Adeno-Associated Virus Delivery of CLN3 Polynucleotide

Abstract

This disclosure relates to recombinant adeno-associated virus (rAAV) delivery of ceroid lipofuscinosis neuron 3 (CLN3) polynucleotides. This disclosure provides rAAV and methods of using rAAV for CLN3 gene therapy of neuronal ceroid lipofuscinosis or CLN3-Batten disease.

Description

Technical Field

[0001] This application claims priority to U.S. Provisional Patent Application No. 62 / 800,911, filed Feb. 4, 2019, which is hereby incorporated by reference in its entirety.

[0002] Incorporation by Reference of Sequence Listing This application includes, as a separate part of the disclosure, a computer-readable form sequence listing (filename: 53576_SeqListing.txt, created on Jan. 31, 2020, 26,705 bytes, ASCII text file), which is hereby incorporated by reference in its entirety.

[0003] The present disclosure relates to recombinant adeno-associated virus (rAAV) delivery of ceroid lipofuscinosis neuronal 3 (CLN3) polynucleotides. The present disclosure provides rAAVs and methods of using rAAVs for CLN3 gene therapy of neuronal ceroid lipofuscinosis (NCL) or CLN3-Batten disease.

Background Art

[0004] Neuronal ceroid lipofuscinosis (NCL) is a group of severe neurodegenerative disorders.

[0005] Mutations in the CLN3 gene cause juvenile NCL or CLN3-Batten disease (Kitzmu et al., Human Molecular Genetics 2008;17(2):303-312, Munroe et al., Am J Hum Genet.1997;61:310-316), which is also known as Spielmeyer-Sjögren-Vogt disease. The mutations interfere with the lysosomal storage clearance process. Currently, mutations causing 67 diseases have been reported. However, 85% of patients are homozygous for a 1.02 kb deletion, which results in the loss of exons 7 and 8. The CLN3 mutations seen in patients mainly cause a decrease in the amount or functionality of the protein (battenin).

[0006] The typical onset age of CLN3-Batten disease is 4 - 7 years old, latent but with rapidly progressive vision loss. Children with juvenile NCL shift from normal vision to blindness within months, but can then maintain light perception for several years. Decline in cognitive and motor functions usually occurs after the next (7 - 10 years), along with behavioral problems such as aggression (8 - 10 years old) and subsequent seizures (10 - 12 years old). The features of Parkinson's disease onset between 11 - 13 years old. Cardiac conduction abnormalities have been reported in individuals in the later stages of the disease. There is high phenotypic variability among individuals affected by CLN3-Batten disease, but all commonly have low vision or progressive blindness. Furthermore, the physical subscale of the Unified Batten Disease Rating Scale (UBDRS) verified in 82 patients shows a steady and measurable decrease of 2.86 points per year (2.27 - 3.45, p < 0.0001). The average survival period is usually 15 years from symptom onset to end-stage.

[0007] Treatment approaches for CLN3-Batten disease are extensive in efforts to improve the disease. These include drug therapies such as EGIS-8332 and talampanel targeting AMPA receptors, drugs enabling lead-through of premature termination mutations, drugs assisting in the destruction of accumulated storage substances (cystagon / cysteamine), and further immunosuppressive therapies (mycophenolic acid, prednisolone). Enzyme replacement therapy and stem cell therapy are also being evaluated. Many treatment means have been studied, but few have been evaluated in the clinical setting. There is nothing available to delay progression or cure the disease. Patients and families rely on treatments to improve symptoms and palliative care.

[0008] Cln3 Δex7 / 8The mouse model was created in the early 2000s to mimic the most common disease-causing mutation in CLN3-Batten disease patients: a ~1 kb mutation that deletes exons 7 and 8 from the CLN3 gene (Cotman et al., Hum Mol Genet. 2002;11(22):2709-2721, Mole et al., Eur J Paediatr Neurol. 2001;5:7-10). This mutation is homozygous in 85% of patients and is seen as a heterozygous mutation in combination with a point mutation in the other allele in an additional 15% of patients. Loss of the exon is predicted to result in a frameshift mutation, which leads to a short, truncated protein product with lost or reduced activity (Lerner et al., Cell. 1995 Sep 22;82(6):949-57, Kitzmuller et al., Hum Mol Genet. 2008 Jan 15;17(2):303-12). In their initial study, Cotman et al. demonstrated that the CLN3 Δex7 / 8 mouse model successfully recapitulated several aspects of CLN3 disease. CLN3 Δex7 / 8 animals accumulated autofluorescent storage material and ATP synthase subunit C in the nervous system at various time points and showed astrocyte reactivity in the brain from 10 months of age. Subsequent studies have detailed changes in glutamate receptor function in the cerebellum, which corresponded to motor deficits in the accelerating rotarod assay (Cotman et al., Hum Mol Genet. 2002;11(22):2709-2721). Behaviorally, CLN3 Δex7 / 8 mice have been characterized at both juvenile and mature time points, with neonatal and juvenile adult mice showing neurodevelopmental motor delays and impairments in walking and hindlimb grip at 10-12 months of age (Cotman et al., Hum Mol Genet. 2002;11(22):2709-2721, Osorio et al., Genes Brain Behav. 2009 Apr;8(3):337-345). CLN3 Δex7 / 8The mice do not appear to have functional visual impairment, but show a slight survival impairment when compared to 12-month-old controls (Cotman et al., Hum Mol Genet. 2002;11(22):2709-2721, Seigel et al., Mol Cell Neurosci. 2002 Apr;19(4):515-27). Collectively, CLN3 carrying the most frequent human mutations Δex7 / 8 mouse models show numerous cellular and behavioral changes consistent with CLN3-Batten disease, making them suitable models for testing therapies.

[0009] Therefore, there remains a need in the art for treatments for CLN3-Batten disease. SUMMARY OF THE INVENTION

[0010] Provided herein are methods and products for CLN3 gene therapy using recombinant AAV.

[0011] Provided herein is a recombinant adeno-associated virus 9 (rAAV9) encoding a CLN3 polypeptide, comprising, in order from 5' to 3', a P546 promoter and a polynucleotide encoding a CLN3 polypeptide, contained within an rAAV9 genome. In some embodiments, the rAAV9 genome comprises a self-complementary genome. In some embodiments, the rAAV9 genome comprises a single-stranded genome.

[0012] There is provided a self-complementary recombinant adeno-associated virus 9 (scAAV9) encoding the CLN3 polypeptide set forth in SEQ ID NO: 1, wherein the genome of the scAAV9 comprises, in order from 5' to 3', a first AAV inverted terminal repeat, a P546 promoter comprising the sequence of SEQ ID NO: 3, a polynucleotide encoding the CLN3 polypeptide set forth in SEQ ID NO: 1, and a second AAV inverted terminal repeat. The polynucleotide encoding the CLN3 polypeptide can be at least 90% identical to SEQ ID NO: 2.

[0013] Also provided is an scAAV9 having a genome that, in the 5' to 3' order, comprises a first AAV inverted terminal repeat, a P546 promoter comprising the sequence of SEQ ID NO: 3, an SV40 intron, a polynucleotide encoding the CLN3 polypeptide of SEQ ID NO: 1, and a second AAV inverted terminal repeat; and an scAAV9 having a genome that, in the 5' to 3' order, comprises a first AAV inverted terminal repeat, a P546 promoter comprising the sequence of SEQ ID NO: 3, a polynucleotide encoding the CLN3 polypeptide of SEQ ID NO: 1, a bovine growth hormone polyadenylation polyA sequence, and a second AAV inverted terminal repeat. In an exemplary embodiment, the scAAV9 has a genome comprising the gene cassette set forth in SEQ ID NO: 4.

[0014] There is provided a single-stranded recombinant adeno-associated virus 9 (ssAAV9) encoding the CLN3 polypeptide set forth in SEQ ID NO: 1, wherein the genome of the ssAAV9 comprises, in the 5' to 3' order, a first AAV inverted terminal repeat, a P546 promoter comprising the sequence of SEQ ID NO: 3, a polynucleotide encoding the CLN3 polypeptide set forth in SEQ ID NO: 1, and a second AAV inverted terminal repeat. The polynucleotide encoding the CLN3 polypeptide can be at least 90% identical to SEQ ID NO: 2. Also provided are ssAAV9s having a genome that, in the 5' to 3' order, comprises a first AAV inverted terminal repeat, a P546 promoter comprising the sequence of SEQ ID NO: 3, an SV40 intron, a polynucleotide encoding the CLN3 polypeptide of SEQ ID NO: 1, and a second AAV inverted terminal repeat; and ssAAV9s having a genome that, in the 5' to 3' order, comprises a first AAV inverted terminal repeat, a P546 promoter comprising the sequence of SEQ ID NO: 3, a polynucleotide encoding the CLN3 polypeptide of SEQ ID NO: 1, a bovine growth hormone polyadenylation polyA sequence, and a second AAV inverted terminal repeat.

[0015] The nucleic acid sequence set forth in SEQ ID NO: 4 is the gene cassette provided in FIG. 1A. Provided is an rAAV9 having an scAAV9 genome or an ssAAV9 genome that includes a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 4, or at least 95% identical to the nucleic acid sequence of SEQ ID NO: 4, or at least 98% identical to the nucleic acid sequence of SEQ ID NO: 4.

[0016] Also provided is a nucleic acid molecule comprising a first AAV inverted terminal repeat, a P546 promoter comprising the sequence of SEQ ID NO: 3, a nucleic acid sequence encoding the CLN3 polypeptide of SEQ ID NO: 1, and a second AAV inverted terminal repeat. In some embodiments, the polynucleotide encoding the CLN3 polypeptide can be at least 90% identical to SEQ ID NO: 2.

