about 80% to about 100%, about 90% to about 95%, about 90% to about 100%, or about 95% to about 100% is a functional nucleotide analog as described herein. In any of these embodiments, the functional nucleotide analogue can be present at any position(s) of the nucleic acid molecule, including at the 5' end, the 3' end, and / or at one or more internal positions. In some embodiments, a single nucleic acid molecule can contain different sugar modifications, different nucleobase modifications, and / or different types of internucleoside linkages (e.g., backbone structures).

[0306] Modifications to nucleobases In some embodiments, functional nucleotide analogs contain non-standard nucleobases. In some embodiments, standard nucleobases in nucleotides (e.g., adenine, guanine, uracil, thymine, and cytosine) can be modified or substituted to provide one or more functional analogs of nucleotides. Exemplary modifications to nucleobases include one or more substitutions or modifications, including, but not limited to, alkyl, aryl, halo, oxo, hydroxyl, alkyloxy, and / or thio substitutions, one or more condensations or ring openings, oxidations, and / or reductions.

[0307] In some embodiments, the non-standard nucleobase is a modified uracil. Exemplary nucleobases and nucleosides having modified uracil include pseudouridine (ψ), pyridin-4-one ribonucleosides, 5-aza-uracil, 6-aza-uracil, 2-thio-5-aza-uracil, 2-thio-uracil (s 2 U), 4-thio-uracil (s 4 U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uracil (ho 5 U), 5-aminoallyl-uracil, 5-halo-uracil (e.g., 5-iodo-uracil or 5-bromo-uracil), 3-methyl-uracil (m 3 U), 5-methoxy-uracil (mo 5 U), uracil 5-oxyacetic acid (cmo 5 U), uracil 5-oxyacetic acid methyl ester (mcmo 5 U), 5-carboxymethyl-uracil (cm 5 U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uracil (chm 5 U), 5-carboxyhydroxymethyl-uracil methyl ester (mchm 5 U), 5-methoxycarbonylmethyl-uracil (mcm 5 U), 5-methoxycarbonylmethyl-2-thio-uracil (mcm 5 s 2 U), 5-aminomethyl-2-thio-uracil (nm 5 s2 U), 5-methylaminomethyl-uracil (mnm 5 U), 5-methylaminomethyl-2-thio-uracil (mnm 5 s 2 U), 5-methylaminomethyl-2-seleno-uracil (mnm 5 se 2 U), 5-carbamoylmethyl-uracil (ncm 5 U), 5-carboxymethylaminomethyl-uracil (cmnm 5 U), 5-carboxymethylaminomethyl-2-thio-uracil (cmnm 5 s 2 U), 5-propynyl-uracil, 1-propynyl-pseudouracil, 5-taurinomethyl-uracil (τm 5 U), 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uracil (τm 5 5s 2 U), 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-uracil (m 5 U, i.e., having the nucleobase deoxythymine), 1-methyl-pseudouridine (m 1 ψ), 1-ethyl-pseudouridine (Et 1 ψ), 5-methyl-2-thiouracil (m 5 s 2 U), 1-methyl-4-thio-pseudouridine (m 1 s 4 ψ), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m 3 ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouracil (D), dihydropseudouridine, 5,6-dihydrouracil, 5-methyl-dihydrouracil (m 5D), 2-thio-dihydrouracil, 2-thio-dihydropseudouridine, 2-methoxy-uracil, 2-methoxy-4-thio-uracil, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uracil (acp 3 U), 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp 3 ψ), 5-(isopentenylaminomethyl)uracil (m 5 U), 5-(isopentenylaminomethyI)-2-thio-uracil (m 5 s 2 U), 5,2'-O-dimethyl-uridine (m 5 Um), 2-thio-2'-O-methyl-uridine (s 2 Um), 5-methoxycarbonylmethyl-2'-O-methyl-uridine (mcm 5 Um), 5-carbamoylmethyl-2'-O-methyl-uridine (ncm 5 Um), 5-carboxymethylaminomethyl-2'-O-methyl-uridine (cmnm 5 Um), 3,2'-O-dimethyl-uridine (m 3 Um), and 5-(isopentenylaminomethyl)-2'-O-methyl-uridine (inm 5 Um), 1-thio-uracil, deoxythymidine, 5-(2-carbomethoxyvinyl)-uracil, 5-(carbamoylhydroxymethyl)-uracil, 5-carbamoylmethyl-2-thio-uracil, 5-carboxymethyl-2-thio-uracil, 5-cyanomethyl-uracil, 5-methoxy-2-thio-uracil, and 5-[3-(1-E-propenylamino)]uracil.

[0308] In some embodiments, the non-standard nucleobase is a modified cytosine. Exemplary nucleobases and nucleosides having modified cytosines include 5-aza-cytosine, 6-aza-cytosine, pseudoisocytosine, 3-methyl-cytosine (m3C), N4-acetyl-cytosine (ac4C), 5-formyl-cytosine (f5C), N4-methyl-cytosine (m4C), 5-methyl-cytosine (m5C), 5-halo-cytosine (e.g., 5-iodo-cytosine), 5- Hydroxymethyl-cytosine (hm5C), 1-methyl-pseudoisocytidine, pyrrolo-cytosine, pyrrolo-pseudoisocytidine, 2-thio-cytosine (s2C), 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine doisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytosine, 2-methoxy-5-methyl-cytosine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, lysine (k2C), 5,2'-O-dimethyl-cytidine (m5Cm), N4-aza-cytidine, These include cetyl-2'-O-methyl-cytidine (ac4Cm), N4,2'-O-dimethyl-cytidine (m4Cm), 5-formyl-2'-O-methyl-cytidine (fSCm), N4,N4,2'-O-trimethyl-cytidine (m42Cm), 1-thio-cytosine, 5-hydroxy-cytosine, 5-(3-azidopropyl)-cytosine, and 5-(2-azidoethyl)-cytosine.

[0309] In some embodiments, the non-standard nucleobase is a modified adenine. Exemplary nucleobases and nucleosides with an alternative adenine include 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diamino ...2,6-diaminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-2,6-diaminopurine, 7-deaza- Aza-2,6-diaminopurine, 1-methyl-adenine (m1A), 2-methyl-adenine (m2A), N6-methy-adenine (m6A), 2-methylthio-N6-methyl-adenine (ms2m6A), N6-isopentenyl-adenine (i6A), 2-methylthio-N6-isopentenyl-adenine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarboxamide N6-threonylcarbamoyl-adenine (g6A), N6-threonylcarbamoyl-adenine (t6A), N6-methyl-N6-threonylcarbamoyl-adenine (m6t6A), 2-methylthio-N6-threonylcarbamoyl-adenine (ms2g6A), N6,N6-dimethyl-adenine (m62A), N6-hydroxynorvalylcarbamoyl-adenine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenine (ms2hn6A), N6-acetyl-adenine (ac6A), 7-methyl -adenine, 2-methylthio-adenine, 2-methoxy-adenine, N6,2'-O-dimethyl-adenosine (m6Am), N6,N6,2'-O-trimethyl-adenosine (m62Am), 1,2'-O-dimethyl-adenosine (m1Am), 2-amino-N6-methyl-purine, 1-thio-adenine, 8-azido-adenine, N6-(19-amino-pentaoxanonadecyl)-adenine, 2,8-dimethyl-adenine, N6-formyl-adenine, and N6-hydroxymethyl-adenine.

[0310] In some embodiments, the non-standard nucleobase is a modified guanine. Exemplary nucleobases and nucleosides having modified guanine include inosine (I), 1-methyl-inosine (m1I), wyosine (imG), methylwyosine (mimG), 4-demethyl-wyosine (imG-14), isowyosine (imG2), wyosine (yW), peroxywyosine (o2yW), hydroxywyosine (OHyW), hypomodified hydroxywyosine (OHyW), and hydroxywyosine (OHyW). * ), 7-deaza-guanine, queuosine (Q), epoxyqueuosine (oQ), galactosyl-queuosine (galQ), mannosyl-queuosine (manQ), 7-cyano-7-deaza-guanine (preQO), 7-aminomethyl-7-deaza-guanine (preQ1), archaeosine (G+), 7-deaza-8-aza-guanine, 6-thio-guanine, 6-thio-7-deaza-guanine, 6-thio-7-deaza-8-aza-guanine, 7-methyl-guanine (m7G), 6-thio-7-methyl-guanine, 7-methyl-inosine, 6-methoxy-guanine, 1-methyl-guanine (m1G), N2-methyl-guanine (m2G), N2,N2-dimethyl-guanine (m22G), N2,7- Dimethyl-guanine (m2,7G), N2,N2,7-dimethylguanine (m2,2,7G), 8-oxo-guanine, 7-methyl-8-oxo-guanine, 1-methyl-6-thio-guanine, N2-methyl-6-thio-guanine, N2,N2-dimethyl-6-thio-guanine, N2-methyl-2'-O-methyl-guanine (m2Gm), N2,N2-dimethyl-2'-O-methyl-guanosine (m22Gm), 1-methyl-2'-O-methyl-guanosine (m1Gm), N2,7-dimethyl-2'-O-methyl-guanosine (m2,7Gm), 2'-O-methyl-inosine (Im), 1,2'-O-dimethyl-inosine (m1Im), 1-thio-guanine, and O-6-methyl-guanine.

[0311] In some embodiments, the non-standard nucleobase of the functional nucleotide analog can be independently a purine, a pyrimidine, a purine or a pyrimidine analog. For example, in some embodiments, the non-standard nucleobase can be a modified adenine, cytosine, guanine, uracil, or hypoxanthine. In other embodiments, non-standard nucleobases include, for example, pyrazolo[3,4-d]pyrimidine, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothiothymine and 2-thiocytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo (e.g., 8-bromo), 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-amino derivatives of adenine and guanine. Naturally occurring and synthetic derivatives of bases including substituted adenines and guanines, 5-halo, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, deazaguanine, 7-deazaguanine, 3-deazaguanine, deazaadenine, 7-deazaadenine, 3-deazaadenine, pyrazolo[3,4-d]pyrimidines, imidazo[1,5-a]1,3,5 triazinones, 9-deazapurines, imidazo[4,5-d]pyrazines, thiazolo[4,5-d]pyrimidines, pyrazin-2-ones, 1,2,4-triazines, pyridazines, or 1,3,5 triazines.

[0312] Sugar modifications In some embodiments, the functional nucleotide analog contains a non-standard sugar group. In various embodiments, the non-standard sugar group can be a 5- or 6-carbon sugar (e.g., pentose, ribose, arabinose, xylose, glucose, galactose, or deoxy derivatives thereof) with one or more substitutions such as halo, hydroxy, thiol, alkyl, alkoxy, alkenyloxy, alkynyloxy, cycloalkyl, aminoalkoxy, alkoxyalkoxy, hydroxyalkoxy, amino, azido, aryl, aminoalkyl, aminoalkenyl, aminoalkynyl groups.

[0313] Generally, RNA molecules contain a ribose sugar group, which is a five-membered ring with oxygen. Exemplary non-limiting alternative nucleotides include those that replace the oxygen in the ribose (e.g., with S, Se, or an alkylene such as methylene or ethylene), add a double bond (e.g., replacing ribose with cyclopentenyl or cyclohexenyl), ring contraction of ribose (e.g., forming a cyclobutane or oxetane four-membered ring), ring expansion of ribose (e.g., anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino (also having a phosphoramidate backbone), etc. These include "unlocked" forms such as tricyclic and glycol nucleic acids (GNAs) (e.g., R-GNA or S-GNA in which the ribose is replaced by a glycol unit linked to a phosphodiester bond), threose nucleic acid (TNA in which the ribose is replaced by α-L-threofuranosyl-(3'→2'), and peptide nucleic acid (PNA in which 2-amino-ethyl-glycine linkages replace the ribose and phosphodiester backbone).

[0314] In some embodiments, the sugar group contains one or more carbons that have the opposite stereochemical configuration of the corresponding carbon in ribose.Thus, a nucleic acid molecule can contain, for example, nucleotides that contain arabinose or L-ribose as sugar.In some embodiments, a nucleic acid molecule contains at least one nucleoside, and the sugar is L-ribose, 2'-O-methyl ribose, 2'-fluoro ribose, arabinose, hexitol, LNA, or PNA.

[0315] Modification of internucleoside linkages In some embodiments, the payload nucleic acid molecules of the present disclosure may contain one or more modified internucleoside linkages (e.g., a phosphate backbone). The backbone phosphate group may be modified by replacing one or more oxygen atoms with a different substituent.

[0316] In some embodiments, functional nucleotide analogs can include the replacement of unmodified phosphate moieties with alternative internucleoside linkages as described herein. Examples of alternative phosphate groups include, but are not limited to, phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters. Phosphorodithioates replace both non-linked oxygens with sulfur. Phosphate linkers can also be modified by replacing linked oxygens with nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylene-phosphonates).

[0317] Alternative nucleosides and nucleotides replace one or more of the non-bridging oxygens with a borane moiety (BH 3), sulfur (thio), methyl, ethyl, and / or methoxy. As a non-limiting example, two non-bridging oxygens at the same position (e.g., alpha (α), beta (β), or gamma (γ) positions) can be replaced with sulfur (thio) and methoxy. Replacement of one or more of the oxygen atoms at the phosphate moiety positions (e.g., α-thiophosphate) provides for imparting stability (such as against exonucleases and endonucleases) to RNA and DNA via the unnatural phosphorothioate backbone linkage. Phosphorothioate DNA and RNA have increased nuclease resistance and subsequently longer half-life in the cellular environment.

[0318] Other internucleoside linkages that can be used in accordance with the present disclosure, including internucleoside linkages that do not contain a phosphorus atom, are described herein.

[0319] Further examples of nucleic acid molecules (e.g., mRNA), compositions, formulations and / or methods related thereto that may be used in connection with the present disclosure include WO2002 / 098443, WO2003 / 051401, WO2008 / 052770, WO2009127230, WO2006122828, WO2008 / 083949, WO2010088927, WO2010 / 037539, WO2004 / 004743, WO2009127230, WO2006122828, WO2008 / 083949, WO2010088927, WO2010 / 037539, WO2004 / 004743, WO2009127230, WO2009127230, WO2009127230, WO2009127230, WO2009127230, WO2009122828, WO2009127230 ... 005 / 016376, WO2006 / 024518, WO2007 / 095976, WO2008 / 014979, WO2008 / 077592, WO2009 / 030481, WO2009 / 09522 6, WO2011069586, WO2011026641, WO2011 / 144358, WO2012019780, WO2012013326, WO2012089338, WO2012113513, WO2012116811, WO2012116810, WO2013113502, WO2013113501, WO2013113736, WO2013143698, WO2013143699, WO 2013143700, WO2013 / 120626, WO2013120627, WO2013120628, WO2013120629, WO2013174409, WO2014127917, WO20 No. 15 / 024669, WO2015 / 024668, WO2015 / 024667, WO2015 / 024665, WO2015 / 024666, WO2015 / 024664, WO2015101415, WO2015101414, WO2015024667, WO2015062738, WO2015101416, the contents of each of which are incorporated herein in their entirety.

[0320] 5.5 Preparations According to the present disclosure, the nanoparticle compositions described herein may include at least one lipid component and one or more additional components, such as a therapeutic agent and / or a prophylactic agent. The nanoparticle compositions may be designed for one or more specific applications or targets. The components of the nanoparticle composition may be selected based on the specific application or target, and / or based on the efficacy, toxicity, cost, ease of use, availability, or other characteristics of one or more components. Similarly, a particular formulation of the nanoparticle composition may be selected for a particular application or target, for example, depending on the efficacy and toxicity of a particular combination of components.

[0321] The lipid component of the nanoparticle composition may include, for example, lipids according to one of formulas (I)-(IV) (and subformulas thereof) described herein, phospholipids (unsaturated lipids such as DOPE or DSPC), PEG lipids, and structural lipids. Elements of the lipid component may be provided in specific fractions.

