Library of barcode - encoded extracellular vesicles
A library of barcoded extracellular vesicles is developed to screen factors influencing their properties and dynamics, addressing the limitations of current methods and offering insights into their applications in drug delivery and biological research.
Patent Information
- Application Number
- JP2021556168
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2019-11-15
- Filing Date
- 2020-11-13
- Publication Date
- 2025-06-11
- Estimated Expiration
- 2040-11-13
AI Technical Summary
Current methods lack a comprehensive approach for screening factors that affect the properties and dynamics of extracellular vesicles, such as secretion amount, membrane composition, and targeting efficiency to specific tissues or cells.
A library of barcoded extracellular vesicles is created by introducing nucleic acids encoding fusion proteins comprising tetraspanins and RNA-binding proteins into extracellular vesicle-secreting cells, allowing for the production of extracellular vesicles with barcoded RNA. This enables the screening of factors influencing extracellular vesicle properties and dynamics.
The approach allows for the comprehensive screening of factors affecting extracellular vesicle properties and dynamics, enhancing our understanding of their behavior and potential applications in drug delivery systems and biological research.
Smart Images

Figure 0007691113000003 
Figure 0007691113000004 
Figure 0007691113000005
Abstract
Description
Technical Field
[0001] <Cross Reference> This application claims priority from a Japanese patent application filed on November 15, 2019 (Japanese Patent Application No. 2019-207329), and the entire content thereof is incorporated herein by reference.
[0002] The present invention relates to a library of barcoded extracellular vesicles.
Background Art
[0003] Regarding vesicles secreted from cells (extracellular vesicles (EVs)), it has been clarified that there are several types depending on their origin and characteristics. Due to their heterogeneity, there are many classification methods, but from the perspective of size, EVs can be roughly divided into small EVs with a diameter of 200 nm or less and large EVs larger than this. The former are membrane vesicles with a diameter of about 30 to 200 nm, and their membranes mainly contain many exosomes thought to be derived from endosomes. Although there is also heterogeneity among exosomes, they are mainly said to be rich in endosome-binding proteins such as Rab GTPase, SNARE, annexin, and flotillin, and transmembrane protein families such as tetraspanins (CD63, CD81, CD9, etc.). Large EVs mainly include microvesicles (MVs; also called ectosomes, whose main component of the membrane is considered to be the constituent component of the cell membrane), and apoptotic bodies formed by fragmentation of cells during apoptosis (Non-Patent Documents 1, 2, 3). MVs are formed in a shape directly pinched off from the cell membrane and are vesicles with a size of about 200 nm to 1000 nm. MVs contain integrin, selectin, CD40, etc. Apoptotic bodies are also formed in a shape directly pinched off from the cell membrane, but are vesicles with a size of 500 nm to 2000 nm and contain fragmented genomic DNA, histone proteins, etc.
[0004] Exosomes have been reported to be involved in cell - cell communication at close or long distances. For example, in the immune system, exosomes released from cells function as antigen - presenting vesicles, inducing responses in anti - tumor immunity and immune tolerance that suppresses inflammation (Non - Patent Document 4). In neurodegenerative diseases, it is known that pathogenic proteins such as prions and β - amyloid peptides utilize exosomes when spreading to other cells.
[0005] Exosomes have characteristics such as low immunogenicity and the ability to penetrate the blood - brain barrier. In addition to proteins, they contain various nucleic acids (mRNA, miRNA, shRNA, ncRNA, etc.) inside, and these nucleic acids function within exosome - receiving cells, affecting the functions of exosome - receiving cells. Therefore, in recent years, research on using exosomes in DDS (Drug Delivery System) has been actively conducted in anticipation of therapeutic effects by modifying the functions of exosome - receiving cells (Non - Patent Document 5). For example, attempts have been made to increase the efficiency of DDS by expressing peptides or proteins recognized by exosome - receiving cells on the membrane surface of exosomes to enhance the targeting efficiency to exosome - receiving cells, or by expressing RNA - binding proteins on the inner membrane side of exosomes to efficiently recruit cytoplasmic RNA (Non - Patent Documents 6 - 9, Patent Document 1).
[0006] The inventors of the present application have also been developing exosomes suitable for DDS (Non - Patent Document 10).
[0007] In addition, it has been proposed that in cancer cells, exosomes secreted by the cancer cells themselves program the metastatic sites and create an environment favorable for their own metastasis. Therefore, if the secretion of exosomes can be selectively inhibited in cancer cells, there are also papers suggesting that anti-cancer drugs can be developed (Non-Patent Documents 11 and 12). According to them, it is suggested that the types of integrins present on the surface of exosomes are related to the types of organs to which cancer metastasizes.
[0008] Extracellular vesicles are not only specific to animals but also exist in plants, and it has been suggested that they play an important role in biological defense (plant immunity) against pathogens and the like, but the functions of extracellular vesicles are not well understood (Non-Patent Document 13).
Prior Art Documents
Patent Documents
[0009]
Patent Document 1
Non-Patent Documents
[0010]
Non-Patent Document 1
Non-Patent Document 2
Non-Patent Document 3
Non-Patent Document 4
Non-Patent Document 5
Non-Patent Document 6
Non-Patent Document 7
Non-Patent Document 8
Non-Patent Document 9
Non-Patent Document 10
Non-Patent Document 11
Non-Patent Document 12
Non-Patent Document 13
Non-Patent Document 14
Summary of the Invention
Problems to be Solved by the Invention
[0011] An object of the present invention is to provide a library of barcoded extracellular vesicles, a method for producing the same, and a method for using the same.
Means for Solving the Problems
[0012] As a result of intensive research, the inventors of the present application have successfully prepared an extracellular vesicle library containing nucleic acids for comprehensively screening factors that affect the properties of extracellular vesicles (i.e., the in vivo dynamics of extracellular vesicles, the secretion amount of extracellular vesicles, the substances encapsulated therein (proteins, nucleic acids, etc.), the composition of the extracellular vesicle membrane (phospholipids constituting the membrane, proteins localized on the extracellular vesicle membrane, etc.)).
[0013] The present invention includes the following embodiments: [1A] (Tool for creating an extracellular vesicle library) A nucleic acid encoding a fusion protein comprising a protein present in extracellular vesicles and an RNA-binding protein. [2A] The nucleic acid according to 1A, wherein the protein present in the extracellular vesicles is tetraspanin or an active fragment thereof. [3A] The nucleic acid according to 2A, wherein the tetraspanin is selected from the group consisting of CD63, CD9, and CD81. [4A] The nucleic acid according to any one of 1A to 3A, wherein the RNA-binding protein is selected from the group consisting of MS2 or an active fragment thereof, CAS or an active fragment thereof, L7Ae or an active fragment thereof, λ bacteriophage antiterminator protein N, or an active fragment thereof, and HuR or an active fragment thereof. [5A] An expression vector comprising the nucleic acid according to any one of 1A to 4A. [6A] An extracellular vesicle-secreting cell comprising the expression vector according to 5A. [7A] The extracellular vesicle-secreting cell according to 6A, further comprising a nucleic acid that affects the properties of extracellular vesicles. [8A] The extracellular vesicle-secreting cell according to 6A, further comprising an expression vector that expresses a nucleic acid that affects the properties of extracellular vesicles. [9A] The nucleic acid that affects the properties of the extracellular vesicles is (1) A nucleic acid that changes the amount of an endogenous protein present inside or on the surface of extracellular vesicles; (2) A nucleic acid that promotes or inhibits the secretion of extracellular vesicles; (3) A nucleic acid that affects the lipid membrane constituting the membrane of extracellular vesicles; and The extracellular vesicle-secreting cell according to 7A or 8A, which comprises a nucleic acid for allowing an exogenous protein to be present in or on the surface of the extracellular vesicle. [10A] The extracellular vesicle-secreting cell according to any one of 7A to 9A, wherein the nucleic acid affecting the properties of the extracellular vesicle comprises mRNA or ncRNA (including miRNA, siRNA, shRNA, gRNA, snRNA, snoRNA).
[0014] [1B] A fusion protein comprising a protein present in the extracellular vesicle and an RNA-binding protein. [2B] The fusion protein according to 1B, wherein the protein present in the extracellular vesicle is tetraspanin or an active fragment thereof. [3B] The fusion protein according to 2B, wherein the tetraspanin is selected from the group consisting of CD63, CD9, and CD81. [4B] The fusion protein according to any one of 1B to 3B, wherein the RNA-binding protein is selected from the group consisting of MS2 or an active fragment thereof, CAS or an active fragment thereof, L7Ae or an active fragment thereof, λ bacteriophage antiterminator protein N or an active fragment thereof, and HuR or an active fragment thereof. [5B] The fusion protein according to any one of 1B to 4B, which is bound to a nucleic acid affecting the properties of the extracellular vesicle. [6B] The nucleic acid affecting the properties of the extracellular vesicle is (1) a nucleic acid that changes the amount of an endogenous protein present in or on the surface of the extracellular vesicle; (2) a nucleic acid that promotes or inhibits the secretion of the extracellular vesicle; (3) a nucleic acid that affects the lipid membrane constituting the extracellular vesicle membrane; and (4) a nucleic acid for allowing an exogenous protein to be present in or on the surface of the extracellular vesicle; and the fusion protein according to 5B, which is selected from the group consisting of. [7B] The fusion protein according to 5B or 6B, wherein the nucleic acid that affects the behavior of the extracellular vesicles contains mRNA or ncRNA (including miRNA, siRNA, shRNA, gRNA, snRNA, snoRNA). [8B] An extracellular vesicle comprising the fusion protein according to any one of 1B to 7B. [9B] The extracellular vesicle according to 8B, having an average diameter of 30 nm or more and 150 nm or less.