[0017] Also provided is a nucleic acid molecule comprising a first AAV inverted terminal repeat, a P546 promoter comprising the nucleotide sequence of SEQ ID NO: 3, an SV40 intron, a nucleic acid sequence encoding the CLN3 polypeptide of SEQ ID NO: 1, and a second AAV inverted terminal repeat. Further provided is a polynucleotide comprising a first AAV inverted terminal repeat, a P546 promoter comprising the sequence of SEQ ID NO: 3, a nucleic acid encoding the CLN3 polypeptide of SEQ ID NO: 1, a bovine growth hormone polyadenylation polyA sequence, and a second AAV inverted terminal repeat. In any of the provided polynucleotides, the CLN3 polypeptide can be encoded by the nucleic acid sequence set forth in SEQ ID NO: 2, or a sequence that is at least 90% identical to SEQ ID NO: 2.

[0018] Provided is an rAAV9, scAAV9, or ssAAV9 comprising any of these polynucleotides. Also provided is an rAAV having a single-stranded genome.

[0019] Also provided are rAAV9 viral particles encoding a CLN3 polypeptide, wherein the rAAV9 genome comprises, in 5' to 3' order, a first AAV inverted terminal repeat, a P546 promoter comprising a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 3, a polynucleotide encoding a CLN3 polypeptide that is at least 90% identical to SEQ ID NO: 1, and a second AAV inverted terminal repeat. The provided rAAV9 particles may comprise a polynucleotide encoding a CLN3 polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 1. Additionally, the rAAV9 viral particles may comprise an AAV9 genome comprising a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 4, at least 95% identical to the nucleic acid sequence of SEQ ID NO: 4, or at least 98% identical to the nucleic acid sequence of SEQ ID NO: 4. Any of the rAAV9 viral particles may further comprise an SV40 intron and / or a BGH polyA sequence.

[0020] In any of the provided rAAV, ssAAV, and scAAV, the AAV inverted terminal repeat may be an AAV2 inverted terminal repeat.

[0021] Also provided is a nucleic acid molecule comprising an rAAV9 genome that comprises, in 5' to 3' order, a first AAV inverted terminal repeat, a P546 promoter comprising a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 3, and a polynucleotide encoding a CLN3 polypeptide that is at least 90% identical to SEQ ID NO: 1. The provided nucleic acid molecule may comprise a self-complementary genome or a single-stranded genome.

[0022] Also provided is a nucleic acid molecule comprising an rAAV9 genome that, in 5' to 3' order, includes a first AAV inverted terminal repeat, a P546 promoter comprising a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 3, a polynucleotide encoding a CLN3 polypeptide that is at least 90% identical to SEQ ID NO: 1, and a second AAV inverted terminal repeat. The provided nucleic acid molecule may comprise a polynucleotide encoding a CLN3 polypeptide comprising an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 1. Additionally, the nucleic acid molecule may comprise an AAV9 genome comprising a nucleic acid sequence that is at least 90% identical, at least 95% identical, or at least 98% identical to the nucleic acid sequence of SEQ ID NO: 4. Any of the provided nucleic acid molecules may further comprise an SV40 intron and / or a BGH polyA sequence.

[0023] Also provided is a composition comprising the scAAV9 described herein, the ssAAV9 described herein, the nucleic acid molecule described herein, or the rAAV viral particle described herein, and at least one pharmaceutically acceptable excipient. Optionally, the pharmaceutically acceptable excipient comprises a nonionic hypotonic compound, a buffer, a polymer, a salt, or a combination thereof. In some embodiments, the polymer is a copolymer. In some embodiments, the copolymer is a poloxamer. For example, the composition may comprise at least a pharmaceutically acceptable excipient comprising a nonionic hypotonic compound. For example, the pharmaceutically acceptable excipient may comprise from about 20% to 40% of a nonionic hypotonic compound, or from about 25% to about 35% of a nonionic hypotonic compound. An exemplary composition comprises scAAV formulated in 20 mM Tris (pH 8.0), 1 mM MgCl 2 2, 200 mM NaCl, 0.001% poloxamer 188, and from about 25% to about 35% of a nonionic hypotonic compound. Another exemplary composition comprises scAAV formulated in 1×PBS and 0.001% pluronic F68.

[0024] Also further provided is a method of treating CLN3-Batten disease in a subject, comprising administering to a subject a composition comprising a therapeutically effective amount of any of the rAAV9 viral particles disclosed herein, any of the scAAV9 disclosed herein, any of the ssAAV9 disclosed herein, any of the nucleic acid molecules described herein, or any of the compositions described herein.

[0025] In any of the provided methods, the composition, rAAV9, ssAAV9, scAAV9, and / or nucleic acid molecule is administered via a route selected from the group consisting of intrathecal, intraventricular, intracerebral, intravenous, and combinations thereof.

[0026] Use for the preparation of a medicament for the treatment of CLN3-Batten disease in a subject in need thereof, of any of a therapeutically effective amount of any of the rAAV9 viral particles disclosed herein, any of the scAAV9 disclosed herein, any of the ssAAV9 disclosed herein, any of the nucleic acid molecules described herein, or any of the compositions described herein.

[0027] Also further provided is a composition comprising a therapeutically effective amount of any of the rAAV9 viral particles disclosed herein, any of the scAAV9 disclosed herein, any of the ssAAV9 disclosed herein, any of the nucleic acid molecules described herein, or any of the compositions described herein for treating CLN3-Batten disease in a subject in need thereof.

[0028] Exemplary dosages of scAAV9, ssAAV9, or rAAV9 administered by the intramedullary route are from about 1×10¹¹ vg of scAAV9, ssAAV9, or rAAV9 viral particles per subject to about 2×10¹⁵ vg per subject, or from about 1×10¹¹ vg of scAAV9, ssAAV9, or rAAV9 viral particles per subject to about 1×10¹⁵ vg of scAAV9, ssAAV9, or rAAV9 viral particles per subject, or from about 1×10¹² vg of scAAV9, ssAAV9, or rAAV9 viral particles per subject to about 1×10¹⁴ vg of scAAV9, ssAAV9, or AAV9 viral particles per subject, or from about 1×10¹² vg of scAAV9, ssAAV9, or rAAV9 viral particles per subject to about 1×10¹⁵ vg of scAAV9, ssAAV9, or AAV9 viral particles per subject. For example, administer about 1×10¹³ vg of scAAV9, ssAAV9, or AAV9 viral particles per subject, or administer about 1.5×10¹³ of scAAV9, ssAAV9, or AAV9 viral particles per subject, or administer about 3.4×10¹³ of scAAV9, ssAAV9, or AAV9 viral particles per subject, or administer about 6×10¹³ vg of scAAV9, ssAAV9, or AAV9 viral particles per subject, or administer about 1.2×10¹⁴ of scAAV9, ssAAV9, or AAV9 viral particles per subject, or administer about 2×10¹⁴ of scAAV9, ssAAV9, or AAV9 viral particles per subject.

[0029] A method, agent or composition for treatment results in one or more of (a) a decrease or delay in lysosomal accumulation of autofluorescent storage material, (b) a decrease or delay in lysosomal accumulation of ATP synthase subunit C, (c) a decrease or delay in glial activation (astrocyte and / or microglia activation), (d) a decrease or delay in astrocytosis, (e) a decrease or delay in brain volume loss as measured by MRI, (f) a decrease or delay in the onset of seizures, and (g) stabilization, a decrease or delay in progression, or an improvement in one or more of the scales used to assess the progression and / or improvement of CLN3 Batten disease, such as the Unified Batten Disease Rating Scale (UBDRS) rating scale or the Hamburg motor and language scale, compared to a subject prior to treatment or an untreated CLN3-Batten disease patient. The subject can be maintained in the Trendelenburg position after administration of rAAV9, ssAAV9, or scAAV or a nucleic acid molecule disclosed herein.

[0030] Also further provided is a method of treating CLN3 disease in a subject in need of treatment, comprising delivering to the brain or spinal cord of a patient in need of treatment any one of the rAAV viruses disclosed herein, any one of the scAAV9 disclosed herein, any one of the ssAAV9 disclosed herein, any one of the nucleic acid molecules described herein, or any one of the compositions described herein or any one of the agents described herein.

[0031] In any of the methods or uses provided, the composition or agent can be delivered by intrathecal, intraventricular, intracerebral, or intravenous injection, or combinations thereof. Any of the methods provided can further include placing the patient in the Trendelenburg position after intrathecal injection of the composition, rAAV9 virus particles or scAAV or nucleic acid molecule disclosed herein.

[0032] In any of the methods or uses provided, the composition or agent may include a nonionic low-osmolar contrast agent. For example, the composition may include a nonionic low-osmolar contrast agent selected from the group consisting of iobitridol, iohexol, iomeprol, iopamidol, iopentol, iopromide, ioversol, ioxilan, and combinations thereof.

[0033] The administered composition or agent may include a pharmaceutically acceptable excipient. For example, the pharmaceutically acceptable excipient may include from about 20% to 40% of a nonionic low-osmolar compound, or from about 25% to about 35% of a nonionic low-osmolar compound. An exemplary composition includes scAAV formulated in 20 mM Tris (pH 8.0), 1 mM MgCl 2 , 200 mM NaCl, 0.001% poloxamer 188, and from about 25% to about 35% of a nonionic low-osmolar compound. Another exemplary composition includes scAAV formulated in 1×PBS and 0.001% pluronic F68.