[0322] In one embodiment, provided herein is a nanoparticle composition comprising a cationic or ionizable lipid compound provided herein, a therapeutic agent, and one or more excipients. In one embodiment, the cationic or ionizable lipid compound comprises a compound according to one of formulas (I)-(IV) (and subformulas thereof) described herein, and optionally one or more additional ionizable lipid compounds. In one embodiment, the one or more excipients are selected from neutral lipids, steroids, and polymer-conjugated lipids. In one embodiment, the therapeutic agent is encapsulated within or associated with the lipid nanoparticles.

[0323] In one embodiment, provided herein is a nanoparticle composition (lipid nanoparticle) comprising: i) 40 to 50 mole percent cationic lipid; ii) neutral lipids, iii) steroids, iv) polymer-conjugated lipids, and v) Therapeutic agents.

[0324] As used herein, "mole percent" refers to the ratio of moles of a component to the total moles of all lipid components (i.e., the total moles of cationic lipid(s), neutral lipids, steroids, and polymer-conjugated lipids) in the LNP.

[0325] In one embodiment, the lipid nanoparticles comprise 41-49 molar percent, 41-48 molar percent, 42-48 molar percent, 43-48 molar percent, 44-48 molar percent, 45-48 molar percent, 46-48 molar percent, or 47.2-47.8 molar percent cationic lipid. In one embodiment, the lipid nanoparticles comprise about 47.0, 47.1, 47.2, 47.3, 47.4, 47.5, 47.6, 47.7, 47.8, 47.9, or 48.0 molar percent cationic lipid.

[0326] In one embodiment, the neutral lipid is present at a concentration ranging from 5 to 15 molar percent, 7 to 13 molar percent, or 9 to 11 molar percent. In one embodiment, the neutral lipid is present at a concentration of about 9.5, 10, or 10.5 molar percent. In one embodiment, the molar ratio of cationic lipid to neutral lipid ranges from about 4.1:1.0 to about 4.9:1.0, from about 4.5:1.0 to about 4.8:1.0, or from about 4.7:1.0 to 4.8:1.0.

[0327] In one embodiment, the steroid is present at a concentration ranging from 39-49 molar percent, 40-46 molar percent, 40-44 molar percent, 40-42 molar percent, 42-44 molar percent, or 44-46 molar percent. In one embodiment, the steroid is present at a concentration of 40, 41, 42, 43, 44, 45, or 46 molar percent. In one embodiment, the molar ratio of cationic lipid to steroid ranges from 1.0:0.9 to 1.0:1.2, or 1.0:1.0 to 1.0:1.2. In one embodiment, the steroid is cholesterol.

[0328] In one embodiment, the ratio of therapeutic agent to lipid in the LNP (i.e., N / P, where N represents the moles of cationic lipid and P represents the moles of phosphate present as part of the nucleic acid backbone) ranges from 2:1 to 30:1, e.g., 3:1 to 22:1. In one embodiment, N / P ranges from 6:1 to 20:1 or 2:1 to 12:1. Exemplary N / P ranges include about 3:1, about 6:1, about 12:1, and about 22:1.

[0329] In one embodiment, provided herein is a lipid nanoparticle comprising: i) a cationic lipid having an effective pKa greater than 6.0; ii) 5 to 15 mole percent neutral lipid; iii) 1 to 15 mole percent of anionic lipid; iv) 30 to 45 mole percent steroids; v) polymer-conjugated lipids, and vi) a therapeutic agent, or a pharma- ceutically acceptable salt or prodrug thereof; The mole percentage is determined based on the total moles of lipid present within the lipid nanoparticle.

[0330] In one embodiment, cationic lipid can be any of several lipid species that carry a net positive charge at a selected pH, such as physiological pH.Exemplary cationic lipids are described herein below.In one embodiment, cationic lipid has a pKa of greater than 6.25.In one embodiment, cationic lipid has a pKa of greater than 6.5.In one embodiment, cationic lipid has a pKa of greater than 6.1, greater than 6.2, greater than 6.3, greater than 6.35, greater than 6.4, greater than 6.45, greater than 6.55, greater than 6.6, greater than 6.65, or greater than 6.7.

[0331] In one embodiment, the lipid nanoparticles comprise 40-45 mole percent cationic lipids.In one embodiment, the lipid nanoparticles comprise 45-50 mole percent cationic lipids.

[0332] In one embodiment, the molar ratio of cationic lipid to neutral lipid ranges from about 2: 1 to about 8: 1. In one embodiment, the lipid nanoparticles comprise between 5 and 10 mole percent neutral lipid.

[0333] Exemplary anionic lipids include, but are not limited to, phosphatidylglycerol, dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG) or 1,2-distearoyl-sn-glycero-3-phospho-(1'-lac-glycerol) (DSPG).

[0334] In one embodiment, the lipid nanoparticles comprise 1-10 molar percent anionic lipid. In one embodiment, the lipid nanoparticles comprise 1-5 molar percent anionic lipid. In one embodiment, the lipid nanoparticles comprise 1-9 molar percent, 1-8 molar percent, 1-7 molar percent, or 1-6 molar percent anionic lipid. In one embodiment, the molar ratio of anionic lipid to neutral lipid ranges from 1:1 to 1:10.

[0335] In one embodiment, the steroid is cholesterol. In one embodiment, the molar ratio of cationic lipid to cholesterol ranges from about 5:1 to 1:1. In one embodiment, the lipid nanoparticles comprise 32 to 40 mole percent of steroid.

[0336] In one embodiment, the sum of the molar percentage of neutral lipids and the molar percentage of anionic lipids ranges from 5 to 15 molar percentage. In one embodiment, the sum of the molar percentage of neutral lipids and the molar percentage of anionic lipids ranges from 7 to 12 molar percentage.

[0337] In one embodiment, the molar ratio of anionic lipid to neutral lipid ranges from 1:1 to 1:10. In one embodiment, the sum of the molar percentage of neutral lipid and the molar percentage of steroid ranges from 35 to 45 molar percentage.

[0338] In one embodiment, the lipid nanoparticle comprises: i) 45 to 55 mole percent cationic lipid; ii) 5 to 10 mole percent neutral lipids; iii) 1 to 5 mole percent of an anionic lipid, and iv) 32-40 mole percent steroids.

[0339] In one embodiment, the lipid nanoparticles comprise 1.0 to 2.5 mole percent of conjugated lipid, hi one embodiment, the polymer-conjugated lipid is present at a concentration of about 1.5 mole percent.

[0340] In one embodiment, the neutral lipid is present at a concentration ranging from 5 to 15 molar percent, 7 to 13 molar percent, or 9 to 11 molar percent. In one embodiment, the neutral lipid is present at a concentration of about 9.5, 10, or 10.5 molar percent. In one embodiment, the molar ratio of cationic lipid to neutral lipid is in the range of about 4.1:1.0 to about 4.9:1.0, about 4.5:1.0 to about 4.8:1.0, or about 4.7:1.0 to 4.8:1.0.

[0341] In one embodiment, the steroid is cholesterol. In some embodiments, the steroid is present at a concentration ranging from 39-49 molar percent, 40-46 molar percent, 40-44 molar percent, 40-42 molar percent, 42-44 molar percent, or 44-46 molar percent. In one embodiment, the steroid is present at a concentration of 40, 41, 42, 43, 44, 45, or 46 molar percent. In some embodiments, the molar ratio of cationic lipid to steroid ranges from 1.0:0.9 to 1.0:1.2, or 1.0:1.0 to 1.0:1.2.

[0342] In one embodiment, the molar ratio of cationic lipid to steroid ranges from 5:1 to 1:1.

[0343] In one embodiment, the lipid nanoparticles comprise 1.0 to 2.5 mole percent of conjugated lipid, hi one embodiment, the polymer-conjugated lipid is present at a concentration of about 1.5 mole percent.

[0344] In one embodiment, the molar ratio of cationic lipid to polymer-conjugated lipid ranges from about 100:1 to about 20:1. In one embodiment, the molar ratio of cationic lipid to polymer-conjugated lipid ranges from about 35:1 to about 25:1.

[0345] In one embodiment, the lipid nanoparticles have an average diameter in the range of 50 nm to 100 nm, or 60 nm to 85 nm.

[0346] In one embodiment, the composition comprises a cationic lipid provided herein, DSPC, cholesterol, and PEG-lipid, and mRNA. In one embodiment, the cationic lipid provided herein, DSPC, cholesterol, and PEG-lipid are in a molar ratio of about 50:10:38.5:1.5.

[0347] Nanoparticle compositions may be designed for one or more specific applications or targets. For example, nanoparticle compositions may be designed to deliver therapeutic and / or prophylactic agents, such as RNA, to specific cells, tissues, organs, or systems or groups thereof within the mammalian body. The physiochemical properties of the nanoparticle composition may be modified to increase selectivity for specific body targets. For example, particle size may be adjusted based on fenestration size of various organs. The therapeutic and / or prophylactic agents included in the nanoparticle composition may be selected based on the desired delivery target(s). For example, therapeutic and / or prophylactic agents may be selected for a specific indication, condition, disease or disorder and / or for delivery to specific cells, tissues, organs, or systems or groups thereof (e.g., localized or specific delivery). In certain embodiments, nanoparticle compositions may include mRNA encoding a polypeptide of interest that can be translated in a cell to produce the polypeptide of interest. Such compositions may be designed to be specifically delivered to a specific organ. In certain embodiments, compositions may be designed to be specifically delivered to the mammalian liver.

[0348] The amount of therapeutic and / or prophylactic agent in the nanoparticle composition can depend on the size, composition, desired target and / or use, or other properties of the nanoparticle composition, as well as the properties of the therapeutic and / or prophylactic agent. For example, the amount of RNA useful in a nanoparticle composition can depend on the size, sequence, and other characteristics of the RNA. The relative amounts of therapeutic and / or prophylactic agent and other components (e.g., lipids) in the nanoparticle composition can also vary. In some embodiments, the weight / weight ratio of lipid component to therapeutic and / or prophylactic agent in the nanoparticle composition can be about 5:1 to about 60:1, such as 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1, and 60:1. For example, the weight / weight ratio of lipid component to therapeutic and / or prophylactic agent can be from about 10:1 to about 40:1. In certain embodiments, the weight / weight ratio is about 20:1. The amount of therapeutic and / or prophylactic agent in the nanoparticle composition can be measured, for example, using absorption spectroscopy (e.g., UV-Vis spectroscopy).

[0349] In some embodiments, the nanoparticle composition comprises one or more RNAs, and the one or more RNAs, lipids, and amounts thereof can be selected to provide a particular N:P ratio. The N:P ratio of a composition refers to the molar ratio of the nitrogen atoms in the one or more lipids to the number of phosphate groups in the RNA. In some embodiments, a lower N:P ratio is selected. The one or more RNAs, lipids, and amounts thereof can be selected to provide an N:P ratio of about 2:1 to about 30:1, such as 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 12:1, 14:1, 16:1, 18:1, 20:1, 22:1, 24:1, 26:1, 28:1, or 30:1. In certain embodiments, the N:P ratio can be about 2:1 to about 8:1. In other embodiments, the N:P ratio is about 5:1 to about 8:1. For example, the N:P ratio can be about 5.0:1, about 5.5:1, about 5.67:1, about 6.0:1, about 6.5:1, or about 7.0:1. For example, the N:P ratio can be about 5.67:1.

[0350] The physical properties of a nanoparticle composition may depend on its components. For example, a nanoparticle composition that contains cholesterol as a structural lipid may have different properties compared to a nanoparticle composition that contains a different structural lipid. Similarly, the properties of a nanoparticle composition may depend on the absolute or relative amounts of its components. For example, a nanoparticle composition that contains a higher molar fraction of phospholipids may have different properties than a nanoparticle composition that contains a lower molar fraction of phospholipids. Properties may also vary depending on the preparation method and conditions of the nanoparticle composition.

[0351] Nanoparticle compositions can be characterized by various methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of nanoparticle compositions. Dynamic light scattering or potentiometry (e.g., potentiometric titration) can be used to measure zeta potential. Dynamic light scattering can also be used to determine particle size. Instruments such as Zetasizer Nano ZS (Malvem Instruments Ltd, Malvem, Worcestershire, UK) can also be used to measure several properties of nanoparticle compositions, such as particle size, polydispersity index, and zeta potential.

[0352] In various embodiments, the average size of the nanoparticle composition can be tens of nanometers to hundreds of nanometers, for example, the average size can be about 40 nm to about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In some embodiments, the average size of the nanoparticle composition can be about 50 nm to about 100 nm, about 50 nm to about 90 nm, about 50 nm to about 80 nm, about 50 nm to about 70 nm, about 50 nm to about 60 nm, about 60 nm to about 100 nm, about 60 nm to about 90 nm, about 60 nm to about 80 nm, about 60 nm to about 70 nm, about 70 nm to about 100 nm, about 70 nm to about 90 nm, about 70 nm to about 80 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, or about 90 nm to about 100 nm. In certain embodiments, the average size of the nanoparticle composition can be about 70 nm to about 100 nm. In some embodiments, the average size can be about 80 nm. In other embodiments, the average size can be about 100 nm.

[0353] The nanoparticle composition may be relatively homogeneous. The polydispersity index may be used to indicate the homogeneity of the nanoparticle composition, for example, the particle size distribution of the nanoparticle composition. A small (e.g., less than 0.3) polydispersity index generally indicates a narrow particle size distribution. The nanoparticle composition may have a polydispersity index of about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of the nanoparticle composition may be about 0.10 to about 0.20.

[0354] The zeta potential of a nanoparticle composition can be used to indicate the electrokinetic potential of the composition. For example, the zeta potential can describe the surface charge of a nanoparticle composition. Nanoparticle compositions with a relatively low positive or negative charge are generally desirable, since more highly charged species can cause undesirable interactions with cells, tissues, and other elements in the body. In some embodiments, the zeta potential of the nanoparticle composition can be about -10 mV to about +20 mV, about -10 mV to about +15 mV, about -10 mV to about +10 mV, about -10 mV to about +5 mV, about -10 mV to about 0 mV, about -10 mV to about -5 mV, about -5 mV to about +20 mV, about -5 mV to about +15 mV, about -5 mV to about +10 mV, about -5 mV to about +5 mV, about -5 mV to about 0 mV, about 0 mV to about +20 mV, about 0 mV to about +15 mV, about 0 mV to about +10 mV, about 0 mV to about +5 mV, about +5 mV to about +20 mV, about +5 mV to about +15 mV, or about +5 mV to about +10 mV.

[0355] The efficiency of encapsulation of a therapeutic and / or prophylactic agent describes the amount of therapeutic and / or prophylactic agent that is encapsulated or otherwise associated with a nanoparticle composition after preparation relative to the initial amount provided. It is desirable for the encapsulation efficiency to be high (e.g., close to 100%). The encapsulation efficiency can be measured, for example, by comparing the amount of therapeutic and / or prophylactic agent in a solution containing the nanoparticle composition before and after disintegration of the nanoparticle composition with one or more organic solvents or detergents. Fluorescence can be used to measure the amount of free therapeutic and / or prophylactic agent (e.g., RNA) in the solution. For the nanoparticle compositions described herein, the encapsulation efficiency of a therapeutic and / or prophylactic agent can be at least 50%, for example, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency may be at least 80%. In certain embodiments, the encapsulation efficiency may be at least 90%.

[0356] Nanoparticle composition can optionally include one or more coatings.For example, nanoparticle composition can be formulated into capsule, film or tablet with coating.Capsule, film or tablet containing the composition described herein can have any useful size, tensile strength, hardness or density.

