Novel AAV Capsids and Compositions Containing the Same

Abstract

Provided herein are novel AAV capsids and rAAVs comprising the same. In one embodiment, vectors using the novel AAV capsids exhibit increased transduction of selected target tissues compared to prior art AAVs.

Description

Background Art

[0001] Adeno-associated virus (AAV) is very promising in human gene therapy and has been widely used in various studies to target the liver, muscle, heart, brain, eye, kidney, and other tissues due to its ability to provide long-term gene expression and lack of pathogenicity. AAV belongs to the family Parvoviridae and contains single-stranded DNA adjacent to two inverted terminal repeats respectively. Dozens of naturally occurring AAV capsids have been reported, and due to their unique capsid structure, they can recognize and transduce different cell types and organs.

[0002] Since the first test was initiated in 1981, no vector-related toxicity has been reported in clinical trials of AAV vector-based gene therapy. The accumulated safety record of AAV vectors in clinical trials, combined with the demonstrated efficacy, indicates that AAV is a promising platform for gene delivery. Another attractive feature is that AAV is a single-stranded DNA virus with a small genome (about 4.7 kb) and simple genetic components - inverted terminal repeats (ITRs), along with the Rep gene and Cap gene, and thus can be relatively easily manipulated. For AAV vectors, only ITRs and AAV capsid proteins are required. The ITRs function as signals for replication and packaging for vector production, and the capsid proteins not only form a capsid to accommodate the vector genomic DNA but also determine the tissue tropism for delivering the vector genome to target cells and tissues.

[0003] AAV is one of the most effective vector candidates for gene therapy due to its low immunogenicity and non-pathogenic nature. However, despite enabling efficient gene transfer, currently used AAV vectors in the clinic can be hindered by existing immunity to the virus and limited tissue tropism. There is a need for new and more effective AAV vectors.

Summary of the Invention

[0004] In one embodiment, provided herein is a recombinant adeno-associated virus (rAAV) having an AAV capsid (AAVrh.90) comprising a capsid protein comprising the amino acid sequence of SEQ ID NO: 2, wherein a vector genome comprising a heterologous nucleic acid sequence is packaged within the capsid. In certain embodiments, the rAAV has a capsid comprising the AAV capsid sequence of SEQ ID NO: 1 or a capsid protein produced by expression of a sequence sharing at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identity with SEQ ID NO: 1, and a vector genome comprising a heterologous nucleic acid sequence is packaged within the capsid.

[0005] In certain embodiments, the rAAV provided by the present invention has an AAV capsid that is a heterologous population of AAVrh.90 vp1 proteins selected from the group consisting of: a vp1 protein produced by expression from a nucleic acid sequence encoding the predicted amino acid sequence of amino acids 1 to 738 of SEQ ID NO: 2, a vp1 protein produced from SEQ ID NO: 1, or a vp1 protein produced from a nucleic acid sequence sharing at least 70% identity with SEQ ID NO: 1 encoding the predicted amino acid sequence of amino acids 1 to 738 of SEQ ID NO: 2; a vp2 protein produced by expression from a nucleic acid sequence encoding the predicted amino acid sequence of at least about amino acids 138 to 738 of SEQ ID NO: 2, a vp2 protein produced from a sequence comprising at least nucleotides 412 to 2214 of SEQ ID NO: 1, or a vp2 protein produced from a nucleic acid sequence sharing at least 70% identity with at least nucleotides 412 to 2214 of SEQ ID NO: 1 encoding the predicted amino acid sequence of at least about amino acids 138 to 738 of SEQ ID NO: 2, selected from the AAVrh.90 A heterogeneous population of AAVrh.90 vp3 proteins selected from a heterogeneous population of vp2 proteins, vp3 proteins produced by expression from a nucleic acid sequence encoding the predicted amino acid sequence of at least about amino acids 204 - 738 of SEQ ID NO: 2, vp3 proteins produced from a sequence comprising at least nucleotides 610 - 2214 of SEQ ID NO: 1, or vp3 proteins produced from a nucleic acid sequence that is at least 70% identical to at least nucleotides 610 - 2214 of SEQ ID NO: 1 encoding the predicted amino acid sequence of at least about amino acids 204 - 738 of SEQ ID NO: 2, and / or (2) a heterogeneous population of vp1 proteins that are products of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 2, a heterogeneous population of vp2 proteins that are products of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 - 738 of SEQ ID NO: 2, and a heterogeneous population of vp3 proteins that are products of a nucleic acid sequence encoding at least amino acids 204 - 738 of SEQ ID NO: 2, comprising AAV capsid proteins, wherein the vp1, vp2, and vp3 proteins comprise a subpopulation having an amino acid modification comprising at least two highly deamidated asparagines (N) in the asparagine - glycine pairs of SEQ ID NO: 2, and optionally further comprising a subpopulation comprising other deamidated amino acids, wherein the deamidation results in an amino acid change.

[0006] In another embodiment, a composition is provided herein comprising at least rAAV and a physiologically compatible carrier, buffer, adjuvant, and / or diluent. In certain embodiments, the composition is formulated for intrathecal delivery and the vector genome comprises a nucleic acid sequence encoding a gene product for delivery to the central nervous system. In yet another embodiment, the composition is formulated for intravenous, intranasal, and / or intramuscular delivery.

[0007] In certain embodiments, a system useful for producing rAAV is provided. The system includes (a) a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 2, (b) a nucleic acid molecule suitable for packaging into an AAV capsid, the nucleic acid molecule comprising at least one AAV inverted terminal repeat (ITR) and a non-AAV nucleic acid sequence encoding a gene product operably linked to a sequence that directs expression of the product in a host cell, and (c) sufficient AAV rep function and helper function to enable packaging of the nucleic acid molecule into an rAAV capsid.

[0008] In certain embodiments, a method for generating rAAV comprising an AAV capsid is provided. The method includes culturing a host cell, the host cell comprising (a) a nucleic acid molecule encoding an AAV capsid protein comprising the amino acid sequence of SEQ ID NO: 2, (b) a functional rep gene, (c) a mini-gene comprising an AAV 5’ ITR, an AAV 3’ ITR, and a transgene, and (d) sufficient helper function to enable packaging of the mini-gene into an AAV capsid.

[0009] In yet another embodiment, a host cell comprising an rAAV, an expression cassette, or a nucleic acid molecule described herein is provided.

[0010] In certain embodiments, a method for delivering a transgene to a cell is provided. The method includes contacting the cell with an rAAV described herein, the rAAV comprising a transgene.

[0011] Other aspects and advantages of these compositions and methods are further described in the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0012]

Figure 1

Figure 2

Figures 3A - 3C

Figure 4

Figures 5A - 5D

Figures 6A - 6B

Figure 7

Figure 8

Figure 9

Figures 10A - 10C

Figure 11

Figures 12A - 12B

BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Genetic variations of AAV in natural mammalian hosts were explored by using AAV single genome amplification (a technique used to accurately isolate individual AAV genomes from a viral population) (Figure 1). Described herein is the isolation of novel AAV sequences from rhesus monkey tissues that can be classified into various clades. We evaluated the biological properties of AAV vectors derived from natural isolates after intravenous (IV) and intracerebroventricular (ICV) delivery in mice, and after IV and intracisternal (ICM) delivery in NHPs. As a result, both clade-specific transduction patterns and variable transduction patterns of novel AAV variants were identified compared to their prototypical clade member controls.

[0014] Recombinant AAVrh.90 vectors are provided herein and have an AAVrh.90 capsid and a nucleic acid encoding a transgene under the control of regulatory sequences that direct expression of the transgene after delivery to a subject. The rAAVrh.90 capsid independently comprises a protein having the amino acid sequence of SEQ ID NO: 2. Compositions comprising these vectors are provided. The methods described herein are directed to the use of rAAV targeting a tissue of interest for the treatment of various conditions.

[0015] In certain embodiments, vectors comprising an AAVrh.90 capsid suitable for delivery of a transgene to cells of the central nervous system are provided herein. In certain embodiments, intrathecal delivery is desired and includes, for example, delivery to the brain or spinal cord via ICM delivery. In certain embodiments, vectors comprising an AAVrh.90 capsid are highly suitable for delivery of a transgene to cells of peripheral organs including the liver, heart, skeletal (striated) muscle, kidney, and pancreas. The AAVrh.90 vectors can be delivered systemically or targeted via an administration route suitable for targeting these tissues.

[0016] Unless otherwise defined, technical and scientific terms used herein shall have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs and by reference to publicly available documents that provide a general guide to many of the terms used in this application. The following definitions are provided solely to clarify and are not intended to limit the claimed invention. As used herein, the terms "a" or "an" refer to one or more. Note that, for example, "host cell" represents one or more host cells. Thus, the terms "a" (or "an"), "one or more," and "at least one" are used interchangeably herein. As used herein, the term "about" means a variability of 10% from a given reference, unless otherwise specified. Although various embodiments herein are presented using the word "comprising," it is also contemplated that in other situations, the relevant embodiments should be construed and described using the words "consisting of" or "consisting essentially of."

[0017] For the following description, each of the compositions described herein is, in another embodiment, intended to be useful in the methods of the invention. Additionally, each of the compositions described herein that is useful in the methods is, in another embodiment, itself intended to be an embodiment of the invention.

[0018] "Recombinant AAV" or "rAAV" is a DNase-resistant viral particle comprising two elements, an AAV capsid, and a vector genome comprising at least a non-AAV coding sequence packaged within the AAV capsid. Unless otherwise specified, this term may be used interchangeably with the phrase "rAAV vector." rAAV is any functional AAV rep gene It lacks the parental or functional AAV cap gene and cannot generate progeny, so it is a "replication-deficient virus" or "replication-deficient viral vector". In certain embodiments, the only AAV sequences are the AAV inverted terminal repeats (ITRs), which are typically located at the 5' and 3' termini of the vector genome to enable the genes and regulatory sequences located between the ITRs to be packaged within the AAV capsid.

[0019] As used herein, "vector genome" refers to the nucleic acid sequence packaged inside the rAAV capsid that forms the viral particle. Such nucleic acid sequences include the AAV inverted terminal repeats (ITRs). In the examples herein, the vector genome typically includes, at least from 5' to 3', the AAV 5' ITR, a coding sequence, and the AAV 3' ITR. In certain embodiments, the ITRs are from AAV2 (a different AAV source than the capsid), or another full-length ITR can be selected. In certain embodiments, the ITRs are from the same AAV source as the AAV providing the rep function or the trans-complementary AAV during production. Additionally, other ITRs can be used. Further, the vector genome includes regulatory sequences that direct the expression of the gene product. Suitable components of the vector genome are discussed in more detail herein. The vector genome may be referred to herein as a "minigene".

[0020] The term "expression cassette" refers to a nucleic acid molecule comprising an introduced gene sequence and regulatory sequences therefor (e.g., promoter, enhancer, polyA), and the cassette can be packaged into the capsid of a viral vector (e.g., viral particle). Typically, such an expression cassette for producing a viral vector comprises an introduced gene sequence adjacent to the packaging signal of the viral genome, and other expression control sequences such as those described herein. For example, in the case of an AAV viral vector, the packaging signals are the 5' inverted terminal repeat (ITR) and the 3' ITR. In certain embodiments, the term "transgene" can be used interchangeably with "expression cassette". In other embodiments, the term "transgene" refers only to the coding sequence of a selected gene.

[0021] rAAV consists of an AAV capsid and a vector genome. The AAV capsid is an aggregate of a heterogeneous population of vp1, a heterogeneous population of vp2, and a heterogeneous population of vp3 proteins. As used herein, when used to refer to a vp capsid protein, the term "heterogeneous" or any grammatical variation thereof refers to a population consisting of non-identical elements having, for example, vp1, vp2, or vp3 monomers (proteins) with different modified amino acid sequences.

[0022] As used herein, the term "heterogeneous population" as used in connection with the vp1, vp2, and vp3 proteins (alternatively referred to as isoforms) refers to differences in the amino acid sequences of the vp1, vp2, and vp3 proteins within the capsid. The AAV capsid contains subpopulations within the vp1 protein, within the vp2 protein, and within the vp3 protein, with modifications from the predicted amino acid residues. These subpopulations contain at least certain deamidated asparagine (N or Asn) residues. For example, a particular subpopulation contains at least 1, 2, 3, or 4 highly deamidated asparagine (N) positions in an asparagine-glycine pair, optionally further containing other deamidated amino acids, and deamidation results in amino acid changes and other optional modifications. See PCT / US19 / 019804, filed February 27, 2019, and PCT / US19 / 019861, filed February 27, 2019 (each of which is incorporated herein by reference).

[0023] As used herein, a "subpopulation" of a vp protein, unless otherwise specified, refers to a group of vp proteins having at least one defined common characteristic and consisting of fewer members than all members of the reference group, from at least one group member to the fewest members. For example, a "subpopulation" of the vp1 protein, unless otherwise specified, is at least one (1) vp1 protein in the assembled AAV capsid and can be less than all vp1 proteins. A "subpopulation" of the vp3 protein, unless otherwise specified, can be one (1) vp3 protein less than all vp3 proteins in the assembled AAV capsid. For example, the vp1 protein can be a subpopulation of the vp proteins, the vp2 protein can be a separate subpopulation of the vp proteins, and vp3 can be a further subpopulation of the vp proteins in the assembled AAV capsid. In another example, the vp1, vp2, and vp3 proteins can contain subpopulations that differ, for example, by at least 1, 2, 3, or 4 highly deamidated asparagines, such as in an asparagine-glycine pair.

[0024] Unless otherwise specified, high-level deamidation refers to at least 45%, at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or up to about 100% deamidation at the reference amino acid position as compared to the predicted amino acid sequence at the reference amino acid position. Such percentages can be determined using 2D gels, mass spectrometry techniques, or other suitable techniques.

[0025] Without intending to be bound by theory, deamidation of at least highly deamidated residues in the vp proteins in the AAV capsid is thought to be essentially non-enzymatic and is caused by functional groups within the capsid protein that deamidate the selected asparagine and, to a lesser extent, glutamine residues. Efficient capsid assembly of most deamidated vp1 proteins indicates that these events occur after capsid assembly or that deamidation in the individual monomers (vp1, vp2, or vp3) is structurally well tolerated and has little effect on the assembly kinetics. Generally, extensive deamidation in the VP1 unique (VP1-u) region (~aa 1-137), which is thought to be located internally prior to cell entry, suggests that VP deamidation can occur prior to capsid assembly.

[0026] Although not intended to be bound by theory, deamidation of N can occur by a nucleophilic attack on the carbon atom of the side-chain amide group of Asn via the backbone nitrogen atom of its C-terminal residue. An intermediate ring-closed succinimide residue is thought to be formed. The succinimide residue then undergoes rapid hydrolysis to yield the final product, aspartic acid (Asp) or isoaspartic acid (IsoAsp). Thus, in certain embodiments, deamidation of asparagine (N or Asn) yields Asp or IsoAsp and can be interconverted, for example, via a succinimide intermediate as illustrated below.

Chemical formula

[0027] As provided herein, each deamidated N in VP1, VP2, or VP3 can independently be aspartic acid (Asp), isoaspartic acid (isoAsp), aspartate, and / or an interconverted blend of Asp and isoAsp, or a combination thereof. Any suitable ratio of α- and isoaspartic acid can be present. For example, in certain embodiments, the ratio can be an aspartic acid to isoaspartic acid of 10:1 to 1:10, about 50:50 aspartic acid:isoaspartic acid, or about 1:3 aspartic acid:isoaspartic acid, or another selected ratio.

[0028] In certain embodiments, one or more glutamines (Q) can be deamidated to glutamic acid (Glu), i.e., α-glutamic acid, γ-glutamic acid (Glu), or a blend of α- and γ-glutamic acid, and can be interconverted via a common glutaryl imide intermediate. Any suitable ratio of α- and γ-glutamic acid can be present. For example, in certain embodiments, the ratio can be an α to γ of 10:1 to 1:10, about 50:50 α:γ, or about 1:3 α:γ, or another selected ratio.

Chemical formula

[0029] Thus, rAAV contains a subpopulation in the rAAV capsid of vp1, vp2, and / or vp3 proteins having deamidated amino acids, including at least one subpopulation containing at least one highly deamidated asparagine. In addition, other modifications may include isomerization at specifically selected aspartic acid (D or Asp) residue positions. In still other embodiments, the modification may include amidation at the Asp position.

[0030] In certain embodiments, the AAV capsid contains a subpopulation of vp1, vp2, and vp3 having at least 1, at least 2, at least 3, at least 4, at least 5 to at least about 25 deamidated amino acid residue positions, at least 1-10%, at least 10-25%, at least 25-50%, at least 50-70%, at least 70-100%, at least 75-100%, at least 80-100%, or at least 90-100% of which are deamidated compared to the encoded amino acid sequence of the vp protein. Most of these may be N residues. However, Q residues may be deamidated.

[0031] As used herein, "encoded amino acid sequence" refers to the amino acids predicted based on the translation of the known DNA codons of a reference nucleic acid sequence that is translated into amino acids. The following table illustrates DNA codons and the 20 common amino acids, showing both the one-letter code (SLC) and the three-letter code (3LC). [Table 1]

[0032] In certain embodiments, rAAV has an AAV capsid having vp1, vp2 and vp3 proteins and has a subpopulation containing combinations of 2, 3, 4, 5 or more deamidated residues at the positions shown in the tables provided herein (incorporated herein by reference).