[0034] In any of the methods or uses provided, when the composition or agent is delivered to the brain or spinal cord, the composition may be delivered to the brainstem, or to the cerebellum, or to the visual cortex, or to the motor cortex. Further, in any of the methods or uses provided, when the composition or agent is delivered to the brain or spinal cord, the composition may be delivered to neurons, glial cells, or both. For example, delivery to the brain or spinal cord includes delivery to cells of the nervous system such as neurons, lower motor neurons, microglial cells, oligodendrocytes, astrocytes, Schwann cells, or combinations thereof.

[0035] The method, use, or administration of the composition or agent results in one or more of (a) a decrease or delay in lysosomal accumulation of autofluorescent storage material, (b) a decrease or delay in lysosomal accumulation of ATP synthase subunit C, (c) a decrease or delay in glial activation (astrocyte and / or microglia) activation, (d) a decrease or delay in astrocytosis, (e) a decrease or delay in brain volume loss as measured by MRI, (f) a decrease or delay in the onset of seizures, and (g) stabilization, a decrease or delay in progression, or an improvement in one or more of the measures used to assess the progression and / or improvement of CLN3 Batten disease, such as the Unified Batten Disease Rating Scale (UBDRS) rating scale or the Hamburg motor and language scale, as compared to a subject before treatment or an untreated subject.

[0036] The headings in this specification are for the convenience of the reader and are not intended to be limiting.

[0037] The use of "may" and "can" in this specification is for the purpose of describing the various embodiments included in the claims and is not for the purpose of indicating uncertainty about the scope of the claims.

Brief Description of the Drawings

[0038]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

Figure 20

Figure 21

Figure 22

Figure 23

Figure 24

Figure 25

Figure 26

Figure 27

Figure 28

Figure 29

Figure 30

Figure 31

Figure 32

Figure 33

Figure 34

Figure 35

Figure 36

Figure 37

Figure 38

Mode for Carrying Out the Invention

[0039] The present disclosure provides methods and products for treating CLN3-Batten disease. The methods involve delivering a CLN3 polynucleotide to a subject using rAAV as a gene delivery vector.

[0040] Adeno-associated virus (AAV) is a replication-defective parvovirus, and its single-stranded DNA genome is approximately 4.7 kb in length, including 145-nucleotide inverted terminal repeats (ITRs), and can be used to refer to the virus itself or its derivatives. This term encompasses all subtypes and both naturally occurring and recombinant forms, unless otherwise specified. There are multiple serotypes of AAV. Each serotype of AAV is associated with a specific clade, and its members share serological and functional similarities. Thus, AAV may be referred to by its clade. For example, the AAV9 sequence is called the "clade F" sequence (Gao et al., J. Virol., 78:6381-6388 (2004)). The present disclosure contemplates the use of any sequence within a specific clade, such as clade F. The nucleotide sequences of the genomes of AAV serotypes are known. For example, the complete genome of AAV-1 is provided in GenBank accession number NC_002077, the complete genome of AAV-2 is provided in GenBank accession numbers NC_001401 and Srivastava et al., J. Virol., 45:555-564 (1983), the complete genome of AAV-3 is provided in GenBank accession number NC_1829, the complete genome of AAV-4 is provided in GenBank accession number NC_001829, the AAV-5 genome is provided in GenBank accession number AF085716, the complete genome of AAV-6 is provided in GenBank accession number NC_001862, at least a part of the genomes of AAV-7 and AAV-8 are provided in GenBank accession numbers AX753246 and AX753249, respectively, the AAV-9 genome is provided in Gao et al., J. Virol., 78:6381-6388 (2004), the AAV-10 genome is provided in Mol. Ther., 13(1):67-76 (2006), the AAV-11 genome is provided in Virology, 330(2):375-383 (2004), a part of the AAV-12 genome is provided in GenBank accession number DQ813647, and a part of the AAV-13 genome is provided in GenBank accession number EU285562.The sequence of the AAV rh.74 genome is provided in U.S. Patent No. 9,434,928, which is incorporated herein by reference. The sequence of the AAV-B1 genome is provided in Choudhury et al., Mol. The., 24(7):1247-1257(2016). Cis-acting sequences that direct viral DNA replication (rep), capsid formation / packaging, and host cell chromosome integration are contained within the ITRs. Three AAV promoters (named p5, p19, and p40 relative to their relative map positions) drive the expression of two AAV internal open reading frames encoding the rep and cap genes. Differential splicing of a single AAV intron (at nucleotides 2107 and 2227), in combination with two rep promoters (p5 and p19), results in the production of four rep proteins (rep78, rep68, rep52, and rep40) from the rep gene. The rep proteins have multiple enzymatic properties that ultimately participate in the replication of the viral genome. The cap gene is expressed from the p40 promoter and encodes three capsid proteins, VP1, VP2, and VP3. Alternative splicing and non-consensus translation initiation sites are involved in the production of the three related capsid proteins. A single consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are reviewed in Muzyczka, Current Topics in Microbiology and Immunology, 158:97-129(1992).

[0041] AAV has unique features that make it attractive as a vector for delivering foreign DNA into cells, for example, in gene therapy. AAV infection of cells in culture is non-cytopathic, and natural infection in humans and other animals is silent and asymptomatic. Furthermore, AAV can infect many mammalian cells and enables the potential to target many different tissues in vivo. Additionally, AAV can transduce both slowly dividing and non-dividing cells and can persist essentially throughout the lifetime of those cells as a transcriptionally active nuclear episome (extrachromosomal element). The native AAV proviral genome is infectious as cloned DNA in a plasmid that enables the construction of recombinant genomes. Further, since the signals that direct AAV replication, genome capsid formation, and integration are contained within the ITRs of the AAV genome, it can be contacted with foreign DNA such as a promoter, DNA of interest, and a gene cassette containing a polyadenylation signal that can replace some or all of the approximately 4.3 kb internal of the genome (encoding the replication and structural capsid proteins, rep-cap). In some cases, the rep and cap proteins are provided in trans. Another important feature of AAV is that it is a very stable and robust virus. This easily withstands the conditions (several hours at 56 °C to 65 °C) used to inactivate adenovirus and reduces the importance of cryopreservation of AAV. AAV can be lyophilized. Finally, AAV-infected cells are not resistant to superinfection.

[0042] As used herein, the term "AAV" refers to wild-type AAV virus or viral particles. The terms "AAV", "AAV virus", and "AAV viral particles" are used interchangeably herein. The term "rAAV" refers to recombinant AAV virus or recombinant infectious encapsulated viral particles. The terms "rAAV", "rAAV virus", and "rAAV viral particles" are used interchangeably herein.

[0043] The term "rAAV genome" refers to a polynucleotide sequence derived from a native AAV genome that has been modified. In some embodiments, the rAAV genome has been modified to remove the native cap and rep genes. In some embodiments, the rAAV genome includes endogenous 5' and 3' inverted terminal repeats (ITRs). In some embodiments, the rAAV genome includes ITRs from an AAV serotype different from the AAV serotype from which the AAV genome is derived. In some embodiments, the rAAV genome includes a transgene of interest (e.g., a polynucleotide encoding CLN3) flanked at the 5' and 3' ends by inverted terminal repeats (ITRs). In some embodiments, the rAAV genome includes a "gene cassette". Exemplary gene cassettes are described in FIG. 1A and the nucleic acid sequence of SEQ ID NO: 4. The rAAV genome can be a self-complementary (sc) genome referred to herein as an "scAAV genome". Alternatively, the rAAV genome can be a single-stranded (ss) genome referred to herein as an "ssAAV genome".

[0044] The term "scAAV" refers to an rAAV virus or rAAV viral particle that includes a self-complementary genome. The term "ssAAV" refers to an rAAV virus or rAAV viral particle that includes a single-stranded genome.

[0045] The rAAV genomes provided herein can include a polynucleotide encoding a CLN3 polypeptide. The CLN3 polypeptide includes the amino acid sequence set forth in SEQ ID NO: 1 or has an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence set forth in SEQ ID NO: 1 and encodes a polypeptide having CLN3 activity (e.g., an increase in the clearance of lysosomal autofluorescent storage material, a decrease in the lysosomal accumulation of ATP synthase subunit C, and / or a decrease in the activation of astrocytes and microglia in a patient when treated compared to the patient before treatment, among others).

[0046] The rAAV genomes provided herein optionally include a polynucleotide encoding a CLN3 polypeptide, which polynucleotide comprises the nucleotide sequence set forth in SEQ ID NO:2 or is a polynucleotide that is at least 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence set forth in SEQ ID NO:2 and encodes a polypeptide having CLN3 activity (e.g., an increase in clearance of lysosomal autofluorescent storage material, a decrease in lysosomal accumulation of ATP synthase subunit C, and at least one of a decrease in activation of astrocytes and microglia in a patient when treated as compared to the patient prior to treatment).

[0047] In some embodiments, the rAAV genomes provided herein encode a polypeptide having CLN3 activity and include a polynucleotide sequence that hybridizes under stringent conditions to the nucleic acid sequence of SEQ ID NO:2, or its complement. The term "stringent" is used to refer to conditions generally understood in the art as being stringent. Hybridization stringency is determined primarily by temperature, ionic strength, and the concentration of denaturing agents such as formamide. Examples of stringent conditions for hybridization and washing are 0.015 M sodium chloride, 0.0015 M sodium citrate at 65 - 68°C, or 0.015 M sodium chloride, 0.0015 M sodium citrate, and 50% formamide at 42°C. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, (Cold Spring Harbor, N.Y. 1989).