[0357] 5.6 Pharmaceutical Compositions In accordance with the present disclosure, the nanoparticle composition may be formulated in whole or in part as a pharmaceutical composition. A pharmaceutical composition may include one or more nanoparticle compositions. For example, a pharmaceutical composition may include one or more nanoparticle compositions that include one or more different therapeutic and / or prophylactic agents. A pharmaceutical composition may further include one or more pharma- ceutically acceptable excipients or auxiliary ingredients, such as those described herein. General guidelines for the formulation and manufacture of pharmaceutical compositions and medicaments can be found, for example, in Remington's The Science and Practice of Pharmacy, 21 st Edition, AR Gennaro; Lippincott, Williams & Wilkins, Baltimore, Md., 2006. Conventional excipients and auxiliary ingredients can be used in any pharmaceutical composition, except insofar as any conventional excipient or auxiliary ingredient may be incompatible with one or more components of the nanoparticle composition. An excipient or auxiliary ingredient may be incompatible with a component of the nanoparticle composition if its combination with the component may result in any undesirable biological effect or other deleterious effect.

[0358] In some embodiments, one or more excipients or auxiliary ingredients can comprise more than 50% of the total mass or volume of a pharmaceutical composition comprising a nanoparticle composition. For example, one or more excipients or auxiliary ingredients can comprise 50%, 60%, 70%, 80%, 90%, or more of pharmaceutical convention. In some embodiments, a pharma- ceutically acceptable excipient is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% pure. In some embodiments, the excipient is approved for human and veterinary use. In some embodiments, the excipient is approved by the United States Food and Drug Administration. In some embodiments, the excipient is pharmaceutical grade. In some embodiments, the excipient meets the standards of the United States Pharmacopoeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia, and / or the International Pharmacopoeia.

[0359] The relative amounts of one or more nanoparticle compositions, one or more pharma- ceutically acceptable excipients, and / or any additional components in a pharmaceutical composition according to the invention may vary depending on the identity, size, and / or condition of the subject being treated, and / or further depending on the route by which the composition is administered. By way of example, a pharmaceutical composition may contain from 0.1% to 100% (w / w) of one or more nanoparticle compositions.

[0360] In certain embodiments, the nanoparticle compositions and / or pharmaceutical compositions of the present disclosure are refrigerated or frozen for storage and / or shipping (e.g., stored at a temperature of 4°C or less, such as at about -150°C to about 0°C, or at about -80°C to about -20°C (e.g., at about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C, or -150°C). For example, a pharmaceutical composition comprising a compound of any of Formulas (I)-(IV) (and subformulas thereof) is a solution that is refrigerated for storage and / or shipping, e.g., at about -20°C, -30°C, -40°C, -50°C, -60°C, -70°C, or -80°C. In certain embodiments, the present disclosure also relates to methods of increasing the stability of a nanoparticle composition and / or pharmaceutical composition comprising a compound of any of Formulas (I)-(IV) (and subformulas thereof) by storing the nanoparticle composition and / or pharmaceutical composition at a temperature below 4°C, such as from about -150°C to about 0°C, or from about -80°C to about -20°C, e.g., at a temperature of about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C, or -150°C. For example, the nanoparticle compositions and / or pharmaceutical compositions disclosed herein are stable, for example, at a temperature of 4° C. or below (e.g., about 4° C. to −20° C.) for about at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 1 month, at least 2 months, at least 4 months, at least 6 months, at least 8 months, at least 10 months, at least 12 months, at least 14 months, at least 16 months, at least 18 months, at least 20 months, at least 22 months, or at least 24 months. In one embodiment, the formulation is stabilized at about 4° C. for at least 4 weeks. In certain embodiments, the pharmaceutical composition of the present disclosure comprises a nanoparticle composition disclosed herein and a pharma- ceutically acceptable carrier selected from one or more of Tris, acetate (e.g., sodium acetate), citrate (e.g., sodium citrate), saline, PBS, and sucrose.In certain embodiments, a pharmaceutical composition of the present disclosure has a pH value of about 7-8 (e.g., 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0, or 7.5-8, or 7-7.8). For example, a pharmaceutical composition of the present disclosure includes a nanoparticle composition disclosed herein, Tris, saline, and sucrose, and has a pH of about 7.5-8, e.g., suitable for storage and / or shipping at about -20°C. For example, a pharmaceutical composition of the present disclosure includes a nanoparticle composition disclosed herein and PBS, and has a pH of about 7-7.8, e.g., suitable for storage and / or shipping at about 4°C or below. "Stability," "stabilized," and "stable," in the context of this disclosure, refer to the resistance of the nanoparticle compositions and / or pharmaceutical compositions disclosed herein to chemical or physical changes (e.g., degradation, change in particle size, aggregation, change in encapsulation, etc.) under given conditions of manufacture, preparation, transportation, storage, and / or use, e.g., when subjected to stresses such as shear forces, freeze / thaw stresses, etc.

[0361] Nanoparticle compositions and / or pharmaceutical compositions comprising one or more nanoparticle compositions may be administered to any patient or subject, including those who may benefit from a therapeutic effect provided by delivery of a therapeutic and / or prophylactic agent to one or more specific cells, tissues, organs, or systems or groups thereof, such as the renal system. The description provided herein of nanoparticle compositions and pharmaceutical compositions comprising nanoparticle compositions is primarily directed to compositions suitable for administration to humans, but it will be understood by those skilled in the art that such compositions are generally suitable for administration to any other mammal. Modifications of compositions suitable for administration to humans to provide compositions suitable for administration to a variety of animals are well understood, and such modifications, if any, can be designed and / or performed by an ordinarily skilled veterinary pharmacologist with no more than routine experimentation. Subjects to which administration of the compositions is contemplated include, but are not limited to, humans, other primates, and other mammals, including commercially relevant mammals such as cows, pigs, horses, sheep, cats, dogs, mice, and / or rats.

[0362] Pharmaceutical compositions containing one or more nanoparticle compositions may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such methods of preparation involve bringing into association the active ingredient with an excipient and / or one or more other accessory ingredients, and then dividing, shaping, and / or packaging the product into desired single or multiple dosage units, as desired or necessary.

[0363] Pharmaceutical compositions according to the present disclosure may be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or as a plurality of single unit doses. As used herein, a "unit dose" is a discrete amount of a pharmaceutical composition comprising a predetermined amount of an active ingredient (e.g., a nanoparticle composition). The amount of the active ingredient is generally equal to the dosage of the active ingredient that would be administered to a subject and / or a convenient fraction of such a dosage, such as, for example, one-half or one-third of such a dosage.

[0364] Pharmaceutical compositions can be prepared in various forms suitable for various routes and methods of administration. For example, pharmaceutical compositions can be prepared in liquid dosage forms (e.g., emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and elixirs), injectable dosage forms, solid dosage forms (e.g., capsules, tablets, pills, powders, and granules), dosage forms for topical and / or transdermal administration (e.g., ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, and patches), suspensions, powders, and other forms.

[0365] Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharma- ceutically acceptable emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and elixirs.In addition to the active ingredient, liquid dosage forms may contain, for example, inert diluents commonly used in the art, such as water or other solvents, solubilizers, and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, cyclodextrin, dimethylformamide, oils (especially cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil, and sesame oil), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycol, and fatty acid ester sorbitan, and mixtures thereof. In addition to inert diluents, oral compositions may contain additional agents such as additional therapeutic and / or prophylactic agents, wetting agents, emulsifying and suspending agents, sweetening, flavoring, and / or perfuming agents, etc. In certain embodiments for parenteral administration, the compositions are mixed with solubilizing agents such as Cremophor™, alcohols, oils, modified oils, glycols, polysorbates, cyclodextrins, polymers, and / or combinations thereof.

[0366] Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions, can be formulated according to known techniques using suitable dispersing agents, wetting agents and / or suspending agents. Sterile injectable preparations can also be sterile injectable solutions, suspensions, and / or emulsions in non-toxic parenterally acceptable diluents and / or solvents, for example, as solutions in 1,3-butanediol. Among the acceptable vehicles and solvents that can be used are water, Ringer's solution, USP, and isotonic sodium chloride solution. As a solvent or suspending medium, sterile fixed oils are conventionally used. For this purpose, any non-irritating fixed oil can be used, including synthetic mono- or diglycerides. Fatty acids such as oleic acid can be used in the preparation of injectables.

[0367] Injectable preparations can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other injectable sterile medium prior to use.

[0368] The disclosure features methods of delivering a therapeutic and / or prophylactic agent to a mammalian cell or organ, producing a polypeptide of interest in the mammalian cell, and treating a disease or disorder in a mammal in need thereof, comprising administering to the mammal and / or contacting the mammalian cell with a nanoparticle composition comprising the therapeutic and / or prophylactic agent. EXAMPLES

[0369] The examples in this section are offered by way of illustration and not by way of limitation.

[0370] Common method. General Prep HPLC Method: HPLC purification is performed on a Waters 2767 equipped with a diode array detector (DAD) on an Inertsil Pre-C8 OBD column, typically using water containing 0.1% TFA as solvent A and acetonitrile as solvent B.

[0371] General LCMS method: LCMS analysis is performed on a Shimadzu (LC-MS2020) system. Generally, chromatography is performed on a SunFire C18 using water containing 0.1% formic acid as solvent A and acetonitrile containing 0.1% formic acid as solvent B.

[0372] 6.1 Example 1: Preparation of Compound 1. [ka] Step 1: Preparation of intermediate 1-2 To a solution of 1-1 (1.9 g, 4.53 mmol, 2.1 equiv) and 2-aminoethanol (132.0 mg, 2.16 mmol, 1.0 equiv) in ACN (15.0 mL) was added K2 CO 3 (626mg, 4.53mmol, 2.1eq), Cs 2 CO 3 (210.0 mg, 0.65 mmol, 0.3 equiv) and NaI (20.0 mg, 0.11 mmol, 0.05 equiv) were added at room temperature. The mixture was stirred at 80 °C for 144 h. LCMS showed the reaction was complete, and the mixture was evaporated under reduced pressure and purified by flash column chromatography (FCC) (petroleum ether / ethyl acetate (PE / EA) = 10 / 1 to 4 / 1) to give 1-2 (1.1 g, 69% yield) as a colorless oil.

[0373] Step 2: Preparation of intermediates 1-3 CHCl 3 To a solution of 1-2 (1.1 g, 1.5 mmol, 1.0 equiv) in 15.0 mL of SOCl 2 (535.0 mg, 4.5 mmol, 3.0 equiv) was added at room temperature. The mixture was stirred for 16 h. LCMS showed the reaction was complete, and the mixture was evaporated under reduced pressure to give 1-3 (1.0 g, crude) as a brown oil.

[0374] Step 3: Preparation of intermediates 1-5 A mixture of ketone 1-4 (0.7 g, 10.0 mmol, 1.0 equiv), titanium(IV) isopropoxide (3.69 g, 13 mmol, 1.3 equiv), and 2-aminoethanol (1.83 g, 30.0 mmol, 3.0 equiv) in methanol (10.0 mL) was stirred at room temperature under argon for 5 h. Sodium borohydride (380.0 mg, 10.0 mmol, 1.0 equiv) was then added at 0° C. and the resulting mixture was stirred for an additional 2 h. The reaction was then quenched by adding water (10.0 mL). Stirring was continued at room temperature for 20 min, and the reaction mixture was then acidified with hydrochloric acid (1 M, 5 mL). After filtration over a pad of Celite, it was washed with water and EA. The organic layer was separated and diluted with Na 2 SO 4 The mixture was dried at 40° C., evaporated under reduced pressure, and purified by FCC (PE / EA=5 / 1 to 0 / 1) to give 1-5 (300.0 mg, 26% yield) as a colorless oil.

[0375] Step 4: Preparation of Compound 1 To a solution of 1-3 (300 mg, 0.4 mmol, 1.0 equiv) and 1-5 (136 mg, 1.2 mmol, 3.0 equiv) in THF (5.0 mL) was added DIEA (258 mg, 2.0 mmol, 5.0 equiv) at 0° C. The mixture was stirred at 70° C. for 16 h. LCMS showed the reaction was complete, and the mixture was evaporated under reduced pressure and purified by pre-HPLC to give compound 1 (100.0 mg, 30% yield) as a colorless oil.

[0376] 1 H NMR (400 MHz, CDCl 3 ) δ:0.86-0.90 (m, 12H), 1.27 (s, 52H), 1.46-1.67 (m, 12H), 1.95-2.10 (m, 5H), 2.29-2.34 (m, 5H), 2.44-2.77 (m, 9H), 3.30 (s, 1H), 3.66 (s, 2H), 3.96 (d, J=6.0 Hz, 4H). LCMS: Room temperature: 1.285 min, MS m / z (ESI): 835.7 [M+H].

[0377] 6.2 Example 2: Preparation of Compound 2. [ka] Step 1: Preparation of intermediate 2-2 A mixture of ketone 2-1 (2.0 g, 20.0 mmol, 1.0 equiv), titanium(IV) isopropoxide (7.4 g, 26 mmol, 1.3 equiv), and 2-aminoethanol (3.66 g, 60.0 mmol, 3.0 equiv) in methanol (10.0 mL) was stirred at room temperature under argon for 5 h. Sodium borohydride (760.0 mg, 20.0 mmol, 1.0 equiv) was then added at 0° C. and the resulting mixture was stirred for an additional 2 h. The reaction was then quenched by adding water (10.0 mL). Stirring was continued at room temperature for 20 min, and the reaction mixture was then acidified with hydrochloric acid (1 M, 5 mL). After filtration over a pad of Celite, it was washed with water and EA. The organic layer was separated and diluted with Na 2 SO 4 The mixture was dried at 40° C., evaporated under reduced pressure, and purified by FCC (PE / EA=5 / 1 to 0 / 1) to give 2-2 (1.5 g, 52% yield) as a yellow oil.

[0378] Step 2: Preparation of Compound 2 To a solution of 1-3 (378 mg, 0.5 mmol, 1.0 equiv) and 2-2 (214 mg, 1.5 mmol, 3.0 equiv) in THF (5.0 mL) was added DIEA (322 mg, 2.5 mmol, 5.0 equiv) at 0° C. The mixture was stirred at 70° C. for 16 h. LCMS showed the reaction was complete, and the mixture was evaporated under reduced pressure and purified by pre-HPLC to give compound 2 (35.0 mg, 8% yield) as a yellow oil.

[0379] 1 H NMR (400 MHz, CDCl 3 ) δ:0.80-0.83 (m, 12H), 0.91-1.20 (m, 4H),1.25 (s, 56H), 1.54-1.59 (m, 8H), 1.70 (s, 3H),1.79-1.86 (m, 6H), 2.22-2.34 (m, 4H), 2.74-3.06 (m, 6H), 3.06-3.20 (m, 2H), 3.69 (s, 1H), 3.88-4.05 (m, 4H). LCMS: room temperature: 1.989 min, MS m / z (ESI): 863.7 [M+H].

[0380] 6.3 Example 3: Preparation of compound 3. [ka] Step 1: Preparation of intermediate 3-2 A mixture of ketone 3-1 (1.12 g, 10.0 mmol, 1.0 equiv), titanium(IV) isopropoxide (3.69 g, 13 mmol, 1.3 equiv), and 2-aminoethanol (1.83 g, 30.0 mmol, 3.0 equiv) in methanol (10.0 mL) was stirred overnight at room temperature under argon. Sodium borohydride (380.0 mg, 10.0 mmol, 1.0 equiv) was then added at 0° C. and the resulting mixture was stirred for an additional 2 h. The reaction was then quenched by adding water (10.0 mL). Stirring was continued at room temperature for 20 min, and the reaction mixture was then filtered over a pad of Celite and washed with water and EA. The organic layer was separated and diluted with Na 2 SO 4 The mixture was dried at 40° C., evaporated under reduced pressure, and purified by FCC (PE / EA=5 / 1 to 0 / 1) to give 3-2 (550.0 mg, 35% yield) as a colorless oil.