[0015] [1C] (Method for preparing a library) A method for preparing a library of extracellular vesicles containing barcoded RNA, comprising: (1) introducing into an extracellular vesicle-secreting cell that expresses a fusion protein containing a protein present in the extracellular vesicle and an RNA-binding protein: (a) a plurality of expression vectors that express barcoded RNA, or (b) a plurality of barcoded RNAs ; (2) culturing the extracellular vesicle-secreting cell in a culture solution; and (3) recovering, from the culture supernatant of the extracellular vesicle-secreting cell, extracellular vesicles containing the barcoded RNA bound to the fusion protein. Method. [2C] The method according to 1C, wherein the protein present in the extracellular vesicle is tetraspanin or an active fragment thereof. [3C] The method according to 2C, wherein the tetraspanin is selected from the group consisting of CD63, CD9, and CD81. [4C] The method according to any one of 1C to 3C, wherein the RNA-binding protein is selected from the group consisting of MS2 or an active fragment thereof, dCas9 or an active fragment thereof, L7Ae or an active fragment thereof, λ bacteriophage antiterminator protein N or an active fragment thereof, and HuR or an active fragment thereof. [5C] The method according to any one of 1C to 4C, wherein the barcoded RNA comprises mRNA or ncRNA (including miRNA, siRNA, shRNA, gRNA, snRNA, snoRNA). [6C] The method according to 5C, wherein the barcoded RNA further comprises a recognition sequence for an RNA-binding protein. [7C] The method according to any one of 1C to 6C, wherein the extracellular vesicle-secreting cell is selected from the group consisting of HEK293 cells, stem cells, epithelial cells, endothelial cells, fibroblasts, cancer cells, immune cells, nerve cells, and plant cells.
[0016] [1D](Library screening method (1): Identification of factors involved in secretion volume change) A method for screening for a factor that promotes or inhibits the secretion of extracellular vesicles containing a protein present in the extracellular vesicles in an extracellular vesicle-secreting cell, (1) introducing into the extracellular vesicle-secreting cell that expresses a fusion protein comprising a protein present in the extracellular vesicle and an RNA-binding protein, (a) a plurality of expression vectors that express barcoded RNAs, or (b) a plurality of barcoded RNAs ; (2) culturing the extracellular vesicle-secreting cell in a culture medium; (3) recovering extracellular vesicles containing the barcoded RNA bound to the fusion protein from the culture supernatant of the extracellular vesicle-secreting cell; (4) recovering the barcoded RNA from the recovered extracellular vesicles; (5) recovering the barcoded RNA from the extracellular vesicle-secreting cell after culturing; (6) determining the sequences of the plurality of barcoded RNAs recovered in step (4) and calculating the quantitative ratio of each barcoded RNA; and (7) a method comprising determining the sequences of the plurality of barcoded RNAs recovered in step (5) and calculating the quantitative ratio of each barcoded RNA. Preferably, here, the quantity ratio calculated in step (6) is compared with the quantity ratio calculated in step (7), barcode RNAs with a change in the quantity ratio are identified, and from the information on the sequences contained in the identified barcode RNAs, factors that promote or inhibit the secretion of extracellular vesicles in which the protein present in the extracellular vesicles is present are identified. [1D2] (Library screening method (2): Identification of factors that affect the secretion of EVs presenting a specific protein, or factors that affect the protein selection process for presenting a specific protein on the membrane of EVs) A method for screening, in extracellular vesicle-secreting cells, factors that promote or inhibit the secretion of extracellular vesicles in which a specific protein is localized on its surface, or factors that affect the localization of a specific protein on the membrane surface of extracellular vesicles, comprising: (1) introducing into the extracellular vesicle-secreting cells that express a fusion protein containing a protein present in extracellular vesicles and an RNA-binding protein, (a) a plurality of expression vectors that express barcode RNAs, or (b) a plurality of barcode RNAs ; (2) culturing the extracellular vesicle-secreting cells in a culture solution; (3) selectively recovering extracellular vesicles in which the specific protein is present on its surface from the culture supernatant of the extracellular vesicle-secreting cells; (4) recovering barcode RNAs from the recovered extracellular vesicles; (5) recovering barcode RNAs from the extracellular vesicle-secreting cells after culturing; (6) determining the sequences of the plurality of barcode RNAs recovered in step (4) and calculating the quantity ratio of each barcode RNA; and (7) determining the sequences of the plurality of barcode RNAs recovered in step (5) and calculating the quantity ratio of each barcode RNA. Preferably, here, the quantity ratio calculated in step (6) is compared with the quantity ratio calculated in step (7), barcode RNAs with a change in the quantity ratio are identified, and from the information on the sequences contained in the identified barcode RNAs, a factor that promotes or inhibits the secretion of extracellular vesicles on the surface of which the specific protein is present, or a factor that affects the localization of the specific protein on the membrane surface of extracellular vesicles is identified. [1D3] The method according to item 1D2, wherein the specific protein is selected from the group consisting of tetraspanin, integrin, and IFITM3 (interferon-induced transmembrane protein). [2D] The method according to any one of items 1D, 1D2, and 1D3, wherein the protein present in the extracellular vesicles is tetraspanin or an active fragment thereof. [3D] The method according to item 2D, wherein the tetraspanin is selected from the group consisting of CD63, CD9, and CD81. [4D] The method according to any one of items 1D, 1D2, 1D3, 2D, and 3D, wherein the RNA-binding protein is selected from the group consisting of MS2 or an active fragment thereof, CAS or an active fragment thereof, L7Ae or an active fragment thereof, λ bacteriophage antiterminator protein N or an active fragment thereof, and HuR or an active fragment thereof. [5D] The method according to any one of items 1D, 1D2, 1D3, and 2D to 4D, wherein the barcode RNA contains mRNA or ncRNA (including miRNA, siRNA, shRNA, gRNA, snRNA, snoRNA). [6D] The method according to item 5D, wherein the barcode RNA further contains a recognition sequence for an RNA-binding protein. [7D] The method according to any one of items 1D, 1D2, 1D3, and 2D to 6D, wherein the extracellular vesicle-secreting cell is selected from the group consisting of HEK293 cells, stem cells, epithelial cells, endothelial cells, fibroblasts, cancer cells, immune cells, nerve cells, and plant cells.
[0017] [1E] (Method for screening library (3-1): Identification of factors affecting the half-life or dynamics of extracellular vesicles in body fluids) A method for screening factors that contribute to the stability of extracellular vesicles in body fluids or factors that promote or inhibit the secretion of extracellular vesicles into body fluids, comprising: (1) Preparing a library containing a plurality of types of extracellular vesicles, which include a fusion protein containing a protein present in the extracellular vesicles and an RNA-binding protein, and extracellular vesicles containing barcoded RNA bound to the fusion protein; (2) Administering the library containing the plurality of types of extracellular vesicles to a subject (including humans, non-human animals (including mice and rats), plants, and microorganisms) (preferably, in the case of humans or non-human animals, administering the library by oral administration, intravenous administration, intramuscular administration, subcutaneous administration, transdermal administration, nasal administration, pulmonary administration, or rectal administration); (3) Isolating a body fluid of the subject (for example, in the case of humans or non-human animals, blood (including whole blood, serum, and plasma), saliva, urine, amniotic fluid, cerebrospinal fluid, pericardial fluid, pleural effusion, ascites, feces, sweat, semen) and extracting RNA (here, extracellular vesicles may be isolated from the isolated body fluid and RNA may be extracted from the isolated extracellular vesicles); And (4) Detecting barcoded RNA from the extracted RNA; A method comprising; Preferably, here, by comparing the quantitative ratio of each barcoded RNA detected in step (4) with the quantitative ratio of each barcoded RNA in the plurality of types of extracellular vesicles prepared in step (1), identifying barcoded RNA with a change in the quantitative ratio, and from the sequence information contained in the identified barcoded RNA, identifying factors that promote or inhibit the secretion of extracellular vesicles. [2E] The method according to 1E, wherein the protein present in the extracellular vesicles is tetraspanin or an active fragment thereof. [3E] The method according to 2E, wherein the tetraspanin is selected from the group consisting of CD63, CD9, and CD81. [4E] The method according to any one of 1E to 3E, wherein the RNA-binding protein is selected from the group consisting of MS2 or an active fragment thereof, CAS or an active fragment thereof, L7Ae or an active fragment thereof, λ bacteriophage antiterminator protein N or an active fragment thereof, and HuR or an active fragment thereof. [5E] The method according to any one of 1E to 4E, wherein the barcoded RNA comprises mRNA or ncRNA (including miRNA, siRNA, shRNA, gRNA, snRNA, snoRNA). [6E] The method according to 5E, wherein the barcoded RNA further comprises a recognition sequence for the RNA-binding protein.