[0033] Deamidation of rAAV can be determined using 2D gel electrophoresis, and / or mass spectrometry, and / or protein modeling techniques. Online chromatography can be performed on an Acclaim PepMap column coupled to a Q Exactive HF with a NanoFlex source (Thermo Fisher Scientific) and a Thermo UltiMate 3000 RSLC system (Thermo Fisher Scientific). MS data is acquired using the data-dependent Top-20 method of the Q Exactive HF, dynamically selecting the most abundant and yet unsequenced precursor ions from the survey scan (200 - 2000 m / z). Sequencing is performed via higher energy collision dissociation fragmentation at a target value of 1e5 ions determined by predicted automatic gain control, with precursor isolation in a 4 m / z window. Survey scans were acquired at a resolution of 120,000 at m / z 200. The resolution of the HCD spectra can be set to 30,000 at m / z 200 with a maximum ion injection time of 50 ms and a normalized collision energy of 30. The S-lens RF level can be set to 50 to optimize the transmission of the m / z region occupied by peptides from the digest. Precursor ions can be excluded in single, unassigned, or more than six charge states from fragmentation selection. BioPharma Finder 1.0 software (Thermo Fischer Scientific) can be used for the analysis of the acquired data. For peptide mapping, a single-entry protein FASTA database with carbamidomethylation set as a fixed modification, oxidation, deamidation, and phosphorylation set as variable modifications, a 10 ppm mass accuracy, high protease specificity, and a confidence level of 0.8 for the MS / MS spectra are used for the search. Examples of suitable proteases can include, for example, trypsin or chymotrypsin. Deamidation is the mass of the intact molecule + 0.984 Da (-OH and -NH 2Since an additional mass difference of the base is added, the mass spectrometric identification of deamidated peptides is relatively easy. The rate of deamidation of a specific peptide is determined by dividing the mass area of the deamidated peptide by the sum of the areas of the deamidated and native peptides. Considering the number of possible deamidation sites, isotopic species deamidated at different sites can co-elute at a single peak. Therefore, fragment ions derived from peptides with multiple potential deamidation sites can be used to identify or distinguish multiple deamidation sites. In these cases, the relative intensities within the observed isotope pattern can be used to specifically determine the relative abundances of different deamidated peptide isomers. This method assumes that the fragmentation efficiency is the same for all isomeric species and is independent at the deamidation site. It will be understood by those skilled in the art that several variations of these exemplary methods can be used. For example, suitable mass spectrometers can include quadrupole time-of-flight mass spectrometers (QTOF) such as Waters Xevo or Agilent 6530, or Orbitrap devices such as Orbitrap Fusion or Orbitrap Velos (Thermo Fisher). Suitable liquid chromatography systems include, for example, the Acquity UPLC system manufactured by Waters or the Agilent system (1100 or 1200 series). Suitable data analysis software can include, for example, MassLynx (Waters), Pinpoint, and Pepfinder (Thermo Fischer Scientific), Mascot (Matrix Science), Peaks DB (Bioinformatics Solutions). Still other techniques can be described, for example, in X. Jin et al, Hu Gene Therapy Methods, Vol. 28, No. 5, pp. 255-267, published online on June 16, 2017.

[0034] In addition to deamidation, even if other modifications occur, one amino acid will not be converted to a different amino acid residue. Such modifications may include acetylated residues, isomerization, phosphorylation, or oxidation.

[0035] Regulation of deamidation: In certain embodiments, AAV is modified to change the glycine of the asparagine-glycine pair to reduce deamidation. In other embodiments, asparagine is changed to a different amino acid, such as glutamine, which deamidates at a slower rate, or an amino acid lacking an amide group (e.g., glutamine and asparagine contain an amide group), and / or an amino acid lacking an amine group (e.g., lysine, arginine, and histidine contain an amine group). As used herein, an amino acid lacking an amide or amine side group refers to, for example, glycine, alanine, valine, leucine, isoleucine, serine, threonine, cysteine, phenylalanine, tyrosine, or tryptophan, and / or proline. The modifications as described can be in one, two, or three of the asparagine-glycine pairs found in the encoded AAV amino acid sequence. In certain embodiments, such modifications are not made in all four of the asparagine-glycine pairs. Thus, the method for reducing deamidation of AAV and / or engineered AAV variants has a lower deamidation rate. Additionally, or alternatively, one or more other amide amino acids can be changed to non-amide amino acids to reduce deamidation of AAV. In certain embodiments, the mutant AAV capsids described herein contain mutations in the asparagine-glycine pair such that glycine is changed to alanine or serine. The mutant AAV capsid can contain one, two, or three mutations, where the reference AAV naturally contains four NG pairs. In certain embodiments, the AAV capsid can contain one, two, three, or four such mutations, where the reference AAV naturally contains five NG pairs. In certain embodiments, the mutant AAV capsid contains only a single mutation in the NG pair. In certain embodiments, the mutant AAV capsid contains mutations in two different NG pairs. In certain embodiments, the mutant AAV capsid has two different NG pairs containing mutations and is located at structurally distinct positions in the AAV capsid. In certain embodiments, the mutation is not in the VP1 unique region. In certain embodiments, one of the mutations is in the VP1 unique region.Optionally, the variant AAV capsid contains modifications that minimize or eliminate deamidation of one or more asparagines or glutamines that are not modified within the NG pair but are located outside the NG pair.

[0036] In certain embodiments, provided is a method of increasing the potency of an rAAV vector that includes engineering an AAV capsid that eliminates one or more of the NGs in the wild-type AAV capsid. In certain embodiments, the coding sequence of the "G" of "NG" is engineered to encode another amino acid. In the following specific examples, "S" or "A" is substituted. However, other suitable amino acid coding sequences may be selected.

[0037] These amino acid modifications can be performed by conventional genetic engineering techniques. For example, a nucleic acid sequence containing a modified AAV vp codon can be generated, and 1 to 3 of the codons encoding glycine in the asparagine-glycine pair are modified to encode an amino acid other than glycine. In certain embodiments, the nucleic acid sequence containing the modified asparagine codon can have 1 to 3 of the asparagine-glycine pairs engineered such that the modified codon encodes an amino acid other than asparagine. Each modified codon can encode a different amino acid. Alternatively, one or more of the modified codons can encode the same amino acid. In certain embodiments, these nucleic acid sequences of the modified AAVrh.90 can be used to generate variant rAAVs having capsids that contain less deamidation than the native AAVrh.90 capsid. Such variant rAAVs can have reduced immunogenicity and / or increased stability upon storage, particularly in suspension form.

[0038] This specification also provides nucleic acid sequences encoding AAV capsids with reduced deamidation. Designing nucleic acid sequences encoding such AAV capsids, including DNA (genomic or cDNA) or RNA (e.g., mRNA), is within the scope of the art. Such nucleic acid sequences can be codon-optimized for expression in a selected system (i.e., cell type) and can be designed by various methods. This optimization can be performed using methods available online (e.g., GeneArt), published methods, or companies that provide codon optimization services, such as DNA2.0 (Menlo Park, CA). One codon optimization method is described, for example, in International Patent Publication No. WO 2015 / 012924, which is hereby incorporated by reference in its entirety. See also, for example, U.S. Patent Publication No. 2014 / 0032186 and U.S. Patent Publication No. 2006 / 0136184. Preferably, the entire length of the open reading frame (ORF) of the product is modified. However, in some embodiments, only fragments of the ORF may be modified. By using one of these methods, a frequency can be applied to any given polypeptide sequence to produce a nucleic acid fragment of a codon-optimized coding region encoding the polypeptide. Several options are available for performing the actual codon changes or synthesizing codon-optimized coding regions designed as described herein. Such modifications or syntheses can be performed using standard and routine molecular biology manipulations known to those of skill in the art. In one approach, a series of complementary oligonucleotide pairs, each 80-90 nucleotides in length and spanning the length of the desired sequence, are synthesized by standard methods. These oligonucleotide pairs are synthesized such that upon annealing, an 80-90 base pair double-stranded fragment containing sticky ends is formed. For example, each oligonucleotide of a pair is synthesized to extend 3, 4, 5, 6, 7, 8, 9, 10, or more bases beyond the region that is complementary to the other oligonucleotide of the pair. The single-stranded ends of each pair of oligonucleotides are designed to anneal with the single-stranded ends of another pair of oligonucleotides.Anneal oligonucleotide pairs, then anneal approximately 5 to 6 of these double-stranded fragments together via cohesive single-stranded ends, then ligate them together and clone them into a standard bacterial cloning vector, such as a TOPO® vector available from Invitrogen Corporation, Carlsbad, Calif. Then sequence the construct by standard methods. Prepare some of these constructs consisting of 5 to 6 fragments of 80 to 90 base pairs ligated together (i.e., a fragment of approximately 500 base pairs) such that the entire desired sequence is represented by a series of plasmid constructs. Then cut the inserts of these plasmids with appropriate restriction enzymes and ligate them together to form the final construct. Then clone the final construct into a standard bacterial cloning vector and sequence it. Additional methods will be readily apparent to those skilled in the art. In addition, gene synthesis is commercially readily available.

[0039] In certain embodiments, an AAV capsid is provided having a heterogeneous population of AAV capsid isoforms (i.e., VP1, VP2, VP3) that includes multiple highly deamidated "NG" positions. In certain embodiments, the highly deamidated positions are at the positions shown below with reference to the predicted full-length VP1 amino acid sequence. In other embodiments, the capsid gene is modified such that the referenced "NG" is removed and the mutant "NG" is engineered to another position.

[0040] As used herein, the terms "target cell" and "target tissue" can refer to any cell or tissue intended to be transduced by the AAV vector of interest. The term can refer to any one or more of muscle, liver, lung, airway epithelium, central nervous system, neurons, eye (visual cells), or heart. In one embodiment, the target tissue is the liver. In another embodiment, the target tissue is the heart. In another embodiment, the target tissue is the brain. In another embodiment, the target tissue is muscle.

[0041] As used herein, the terms "mammalian subject" or "subject" include any mammal in need of the treatment methods or prophylaxis described herein, and in particular include humans. Other mammals in need of such treatment or prophylaxis include dogs, cats, or other domesticated animals, horses, livestock, laboratory animals, etc., including non-human primates. The subject may be male or female.

[0042] As used herein, the term "host cell" may refer to a packaging cell line from which rAAV is produced from a plasmid. Alternatively, the term "host cell" may refer to a target cell in which expression of the transgene is desired.

[0043] A. AAV Capsid A novel AAV capsid protein having the vp1 sequence shown in SEQ ID NO: 2 is provided herein. The AAV capsid consists of three overlapping coding sequences, which vary in length due to alternative start codon usage. These variable proteins are referred to as VP1, VP2, and VP3, with VP1 being the longest and VP3 being the shortest. AAV particles consist of all three capsid proteins in a ratio of approximately 1:1:10 (VP1:VP2:VP3). VP3, which is included in the N-terminal VP1 and VP2, is the major structural component that builds the particle. The capsid proteins can be referred to using several different numbering systems. For convenience, as used herein, AAV sequences are referred to using the numbering of VP1 that starts at aa1 of the first residue of VP1. However, the capsid proteins described herein include VP1, VP2, and VP3 (used interchangeably herein as vp1, vp2, and vp3). The numbering of the variable proteins of the capsid is as follows. Nucleotide (nt) AAVrh.90: vp1 - nt1 to 2214 of SEQ ID NO: 1, vp2 - nt412 to 2214, vp3 - nt610 to 2214

[0044] Figures 3A - 3C show the alignment of the nucleic acid sequences of the AAVrh.90 capsid and the AAV8 capsid sequence. Amino acid (aa) AAVrh.90: vp1 - nucleotides 1 to 738 of SEQ ID NO: 2, vp2 - aa 138 to 738, vp3 - aa 204 to 738

[0045] Figure 4 shows the alignment of the amino acid sequence capsids of the AAVrh.90 capsid and the AAV8 capsid sequence.

[0046] Also included herein are rAAVs comprising at least one of vp1, vp2, and vp3 of AAVrh.90 (SEQ ID NO: 2). Also provided herein are rAAVs comprising an AAV capsid encoded by at least one of vp1, vp2, and vp3 of AAVrh.90 (SEQ ID NO: 1).

[0047] In one embodiment, a composition comprising a mixed population of recombinant adeno - associated viruses (rAAVs), wherein each of the rAAVs is (a) an AAV capsid comprising approximately 60 capsid vp1 proteins, vp2 proteins, and vp3 proteins, wherein the vp1, vp2, and vp3 proteins are a heterogeneous population of vp1 proteins produced from a nucleic acid sequence encoding a selected AAVvp1 amino acid sequence, a heterogeneous population of vp2 proteins produced from a nucleic acid sequence encoding a selected AAVvp2 amino acid sequence, a heterogeneous population of vp3 proteins produced from a nucleic acid sequence encoding a selected AAVvp3 amino acid sequence, and the vp1, vp2, and vp3 proteins comprise a sub - population having an amino acid modification comprising at least two highly deamidated asparagines (N) in the asparagine - glycine pairs in the AAV capsid, optionally further comprising a sub - population comprising other deamidated amino acids, wherein the deamidation results in an amino acid change, and an AAV capsid, and (b) a vector genome in the AAV capsid, wherein the vector genome comprises a nucleic acid molecule comprising AAV inverted terminal repeats, and a non - AAV nucleic acid sequence encoding a product operably linked to a sequence that directs expression of the product in a host cell. is provided.

[0048] In certain embodiments, deamidated asparagine is deamidated to aspartic acid, isoaspartic acid, an interconverting aspartic acid / isoaspartic acid pair, or a combination thereof. In certain embodiments, the capsid further comprises deamidated glutamine that is deamidated to (α)-glutamic acid, γ-glutamic acid, an interconverting (α)-glutamic acid / γ-glutamic acid pair, or a combination thereof.

[0049] In certain embodiments, a novel isolated AAVrh.90 capsid is provided. The nucleic acid sequence encoding AAVrh.90 is provided in SEQ ID NO: 1, and the encoded amino acid sequence is provided in SEQ ID NO: 2. rAAV comprising at least one of vp1, vp2, and vp3 of AAVrh.90 (SEQ ID NO: 2) is provided herein. Also provided herein is rAAV comprising an AAV capsid encoded by at least one of vp1, vp2, and vp3 of AAVrh.90 (SEQ ID NO: 1). In certain embodiments, vp1, vp2, and / or vp3 are the full-length capsid proteins of AAVrh.90 (SEQ ID NO: 2). In other embodiments, vp1, vp2, and / or vp3 have N-terminal and / or C-terminal truncations (e.g., truncations of about 1 to about 10 amino acids).

[0050] In a further aspect, a recombinant adeno-associated virus (rAAV) is provided, which comprises (A) an AAVrh.90 capsid, wherein the AAVrh.90 capsid comprises a heterogeneous population of AAVrh.90 vp1 proteins selected from a vp1 protein produced by expression from a nucleic acid sequence encoding the predicted amino acid sequence of positions 1 to 738 of SEQ ID NO: 2, a vp1 protein produced from SEQ ID NO: 2, or a vp1 protein produced from a nucleic acid sequence that is at least 70% identical to SEQ ID NO: 1 encoding the predicted amino acid sequence of positions 1 to 738 of SEQ ID NO: 2; a heterogeneous population of AAVrh.90 vp2 proteins selected from a vp2 protein produced by expression from a nucleic acid sequence encoding the predicted amino acid sequence of at least about amino acids 138 to 738 of SEQ ID NO: 2, a vp2 protein produced from a sequence comprising at least nucleotides 412 to 2214 of SEQ ID NO: 2, or a vp2 protein produced from a nucleic acid sequence that is at least 70% identical to at least nucleotides 412 to 2214 of SEQ ID NO: 1 encoding the predicted amino acid sequence of at least about amino acids 138 to 738 of SEQ ID NO: 2; and a heterogeneous population of AAVrh.90 vp3 proteins selected from a vp3 protein produced by expression from a nucleic acid sequence encoding the predicted amino acid sequence of at least about amino acids 204 to 738 of SEQ ID NO: 2, a vp3 protein produced from a sequence comprising at least nucleotides 610 to 2214 of SEQ ID NO: 2, or a vp3 protein produced from a nucleic acid sequence that is at least 70% identical to at least nucleotides 610 to 2214 of SEQ ID NO: 1 encoding the predicted amino acid sequence of at least about amino acids 204 to 738 of SEQ ID NO: 2; AAVrh.A heterogeneous population of 90vp3 protein, and / or (2) a heterogeneous population of vp1 protein that is a product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 2, a heterogeneous population of vp2 protein that is a product of a nucleic acid sequence encoding at least about amino acids 138 - 738 of SEQ ID NO: 2, and a heterogeneous population of vp3 protein that is a product of a nucleic acid sequence encoding at least amino acids 204 - 738 of SEQ ID NO: 2, wherein the vp1, vp2, and vp3 proteins include a subpopulation having an amino acid modification containing at least two highly deamidated asparagines (N) in the asparagine - glycine pair of SEQ ID NO: 2, and optionally further include a subpopulation containing other deamidated amino acids, and the deamidation results in an amino acid change, AAVrh.90 capsid protein. One or more of the AAVrh.90 capsid proteins, and (B) a vector genome in the AAVrh.90 capsid, the vector genome comprising a nucleic acid molecule containing AAV inverted terminal repeats, and a non - AAV nucleic acid sequence encoding a product operably linked to a sequence that directs expression of the product in a host cell.

[0051] In certain embodiments, the vp1, vp2, and vp3 proteins of AAVrh.90 include a subpopulation having an amino acid modification that includes at least two highly deamidated asparagines (N) in the asparagine-glycine pairs of SEQ ID NO: 2, optionally further including a subpopulation that includes other deamidated amino acids, and the deamidation results in an amino acid change. High levels of deamidation are observed at ~N57, ~N263, ~N385, and / or ~N514 of the N-G pairs, compared to the number of SEQ ID NO: 2. As shown in the following table and Figure 12B, deamidation has been observed at other residues. In certain embodiments, AAVrh.90 may have other residues that are deamidated (e.g., ~N305, ~N499, and / or ~N599, typically less than 20%), and / or phosphorylation (e.g., at S149) (e.g., if present, in the range of about 2 to about 30%, or about 2 to about 20%, or about 2 to about 10%), or oxidation (e.g., at one or more of ~W23, ~M204, ~M212, W248, W282, M405, M473, W480, W505, M526, ~N544, M561, and / or ~M607). Optionally, W can be oxidized to kynurenine.