[0048] The rAAV genomes provided herein, in some embodiments, include one or more AAV ITRs adjacent to a polynucleotide encoding a CLN3 polypeptide. The CLN3 polynucleotide is operably linked to transcriptional control elements (including, but not limited to, promoters, enhancers and / or polyadenylation signal sequences) that are functional within the target cell to form a gene cassette. Examples of promoters are the chicken β-actin promoter and the P546 promoter. Additional promoters contemplated herein include, but are not limited to, the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus immediate early promoter, Rous sarcoma virus promoter, and human gene promoters (e.g., but not limited to, actin promoter, myosin promoter, elongation factor-1a promoter, hemoglobin promoter, and creatine kinase promoter). Further provided herein is the P546 promoter sequence set forth in SEQ ID NO: 3, a promoter having P546 transcriptional promoting activity, and a promoter sequence that is at least 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence set forth in SEQ ID NO: 3. Other examples of transcriptional control factors are tissue-specific control factors, e.g., promoters that allow for specific expression within neurons or that allow for specific expression within astrocytes. Examples include the neuron-specific enolase and glial fibrillary acidic protein promoters. Inducible promoters are also contemplated. Non-limiting examples of inducible promoters include, but are not limited to, the metallothionein promoter, glucocorticoid promoter, progesterone promoter, and tetracycline-regulated promoter.The gene cassette may also contain intron sequences that facilitate the processing of the CLN3 RNA transcript when expressed in mammalian cells. An example of such an intron is the SV40 intron. "Packaging" refers to a series of intracellular events that result in the assembly and capsid formation of AAV particles. The term "production" refers to the process of producing rAAV (infectious, encapsulated rAAV particles) by producer cells.

[0049] The AAV "rep" and "cap" genes refer to polynucleotide sequences that encode the replication protein and capsid-forming protein of adeno-associated virus, respectively. AAV rep and cap are referred to herein as AAV "packaging genes".

[0050] A "helper virus" for AAV refers to a virus that enables AAV (e.g., wild-type AAV) to be replicated and packaged by mammalian cells. A variety of such helper viruses for AAV, including adenoviruses, herpesviruses, and poxviruses such as vaccinia virus, are known in the art. Adenoviruses can include several different subgroups, but adenovirus type 5 of subgroup C is most commonly used. Numerous adenoviruses of human, non-human mammalian, and avian origin are known and are available from depository institutions such as the ATCC. Herpesviridae viruses include, for example, herpes simplex virus (HSV) and Epstein-Barr virus (EBV), as well as cytomegalovirus (CMV) and pseudorabies virus (PRV), and these are also available from depository institutions such as the ATCC.

[0051] The "helper virus function" refers to a function encoded by a helper virus genome that enables AAV replication and packaging (in conjunction with other requirements for replication and packaging described herein). As described herein, the "helper virus function" can be provided in many ways, including by providing a helper virus or by providing, for example, a polynucleotide sequence encoding the required function in trans to producer cells.

[0052] The rAAV genomes provided herein lack AAV rep and cap DNA. The AAV DNA within the rAAV genomes contemplated herein (e.g., ITRs) can be from any AAV serotype suitable for deriving recombinant viruses, including, but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV rh.74, and AAV-B1. As described above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art. rAAVs with capsid mutations are also contemplated. See, e.g., Marsic et al., Molecular Therapy, 22(11):1900-1909 (2014). Modified capsids are also contemplated herein, including capsids with various post-translational modifications such as glycosylation and deamidation. Deamidation of asparagine or glutamine side chains to convert asparagine residues to aspartic acid or isoaspartic acid residues, and conversion of glutamine to glutamic acid or isoglutamic acid, are contemplated in the rAAV capsids provided herein. See, e.g., Giles et al., Molecular Therapy, 26(12):2848-2862 (2018). The modified capsids herein are also contemplated to include targeting sequences that direct rAAV to diseased tissues and organs in need of treatment.

[0053] The DNA plasmids provided herein contain the rAAV genomes described herein. The DNA plasmids are introduced into cells permissive to infection by an AAV helper virus (e.g., an adenovirus, an E1-deleted adenovirus, or a herpesvirus) to assemble the rAAV genome into infectious virus particles using the AAV9 capsid protein. Techniques for producing rAAV in which the rAAV genome to be packaged, the rep and cap genes, and the helper virus functions are provided to the cells are standard in the art. Production of rAAV particles requires that the following components, the rAAV genome, AAV rep and cap genes separated from the rAAV genome (i.e., not present therein), and the helper virus functions, be present within a single cell (referred to herein as a packaging cell). The rep and cap genes of AAV may be derived from any AAV serotype from which the recombinant virus may be derived, and may be derived from an AAV serotype different from the rAAV genome ITR. Generation of pseudotyped rAAV is disclosed, for example, in WO01 / 83692, which is incorporated herein by reference in its entirety. In various embodiments, the AAV capsid protein may be modified to enhance delivery of recombinant rAAV. Modifications to the capsid protein are generally known in the art. See, for example, US2005 / 0053922 and US2009 / 0202490, the entire disclosures of which are incorporated herein by reference.

[0054] The method of generating packaging cells is to create a cell line that stably expresses all the components necessary for the production of rAAV. For example, a plasmid (or plasmids) containing an rAAV genome lacking the AAV rep and cap genes, AAV rep and cap genes separated from the rAAV genome, and a selectable marker such as the neomycin resistance gene may be integrated into the genome of the cells. The rAAV genome may be introduced into a bacterial plasmid by procedures such as GC tailing (Samulski et al., 1982, Proc. Natl. Acad. Sci. USA, 79:2077-2081), addition of a synthetic linker containing a restriction endonuclease cleavage site (Laughlin et al., 1983, Gene, 23:65-73), or direct blunt-end ligation (Senapathy & Carter, 1984, J. Biol. Chem., 259:4661-4666). Subsequently, the packaging cell line can be infected with a helper virus such as adenovirus. The advantage of this method is that the cells are selectable and suitable for large-scale production of rAAV. Another example of a suitable method is to use an adenovirus or baculovirus instead of a plasmid to introduce the rAAV genome and / or the rep and cap genes into the packaging cells.

[0055] The general principles of rAAV particle production are outlined, for example, in Carter, 1992, Current Opinions in Biotechnology, 1533 - 539, and Muzyczka, 1992, Curr. Topics in Microbial. and Immunol., 158:97 - 129). Various approaches are described in Ratschin et al., Mol. Cell. Biol. 4:2072 (1984), Hermonat et al., Proc. Natl. Acad. Sci. USA, 81:6466 (1984), Tratschin et al., Mo1. Cell. Biol. 5:3251 (1985), McLaughlin et al., J. Virol., 62:1963 (1988), and Lebkowski et al., 1988 Mol. Cell. Biol., 7:349 (1988), Samulski et al. (1989, J. Virol., 63:3822 - 3828), U.S. Patent No. 5,173,414, WO95 / 13365 and corresponding U.S. Patent No. 5,658,776, WO95 / 13392, WO96 / 17947, PCT / US98 / 18600, WO97 / 09441 (PCT / US96 / 14423), WO97 / 08298 (PCT / US96 / 13872), WO97 / 21825 (PCT / US96 / 20777), WO97 / 06243 (PCT / FR96 / 01064), WO99 / 11764, Perrin et al. (1995) Vaccine 13:1244 - 1250, Paul et al. (1993) Human Gene Therapy 4:609 - 615, Clark et al. (1996) Gene Therapy 3:1124 - 1132, U.S. Patent No. 5,786,211, U.S. Patent No. 5,871,982, and U.S. Patent No. 6,258,595. The foregoing documents are hereby incorporated by reference in their entirety, and the portions of the documents relating to rAAV particle production are particularly emphasized.

[0056] Also provided herein are packaging cells that produce infectious rAAV particles. In one embodiment, the packaging cells can be stably transformed cancer cells such as HeLa cells, 293 cells, and PerC.6 cells (a 293-derived cell line). In another embodiment, the packaging cells can be cells that are not transformed cancer cells, such as low passage 293 cells (human fetal kidney cells transformed with adenovirus E1), MRC-5 cells (human fetal fibroblasts), WI-38 cells (human fetal fibroblasts), Vero cells (monkey kidney cells), and FRhL-2 cells (African green monkey fetal lung cells).

[0057] Also provided herein are rAAVs (e.g., infectious encapsidated rAAV particles) that contain the rAAV genome of the present disclosure. The genome of the rAAV lacks AAV rep and cap DNA, i.e., there is no AAV rep or cap DNA between the ITRs of the rAAV genome. The rAAV genome can be a self-complementary (sc) genome. rAAV having an sc genome is referred to herein as scAAV. The rAAV genome can be a single-stranded (ss) genome. rAAV having an ss genome is referred to herein as ssAAV.

[0058] An exemplary rAAV provided herein is an scAAV designated "scAAV9.P546.CLN3". The scAAV9.P546.CLN3 scAAV contains an scAAV genome that includes the human CLN3 cDNA under the control of the P546 promoter (SEQ ID NO: 3). The scAAV genome also includes an SV40 intron (upstream of the human CLN3 cDNA) and a bovine growth hormone polyadenylation (BGH polyA) terminator sequence (downstream of the human CLN3 cDNA). The sequence of this scAAV9.P546.CLN3 gene cassette is set forth in SEQ ID NO: 4. The scAAV genome is packaged in an AAV9 capsid and includes AAV2 ITRs (one ITR is upstream of the P546 promoter and the other ITR is downstream of the BGH polyA terminator sequence).

[0059] rAAV can be purified by standard methods in the art, e.g., by column chromatography or cesium chloride gradient. Methods for purifying rAAV vectors from helper virus are known in the art and can include, for example, the methods disclosed in Clark et al., Hum. Gene Ther., 10(6):1031-1039 (1999), Schenpp and Clark, Methods Mol. Med., 69:427-443 (2002), U.S. Patent No. 6,566,118, and WO98 / 09657.

[0060] Compositions comprising rAAV are also provided. The compositions comprise rAAV encoding a CLN3 polypeptide. The compositions can comprise two or more rAAV encoding different polypeptides of interest. In some embodiments, the rAAV is scAAV or ssAAV.