[0018] [1F](Library screening method (3-2): Identification of factors affecting the targeting of extracellular vesicles to each tissue or each body fluid) A method for screening factors that affect the efficiency of targeting of extracellular vesicles to a tissue, comprising: (1) preparing a library comprising a plurality of types of extracellular vesicles containing a protein present in the extracellular vesicles and a fusion protein comprising an RNA-binding protein, and a barcoded RNA bound to the fusion protein; (2) administering the library comprising the plurality of types of extracellular vesicles to a subject (human, non-human animal (including mouse, rat)), preferably by oral administration, intravenous administration, intramuscular administration, subcutaneous administration, transdermal administration, nasal administration or pulmonary administration (3) isolating the tissue or body fluid of the subject and extracting RNA; and (4) detecting the barcoded RNA from the extracted RNA. Preferably, here, by comparing the quantitative ratio of each barcoded RNA detected in step (4) with the quantitative ratio of each barcoded RNA in the plurality of types of extracellular vesicles prepared in step (1), identifying the barcoded RNA with a change in the quantitative ratio, and from the information of the sequences contained in the identified barcoded RNA, identifying factors that affect the efficiency of targeting of the extracellular vesicles to the tissue or body fluid. [2F] The method according to 1F, wherein the protein present in the extracellular vesicles is tetraspanin or an active fragment thereof. [3F] The method according to 2F, wherein the tetraspanin is selected from the group consisting of CD63, CD9, and CD81. [4F] The method according to any one of 1F to 3F, wherein the RNA-binding protein is selected from the group consisting of MS2 or an active fragment thereof, CAS or an active fragment thereof, L7Ae or an active fragment thereof, λ bacteriophage antiterminator protein N or an active fragment thereof, and HuR or an active fragment thereof. [5F] The method according to any one of 1F to 4F, wherein the barcoded RNA contains mRNA or ncRNA (including miRNA, siRNA, shRNA, gRNA, snRNA, snoRNA). [6F] The method according to 5F, wherein the barcoded RNA further contains a recognition sequence for the RNA-binding protein. [7F] The method according to any one of 1F to 6F, wherein the tissue is selected from the group consisting of tumor tissue, nerve tissue, and immune tissue.
[0019] [1G](Library screening method (3-3): Identification of factors affecting the targeting of extracellular vesicles of cultured cells (including primary cultured cells)) A method for screening factors that affect the efficiency of targeting of extracellular vesicles to cells, comprising: (1) A step of preparing a plurality of types of extracellular vesicles containing a fusion protein comprising a protein present in the extracellular vesicles and an RNA-binding protein, and a barcoded RNA bound to the fusion protein; (2) A step of administering the plurality of types of extracellular vesicles to cells; (3) A step of extracting RNA from the cells; (4) A step of detecting the barcoded RNA from the extracted RNA. Preferably here, the quantitative ratio of each barcode RNA detected in step (4) is compared with the quantitative ratio of each barcode RNA in the plurality of types of extracellular vesicles prepared in step (1), to identify a barcode RNA with a change in the quantitative ratio, and from the information of the sequences contained in the identified barcode RNA, a factor that affects the efficiency of targeting of the extracellular vesicles to the cells is identified. [2G] The method according to 1G, wherein the protein present in the extracellular vesicles is tetraspanin or an active fragment thereof. [3G] The method according to 2G, wherein the tetraspanin is selected from the group consisting of CD63, CD9 and CD81. [4G] The method according to any one of 1G to 3G, wherein the RNA-binding protein is selected from the group consisting of MS2 or an active fragment thereof, CAS or an active fragment thereof, L7Ae or an active fragment thereof, λ bacteriophage antiterminator protein N or an active fragment thereof, and HuR or an active fragment thereof. [5G] The method according to any one of 1G to 4G, wherein the barcode RNA contains mRNA or ncRNA (including miRNA, siRNA, shRNA, gRNA, snRNA, snoRNA). [6G] The method according to 5G, wherein the barcode RNA further contains a recognition sequence for the RNA-binding protein. [7G] The method according to any one of 1G to 6G, wherein the cells are selected from stem cells, epithelial cells, endothelial cells, fibroblasts, cancer cells, immune cells and nerve cells, and cell lines established therefrom.
[0020] [1H] An extracellular vesicle secretion promoter comprising an active ingredient selected from the group consisting of an inhibitor of PI4KA (Phosphatidylinositol 4-kinase alpha), an inhibitor of CYB5B (Cytochrome B5 Type B), an inhibitor of PIK3C3 (Phosphatidylinositol 3-Kinase Catalytic Subunit Type 3), an inhibitor of PTPN23 (Protein Tyrosine Phosphatase Non-Receptor Type 23), an inhibitor of PIK3R4 (Phosphoinositide-3-Kinase Regulatory Subunit 4), and an inhibitor of METAP1 (Methionyl Aminopeptidase 1). [2H] The extracellular vesicle secretion promoter according to 1H, wherein the extracellular vesicles express CD63. [3H] The extracellular vesicle secretion promoter according to 1H or 2H, wherein the inhibitor of PI4KA is GSK-A1 (5-(2-amino-1-(4-morpholinophenyl)-1H-benzo[d]imidazol-6-yl)-N-(2-fluorophenyl)-2-methoxypyridine-3-sulfonamide). [4H] The extracellular vesicle secretion promoter according to any one of 1H to 3H for liquid biopsy.
[0021] [1H1] A method for promoting the secretion of extracellular vesicles by administering an active ingredient selected from the group consisting of an inhibitor of PI4KA (Phosphatidylinositol 4-kinase alpha), an inhibitor of CYB5B (Cytochrome B5 Type B), an inhibitor of PIK3C3 (Phosphatidylinositol 3-Kinase Catalytic Subunit Type 3), an inhibitor of PTPN23 (Protein Tyrosine Phosphatase Non-Receptor Type 23), an inhibitor of PIK3R4 (Phosphoinositide-3-Kinase Regulatory Subunit 4), and an inhibitor of METAP1 (Methionyl Aminopeptidase 1) to a subject (human, non-human animal, higher plant, or their cells or tissues) in vivo or in vitro. [2H1] The method for promoting the secretion of extracellular vesicles according to 1H1, wherein the extracellular vesicles express CD63. [3H1] The method for promoting the secretion of extracellular vesicles according to 2H1, wherein the inhibitor of PI4KA is GSK-A1 (5-(2-amino-1-(4-morpholinophenyl)-1H-benzo[d]imidazol-6-yl)-N-(2-fluorophenyl)-2-methoxypyridine-3-sulfonamide). [4H1] The method for promoting the secretion of extracellular vesicles according to any one of 1H1 to 3H1, which is administered for liquid biopsy.
[0022] [1H2] An active ingredient selected from the group consisting of an inhibitor of PI4KA (Phosphatidylinositol 4-kinase alpha), an inhibitor of CYB5B (Cytochrome B5 Type B), an inhibitor of PIK3C3 (Phosphatidylinositol 3-Kinase Catalytic Subunit Type 3), an inhibitor of PTPN23 (Protein Tyrosine Phosphatase Non-Receptor Type 23), an inhibitor of PIK3R4 (Phosphoinositide-3-Kinase Regulatory Subunit 4), and an inhibitor of METAP1 (Methionyl Aminopeptidase 1) for use as a sensitizer for cancer diagnosis by liquid biopsy. [2H2] The active ingredient for use according to 1H2, wherein the extracellular vesicles express CD63. [3H2] The active ingredient for use according to 2H2, wherein the inhibitor of PI4KA is GSK-A1 (5-(2-amino-1-(4-morpholinophenyl)-1H-benzo[d]imidazol-6-yl)-N-(2-fluorophenyl)-2-methoxypyridine-3-sulfonamide).
[0023] [1H3] Use of an active ingredient selected from the group consisting of an inhibitor of PI4KA (Phosphatidylinositol 4-kinase alpha), an inhibitor of CYB5B (Cytochrome B5 Type B), an inhibitor of PIK3C3 (Phosphatidylinositol 3-Kinase Catalytic Subunit Type 3), an inhibitor of PTPN23 (Protein Tyrosine Phosphatase Non-Receptor Type 23), an inhibitor of PIK3R4 (Phosphoinositide-3-Kinase Regulatory Subunit 4), and an inhibitor of METAP1 (Methionyl Aminopeptidase 1) in the manufacture of an extracellular vesicle secretion promoter in vivo or in vitro. [2H3] Use in the manufacture of an extracellular vesicle secretion promoter according to 1H3, wherein the extracellular vesicles express CD63. [3H3] Use in the manufacture of an extracellular vesicle secretion promoter according to 2H3, wherein the inhibitor of PI4KA is GSK-A1 (5-(2-amino-1-(4-morpholinophenyl)-1H-benzo[d]imidazol-6-yl)-N-(2-fluorophenyl)-2-methoxypyridine-3-sulfonamide). [4H3] Use in the manufacture of an extracellular vesicle secretion promoter according to any one of 1H3 to 3H3, which is administered for liquid biopsy.
[0024] [1I] An extracellular vesicle secretion inhibitor containing an inhibitor of MMAA (Metabolism Of Cobalamin Associated A). [1I1] A method for inhibiting extracellular vesicle secretion by administering an inhibitor of MMAA (Metabolism Of Cobalamin Associated A) to a subject (human, non-human animal, higher plant, or cells or tissues thereof) in vivo or in vitro. [1I2] Inhibitors of MMAA (Metabolism Of Cobalamin Associated A) for use in cancer treatment. [1I3] Use of an inhibitor of MMAA (Metabolism Of Cobalamin Associated A) in the manufacture of an inhibitor of extracellular vesicle secretion. [Effect of the invention]
[0025] According to the present invention, it can be used for the development of an efficient drug delivery system using extracellular vesicles, the biological research of extracellular vesicles, and the drug discovery research targeting the extracellular vesicle secretion pathway. [Brief description of the drawings]
[0026]
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
[0027] The embodiments and specific examples of the invention described below show preferred embodiments of the present invention and are presented for illustration or explanation, and do not limit the present invention thereto. It is obvious to those skilled in the art that various modifications and alterations can be made based on the description herein within the spirit and scope of the present invention disclosed herein. In the present disclosure, “comprising” embodiments include “essentially comprising” embodiments and “consisting of” embodiments.