Table 2

[0052] In certain embodiments, the AAVrh.90 capsid is modified at one or more of the positions specified in the above table, in the provided ranges, as determined using mass spectrometry with trypsin enzyme. In certain embodiments, one or more of the positions, or the glycine following N, is modified as described herein. The residue numbers are based on the AAVrh.90 sequence provided herein. See SEQ ID NO: 2.

[0053] In certain embodiments, the AAVrh.90 capsid comprises a heterogeneous population of vp1 proteins that are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 2, a heterogeneous population of vp2 proteins that are the product of a nucleic acid sequence encoding the amino acid sequence at at least about amino acids 138-738 of SEQ ID NO: 2, and a heterogeneous population of vp3 proteins that are the product of a nucleic acid sequence encoding at least amino acids 204-738 of SEQ ID NO: 2.

[0054] In certain embodiments, the nucleic acid sequence encoding the AAVrh.90 vp1 capsid protein is provided in SEQ ID NO: 1. In other embodiments, 70% to 99.9% The same nucleic acid sequence can be selected to express the AAVrh.90 capsid protein. In certain other embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99% - 99.9% identical to SEQ ID NO: 1. However, other nucleic acid sequences encoding the amino acid sequence of SEQ ID NO: 2 can be selected for use in the production of the rAAV capsid. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 1, or is at least 70% - 99.9% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to SEQ ID NO: 1. In certain embodiments encoding SEQ ID NO: 2, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 1, or has a sequence that is at least 70% - 99.9%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to about nt412 to about nt2214 of SEQ ID NO: 1 and encodes the vp2 capsid protein of SEQ ID NO: 2 (about aa138 - 738). In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of about nt610 to about nt2214 of SEQ ID NO: 1, or has a sequence that is at least 70% - 99.9%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to about nt610 to about nt2214 of SEQ ID NO: 1 and encodes the vp3 capsid protein of SEQ ID NO: 2 (about aa204 - 738).

[0055] The present invention also encompasses a nucleic acid sequence encoding the AAVrh.90 capsid sequence (SEQ ID NO: 2), or a variant AAVrh.90, wherein one or more residues have been modified to reduce deamidation or other modifications specified herein. Such nucleic acid sequences can be used in the production of variant AAVrh.90 capsids.

[0056] In certain embodiments, nucleic acid molecules are provided that have a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to the sequence of SEQ ID NO:1, or to a sequence encoding the vp1 amino acid sequence of SEQ ID NO:2 having the modifications described herein (e.g., deamidated amino acids). In certain embodiments, plasmids having the nucleic acid sequences described herein are provided.

[0057] The terms "substantially homologous" or "substantially similar," when referring to a nucleic acid or fragment thereof, mean that there is nucleotide sequence identity in at least about 95-99% of the aligned sequences when optimally aligned with another nucleic acid (or its complementary strand) with appropriate nucleotide insertions or deletions. Preferably, the homology is over the full length of the sequence, or its open reading frame, or another suitable fragment at least 15 nucleotides in length. Examples of suitable fragments are described herein.

[0058] The terms "percent (%) identity," "sequence identity," "percent sequence identity," or "percent identical" in the context of nucleic acid sequences refer to residues in two sequences that are the same when aligned correspondingly. The length of the comparison for sequence identity can span the full length of the genome, the full length of the gene coding sequence, or, desirably, at least about 500 - 5000 nucleotide fragments. However, identity between smaller fragments, for example, at least about 9 nucleotides, usually at least about 20 - 24 nucleotides, at least about 28 - 32 nucleotides, at least about 36 or more nucleotides, may also be desired.

[0059] Percent identity can be readily determined for the full length of a protein, polypeptide, amino acid sequence over about 32 amino acids, about 330 amino acids, or a peptide fragment thereof, or for the corresponding nucleic acid sequence encoding the sequence. Suitable amino acid fragments The peptide can be at least about 8 amino acids in length and can be up to about 700. Generally, when referring to "identity", "homology", or "similarity" between two different sequences, the "identity", "homology", or "similarity" is determined with reference to an "aligned" sequence. An "aligned" sequence or "alignment" refers to multiple nucleic acid sequences or protein (amino acid) sequences, which, when compared to a reference sequence, often includes corrections for missing or added bases or amino acids.

[0060] Identity can be determined by creating an alignment of the sequences and using various algorithms and / or computer programs known in the art or commercially available [e.g., using BLAST, ExPASy, ClustalO, FASTA, e.g., the Needleman - Wunsch algorithm, the Smith - Waterman algorithm]. The alignment is performed using any of a variety of publicly or commercially available multiple sequence alignment programs. In the case of amino acid sequences, sequence alignment programs such as "Clustal Omega", "Clustal X", "MAP", "PIMA", "MSA", "BLOCKMAKER", "MEME", and "Match - Box" programs are available. Generally, any of these programs is used with default settings, but those skilled in the art can change these settings as needed. Alternatively, those skilled in the art can utilize another algorithm or computer program that provides at least the same level of identity or alignment as that provided by the reference algorithms and programs. See, for example, J.D. Thomson et al, Nucl. Acids Res., "A comprehensive comparison of multiple sequence alignments", 27(13):2682 - 2690(1999).

[0061] Multiple sequence alignment programs are also available for nucleic acid sequences. Examples of such programs include "Clustal Omega", "Clustal W", "CAP Sequence Assembly", "BLAST", "MAP", and "MEME", which are accessible through web servers on the Internet. Other sources of such programs are known to those skilled in the art. Alternatively, the Vector NTI utility can also be used. There are also several algorithms known in the art that can be used to measure nucleotide sequence identity, including those included in the programs described above. As another example, polynucleotide sequences can be compared using Fasta™, a program of GCG version 6.1. Fasta™ provides the alignment of the best overlapping regions and percent sequence identity between a query sequence and a search sequence. For example, percent sequence identity between nucleic acid sequences can be determined using Fasta™ with its default parameters (word size 6 and NOPAM factor for the scoring matrix), as provided in GCG version 6.1 (incorporated herein by reference).

[0062] B.rAAV Vectors and Compositions In another aspect, provided herein are molecules that utilize the AAV capsid sequences (including fragments thereof) described herein to produce viral vectors useful for delivering heterologous genes or other nucleic acid sequences to target cells. In one embodiment, vectors useful in the compositions and methods described herein include at least a sequence encoding the AAVrh.90 capsid, or a fragment thereof. In another embodiment, useful vectors include at least a sequence encoding the rep protein of AAVrh.90, or a fragment thereof. Optionally, such vectors can include both the AAV cap protein and the rep protein. In vectors where both AAV rep and cap are provided, the AAV rep sequence and A All AV cap arrays can have a single origin of a single serotype (e.g., all AAVrh.90 origin). Alternatively, a vector in which the rep array is derived from an AAV different from the wild-type AAV providing the cap array may be used. In one embodiment, the rep and cap arrays are expressed from separate sources (e.g., separate vectors, or host cells and vectors). In another embodiment, these rep arrays are fused in-frame with cap arrays of different AAV serotypes to form chimeric AAV vectors such as AAV2 / 8 described in U.S. Patent No. 7,282,199, which is incorporated herein by reference. Optionally, the vector further comprises a minigene comprising a selected transgene flanked by AAV 5' ITR and AAV 3' ITR. In another embodiment, the AAV is self-complementary AAV (sc-AAV). See US2012 / 0141422, which is incorporated herein by reference. Self-complementary vectors package an inverted repeat genome that can fold into dsDNA without the need for DNA synthesis or base pairing between multiple vector genomes. scAAV are more efficient vectors because they do not need to convert a single-stranded DNA (ssDNA) genome to double-stranded DNA (dsDNA) prior to expression. However, this efficiency trade-off is that the coding capacity of the vector is halved, so scAAV is useful for coding genes of small proteins (up to about 55 kd) and is currently available for RNA-based therapies.

[0063] Pseudotyped vectors in which one AAV capsid has been replaced with a heterologous capsid protein are useful in the present invention. For illustrative purposes, AAV vectors utilizing the AAVrh.90 capsid described herein are used in the examples described below, along with the ITRs of AAV2. See Mussolino et al. cited above. Unless otherwise specified, AAV ITRs, and other selected AAV components described herein, can be individually selected from among any AAV serotype, including, but not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or other known or unknown AAV serotypes. In one desirable embodiment, the ITRs of AAV serotype 2 are used. However, ITRs from other suitable serotypes may be selected. These ITRs or other AAV components can be readily isolated from AAV serotypes using techniques available to those skilled in the art. Such AAVs can be isolated or obtained from academic, commercial, or public resources (e.g., American Type Culture Collection, Manassas, VA). Alternatively, AAV sequences can be obtained through synthesis or other suitable means by referring to published sequences such as those available in the literature or databases (e.g., GenBank, PubMed, etc.).

[0064] The rAAV described herein also contains a vector genome. The vector genome is composed of at least a non-AAV or heterologous nucleic acid sequence (transgene) described below, and its regulatory sequences, as well as 5' and 3' AAV inverted terminal repeats (ITRs). It is this mini-gene that is packaged into the capsid protein and delivered to the selected target cells.

[0065] The transgene is a nucleic acid sequence heterologous to the vector sequence adjacent to the transgene encoding the polypeptide, protein, or other product of interest. The nucleic acid coding sequence is operably linked to regulatory components in a manner that enables transcription, translation, and / or expression of the transgene in the target cell. The heterologous nucleic acid sequence (transgene) can be derived from any organism. AAV can contain one or more transgenes.

[0066] In certain embodiments, an rAAVrh.90 vector is provided herein that contains a transgene comprising a sequence encoding erythropoietin (EPO). In certain embodiments, the transgene encodes an EPO gene of a dog or a cat. Such recombinant vectors are suitable for use, for example, in a regimen for treating chronic kidney disease and other conditions in a subject characterized by a decrease in the amount of circulating erythrocytes. For example, it is suitable for use in a regimen for treating chronic kidney disease and other conditions in a subject characterized by a decrease in the amount of circulating erythrocytes.

[0067] In certain embodiments, an rAAVrh.90 vector is provided herein that contains a transgene comprising a sequence encoding an anti - nerve growth factor (NGF) antibody. In certain embodiments, the transgene encodes an anti - NGF antibody of a dog or a cat. Such recombinant vectors are suitable for use, for example, in a regimen for treating osteoarthritic pain in a subject.

[0068] In certain embodiments, an rAAVrh.90 vector is provided herein that contains a transgene comprising a sequence encoding an anti - nerve growth factor (NGF) antibody. In certain embodiments, the transgene encodes an anti - NGF antibody of a dog or a cat. Such recombinant vectors are suitable for use, for example, in a regimen for treating osteoarthritic pain in a subject.

[0069] In certain embodiments, an rAAVrh.90 vector is provided herein and includes a transgene that includes a sequence encoding glucagon-like peptide 1 (GLP-1). In certain embodiments, the transgene encodes canine or feline GLP-1. Such recombinant vectors are suitable for use, for example, in a regimen for treating type II diabetes in a subject.

[0070] In certain embodiments, an rAAVrh.90 vector is provided herein and includes a transgene that includes a sequence encoding glucagon-like peptide 1 (GLP-1). In certain embodiments, the transgene encodes canine or feline GLP-1. Such recombinant vectors are suitable for use, for example, in a regimen for treating type II diabetes in a subject.

[0071] In certain embodiments, an rAAVrh.90 vector is provided herein and includes a transgene that includes a sequence encoding insulin. In certain embodiments, the transgene encodes canine or feline insulin. Such recombinant vectors are suitable for use, for example, in a regimen for treating type I or type II diabetes in a subject.

[0072] In certain embodiments, an rAAVrh.90 vector is provided herein and includes a transgene that includes a sequence encoding an antagonist of interleukin-4 receptor α (IL-4Rα) subunit of IgE, IL-32, or IL-4 / IL-13 receptor, including, for example, an antibody and a receptor-IgG fusion protein. In certain embodiments, the transgene encodes a canine or feline antagonist of IgE, IL-32, or IL-4Rα subunit. Such recombinant vectors are suitable for use, for example, in a regimen for treating atopic dermatitis in a subject.

[0073] The composition of the introduced gene sequence depends on the use for which the resulting vector is employed. For example, certain types of introduced gene sequences include a reporter sequence that generates a detectable signal upon expression. Such reporter sequences include, but are not limited to, β-lactamase, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), enhanced GFP (EGFP), chloramphenicol acetyltransferase (CAT), luciferase, membrane-bound proteins (e.g., including CD2, CD4, CD8, influenza hemagglutinin protein, and others known in the art for which high-affinity antibodies exist or can be produced by conventional means), and DNA sequences encoding fusion proteins (including, inter alia, membrane-bound proteins appropriately fused to antigen-tagged domains derived from hemagglutinin or Myc). are included.

[0074] When these coding sequences are associated with regulatory elements that drive their expression, they provide a signal detectable by conventional means including assays for enzymes, radiation, colorimetric, fluorescent or other spectroscopic assays, fluorescence-activated cell sorting assays, and immunological assays (including enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and immunohistochemistry). For example, if the marker sequence is the LacZ gene, the presence of a vector with a signal is detected by an assay for β-galactosidase activity. If the introduced gene is green fluorescent protein or luciferase, a vector with a signal can be visually measured by color or light production in a luminometer.

[0075] However, the transgene is preferably a non-marker sequence encoding a biologically and medically useful product, such as a protein, peptide, RNA, enzyme, dominant negative mutant, or catalytic RNA. Desirable RNA molecules include tRNA, dsRNA, ribosomal RNA, catalytic RNA, siRNA, small hairpin RNA, trans-splicing RNA, and antisense RNA. An example of a useful RNA sequence is one that inhibits or abolishes the expression of a target nucleic acid sequence in the animal being treated. Typically, suitable target sequences include tumor targets and viral diseases. For examples of such targets, see the tumor targets and viruses described later in the section related to immunogens.

[0076] The introduced gene can be used to correct or improve gene deficiencies. Gene deficiencies can include deficiencies where the normal gene is expressed at levels lower than normal, or deficiencies where a functional gene product is not expressed. Alternatively, the introduced gene can provide the cell with a product that is not naturally expressed in the cell type or host. A preferred type of introduced gene sequence encodes a therapeutic protein or polypeptide that is expressed in the host cell. The present invention further includes using multiple introduced genes. In certain situations, different introduced genes can be used to encode each subunit of a protein, or to encode different peptides or proteins. This is desirable when the size of the DNA encoding the protein subunit is large (e.g., immunoglobulin, platelet-derived growth factor, or dystrophin protein). Cells are infected with a recombinant virus containing each of the different subunits in order to produce a multi-subunit protein. Alternatively, the different subunits of the protein may be encoded by the same introduced gene. In this case, a single introduced gene contains DNA encoding each subunit, where the DNA of each subunit is separated by an internal ribozyme entry site (IRES). This is desirable when the size of the DNA encoding each subunit is small (e.g., the total size of the DNA encoding the subunit and the IRES is less than 5 kilobases). As an alternative to the IRES, the DNA may be separated by a sequence encoding a 2A peptide that self-cleaves in a post-translational event. See, for example, M. L. Donnelly, et al, J. Gen. Virol., 78 (Pt 1):13-21 (Jan 1997), Furler, S., et al, Gene Ther., 8(11):864-873 (June 2001), Klump H., et al., Gene Ther., 8(10):811-817 (May 2001). This 2A peptide is significantly smaller than the IRES and is very suitable for use when space is a limiting factor.More often, when the transgene is large, consists of multiple subunits, or two transgenes are co-delivered, it is possible to concatenate them in vivo to form a single vector genome by co-administering rAAVs having the desired transgene or subunit. In such embodiments, for co-expression in host cells, the first AAV may have an expression cassette that expresses a single transgene, and the second AAV may have an expression cassette that expresses a different transgene. However, the transgene selected can be any biologically... active product or other product (e.g., a product desirable for research).

[0077] Examples of suitable transgenes or gene products can include those related to familial hypercholesterolemia, muscular dystrophy, cystic fibrosis, and rare diseases or orphan diseases. Examples of such rare diseases can include, among others, spinal muscular atrophy (SMA), Huntington's disease, Rett syndrome (e.g., methyl-CpG binding protein 2 (MeCP2), UniProtKB-P51608), amyotrophic lateral sclerosis (ALS), Duchenne muscular dystrophy, Friedreich's ataxia (e.g., frataxin), spinocerebellar ataxia associated ATXN2 type 2 (SCA2) / ALS; ALS-associated TDP-43, progranulin (PRGN) (associated with non-Alzheimer's type neurodegeneration including frontotemporal dementia (FTD), progressive non-fluent aphasia (PNFA), and semantic dementia). See, for example, www.orpha.net / consor / cgi-bin / Disease_Search_List.php; rarediseases.info.nih.gov / diseases.

[0078] Useful therapeutic products encoded by the introduced gene include hormones and growth and differentiation factors, including but not limited to insulin, glucagon, glucagon-like peptide-1 (GLP-1), growth hormone (GH), parathyroid hormone (PTH), growth hormone releasing factor (GRF), follicle stimulating hormone (FSH), luteinizing hormone (LH), human chorionic gonadotropin (hCG), vascular endothelial growth factor (VEGF), angiopoietin, angiostatin, granulocyte colony stimulating factor (GCSF), erythropoietin (EPO), connective tissue growth factor (CTGF), basic fibroblast growth factor (bFGF), acidic fibroblast growth factor (aFGF), epidermal growth factor (EGF), transforming growth factor alpha (TGFα), platelet-derived growth factor (PDGF), insulin-like growth factors I and II (IGF-I and IGF-II), any one of the transforming growth factor β superfamily (TGFβ, activin, inhibin), or any one of bone morphogenetic proteins (BMP) BMP1-15, any one of the heregulin / neuregulin / ARIA / neu differentiation factor (NDF) family of growth factors, nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophins (NT-3 and NT-4 / 5), ciliary neurotrophic factor (CNTF), glial cell line-derived neurotrophic factor (GDNF), neurturin, agrin, any one of the semaphorin / collapsin family, netrin-1 and netrin-2, hepatocyte growth factor (HGF), ephrin, noggin, sonic hedgehog, tyrosine hydroxylase.