[0381] Step 2: Preparation of compound 3 To a solution of 1-3 (300 mg, 0.4 mmol, 1.0 equiv) and 3-2 (188 mg, 1.2 mmol, 3.0 equiv) in THF (5.0 mL) was added DIEA (258 mg, 2.0 mmol, 5.0 equiv) at 0° C. The mixture was stirred at 70° C. for 16 h. LCMS showed the reaction was complete, and the mixture was evaporated under reduced pressure and purified by pre-HPLC to give compound 3 (53.0 mg, 15% yield) as a colorless oil.

[0382] 1 H NMR (400 MHz, CDCl 3) δ:0.86-0.90 (m, 15H), 1.26 (s, 65H), 1.24-1.46 (m, 4H),1.6-1.67 (m, 7H), 2.29-2.47 (m, 8H), 2.73-2.77 (m, 2H), 3.46-3.50 (t, J=8.0 Hz, 1H), 3.96-3.98 (d, J=8.0 Hz, 4H). LCMS: room temperature: 1.834 min, MS m / z (ESI): 877.7 [M+H].

[0383] 6.4 Example 4: Preparation of Compound 4. [ka] Step 1: Preparation of intermediate 4-2 To a solution of 4-1 (250 mg, 2.0 mmol, 1.0 equiv) and cyclopropanamine (125 mg, 2.2 mmol, 1.1 equiv) in ACN (5.0 mL) was added K 2 CO 3 (552 mg, 4.0 mmol, 2.0 equiv) was added at room temperature. The mixture was stirred at 80° C. overnight. LCMS showed the reaction was complete, and the mixture was extracted with EA (40 ml×2), washed with brine, and evaporated under reduced pressure to give 4-2 (170 mg, crude). The crude product was used in the next step without further purification.

[0384] Step 2: Preparation of compound 4 To a solution of 1-3 (300 mg, 0.4 mmol, 1.0 equiv) and 4-2 (160 mg, 1.6 mmol, 4.0 equiv) in THF (5.0 mL) was added DIEA (205 mg, 2.0 mmol, 4.0 equiv) at 0° C. The mixture was stirred at 70° C. for 16 h. LCMS showed the reaction was complete, and the mixture was evaporated under reduced pressure and purified by pre-HPLC to give compound 4 (58.0 mg, 17.6% yield) as a colorless oil.

[0385] 1 H NMR (400 MHz, CDCl 3) δ:0.86-0.90 (t, J=8.0 Hz 12H), 1.26-1.39 (m, 54H), 1.43-1.66 (m, 12H), 2.30-2.33 (m, 6H), 2.81-3.01(m, 8H), 3.49 (s, 4H), 3.96-3.98 (d, J=8.0 Hz, 4H). LCMS: room temperature: 1.39 min, MS m / z (ESI): 821.8 [M+H].

[0386] 6.5 Example 5: Preparation of Compound 5. [ka] Step 1: Preparation of intermediate 5-2 A mixture of cyclopentanone 5-1 (840 mg, 10.0 mmol, 1.0 equiv), titanium(IV) isopropoxide (3.69 g, 13 mmol, 1.3 equiv), and 2-aminoethanol (1.83 g, 30.0 mmol, 3.0 equiv) in methanol (10.0 mL) was stirred overnight at room temperature under argon. Sodium borohydride (380.0 mg, 10.0 mmol, 1.0 equiv) was then added at 0° C. and the resulting mixture was stirred for an additional 2 h. The reaction was then quenched by adding water (10.0 mL). Stirring was continued at room temperature for 20 min, and the reaction mixture was then filtered over a pad of Celite and washed with water and EA. The organic layer was separated and diluted with Na 2 SO 4 The mixture was evaporated under reduced pressure and purified by FCC (PE / EA=2 / 1 to 0 / 1) to give 5-2 (410 mg, 32% yield) as a colorless oil.

[0387] Step 2: Preparation of compound 5 To a solution of 1-3 (300 mg, 0.4 mmol, 1.0 equiv) and 5-2 (154 mg, 1.2 mmol, 3.0 equiv) in THF (5.0 mL) was added DIEA (258 mg, 2.0 mmol, 5.0 equiv) at 0° C. The mixture was stirred at 70° C. for 16 h. LCMS showed the reaction was complete, and the mixture was evaporated under reduced pressure and purified by pre-HPLC to give compound 5 (10.0 mg, 3% yield) as a colorless oil.

[0388] 1 H NMR (400 MHz, CDCl 3 ) δ:0.80-0.83 (m, 12H), 1.20 (m, 54H), 1.51-1.61 (m, 4H) 1.68-1.79 (m, 8H), 1.85-1.94(m, 2H), 2.02 (s, 1H), 2.29-2.50(m, 4H) 2.69-3.15(m, 10H), 3.27-3.59(m, 4H) 3.89-3.91 (d, J=8.0 Hz, 4H). LCMS: room temperature: 2.22 min, MS m / z (ESI): 849.8 [M+H].

[0389] 6.6 Example 6: Preparation of compound 6. [ka] Step 1: Preparation of intermediate 6-2 A mixture of cyclooctanone 6-1 (1.26 g, 10.0 mmol, 1.0 equiv), titanium(IV) isopropoxide (3.69 g, 13 mmol, 1.3 equiv), and 2-aminoethanol (1.83 g, 30.0 mmol, 3.0 equiv) in methanol (10.0 mL) was stirred overnight at room temperature under argon. Sodium borohydride (380.0 mg, 10.0 mmol, 1.0 equiv) was then added at 0° C. and the resulting mixture was stirred for an additional 2 h. The reaction was then quenched by adding water (10.0 mL). Stirring was continued at room temperature for 20 min, and the reaction mixture was then filtered over a pad of Celite and washed with water and EA. The organic layer was separated and diluted with Na 2 SO 4 The mixture was dried at 40° C., evaporated under reduced pressure, and purified by FCC (PE / EA=5 / 1 to 0 / 1) to give 2 (900 mg, 52% yield) as a colorless oil.

[0390] Step 2: Preparation of compound 6 To a solution of 1-3 (300 mg, 0.4 mmol, 1.0 equiv) and 6-2 (208 mg, 1.2 mmol, 3.0 equiv) in THF (5.0 mL) was added DIEA (258 mg, 2.0 mmol, 5.0 equiv) at 0° C. The mixture was stirred at 70° C. for 16 h. LCMS showed the reaction was complete, and the mixture was evaporated under reduced pressure and purified by pre-HPLC to give compound 6 (40.0 mg, 11% yield) as a colorless oil.

[0391] 1 H NMR (400 MHz, CDCl 3 ) δ:0.86-0.90 (m, 12H), 1.26 (m, 52H), 1.62-1.73 (m, 16H), 1.94-1.85(m, 2H) 2.12-2.3 (m, 11H), 2.32-2.34 (m, 4H), 2.75-3.30 (m, 8H) 3.96-3.98 (d, J=8.0 Hz, 4H). LCMS: room temperature: 1.81 min, MS m / z (ESI): 891.5 [M+H].

[0392] 6.7 Example 7: Preparation of Compound 7. [ka] Step 1: Preparation of intermediate 7-2 A mixture of iodobenzene 7-1 (0.81 g, 4.0 mmol, 1.0 equiv), 2-aminoethanol (0.73 g, 12.0 mmol, 3.0 equiv), and CuCl (39.6 mg, 0.4 mmol, 0.1 equiv), KOH (0.73 g, 12.0 mmol, 3.0 equiv) was stirred at room temperature under argon for 16 h. The reaction was then quenched by adding water (10.0 mL) and extracted with EA. The organic layer was separated and diluted with Na 2 SO 4 The mixture was evaporated under reduced pressure and purified by FCC (PE / EA=5 / 1 to 1 / 1) to give 7-2 (0.5 g, 90% yield) as a yellow oil.

[0393] Step 2: Preparation of compound 7 To a solution of 1-3 (300 mg, 0.4 mmol, 1.0 equiv) and 7-2 (163 mg, 1.19 mmol, 3.0 equiv) in THF (10.0 mL) was added DIEA (256 mg, 1.98 mmol, 5.0 equiv) at 0° C. The mixture was stirred at 70° C. for 16 h. LCMS showed the reaction was complete, and the mixture was evaporated under reduced pressure and purified by pre-HPLC to give compound 7 (60.0 mg, 18% yield) as a colorless oil.

[0394] 1 H NMR (400 MHz, CDCl 3 ) δ:0.86-0.90 (m, 12H), 1.27-1.37 (m, 55H), 1.69 (s, 12H), 2.31 (s, 4H), 2.43 (s, 2H), 2.70 (s, 1H), 3.61-3.71 (m, 5H), 3.88-3.96 (m, 4H), 6.55-6.83 (m, 3H), 7.14-7.26 (m, 2H). LCMS: room temperature: 2.193 min, MS m / z (ESI): 858.2 [M+H].

[0395] 6.8 Example 8: Preparation of Compound 8. [ka] Step 1: Preparation of intermediate 8-2 A mixture of 8-1 (0.5 g, 2.66 mmol, 1.0 equiv) and ketone 1-4 (0.37 g, 5.32 mmol, 2.0 equiv) in methanol (10.0 mL) was stirred at room temperature under argon for 2 h. Then, NaCNBH 3 (355.0 mg, 5.32 mmol, 2.0 equiv) was added and the resulting mixture was stirred for an additional 16 h. The reaction was then quenched by adding water (10.0 mL). Stirring was continued at room temperature for 20 min, then the reaction mixture was extracted with EA and washed with brine. The organic layer was separated and diluted with Na 2 SO 4 The mixture was dried at rt and evaporated under reduced pressure to give 8-2 (0.35 g, 54% yield) as a yellow oil.

[0396] Step 2: Preparation of intermediate 8-3 To a mixture of 8-2 (0.35 g, 1.45 mmol, 1.0 equiv.) and 3-hydroxypropanoic acid (1.2 mL, 4.35 mmol, 3.0 equiv.) in DMF (10.0 mL), HATU (0.72 g, 1.88 mmol, 1.3 equiv.) and DIEA (0.56 g, 4.35 mmol, 3.0 equiv.) were added and stirred at room temperature under argon for 2 h. LCMS showed the reaction was complete and EA (100.0 mL) was added. The mixture was washed with saturated brine and diluted with Na 2 SO 4 The mixture was evaporated under reduced pressure to give 8-3 (400 mg, crude) as a brown oil.

[0397] Step 3: Preparation of intermediate 8-4 To a mixture of 8-3 (0.4 g, 1.27 mmol, 1.0 equiv) in dioxane (5.0 mL) was added HCl / dioxane (5.0 mL) and stirred at room temperature for 2 h. LCMS showed the reaction was complete. The mixture was evaporated under reduced pressure to give 8-4 (170 mg, crude) as a white solid.

[0398] Step 4: Preparation of compound 8 To a solution of 8-4 (120 mg, 0.56 mmol, 1.0 equiv) and 8-5 (1.17 g, 2.8 mmol, 5.0 equiv) in ACN (15.0 mL) was added K 2 CO 3 (309mg, 2.24mmol, 4.0eq), Cs 2 CO 3 (55.0 mg, 0.17 mmol, 0.3 equiv) and NaI (10.0 mg, 0.06 mmol, 0.1 equiv) were added at room temperature. The mixture was stirred at 80° C. for 72 h. LCMS showed the reaction was complete, and the mixture was evaporated under reduced pressure and purified by pre-HPLC to give compound 8 (40.0 mg, 8% yield) as a yellow oil.

[0399] 1 H NMR (400 MHz, CDCl 3) δ:0.80-0.90 (m, 14H), 0.91-0.98 (m, 2H),1.32 (s, 54H), 1.36-1.50 (m, 4H), 1.62-1.70 (m, 15H), 1.77-1.86 (m, 5H), 2.31-2.34 (m, 4H), 2.89-3.08 (m, 1H), 3.52-3.55 (m, 3H), 3.97 (d, J=6.0 Hz, 4H). LCMS: Room temperature: 1.149 min, MS m / z (ESI): 891.6 [M+H].

[0400] 6.9 Example 9: Preparation of Compound 9. [ka] Step 1: Preparation of intermediate 9-1 A mixture of 8-1 (0.5 g, 2.66 mmol, 1.0 equiv) and ketone 2-1 (0.5 g, 5.32 mmol, 2.0 equiv) in methanol (10.0 mL) was stirred at room temperature under argon for 2 h. Then, NaCNBH 3 (355.0 mg, 5.32 mmol, 2.0 equiv) was added and the resulting mixture was stirred for an additional 16 h. The reaction was then quenched by adding water (10.0 mL). Stirring was continued at room temperature for 20 min, then the reaction mixture was extracted with EA and washed with brine. The organic layer was separated and diluted with Na 2 SO 4 The mixture was dried at rt and evaporated under reduced pressure to give 9-1 (0.35 g, 48% yield) as a yellow oil.

[0401] Step 2: Preparation of intermediate 9-2 To a mixture of 9-1 (0.35 g, 1.31 mmol, 1.0 equiv) and 3-hydroxypropanoic acid (1.0 mL, 3.93 mmol, 3.0 equiv) in DMF (10.0 mL) was added HATU (0.72 g, 1.88 mmol, 1.3 equiv) and DIEA (0.56 g, 4.35 mmol, 3.0 equiv) and stirred at room temperature under argon for 2 h. LCMS showed the reaction was complete and EA (100.0 mL) was added. The mixture was washed with saturated brine and diluted with Na 2 SO4 The mixture was evaporated under reduced pressure to give 9-2 (400 mg, crude) as a brown oil.

[0402] Step 3: Preparation of intermediate 9-3 To a mixture of 9-2 (0.4 g, 1.2 mmol, 1.0 equiv) in dioxane (5.0 mL) was added HCl / dioxane (5.0 mL) and stirred at room temperature for 2 h. LCMS showed the reaction was complete. The mixture was evaporated under reduced pressure to give 9-3 (170 mg, crude) as a white solid.

[0403] Step 4: Preparation of compound 9 To a solution of 9-3 (120 mg, 0.5 mmol, 1.0 equiv) and 8-5 (0.84 g, 2.0 mmol, 4.0 equiv) in ACN (15.0 mL) was added K 2 CO 3 (207mg, 1.5mmol, 3.0eq), Cs 2 CO 3 (50.0 mg, 0.15 mmol, 0.3 equiv.) and NaI (7.0 mg, 0.05 mmol, 0.1 equiv.) were added at room temperature. The mixture was stirred at 80° C. for 72 h. LCMS showed the reaction was complete, and the mixture was evaporated under reduced pressure and purified by pre-HPLC to give compound 9 (24.0 mg, 5% yield) as a colorless oil.

[0404] 1 H NMR (400 MHz, CDCl 3 ) δ:0.86-0.90 (m, 12H), 1.27-1.38 (m, 50H), 1.52-1.57 (m, 8H), 1.79-1.94 (m, 22H), 2.28-2.42 (m, 5H), 2.50-2.60 (m, 2H), 2.90 (s, 3H), 3.29 (s, 1H), 3.57 (s, 1H), 3.83-3.87 (m, 2H), 3.96-3.98 (m, 4H). LCMS: room temperature: 1.704 min, MS m / z (ESI): 919.7 [M+H].

[0405] 6.10 Example 10: Preparation of Compound 10. [ka] Step 1: Preparation of intermediate 10-1 A mixture of 8-1 (2.0 g, 8.92 mmol, 1.0 equiv) and ketone 3-1 (2.0 g, 17.85 mmol, 2.0 equiv) in methanol (15.0 mL) was stirred at room temperature under argon for 2 h. Then, NaCNBH 3 (1.12 g, 17.85 mmol, 2.0 equiv) was added and the resulting mixture was stirred for an additional 16 h. The reaction was then quenched by adding water (20.0 mL). Stirring was continued at room temperature for 20 min, then the reaction mixture was extracted with EA and washed with brine. The organic layer was separated and diluted with Na 2 SO 4 The mixture was dried at rt and evaporated under reduced pressure to give 10-1 (1.52 g, 60% yield) as a yellow oil.