[0028] One embodiment of the present invention is a nucleic acid encoding a fusion protein comprising a protein present in extracellular vesicles and an RNA-binding protein; or a fusion protein comprising a protein present in extracellular vesicles and an RNA-binding protein.
[0029] Extracellular (secretory) vesicles (EVs) are vesicles used to release intracellular substances extracellularly and are formed by a phospholipid bilayer. Examples of lipid compositions include sphingomyelin and phosphatidylserine. Their size is 10 nm to 10 μm in diameter, 30 nm to 5000 nm, or 50 nm to 3000 nm, and small EVs (mainly including exosomes and microvesicles) with a diameter of 10 nm or more, 20 nm or more, 30 nm or more, 40 nm or more, or 50 nm or more and 500 nm or less, 400 nm or less, 300 nm or 200 nm or less are preferred in the present invention but not limited thereto. Their origin is preferably from eukaryotes but not particularly limited. Extracellular vesicles derived from humans, non-human mammals (including mice and rats), higher plants, and microorganisms (including intestinal bacteria) are preferred.
[0030] In the present invention, the protein present in extracellular vesicles is preferably a marker of extracellular vesicles, that is, a protein whose detection serves as proof of the presence of (specific) extracellular vesicles (i.e., a protein that is abundantly present in extracellular vesicles or specifically present in extracellular vesicles). Its origin is not particularly limited, but preferably derived from humans, non-human mammals (including mice and rats), higher plants, or microorganisms (including intestinal bacteria).
[0031] According to Non-Patent Document 3, the markers of mammalian extracellular vesicles are classified as follows. Examples of membrane proteins or GPI-anchored proteins that can be used as extracellular vesicle marker proteins include 1) Tissue-nonspecific ones Tetraspanins (CD63, CD9, CD81, CD82), other multi-transmembrane membrane proteins (such as CD47 and heterotrimeric G proteins (GNA: Guanine nucleotide-binding proteins)), MHC class I (HLA-A / B / C, H2-K / D / Q), Integrins (ITGA / ITGB), transferrin receptor (TFR2); LAMP1 / 2; Heparan sulfate proteoglycan (including syndecan (SDC)); Extracellular matrix metalloproteinase inducer (EMMPRIN) (also called BSG or CD147); ADAM10; CD73 (NT5E), a GPI-anchored 5'-nucleotidase, CD55 and CD59, GPI-anchored complement-binding proteins; Sonic hedgehog protein (SHH) 2) Cell / tissue-specific ones Some tetraspanins: TSPAN8 (epithelial cell-specific), CD37 and CD53 (leukocyte-specific); PECAM1 (endothelial cell-specific); ERBB2 (breast cancer-specific); EPCAM (epithelial specific); CD90 (THY1) (mesenchymal stem cell specific); CD45 (PTPRC) (immune cell specific), CD41 (ITGA2B) or CD42a (GP9) (platelet specific); Glycophorin A (GYPA) (erythrocyte specific); CD14 (monocyte specific), MHC class II (HLA-DR / DP / DQ, H2-A); CD3 (T cell specific); Acetylcholinesterase / AChE-S (neuron specific), AChE-E (erythrocyte specific); Amyloid beta A4 / APP (neuron specific); and the like.
[0032] Cytoplasmic proteins that can be used as marker proteins for extracellular vesicles are ESCRT-I / II / III (TSG101, CHMP) and accessory proteins: ALIX (PDCD6IP), VPS4A / B; ARRDC1; Flotillin-1 and 2 (FLOT1 / 2); Caveolin (CAV); EHD; RHOA; Annexin (ANXA); Heat shock proteins HSC70 (HSPA8) and HSP84 (HSP90AB1); ARF6; Syntenin (SDCBP); Microtubule-associated protein Tau (Tau, MAPT; neuron specific) and the like. In the present invention, the proteins present in extracellular vesicles may be naturally occurring proteins (including polymorphisms, orthologs, paralogs). Alternatively, it may be an artificial mutant in which some amino acids are added, substituted, or deleted, or a fragment thereof (for example, "exoTOPE"), but an artificial mutant or fragment that does not change the localization of the protein is preferred.
[0033] An RNA-binding protein refers to a protein that can bind to RNA either dependently or independently of the RNA sequence. As for the RNA-binding ability, a dissociation constant (Kd) with RNA of 1 μM or less, 500 nM or less, 300 nM or less, 100 nM or less, 50 nM or less, 30 nM or less, 10 nM or less, 5 nM or less, 3 nM or less, 1 nM or less, 500 pM or less, 300 pM or less, 100 pM or less, 50 pM or less, 30 pM or less, 10 pM or less, 5 pM or less, or 3 pM or less is preferred. Coat protein of bacteriophage MS2 (maturation gene product) (Kd = 3 - 300 nM with RNA containing MS2 recognition sequence), CAS (CRISPR-associated gene) products (including Cas9 (SpCas9, SaCas9 and mutants lacking endonuclease activity (dCas9); Kd = 10 pM with gRNA), Cpf1 (Cas12a, Cas13, etc.), L7Ae, λ bacteriophage antiterminator protein N, HuR (Human antigen R), etc. are exemplified as RNA-binding proteins. It may be a naturally occurring protein (including polymorphism, ortholog, paralog). Alternatively, it may be an artificial mutant in which some amino acids are added, substituted, or deleted, or a fragment thereof, but preferably an (active) artificial mutant or (active) fragment that maintains its RNA-binding ability (at least having a binding ability of 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 100% or more compared to the binding ability of the corresponding natural protein).
[0034] In the present invention, the fusion protein of a protein present in extracellular vesicles and an RNA-binding protein may further contain a transcription factor, a transcriptional activator (e.g., VP64, p65, Rta, VPH), a transcriptional repressor (e.g., KRAB), or active fragments thereof. Furthermore, a labeling peptide (e.g., GFP, HisTag, etc.) may be fused. The fusion protein of a protein present in extracellular vesicles and an RNA-binding protein may contain post-translational modifications (e.g., glycosylation modification, phosphorylation, etc.).
[0035] One embodiment of the present invention involves a nucleic acid that affects the properties of extracellular vesicles.
[0036] The nucleic acid that affects the properties of extracellular vesicles is such that when the cell secreting the extracellular vesicles contains the nucleic acid, by analyzing the extracellular vesicles secreted from the cell (1) The amount of endogenous protein present inside or on the surface of the secreted extracellular vesicles changes compared to when the cell secreting the extracellular vesicles does not contain the nucleic acid; (2) The amount of extracellular vesicle secretion changes compared to when the cell secreting the extracellular vesicles does not contain the nucleic acid; (3) It affects the lipid membrane constituting the extracellular vesicle membrane compared to when the cell secreting the extracellular vesicles does not contain the nucleic acid; (4) An exogenous protein encoded by the nucleic acid is present inside or on the surface of the extracellular vesicles; Examples of nucleic acids that cause such changes include. The nucleic acid may be naturally occurring DNA, RNA, or a mixture thereof. It may also be a non-naturally occurring nucleic acid (for example, one in which the nucleotides are not linked by phosphoric acid esters (P), but are partially or entirely S-modified (phosphorothioate), or peptide nucleic acid (PNA), etc.).
[0037] (1) includes nucleic acids encoding the endogenous protein itself, nucleic acids encoding transcription factors that control the transcription of endogenous proteins, nucleic acids encoding factors related to post-translational modification of endogenous proteins, nucleic acids encoding factors related to the chaperoning (including folding and intracellular transport) of endogenous proteins, etc.; antisense RNAs (siRNAs), miRNAs (microRNAs), shRNAs (small hairpin RNAs), and snRNAs (small nuclear RNAs) that positively or negatively regulate the expression of endogenous proteins, or nucleic acids for modifying genes encoding endogenous proteins using genome editing techniques (e.g., Zinc-Finger Nuclease (ZFN), Transcription Activator-Like Effector Nuclease (TALEN), Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) / Crispr Associated protein 9 (Cas9), etc.) (e.g., gRNAs used in the CRISPR / Cas9 system). (2) includes nucleic acids encoding factors that affect the secretion amount of extracellular vesicles, nucleic acids encoding factors that control the transcription, translation, and expression of factors that affect the secretion amount of extracellular vesicles itself; antisense RNAs, miRNAs, shRNAs, and snRNAs that positively or negatively regulate the expression of factors that affect the secretion amount of extracellular vesicles and factors that control the transcription, translation, and expression of factors that affect the secretion amount of extracellular vesicles itself, or nucleic acids for modifying genes encoding factors that affect the secretion amount of extracellular vesicles and factors that control the transcription, translation, and expression of factors that affect the secretion amount of extracellular vesicles itself in genome editing techniques (e.g., ZFN, TALEN, CRISPR / Cas9) (e.g., gRNAs used in the CRISPR / Cas9 system). (3) Examples include nucleic acids encoding enzymes for synthesizing the lipid membrane constituting the extracellular vesicle membrane, nucleic acids encoding factors for controlling the transcription, translation, and expression of enzymes for synthesizing the lipid membrane constituting the extracellular vesicle membrane; antisense RNAs, miRNAs, shRNAs, and snRNAs that negatively or positively regulate the expression of enzymes for synthesizing the lipid membrane constituting the extracellular vesicle membrane and factors for controlling the transcription, translation, and expression of enzymes for synthesizing the lipid membrane constituting the extracellular vesicle membrane, or nucleic acids for modifying genes encoding enzymes for synthesizing the lipid membrane constituting the extracellular vesicle membrane and factors for controlling the transcription, translation, and expression of enzymes for synthesizing the lipid membrane constituting the extracellular vesicle membrane in genome editing techniques (such as ZFN, TALEN, CRISPR / Cas9, etc.) (for example, gRNA used in the CLISPR / Cas9 system). (4) Examples include nucleic acids encoding exogenous proteins.