[0079] Other useful transgene products include proteins that control the immune system, including but not limited to thrombopoietin (TPO), interleukins (IL), IL-1 to IL-25 (e.g., IL-2, IL-4, IL-12, and IL-18), monocyte chemoattractant protein, leukemia inhibitory factor, granulocyte macrophage colony-stimulating factor, Fas ligand, tumor necrosis factors α and β, interferons α, β, and γ, stem cell factor, flk-2 / flt3 ligand, and other cytokines and lymphokines. Gene products produced by the immune system are also useful in the present invention. These include, but are not limited to, immunoglobulins IgG, IgM, IgA, IgD, and IgE, chimeric immunoglobulins, humanized antibodies, single-chain antibodies, T cell receptors, chimeric T cell receptors, single-chain T cell receptors, class I and class II MHC molecules, and engineered immunoglobulins and MHC molecules. Useful gene products also include complement regulatory proteins, such as membrane cofactor protein (MCP), decay-accelerating factor (DAF), CR1, CF2, and CD59.

[0080] Still other useful gene products include any one of receptors for hormones, growth factors, cytokines, lymphokines, regulatory proteins, and immune system proteins. It follows. The present invention encompasses receptors for cholesterol regulation, including low-density lipoprotein (LDL) receptors, high-density lipoprotein (HDL) receptors, very-low-density lipoprotein (VLDL) receptors, and scavenger receptors. The present invention also encompasses gene products such as members of the steroid hormone receptor superfamily, including glucocorticoid receptors and estrogen receptors, vitamin D receptors and other nuclear receptors. In addition, useful gene products include transcription factors such as jun, fos, max, mad, serum response factor (SRF), AP-1, AP2, myb, MyoD and myogenin, proteins including the ETS box, TFE3, E2F, ATF1, ATF2, ATF3, ATF4, ZF5, NFAT, CREB, HNF-4, C / EBP, SP1, CCAAT box-binding proteins, interferon regulatory factor (IRF-1), Wilms tumor protein, ETS-binding proteins, STAT, GATA box-binding proteins such as GATA-3, and the forkhead family of winged helix proteins.

[0081] Other useful gene products include carbamoyl synthetase I, ornithine transcarbamylase, arginosuccinate synthetase, arginosuccinate lyase, arginase, fumarylacetoacetate hydrolase, phenylalanine hydroxylase, α-1 antitrypsin, glucose-6-phosphatase, porphobilinogen deaminase, factor VIII, factor IX, cystathionine β-synthase, branched-chain keto acid decarboxylase, albumin, isovaleryl coA dehydrogenase, propionyl CoA carboxylase, methylmalonyl CoA mutase, glutaryl CoA dehydrogenase, insulin, β-glucosidase, pyruvate carboxylase, liver phosphorylase, phosphorylase kinase, glycine decarboxylase, H-protein, T-protein, cystic fibrosis transmembrane regulator (CFTR) sequence, and dystrophin sequence, or functional fragments thereof. Still other useful gene products include enzymes that may be useful in enzyme replacement therapy, which are useful in various conditions resulting from insufficient enzyme activity. For example, enzymes containing mannose-6-phosphate can be utilized in the treatment of lysosomal storage diseases (e.g., suitable genes include genes encoding β-glucuronidase (GUSB)). In another example, the gene product is ubiquitin protein ligase E3A (UBE3A). Still other useful gene products include UDP glucuronosyltransferase family 1 member A1 (UGT1A1).

[0082] Other useful gene products include non-natural polypeptides such as chimeric or hybrid polypeptides having non-natural amino acid sequences including insertions, deletions, or amino acid substitutions. For example, single-chain engineered immunoglobulins may be useful in certain immunodeficient patients. Other types of non-natural gene sequences include catalytic nucleic acids such as antisense molecules and ribozymes, which can be used to reduce the overexpression of a target.

[0083] Reduction and / or modulation of gene expression is particularly desirable for the treatment of hyperproliferative conditions characterized by hyperproliferative cells, such as cancer and psoriasis. Target polypeptides include polypeptides produced exclusively or at higher levels in hyperproliferating cells compared to normal cells. Target antigens include oncogenes such as myb, myc, fyn, and polypeptides encoded by the translocation genes bcr / abl, ras, src, P53, neu, trk, and EGRF. In addition to oncogene products as target antigens, target polypeptides for anti-cancer treatment and protective regimens include the variable regions of antibodies produced by B-cell lymphomas and the variable regions of T-cell receptors of T-cell lymphomas, and in some embodiments, are also used as target antigens for autoimmune diseases. Other tumor-associated polypeptides can be used as target polypeptides, such as polypeptides found at higher levels in tumor cells, including polypeptides recognized by monoclonal antibody 17-1A and folate-binding polypeptides.

[0084] Other suitable therapeutic polypeptides and proteins may be useful for treating individuals suffering from autoimmune diseases and disorders by conferring a broad protective immune response against targets associated with autoimmunity, including cell receptors and cells that produce "self"-directed antibodies. T-cell-mediated autoimmune diseases include rheumatoid arthritis (RA), multiple sclerosis (MS), Sjogren's syndrome, sarcoidosis, insulin-dependent diabetes mellitus (IDDM), autoimmune thyroiditis, reactive arthritis, ankylosing spondylitis, scleroderma, polymyositis, dermatomyositis, psoriasis, vasculitis, Wegener's granulomatosis, Crohn's disease, and ulcerative colitis. Each of these diseases is characterized by a T-cell receptor (TCR) that binds to an endogenous antigen and initiates the inflammatory cascade associated with the autoimmune disease.

[0085] Still other useful gene products include those used in the treatment of hemophilia, including hemophilia B (including factor IX) and hemophilia A (including factor VIII and its variants, such as heterodimers and the light and heavy chains of the B - deleted domain; U.S. Patent Nos. 6,200,560 and 6,221,349). In some embodiments, the mini - gene comprises the first 57 base pairs of the factor VIII heavy chain encoding a 10 - amino acid signal sequence, as well as a human growth hormone (hGH) polyadenylation sequence. In alternative embodiments, the mini - gene further comprises the A1 and A2 domains, and 5 amino acids from the N - terminus of the B domain, and / or 85 amino acids from the C - terminus of the B domain, as well as the A3, C1, and C2 domains. In still other embodiments, the nucleic acids encoding the factor VIII heavy and light chains are provided within a single mini - gene separated by 42 nucleic acids encoding 14 amino acids of the B domain [U.S. Patent No. 6,200,560].

[0086] Additional exemplary genes that can be delivered via rAAV include, but are not limited to, glucose-6-phosphatase associated with glycogen storage disease or type 1A deficiency (GSD1), phosphoenolpyruvate-carboxykinase (PEPCK) associated with PEPCK deficiency, cyclin-dependent kinase-like 5 (CDKL5), also known as serine / threonine kinase 9 (STK9), associated with seizures and severe neurodevelopmental disorders, galactose-1-phosphate uridyltransferase associated with galactosemia, phenylalanine hydroxylase (PAH) associated with phenylketonuria (PKU), gene products associated with primary hyperoxaluria type 1 including hydroxyacid oxidase 1 (GO / HAO1) and AGXT, branched-chain α-ketoacid dehydrogenase (including BCKDH, BCKDH-E2, BAKDH-E1a, and BAKDH-E1b) associated with maple syrup urine disease, fumarylacetoacetate hydrolase associated with tyrosinemia type 1, methylmalonyl-CoA mutase associated with methylmalonic acidemia, medium-chain acyl-CoA dehydrogenase associated with medium-chain acyl-CoA deficiency, ornithine transcarbamylase (OTC) associated with ornithine transcarbamylase deficiency, argininosuccinate synthetase (ASS1) associated with citrullinemia, lecithin-cholesterol acyltransferase (LCAT) deficiency, methylmalonic acidemia (MMA), NPC1 associated with Niemann-Pick disease (type C1), propionic academia (PA), TTR associated with transthyretin (TTR)-related hereditary amyloidosis, low-density lipoprotein receptor (LDLR) protein associated with familial hypercholesterolemia (FH), the LDLR variant described in WO2015 / 164778, proprotein convertase subtilisin / kexin type 9, ApoE and ApoC proteins associated with dementia, UDP-glucuronosyltransferase associated with Crigler-Najjar disease, adenosine deaminase associated with severe combined immunodeficiency, hypoxanthine-guanine phosphoribosyltransferase associated with gout and Lesh-Nyhan syndrome, biotinidase associated with biotinidase deficiency, α-galactosidase A (a-GalA) associated with Fabry disease,β-galactosidase (GLB1) associated with GM1 gangliosidosis, ATP7B associated with Wilson disease, β-glucocerebrosidase associated with Gaucher disease types 2 and 3, Zellweger, Peroxisomal membrane protein 70 kDa related to Zellweger syndrome, arylsulfatase A (ARSA) related to metachromatic leukodystrophy, galactocerebrosidase (GALC) enzyme related to Krabbe disease, α-glucosidase (GAA) related to Pompe disease, sphingomyelinase (SMPD1) gene related to Niemann-Pick disease type A, argininosuccinate synthetase related to adult-onset type II citrullinemia (CTLN2), carbamoyl phosphate synthetase 1 (CPS1) related to urea cycle disorders, survival motor neuron (SMN) protein related to spinal muscular atrophy, ceramidase related to Farber lipogranulomatosis, β-hexosaminidase related to GM2 gangliosidosis and Tay-Sachs disease and Sandhoff disease, aspartylglucosaminidase related to aspartyl-glucosaminuria, α-fucosidase related to fucosidosis, α-mannosidase related to α-mannosidosis, porphobilinogen deaminase related to acute intermittent porphyria (AIP), α-1 antitrypsin for the treatment of α-1 antitrypsin deficiency (emphysema), erythropoietin for the treatment of anemia due to thalassemia or renal failure, vascular endothelial growth factor, angiopoietin-1, and fibroblast growth factor for the treatment of ischemic diseases, inhibitors of the thrombomodulin and tissue factor pathway for the treatment of occluded blood vessels found in atherosclerosis, thrombosis, or embolism, aromatic amino acid decarboxylase (AADC) and tyrosine hydroxylase (TH) for the treatment of Parkinson's disease, β-adrenergic receptor for the treatment of congestive heart failure, antisense or variants thereof against phospholamban, sarcoplasmic reticulum (endoplasmic reticulum) adenosine triphosphatase-2 (SERCA2), and cardiac adenylate cyclase, tumor suppressor genes such as p53 for the treatment of various cancers, cytokines such as one of various interleukins for the treatment of inflammatory disorders and immune disorders and cancers, dystrophin or minidystrophin and utrophin or miniutrophin for the treatment of muscular dystrophy, and insulin or GLP-1 for the treatment of diabetes are mentioned.

[0087] Alternatively, or in addition, the vectors of the invention may contain a transgene encoding a peptide, polypeptide or protein that induces an immune response against the AAV sequences and the selected immunogen of the invention. For example, the immunogen can be selected from various viral families. Examples of desirable viral families for which an immune response is desired include the picornavirus family, including the genus Rhinovirus, which accounts for about 50% of cases of the common cold, enteroviruses such as poliovirus, coxsackievirus, echovirus, and hepatitis A virus, and the genus Aphthovirus, which is responsible for foot-and-mouth disease mainly in non-human animals. Within the picornavirus family of viruses, the target antigens include VP1, VP2, VP3, VP4, and VPG. Another viral family includes the calicivirus family, including the Norwalk virus group, which is an important causative pathogen of epidemic gastroenteritis. Yet another desirable viral family for use as a targeted antigen for inducing an immune response in humans and non-human animals is the togavirus family, including the genus Alphavirus, which includes Sindbis virus, Ross River virus, and Venezuelan, Eastern, and Western equine encephalitis viruses, and rubivirus, including rubella virus. The Flaviviridae family includes dengue fever, yellow fever, Japanese encephalitis, St. Louis encephalitis, and tick-borne encephalitis viruses. Other target antigens can be generated from the hepatitis C virus or the coronavirus family, which includes several non-human viruses such as infectious bronchitis virus (poultry), porcine transmissible gastroenteritis virus (pig), porcine hemagglutinating encephalomyelitis virus (pig), feline infectious peritonitis virus (cat), feline enteric coronavirus (cat), canine coronavirus (dog), and human respiratory coronavirus, which can cause the common cold and / or non-A, B, or C hepatitis. Target antigens within the coronavirus family include the E1 (also called the M or matrix protein), E2 (also called the S or spike protein), and E3 (also called the HE or hemagglutinin-esterase) glycoproteins (all coronav (which are not present in the virus), or N (nucleocapsid). Further other antigens may target the Rhabdovirus family, which includes the Vesiculovirus genus (e.g., Vesicular stomatitis virus), and common Lyssaviruses (e.g., Rabies virus). Within the Rhabdovirus family, suitable antigens may be derived from the G protein or the N protein. The Filoviridae family includes hemorrhagic fever viruses such as Marburg virus and Ebola virus, which can be suitable sources of antigens. The Paramyxovirus family includes Parainfluenza virus type 1, Parainfluenza virus type 3, Bovine parainfluenza virus type 3, Rubulavirus (Mumps virus, Parainfluenza virus type 2, Parainfluenza virus type 4, Newcastle disease virus (chicken), Rinderpest virus, Measles virus, and Morbillivirus including Canine distemper, as well as Pneumovirus including Respiratory syncytial virus. Influenza virus is classified within the Orthomyxovirus family and is a suitable source of antigens (e.g., HA protein, N1 protein). The Bunyavirus family includes the Bunyavirus genus (California encephalitis, La Crosse), Phlebovirus genus (Rift Valley fever), Hantavirus genus (Puumala is the Hantaan fever virus), Nairovirus genus (Nairobi sheep disease), and various unclassified Bungaviruses. The Arenavirus family provides a source of antigens against LCM and Lassa fever virus. The Reovirus family includes the Reovirus genus, Rotavirus genus (which causes acute gastroenteritis in children), Orbivirus, and Coltivirus (Colorado tick fever, Lebombo (human), Equine encephalosis, Bluetongue).

[0088] The retrovirus family includes the oncovirus subfamily, which encompasses human and veterinary diseases such as feline leukemia virus, HTLV I and HTLV II, lentiviruses (including human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), equine infectious anemia virus, and spumaviruses). Many suitable antigens have been described between HIV and SIV and can be easily selected. Examples of suitable HIV and SIV antigens include, but are not limited to, the proteins of gag, pol, Vif, Vpx, Vpr, Env, Tat, and Rev, as well as various fragments thereof. In addition, various modifications to these antigens have been described. Suitable antigens for this purpose are known to those skilled in the art. For example, among other proteins, sequences encoding gag, pol, Vif and Vpr, Env, Tat, and Rev may be selected. See, for example, the modified gag protein described in U.S. Patent No. 5,972,596. Also see the HIV and SIV proteins described in D.H. Barouch et al, J. Virol., 75(5):2462-2467 (March 2001), and R.R. Amara, et al, Science, 292:69-74 (6 April 2001). These proteins or their subunits can be delivered alone, via separate vectors, or in combination from a single vector.

[0089] The Papovavirus family includes the Polyomavirus subfamily (BKU and JCU viruses) and the Papillomavirus subfamily (associated with cancer or malignant progression of papillomas). The Adenovirus family includes viruses that cause respiratory diseases and / or enteritis (e.g., EX, AD7, ARD, O.B.). The Parvovirus family includes feline panleukopenia virus (feline enteritis), feline panleukopenia virus, canine parvovirus, and porcine parvovirus. The Herpesvirus family includes the Alphaherpesvirus subfamily containing the Simplexvirus genus (HSVI, HSVII), the Varicellovirus genus (pseudorabies, varicella-zoster), and the Betaherpesvirus subfamily containing the Cytomegalovirus genus (HCMV, murine cytomegalovirus), as well as the Gammaherpesvirus subfamily containing the Lymphocryptovirus genus, EBV (Burkitt lymphoma), infectious laryngotracheitis, Marek's disease virus, and ranidovirus. Pox The Poxvirus family includes the Orthopoxvirus genus (smallpox (variola) and vaccinia (cowpox)), the Parapoxvirus, the Avipoxvirus, the Capripoxvirus, the Leporipoxvirus, the Suipoxvirus, the Chordopoxvirus subfamily, and the Entomopoxvirus subfamily. The Hepadnavirus family includes hepatitis B virus. One unclassified virus that can be a suitable source of antigen is hepatitis D virus. Still other virus sources include the avian infectious bursal disease virus and the porcine reproductive and respiratory syndrome virus. The Alphavirus family includes equine arteritis virus and various encephalitis viruses.