[0406] Step 2: Preparation of intermediate 10-2 To a mixture of 10-1 (500 mg, 1.76 mmol, 1.0 equiv) and 3-hydroxypropanoic acid (676 mg, 5.28 mmol, 3.0 equiv) in DMF (10.0 mL) was added HATU (869 mg, 2.29 mmol, 1.3 equiv) and DIEA (681 mg, 5.28 mmol, 3.0 equiv) and stirred at room temperature under argon for 2 h. LCMS showed the reaction was complete and EA (100.0 mL) was added. The mixture was washed with saturated brine and diluted with Na 2 SO 4 The mixture was evaporated under reduced pressure to give 10-2 (590 mg, crude) as a brown oil.

[0407] Step 3: Preparation of intermediate 10-3 To a mixture of 10-2 (590 mg, 1.65 mmol, 1.0 equiv) in dioxane (5.0 mL) was added HCl / dioxane (5.0 mL) and stirred at room temperature for 2 h. LCMS showed the reaction was complete. The mixture was evaporated under reduced pressure to give 10-3 (400 mg, crude) as a white solid.

[0408] Step 4: Preparation of compound 10 To a solution of 10-3 (150 mg, 0.58 mmol, 1.0 equiv) and 8-5 (1.22 g, 2.92 mmol, 5.0 equiv) in ACN (15.0 mL) was added K 2 CO 3 (322mg, 2.32mmol, 4.0eq), Cs 2 CO 3 (57.0 mg, 0.17 mmol, 0.3 equiv) and NaI (10.0 mg, 0.06 mmol, 0.1 equiv) were added at room temperature. The mixture was stirred at 80° C. for 72 h. LCMS showed the reaction was complete, and the mixture was evaporated under reduced pressure and purified by pre-HPLC to give compound 10 (92.0 mg, 17% yield) as a yellow oil.

[0409] 1 H NMR (400 MHz, CDCl 3 ) δ:0.87-0.90 (m, 14H), 1.27 (s, 62H), 1.44-1.50 (m, 6H), 1.62-1.72 (m, 12H), 1.85-1.92 (m, 2H), 2.29-2.35 (m, 5H), 3.13-3.68 (m, 5H), 3.85-3.87 (m, 2H), 3.96-3.98 (d, J=8.0 Hz, 4H). LCMS: Room temperature: 1.520 min, MS m / z (ESI): 933.9 [M+H].

[0410] 6.11 Example 11: Preparation of Compound 11. [ka] Step 1: Preparation of intermediate 11-1 CH 3 To a solution of compound 1-1 (10 g, 21.87 mmol, 3.0 equiv.) in CN (50 mL), 2 CO 3 (3.02g, 21.87mmol, 3.0eq), Cs 2 CO 3(2.38 g, 7.29 mmol, 1.0 equiv), NaI (0.2 g, 1.46 mmol, 0.2 equiv), and (4-methoxyphenyl)methanamine (1 g, 7.29 mmol, 1.0 equiv) were added. The reaction was stirred at 80° C. for 10 h. The reaction mixture was poured into water (100 ml) and diluted with CH 2 Cl 2 (3×100 mL). The combined organic layers were washed with brine and anhydrous Na 2 SO 4 The mixture was dried at 40° C. and concentrated in vacuo. The crude product was purified by flash column chromatography (EtOAc:PE=2:1) ​​to give 11-1 (5 g, 84% yield) as a yellow oil.

[0411] Step 2: Preparation of intermediate 11-2 To a solution of 11-1 (5 g, 6.14 mmol, 1.0 equiv) in EtOAc (100 mL) was added Pd / C (1.0 g). The reaction was stirred for 2 h. 2 The mixture was stirred at room temperature for 10 h under reduced pressure, and the reaction mixture was filtered and concentrated in vacuo to give 11-2 (4.0 g, 94% yield) as a yellow oil.

[0412] Step 3: Preparation of intermediate 11-3 CH 2 Cl 2 To a solution of 11-2 (200 mg, 0.29 mmol, 1.0 equiv) in 1H2O (20 mL) was added DIPEA (120 mg, 0.87 mmol, 3.0 equiv) and 2-bromoacetyl bromide (120 mg, 0.58 mmol, 2.0 equiv). The reaction was stirred at 0° C. for 1 h. The reaction mixture was poured into water (50 ml) and diluted with CH 2 Cl 2 (3×50 mL). The combined organic layers were washed with brine and anhydrous Na 2 SO 4 The mixture was dried at rt and concentrated in vacuo to give 11-3 (200 mg, 85% yield) as a yellow oil.

[0413] Step 4: Preparation of compound 11 CH 3To a solution of 11-3 (200 mg, 0.24 mmol, 1.0 equiv) in CN (10 mL) was added K 2 CO 3 (170 mg, 1.23 mmol, 3.0 equiv.) and compound 1-5 (85 mg, 0.74 mmol, 3.0 equiv.) were added. The reaction was stirred at 80° C. for 10 h. The reaction mixture was filtered and concentrated in vacuo. The crude product was purified by preparative HPLC to give compound 11 (50 mg, 24% yield) as a colorless oil.

[0414] 1 H NMR (400 MHz, CDCl 3 ) δ:0.87 (t, J = 8 Hz, 12H), 1.22-1.46 (m, 54H), 1.50-1.69 (m, 14H), 1.77-2.04 (m, 4H), 2.28-2.34 (m, 4H), 2.76-2.80 (m, 2H), 3.18-3.44 (m, 4H), 3.51-3.58 (m, 2H), 3.95-3.98(m, 4H). LCMS: room temperature: 1.431 min, MS m / z (ESI): 849.7 [M+H].

[0415] 6.12 Example 12: Preparation of Compound 12. [ka] Step 1: Preparation of intermediate 12-1 CH 2 Cl 2 To a solution of 11-2 (200 mg, 0.29 mmol, 1.0 equiv) in (20 mL) was added DIPEA (120 mg, 0.87 mmol, 3.0 equiv) and 3-bromopropanoyl chloride (100 mg, 0.58 mmol, 2.0 equiv). The reaction was stirred at 0° C. for 1 h. The reaction mixture was poured into water (50 ml) and diluted with CH 2 Cl 2 (3×50 mL). The combined organic layers were washed with brine and anhydrous Na 2 SO 4 The mixture was dried at rt and concentrated in vacuo to give 12-1 (185 mg, 77% yield) as a yellow oil.

[0416] Step 2: Preparation of compound 12 CH 3 To a solution of 12-1 (180 mg, 0.21 mmol, 1.0 equiv) in CN (10 mL), 2 CO 3 (150 mg, 1.09 mmol, 5.0 equiv) and 1-5 (75 mg, 0.65 mmol, 3.0 equiv) were added. The reaction was stirred at 80° C. for 10 h. The reaction mixture was filtered and concentrated in vacuo. The crude product was purified by preparative HPLC to give compound 12 (10 mg, 5% yield) as a colorless oil.

[0417] 1 H NMR (400 MHz, CDCl 3 ) δ:0.87 (t, J = 8 Hz, 12H), 1.02-1.45 (m, 56H), 1.50-1.67 (m, 13H), 1.99-2.08 (m, 2H), 2.23-2.34 (m, 4H), 2.51-3.03 (m, 4H), 3.14-3.31 (m, 5H), 3.51-3.88 (m, 2H), 3.95-3.98(m, 4H). LCMS: room temperature: 1.491 min, MS m / z (ESI): 863.7 [M+H].

[0418] 6.13 Example 13: Preparation of compound 13. [ka] Step 1: Preparation of intermediate 13-1 CH 2 Cl 2 To a solution of 11-2 (200 mg, 0.29 mmol, 1.0 equiv) in 1H2O (20 mL) was added DIPEA (120 mg, 0.87 mmol, 3.0 equiv) and 4-bromobutanoyl chloride (107 mg, 0.58 mmol, 2.0 equiv). The reaction was stirred at 0° C. for 1 h. The reaction mixture was poured into water (50 ml) and diluted with CH 2 Cl 2 (3×50 mL). The combined organic layers were washed with brine and anhydrous Na 2 SO 4The mixture was dried at rt and concentrated in vacuo to give 13-1 (191 mg, 78% yield) as a yellow oil.

[0419] Step 2: Preparation of compound 13 CH 3 To a solution of 13-1 (190 mg, 0.22 mmol, 1.0 equiv) in CN (10 mL) was added K 2 CO 3 (155 mg, 1.13 mmol, 5.0 equiv) and 1-5 (78 mg, 0.67 mmol, 3.0 equiv) were added. The reaction was stirred at 80° C. for 10 h. The reaction mixture was filtered and concentrated in vacuo. The crude product was purified by preparative HPLC to give compound 13 (21 mg, 10% yield) as a colorless oil.

[0420] 1 H NMR (400 MHz, CDCl 3 ) δ:0.87 (t, J = 8 Hz, 12H), 1.39-1.48 (m, 54H), 1.50-1.83 (m, 15H), 2.02-2.04 (m, 2H), 2.24-2.34 (m, 6H), 2.46-2.50 (m, 2H), 2.55-2.57 (m, 2H), 3.18-3.30 (m, 5H), 3.52-3.54 (m, 2H), 3.95-3.98(m, 4H). LCMS: room temperature: 1.503 min, MS m / z (ESI): 877.7 [M+H].

[0421] 6.14 Example 14: Preparation of compound 14. [ka] Step 1: Preparation of intermediate 14-B 14-A (20.0 g, 103 mmol, 1.0 equiv.), phenylmethanol (10.0 g, 93 mmol, 0.9 equiv.) and concentrated H 2 SO 4 (1 ml) was refluxed for 6 h and water was removed azeotropically. TLC showed the reaction was complete. The mixture was diluted with ethyl acetate (100 ml) and saturated NaHCO 3Wash with aqueous solution and brine, and add Na 2 SO 4 The mixture was dried at 40° C. and concentrated. The residue was purified by chromatography column to give 14-B (24.2 g, 92% yield) as a colorless oil.

[0422] Step 2: Preparation of intermediate 14-2 To a solution of 14-1 (12.0 g, 55.4 mmol, 1.0 equiv) in anhydrous THF (100 ml), NaH (2.22 g, 55.4 mmol, 1.0 equiv) was added using an inert N 2 The mixture was stirred at 0° C. under atmospheric pressure for 30 min, and 14-B (15.6 g, 55.4 mmol, 1.0 equiv.) was added. The mixture was stirred at room temperature overnight. TLC showed the reaction was complete. The mixture was concentrated and purified by chromatography column to give 14-2 (16.8 g, 72% yield) as a colorless oil.

[0423] Step 3: Preparation of intermediate 14-3 To a solution of 14-2 (16.8 g, 40.0 mmol, 1.0 equiv) in anhydrous THF (100 mL) was added NaH (1.60 g, 40.0 mmol, 1.0 equiv) at room temperature under inert atmosphere. The mixture was stirred for 30 min and 14-B (7.3 g, 35.6 mmol, 1.0 equiv) was added. The mixture was stirred at reflux overnight. TLC showed the reaction was complete. The mixture was concentrated and purified by chromatography column to give 14-3 (15.0 g, 60% yield) as a colorless oil.

[0424] Step 4: Preparation of intermediate 14-4 A mixture of 14-3 (9.0 g, 14.4 mmol, 1.0 equiv) and TFA (8.2 g, 74.0 mmol, 5.0 equiv) in DCM (50 ml) was stirred at reflux for 4 h. TLC showed the reaction was complete. The mixture was concentrated and the residue was refluxed in dimethylbenzene (100 mL) and concentrated. The residue was purified by chromatography column to give 14-4 (5.8 g, 86% yield) as a colorless oil.

[0425] Step 5: Preparation of intermediate 14-5 To a solution of 14-4 (5.8 g, 12.4 mmol, 1.0 equiv) in anhydrous THF (30 mL) was added BH 3 (1M in THF, 20 mL) was added under inert atmosphere at -78°C. The mixture was stirred at this temperature for 4 hours. TLC showed the reaction was complete. The mixture was diluted with Na 2 CO 3 The mixture was quenched with aqueous solution of NaCl, extracted with ethyl acetate, washed with water and brine, and 2 SO 4 The residue was purified by chromatography column to give 14-5 (2.9 g, 51.4% yield) as a colorless oil.

[0426] Step 6: Preparation of intermediate 14-6 To a mixture of 14-5 (2.1 g, 5.4 mmol, 1.0 equiv) and triethylamine (920 mg, 10.8 mmol, 2.0 equiv) in DCM (30 mL) was added methanesulfonyl chloride (880 mg, 6.5 mmol, 1.2 equiv) dropwise at 0° C. The mixture was stirred for 4 h. TLC showed the reaction was complete. The resulting was washed with water and brine, and the Na 2 SO 4 The residue was purified by chromatography column to give 14-6 (2.2 g, 89% yield) as a colorless oil.

[0427] Step 7: Preparation of intermediate 14-7 A mixture of 14-6 (2.2 g, 4.1 mmol, 1.0 equiv) and Pd / C (200 mg) in ethyl acetate (30 mL) was stirred overnight at room temperature under a hydrogen balloon. TLC showed the reaction was complete. The product was filtered and the filtrate was concentrated to give 14-7 (1.5 g, crude). The residue was used in the next step without further purification.

[0428] Step 8: Preparation of intermediate 14-8 A mixture of 14-7 (1.5 g, 4.1 mmol, 1.0 equiv.), 2-hexyldecan-1-ol (3.0 g, 12.4 mmol, 3.0 equiv.) and concentrated H 2 SO 4 (0.5 mL) was refluxed for 3 h and water was removed azeotropically. TLC showed the reaction was complete. The mixture was diluted with ethyl acetate (100 ml) and saturated NaHCO 3 Wash with aqueous solution and brine, and add Na 2 SO 4 The residue was purified by chromatography column to give 14-8 (3.2 g, 97% yield) as a colorless oil.

[0429] Step 9: Preparation of compound 14 14-8 (200 mg, 0.25 mmol, 1.0 equiv.), 2-(methylamino)ethanol (100 mg, 1.3 mmol, 5.3 equiv.), K 2 CO 3 (70 mg, 0.50 mmol, 2.0 equiv) was stirred at 70° C. overnight. LCMS showed the reaction was complete. The mixture was diluted with ethyl acetate (100 ml) and washed with water and brine, and added Na 2 SO 4 The residue was purified by Pre-HPLC to give compound 14 (69 mg) as a colorless oil.

[0430] 1 H NMR (400 MHz, CCl 3 D) δ:0.86-0.90 (m, 12H), 1.26-1.28 (m, 60H), 1.62(s, 8H), 2.20 (s, 5H), 2.28-2.31 (m, 4H), 2.49(s, 2H), 3.55-3.57 (m, 2H), 3.96-3.97 (d, J=5.6Hz, 4H). LCMS: Room temperature: 1.830 min, MS m / z (ESI): 780.7 [M+H].

[0431] The following compounds were prepared in a similar manner to compound 14 using the corresponding starting materials. [Table 2]

[0432] 6.15 Example 15: Preparation of Compound 15. [ka] CH 3 To a solution of 14-8 (200 mg, 0.25 mmol, 1.0 equiv) in CN (10 mL) was added K 2 CO 3 (175 mg, 1.25 mmol, 5.0 equiv) and 1-5 (90 mg, 0.75 mmol, 3.0 equiv) were added. The reaction was stirred at 80° C. for 10 h. The reaction mixture was filtered and concentrated in vacuo. The crude product was purified by preparative HPLC to give compound 15 (6 mg, 3% yield) as a colorless oil.

[0433] 1 H NMR (400 MHz, CDCl 3 ) δ:0.87 (t, J = 8 Hz, 12H), 1.39-1.48 (m, 55H), 1.50-1.87 (m, 14H), 1.92-2.18 (m, 4H), 2.21-2.325 (m, 4H), 2.40-3.68 (m, 8H), 3.82-3.90 (m, 4H). LCMS: room temperature: 1.883 min, MS m / z (ESI): 820.7 [M+H].