[0038] In the present disclosure, the nucleic acids affecting the properties of extracellular vesicles may include mRNA and ncRNA, and may further include recognition sequences for RNA-binding proteins.
[0039] In the present disclosure, mRNA refers to RNA containing base sequence information and structure that can be translated into proteins (or peptides) (cRNA; coding RNA), including not only naturally occurring mRNA but also RNA not containing an m7G cap at the 5' end and RNA not containing polyadenylation (polyA) at the 3' end. It also includes immature (premature) mRNA that can become base sequence information and structure that can be translated into proteins if appropriately spliced intracellularly.
[0040] An ncRNA (non-coding RNA) refers to an RNA (functional nucleic acid) that does not have the base sequence information and structure capable of being translated into a protein but has some function in vivo. Although not particularly limited, it includes small nuclear RNAs (snRNAs (small nuclear RNAs)) that form a complex with proteins in the nucleus, small nucleolar RNAs (snoRNAs), miRNAs (including pre-miRNAs) that bind to other RNAs, and siRNAs (including pre-siRNAs (e.g., shRNAs (small hairpin RNAs))). Furthermore, ncRNAs may also include guide RNAs (gRNAs; including single-stranded guide RNAs) (RNAs that guide an RNA:protein complex to a target nucleic acid molecule by complementary binding). In the CRISPR / Cas9 system in bacteria and archaea, two types, a crRNA (CRISPR RNA) that recognizes a target DNA sequence of about 20 bases and a tracrRNA (trans-activating crRNA) that serves as a scaffold for binding to Cas9, combine to function as a gRNA. For the purpose of genome editing, an sgRNA (single guide RNA) that combines them into one is also included in gRNAs. When Cpf1 is used instead of Cas9, only a crRNA of 41 - 44 bases (the recognition region is 21 - 24 bases) functions as a gRNA.
[0041] The recognition sequence of an RNA-binding protein refers to a sequence to which an RNA protein can bind. The RNA protein may bind as a monomer or as a multimer. It may also bind in the form of a heteromultimer together with other factors. For example, in the case of MS2, ACAUGAGGAUCACCCAUGU (SEQ ID NO: 1); in the case of Cas9, CAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 2) as tracrRNA; in the case of L7Ae, GGGUACCGUGAUCCGAAAGGUGAGUACCC (SEQ ID NO: 3); in the case of LBAPN (λ bacteriophage antiterminator protein N), GCCCUGAAGAAGGGC (SEQ ID NO: 4); in the case of HuR, AUUUACCCAUUUACCCAUUUACCCAUUUACCCAUUUACCCAUUUA (SEQ ID NO: 5), etc. are exemplified as recognition sequences of RNA-binding proteins, but are not limited thereto.
[0042] The cells that secrete the extracellular vesicles according to the present invention are not particularly limited as long as their origin is from eukaryotes, but are preferably from humans, non-human mammals (including mice and rats), and higher plants. Mammalian cells include stem cells (including induced pluripotent stem cells (iPS cells), embryonic stem cells (ES cells), and somatic stem cells (including mesenchymal stem cells, adipose stem cells, hematopoietic stem cells, neural stem cells, vascular endothelial stem cells, hepatic stem cells, and epithelial stem cells)), cells obtained by inducing differentiation of stem cells, epithelial cells, endothelial cells, fibroblasts, cancer cells, immune cells (dendritic cells and blood cells), and nerve cells, and may also be cells obtained by immortalizing these cells. They may also be cultured cells (for example, HEK293T cells).
[0043] One embodiment of the present invention is a method for producing a library of extracellular vesicles containing barcode RNA and a screening method using the library. The screening method includes identifying a specific barcode RNA contained in the extracellular vesicles.
[0044] Barcode RNA is RNA containing mRNA and / or ncRNA, and by being contained in intracellular vesicles, it enables the identification of intracellular vesicles.
[0045] A library of extracellular vesicles containing barcode RNA, which is one embodiment of the present invention, contains at least two or more types of extracellular vesicles, and the extracellular vesicles are identified by determining the sequence of the encapsulated barcode RNA. The library preferably contains 5000 or more, 6000 or more, 7000 or more, 8000 or more, 9000 or more, or 10000 or more types of extracellular vesicles. The method of introducing barcode RNA into cells is not particularly limited. Barcode RNA itself may be introduced into cells (for example, using microinjection, electroporation, gene introduction method using cationic liposomes, etc.), or an expression vector (DNA vector, RNA vector (including viral vector, etc.)) expressing barcode RNA may be introduced into cells to transcribe barcode RNA intracellularly. By collecting extracellular vesicles secreted from cells containing barcode RNA, a library of extracellular vesicles can be obtained. For example, the secreted extracellular vesicles can be collected from the cell culture supernatant. In addition, when collecting extracellular vesicles, specific types of extracellular vesicles may be collected by using a marker of specific extracellular vesicles as an index. For example, an antibody that recognizes a membrane protein such as tetraspanin present on the membrane of extracellular vesicles can be used to collect only the extracellular vesicles having tetraspanin on the membrane surface without destroying them.
[0046] Recover barcode RNA from cells, tissues, body fluids, or extracellular vesicles and determine its sequence. In the case of tissues and body fluids, extracellular vesicles may be isolated from them once, and barcode RNA may be recovered from the isolated extracellular vesicles. Although not particularly limited, the extraction method is preferably carried out using an RNA separation reagent such as TRIzol reagent based on phenol and guanidine isothiocyanate, or a general-purpose RNA purification kit. It is preferable to determine the sequence of the recovered barcode RNA after amplification. Although not particularly limited, in order to improve the amplification accuracy, it is preferable to perform reverse transcription and amplification using a plurality of types of primers.
[0047] The screening method of the library can be used for (1) Identifying factors involved in the change in the secretion amount of extracellular vesicles (including factors involved in the change in the secretion amount of vesicles containing specific proteins); (2) Identifying factors involved in the localization of a specific protein in / on the membrane of extracellular vesicles; (3) Identifying factors that affect the half-life and dynamics of extracellular vesicles in body fluids; (4) Identifying factors that affect the targeting of extracellular vesicles to each tissue or each body fluid; (5) Identifying factors that affect the targeting of extracellular vesicles to specific cells (including primary cultured cells); and so on.
[0048] In (1) or (2), an expression vector expressing barcode RNA or barcode RNA is introduced into extracellular vesicle-secreting cells, and by comparing and analyzing the barcode RNA recovered from the extracellular vesicles secreted by the extracellular vesicle-secreting cells after introduction with the barcode RNA remaining in the extracellular vesicle-secreting cells, the target factor can be identified. After administering a specific drug to extracellular vesicle-secreting cells, the effect of the drug on the change in the secretion amount of extracellular vesicles can be examined by recovering extracellular vesicles after a certain period of time.
[0049] In (2), a library of recovered barcoded extracellular vesicles is precipitated with an antibody (or antibody-conjugated beads) that recognizes a specific protein, etc., and by analyzing the barcode RNA in the extracellular vesicles on whose surface the specific protein is present, factors involved in the localization of the specific protein in / on the membrane of extracellular vesicles can be identified. Here, factors involved in the localization of a specific protein in / on the membrane of extracellular vesicles include factors that affect the transcription and translation of the specific protein (for example, transcription factors), factors related to the post-translational modification of the specific protein (for example, enzymes that perform sugar chain modification including GPI anchor connection), factors related to the chaperoning (including folding and intracellular transport) of the specific protein, and the like. As the specific protein, it is preferably a protein present on the membrane surface or in the membrane of extracellular vesicles, and may be the same as or different from the protein used for fusion with an RNA-binding protein. Without particular limitation, examples include tetraspanins, adhesion factors such as various integrins, and interferon-induced transmembrane protein (IFITM3), which is considered to be one of the factors connecting cell senescence and EVs.
[0050] (3) and (4), after administration to the library of extracellular vesicles prepared in the present invention, after a certain period of time, isolate the target tissue or body fluid, and detect the barcode RNA in the isolated tissue or body fluid, whereby the target factor can be identified. In (5), after administration of the library of extracellular vesicles prepared in the present invention to target cells, after a certain period of time, detect the barcode RNA from the cells, whereby the target factor can be identified. Before, after, or simultaneously with the administration of the library of extracellular vesicles to the target (cells), after administering a specific drug to the target (cells), the extracellular vesicles are collected after a certain period of time to observe the effect of the drug.