[0090] The present invention may also include immunogens useful for immunizing humans or non-human animals against other pathogens, including bacteria, fungi, parasitic microorganisms, or multicellular parasites that infect humans and non-human vertebrates, or against cancer cells or tumor cells. Examples of bacterial pathogens include pathogenic Gram-positive cocci, pneumococci, staphylococci, and streptococci. Pathogenic Gram-negative cocci include meningococci and gonococci. Pathogenic enteric Gram-negative bacilli include Enterobacteriaceae (including Pseudomonas, Acinetobacter, and Eikenella), melioidosis, Salmonella, Shigella, Haemophilus, Moraxella, H. ducreyi (causing chancroid), Brucella, Francisella tularensis (causing tularemia), Yersinia (Pasteurella), Streptobacillus, Moniliformis, and Spirillum. Gram-positive bacilli include Listeria monocytogenes, Erysipelothrix rhusiopathiae, Corynebacterium diphtheria (diphtheria), cholera, Bacillus anthracis (anthrax), Donovanosis (inguinal granuloma), and Bartonellosis. Diseases caused by pathogenic anaerobic bacteria include tetanus, botulism, other Clostridium, tuberculosis, leprosy, and other Mycobacteria. Pathogenic spirochetal diseases include syphilis, treponematosis (yaws, pinta, and endemic syphilis), and leptospirosis. Other infectious diseases caused by highly pathogenic bacteria and pathogenic fungi include actinomycosis, nocardiosis, cryptococcosis, blastomycosis, histoplasmosis, and coccidioides, candidiasis, aspergillosis, and mucormycosis, sporotrichosis, paracoccidioidomycosis, petriellidiosis, torulopsis, mycetoma, and chromomycosis, as well as dermatophytosis. Rickettsial infections include typhus fever, Rocky Mountain spotted fever, Q fever, and rickettsialpox. Examples of Mycoplasma and Chlamydia infections include Mycoplasma pneumonia, lymphogranuloma venereum, psittacosis, and perinatal Chlamydia infections.Pathogenic eukaryotes include pathogenic protozoa and helminths, as well as the infectious diseases caused thereby, including amoebiasis, malaria, leishmaniasis, trypanosomiasis, toxoplasmosis, Pneumocystis carinii, trichinella, Toxoplasma gondii, babesiosis, babesia, giardiasis, trichinosis, filariasis, schistosomiasis, nematodes, trematodes or flukes, and cestode (tapeworm) infections.

[0091] Many of these organisms and / or the toxins produced thereby have been identified by the Centers for Disease Control [(CDC), Department of Health and Human Services, USA] as potential pathogens for use in biological attacks. For example, some of these biological agent pathogens include: Bacillus anthracis (anthrax), Clostridium botulinum and its toxin (botulism), Yersinia pestis (plague), smallpox (variola), Francisella tularensis (tularemia), and viral hemorrhagic fevers, all of which are currently classified as Category A pathogens, Coxiella burnetti (Q fever), Brucella species (brucellosis), Burkholderia mallei (glanders), Ricinus communis and its toxin (ricin toxin), Clostridium perfringens and its toxin (epsilon toxin), Staphylococcus species and its toxin (enterotoxin B), all of which are currently classified as Category B pathogens, as well as ebola virus and hantavirus, which are classified as Category C pathogens. In addition, other organisms that are so classified or have different classifications may be identified and / or used for such purposes in the future. It will be readily understood that the viral vectors and other constructs described herein are useful for delivering antigens derived from these organisms, viruses, their toxins, or other by-products, and for preventing and / or treating infections or other adverse reactions caused by these biological pathogens.

[0092] Administration of the vectors of the present invention for delivering an immunogen to the variable region of T cells induces an immune response including CTLs to eliminate those T cells. In rheumatoid arthritis (RA), some specific variable regions of the T cell receptors (TCRs) involved in the disease have been characterized. These TCRs include V-3, V-14, V-17, and Vα-17. Thus, delivery of a nucleic acid sequence encoding at least one of these polypeptides will induce an immune response targeting T cells involved in RA. In multiple sclerosis (MS), some specific variable regions of the TCRs involved in the disease have been characterized. These TCRs include V-7 and Vα-10. Thus, delivery of a nucleic acid sequence encoding at least one of these polypeptides will induce an immune response targeting T cells involved in MS. In scleroderma, some specific variable regions of the TCRs involved in the disease have been characterized. These TCRs include V-6, V-8, V-14, and Vα-16, Vα-3C, Vα-7, Vα-14, Vα-15, Vα-16, Vα-28, and Vα-12. Thus, delivery of a nucleic acid molecule encoding at least one of these polypeptides will induce an immune response targeting T cells involved in scleroderma.

[0093] In one embodiment, the transgene is selected to provide optogenetic therapy. In optogenetic therapy, artificial photoreceptors are constructed by gene delivery of light-activated channels or pumps to surviving cell types in the remaining retinal circuitry. This is particularly useful for patients who have lost a significant amount of photoreceptor function but still have the circuitry of bipolar cells to ganglion cells and the optic nerve intact. In one embodiment, the heterologous nucleic acid sequence (transgene) is an opsin. The opsin sequence can be derived from any suitable unicellular or multicellular organism including humans, algae, and bacteria. In one embodiment, the opsin is rhodopsin, photopsin, L / M wavelength (red / green)-opsin, or short wavelength (S) opsin (blue). In another embodiment, the opsin is channelrhodopsin or halorhodopsin.

[0094] In another embodiment, the transgene is selected for use in gene augmentation therapy, i.e., to provide a replacement copy of a missing or defective gene. In this embodiment, the transgene can be readily selected by one of ordinary skill in the art to provide the necessary replacement gene. In one embodiment, the missing / defective gene is associated with an eye disorder. In another embodiment, the transgene is NYX, GRM6, TRPM1L, or GPR179, and the eye disorder is congenital stationary night blindness. See, e.g., Zeitz et al, Am J Hum Genet. 2013 Jan 10;92(1):67-75. Epub 2012 Dec 13 (incorporated herein by reference). In another embodiment, the transgene is RPGR.

[0095] In another embodiment, the transgene is selected for use in gene silencing therapy, i.e., the expression of one or more native genes is disrupted or suppressed at the transcriptional or translational level. This can be accomplished using short hairpin RNA (shRNA) or other techniques known in the art. See, e.g., Sun et al, Int J Cancer. 2010 Feb 1;126(3):764-74, and O’Reill y M, et al. Am J Hum Genet. 2007 Jul;81(1):127-35 (incorporated herein by reference). In this embodiment, the transgene can be readily selected by one of ordinary skill in the art based on the gene(s) that are desired to be silenced.

[0096] In another embodiment, the transgene comprises two or more transgenes. This can be achieved using a single vector having two or more heterologous sequences, or using two or more AAVs each having one or more heterologous sequences. In one embodiment, AAV is used in gene silencing (or knockdown) combination therapy and gene augmentation combination therapy. In knockdown / augmentation combination therapy, a defective copy of the gene of interest is silenced and a non-mutated copy is supplied. In one embodiment, this is achieved using two or more co-administered vectors. See Millington-Ward et al, Molecular Therapy, April 2011, 19(4):642-649 (incorporated herein by reference). The transgene can be readily selected by one of ordinary skill in the art based on the desired result.

[0097] In another embodiment, the transgene is selected for use in gene correction therapy. This can be achieved, for example, by using zinc finger nuclease (ZFN)-induced DNA double-strand breaks in combination with an exogenous DNA donor substrate. See, for example, Ellis et al, Gene Therapy (epub January 2012) 20:35-42 (incorporated herein by reference). The transgene can be readily selected by one of ordinary skill in the art based on the desired result.

[0098] In one embodiment, the capsids described herein are useful in a CRISPR-Cas dual vector system as described in U.S. Provisional Patent Applications Nos. 61 / 153,470, 62 / 183,825, 62 / 254,225, and 62 / 287,511 (each of which is incorporated herein by reference). The capsids are also useful for delivery of homing endonucleases or other meganucleases.

[0099] In another embodiment, the transgenes useful herein include a reporter sequence that generates a detectable signal upon expression. Such reporter sequences include, but are not limited to, β-lactamase, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), red fluorescent protein (RFP), chloramphenicol acetyltransferase (CAT), luciferase, membrane-bound proteins (e.g., influenza hemagglutinin protein, including CD2, CD4, CD8, and others known in the art for which high-affinity antibodies exist or can be produced by conventional means), and DNA sequences encoding fusion proteins, including in particular membrane-bound proteins appropriately fused to antigen tag domains derived from hemagglutinin or Myc.

[0100] When these coding sequences are associated with regulatory elements that drive their expression, they provide a detectable signal by conventional means, including assays for enzymes, radiation, colorimetric, fluorescent or other spectroscopic assays, fluorescence-activated cell sorting assays, and immunoassays, including enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and immunohistochemistry. For example, when the marker sequence is the LacZ gene, the presence of a vector with a signal is detected by an assay for β-galactosidase activity. When the transgene is green fluorescent protein or luciferase, a vector with a signal can be visually measured by a luminometer for color or light production.

[0101] The transgene preferably encodes a product useful in biology and medicine, such as a protein, peptide, RNA, enzyme, or catalytic RNA. Desirable RNA molecules include shRNA, tRNA, dsRNA, ribosomal RNA, catalytic RNA, and antisense RNA. An example of a useful RNA sequence is one that causes loss of expression of a target nucleic acid sequence in the treated animal.

[0102] ​The regulatory sequences include conventional control elements operably linked to the transgene in a manner that allows its transcription, translation, and / or expression in cells transfected with the vector or infected with the virus produced as described herein. As used herein, "operably linked" sequences include both expression control sequences adjacent to the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest.

[0103] Expression control sequences can include appropriate transcription start, termination, promoter, and enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (polyA) signals, sequences that stabilize cytoplasmic mRNA, sequences that enhance translation efficiency (i.e., Kozak consensus sequences), sequences that enhance protein stability, and, optionally, sequences that enhance the secretion of the encoded product. A number of expression control sequences, including promoters, are known in the art and can be utilized.

[0104] Regulatory sequences useful in the constructs provided herein can also desirably include an intron located between the promoter / enhancer sequence and the gene. One desired intron sequence is derived from SV-40 and is a 100 bp mini-intron splice donor / splice acceptor designated SD-SA. Another suitable sequence is the woodchuck hepatitis virus post-transcriptional element. (See, e.g., Wang and I. Verma, 1999 Proc. Natl. Acad. Sci., USA, 96:3906-3910). PolyA signals can be derived from a number of suitable species including, but not limited to, SV-40, human, and bovine.

[0105] Another regulatory component of rAAV useful in the methods described herein is an internal ribosome entry site (IRES). The IRES sequence, or other suitable system, can be used to produce two or more polypeptides from a single gene transcript. An IRES (or other suitable sequence) can be used to produce a protein containing two or more polypeptide chains, or to express two different proteins from the same cell or within the same cell. An exemplary IRES is the poliovirus internal ribosome entry sequence and supports the expression of transgenes in photoreceptors, RPE, and ganglion cells. Preferably, the IRES is located 3' of the transgene within the rAAV vector.

[0106] In one embodiment, the AAV contains a promoter (or a functional fragment of a promoter). The promoter used for rAAV can be selected from among a number of constitutive or inducible promoters capable of expressing a selected transgene in a desired target cell. In one embodiment, the target cell is a visual cell. The promoter can be derived from any species, including humans. Desirably, in one embodiment, the promoter is "cell-specific." The term "cell-specific" means that a particular promoter selected for a recombinant vector can direct the expression of a selected transgene in a particular cell tissue. In one embodiment, the promoter is specific for the expression of a transgene in muscle cells. In another embodiment, the promoter is specific for expression in the lung. In another embodiment, the promoter is specific for the expression of a transgene in hepatocytes. In another embodiment, the promoter is specific for the expression of a transgene in airway epithelium. In another embodiment, the promoter is specific for the expression of a transgene in neurons. In another embodiment, the promoter is specific for the expression of a transgene in the heart.

[0107] Expression cassettes typically include, as part of the expression control sequences, for example, a promoter sequence located between a selected 5’ ITR sequence and the coding sequence of an immunoglobulin construct. In one embodiment, expression in the liver is desired. Thus, in one embodiment, a liver-specific promoter is used. Tissue-specific promoters, constitutive promoters, regulatable promoters [see, e.g., WO2011 / 126808 and WO2013 / 04943], or promoters that respond to physiological cues can be used in the vectors described herein. In another embodiment, expression in muscle is desired. Thus, in one embodiment, a muscle-specific promoter is used. In one embodiment, the promoter is an MCK-based promoter such as the promoter of dMCK (509bp) or tMCK (720bp). See, for example, Wang et al, Gene Ther. 2008 Nov;15(22):1489-99.doi:10.1038 / gt.2008.104.Epub 2008 Jun 19 (incorporated herein by reference). Another useful promoter is the SPc5-12 promoter. See Rasowo et al, European Scientific Journal June 2014 edition vol.10, No.18 (incorporated herein by reference). In one embodiment, the promoter is the CMV promoter. In another embodiment, the promoter is the TBG promoter. In another embodiment, the CB7 promoter or the CAG promoter is used. CB7 is a chicken β-actin promoter having a cytomegalovirus enhancer element. Alternatively, other liver-specific promoters can be used [e.g., Liver-Specific Promoter Database, Cold Spring Harbor: rulai.schl.edu / LSPD, α1 anti-trypsin (A1AT), human albumin: Miyatake et al., J. Virol., 71:5124 32 (1997), humAlb, and hepatitis B virus core promoter: Sandig et al., Gene See Ther., 3:1002 9(1996). TTR minimal enhancer / promoter, α-antitrypsin promoter, LSP (845 nt) 25 (requiring intronless scAAV).

[0108] The promoter can be selected from different sources, such as the human cytomegalovirus (CMV) immediate early enhancer / promoter, SV40 early enhancer / promoter, JC polyomavirus promoter, myelin basic protein (MBP) or glial fibrillary acidic protein (GFAP) promoter, herpes simplex virus (HSV-1) latency-associated promoter (LAP), Rous sarcoma virus (RSV) long terminal repeat (LTR) promoter, neuron-specific promoter (NSE), platelet-derived growth factor (PDGF) promoter, hSYN, melanin-concentrating hormone (MCH) promoter, CBA, matrix metalloprotein promoter (MPP), and chicken β-actin promoter.

[0109] The expression cassette may contain at least one enhancer, namely, the CMV enhancer. Further other enhancer elements include, for example, apolipoprotein enhancer, zebrafish enhancer, GFAP enhancer element, and brain-specific enhancers such as those described in WO2013 / 1555222, woodchuck hepatitis post-transcriptional regulatory element. Additionally, or alternatively, other, for example, hybrid human cytomegalovirus (HCMV)-immediate early (IE)-PDGR promoter or other promoter-enhancer elements may be selected. Other enhancer sequences useful herein include the IRBP enhancer (Nicoud 2007, J Gene Med. 2007 Dec;9(12):1015-23), immediate early cytomegalovirus enhancer, those derived from immunoglobulin genes or SV40 enhancer, cis-acting elements identified in mouse proximal promoters, etc. are included.

[0110] In addition to the promoter, the expression cassette and / or vector may include suitable transcriptional initiation sequences, termination sequences, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (polyA) signals, sequences that stabilize cytoplasmic mRNA, sequences that enhance translation efficiency (i.e., Kozak consensus sequences), sequences that enhance protein stability, and, optionally, sequences that enhance the secretion of the encoded product. Various suitable polyAs are known. In one example, the polyA is rabbit β-globin such as the 127 bp rabbit β-globin polyadenylation signal (GenBank#V00882.1). In other embodiments, the SV40 polyA signal is selected. Still other suitable polyA sequences may be selected. In certain embodiments, an intron is included. One suitable intron is the chicken β-actin intron. In one embodiment, the intron is 875 bp (GenBank, #X00182.1). In another embodiment, a chimeric intron available from Promega is used. However, other suitable introns may be selected. In one embodiment, the spacer is included such that the vector genome is approximately the same size as the native AAV vector genome (e.g., 4.1-5.2 kb). In one embodiment, the spacer is included such that the vector genome is approximately 4.7 kb. See Wu et al, Effect of Genome Size on AAV Vector Packaging, Mol Ther. 2010 Jan;18(1):80-86 (incorporated herein by reference).

[0111] The selection of these and other common vectors and regulatory elements has been done conventionally and many such sequences are available. See, for example, Sambrook et al, and references cited therein at, for example, pages 3.18-3.26 and 16.17-16.27 and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989. Of course, not all vectors and expression control sequences will function equally well to express all introduced genes as described herein. However, one of ordinary skill in the art can select from among these and other expression control sequences without departing from the scope of the invention.

[0112] In certain embodiments, the expression cassette comprises at least one miRNA target sequence that is a target sequence of miR-183. In certain embodiments, the vector genome or the expression cassette comprises a miR-183 target sequence comprising AGTGAATTCTACCAGTGCCATA (SEQ ID NO: 9) (the sequence complementary to the miR-183 seed sequence is underlined). In certain embodiments, the vector genome or the expression cassette comprises 2 or more copies (e.g., 2 or 3 copies) of a sequence that is 100% complementary to the miR-183 seed sequence. In certain embodiments, the miR-183 target sequence is about 7 to about 28 nucleotides in length and comprises at least one region that is at least 100% complementary to the miR-183 seed sequence. In certain embodiments, the miR-183 target sequence comprises a sequence that is partially complementary to SEQ ID NO: 9 and thus has one or more mismatches when aligned with SEQ ID NO: 9. In certain embodiments, the miR-183 target sequence comprises a sequence that has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches when aligned with SEQ ID NO: 9, and the mismatches can be non-consecutive. In certain embodiments, the miR-183 target sequence comprises a region that is 100% complementary and comprises at least 30% of the length of the miR-183 target sequence. In certain embodiments, the region of 100% complementarity comprises a sequence that is 100% complementary to the miR-183 seed sequence. In certain embodiments, the remainder of the miR-183 target sequence has at least about 80% to about 99% complementarity with miR-183. In certain embodiments, the expression cassette or the vector genome comprises a miR-183 target sequence and comprises the cleaved SEQ ID NO: 9 (i.e., a sequence lacking at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides at either or both of the 5' end and the 3' end of SEQ ID NO: 9). In certain embodiments, the expression cassette or the vector genome comprises a transgene and one miR-183 target sequence. In yet other embodiments, the expression cassette or the vector genome comprises at least 2, 3, or 4 miR-183 target sequences. In certain embodiments, the expression cassette or the vector genome comprises a miR-183 target sequence and comprises the cleaved SEQ ID NO: 9 (i.e., a sequence lacking at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides at either or both of the 5' end and the 3' end of SEQ ID NO: 9). In certain embodiments, the expression cassette or the vector genome comprises a transgene and one miR-183 target sequence. In yet other embodiments, the expression cassette or the vector genome comprises at least 2, 3, or 4 miR-183 target sequences.