[0434] 6.16 Example 16: Preparation of Compound A. [ka] To a solution of 1-3 (300 mg, 0.4 mmol, 1.0 equiv) and 2-aminoethanol 2 (74 mg, 1.2 mmol, 3.0 equiv) in THF (5.0 mL) was added DIEA (209 mg, 1.6 mmol, 4.0 equiv) at 0° C. The mixture was stirred at 70° C. for 16 h. LCMS showed the reaction was complete, and the mixture was evaporated under reduced pressure and purified by pre-HPLC to give compound A (20.0 mg, 6.4% yield) as a colorless oil.

[0435] 1 H NMR (400 MHz, CDCl 3 ) δ:0.86-0.90 (t, J=8.0 Hz, 12H), 1.27-1.35 (m, 54H), 1.5-1.53 ​​(m, 4H), 1.6-1.65 (m, 4H), 2.31-2.35 (t, J=8.0 Hz, 4H), 2.51-2.54 (m, 4H), 2.82 (s, 2H), 2.98-3.06 (m, 4H), 3.89-3.91 (m, 2H), 3.95-3.97 (d, J=8.0 Hz, 4H). LCMS: room temperature: 2.43 min, MS m / z (ESI): 781.7 [M+H].

[0436] 6.17 Example 17: Preparation of Compound B. [ka] To a solution of 1-3 (300 mg, 0.4 mmol, 1.0 equiv) and 2-(methylamino)ethanol (91 mg, 1.2 mmol, 3.0 equiv) in THF (5.0 mL) was added DIEA (209 mg, 1.6 mmol, 4.0 equiv) at 0° C. The mixture was stirred at 70° C. for 16 h. LCMS showed the reaction was complete, and the mixture was evaporated under reduced pressure and purified by pre-HPLC to give compound B (104.0 mg, 32.3% yield) as a colorless oil.

[0437] 1 H NMR (400 MHz, CDCl 3) δ: 0.86 - 0.90 (t, J = 8.0 Hz, 12H), 1.26 - 1.34 (m, 52H), 1.54 - 1.66 (m, 10H), 2.29 - 2.35 (m, 7H), 2.60 - 2.82 (m, 10H), 3.49 - 3.60 (m, 3H), 3.95 - 3.97 (d, J = 8.0 Hz, 4H). LCMS: Room temperature: 1.53 min, MS m / z(ESI): 796.6[M + H].

[0438] 6.18 Example 18: Preparation of Compound C.

Chemical formula

[0439] 1 H NMR (400 MHz, CDCl 3 ) δ: 0.86 - 0.94 (m, 15H), 1.27 - 1.34 (m, 56H), 1.43 - 1.68 (m, 12H), 2.29 - 2.33 (m, 4H), 2.56 - 2.82 (m, 12H), 3.57 - 3.58 (m, 1H), 3.97 (d, J = 5.6 Hz, 4H). LCMS: Room temperature: 1.650 min, MS m / z(ESI): 837.8[M + H].

[0440] 6.19 Example 19: Preparation of Compound D.

Chemical formula

[0441] 1 H NMR (400 MHz, CDCl 3 ) δ:0.87-0.90 (t, J=6.6 Hz, 15H), 1.26-1.35 (m, 62H), 1.62-1.67 (m, 10H), 2.30-2.34 (m, 4H), 2.70-3.10 (m, 10H) 3.35-3.73 (m, 2H), 3.95-3.97 (d, J=8.0 Hz, 4H). LCMS: room temperature: 1.89 min, MS m / z (ESI): 865.8 [M+H].

[0442] 6.20 Example 20: Preparation of Compound 18 [ka] Step 1: Preparation of compound 18-2 To a mixture of compound 14-5 (800 mg, 1.76 mmol, 1.0 equiv.), DMSO (410 mg, 5.28 mmol, 3.0 equiv.) in DCM (30 mL) was added a solution of acyl chloride (450 mg, 3.52 mmol, 2.0 equiv.) in DCM (10 mL) at −78° C. under an inert atmosphere, and stirred at −78° C. for 2 h. After stirring, the mixture was cooled to 30° C. and cooled to 30° C. with 5% CO. 3 The reaction was quenched with N (900 mg, 8.8 mmol, 5.0 equiv.). The reaction mixture was warmed to room temperature, diluted with DCM, washed with water and brine, and added Na 2 SO 4 The residue was purified by column chromatography to give compound 18-2 (760 mg) as a colorless oil.

[0443] Step 2: Preparation of compound 18-3 To a solution of compound 18-2a (810 mg, 3.23 mmol, 2.0 equiv) in anhydrous THF solution (100 ml) was added NaH (130 mg, 3.23 mmol, 2.0 equiv) under inert atmosphere at 0° C. The mixture was stirred for 30 min and compound 18-2 (730 mg, 1.61 mmol, 1.0 equiv) was added. The mixture was stirred at room temperature overnight. TLC showed the reaction was complete. The mixture was concentrated and purified by chromatography column to give compound 18-3 (690 mg) as a colorless oil.

[0444] Step 3: Preparation of compound 18-4 A mixture of compound 18-3 (690 mg, 1.25 mmol, 1.0 equiv) and Pd / C (70 mg) in EA (20 ml) was stirred under hydrogen overnight. TLC showed the reaction was complete. The mixture was filtered, the filtrate was concentrated, and the residue was used in the next step without further purification.

[0445] Step 4: Preparation of compound 18-5 A mixture of compound 18-4 (470 mg, 1.25 mmol, 1.0 equiv) and EDCI (720 mg, 3.75 mmol, 3.0 equiv), octadecyl alcohol (910 mg, 3.75 mmol, 3.0 equiv), DMAP (50 mg) and DIEA (1300 mg, 10.00 mmol, 8.0 equiv) in DCM (20 mL) was stirred overnight. The mixture was diluted with DCM, washed with brine and concentrated. The residue was purified by column chromatography to give compound 18-5 (630 mg).

[0446] Step 5: Preparation of compound 18-6 To a solution of compound 18-5 (630 mg, 0.77 mmol, 1.0 equiv) in DCM (10 ml) was added TFA (1 ml). The mixture was stirred at reflux for 4 h. TLC showed the reaction was complete. The resulting residue was concentrated and used in the next step without further purification.

[0447] Step 6: Preparation of compound 18-7 To a mixture of compound 18-6 (580 mg, 0.77 mmol, 1.0 equiv) in anhydrous THF (20 mL) was added BH 3 (1.0 M in THF, 5.0 mL) was added at -78°C. The mixture was stirred for 4 h and saturated Na 2 CO 3 It was quenched with aqueous solution, extracted with EA, washed with brine and concentrated. The residue was purified by chromatography column to give compound 18-7 (320 mg) as a colorless oil.

[0448] Step 7: Preparation of compound 18-8 Compound 18-7 (320 mg, 0.43 mmol, 1.0 q) in DCM (10 ml) and Et 3 To a mixture of N (65 mg, 0.65 mmol, 1.5 equiv) was added methanesulfonyl chloride (60 mg, 0.52 mmol, 1.2 equiv) at 0° C. After 4 h, TLC showed the reaction was complete. The mixture was diluted with DCM, washed with brine, and concentrated. The residue was purified by column chromatography to give compound 18-8 (280 mg).

[0449] Step 8: Preparation of compound 18 Compound 18-8 (200 mg, 0.25 mmol, 1.0 equiv.), 2-(methylamino)ethanol (100 mg, 1.3 mmol, 5.3 equiv.), K 2 CO 3 (70 mg, 0.50 mmol, 2.0 equiv) was stirred at 70° C. overnight. LCMS showed the reaction was complete. The mixture was diluted with EA (100 ml), washed with water and brine, and added Na 2 SO 4 The residue was purified by Pre-HPLC to give compound 18 (24 mg) as a colorless oil.

[0450] 1 H NMR (400 MHz, CCl 3D) δ:0.87-0.90 (m, 12H), 1.39 (s, 62H), 1.41-1.42(m, 4H), 1.60-1.62(m, 6H), 2.25 (s, 3H), 2.28-2.32(m, 4H), 2.35-2.39(m, 2H), 2.51-2.54(m, 2H),3.57-3.59 (m, 2H), 3.97(d, J=5.6Hz, 4H). LCMS: room temperature: 0.090 min, MS m / z (ESI): 808.7 [M+H].

[0451] 6.21 Example 21: Preparation of Compound 20 [ka] Step 1: Preparation of compound 20-2 To a solution of 20-1 (30.0 g, 98.25 mmol) in DMF (800 mL) was added NaCN (9.63 g, 196.5 mmol). The reaction was stirred at 60° C. for 10 h. The reaction mixture was poured into water (500 ml) and extracted with EtOAc (3×500 mL). The combined organic layers were washed with brine and extracted with anhydrous Na 2 SO 4 After drying at 40° C. and concentrating in vacuum, the crude product was purified by flash column chromatography (EtOAc:PE=1:20) to give the target product as a yellow oil (18.3 g, 74% yield).

[0452] Step 2: Preparation of compound 20-3 To a solution of 20-2 (17.0 g, 67.61 mmol) in EtOH (200 mL), 2 SO 4 (40 mL) was added. The reaction was stirred at 90° C. for 48 h. The reaction mixture was poured into water (500 ml) and extracted with EtOAc (3×500 mL). The combined organic layers were washed with brine and anhydrous Na 2 SO 4 Drying in rt and concentration in vacuo afforded the target product as a yellow oil (15 g, 75% yield).

[0453] Step 3: Preparation of compound 20-4 MeOH (240 mL) and H 2 A solution of 20-3 (14 g, 46.90 mmol) in 20HO (60 mL) was added to LiOH H 2 2H2O (9.84 g, 234.5 mmol) was added. The reaction was stirred at 50° C. for 10 h. The reaction mixture was concentrated in vacuo to give the target product. The crude product was dissolved in water. The residue was adjusted to PH=2 with 6 M HCl and extracted with EtOAc (3×500 mL). The combined organic layers were washed with brine and washed with anhydrous Na 2 SO 4 Drying in rt and concentration in vacuo afforded the target product as a yellow oil (15 g, 75% yield).

[0454] Step 4: Preparation of compound 20-5 CH 2 Cl 2 To a solution of 20-4 (4 g, 14.79 mmol) in 100 mL of 2-(2-bromo-2,4-dichloro-1,2-diphenyl-2,4-diphenyl ...2,4-diphenyl-1,2-diphenyl-2,4-diphenyl-2,4-diphenyl-1,2-di

[0455] Step 5: Preparation of compound 20-6 CH 3 To a solution of 20-5 (2.0 g, 4.91 mmol) in CN (50 mL), 2 CO 3 (700mg, 4.91mmol), Cs 2 CO 3 (160 mg, 0.49 mmol), NaI (80 mg, 0.49 mmol), and 2-aminoethan-1-ol (100 mg, 1.64 mmol) were added. The reaction was stirred at 80° C. for 10 h. The reaction mixture was concentrated in vacuo. The crude product was purified by flash column chromatography (CH 2 Cl 2:MeOH=10:1) to give the target product as a yellow oil (600 mg, 50% yield).

[0456] Step 6: Preparation of compound 20-7 CH 2 Cl 2 To a solution of 20-6 (300 mg, 0.54 mmol) in 10 mL of SOCl 2 (150 mg, 1.22 mmol) was added. The reaction was stirred for 10 h at 30° C. The reaction mixture was concentrated in vacuo to give the target product as a yellow oil (308 mg, 100% yield).

[0457] Step 7: Preparation of compound 20 To a solution of 20-7 (300 mg, 0.4 mmol) in THF (10 mL) was added DIEA (160 mg, 1.19 mmol), NaI (60 mg, 0.4 mmol) and 1-5 (100 mg, 0.8 mmol). The reaction was stirred at 70 °C for 10 h. The reaction mixture was filtered and concentrated in vacuo. The crude product was purified by preparative HPLC to give the target product as a colorless oil (40 mg, 12% yield).

[0458] 1 H NMR (400 MHz, CDCl 3 ): δ 0.87 (t, J = 8 Hz, 12H), 1.30-1.36 (m, 54H), 1.45-1.52 (m, 4H), 1.56-1.68 (m, 6H), 1.83-1.88 (m, 4H), 1.97-2.01 (m, 2H), 2.21-2.23 (m, 4H), 2.43-2.56 (m, 9H), 3.14-3.16 (m, 1H), 3.51-3.54 (m, 2H), 4.03-4.07(m, 4H). LCMS: Room temperature: 1.930 min, MS m / z (ESI): 835.7 [M+H].

[0459] The following compounds were prepared in a similar manner to compound 20 using the corresponding starting materials. [Table 3-1] [Table 3-2] [Table 3-3]

[0460] 6.22 Example 22: Preparation of Compound 21 [ka] Step 1: Preparation of compound 21-1 A mixture of 4-hydroxycyclohexan-1-one (2.28 g, 20 mmol, 1.0 equiv), 2-aminoethanol (1.2 g, 20 mmol, 1.0 equiv) and titanium tetraisopropanolate (7.4 g, 26 mmol, 1.3 equiv) in methanol (40 mL) was stirred at room temperature for 16 h under argon atmosphere. Sodium borohydride (757 mg, 20 mmol, 1.0 equiv) was then added at 0° C. and the resulting mixture was stirred for an additional 2 h. The reaction was quenched with water (20 mL), filtered through a pad of Celite and washed with MeOH. The filtrate was concentrated under reduced pressure and purified by column chromatography (silica gel, DCM / MeOH=20 / 1-10 / 1) to give the title compound (1.3 g, 40% yield) as a yellow oil. LCMS: room temperature: 0.320 min, MS m / z (ESI): 160.3 [M+H].

[0461] Step 2: Preparation of compound 21 To a solution of 1-3 (300 mg, 0.40 mmol, 1.0 equiv) and 21-1 (191 mg, 1.2 mmol, 3.0 equiv) in THF (10 mL) was added DIEA (258 mg, 2.0 mmol, 5.0 equiv) and NaI (12 mg, 0.08 mmol, 0.2 equiv). The reaction was stirred at 70° C. for 16 h. LCMS showed the reaction was complete. The mixture was evaporated under reduced pressure and purified by preparative HPLC to give the title compound (60 mg, 17%) as a colorless oil.

[0462] 11H NMR (400 MHz, CDCl 3 ) δ: 0.88 (t, J = 6.8 Hz, 12H), 1.26 (s, 56H), 1.32 - 1.53 (m, 4H), 1.60 - 1.68 (m, 7H), 1.72 - 1.89 (m, 3H), 1.99 - 2.04 (m, 1H), 2.31 (t, J = 7.4 Hz, 4H), 2.43 - 2.49 (m, 6H), 2.50 - 2.65 (m, 4H), 3.49 - 3.56 (m, 3H), 3.97 (d, J = 5.6 Hz, 4H). LCMS: Room temperature: 1.02 min, MS m / z (ESI): 879.7 [M + H] + 。

[0463] The following compounds were prepared in a manner similar to Compound 21 using the corresponding starting materials.

Table 4 - 1

Table 4 - 2

Table 4 - 3

Table 4 - 4

Table 4 - 5

Table 4 - 6

Table 4 - 7

Table 4 - 8

Table 4 - 9

Table 4 - 10

Table 4 - 11

[0464] 6.23 Example 23: Preparation of Compound 33 [ka] Step 1: Preparation of compound 33-2 To a solution of cyclobutanamine (853 mg, 12 mmol, 1.2 equiv) in EtOH (10 mL) was added 33-1 (1 g, 10 mmol). The reaction mixture was stirred at room temperature for 16 h. LCMS showed the reaction was complete. The solvent was removed and compound 33-2 (450 mg, 26.26%) was obtained as a colorless oil by FCC. LCMS: Room temperature: 0.690 min, MS m / z (ESI): 172.2 [M+H].