[0051] (3) and (4), the body fluid refers to substances in the body of an animal that fill the spaces between tissues, in body cavities, or in the tubes and circulatory systems that spread throughout the body, as well as substances secreted and excreted inside and outside the body such as saliva, sweat, semen, and urine. Without particular limitation, it includes blood (including whole blood, serum, and plasma), saliva, urine, amniotic fluid, cerebrospinal fluid, pericardial fluid, pleural effusion, ascites, feces, sweat, semen, etc. (4), the tissue refers to normal tissues of eukaryotes (including humans, non-human animals, and plants) (tissues forming various organs such as nerve tissue, immune tissue, muscle tissue, and digestive tract), or abnormal tissues such as benign or malignant tumor tissues (including blood cancers) and tissues infected with pathogens. The cell in (5) is a cell that can receive extracellular vesicles, and can be a normal cell (such as a differentiated or undifferentiated cell (including stem cells), etc.) of eukaryotes (including humans, non-human animals, and plants), an abnormal cell such as a cancer cell, or a cell line established from these, a plant cell (including callus cells), or a unicellular microorganism (including enterobacteria).
[0052] The identification of such a factor is made by comparing the quantitative ratios of barcode RNAs. Although not particularly limited, those with a quantitative ratio of 1.5 times or more, 2 times or more, or 3 times or more, or 0.3 times or less, 0.5 times or less, or 0.67 times or less may be identified as a guide. For example, when preparing a library of extracellular vesicles, the quantitative ratio of barcode RNA in a DNA library or RNA library (such as an expression vector) used and the quantitative ratio of barcode RNA recovered from cells, tissues, body fluids, or extracellular vesicles may be compared.
[0053] One embodiment of the present invention is an accelerator or inhibitor of extracellular vesicle secretion in vitro or in vivo. As the extracellular vesicle, an extracellular vesicle expressing tetraspanin (CD63, CD9, CD81, CD82) on its surface is preferred. Examples of the accelerator of extracellular vesicle secretion include inhibitors of PI4KA (Phosphatidylinositol 4-kinase alpha), inhibitors of CYB5B (Cytochrome B5 Type B), inhibitors of PIK3C3 (Phosphatidylinositol 3-Kinase Catalytic Subunit Type 3), inhibitors of PTPN23 (Protein Tyrosine Phosphatase Non-Receptor Type 23), inhibitors of PIK3R4 (Phosphoinositide-3-Kinase Regulatory Subunit 4), and inhibitors of METAP1 (Methionyl Aminopeptidase 1). Examples of inhibitors of extracellular vesicle secretion include inhibitors of MMAA (Metabolism Of Cobalamin Associated A). The inhibitor may be an miRNA (including pre-miRNA) or siRNA (pre-siRNA (for example, shRNA (small hairpin RNA))) that suppresses the expression of these genes; or a small molecule compound (molecular weight of 2000 or less, preferably 1000 or less, more preferably 600 or less), an aptamer, or an antibody (including binding fragments) that binds to these gene products and suppresses their functions. As an inhibitor of PI4KA (Phosphatidylinositol 4-kinase alpha) which is a small molecule compound, GSK-A1 (5-(2-amino-1-(4-morpholinophenyl)-1H-benzo[d]imidazol-6-yl)-N-(2-fluorophenyl)-2-methoxypyridine-3-sulfonamide) is preferred.
[0054] Liquid biopsy is mainly in the field of cancer. Instead of conventional biopsy that uses an endoscope or a needle to collect tumor tissue, it is a technique for diagnosis and prediction of treatment effect using body fluid samples such as blood (including whole blood, serum, plasma), saliva, urine, amniotic fluid, cerebrospinal fluid, pericardial fluid, pleural effusion, ascites, feces, etc. Although research has been conducted on diagnosis and prediction of treatment effect by detecting circulating free DNA, circulating tumor DNA, circulating free RNA, extracellular vesicles, etc. present in body fluids, the extracellular vesicle secretion promoter according to the present invention can improve the accuracy of diagnosis and prediction of treatment effect by liquid biopsy by promoting the secretion of extracellular vesicles secreted from cancer cells and the like.
[0055] The extracellular vesicle secretion inhibitor can be applied to cancer treatment. By inhibiting the secretion of extracellular vesicles, not only can cancer metastasis be suppressed, but it is also possible to prevent the primary tumor from programming the surrounding area by the secretion of small EVs and affecting the primary tumor itself.
Example
[0056] A. Materials and Methods <Vector for expressing fusion protein> 1. CD63-L7Ae The vector plasmid (pRK320) for expressing the CD63-L7Ae fusion protein (SEQ ID NO: 6) was prepared by introducing the sequence encoding the CD63-L7Ae fusion protein under the EF-1α promoter of the pSBbi-GH vector (addgene, plasmid #60514; hygromycin resistance gene + EGFP co-expression type). 2. CD63-MS2 The vector plasmid (pKK47: pSBbi-GH CD63-MS2) for expressing the CD63-MS2 fusion protein (SEQ ID NO: 7) was prepared by introducing the sequence encoding the CD63-MS2 fusion protein into the SfiI restriction enzyme recognition site under the EF-1α promoter of the pSBbi-GH vector (addgene, plasmid #60514; hygromycin resistance gene + EGFP co-expression type). 3. CD63-dCas9 The vector plasmid (pKK60: pSBbi-GH CD63-dCas9) for expressing the CD63-dCas9 fusion protein (SEQ ID NO: 8) was prepared by introducing the sequence encoding the CD63-dCas9 fusion protein into the SfiI restriction enzyme recognition site under the EF-1α promoter of the pSBbi-GH vector (addgene, plasmid #60514; hygromycin resistance gene + EGFP co-expression type). 4. CD9-dCas9 The vector plasmid (pKK106: pSBbi-GH CD9-dCas9) for expressing the CD9-dCas9 fusion protein (SEQ ID NO: 9) was prepared by introducing the sequence encoding the CD9-dCas9 fusion protein into the SfiI restriction enzyme recognition site under the EF-1α promoter of the pSBbi-GH vector (addgene, plasmid #60514; hygromycin resistance gene + EGFP co-expression type).
[0057] <CRISPR Vector> 1. Cas9 (for knockout) The vector plasmid (pRK300:pSBbi-RB Cas9) that expresses SpCas9-NLS-FLAG (SEQ ID NO: 10) was prepared by introducing a sequence encoding the Cas9 fusion protein into the SfiI restriction enzyme recognition site under the EF-1α promoter of the pSBbi-RB vector (addgene, plasmid#60522; blasticidin resistance gene + RFP co-expression type). 2. dCas9-VPR (for enhancing expression) The vector plasmid (pKK56:pSBbi-RB dCas9-VPR) that expresses the dCas9-VPR fusion protein (SEQ ID NO: 11) was prepared by introducing a sequence encoding the dCas9-VPR fusion protein under the EF-1α promoter of the pSBbi-RB vector (addgene, plasmid#60522; blasticidin resistance gene + RFP co-expression type).
[0058] <Preparation of EV-producing cells> HEK293T cells were transfected with a vector for expressing a fusion protein (pRK320:CD63-L7Ae; pKK47:CD63-MS2; or pKK60:CD63-dCas9) and, if necessary, a CRISPR vector (pRK300 or pKK56), selected with drug resistance, and a stable expression strain was established.
[0059] <Library for each fusion protein> 1. Library for CD63-L7Ae (for CRISPRa (expression amplification)) The backbone sequence of the gRNA containing the L7Ae recognition sequence region (C / D box) (SEQ ID NO: 12) is prepared by oligo annealing and cloned into the BlpI-XhoI site of pCRISPRia-v2 (addgene, plasmid #84832). From the resulting plasmid, the BlpI-NheI sequence containing the L7Ae recognition sequence region (C / D box) and the gRNA backbone region is excised and cloned into the same restriction enzyme sites of the addgene Membrane Proteins - gRNA pooled library (1.2x10 4 species) of the Human Subpooled CRISPRi-v2 Libraries series (addgene, plasmid #83976) or the addgene Membrane Proteins - gRNA pooled library (1.2x10 4 species) of the Human Subpooled CRISPRa-v2 Libraries series (addgene, plasmid #83985) to generate a library vector that transcribes an RNA in which the sequence recognized by the L7Ae protein is bound to the gRNA.
[0060] 2(1). Library for CD63-MS2 (for CRISPRa (expression amplification)) Using the sgRNA (MS2) cloning backbone (addgene, plasmid #61424) as a template, the backbone sequence of the gRNA containing the MS2 recognition sequence region (two MS2 boxes) is amplified by PCR in a form containing BlpI and XhoI recognition sequences at both ends, and this is cloned into the BlpI-XhoI site of pCRISPRia-v2 (addgene, plasmid #84832). From the resulting plasmid (pKK66), the BlpI-NheI fragment containing the MS2 recognition sequence region (two MS2 boxes) and the gRNA backbone region is excised and the addgene Membrane Proteins - gRNA pooled library (1.3x10 4A vector library that transcribes gRNAs containing sequences recognized by the MS2 protein was constructed by cloning into the same restriction enzyme recognition sites of the (addgene, plasmid #83976). Separately, vectors (one or two for each gene) that express gRNAs for CD274, CD47, CD55, CD59, CD81, ICAM1, ITGAL, LRP1, and IL1B were constructed. The sequences encoding gRNAs contained in each vector are shown in Table 1 below.