[0113] In certain embodiments, the expression cassette comprises at least one miRNA target sequence that is a target sequence of miR-182. In certain embodiments, the vector genome or the expression cassette comprises a miR-182 target sequence and comprises AGTGTGAGTTCTACCATTGCCAAA (SEQ ID NO: 10). In certain embodiments, the vector genome or the expression cassette comprises two or more (e.g., 2 or 3) copies of a sequence that is 100% complementary to the miR-182 seed sequence. In certain embodiments, the miR-182 target sequence is about 7 nucleotides to about 28 nucleotides in length and comprises at least one region that is at least 100% complementary to the miR-182 seed sequence. In certain embodiments, the miR-182 target sequence comprises a sequence that is partially complementary to SEQ ID NO: 10 and thus has one or more mismatches when aligned with SEQ ID NO: 10. In certain embodiments, the miR-183 target sequence comprises a sequence that has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches when aligned with SEQ ID NO: 10, and the mismatches can be non-consecutive. In certain embodiments, the miR-182 target sequence comprises a region that is 100% complementary and also comprises at least 30% of the length of the miR-182 target sequence. In certain embodiments, the region of 100% complementarity comprises a sequence that is 100% complementary to the miR-182 seed sequence. In certain embodiments, the remainder of the miR-182 target sequence has at least about 80% to about 99% complementarity with miR-182. In certain embodiments, the expression cassette or the vector genome comprises a miR-182 target sequence and comprises a truncated SEQ ID NO: 10 (i.e., a sequence lacking at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides at either or both of the 5' end and the 3' end of SEQ ID NO: 10). In certain embodiments, the expression cassette or the vector genome comprises a transgene and one miR-182 target sequence. In yet other embodiments, the expression cassette or the vector genome comprises at least two, three, or four miR-182 target sequences.

[0114] As used herein, the term "tandem repeat" refers to the presence of two or more contiguous miRNA target sequences. These miRNA target sequences may be contiguous. That is, the 3' end of one sequence may be immediately upstream of the 5' end of the next sequence without an intervening sequence, or vice versa, and they may be located directly one after another. In another embodiment, two or more of the miRNA target sequences are separated by a short spacer sequence.

[0115] As used herein, a "spacer" is, for example, any selected nucleic acid sequence 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length, and is located between two or more contiguous miRNA target sequences. In certain embodiments, the spacer is 1 - 8 nucleotides in length, 2 - 7 nucleotides in length, 3 - 6 nucleotides in length, 4 nucleotides in length, 4 - 9 nucleotides, 3 - 7 nucleotides, or a longer value. Preferably, the spacer is a non-coding sequence. In certain embodiments, the spacer can be four (4) nucleotides. In certain embodiments, the spacer is GGAT. In certain embodiments, the spacer is six (6) nucleotides. In certain embodiments, the spacer is CACGTG or GCATGC.

[0116] In certain embodiments, the tandem repeat comprises two, three, four or more of the same miRNA target sequences. In certain embodiments, the tandem repeat comprises at least two different miRNA target sequences, at least three different miRNA target sequences, or at least four different miRNA target sequences, etc. In certain embodiments, the tandem repeat may comprise two or three of the same miRNA target sequences, and a different fourth miRNA target sequence.

[0117] In certain embodiments, the expression cassette can have at least two different sets of tandem repeats. For example, the 3’UTR can contain tandem repeats immediately downstream of the transgene, UTR sequences, and two or more tandem repeats near the 3’ end of the UTR. In another example, the 5’UTR can contain one, two or more miRNA target sequences. In another example, the 3’ can contain tandem repeats and the 5’UTR can contain at least one miRNA target sequence.

[0118] In certain embodiments, the expression cassette contains two, three, four or more tandem repeats and starts within about 0 to 20 nucleotides of the stop codon of the transgene. In other embodiments, the expression cassette contains miRNA tandem repeats of at least 100 to about 4000 nucleotides from the stop codon of the transgene.

[0119] See PCT / US19 / 67872, filed Dec. 20, 2019, which claims priority to U.S. Provisional Patent Application No. 62 / 783,956, filed Dec. 21, 2018, incorporated herein by reference.

[0120] In another embodiment, a method of generating a recombinant adeno-associated virus is provided. A suitable recombinant adeno-associated virus (AAV) is generated by culturing a host cell that contains a nucleic acid sequence encoding an AAV capsid protein described herein, or a fragment thereof, a functional rep gene, at least the AAV inverted terminal repeat (ITR), and a mini-gene consisting of a heterologous nucleic acid sequence encoding a desired transgene, and sufficient helper functions to enable packaging of the mini-gene into the AAV capsid protein. Components that need to be cultured in the host cell to package the AAV mini-gene into the AAV capsid can be provided to the host cell in trans. Alternatively, any one or more of the necessary components (e.g., the mini-gene, rep sequences, cap sequences, and / or helper functions) can be provided by a stable host cell engineered to contain one or more of the necessary components using methods known to those of skill in the art.

[0121] Also provided herein are host cells transfected with AAV as described herein. Most preferably, such stable host cells will contain the necessary components under the control of an inducible promoter. However, the necessary components can be under the control of a constitutive promoter. Examples of suitable inducible and constitutive promoters are provided herein in the following discussion of regulatory elements suitable for use with transgenes. As yet another alternative, the selected stable host cell can contain a selected component under the control of a constitutive promoter and other selected components under the control of one or more inducible promoters. For example, stable host cells can be generated that are derived from 293 cells (containing the E1 helper function under the control of a constitutive promoter) but contain rep and / or cap proteins under the control of an inducible promoter. Still other stable host cells can be generated by those skilled in the art. In another embodiment, the host cell contains a nucleic acid molecule as described herein.

[0122] The minigenes, rep sequences, cap sequences, and helper functions necessary for the production of rAAV described herein can be delivered to the packaging host cell in the form of any genetic element that introduces the sequences it carries. The genetic element selected can be delivered by any suitable method, including the methods described herein. The methods used to construct any embodiment of the present invention are known to those skilled in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. For example, see Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY. Similarly, methods for generating rAAV virions are known, and the selection of a suitable method does not limit the present invention. For example, see, in particular, K. Fisher et al, 1993 J. Virol., 70:520-532 and U.S. Patent No. 5,478,745. These publications are incorporated herein by reference. ​

[0123] Plasmids for use in the production of the vectors described herein are also provided herein. Such plasmids are described in the Examples section.

[0124] C. Pharmaceutical Compositions and Administration In one embodiment, a recombinant AAV comprising a desired transgene and promoter for use in the target cells detailed above is optionally evaluated for contamination by conventional methods and then formulated into a pharmaceutical composition, which is intended for administration to a subject in need thereof. Such formulations include a pharmaceutically and / or physiologically acceptable vehicle or carrier (such as buffered saline or other buffer (e.g., HEPES) to maintain pH at appropriate physiological levels), and optionally, other medicinal agents, pharmaceutical agents, stabilizers, buffers, carriers, adjuvants, diluents, etc. In the case of injection, the carrier is typically liquid. Exemplary physiologically acceptable carriers include pyrogen-free sterile water and pyrogen-free sterile phosphate-buffered saline. Such various known carriers are provided in U.S. Patent Publication No. 7,629,322 (incorporated herein by reference). In one embodiment, the carrier is an isotonic sodium chloride solution. In another embodiment, the carrier is a balanced salt solution. In one embodiment, the carrier contains Tween. When storing the virus long-term, it may be frozen in the presence of glycerol or Tween 20. In another embodiment, the pharmaceutically acceptable carrier contains a surfactant such as perfluorooctane (Perfluoron liquid). The vector is formulated in a buffer / carrier suitable for injection into a human subject. The buffer / carrier should contain components that prevent rAAV from adhering to the injection tube but do not interfere with rAAV binding activity in vivo.

[0125] In certain embodiments of the methods described herein, the pharmaceutical composition described above is administered intramuscularly to a subject. In other embodiments, the pharmaceutical composition is administered intravenously. In other embodiments, the pharmaceutical composition is administered by intracerebroventricular infusion. In other embodiments, the pharmaceutical composition is administered by intracisternal (ICM) infusion. Other forms of administration that may be useful in the methods described herein include, but are not limited to, direct delivery to a desired organ (e.g., the eye) including subretinal or intravitreal delivery, oral, inhalation, intranasal, intratracheal, intravenous, intramuscular, subcutaneous, intradermal, and other parenteral routes of administration. Routes of administration may be combined, if desired.

[0126] As used herein, the terms "intrathecal delivery" or "intrathecal administration" refer to a route of administration via injection into the spinal canal, and more particularly, into the subarachnoid space to reach the cerebrospinal fluid (CSF). Intrathecal delivery may include lumbar puncture, intracerebroventricular (including intraventricular (ICV)), suboccipital / cisternal, and / or C1-2 puncture. For example, a material may be introduced by lumbar puncture to diffuse across the subarachnoid space. In another example, the injection may be cisternal.

[0127] As used herein, the terms "cisternal delivery" or "cisternal administration" refer to a direct route of administration into the cerebrospinal fluid of the cisterna magna cerebellomedularis, more particularly, via suboccipital puncture, or by direct injection into the cisterna magna, or via a permanently placed tube.

[0128] The composition can be delivered in a volume ranging from about 0.1 μL to about 10 mL, including all numerical values within the range, depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method. In one embodiment, the volume is about 50 μL. In another embodiment, the volume is about 70 μL. In another embodiment, the volume is about 100 μL. In another embodiment, the volume is about 125 μL. In another embodiment, the volume is about 150 μL. In another embodiment, the volume is about 175 μL. In yet another embodiment, the volume is about 200 μL. In another embodiment, the volume is about 250 μL. In another embodiment, the volume is about 300 μL. In another embodiment, the volume is about 450 μL. In another embodiment, the volume is about 500 μL. In another embodiment, the volume is about 600 μL. In another embodiment, the volume is about 750 μL. In another embodiment, the volume is about 850 μL. In another embodiment, the volume is about 1000 μL. In another embodiment, the volume is about 1.5 mL. In another embodiment, the volume is about 2 mL. In another embodiment, the volume is about 2.5 mL. In another embodiment, the volume is about 3 mL. In another embodiment, the volume is about 3.5 mL. In another embodiment, the volume is about 4 mL. In another embodiment, the volume is about 5 mL. In another embodiment, the volume is about 5.5 mL. In another embodiment, the volume is about 6 mL. In another embodiment, the volume is about 6.5 mL. In another embodiment, the volume is about 7 mL. In another embodiment, the volume is about 8 mL. In another embodiment, the volume is about 8.5 mL. In another embodiment, the volume is about 9 mL. In another embodiment, the volume is about 9.5 mL. In another embodiment, the volume is about 10 mL.

[0129] The effective concentration of the recombinant adeno-associated virus having a nucleic acid sequence encoding a desired transgene under the control of a regulatory sequence is desirably about 10 per milliliter 7 ~10 14within the range of individual vector genomes (vg / mL) (also referred to as genome copies / mL (GC / mL)). In one embodiment, the rAAV vector genome is measured by real-time PCR. In another embodiment, the rAAV vector genome is measured by digital PCR. See Lock et al, Absolute determination of single-stranded and self-complementary adeno-associated viral vector genome titers by droplet digital PCR, Hum Gene Ther Methods. 2014 Apr; 25(2):115 - 25. doi:10.1089 / hgtb.2013.131. Epub 2014 Feb 14 (incorporated herein by reference). In another embodiment, the rAAV infectious units are measured as described in S.K. McLaughlin et al, 1988 J.Virol., 62:1963 (incorporated herein by reference).

[0130] Preferably, the concentration is about 1.5×10 9 vg / mL to about 1.5×10 13 vg / mL, more preferably about 1.5×10 9 vg / mL to about 1.5×10 11 vg / mL. In one embodiment, the effective concentration is about 1.4×10 8 vg / mL. In one embodiment, the effective concentration is about 3.5×10 10 vg / mL. In another embodiment, the effective concentration is about 5.6×10 11 vg / mL. In another embodiment, the effective concentration is about 5.3×10 12 vg / mL. In yet another embodiment, the effective concentration is about 1.5×10 12 vg / mL. In another embodiment, the effective concentration is about 1.5×10 13 vg / mL. All ranges described herein include the endpoints.

[0131] In one embodiment, the dosage is about 1.5×10 9 vg / kg of body weight to about 1.5×10 13 vg / kg, more preferably about 1.5×10 9 vg / kg to about 1.5×10 11 vg / kg. In one embodiment, the dosage is about 1.4×10 8 vg / kg. In one embodiment, the dosage is about 3.5×10 10 vg / kg. In another embodiment, the dosage is about 5.6×10 11 vg / kg. In another embodiment, the dosage is about 5.3×10 12 vg / kg. In yet another embodiment, the dosage is about 1.5×10 12 vg / kg. In another embodiment, the dosage is about 1.5×10 13 vg / kg. In another embodiment, the dosage is about 3.0×10 13 vg / kg. In another embodiment, the dosage is about 1.0×10 14 vg / kg. All ranges described herein include the endpoints.

[0132] In one embodiment, the effective dosage (total genomic copies delivered) is about 10 7 to 10 13 vector genomes. In one embodiment, the total dosage is about 10 8 genomic copies. In one embodiment, the total dosage is about 10 9 genomic copies. In one embodiment, the total dosage is about 10 10 genomic copies. In one embodiment, the total dosage is about 10 11 genomic copies. In one embodiment, the total dosage is about 10 12 genomic copies. In one embodiment, the total dosage is about 10 13 genomic copies. In one embodiment, the total dosage is about 10 14 genomic copies. In one embodiment, the total dosage is about 10 15 genomic copies.

[0133] To reduce the risk of undesirable effects such as toxicity, it is desirable to utilize the minimum effective concentration of the virus. Further, other dosages and dosing volumes within these ranges can be selected by the attending physician, taking into account the physical condition of the subject to be treated (preferably, a human), the age of the subject, a particular disorder, and, in the case of a progressive disorder, the extent of the disorder that has developed. For example, intravenous delivery may require a dosage on the order of 1.5×10 13 vg / kg.

[0134] D. Method In another aspect, a method of transducing a target tissue is provided. In one embodiment, the method comprises administering an AAV having the AAVrh.90 capsid described herein. As shown in the following examples, the inventors have shown that an AAV designated AAVrh.90 effectively transduces the CNS (brain), liver, heart, and muscle tissue. Accordingly, a method of transducing muscle, which comprises administering rAAV having the AAVrh.90 capsid, is provided herein. In another embodiment, a method of transducing the brain, which comprises administering rAAV having the AAVrh.90 capsid, is provided herein. In another embodiment, a method of transducing the liver, which comprises administering rAAV having the AAVrh.90 capsid, is provided herein. In another embodiment, a method of transducing the heart, which comprises administering rAAV having the AAVrh.90 capsid, is provided herein. In one embodiment, intravenous administration is used. In another embodiment, ICV administration is used. In yet another embodiment, ICM administration is used.

[0135] As discussed herein, vectors comprising the AAV capsids described herein can transduce target tissues at high levels. Accordingly, methods for delivering a transgene to hepatocytes are provided herein. The methods include contacting cells with an rAAV having an AAVrh.90 capsid, the rAAV comprising a transgene. In another aspect, use of an rAAV having an AAVrh.90 capsid for delivering a transgene to the liver is provided. In certain embodiments, the methods include administering an rAAV having an AAVrh.90 capsid to deliver a transgene to cells of the liver, the transgene being selected from proprotein convertase subtilisin / kexin type 9 (PCSK9) (cholesterol-related disorders), transthyretin (TTR) (transthyretin amyloidosis), HAO, apolipoprotein C-III (APOC3), factor VIII, factor IX, low density lipoprotein receptor (LDLr), lipoprotein lipase (LPL) (lipoprotein lipase deficiency), lecithin cholesterol acyltransferase (LCAT), ornithine transcarbamylase (OTC), carnosinase (CN1), sphingomyelin phosphodiesterase (SMPD1) (Niemann-Pick disease), hypoxanth ine-guanine phosphoribosyltransferase (HGPRT), branched-chain α-keto acid dehydrogenase complex (BCKDC) (maple syrup), and erythropoietin (EPO).

[0136] Also provided herein are methods for delivering a transgene to muscle cells. The methods include contacting cells with an rAAV having an AAVrh.90 capsid, the rAAV comprising a transgene. In another aspect, use of an rAAV having an AAVrh.90 capsid for delivering a transgene to muscle is provided.

[0137] Also provided herein are methods for delivering a transgene to cardiac cells. The methods include contacting the cells with an rAAV having an AAVrh.90 capsid, wherein the rAAV contains the transgene. In another aspect, provided is the use of an rAAV having an AAVrh.90 capsid for delivering a transgene to the heart.

[0138] Also provided herein are methods for delivering a transgene to renal cells. The methods include contacting the cells with an rAAV having an AAVrh.90 capsid, wherein the rAAV contains the transgene. In another aspect, provided is the use of an rAAV having an AAVrh.90 capsid for delivering a transgene to the kidney.

[0139] Also provided herein are methods for delivering a transgene to pancreatic cells. The methods include contacting the cells with an rAAV having an AAVrh.90 capsid, wherein the rAAV contains the transgene. In another aspect, provided is the use of an rAAV having an AAVrh.90 capsid for delivering a transgene to the pancreas.

[0140] Also provided herein are methods for delivering a transgene to brain cells. The methods include contacting the cells with an rAAV having an AAVrh.90 capsid, wherein the rAAV contains the transgene. In another aspect, provided is the use of an rAAV having an AAVrh.90 capsid for delivering a transgene to the brain. In certain embodiments, the rAAV is delivered using ICM delivery.