[0061] The compositions provided herein comprise rAAV and one or more pharmaceutically acceptable excipients. Acceptable excipients are non-toxic to the recipient, and preferably are inert at the dosages and concentrations employed, and include buffers such as phosphates [e.g., phosphate buffered saline (PBS)], citrates, or other organic acids; antioxidants such as ascorbic acid; low molecular weight polypeptides; proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrin; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or nonionic surfactants such as Tween, copolymers such as poloxamer 188, pluronics (e.g., pluronic F68) or polyethylene glycol (PEG), but are not limited thereto. The compositions provided herein can include a pharmaceutically acceptable aqueous excipient containing a nonionic hypoosmotic compound such as iodixanol, iohexol, iomeprol, iopamidol, iopentol, iopromide, ioversol, or ioxilan, and the aqueous excipient containing the nonionic hypoosmotic compound can have one or more of the following properties: a weight osmolality by vapor pressure osmometry of about 180 mgl / mL, about 322 mOsm / kg water, a volume osmolality of about 273 mOsm / L, an absolute viscosity of about 2.3 cp at 20° C. and about 1.5 cp at 37° C., and a specific gravity of about 1.164 at 37° C. Exemplary compositions include about 20-40% nonionic hypoosmotic compound, or about 25%-about 35% nonionic hypoosmotic compound. Exemplary compositions are formulated in 20 mM Tris (pH 8.0), 1 mM MgCl 2 , 200 mM NaCl, 0.001% poloxamer 188, and contain scAAV or rAAV viral particles formulated in about 25%-about 35% nonionic hypoosmotic compound. Another exemplary composition includes scAAV formulated in 1×PBS and 0.001% pluronic F68.

[0062] The dosage of rAAV administered by the methods of the present disclosure will vary, for example, depending on the particular rAAV, mode of administration, timing of administration, treatment goal, individual, and targeted cell type, and can be determined by standard methods in the art. The dosage may be expressed in units of viral genome (vg). Dosages contemplated herein are about 1×10 11 to about 1×10 12 to about 1×10 13 to about 1.1×10 13 to about 1.2×10 13 to about 1.3×10 13 to about 1.5×10 13 to about 2×10 13 to about 2.5×10 13 to about 3×10 13 to about 3.4×10 13 to about 3.5×10 13 to about 4×10 13 to about 4.5×10 13 to about 5×10 13 to about 6×10 13 to about 1×10 14 to about 1.2×10 14 to about 2×10 14 to about 3×10 14 to about 4×10 14 to about 5×10 14 to about 1×10 15 to about 1×10 16 and up to, or more than, total viral genomes. Dosages of about 1×10 11 to about 1×10 15 vg, about 1×10 12 to about 1×10 15 vg, about 1×10 12 to about 1×10 14 vg, about 1×10 13 to about 6×10 14 vg, and about 6×10 13 to about 1.2×10 14 vg are also contemplated. The dosage exemplified herein is 6×10 13 vg. Other dosages exemplified herein are 1.2×10 14 .

[0063] Provided is a method of transducing a target cell (including, but not limited to, cells of the nervous system, neurons, or glial cells). Cells of the nervous system include neurons, lower motor neurons, microglial cells, oligodendrocytes, astrocytes, Schwann cells, or combinations thereof.

[0064] The term "transduction" is used to refer to the administration / delivery of a CLN3 polynucleotide to a target cell, either in vivo or in vitro, via a replication-deficient rAAV of the present disclosure that results in the expression of a functional polypeptide by the recipient cell. Transduction of cells by the rAAV of the present disclosure results in the sustained expression of a polypeptide or RNA encoded by the rAAV. Accordingly, the present disclosure provides a method of administering / delivering an rAAV encoding a CLN3 polypeptide to a subject via an intrathecal, intraventricular, intracerebral, or intravenous route, or any combination thereof. Intrathecal delivery refers to delivery into the space under the arachnoid membrane of the brain or spinal cord. In some embodiments, intrathecal administration is by cisternal administration.

[0065] Intrathecal administration is exemplified herein. These methods include transducing one or more of the rAAVs described herein into a target cell (including, but not limited to, neurons and / or glial cells). In some embodiments, rAAV viral particles comprising a polynucleotide encoding a CLN3 polypeptide are administered or delivered to a patient's brain and / or spinal cord. In some embodiments, the polynucleotide is delivered to the brain. Regions of the brain where delivery is contemplated include, but are not limited to, the motor cortex, visual cortex, cerebellum, and brainstem. In some embodiments, the polynucleotide is delivered to the spinal cord. In some embodiments, the polynucleotide is delivered to a neuron or lower motor neuron. The polynucleotide can be delivered to neurons and glial cells. Glial cells are microglial cells, oligodendrocytes, or astrocytes. In some embodiments, the polynucleotide is delivered to Schwann cells.

[0066] In some embodiments of the methods provided herein, the patient is maintained in the Trendelenburg position (head down position) for a period of time (e.g., about 5, about 10, about 15, or about 20 minutes) after administration of rAAV. For example, the patient may be tilted at a head down position by about 1 degree to about 30 degrees, about 15 to about 30 degrees, about 30 to about 60 degrees, about 60 to about 90 degrees, or about 90 to about 180 degrees.

[0067] The methods provided herein include administering an effective dose or effective multiple doses of a composition comprising the rAAV provided herein to a subject in need thereof (e.g., an animal including, but not limited to, a human patient). When the dose is administered prior to the onset of CLN3-Batten disease, the administration is prophylactic. When the dose is administered after the onset of CLN3-Batten disease, the administration is therapeutic. An effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the disease, delays or prevents progression of the disease, reduces the extent of the disease, brings about remission (partial or complete) of the disease, and / or prolongs survival. Compared to a subject prior to treatment or to an untreated subject, the methods provided herein result in stabilization, decreased progression, or improvement of one or more of the measures used to assess progression and / or improvement of CLN3 Batten disease, such as the Unified Batten Disease Rating Scale (UBDRS) or the Hamburg Motor and Language Scale. The UBDRS assessment scale (Marshall et al., Neurology. 2005 65(2):275-279) [including the UBDRS Physical Assessment Scale, UBDRS Seizure Assessment Scale, UBDRS Behavioral Assessment Scale, UBDRS Functional Ability Assessment Scale, UBDRS Symptom Presentation Order, and UBDRS Clinical Global Impression (CGI)], and the Pediatric Quality of Life Scale (PEDSQOL) measure motor function, language function, cognitive function, and survival. Compared to a subject prior to treatment or to an untreated subject, the methods provided herein result in one or more of the following: a decrease or delay in lysosomal accumulation of autofluorescent storage material, a decrease or delay in lysosomal accumulation of ATP synthase subunit C, a decrease or delay in glial activation (astrocyte and / or microglia) activation, a decrease or delay in astrocytosis, and a decrease or delay in brain volume loss as measured by MRI.

[0068] Combination therapies are also provided. The combinations used herein include either simultaneous or sequential treatment. Combinations of the methods described herein with standard drug therapies are specifically contemplated. Further, combinations of compositions for use according to the invention (e.g., a combination of scAAV9.P546.CLN3 and a contrast agent disclosed herein) (either simultaneous or sequential treatment) are specifically contemplated.

[0069] Delivery to subjects requiring postnatal delivery is contemplated, but intrauterine delivery to the fetus is also contemplated.

Examples

[0070] The following examples illustrate specific embodiments, but it will be understood by those skilled in the art that variations and modifications will occur. Accordingly, only such limitations as are found in the claims should be imposed on the invention.

[0071] In the example, self-complementary AAV carrying CLN3 cDNA under the control of the P546 promoter (designated scAAV9.P546.CLN3) was produced. The P546 promoter is a truncated form of the MeCP2 promoter and allows for transgene expression at moderate levels in both neurons and astrocytes. The efficacy of this gene therapy vector was tested in a CLN3 Δex7 / 8 knock-in mouse model having the mutation most frequently seen in human patients. The safety and efficacy of scAAV9.P546.CLN3 were evaluated in vivo in a CLN3 Δex7 / 8 knock-in mouse model, wild-type mice, and non-human primates. Data from mice and non-human primates clearly demonstrate efficient transduction of astrocytes and neurons throughout the brain and spinal cord, including deep brain structures such as the thalamus, hippocampus, striatum, amygdala, medulla, and cerebellum.

[0072] Example 1 Production of scAAV9.P546.CLN3 DNA containing the open reading frame of human CLN3 (SEQ ID NO: 2) between two Not1 restriction sites was synthesized by Eurofin Genomics, USA and then inserted into a double-stranded AAV2-ITR-based production plasmid. A schematic diagram of the plasmid construct showing the CLN3 DNA inserted between the AAV2 ITRs [the 5’ ITR was modified as previously described in McCarty et al., Gene Therapy 8:1248-1254 (2001) such that scAAV was generated] is shown in Figure 1. The plasmid construct also contains the P546 promoter, the SV40 chimeric intron, and the bovine growth hormone (BGH) polyadenylation signal.

[0073] scAAV9.P546.CLN3 was produced under cGMP conditions by transient triple plasmid transfection method using a double-stranded AAV2-ITR-based production plasmid together with the adenoviral helper plasmid pHelper (Stratagene, Santa Clara, CA) in HEK293 cells and a plasmid encoding the Rep2Cap9 sequence (as described in [Gao et al., J. Virol., 78:6381-6388 (2004)]). The virus was purified by two cesium chloride density gradient purification steps, dialyzed against PBS, formulated with 0.001% Pluronic-F68 to prevent virus aggregation, and stored at 4°C. All scAAV preparations were titrated by quantitative PCR using Taq-Man technology. The purity of scAAV was evaluated by 4-12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and silver staining (Invitrogen, Carlsbad, CA).