Table 1
[0061] 2(2). Library for CD63-MS2 (Library presenting random peptides in the extracellular region of Lamp2b) Using pCRISPRia-v2 (addgene plasmid #84832) as the backbone, a bidirectional promoter (amplified from pSBbi-RB addgene #60522); MS2 recognition sequence x3; a sequence encoding RVGLamp2b (synthesized by modifying the sequence based on pcDNA GNSTM-3-RVG-10-Lamp2b-HA; addgene, plasmid #71294 to include the desired restriction enzyme recognition sequence); and a sequence encoding bGHpolyA were introduced into the site cut with NheI / SbfI (the part sandwiched between the sequences encoding cPPT and PuroR was excised). At this time, the RPBSA promoter in the bidirectional promoter was introduced in the forward direction with respect to PuroR, and the EF1a promoter, MS2 recognition sequence x3, RVGLamp2b, and bGHpolyA were introduced in the reverse direction. Subsequently, the part encoding the RVG peptide was excised by restriction enzyme treatment, and a synthetic oligonucleotide library (NDT codon set; 12x4 = 20736 types) encoding a random peptide (4mer) was introduced instead to construct a library (pSF63) for expressing a random peptide-Lamp2b fusion protein (SEQ ID NO: 34).
[0062] 3. Library for CD63-dCas9 As the library for CD63-dCas9, existing gRNA libraries can be used as they are. In this example, in addition to the addgene Membrane Proteins - gRNA pooled library (1.3x10 4 species) (addgene #83976, for CRISPRa) of the above Human Subpooled CRISPRa-v2 Libraries series, the Human CRISPR Knockout Pooled Library (GeCKOv2) (addgene, Pooled Library #1000000048) and the Bassik Human CRISPR Knockout library (Non-Patent Document 14), Drug Targets, Kinases, phosphatases (DTKPlibrary) (10 gRNA / gene, a total of 24,569 gRNA species (2,323 target genes), addgene, Pooled library #101927) (both for CRISPR knockout) were used.
[0063] Each plasmid library or gRNA plasmid for individual genes; and the lentiviral packaging plasmids psPAX2 (addgene, plasmid #122260) and pMD2.G (addgene, plasmid #12259) were transfected into Lenti-X (registered trademark) 293T cells (Takara Bio, Japan). After culturing for 6 - 16 hours, the medium was changed, and then the culture supernatant after culturing for 48 hours was filtered through a filter to collect the solution containing lentivirus. The collected lentivirus was infected into EV-producing cells, and the titer (MOI) of the lentivirus was determined by monitoring the fluorescent marker separately encoded in the library expression cassette or by performing a cell viability assay using the antibiotic resistance gene separately encoded in the library expression cassette.
[0064] <Lentivirus Infection and EV Production> According to the measured titer, lentivirus was used to infect EV-producing cells. After infection, the cells were cultured for more than 4 days in the presence of puromycin. Subsequently, the culture medium was replaced with OptiMEM® medium (Thermo Fisher Scientific, Japan). After culturing for 48 hours, the culture supernatant containing extracellular vesicles was collected. Then, the supernatant was centrifuged at 300G for 5 minutes and subsequently at 1500G for 10 minutes, and the cells and cell debris were removed by passing the supernatant through a 0.22 μm filter. Subsequently, extracellular vesicles were purified and concentrated from the supernatant by ultracentrifugation.
[0065] <Method for Sequencing Analysis of Barcoded RNA> 1. RNA from the gRNA library for CD63-L7Ae RNA was extracted from the collected extracellular vesicles or EV-producing cells using TRIzol. In the presence of LNA (2’-4’ bridged nucleic acid, AAGCAGTGGTATCAACGCAGAGTACrGrG+G) (SEQ ID NO: 13: the bases with “r” are RNA bases, and the bases with “+” are LNA bases), reverse transcription was performed using the reverse transcription primer AAAGCACCGACTCGGTGCCAC (SEQ ID NO: 14) and a reverse transcriptase with template switching activity. This reverse transcription product was PCR amplified using oligonucleotides with adapter sequences for next-generation sequencers and barcodes for sample multiplexing added to the Fw primer and Rev primer, respectively. The amplified DNA was analyzed using Ion Proton or Illumina Hiseq X Ten to determine the sequences of each gRNA and calculate their quantitative ratios. 2(1). RNA from the gRNA library for CD63-MS2 RNA was extracted from the recovered extracellular vesicles or EV-producing cells using TRIzol and reverse-transcribed in the presence of LNA (SEQ ID NO: 13) using the reverse transcription primer AAAGCACCGACTCGGTGCCAC (SEQ ID NO: 14) and a reverse transcriptase with template switching activity. This reverse transcription product was PCR-amplified using oligonucleotides with adapter sequences for next-generation sequencers and barcodes for sample multiplexing added to the Fw primer and Rev primer, respectively. The amplified DNA was analyzed using Ion Proton or Illumina Hiseq X Ten to determine the sequences of each gRNA and calculate their quantitative ratios. 2(2). RNA from the random peptide-Lamp2b library for CD63-MS2 RNA was extracted from the recovered extracellular vesicles or EV-producing cells using TRIzol, reverse-transcribed using the reverse transcription primer attttgcataaaggcaagtgg (SEQ ID NO: 15) and a reverse transcriptase, and PCR-amplified using oligonucleotides with adapters for next-generation sequencing added to the Fw primer and Rev primer, respectively. The product was analyzed using Ion Proton and its quantitative ratio was calculated. 3. RNA from the library for CD63-dCas9 (when using addgene, Pooled Library #83976, #1000000048 or #101927) RNA was extracted from the recovered extracellular vesicles using TRIzol and reverse-transcribed in the presence of LNA (2’-4’ bridged nucleic acid, AAGCAGTGGTATCAACGCAGAGTACrGrG+G) (SEQ ID NO: 13) with a reverse transcription primer TTTTTCAAGTTGATAACGGACTAGCC (SEQ ID NO: 16) and a reverse transcriptase with template switching activity. The reverse transcription product was PCR amplified using oligonucleotides with adapter sequences for next-generation sequencers and barcodes for sample multiplexing added to the Fw primer and the Rev primer, respectively. The amplified DNA was analyzed using Ion Proton or Illumina Hiseq X Ten to determine the sequences of each gRNA and calculate their quantitative ratios.
[0066] B. Evaluation of Barcoded CD63-MS2-expressing Extracellular Vesicles The following experiment was conducted to examine the blood retention of CD63-MS2-expressing extracellular vesicles. Vectors expressing gRNAs for CD274, CD47, CD55, CD59, CD81, ICAM1, ITGAL, LRP1, and IL1B (one or two types of each gene) were separately transfected into EV-producing cells for CD63-MS2 (HEK293T CD63-MS2, dCas9-VPR-expressing strain), and the culture supernatants containing extracellular vesicles were collected and mixed. Extracellular vesicles were purified from the collected culture supernatants by ultracentrifugation and suspended in PBS to a total of approximately 1x10 11 ~10 12 vesicles / mL. 100 μL of the prepared EV solution was injected into the tail vein of Jcl:ICR mice. Two minutes after intravenous injection, CO 2After euthanizing the mice, whole blood was collected from the mice, serum was obtained using a microtainer blood collection tube (BD), and extracellular vesicles in the serum were isolated using Total Exosome Isolation Reagent (Thermo Fisher Scientific, Japan). RNA was extracted from the isolated extracellular vesicles using TRIzol reagent, reverse transcription and amplification were performed, the sequences of each gRNA were determined, and their quantitative ratios were calculated (t = 2 min). As a control (t = 0), the prepared EV solution before injection into the mice was treated in the same manner except for the isolation of EVs from serum using total exosome isolation reagent. The sequences of each gRNA were determined, and their quantitative ratios were calculated. Then, the amount of each gRNA recovered from the blood when the control was set to 1 was calculated. As a result, all 17 types of gRNAs used could be detected, and their quantitative ratios could also be stably detected (Figure 1).
[0067] C. CD63-MS2-expressing EV Library and CD63-dCas9-expressing EV Library For the CD63-MS2-expressing EV library (for gRNA), addgene #83985, Human Subpooled CRISPRa-v2 Libraries Membrane Proteins - gRNA pooled library (1.3x10 4 species) was used to perform cloning as described above to prepare a gRNA library containing the MS2box in the backbone. The prepared library was packaged into lentivirus and used to infect EV-producing cells (HEK293T CD63-MS2, dCas9-VPR stable expression strain). For the CD63-dCas9-expressing EV library, the addgene #83985 library was directly packaged into lentivirus and used to infect EV-producing cells (HEK293T CD63-dCas9, dCas9-VPR stable expression strain). The infected cells were cultured under the same conditions, and extracellular vesicles were recovered from the culture supernatant. RNA was extracted from the collected extracellular vesicles, reverse transcribed and amplified, the sequences were determined, and their quantitative ratios were calculated. As a control, the sequences of the original gRNA library itself were also determined, and their quantitative ratios were calculated. As a result, from the CD63-MS2-expressing EV library, EVs barcoded with gRNAs of more than 9,000 out of 13,147 species (detection rate 68.4%) could be detected. Furthermore, in the CD63-dCas9-expressing EV library, extracellular vesicles barcoded with gRNAs of 13,120 out of 13,147 species (detection rate 99.8%) could be detected (Figs. 2A–C). Furthermore, from the CD63-dCas9-expressing EV library using the Gecko V2A (addgene #1000000048) library, 60,711 out of 63,950 species (detection rate 94.9%) (Fig. 2D); from the CD63-dCas9-expressing EV library using the DTKP library (addgene #101927), extracellular vesicles barcoded with gRNAs of 24,285 out of 24,569 species (detection rate: 98.8%) could be detected (Fig. 2E). For the CD63-MS2-expressing EV library (for random peptide-Lamp2b), the plasmid library prepared in the above <library for each fusion protein> 2(2) was packaged into lentivirus and used to infect EV-producing cells (HEK293T CD63-MS2, dCas9-VPR stable expression strain). The infected cells were cultured under the same conditions, and extracellular vesicles were collected from the culture supernatant. RNA was extracted from the collected extracellular vesicles, reverse transcribed and amplified, the sequences were determined, and their quantitative ratios were calculated (Fig. 2G). As a control, RNA was extracted from the EV-producing cells themselves after collecting the culture supernatant, reverse transcribed and amplified, the sequences were determined, and their quantitative ratios were calculated (Fig. 2F). As a result, we successfully produced an EV library expressing a random peptide on its surface.