[0141] Single genome amplification AAV genomes have conventionally been isolated from mammalian genomic DNA as a whole using PCR-based methods. Primers are used to detect conserved regions adjacent to most of the diverse VP1 (capsid) genes. The PCR products are then cloned into plasmid backbones, and individual clones are sequenced using the Sanger method. Virus isolation methods based on conventional PCR and molecular cloning are effective in recovering novel AAV genomes, but the recovered genomes may be affected by PCR-mediated recombination and polymerase errors. In addition, currently available next-generation sequencing technologies have made it possible to sequence viral genomes with unparalleled accuracy compared to the previously used Sanger technology. Novel and higher-throughput PCR- and next-generation sequencing-based methods for accurately isolating individual AAV genomes from within a viral population are provided herein. The method, AAV-Single Genome Amplification (AAV-SGA), can be used to improve our knowledge of AAV diversity in mammalian hosts. Furthermore, it has enabled the identification of novel capsids for use as vectors for gene therapy.

[0142] AAV-SGA has been validated and optimized to effectively recover individual AAV sequences from samples containing a population of genomes. This technique has previously been used to isolate single HIV and HCV genomes from within human and non-human primate hosts. Genomic DNA samples screened for AAV positivity by capsid detection PCR are endpoint diluted It is interpreted. According to the Poisson distribution with 80% reliability, dilutions that result in less than 30% positive reactions in PCR amplification contain a single amplifiable AAV genome. This procedure enables PCR amplification of the viral genome with reduced potential for PCR-mediated recombination caused by switching the polymerase template. The PCR amplicons of AAV-SGA are sequenced using the Illumina MiSeq platform with 2×150 or 2×250 paired-end sequencing. This method enables accurate de novo assembly of the full-length AAV VP1 sequence without concern for the convergence of sequencing reads from a single sample containing multiple viruses with highly homologous regions.

[0143] The AAV-SGA technology has successfully isolated multiple novel AAV capsid sequences from rhesus monkey tissues. Multiple viruses from different clades of AAV have been identified from a single sample, indicating that the population of AAV can exist in the host tissue. For example, capsids with sequence similarity to clades D, E, and distant "fringe" viruses were isolated from a single liver tissue sample.

[0144] The application of SGA for discovering AAV has not been previously described. This approach addresses the problems of template switching and polymerase errors that can result in invalid AAV genome sequences. Furthermore, when the same sequence is repeatedly recovered from the same host sample as a single isolate, the quality of the isolated genome is self-evident.

[0145] The following examples are provided to illustrate various embodiments of the present invention. These examples are not intended to limit the present invention in any way. E.

Example

[0146] Example 1: Materials and Methods: Detection and Isolation of AAV Sequences Non-Human Primate Tissue Sources Rhesus monkeys from the University of Pennsylvania colony were bred in captivity and were of Chinese or Indian origin. Rhesus monkey liver tissue samples were kindly provided from a gene therapy program and the laboratory of Timothy H. Lucas at the University of Pennsylvania.

[0147] Isolation of novel AAVs Genomic DNA was extracted (QIAmp DNA Mini Kit, QIAGEN), and the presence of AAV DNA was analyzed by amplifying a 3.1 kb full-length Cap fragment from NHP liver tissue samples using a PCR strategy. A 5’ primer (AV1NS, 5’-GCTGCGTCAACTGGACCAATGAGAAC-3’) (SEQ ID NO: 5) within the conserved region of the AAV Rep gene was combined with a 3’ primer (AV2CAS, 5’-CGCAGAGACCAAAGTTCAACTGAAACGA-3’) (SEQ ID NO: 6) located within the conserved region downstream of the AAV Cap gene for amplification of the full-length AAV Cap amplicon. AAV DNA was amplified using Q5 High-Fidelity Hot Start DNA Polymerase (New England Biolabs) using the following cycle conditions: 30 seconds at 98°C; 50 cycles of 10 seconds at 98°C, 10 seconds at 59°C, and 93 seconds at 72°C; and a 120-second extension at 72°C.

[0148] Template genomic DNA samples that gave a positive PCR reaction were subjected to AAV-single genome amplification (AAV-SGA). Genomic DNA was end-point diluted in a 96-well plate and the same primers described above were used such that fewer than 29 out of 96 PCR reactions yielded an amplification product. According to the Poisson distribution, a DNA dilution that gives a PCR product in less than 30% of the wells contains one amplifiable AAV DNA template per positive PCR at that time. AAV DNA amplicons from positive PCR reactions were subjected to Illumin Sequencing was performed using a MiSeq 2×150 or 2×250 paired-end sequencing platform, and the resulting reads were de novo assembled using the SPAdes assembler (cab.spbu.ru / software / spades). NCBI BLASTn (blast.ncbi.nlm.nih.gov) and Vector Sequence analysis was performed using NTI AlignX software (Thermo Fisher).

[0149] Vector production using a novel AAV capsid The DNA sequence of the AAV capsid gene from the PCR product of interest was TOPO cloned and amplified (Invitrogen). The amplified capsid gene was further cloned into an AAV transfer plasmid backbone containing the AAV2 Rep gene and other related plasmid elements.

[0150] AAV vectors were generated and titrated by the Penn Vector Core as previously described (e.g., Lock, M., et al. (2010) Hum. Gene Ther. 21(1259): -71). HEK293 cells were transfected in triplicate, and the cell culture supernatant was harvested, concentrated, and purified by iodixanol gradient. The purified vectors were titrated by digital droplet PCR using primers targeting the rabbit β-globin polyA sequence as previously described (see, e.g., Lock, M., et al. (2014) Hum. Gene Ther. Methods 25:115 - 125).

[0151] In vivo characterization of a novel AAV capsid in rodents Animals All animal protocols were approved by the Institutional Animal Care and Use Committee of the University of Pennsylvania. C56BL / 6J mice were purchased from the Jackson Laboratory. For GFP reporter gene experiments, adult (6 - 8 weeks old) male mice were injected. Animals were housed in standard cages at 2 - 5 animals per cage. Barrier facility cages, water bottles, and bedding were autoclaved, and cages were changed once a week. A 12 - hour light - dark cycle was maintained under automatic control. Each dark period started at 7 p.m. (±30 minutes). Food for irradiated laboratory rodents was provided ad libitum.

[0152] Test Samples and Research Design Mice received 1×10 12 of each vector of GC via the lateral tail vein intravenously (IV) at 0.1 mL per mouse, or 1×10 11 GC at a dose of 5 μL was injected intracerebroventricularly (ICV) per mouse. For each group, 3 or 5 mice were dosed.

[0153] Fourteen days after injection, the mice were euthanized by inhalation of CO 2 . Tissues were harvested and snap - frozen on dry ice for biodistribution analysis, or immersed and fixed in 10% neutral formalin, cryopreserved in sucrose, frozen in OCT, and sectioned on a cryostat for direct GFP observation. After necropsy, tissues used for analysis of endothelial cell transduction were paraffin - embedded.

[0154] Vector Biodistribution Tissue genomic DNA was extracted using the QIAamp DNA Mini Kit (QIAGEN), and the AAV vector genome was quantified by real - time PCR using primers / probes targeting the EGFP sequence of the vector together with Taqman reagents (Applied Biosystems, Life Technologies).

[0155] Visualization of reporter gene To observe direct GFP fluorescence, tissue samples were fixed in formalin for approximately 24 hours, washed briefly in PBS, sequentially equilibrated with 15% and 30% sucrose in PBS until maximum density was reached, and then frozen in OCT embedding medium for preparation of frozen sections. Sections were mounted in Fluoromount G (Electron Microscopy Sciences, Hatfield, PA) containing DAPI as a nuclear counterstain.

[0156] For paraffin-embedded tissue samples, GFP immunohistochemistry was performed. Sections were deparaffinized with ethanol and xylene, boiled in 10 mM citrate buffer (pH 6.0) for 6 minutes for antigen activation, and sequentially treated with 2% H 2 O 2 for 15 minutes, avidin / biotin blocking reagent (Vector Laboratories) for 15 minutes each, and blocking buffer (1% donkey serum + 0.2% Triton in PBS) for 10 minutes. Subsequently, they were incubated with the primary antibody for 1 hour and the biotinylated secondary antibody in blocking buffer for 45 minutes (Jackson Immunoresearch). Rabbit anti-GFP (Abcam ab13970) as the primary antibody and rabbit anti-CD31 (Abcam ab28364) as an endothelial cell marker were used. The Vectastain Elite ABC kit (Vector Laboratories) was used to visualize the bound antibody as brown precipitates using DAB as a substrate according to the manufacturer's instructions.

[0157] For immunofluorescence, paraffin sections were deparaffinized, antigen-activated, blocked with 1% donkey serum + 0.2% Triton in PBS for 15 minutes, and then sequentially incubated with primary antibodies (1 hour) and fluorescently labeled secondary antibodies (45 minutes, Jackson Immunoresearch) diluted in blocking buffer. The antibodies used were chicken anti-GFP (Abcam ab13970), rabbit anti-CD31 (Abcam ab28364), and mouse anti-NF-200 (clone RT97, Millipore CBL212). The primary antibodies were mixed together, and the GFP antibody and NF-200 antibody were detected with FITC-labeled and TRITC-labeled secondary antibodies, respectively. The signal of the rabbit antibody against CD31 was enhanced using the VectaFluor™ Excel Amplified DyLight® 488 anti-rabbit IgG kit according to the manufacturer's protocol (Vector Labs). Fluorescent and bright-field microscopic images were taken using a Nikon Eclipse TiE microscope.

[0158] Evaluation of the Introduction of a Barcoded Vector Transgene into Non-Human Primates Test Samples and Study Design Five novel capsids and five control capsids (AAVrh90, AAVrh91, AAVrh92, AAVrh93, AAVrh91.93, AAV8, AAV6.2, AAVrh32.33, AAV7, and AAV9) were used to package a modified ATG-depleted self-complementary eGFP (dGFP) transgene. Each unique capsid preparation contained a dGFP transgene with the corresponding unique 6bp barcode in front of the polyadenylation sequence of the vector genome. The transgene contained a CB8 promoter and an SV40 polyadenylation sequence (AAVsc.CB8.dGFP.barcode.SV40). AAV vectors were generated and titrated by the Penn Vector Core as previously described (see, e.g., Lock, M., et al. (2010) Hum. Gene Ther. 21:1259-71). HEK293 cells were transfected in triplicate, and the cell culture supernatants were harvested, concentrated, and purified by an iodixanol gradient. The purified vectors were titrated by digital droplet PCR using primers targeting the SV40 polyA sequence as previously described (see, e.g., Lock, M., et al. (2014) Hum. Gene Ther. Methods 25:115-25).

[0159] Ten purified vectors were pooled at equal genomic copy amounts for injection into two separate animals: the total dose delivered was 2e13 GC / kg and 3e13 GC / animal via intravenous (IV) delivery and via intracisternal magna (ICM) delivery into the intrathecal space. Animals were sacrificed 30 days after injection, and all tissues were recovered in RNAlater (QIAGEN) for downstream transgene RNA expression analysis.

[0160] Animals All animal procedures were approved by the Institutional Animal Care and Use Committee of the University of Pennsylvania. Cynomolgus monkeys (Macaca fascicularis) were donated by Bristol Meyers Squibb (USA). The animals were housed in stainless-steel squeeze-back cages in the non-human primate research program facility of The Children's Hospital of Philadelphia (Philadelphia, PA), which is accredited by the International Association for Assessment and Accreditation of Laboratory Animal Care. The animals enjoyed various enrichments such as feeding, visual and auditory stimuli, manipulation, and social interaction.

[0161] For the ICM test, 10-year-old, male, 8-kg animals were used. For the IV test, 6-year-old, male, 6.98-kg animals were used. These animals were screened for the presence of AAV neutralizing antibodies and were seronegative for AAV6, AAV8, and AAVrh32.33 at baseline. These animals had neutralizing antibody titers of 1:5 and 1:10 against AAV7 and AAV9, respectively, at baseline.

[0162] ICM injection procedure Anesthetized macaques were placed in the lateral decubitus position on an X-ray table with their heads flexed forward. Using aseptic technique, a 21G - 27G, 1 - 1.5-inch Quincke spinal needle (Becton Dickinson, Franklin Lakes, NJ, USA) was advanced into the suboccipital space until CSF flow was observed. 1 mL of CSF was collected for baseline analysis. The exact placement of the needle was confirmed by fluoroscopy (OEC9800 C-arm; GE Healthcare, Little Chalfont, UK) to avoid the possibility of brainstem injury. After CSF collection, a Luer access extension or small-bore T-port extension set catheter was connected to the spinal needle to facilitate administration of 180 mg / mL of iohexol contrast agent (GE Healthcare, Little Chalfont, UK). After confirming the needle placement, a syringe containing the test sample (volume equal to the syringe capacity and linker dead space in addition to 1 mL) was connected to a flexible linker and injected over 30 ± 5 seconds. The needle was removed and direct pressure was applied to the puncture site.

[0163] IV injection procedure Macaques were administered 10 mL of the vector test sample via a peripheral vein at a rate of 1 mL / min using an infusion pump (Harvard Apparatus, Holliston, MA).

[0164] Analysis of transgene expression Total tissue RNA was extracted from all RNALater-treated tissues using TRIzol according to the manufacturer's specifications (Life Technologies). The extracted RN A was treated with DNaseI according to the manufacturer's protocol (Roche, Basel, Switzerland). RNA was purified using the RNeasy Mini Kit (QIAGEN). Reverse transcription synthesis of cDNA was performed using the Applied Biosystems High Capacity cDNA Reverse Transcription Kit (Life Technologies). To PCR amplify the 117 bp amplicon, primers targeting the region adjacent to the 6 bp unique barcode were used (Forward primer: GGCGAACAGCGGACACCGATATGAA (SEQ ID NO: 7), Reverse primer: GGCTCTCGTCGCGTGAGAATGAGAA (SEQ ID NO: 8)), and Q5 High-Fidelity Hot Start DNA Polymerase (New England Biolabs) was used with the following cycling conditions: 30 seconds at 98 °C; 10 seconds at 98 °C, 17 seconds at 72 °C for 25 cycles; and an extension of 120 seconds at 72 °C. The amplicon was sequenced using the MiSeq Standard 2x150bp sequencing platform (Illumina). Barcode reads were analyzed using the expression analysis package (github.com / ExpressionAnalysis / ea-utils), cutadapt (cutadapt.readthedocs.io / en / stable / ), fastx toolkit package (hannonlab.cshl.edu / fastx_toolkit / ), and the fastq-join program from R version 3.3.1. (cran.r-project.org / bin / windows / base / old / 3.3.1 / ). Barcode expression count data from tissue samples were normalized to barcode counts from the injection vector material sequenced for each animal, and the proportion of barcodes from each tissue sample was plotted using GraphPad Prism version 7.04.

[0165] Study of the ICM transduction characteristics of AAVrh90 in NHP Animals and study design All animal procedures were approved by the Institutional Animal Care and Use Committee at the University of Pennsylvania. Six adult rhesus monkeys (Macaca mulatta) were procured from Orient Bioresources (Alice, TX) via PreLabs. The animals were housed in stainless steel squeeze-back cages at the non-human primate research program facility of The Children's Hospital of Philadelphia (Philadelphia, PA), which is accredited by the International Association for Assessment and Accreditation of Laboratory Animal Care. The animals enjoyed various enrichments such as feeding, visual and auditory stimulation, manipulation, and social interaction.

[0166] AAVrh90, AAV8, and AAV9 capsids were packaged with the AAV.CB7.CI.eGFP.WPRE.rBG transgene using previously described methods (see, e.g., Lock, M., et al. (2010) Hum. Gene Ther. 21:1259-71 and Lock, M., et al. (2014) Hum. Gene Ther. Methods 25:115-25). 3e13 Doses of GC were injected into the ICM of each animal. The ICM injection method is described above. Fourteen days after injection, the animals were sacrificed and tissues were harvested on dry ice for DNA vector biodistribution studies. The entire brain was harvested, trimmed, and sectioned using a brain mold according to recommended procedures for sampling and processing of the nervous system (brain, spinal cord, nerves, and eyes) during non-clinical general toxicity studies. Pardo, et.al. (2012). STP Position Paper. Tissues were also harvested, fixed in formalin, paraffin-embedded, and subjected to histopathological analysis.

[0167] Histological analysis of vector transduction For GFP immunohistochemistry (IHC), sections were deparaffinized with ethanol and xylene and boiled in 10 mM citrate buffer (pH 6.0) for 6 minutes for antigen retrieval Subsequently, it was sequentially treated with 2% H2O2 for 15 minutes, avidin / biotin blocking reagent (Vector Laboratories) for 15 minutes each, and blocking buffer (1% donkey serum + 0.2% Triton in PBS) for 10 minutes. Subsequently, it was incubated overnight at 4°C with a goat antibody against GFP (Novus Biologicals, NB100-1770, 1:500) in blocking buffer, washed in PBS, and then incubated for 45 minutes with a biotinylated anti-goat secondary antibody (Jackson ImmunoResearch, 1:500) in blocking buffer. After washing in PBS, the Vectastain Elite ABC kit (Vector Laboratories) was applied and the bound antibody was visualized as a brown precipitate using DAB as a substrate according to the manufacturer's instructions.

[0168] Mass spectrometry (MS) for amino acid modification of AAV capsids Reagents Ammonium bicarbonate, dithiothreitol (DTT), and iodoacetamide (IAM) were purchased from Sigma (St. Louis, MO). Acetonitrile, formic acid, trifluoroacetic acid (TFA), 8 M guanidine hydrochloride (GndHCl), and trypsin were purchased from Thermo Fisher Scientific (Rockford, IL).

[0169] Trypsin digestion Stock solutions of 1 M DTT and 1.0 M iodoacetamide were prepared. The capsid protein was denatured and incubated at 90 in the presence of 10 mM DTT and 2 M GndHCl. oIt was reduced at C for 10 minutes. The sample was cooled to room temperature and then alkylated at room temperature for 30 minutes using 30 mM IAM in the dark. 1 mL of DTT was added to quench the alkylation reaction. 20 mM ammonium bicarbonate with a pH of 7.5 - 8 was added to the denatured protein solution in an amount to dilute the final GndHCl concentration to 200 mM. A trypsin solution was added such that the ratio of trypsin to protein was 1:20, and it was incubated at 37 °C for 4 hours to overnight. After digestion, TFA was added to a final concentration of 0.5% to quench the digestion reaction.