[0074] Example 2 CLN3 Δex7 / 8 Long-term efficacy study of scAAV9.P546.CLN3 delivered by CSF in mice Cell targeting and expression To confirm the expression and in vivo distribution of virus-introduced human CLN3 in mice, scAAV9.P546.CLN3 was formulated in 1×PBS and 0.001% Pluronic F68, or in 20 mM Tris (pH 8.0), 1 mM MgCl2, 200 mM NaCl, 0.001% poloxamer 188, and administered to CLN3 Δex7 / 8 mice by intracerebroventricular (ICV) injection within 36 hours after birth, and the expression was monitored at various time points. Wild-type mice injected with an equal volume of PBS and CLN3 Δex7 / 8 mice were used as controls. The effective dose was 2.2×10 10 vg / mouse using the NCH virus vector core titer.

[0075] To obtain a detailed in-brain distribution profile, RNAscope in situ hybridization technology was used to specifically identify human CLN3 mRNA in the brain, cervical spinal cord, thoracic spinal cord, and lumbar spinal cord. This technology involves using RNA in situ hybridization with specific probes to detect only the human transgene encoded by scAAV9. Strong signals were observed in CLN3 Δex7 / 8 mice injected with scAAV9.P546.CLN3, particularly in the cortex (regions A - C) at 4 and 6 months after injection, compared with no signal in the PBS-injected control. Analysis demonstrated that the AAV9-delivered CLN3 transgene was expressed at appropriate levels in various regions of the brain, including the cortex, thalamus, hindbrain, cerebellum, and spinal cord. In the cerebellum, the signal was particularly strong in Purkinje neurons. Transgene expression was also detected by reverse transcription PCR in all regions of the brain and spinal cord at 4 and 6 months (Figure 2).

[0076] In summary, CLN3 Δex7 / 8Reverse transcription PCR data and RNAscope analysis performed on tissues from mice confirmed that a single ICV injection of scAAV9.P546.CLN3 resulted in successful targeting and expression of human CLN3 for up to 6 months post-injection throughout the brain and spinal cord. This confirms the validity of ICV-mediated delivery of scAAV9 for specifically targeting cells that are disproportionately involved in the etiology of CLN3-Batten disease. CLN3 Δex7 / 8 Expression data in the mouse model were further confirmed in studies in wild-type mice using the same primers for detection of the human transgene by quantitative RT-PCR.

[0077] Improvement of pathology after delivery of scAAV9.P546.CLN3 Accumulation of autofluorescent storage material (ASM) Accumulation of autofluorescent storage material (ASM) is a characteristic histological marker for the progression of Batten disease (Mole et al., Biochim Biophys Acta-Mol Basis Dis. 2015;1852(10):2237-2241, Cotman et al., Clin Lipidol. 2012 Feb;7(1):79-91, Seehafer et al., Neurobiol Aging. 2006;27:576-588). Accumulation of ASM is a powerful indicator of disease progression for many forms of Batten disease (Bosch et al., J Neurosci. 2016;36(37):9669-9682, Morgan et al., PloS One. 2013;8(11):e78694). In the present specification, a decrease in ASM is contemplated to be used as an indicator of treatment success. ASM is one of the earliest detectable disease signs of CLN3-Batten disease and was already seen in multiple brain regions of mice at 2 months of age (Figure 3). Δex7 / 8 already seen in multiple brain regions of mice (Figure 3).

[0078] Automated quantification of the fluorescent pixel area was performed on 2-month-old scAAV9.P546.CLN3-injected CLN3 Δex7 / 8A significant decrease in the accumulation of ASM in the somatosensory cortex and thalamus was confirmed in mice. At this initial time point, higher variability in ASM accumulation in the motor cortex and visual cortex was observed in PBS-treated CLN3 Δex7 / 8 mice, so the statistical power of the analysis was lower for these two regions. At 4 and 6 months after injection, all four brain regions showed a highly significant decrease in ASM accumulation compared to PBS-treated CLN3 Δex7 / 8 mice (Figure 4). When comparing scAAV9.P546.CLN3-injected CLN3 Δex7 / 8 mice to wild-type animals, slightly higher ASM levels were found in the somatosensory and visual cortices of scAAV9.P546.CLN3-injected CLN3 Δex7 / 8 mice at 4 months after injection, while no significant difference was found between the motor cortex and thalamus of wild-type and scAAV9.P546.CLN3-injected CLN3 Δex7 / 8 mice. At 6 months after injection, all regions showed comparable low levels of ASM in wild-type mice and scAAV9.P546.CLN3-treated CLN3 Δex7 / 8 mice, which were much lower compared to PBS-treated CLN3 Δex7 / 8 mice, and long-term persistence and highly efficient reduction in ASM accumulation were confirmed (p≤0.0001). p≤0.0001 for all except the visual cortex at 4 months after injection (p≤0.001) and the motor cortex at 6 months after injection (p≤0.001) between PBS and scAAV9.P546.CLN3-treated animals (N = 10 per group).

[0079] Accumulation of the mitochondrial protein ATP synthase subunit C Wild-type and CLN3 Δex7 / 8 Brain tissues from wild-type and CLN3 Δex7 / 8In mice, accumulation of subunit C became apparent by 4 months of age in the posterior medial ventral nucleus and posterior lateral ventral nucleus (VPM / VPL region) of the thalamus, which are brain regions that are often affected early in the NCL mouse model (Morgan et al., PLoS One. 2013;8(11):e78694, Pontikis et al., Neurobiol Dis. 2005;20(3):823 - 836). Untreated animals showed strong signals for accumulated ATP synthase subunit C in the somatosensory cortex and the VPM / VPL region of the thalamus, while scAAV9.P546.CLN3 - treated animals showed minimal signals comparable to wild - type animals at both 4 and 6 months after injection (Figure 5) (p ≤ 0.0001 between PBS and scAAV9.P546.CLN3 - treated animals).

[0080] Activation of glial cells and astrocytes In addition to abnormal accumulation of storage material and accumulation of ATP synthase subunit C, other histological markers of disease progression in both human patients and animal models include activation of astrocytes and microglia (Cotman et al., Hum Mol Genet. 2002;11(22):2709 - 2721, Morgan et al., PLoS One. 2013;8(11):e78694, Pontikis et al., Neurobiol Dis. 2005;20(3):823 - 836, Palmer et al., Am J Med Genet. 1992;42(4):561 - 567). In particular, reactive microglia are primed to release pro - inflammatory mediators such as IL1 - β26, which can be a major cause of neuronal cell death in the late stages of CLN3 - Batten disease. Activated astrocytes were identified in VPM / VPL of the thalamus and somatosensory cortex sections by staining for glial fibrillary acidic protein (GFAP) at 4 and 6 months. For the somatosensory cortex, quantification was performed in the barrel cortex within cortical layer IV of the somatosensory cortex. Representative images at 6 months after injection are shown in Figure 6.

[0081] Quantification at 4 and 6 months after treatment of the GFAP-positive area showed that astrocyte activation was significantly reduced in both brain regions of scAAV9.P546.CLN3-injected CLN3 Δex7 / 8 mice compared to PBS-injected CLN3 Δex7 / 8 mice (Figure 6). The levels of GFAP staining in these brain regions in scAAV9.P546.CLN3-injected CLN3 Δex7 / 8 mice were much lower compared to PBS-treated CLN3 Δex7 / 8 mice, but they remained above wild-type levels at both 4 and 6 months after injection for most of the regions analyzed.

[0082] Glia activation was also determined in VPM / VPL and somatosensory cortex sections using anti-CD68 staining as a marker of activated microglia. CD68 is a lysosomal protein that is upregulated in cells primed for inflammatory-induced functions such as phagocytosis (Seehafer et al., J Neuroimmunol. 2011;230:169-172). Similar to what was observed in astrocytes, glia activation was significantly reduced in the VPM / VPL and somatosensory cortex regions of AAV9-injected CLN3 Δex7 / 8 mice compared to PBS-injected CLN3 Δex7 / 8 mice at 4 months (Figure 7). In the somatosensory cortex, treatment with scAAV9.P546.CLN3 reduced CD68 staining to levels comparable to wild-type mice. At the 6-month time point, there was no significant improvement in the level of CD68 staining in the VPM / VPL region with scAAV9.P546.CLN3 treatment compared to PBS-treated CLN3 Δex7 / 8 mice, but there was still a significant reduction in reactive glia in the somatosensory cortex of scAAV9.P546.CLN3-treated mice (Figure 7).

[0083] Improvement in behavior after delivery of scAAV9.P546.CLN3 In human CLN3-Batten disease patients, neurological disorders such as motor and cognitive impairments become apparent very late compared to early-onset disease variants such as CLN3-Batten disease (late infantile Batten disease), which may be due to the residual function of the short and incomplete CLN3 protein (Kitzmuller et al., Hum Mol Genet. 2008 Jan 15;17(2):303-12). This phenotypic delay also exists in the CLN3 Δex7 / 8 mouse model. In the efficacy study of scAAV9.P546.CLN3 starting at 2 months of age and continuing at 2-month intervals, mice underwent a series of behavioral test paradigms including the accelerating rotarod assay and pole climbing to test motor function and coordinated movement, as well as the Morris water maze to evaluate learning and memory. Currently, the animals are being followed up for 10 months after injection and the study is ongoing. Previous publications characterizing this mouse model have shown an initial delay in neurodevelopmental behavior, followed by normalization, and then a decline starting around 10-12 months of age (Osorio et al., Genes Brain Behav. 2009 Apr;8(3):337-345).