[0068] D. Screening for Factors that Prolong the Plasma Half-life of Exosomes Using Barcoded Exosomes 3.0×10 of the CD63-dCas9-expressing EV library prepared in C above10 Individual vesicles were injected into the tail vein of mice. Thirty minutes after injection, blood was collected from the mice, and extracellular vesicles were isolated from the collected blood. RNA was extracted from the isolated extracellular vesicles, reverse transcribed and amplified, and the sequence was determined. As a control, RNA was extracted from the CD63-dCas9-expressing EV library before injection, reverse transcribed and amplified, the sequence was determined, and the quantitative ratio was calculated. Then, the amount of each gRNA recovered from the blood when the control was set to 1 was calculated. As a result, gRNAs with a significantly increased composition ratio in the blood were identified (Figure 3). The sequences encoding the detectable gRNAs are shown in Table 2.
Table 2
[0069] E1. Screening for Factors that Promote / Inhibit the Secretion of Extracellular Vesicles Using Barcoded Extracellular Vesicles HEK293T cells were transfected only with the vector for CD63-dCas9 expression, selected for drug resistance, and a stable expression strain was established (hereinafter referred to as Cas9(-) EV-producing cells). HEK293T cells were transfected with the vector for CD63-dCas9 expression and the pRK300 plasmid, selected for drug resistance, and a stable expression strain was established (hereinafter referred to as Cas9(+) EV-producing cells). Cas9(-) EV-producing cells and Cas9(+) EV-producing cells were infected with lentivirus containing the DTKP library. After infection, they were cultured for 7 days or more in the presence of puromycin. Then, the culture medium was replaced with OptiMEM® medium (Thermo Fisher Scientific, Japan), and after culturing for 48 hours, the culture supernatant containing extracellular vesicles was collected. Centrifugation was performed at 300 x g for 5 minutes and 1500 x g for 10 minutes, and cells and cell debris were removed through a 0.22 μm filter. Then, extracellular vesicles (Cas9(-) EV and Cas9(+) EV) were purified and concentrated from the cell supernatant by ultracentrifugation. RNA was extracted from the recovered extracellular vesicles, reverse transcribed and amplified, and then sequenced and quantified using a next-generation sequencer. RNA was also extracted from the EV-producing cells after culture, reverse transcribed and amplified, and then sequenced and quantified using a next-generation sequencer. The quantity ratios of gRNAs corresponding to each gene were calculated for Cas9(-)EV / Cas9(+)EV or Cas9(+)EV / Cas9(+)EV-producing cells using CRISPR AnalyzeR (bioRxiv 2017, http: / / crispr-analyzer.dkfz.de / ) (Figures 4 and 5). As a result, knocking out PI4KA, CYB5B, PIK3C3, PTPN23, PIK3R4, METAP1, etc. increased the secretion amount of extracellular vesicles (Figure 4A). This effect was independent of the number of EV-producing cells expressing each gRNA (Figure 4B).
[0070] E2. Enhancement of the Secretion Amount of CD63-positive EVs by PI4KA Inhibitor GSK-A1, a PI4KA inhibitor, was administered to HEK293T cells expressing CD63-nanoLuc (pDB30), and the amount of secreted extracellular vesicles was measured by a luminescence assay (Promega, Nanoglo luciferase assay system) measuring nluc activity in the culture supernatant or nanoparticle tracking analysis (NTA) using Nanosight (Malvern). As a control, a similar experiment was conducted without administering GSK-A1, and the EV secretion amount at each GSK-A1 concentration was calculated with the EV secretion amount of the control set to 1. As a result, it was found that the addition of GSK-A1 increased the secretion amount of CD63-positive extracellular vesicles (Figure 6). This indicates that the screening method according to the present invention can identify factors that promote the secretion amount of extracellular vesicles.
[0071] Also, the same assay as above was performed using HEK293T cells expressing CD9-dCas9 (SEQ ID NO: 9) as EV-producing cells. As a result, the secretion amount of exosomes containing gRNA that knocks out MMAA (Metabolism Of Cobalamin Associated A) as a barcode was suppressed (0.62-fold compared to intracellular). On the other hand, when HEK293T expressing CD63-dCas9 was used as EV-producing cells, there was no change in the secretion amount (1.06-fold compared to intracellular). This indicates that by changing the EV marker used, it becomes possible to elucidate differences in the secretion mechanisms of EVs of a specific population, etc.
Industrial Applicability
[0072] By using the barcoded exosomes according to the present invention, it can be used for the development of an efficient drug delivery system using exosomes, the biological research of exosomes (for example, elucidation of EV secretion in various cells), and drug discovery research targeting the exosome secretion pathway (for example, identification of factors that specifically change the EV secretion amount in cells).
[0073] The present invention can also be used for the analysis of networks via exosomes across biological kingdoms. For example, in the mammalian digestive tract, in addition to plants (food), intestinal bacteria, pathogenic microorganisms, yeasts in food, etc. constantly build relationships that interact with each other, and it can also be useful for the study of exosomes produced by these heterogeneous biological communities.
[0074] The extracellular vesicle secretion promoter or inhibitor according to the present invention can also be used for the analysis of the physiological role played by a specific sub-population of extracellular vesicles by promoting or inhibiting the secretion of the specific sub-population of extracellular vesicles in vivo or in vitro by administering it to a subject.
Claims
**Claim 1** A method for producing a library of extracellular vesicles containing barcode RNA, comprising: (1) introducing into extracellular vesicle-secreting cells that express a fusion protein comprising a protein present in extracellular vesicles and an RNA-binding protein, (a) a plurality of expression vectors that express barcode RNA, or (b) a plurality of barcode RNAs; (2) culturing the extracellular vesicle-secreting cells in a culture medium; and (3) recovering, from the culture supernatant of the extracellular vesicle-secreting cells, extracellular vesicles containing barcode RNA bound to the fusion protein. **Claim 2** The method according to claim 1, wherein the barcode RNA comprises a nucleic acid selected from the group consisting of: (1) a nucleic acid that changes the amount of an endogenous protein present inside or on the surface of an extracellular vesicle; (2) a nucleic acid that promotes or inhibits the secretion of extracellular vesicles; (3) a nucleic acid encoding an enzyme for synthesizing a lipid membrane that constitutes the extracellular vesicle membrane; and (4) a nucleic acid for causing an exogenous protein to be present inside or on the surface of an extracellular vesicle. **Claim 3** The method according to claim 1 or 2, wherein the barcode RNA is a nucleic acid that negatively or positively regulates the expression of a factor that promotes or inhibits the secretion of extracellular vesicles. **Claim 4** A method for screening for a factor, comprising steps (1) to (3) in the method according to claim 1, wherein the barcode RNA is a nucleic acid that negatively or positively regulates the expression of the factor, and further comprising: (4) determining the sequences of a plurality of barcode RNAs and calculating the quantitative ratios of the respective barcode RNAs; and (5) identifying the factor from the sequence information contained in the barcode RNAs with changed quantitative ratios. **Claim 5** The method according to claim 4, wherein the factor is a factor that promotes or inhibits the secretion of extracellular vesicles. **Claim 6** The method according to claim 4, wherein the factor is a factor that promotes or inhibits the secretion of extracellular vesicles on the surface of which a specific protein is localized, or a factor that is involved in the localization of a specific protein on the membrane surface of extracellular vesicles. **Claim 7** The method according to claim 4, wherein the factor is a factor that contributes to the stability of extracellular vesicles in a body fluid, or a factor that promotes or inhibits the secretion of extracellular vesicles into a body fluid. **Claim 8** (1) A step of preparing a library containing a plurality of types of extracellular vesicles, the extracellular vesicles containing a fusion protein comprising a protein present in the extracellular vesicles and an RNA-binding protein, and barcode RNAs bound to the fusion protein; (2) A step of extracting RNA from a tissue or body fluid isolated from a subject administered with the library containing the plurality of types of extracellular vesicles; and (3) A step of detecting barcode RNAs from the extracted RNA; A screening method comprising the above steps. **Claim 9** A step of further identifying a barcode RNA with a change in the quantitative ratio by comparing the quantitative ratio of each barcode RNA detected in step (3) with the quantitative ratio of each barcode RNA in the plurality of types of extracellular vesicles prepared in step (1), and identifying a factor from the sequence information contained in the identified barcode RNA. The screening method according to claim 8. **Claim 10** The screening method according to claim 8 or 9, wherein the tissue or body fluid is saliva, urine, feces, or semen. **Claim 11** The screening method according to any one of claims 8 to 10, wherein the subject is a non-human animal.
Citation Information
Patent Citations
Targeted and modular exosome loading system
US20150093433A1
Methods for High-Throughput Labelling and Detection of Biological Features In Situ Using Microscopy
US20190085383A1