[0465] Step 2: Preparation of compound 33 To a mixture of compound 33-2 (450 mg, 2.626 mmol, 8.0 equiv.), DIEA (214 mg, 1.652 mmol, 5.0 equiv.) in THF (10 mL) was added 1-3 (250 mg, 0.3304 mmol, 1 equiv.). The reaction mixture was stirred at 70° C. for 16 h. LCMS showed the reaction was complete. After removal of the solvent, the residue was purified by pre-HPLC to give the title compound (90 mg, 30.55% yield) as a colorless oil.

[0466] 1 H NMR (400 MHz, CDCl 3 ) δ:3.96 (d, J=5.6 Hz, 4 H), 3.51-3.50 (m, 1 H), 3.19-3.11 (m, 1 H), 2.42-2.28 (m, 15 H), 2.02-1.76 (m, 6 H), 1.65-1.60 (m, 9 H), 1.45-1.30 (m, 7H), 1.26 (s, 52H), 0.92-0.87 (m, 15H). LCMS: Room temperature: 1.760 min, MS m / z (ESI): 891.8 [M+H].

[0467] The following compounds were prepared in a similar manner to compound 33 using the corresponding starting materials. [Table 5]

[0468] 6.24 Example 24: Preparation of Compound 39 [ka] Step 1: Preparation of compound 39-2 CH 2 Cl 2 (COCl) in (120 mL) 2 (7.85 g, 61.87 mmol) was added DMSO (4.83 g, 61.87 mmol) at -78 °C. The reaction was stirred at -78 °C for 1 h. 2 Cl 2A solution of 39-1 (5 g, 20.62 mmol) in Et (30 mL) was added. The reaction was stirred at -78 °C for 2 h. 3 N (10.43 g, 103.17 mmol) was added. The reaction was stirred at room temperature for 5 h. The reaction mixture was poured into water (100 ml) and diluted with CH 2 Cl 2 (3×100 mL). The combined organic layers were washed with brine and anhydrous Na 2 SO 4 After drying at 40° C. and concentrating in vacuum, the crude product was purified by flash column chromatography (PE:EtOAc=20:1) to give the target product as a yellow oil (4.2 g, 84% yield).

[0469] Step 2: Preparation of compound 39-3 To a solution of 39-2 (2.1 g, 8.3 mmol) in THF (100 mL) was added ethylmagnesium bromide (9 mL, 18 mmol) at −78° C. The reaction was stirred at −30° C. for 1 h. The reaction mixture was poured into ice-cold water (100 ml) and diluted with CH 2 Cl 2 (3×100 mL). The combined organic layers were washed with brine and anhydrous Na 2 SO 4 After drying at 40° C. and concentrating in vacuum, the crude product was purified by flash column chromatography (PE:EtOAc=10:1) to give the target product as a yellow oil (1.5 g, 63% yield).

[0470] Step 3: Preparation of compound 39-4 CH 2 Cl 2 To a solution of 39-3 (1.5 g, 5.55 mmol) in (50 mL) was added DIEA (3.58 g, 27.73 mmol), 6-bromohexanoic acid (1.62 g, 8.32 mmol), EDCI (2.13 g, 11.09 mmol), and DMAP (350 mg, 2.77 mmol). The reaction was stirred at 40° C. for 10 h. The reaction mixture was concentrated in vacuo and purified by flash column chromatography (EtOAc:PE=20:1) to give the target product as a yellow oil (1.3 g, 52% yield).

[0471] Step 4: Preparation of compound 39-5 CH 3 To a solution of 39-4 (1.13 g, 2.46 mmol) in CN (50 mL), 2 CO 3 (350mg, 2.46mmol), Cs 2 CO 3 (80 mg, 0.25 mmol), NaI (40 mg, 0.25 mmol), and 2-aminoethan-1-ol (50 mg, 0.82 mmol) were added. The reaction was stirred at 80° C. for 10 h. The reaction mixture was concentrated in vacuo. The crude product was purified by flash column chromatography (CH 2 Cl 2 :MeOH=10:1) to give the target product (300 mg, 46% yield) as a yellow oil. LCMS: Room temperature: 1.870 min, MS m / z (ESI): 794.7 [M+H].

[0472] Step 5: Preparation of compound 39-6 CH 2 Cl 2 To a solution of 39-5 (300 mg, 0.37 mmol) in (10 mL) of SOCl 2 (135 mg, 1.13 mmol) was added. The reaction was stirred at 30° C. for 10 h. The reaction mixture was concentrated in vacuo to give the target product as a yellow oil (307 mg, 100% yield). LCMS: Room temperature: 0.250 min, MS m / z (ESI): 812.7 [M+H].

[0473] Step 6: Preparation of compound 39 To a solution of 39-6 (400 mg, 0.51 mmol) in THF (5 mL) was added DIEA (150 mg, 1.11 mmol), NaI (60 mg, 0.37 mmol) and 1-5 (85 mg, 0.74 mmol). The reaction was stirred at 70 °C for 10 h. The reaction mixture was filtered and concentrated in vacuo. The crude product was purified by preparative HPLC to give the target product as a yellow oil (45 mg, 13% yield).

[0474] 1H NMR (400 MHz, CDCl 3 ) δ:0.87 (t, J = 8 Hz, 18H), 1.11-1.26 (m, 52H), 1.43-1.68 (m, 17H), 1.83-2.02 (m, 4H), 2.28-2.55 (m, 14H), 3.14-3.18 (m, 1H), 3.51-3.53 (m, 2H), 4.83-4.88 (m, 2H). LCMS: room temperature: 1.726 min, MS m / z (ESI): 891.8 [M+H].

[0475] The following compounds were prepared in a similar manner to compound 39 using the corresponding starting materials. [Table 6]

[0476] 6.25 Example 25: Preparation of Compound 54 [ka] Step 1: Preparation of compound 54-2 To a solution of 53-1 (575 mg, 5.0 mmol, 1.0 equiv) in DCM (10 mL) was added Boc 2 O (1145 mg, 5.25 mmol, 1.05 equiv) was added. The mixture was stirred at room temperature for 3 h. LCMS showed the reaction was complete. The mixture was concentrated in vacuo and the crude product, a yellow oil, was used in the next step without further purification (1.1 g, crude).

[0477] Step 2: Preparation of compound 54-3 To a solution of 54-2 (1.1 g, 5.11 mmol, 1.0 equiv) in dry THF (20 ml) was added LiAlH 4(970 mg, 25.55 mmol, 5.0 equiv.) was added. The mixture was stirred at 75° C. overnight. It was quenched with 15% NaOH solution (5 mL) and the mixture was filtered. The organic phase was evaporated under reduced pressure. The crude product as a white solid was used in the next step without further purification (550 mg, crude). LCMS: Room temperature: 0.380 min, MS m / z (ESI): 130.3 [M+H] + .

[0478] Step 3: Preparation of compound 54 To a solution of 1-3 (300 mg, 0.397 mmol, 1.0 equiv) and 54-3 (153 mg, 1.19 mmol, 3.0 equiv) in THF (10 mL) was added DIEA (205 mg, 1.59 mmol, 4.0 equiv). The reaction was stirred at 70° C. for 16 h. LCMS showed the reaction was complete. The mixture was evaporated under reduced pressure and purified by preparative HPLC to give the title compound (60 mg, 17.9%) as a colorless oil.

[0479] 1 H NMR (400 MHz, CDCl 3 ) δ:0.87-0.90 (m, 12H), 1.27-1.33 (m, 54H), 1.43-1.47 (m, 5H), 1.59-1.65 (m, 7H), 1.82-2.03 (m, 4H), 2.26-2.32 (m, 7H), 2.40-2.44 (m, 5H), 2.46-2.51 (m, 4H), 3.59-3.69 (m, 2H), 3.96-3.97 (m, 4H). LCMS: Room temperature: 1.40 min, MS m / z (ESI): 849.7 [M+H] + .

[0480] The following compounds were prepared in a similar manner to compound 54 using the corresponding starting materials. [Table 7]

[0481] 6.26 Example 26: Preparation of Compound 55 [ka] Step 1: Preparation of compound 55-2 To a solution of 53-1 (500 mg, 4.34 mmol, 1.0 equiv) in MeOH (10 mL) was added acetaldehyde (191 mg, 4.34 mmol, 1.0 equiv). The mixture was stirred at room temperature overnight. Then, NaBH 4 (200 mg, 5.21 mmol, 1.2 equiv.) was added. The mixture was stirred at room temperature for 2 h. LCMS showed the reaction was complete. The mixture was concentrated under vacuum and the residue was purified by column chromatography silica gel (DCM:MeOH=1:0 to 10:1) to give the desired product 55-2 (200 mg, 23.6%) as a yellow oil. LCMS: Room temperature: 0.36 min, MS m / z (ESI): 144.2 [M+H] + .

[0482] Step 2: Preparation of compound 55 To a solution of 1-3 (300 mg, 0.397 mmol, 1.0 equiv) and 55-2 (172 mg, 1.19 mmol, 3.0 equiv) in THF (10 mL) was added DIEA (205 mg, 1.59 mmol, 4.0 equiv). The reaction was stirred at 70° C. for 16 h. LCMS showed the reaction was complete. The mixture was evaporated under reduced pressure and purified by preparative HPLC to give the title compound (82 mg, 23.9%) as a colorless oil.

[0483] 1 H NMR (400 MHz, CDCl 3 ) δ:0.92-0.93 (m, 12H), 0.95-0.97 (m, 3H), 1.25-1.34 (m, 54H), 1.38-1.42 (m, 5H), 1.53-1.60 (m, 7H), 1.72-1.74 (m, 3H), 1.94-1.95 (m, 2H), 2.21-2.25 (m, 4H), 2.32-2.49 (m, 11H), 3.49-3.51 (m, 1H), 3.89-3.90 (m, 4H). LCMS: Room temperature: 1.63 min, MS m / z (ESI): 863.6 [M+H]+ .

[0484] The following compounds were prepared in a similar manner to compound 55 using the corresponding starting materials. [Table 8-1] [Table 8-2] [Table 8-3] [Table 8-4]

[0485] 6.27 Example 27: Preparation of Compound 57 [ka] Step 1: Preparation of compound 57-2 A solution of 53-1 (300 mg, 2.61 mmol, 1.2 equiv) in EtOH (10 ml) was diluted with 2-iodopropane (369 mg, 2.17 mmol, 1.0 equiv), NaHCO 3 (547 mg, 6.52 mmol, 3.0 equiv) was added. The mixture was stirred at 80 °C overnight. LCMS showed the reaction was complete. The mixture was filtered, the organic layer was concentrated in vacuo, and the residue was purified by column chromatography on silica gel (DCM:MeOH = 1:0 to 10:1) to give the desired product 57-2 (300 mg, 88%) as a white solid.

[0486] Step 2: Preparation of compound 57 To a solution of 1-3 (300 mg, 0.397 mmol, 1.0 equiv) and 57-2 (187 mg, 1.19 mmol, 3.0 equiv) in THF (10 mL) was added DIEA (205 mg, 1.59 mmol, 4.0 equiv). The reaction was stirred at 70° C. for 16 h. LCMS showed the reaction was complete. The mixture was evaporated under reduced pressure and purified by preparative HPLC to give the title compound (35 mg, 10.1%) as a yellow oil.

[0487] 1 H NMR (400 MHz, CDCl 3 ) δ:0.80-0.83 (m, 12H), 0.93-0.94(m, 6H), 1.19-1.25 (m, 54H), 1.35-1.40 (m, 4H), 1.53-1.59 (m, 8H), 1.70-1.75 (m, 2H), 1.92-1.94 (m, 2H), 2.18-2.51(m, 14H), 2.89-2.91(m, 1H), 3.46-3.53 (m, 1H), 3.89-3.90 (m, 4H). LCMS: Room temperature: 1.34 min, MS m / z (ESI): 877.7[M+H] + .

[0488] 6.28 Example 28: Preparation of Compound 46 [ka] Step 1: Preparation of compound 46-3 CH 2 Cl 2 To a solution of 46-1 (2.0 g, 10.25 mmol) in (50 mL) was added DIEA (6.63 g, 51.27 mmol), 46-2 (2.19 g, 15.38 mmol), EDCI (3.93 g, 20.51 mmol), and DMAP (650 mg, 5.13 mmol). The reaction was stirred at room temperature for 10 h. The reaction mixture was concentrated in vacuo and purified by flash column chromatography (EtOAc:PE=20:1) to give the target product (2 g, 64% yield) as a yellow oil.

[0489] Step 2: Preparation of compound 46-4 CH 3 To a solution of 46-3 (1.6 g, 4.91 mmol) in CN (50 mL), 2 CO 3 (700mg, 4.91mmol), Cs 2 CO 3 (100 mg, 0.49 mmol), NaI (80 mg, 0.49 mmol), and 2-aminoethan-1-ol (100 mg, 0.1.64 mmol) were added. The reaction was stirred at 80° C. for 10 h. The reaction mixture was concentrated in vacuo. The crude product was purified by flash column chromatography (CH 2 Cl 2 :MeOH=10:1) to give the target product (300 mg, 61% yield) as a yellow oil. LCMS: Room temperature: 0.746 min, MS m / z (ESI): 300.2 [M+H].

[0490] Step 3: Preparation of compound 46-7 To a solution of 46-5 (1.0 g, 16.65 mmol) in THF (20 mL) was added 46-6 (100 mL, 100 mmol). The reaction was stirred at room temperature for 1 h. The reaction mixture was poured into ice-cold water (100 ml) and diluted with CH 2 Cl 2 (3×100 mL). The combined organic layers were washed with brine and anhydrous Na 2 SO 4 After drying at 40° C. and concentrating in vacuum, the crude product was purified by flash column chromatography (PE:EtOAc=10:1) to give the target product as a yellow oil (1.0 g, 26% yield).

[0491] Step 4: Preparation of compound 46-9 A solution of 46-7 (0.5 g, 2.19 mmol) in PhMe (30 mL) was added to TsOH H 2O (40 mg, 0.22 mmol) and 46-8 (1.1 g, 6.57 mmol) were added. The reaction was stirred at 130° C. for 2 h. The reaction mixture was concentrated in vacuo and purified by flash column chromatography (EtOAc:PE=20:1) to give the target product (0.5 g, 63% yield) as a yellow oil.

[0492] Step 5: Preparation of compound 46-10 CH 3 To a solution of 46-4 (300 mg, 1.0 mmol) in CN (20 mL), 2 CO 3 (420mg, 3.01mmol), Cs 2 CO 3 (100 mg, 0.3 mmol), NaI (50 mg, 0.3 mmol) and 46-9 (500 mg, 1.3 mmol) were added. The reaction was stirred at 80° C. for 10 h. The reaction mixture was concentrated in vacuo. The crude product was purified by flash column chromatography (PE:EtOAc=2:1) ​​to give the target product (200 mg, 33% yield) as a yellow oil. LCMS: Room temperature: 0.915 min, MS m / z (ESI): 596.4 [M+H].

[0493] Step 6: Preparation of compound 46-11 CH 2 Cl 2 To a solution of 46-10 (200 mg, 0.33 mmol) in 10 mL of SOCl 2 (120 mg, 1.01 mmol) was added. The reaction was stirred at 30° C. for 10 h. The reaction mixture was concentrated in vacuo to give the target product as a yellow oil (206 mg, 100% yield). LCMS: Room temperature: 1.460 min, MS m / z (ESI): 614.4 [M+H].

[0494] Step 7: Preparation of compound 46 To a solution of 46-11 (200 mg, 0.32 mmol) in THF (10 mL) was added DIEA (130 mg, 0.98 mmol), NaI (50 mg, 0.32 mmol) and 1-3 (75 mg, 0.65 mmol). The reaction was stirred at 70 °C for 10 h. The reaction mixture was filtered and concentrated in vacuo. The crude product was purified by preparative HPLC to give the target product as a yellow oil (20 mg, 9% yield).