[0084] The rotarod analysis showed no statistical significant difference between wild-type and PBS or treated CLN3 Δex7 / 8 mice up to 18 months after injection.

[0085] The rotarod assay was performed every 2 months. Mice were placed on an accelerating wheel and the time until the mice fell off was measured. At each time point, the mice were trained in the morning and the test was performed 4 hours later in the afternoon. Different from previously published data (Bosch et al., J Neurosci. 2016;36(37):9669-9682), no significant difference in the performance ability was observed between wild-type mice and PBS CLN3 Δex7 / 8 mice up to 18 months after injection. However, PBS-treated CLN3 Δex7 / 8In female WT mice, significant differences were observed in the latency until falling after 2 months of injection. This discrepancy compared to previous data is most likely due to the design of the test protocol and / or environmental factors of housing. The current protocol used in this study tests animals only once a day at each time point, whereas the previously published data repeated the test over 4 days. Furthermore, the protocol used in this study was performed at a slightly lower starting speed (36 rpm vs. 40 rpm) and with a longer time interval between morning training and afternoon test period (4-hour rest vs. 2-hour rest) compared to the previously published data. Additionally, the setting of the morning training was also different: in the previous study, mice were trained on a rotating wheel at 5 rpm for 5 minutes only in the morning, whereas the animals in the current study were performed in exactly the same setting applied in the afternoon test that brought the wheel acceleration up to 0.3 rpm every 2 seconds. In summary, using the described settings, up to 18 months after injection, untreated mice or scAAV9.P546.CLN3-treated CLN3 mice showed no impairment in the ability to hold the accelerating rotarod wheel (upper panel of Figure 8). Δex7 / 8 In CLN3 mice, no impairment in the ability to hold the accelerating rotarod wheel was observed (upper panel of Figure 8).

[0086] Morris water maze analysis showed statistically significant differences between wild-type and CLN3 mice at 2, 4, 16, and 18 months after injection. Δex7 / 8 In the Morris water maze test, animals were placed in a pool filled with water containing a hidden platform. After training, the time it took the animals to find the hidden platform using environmental cues for orientation was measured as an indication of learning and memory ability. At 2 and 4 months after injection, wild-type animals and PBS- or scAAV9.P546.CLN3-treated CLN3

[0087] mice showed significant differences in the latency to find the platform. Δex7 / 8Statistical differences were observed between the mice, indicating that learning and memory were impaired at this point in the disease such that they were measurable in this test, resulting in a latency until the animals found the hidden platform. Furthermore, at 16 and 18 months, between wild-type and PBS- or scAAV9.P546.CLN3-treated CLN3 Δex7 / 8 mice, more significant statistical differences in latency were observed (Figure 9, upper left panel). The increase in latency at 16 months was also correlated with an increase in swimming speed for PBS-treated CLN3 Δex7 / 8 mice (Figure 9, upper right panel). Additionally, when classified by gender, at 16 and 18 months, between wild-type male animals and scAAV9.P546.CLN3-treated CLN3 Δex7 / 8 mice, a statistical difference in latency was observed (Figure 9, upper middle left panel), while for scAAV9.P546.CLN3-treated CLN3 Δex7 / 8 male mice, the swimming speed significantly decreased at 16 months (Figure 9, upper middle right panel). scAAV9.P546.CLN3-treated female CLN3 Δex7 / 8 mice showed a significantly increased latency at 18 months compared to wild-type or PBS-treated CLN3 Δex7 / 8 mice (Figure 9, lower left panel), while for PBS-treated CLN3 Δex7 / 8 male mice, the swimming speed significantly increased at 16 months (Figure 9, lower right panel).

[0088] The pole climbing assay showed improved performance for scAAV9.P546.CLN3-treated CLN3 Δex7 / 8 compared to PBS-injected animals.

[0089] The pole climbing test measures the time it takes for a mouse to turn around on a vertical pole when placed upside down, as well as the time it takes to descend the pole when placed right side down. Additionally, the number of times the mouse falls off the pole while attempting to turn around or descend may also be measured. This test evaluates coordinated movement and balance ability.

[0090] At 10 and 12 months post-injection, the scAAV9.P546.CLN3 animals had a significantly faster decline in pole than the PBS-treated animals (Figure 10, upper left panel). At 10 and 12 months post-injection, there was a statistically significant difference in the time it took for the PBS-treated CLN3 Δex7 / 8 animals to decline the pole, while there was no distinguishable difference between wild-type and scAAV9.P546.CLN3-treated CLN3 Δex7 / 8 animals (Figure 10, upper left panel). Regarding the time it took for the animals to change orientation from upward to downward, two statistically significant differences were observed. At 2 and 16 months of age, wild-type animals changed orientation significantly earlier compared to both scAAV9.P546.CLN3 and PBS-treated CLN3 Δex7 / 8 mice. This difference was more pronounced in male mice (Figure 10, middle left panel) compared to female mice (Figure 10, lower left panel), in which no difference was seen compared to wild-type. The 2- and 16-month time points were the only time points at which differences in this parameter were observed between study groups (Figure 10, upper left panel).

[0091] Additional statistically significant differences were seen in the average number of falls from the pole, with male and female PBS-treated CLN3 Δex7 / 8 mice falling more frequently compared to wild-type and scAAV9.P546.CLN3-treated animals (Figure 11). Upper graph: A significant difference in the number of falls was seen at 2 months between scAAV9.P546.CLN3-treated and PBS-treated animals. Statistically significant differences were also observed at 16 months post-injection between wild-type mice and PBS-treated CLN3 Δex7 / 8 mice. Middle graph: Males only. PBS-treated CLN3 Δex7 / 8Mice fell off the pole more frequently than other treatment groups with the greatest statistical significance at 16 months after injection. Lower graph: For females, the difference in falls was significant at 8 months after injection, and this trend was seen throughout the study. N = 5 (5M / 5F) for each treatment group. Interestingly, the difference in falls from the pole was seen over the entire 18 months and was statistically significant at early time points (4 months) as well as at 8 and 16 months. At the 8-month time point, this difference was statistically significant only in females, but an obvious trend also existed in males and was statistically significant in males at 16 months after injection. Generally, male PBS-treated CLN3 Δex7 / 8 fell off the pole more frequently than other treatment groups.

[0092] In summary, CLN3 Δex7 / 8 There is strong evidence that treatment of CLN3 mice with scAAV9.P546.CLN3 prevents the accumulation of ASM substance and ATP synthase subunit C (both major features of the progression of CLN3-Batten disease). These data correlate with a strong decrease in glial (astrocytes and microglia) activation. Although at an early stage of the disease course, the first trend towards improvement in the behavioral phenotype is becoming apparent: scAAV9.P546.CLN3-treated CLN3 Δex7 / 8 mice were more capable of descending a vertical pole because they moved faster and were less likely to fall, compared to PBS-treated animals. Overall, these data support scAAV9.P546.CLN3 gene therapy as a treatment strategy for this disease.

[0093] Example 3 Expression study using scAAV9.P546.GFP in mice The P546 promoter enables the expression of the transgene throughout the CNS in a manner similar to the chicken beta-actin (CBA) promoter. To compare the two promoters side by side, on the first day after birth, mice were injected with either 1×PBS and 0.001% pluronic F68 or 20 mM Tris (pH 8.0), 1 mM MgCl2, 200 mM NaCl, 0.001% poloxamer 188 containing either scAAV9.CB.GFP or scAAV9.P546.GFP at 5×10 10 viral genomes per animal. Three weeks later, the animals were sacrificed and the brains were placed directly under a fluorescence dissection microscope. From the fluorescence images, it was clear that the GFP distribution was similar, but the fluorescence levels were lower in animals receiving scAAV9.P546.GFP compared to those receiving scAAV9.CB.GFP, confirming that the P546 promoter results in a more moderate expression level of the transgene compared to the CBA promoter.

[0094] Another mouse was injected with scAAV9.P546.GFP and survived for 200 days. After 200 days, the animal was sacrificed and whole brain sagittal sections were stained for GFP expression. Even on the 200th day after injection, widespread expression of the GFP transgene was observed throughout the brain, including the cortex, hippocampus, midbrain, medulla, tonsils, and cerebellum, suggesting that the P546 promoter is an excellent candidate for CNS gene therapy.

[0095] Data from GFP fluorescence and GFP immunofluorescence staining were further supported by Western blot data from various tissues and brain regions. GFP expression was readily detectable by fluorescence Western blot using a recA system in mice treated with scAAV9.P546.GFP (n = 3) at 3 weeks after injection, while no bands were detected in PBS-injected animals (n = 1) used as controls. Transgene expression was evident in whole brain lysates as well as in region-specific lysates including the cortex, medulla, midbrain, hippocampus, cerebellum, and spinal cord.

[0096] Furthermore, GFP expression was also confirmed in the heart and liver, while the lungs and spleen showed little or no transcript expression (Figure 12). Western blot data with scAAV9.P546.GFP were consistent with expression data from mouse and non-human primate safety studies, where very similar expression profiles were seen. Furthermore, this expression pattern in the brain and peripheral organs is comparable to the pattern seen with scAAV9.CB.GFP.

[0097] In summary, extensive expression analysis in mice using immunostaining and Western blot techniques has shown that the P546 promoter allows for a more moderate expression level compared to the strong CBA promoter, while yielding a very similar and long-lasting expression profile throughout the nervous system.