[0170] LC-MS / MS Online chromatography was performed using a Thermo UltiMate 3000 RSLC system (Thermo Fisher Scientific) coupled to a Q Exactive HF equipped with an Acclaim PepMap column (length 15 cm, inner diameter 300 μm) and a NanoFlex source (Thermo Fisher Scientific). During online analysis, the column temperature was maintained at a temperature of 35 °C. Peptides were separated with a gradient of mobile phase A (MilliQ water containing 0.1% formic acid) and mobile phase B (acetonitrile containing 0.1% formic acid). The gradient was run from 4% B to 6% B over 15 minutes, then to 10% B over 25 minutes (total 40 minutes), and then to 30% B over 46 minutes (total 86 minutes). The sample was directly loaded onto the column. The column size was 75 cm × 15 μm inner diameter and was packed with a 2-micron C18 medium (Acclaim PepMap). With the loading, introduction, and washing steps, the total time for LC-MS / MS execution was approximately 2 hours.

[0171] MS data was acquired using the data-dependent Top-20 method of Q Exactive HF, where the most abundant yet unsequenced precursor ions were dynamically selected from survey scans (200 - 2000 m / z). Sequencing was performed via higher energy collisional dissociation fragmentation at a target value of 1e5 ions determined by predicted automatic gain control, with precursor isolation in a 4 m / z window. Survey scans were acquired at a resolution of 120,000 at m / z 200. The resolution of the HCD spectra was set to 30,000 at m / z 200 with a maximum ion injection time of 50 ms and a normalized collision energy of 30. The RF level of the S lens was set to 50, which optimally transmits the m / z region occupied by peptides from digestion. Precursor ions with a single, unassigned, or charge state of 6 or more were excluded from fragmentation selection.

[0172] Data processing BioPharma Finder 1.0 software (Thermo Fisher Scientific) was used for the analysis of the acquired data. For peptide mapping, a single-entry protein FASTA database was searched using carbamidomethylation set as a fixed modification, oxidation, deamidation, and phosphorylation set as variable modifications, a mass accuracy of 10 ppm, high protease specificity, and a confidence level of 0.8 for MS / MS spectra. The percent modification of peptides was determined by dividing the mass area of the modified peptide by the sum of the areas of the modified and native peptides. Considering the number of possible modification sites, isotopic species modified at different sites can co-migrate at a single peak. Thus, fragment ions derived from peptides with multiple potential modification sites can be used to identify or distinguish multiple modification sites. In these cases, the relative intensities within the observed isotope pattern can be used to specifically determine the relative abundance of different modified peptide isomers. This method assumes that the fragmentation efficiency is the same for all isomeric species and is independent at the modification site. This approach enables the definition of specific modification sites and related potential combinations.

[0173] Example 2: AAV-SGA Adeno-associated virus (AAV) is a single-stranded DNA parvovirus and is a promising candidate as a vector for gene therapy due to its non-pathogenic and weakly immunogenic properties. Since the discovery of the first-generation AAV (AAV1 - 6), our laboratory has made efforts to isolate numerous viruses from various higher primate species. This second-generation AAV identified herein was isolated using a bulk PCR-based technique with primers specific for conserved regions specific to the primate-derived AAV genome. Using AAV-SGA, we explored the genetic variations of AAV in natural mammalian hosts (Figure 1).

[0174] AAV-SGA is a powerful technique that can be used to isolate a single viral genome with high precision from a mixed population. In this study, the inventors used AAV-SGA to identify novel AAV genomes from rhesus tissue specimens. The novel virus isolates are genetically diverse and can be classified into clades D, E, and fringe clades (Figure 2).

[0175] Vectors containing the enhanced GFP (eGFP) gene were produced using novel capsids and previously identified control capsids. Vectors with various capsids were tested in mice via intravenous (IV) (Figure 5A) and intracerebroventricular (ICV) (Figure 5C) delivery routes. The biodistribution of the vector genome was assayed in heart, skeletal muscle, liver, and brain tissues (Figure 5B and Figure 5D). Mouse studies showed that novel capsids typically demonstrate clade-specific transduction patterns (except for the clade D capsid). In particular, the novel clade E vector, AAVrh.90, showed robust peripheral organ transduction after IV and ICV delivery. This was confirmed by histology of liver sections showing high levels of GFP detection, as was also evident with AAV8. Histological analysis of muscle showed endothelial cell transduction in the vasculature after IV injection of the AAVrh.90 vector (determined by immunofluorescence imaging of mouse brain sections stained with anti-GFP, anti-CD31 (endothelial cells), and neurofilaments (neurons)).

[0176] Additional tests were performed to evaluate transduction of muscle tissue after IM delivery. Vectors with various capsids expressing LacZ (Figure 6A) or mAb were delivered IM, and transgene expression was analyzed via staining of muscle fibers (in the case of LacZ) or detection in serum (in the case of mAb). Figure 6B shows a comparison of muscle transduction by detection of LacZ. Vectors of clade A (AAV1, AAV6, and AAVrh.91) transduced muscle fibers with high efficiency (darker staining), whereas for AAVrh.90, little or no staining was observed. IM delivery with AAVrh.90 resulted in detectable levels of mAb in serum comparable to AAV8 (Figure 7). Figure 8 shows the yields of various preparations of mAb and LacZ vectors. For both transgenes, AAVrh.90 had a higher yield compared to AAV8.

[0177] Example 3: Evaluation of transduction of novel AAV natural isolates in non-human primates using a barcoded transgene system Adeno-associated virus (AAV) vectors have been shown to be safe and effective gene delivery vehicles in clinical applications, but can be inhibited by existing immunity to the virus and can have limited tissue tropism. The inventors demonstrated that the barcoded transgene method is effective for simultaneously comparing transduction of various tissues in a single animal by multiple AAV serotypes. This technology reduces the number of animals used and prevents transgene-related immune responses. Accordingly, novel capsids and their respective prototypical clade member controls (AAV6.2, AAV7, AAV8, AAVrh32.33, and AAV9) were generated into vectors containing a modified eGFP transgene and a unique 6-base pair barcode, prior to the polyA signal of the transcript (Figure 9). The transgene was modified by deletion of the ATG sequence motif to prevent translation of the polypeptide and the resulting immune response to the foreign protein. The vectors were pooled in equal amounts and injected IV or ICM into cynomolgus monkeys (total dose: 2e13 GC / kg (IV) and 3e13 GC (ICM)) to evaluate the systemic and central nervous system transduction patterns of the novel capsids. The animals injected IV were seronegative for AAV6, AAV8, and AAVrh32.33 at baseline and had neutralizing antibody titers of 1:5 and 1:10 for AAV7 and AAV9, respectively.

[0178] Both AAVrh.90 and AAVrh.91 transduced peripheral organs with high efficiency after IV delivery (Figure 10A). Analysis of tissues after IV delivery revealed that the AAVrh.90 capsid had higher levels of expression in the liver, heart, skeletal muscle, kidney, and pancreas of NHPs than all other capsids (novel and control) tested (Figure 10A). AAVrh.90 also transduced CNS tissues with higher efficiency than the other capsids tested after IV delivery (Figure 10B).

[0179] AAVrh.90 did not show an increase in the level of transduction in the brains of NHPs after ICM injection (compared to other vectors tested including AAV8). Histological tests also showed that AAVrh.90 transduced both neurons and astrocytes at lower levels than AAV9 and did not transduce the epithelial cells covering the ventricles at a dose of 3e13 GC / animal. This is in contrast to AAVrh.91, a novel clade A variant, which transduced both neurons and astrocytes at high levels compared to AAV9 and showed robust transduction of motor neurons in the spinal cord. IHC staining also revealed that both AAVrh.91 and AAV1 showed efficient transduction of the ependymal cells covering the ventricles of the brain.

[0180] Evaluation of the yields from small-scale preparations of the novel and control capsids showed that AAVrh.90 exhibited yields equivalent to those of AAV8 (Figure 11). The AAVrh.90 capsid was analyzed for deamidation and other modifications as previously described (see PCT / US19 / 019804 and PCT / US19 / 2019 / 019861). As shown in Figures 12A and 12B, the results showed that AAVrh.90 has four highly deamidated amino acids (N57, N263, N385, N514) corresponding to asparagine in the asparagine-glycine pair (numbering of AAVrh.90 as in SEQ ID NO: 2). Lower rates of deamidation at residues N94, N305, N499, and N599, as well as phosphorylation at S149, were consistently observed. CT / US19 / 019804 and PCT / US19 / 2019 / 019861). As shown in Figures 12A and 12B, the results showed that AAVrh.90 has four highly deamidated amino acids (N57, N263, N385, N514) corresponding to asparagine in the asparagine-glycine pair (numbering of AAVrh.90 as in SEQ ID NO: 2). Lower rates of deamidation at residues N94, N305, N499, and N599, as well as phosphorylation at S149, were consistently observed.

[0181] (Sequence Listing Free Text) The following information provides sequences containing free text under numerical identifier <223>.

Table 3

[0182] All documents cited in this specification are hereby incorporated by reference into this specification. U.S. Provisional Patent Application No. 62 / 924,095, filed on October 21, 2019, U.S. Provisional Patent Application No. 62 / 913,314, filed on October 10, 2019, and U.S. Provisional Patent Application No. 62 / 840,184, filed on April 29, 2019, together with their sequence listings, are hereby incorporated by reference in their entirety. Similarly, the sequence listing filed herewith under the name "19-8901PCT1_ST25.txt", as well as the sequences and text therein, are hereby incorporated by reference. Although the invention has been described with reference to specific embodiments, it will be understood that modifications can be made without departing from the spirit of the invention. Such modifications are intended to fall within the scope of the appended claims.

Claims

**Claim 1** A recombinant adeno-associated virus (AAV), wherein the AAV has an AAVrh.90 capsid containing a vector genome therein, the AAVrh.90 capsid contains amino acids 1 to 738 of SEQ ID NO: 2 with deamidated asparagine at least 50% at positions N57, N263, N385, and N514, and includes a heterogeneous population of AAVrh.90 vp1 capsid proteins; a heterogeneous population of AAVrh.90 vp2 capsid proteins containing amino acids 138 to 738 of SEQ ID NO: 2 with deamidated asparagine at least 50% at positions N263, N385, and N514; and a heterogeneous population of AAVrh.90 vp3 capsid proteins containing amino acids 204 to 738 of SEQ ID NO: 2; wherein the AAVrh.90 vp2 capsid protein and the AAVrh.90 vp3 capsid protein contain deamidated asparagine at least 50% at positions N263, N385, and N514, and the deamidation ratio is determined by mass spectrometry; the vector genome contains a heterologous nucleic acid sequence operably linked to a regulatory sequence, the regulatory sequence directs the expression of a gene product encoded by the heterologous nucleic acid sequence in a target cell; and the deamidated asparagine is aspartic acid, isoaspartic acid, or a combination thereof; said AAV. **Claim 2** A recombinant AAV having a vector genome in an AAVrh.90 capsid containing AAVrh.90 vp1 capsid protein, AAVrh.90 vp2 capsid protein, and AAVrh.90 vp3 capsid protein produced by the expression of a nucleotide sequence encoding amino acids 1 to 738 of SEQ ID NO: 2, wherein the AAV vector genome contains a heterologous nucleic acid sequence operably linked to a regulatory sequence, and the regulatory sequence directs the expression of a gene product encoded by the heterologous nucleic acid sequence in a target cell; said recombinant AAV. **Claim 3** The recombinant AAV according to claim 2, wherein the AAVrh.90 vp1 capsid protein, the AAVrh.90 vp2 capsid protein, and the AAVrh.90 vp3 capsid protein are encoded by a nucleotide sequence having at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identity with SEQ ID NO:

1.

4. The recombinant AAV according to any one of claims 1 to 3, wherein the vector genome further comprises a 5' AAV inverted terminal repeat (ITR) sequence and a 3' AAV ITR sequence, wherein the 5' AAV ITR sequence and the 3' AAV ITR sequence are derived from AAV2, the recombinant AAV.

5. (a) When determined by mass spectrometry, the AAVrh.90 vp1 capsid protein contains 65% to 90% deamidated asparagine at position N57, (b) When determined by mass spectrometry, the AAVrh.90 vp1 capsid protein, the AAVrh.90 vp2 capsid protein, and / or the AAVrh.90 vp3 capsid protein contain 80% to 100% deamidated asparagine at positions N263, N385, and / or N514, and / or (c) When determined by mass spectrometry, the AAVrh.90 vp1 capsid protein, the AAVrh.90 vp2 capsid protein, and / or the AAVrh.90 vp3 capsid protein further contain 2% to 15% deamidated asparagine at position N94, or 10% to 20% deamidated asparagine at position N305, or 2% to 15% deamidated asparagine at position N499, or 2% to 10% deamidated asparagine at position N599, The recombinant AAV according to claim 1 or claim 2.

6. The AAVrh.90 capsid is a heterogeneous population of AAVrh.90 vp1 capsid proteins selected from a vp1 protein produced from a nucleic acid encoding amino acids 1 to 738 of SEQ ID NO: 2, a vp1 protein produced from the nucleic acid of SEQ ID NO: 1, or a vp1 protein produced from a nucleic acid having at least 70% identity with SEQ ID NO: 1 encoding amino acids 1 to 738 of SEQ ID NO:

2. An AAVrh.90 vp2 capsid protein heterogeneous population selected from a vp2 protein produced from a nucleic acid encoding at least the amino acid sequence of amino acids 138 to 738 of SEQ ID NO: 2, a vp2 protein produced from a nucleic acid containing at least nucleotides 412 to 2214 of SEQ ID NO: 1, or a vp2 protein produced from a nucleic acid that is at least 70% identical to at least nucleotides 412 to 2214 of SEQ ID NO: 1 encoding at least the amino acid sequence of amino acids 138 to 738 of SEQ ID NO: 2, and, An AAVrh.90 vp3 capsid protein heterogeneous population selected from a vp3 protein produced from a nucleic acid encoding at least the amino acid sequence of amino acids 204 to 738 of SEQ ID NO: 2, a vp3 protein produced from a nucleic acid containing at least nucleotides 610 to 2214 of SEQ ID NO: 1, or a vp3 protein produced from a nucleic acid that is at least 70% identical to at least nucleotides 610 to 2214 of SEQ ID NO: 1 encoding at least the amino acid sequence of amino acids 204 to 738 of SEQ ID NO: 2, The recombinant AAV according to claim 1, comprising the same.

7. The nucleic acid sequence encoding the AAVrh.90 vp1 capsid protein, the AAVrh.90 vp2 capsid protein, and / or the AAVrh.90 vp3 capsid protein is SEQ ID NO: 1 or a nucleic acid sequence that is at least 80% identical to SEQ ID NO: 1 encoding the amino acid sequence of SEQ ID NO: 2, the recombinant AAV according to claim 6.

8. A composition comprising at least the recombinant AAV according to any one of claims 1 to 7 and a physiologically compatible carrier, buffer, adjuvant, and / or diluent.

9. The composition is a) formulated for intrathecal delivery and the vector genome contains a nucleic acid sequence encoding a gene product for delivery to the central nervous system, or b) formulated for intravenous delivery, or c) formulated for intranasal or intramuscular delivery, The composition according to claim 8.

10. The recombinant AAV according to any one of claims 1 to 7 for delivering a desired gene product to a subject in need thereof.

11. Use of the recombinant AAV according to any one of claims 1 to 7, or the composition according to claim 8 or 9, in the manufacture of a pharmaceutical composition, a medicament, or a kit for delivering a desired gene product to a subject in need thereof.

12. A recombinant AAV production system useful for producing the recombinant AAV according to any one of claims 1 to 7, wherein the production system comprises (a) a nucleic acid encoding the amino acid sequence of SEQ ID NO: 2, and (b) a nucleic acid molecule suitable for packaging into the AAV capsid, the nucleic acid molecule comprising at least one AAV inverted terminal repeat (ITR) sequence and a non-AAV nucleic acid sequence encoding a gene product operably linked to a sequence directing expression of the product in a host cell, the nucleic acid molecule, and a cell culture containing the same, the cell culture having AAV rep function and helper function sufficient to enable packaging of the nucleic acid molecule into the AAV capsid, the recombinant AAV production system.

13. The recombinant AAV production system according to claim 12, wherein the nucleic acid sequence of (a) comprises at least SEQ ID NO: 1 or a sequence having at least 70% identity with SEQ ID NO:

1.

14. A method for generating recombinant AAV, the method comprising culturing a host cell, the host cell comprising (a) a nucleic acid molecule comprising a sequence encoding the amino acid sequence of SEQ ID NO: 2, (b) a functional rep gene, and (c) a mini-gene comprising a 5' AAV ITR sequence, a 3' AAV ITR sequence, and a transgene, the host cell having helper function sufficient to enable packaging of the mini-gene into the AAV capsid, the method.

15. The method according to claim 14, wherein the sequence encoding the amino acid sequence of SEQ ID NO: 2 comprises SEQ ID NO: 1 or a sequence having at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identity with SEQ ID NO:

1.

16. A method for delivering a transgene to a cell in vitro, the method comprising contacting the cell with the recombinant AAV according to any one of claims 1 to 7, the recombinant AAV comprising the transgene.

17. A plasmid comprising a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 2 and a heterologous nucleic acid sequence.

18. The plasmid according to claim 17, wherein the nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 2 comprises SEQ ID NO: 1 or a sequence having at least 70% identity with SEQ ID NO:

1.

19. A packaging cell comprising the plasmid according to claim 17 or 18.

20. Use of the packaging cell according to claim 19 for the production of recombinant AAV.

Images