[0495] 1 H NMR (400 MHz, CDCl 3 ) δ:0.87 (t, J = 8 Hz, 9H), 1.35-1.68 (m, 22H), 1.72-2.33 (m, 24H), 2.41-2.55 (m, 17H), 3.14-3.18 (m, 1H), 3.50-3.53 (m, 2H), 4.61-4.63 (m, 2H), 4.85-4.89 (m, 1H), 5.50-5.65 (m, 2H). LCMS: room temperature: 0.940 min, MS m / z (ESI): 693.5 [M+H].

[0496] The following compounds were prepared in a similar manner to compound 46 using the corresponding starting materials. [Table 9-1] [Table 9-2] [Table 9-3]

[0497] 6.29 Example 29: Preparation of Compound 85 [ka] Step 1: Preparation of compound 85-1 6-Bromohexanoic acid (10.0 g, 51.3 mmol, 1.0 equiv) and PPh in ACN (150 mL) 3(13.4 g, 51.3 mmol, 1.0 equiv) was stirred at reflux for 16 h. LCMS showed the reaction was complete. The reaction mixture was cooled to room temperature and filtered. The cake was dried under vacuum to give the title compound 85-2 (19.3 g, 82%) as a white solid. LCMS: Room temperature: 0.720 min, MS m / z (ESI): 377.1 [M-Br] + .

[0498] Step 2: Preparation of compound 85-2 To a mixture of NaHMDS (10.0 mL, 20.0 mmol, 2.0 equiv.) in THF (50.0 mL), 85-1 (4.5 g, 10.0 mmol, 1.0 equiv.) was added with N 2 The mixture was stirred at room temperature under 45° C. for 1 h. 5-Nonanone (1.42 g, 10.0 mmol, 1.0 equiv) was added. The reaction mixture was stirred at 80° C. for 16 h. TLC showed the reaction was complete. The mixture was adjusted to PH=2-3 with 1M HCl and extracted with EA. The mixture was washed with saturated brine and added with Na 2 SO 4 The solvent was removed and purified by FCC (PE / EA=100 / 1 to 10 / 1) to give compound 85-2 (2.3 g, crude) as a yellow oil. 1 H NMR (400 MHz, CDCl 3 ) δ:0.86-0.89 (m, 6H), 1.25-1.34 (m, 12H), 1.34-1.42 (m, 2H), 1.93-2.05 (m, 4H), 2.35-2.42 (m, 2H), 5.05-5.09 (m, 1H).

[0499] Step 3: Preparation of compound 85-3 To a solution of 85-2 (0.7 g, 3.0 mmol, 1.0 equiv) and 5-bromopentan-1-ol (0.5 g, 3.0 mmol, 1.0 equiv) dissolved in 20 mL of toluene was subsequently added TsOH·HO (60 mg, 0.3 mmol, 0.1 equiv). The mixture was stirred at 140 °C for 2.0 h. The solvent was evaporated to give the crude product, which was purified by column (silica gel, 0–2% EA in PE) chromatography, and the pure product fractions were evaporated to give product 85-3 (0.8 g, crude) as a yellow oil. 1 H NMR (400 MHz, CDCl 3 ) δ:0.86-0.89 (m, 6H), 1.25-1.34 (m, 9H), 1.51-1.53 ​​(m, 3H), 1.63-1.69 (m, 3H), 1.86-2.37 (m, 6H), 2.39-2.41 (m, 2H), 3.40-3.43 (m, 4H), 4.06-4.09 (m, 2H), 5.07-5.12 (m, 1H).

[0500] Step 4: Preparation of compound 85-4 To a solution of 85-3 (0.8 g, 2.0 mmol, 3.0 equiv) and ethanolamine (42 mg, 0.68 mmol, 1.0 equiv) in ACN (10.0 mL) was added Cs 2 CO 3 (61.0mg, 0.0.19mmol, 0.3eq), K 2 CO 3 (261.0 mg, 1.89 mmol, 3.0 equiv) and NaI (9 mg, 0.063 mmol, 0.1 equiv) were added at room temperature. The mixture was stirred at 85 °C for 16 h. LCMS showed the reaction was complete, the mixture was evaporated under reduced pressure and purified by FCC (DCM / MeOH = 1 / 0 to 20 / 1) to give 85-4 (0.2 g, 42% yield) as a yellow oil. LCMS: Room temperature: 0.945 min, MS m / z (ESI): 678.5 [M+H].

[0501] Step 5: Preparation of compound 85-5 To a solution of 85-4 (0.2 g, 0.3 mmol, 1.0 equiv) in MeOH (10 mL) was added Pd / C (30 mg). The reaction mixture was stirred for 2 h. 2 The mixture was stirred at room temperature under reduced pressure for 16 hours. LCMS showed the reaction was complete. The mixture was filtered through diatomaceous earth. The solvent was removed to give compound 85-5 (200 mg, crude) as a brown oil. LCMS: room temperature: 1.033 min, MS m / z (ESI): 662.6 [M+H].

[0502] Step 6: Preparation of compound 85-6 To a solution of 85-5 (200.0 mg, 0.29 mmol, 1.0 equiv) in DCM (5.0 mL) was added SOCl 2 (105 mg, 0.88 mmol, 3.0 equiv) was added at room temperature. The mixture was stirred for 16 h. LCMS showed the reaction was complete, and the mixture was evaporated under reduced pressure to give 85-6 (0.21 g, crude) as a brown oil. LCMS: room temperature: 0.585 min, MS m / z (ESI): 700.4 [M+H].

[0503] Step 7: Preparation of Compound 85 To a solution of 85-6 (200.0 mg, 0.28 mmol, 1.0 equiv) and 1-3 (98.0 mg, 0.86 mmol, 3.0 equiv) in THF (5.0 mL) was added DIEA (180.0 mg, 1.4 mmol, 5.0 equiv) at 0° C. The mixture was stirred at 70° C. for 16 h. LCMS showed the reaction was complete, and the mixture was evaporated under reduced pressure and purified by pre-HPLC to give 85 (70.0 mg, 32% yield) as a yellow oil.

[0504] 1 H NMR (400 MHz, CDCl 3) δ:0.79-0.90 (m, 12H), 1.21-1.35 (m, 43H), 1.58-1.68 (m, 15H), 1.78-2.02 (m, 4H), 2.27-2.31 (m, 4H), 2.47-2.61 (m, 9H), 3.18 (s, 1H), 3.55 (s, 2H), 4.04-4.08 (m, 4H). LCMS: room temperature: 1.330 min, MS m / z (ESI): 779.6 [M+H].

[0505] The following compounds were prepared in a similar manner to compound 85 using the corresponding starting materials. [Table 10]

[0506] 6.30 Example 30: Preparation of Compound 64 [ka] To a solution of compound 1 (300 mg, 0.36 mmol, 1.0 equiv) and DIPEA (140 mg, 1.08 mmol, 3.0 equiv) in DCM (10 mL) was added acetic anhydride (74 mg, 0.72 mmol, 2.0 equiv). The mixture was stirred at room temperature for 16 h. LCMS showed the reaction was complete. The reaction mixture was concentrated and purified by preparative HPLC to give the title compound (40 mg, 13% yield) as a yellow oil.

[0507] 1 H NMR (400 MHz, CDCl 3) δ:0.86-0.90 (m, 12H), 1.26 (s, 52H), 1.43-1.48 (m, 4H), 1.58-1.67 (m, 8H), 1.89-1.89 (m, 2H), 1.97-2.06 (m, 6H), 2.30 (t, J=7.4 Hz, 4H), 2.35-2.56 (m, 6H), 2.68-2.73 (m, 2H), 2.94-3.07 (m, 1H), 3.12-3.20 (m, 1H), 3.96-3.97 (m, 4H), 4.09 (t, J=6.0 Hz, 2H). LCMS: Room temperature: 1.630 min, MS m / z (ESI): 878.6 [M+H] + .

[0508] 6.31 Example 31: Preparation of Compound 95 [ka] To a mixture of pyrrolidin-3-ol (104 mg, 1.189 mmol, 3.0 equiv), DIEA (256 mg, 1.983 mmol, 5.0 equiv) in THF (10 mL) was added 1-3 (300 mg, 0.3965 mmol, 1.0 equiv), NaI (10 mg). The reaction mixture was stirred at 70° C. for 16 h. LCMS showed the reaction was complete. After removal of the solvent, the residue was purified by pre-HPLC to give the title compound (120 mg, 37.49% yield) as a yellow oil.

[0509] 1 H NMR (400 MHz, CCl 3D) δ:4.33 (d, J=...

Claims

1. A compound of formula (I), 【Chemistry 1】 or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof, wherein: G １ and G ２ each independently represents a substituted or unsubstituted C ２ -C １２ Alkylene, or C ２ -C １２ alkenylene, wherein the alkylene or alkenylene is at least one -CH ２ - is optionally replaced by -O-; L １ But -OC(=O)R １ , -C(=O)OR １ , -OC(=O)OR １ , -C(=O)R １ , -OR １ , -S(O) ｘ R １ , -S-SR １ , -C(=O)SR １ , -SC(=O)R １ , -NR ａ C(=O)R １ , -C(=O)NR ｂ R ｃ , -NR ａ C(=O)NR ｂ R ｃ , -OC(=O)NR ｂ R ｃ , -NR ａ C(=O)OR １ , -SC(=S)R １ , -C(=S)SR １ , -C(=S)R １ , -CH(OH)R １ , -P(=O)(OR ｂ ) (OR ｃ ), -(C ６ -C １０ Arylene)-R １ , -(6- to 10-membered heteroarylene)-R １ , or R １ wherein the arylene and heteroarylene are substituted or unsubstituted; L ２ But -OC(=O)R ２ , -C(=O)OR ２ , -OC(=O)OR ２ , -C(=O)R ２ , -OR ２ , -S(O) ｘ R ２ , -S-SR ２ , -C(=O)SR ２ , -SC(=O)R ２ , -NR ｄ C(=O)R ２ , -C(=O)NR ｅ R ｆ , -NR ｄ C(=O)NR ｅ R ｆ , -OC(=O)NR ｅ R ｆ , -NR ｄ C(=O)OR ２ , -SC(=S)R ２ , -C(=S)SR ２ , -C(=S)R ２ , -CH(OH)R ２ , -P(=O)(OR ｅ ) (OR ｆ ), -(C ６ -C １０ Arylene)-R ２ , -(6- to 10-membered heteroarylene)-R ２ , or R ２ wherein the arylene and heteroarylene are substituted or unsubstituted; R １ and R ２ each independently represents a substituted or unsubstituted C ６ -C ３２ Alkyl or C ６ -C ３２ alkenyl, R ａ , R ｂ , R ｄ , and R ｅ each independently represents H, substituted or unsubstituted, C １ -C ２４ Alkyl, or C ２ -C ２４ alkenyl, R ｃ and R ｆ each independently represents a substituted or unsubstituted C １ -C ３２ Alkyl or C ２ -C ３２ alkenyl, G ３ is substituted or unsubstituted, C ２ -C ２４ Alkylene, C ２ -C ２４ Alkenylene, C ３ -C ８ Cycloalkylene, or C ３ -C ８ is cycloalkenylene, R ３ But -N(R ４ ) R ５ and R ４ But, C ３ -C ８ Cycloalkyl, C ３ -C ８ cycloalkenyl, or 4- to 8-membered heterocyclyl; R ４ is unsubstituted or has one or more hydroxyl, halogen, C １ -C ６ substituted with alkyl or oxo; R ５ But, C １ -C １２ Alkyl or C ３ -C ８ cycloalkyl, R ５ is unsubstituted, substituted with one or more hydroxyls, or substituted with one or more hydroxyls and one or more oxos; x is 0, 1, or 2; The prodrug is an acetate, formate, or benzoate of an alcohol of the compound of formula (I). A compound or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.

2. A compound of formula (IA), 【Chemistry 2】 2. The compound of claim 1, or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof, wherein: y and z are each independently an integer from 2 to 12.

3. L １ But -OC(=O)R １ , -C(=O)OR １ or -C(=O)NR ｂ R ｃ And L ２ But -OC(=O)R ２ , -C(=O)OR ２ or -C(=O)NR ｅ R ｆ 3. The compound according to claim 1 or 2,

4. A compound of formula (IB), (IB'), (IB"), (IC), (ID), or (IE), 【Chemistry 3】 2. The compound of claim 1 or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof.

5. A compound of formula (IF), (IF'), (IF"), (IG), (I-H), or (II), 【Chemistry 4】 2. The compound of claim 1, or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof, wherein: y and z are each independently an integer from 2 to 12.

6. G ３ But, C ２ -C ４ alkylene, and optionally, G ３ The compound according to any one of claims 1 to 5, wherein is substituted with one or more oxo.

7. A compound of formula (I-J), (I-J'), (I-J"), (I-K), (IL), or (IM), 【Chemistry 5】 wherein y and z are each independently an integer from 2 to 12; 2. The compound of claim 1, or a pharma- ceutically acceptable salt, prodrug, or stereoisomer thereof, wherein s is an integer from 2 to 24.

8. A compound of formula (IN), (IN'), (IN"), (IO), (IP), or (IQ), 【Chemistry 6】 wherein y and z are each independently an integer from 2 to 12; s is an integer from 2 to 24; t is an integer from 1 to 12, R ６ 2. The compound of claim 1, or a pharma- ceutically acceptable salt, prodrug, or stereoisomer thereof, wherein: is hydrogen or hydroxyl.

9. R ５ But -CH ２ CH ２ The compound according to any one of claims 1 to 7, wherein said compound is OH.

10. A compound of formula (IR), (IR'), (IR"), (IS), (IT), or (IU), 【Chemistry 7】 wherein y and z are each independently an integer from 2 to 12; s is an integer from 2 to 24; t is an integer from 1 to 12, R ６ 2. The compound of claim 1, or a pharma- ceutically acceptable salt, prodrug, or stereoisomer thereof, wherein: is hydrogen or hydroxyl.

11. R １ and R ２ each independently represents a substituted or unsubstituted branched C ６ -C ２４ Alkyl or branched C ６ -C ２４ The compound according to any one of claims 1 to 10, which is alkenyl.

12. R ａ , R ｂ , R ｄ , and R ｅ are each independently H, and / or R ｃ and R ｆ each independently represents a substituted or unsubstituted branched C ６ -C ２４ Alkyl or branched C ６ -C ２４ The compound according to any one of claims 1 to 11, which is alkenyl.

13. The following compounds 【Chemistry 8-1】 【Chemistry 8-2】 【Chemistry 8-3】 【Chemistry 8-4】 【Chemistry 8-5】 【Chemistry 8-6】 【Chemistry 8-7】 【Chemistry 8-8】 【Chemistry 8-9】 【Chemistry 8-10】 【Chemistry 8-11】 【Chemistry 8-12】 【Chemistry 8-13】 or a pharma- ceutically acceptable salt, prodrug or stereoisomer thereof that is an acetate, formate, or benzoate of the alcohol.

14. A composition comprising a compound according to any one of claims 1 to 13 and a therapeutic or prophylactic agent.

15. below: (i) structural lipids; (ii) steroids, (iii) Polymer-conjugated lipids The composition of claim 14 further comprising one or more of the following:

16. The composition of claim 15 , wherein the therapeutic or prophylactic agent comprises at least one mRNA encoding an antigen or a fragment or epitope thereof.

17. 17. The composition of claim 16, wherein the mRNA comprises one or more functional nucleotide analogs, the functional nucleotide analogs being one or more selected from pseudouridine, 1-methyl-pseudouridine, and 5-methylcytosine.

18. The composition according to any one of claims 14 to 17, wherein the composition is a nanoparticle.

19. A lipid nanoparticle comprising a compound according to any one of claims 1 to 13 or a composition according to any one of claims 14 to 18.

20. A pharmaceutical composition comprising a compound according to any one of claims 1 to 13, a composition according to any one of claims 14 to 18, or a lipid nanoparticle according to claim 19, and a pharma- ceutically acceptable excipient or diluent.

Images