[0098] Example 4 Expression study with scAAV9.P546.CLN3 in non-human primates 3.4×10 13 A single dose of 3.4×10

[0099] In the targeting analysis in the brain tissue of cynomolgus monkeys injected with scAAV9.P546.CLN3, the target was analyzed at the RNA level using primers specific for the human CLN3 transgene and not cross-reactive with endogenous non-human primate CLN3 RNA. Reverse transcription quantitative PCR in tissues from various brain regions of one cynomolgus monkey sacrificed 12 weeks after injection revealed human CLN3 expression at all levels of the spinal cord, cortex, thalamus, striatum, cerebellum, and retina, further highlighting the broad reach of scAAV9 by the P546 promoter and the expression of transcripts throughout the brain and spinal cord (Figure 13). Notably, the primers used to detect vector-derived human CLN3 do not cross-react with endogenous NHP CLN3 transcripts. Therefore, normalization to zero was not possible, and normalization was performed against the vector-derived CLN3 RNA levels found in the lumbar spinal cord set to 1 rather than against animals injected with saline or non-injected animals. Actin was used as the normalization gene.

[0100] In summary, data from non-human primates demonstrate that after a single intrathecal lumbar injection, scAAV9 is likely to pass through the nervous system and reach a wide area of the CNS. Notably, all non-human primates treated by intrathecal injection of scAAV9.P546.CLN3 tolerated the treatment well, and no adverse effects were observed in any of the animals at any time point up to 6 months after injection.

[0101] Example 5 Clinical trial of scAAV9.P546.CLN3 gene therapy scAAV9.P546.CLN3 will be delivered intrathecally to human patients with CLN3-Batten disease.

[0102] scAAV for clinical trials is manufactured by the Nationwide Children’s Hospital clinical manufacturing facility using the triple transfection method of HEK293 cells under cGMP conditions as described in Example 1.

[0103] Patients selected for participation will be 3 to 10 years old, diagnosed with CLN3 disease determined by genotype. The first cohort (n = 3) will receive a single gene transfer dose of 6×10 13 vg of total scAAV. scAAV9.P546.CLN3 will be formulated at 20 mM in 1 mM MgCl 2 , 200 mM NaCl, 0.001% poloxamer 188 Tris (pH 8.0) and delivered once via an intrathecal catheter inserted by lumbar puncture into the interspinous space leading to the lumbar subarachnoid space. Safety will be evaluated based on clinical evidence and by considering the safety label. There will be at least 4 weeks during the enrollment of each subject to allow for review of safety data at 30 days post-gene transfer. If there are no safety concerns, after the third subject is evaluated 1 month after injection, a second cohort of 4 additional subjects will be enrolled. Each subject in cohort 2 (n = 4) will receive escalating doses of 1.2×10 14 vg of total scAAV. There will be at least a 6-week window between the completion of cohort 1 and the start of cohort 2 to allow for review of safety analyses at 5 time points (days 1, 2, 7, 14, and 21) and DSMB review prior to dosing the next subject.

[0104] Disease progression will be measured using the UBDRS scale (referred to in the form for carrying out the above invention) and the impact of treatment on quality of life using the Pediatric Quality of Life (PEDSQOL) scale, as well as the likelihood of long-term survival.

[0105] When all patients have completed the 3-year study, a primary analysis regarding efficacy will be evaluated. The basis for determining efficacy will be based on the established Unified Batten Disease Rating Scale (UBDRS) specifically developed for CLN3-Batten disease, due to stabilization of the disease or reduction in progression. At the end of the 3-year study period, patients will be monitored annually for 5 years in accordance with FDA guidance.

[0106] Example 6 Cln3 Δ7 / 8 Additional studies in mouse models As described in the examples, two wild-type (WT) and Cln3Δ7 / 8 mice were each administered, on postnatal day 1, either PBS, scAAV9.p546.CLN3, or scAAV9.CB.CLN3 gene therapy via intracerebroventricular (ICV) injection. In this study, mice were administered 5x10^10 vg / animal (4 μL volume).

[0107] The method and timing of injection were selected to target specific neuronal populations relevant to CLN3-Batten disease patients. Animals were sedated by hypothermia during the procedure, monitored until fully recovered, and genotyped as previously described (see Morgan et al. PLoS One 8 and Laboratory, TJ Protocol 18257: Standard PCR Assay).

[0108] Statistical analysis was performed using GraphPad Prism, and details are described in the figure legends. Generally, two-way ANOVA was used with appropriate post hoc tests, and outliers were removed by the ROUT method (Q = 0.1 - 1%). Unpaired t-tests were used as needed.

[0109] Expression and distribution of hCLN3 transcripts in the brain Quantitative PCR was performed to measure hCLN3 transcripts in the brains of treated mice. Total RNA and cDNA were generated as previously described (see Cain et al. Mol Ther., 2019). The relative gene expression of human CLN3 transcripts normalized to Gapdh as a housekeeping control was calculated using the 2^-Delta-Delta Ct method. hCLN3 forward primer sequence: CGCTAGCATCTCATCAGGCCTTG (SEQ ID NO: 11), hCLN3 reverse primer sequence: AGCATGGACAGCAGGGTCTG (SEQ ID NO: 12).

[0110] As shown in Figure 16, upon treatment with scAAV9.p546.CLN3, the expression levels of hCLN3 transcripts in the cerebral cortex and spinal cord of Cln3 Δ7 / 8 mice were increased when measured by qPCR up to 24 months of age. Thus, a single neonatal ICV administration of scAAV9.p546.CLN3 results in sustained and well-targeted expression of hCLN3.

[0111] In addition, RNAscope was performed to detect CLN3 transcripts in the brains of treated mice. Mice were euthanized by CO 2 and the hearts were perfused with PBS. Brains were collected and placed into 1 mm sagittal brain blocks. Brains were sliced at the midline and 3 mm to the right of the midline. 3 mm sagittal sections were snap frozen in -50 °C isopentane, sectioned on a cryostat at 16 μm, and placed on slides. Next, the slides were processed according to the manufacturer's recommended protocols (ACD Bio manuals 320293 and 320513). Sections were labeled with a human-specific CLN3 probe (ACD Bio catalog number 470241), which consisted of 20 double Z pairs in a region of the CLN3 gene (region 631 - 1711) with little homology between mouse and human CLN3. Slides were fluorescently labeled with the RNAscope Fluorescent Multiplex Kit (ACD Bio catalog number 320850) using Amp4-FL-AltC tagged with a 550 nm fluorophore to the hCLN3 probe, and the slides were counterstained with DAPI to label nuclei. Tissue sections were mounted onto slides under coverslips using a fade-resistant mounting medium (Dako faramount, Agilent). Slides were stored in the dark prior to imaging. Sections were imaged and analyzed using a Nikon NiE microscope equipped with NIS-Elements Advanced Research software (v4.20).

[0112] As shown in Figure 17, upon treatment with scAAV9.p546.CLN3, when measured by RNAscope (red fluorescence) up to 24 months of age, Cln3 Δ7 / 8Stable hCLN3 transcripts are generated throughout the mouse brain. Quantitative PCR and RNAscope assays confirm that a single, neonatal ICV administration of scAAV9.p546 results in sustained and well-targeted expression of hCLN3. scAAV9.p546.CLN3 gene therapy increases hCLN3 gene expression throughout the brain and spinal cord by 24 months of age.

[0113] Classic Batten disease pathology Administration of scAAV9.p546.CLN3 resulted in Cln3 Δ7 / 8 To determine whether ICV administration of CLN3 prevented classical Batten disease pathology in the mouse brain, we examined accumulation of storage material (ASM) and glial reactivity in wild-type and CLN3 mice. Δ7 / 8 Mice were then inoculated with CO 2 After euthanasia and perfusion with PBS, tissues were fixed in 4% PFA. Fixed brains were sectioned with a vibratome (Leica VT10008) at 50 μm. Sections were processed with standard immunofluorescence and DAB staining protocols. Primary antibodies included anti-CD68 (AbD Serotec, MCA1957, 1:2000), anti-GFAP (Dako, Z0334, 1:8000), and anti-ATP synthase subunit C (Abcam, ab181243, 1:1000). Secondary antibodies included anti-rat and anti-rabbit biotinylated (Vector Labs, BA-9400, 1:2000). Sections were imaged and analyzed using an Aperio slide scanning microscope at 20x magnification. Images were extracted from the VPM / VPL of the thalamus and layers 2 / 3 of the somatosensory cortex, with multiple images taken from multiple tissues in each animal. Total area of ​​immunoreactivity was quantified using threshold analysis in ImageJ.

[0114] FIG. 18 shows that scAAV9.p546.CLN3 treatment reduces Cln3 expression up to 24 months of age. Δ7 / 8 Figure 19 shows that scAAV9.p546.CLN3 treatment prevents and reduces ASM accumulation in two regions of the mouse brain. Δ7 / 8In two regions of the mouse brain, it has been shown that accumulation of a large amount of subunit C (a component of ASM) was generally prevented. Figure 20 shows that scAAV9.p546.CLN3 treatment generally prevents activation of astrocytes (GFAP+) in two regions of the brains of Cln3Δ7 / 8 mice up to 24 months of age. Figure 21 shows that scAAV9.p546.CLN3 treatment prevents activation of microglia (CD68+) in two regions of the brains of Cln3Δ7 / 8 mice up to 24 months of age, depending on the time point. Therefore, scAAV9.p546.CLN3 prevents classical Batten disease pathologies in the mouse brain, including accumulation of storage material and glial reactivity, in Cln3 Δ7 / 8 prevented classical Batten disease pathologies in the mouse brain. Figure 22 shows that scAAV9.CB.CLN3 treatment Δ7 / 8 has been shown to be similarly effective in preventing various Batten disease pathologies in Cln3 mice.

[0115] In addition, treatment with scAAV9.p546.CLN3 did not cause red blood cell (CBC) abnormalities or white blood cell (WBC) abnormalities when measured up to 24 months after ICV administration. Figure 23 provides data on the following CBC parameters: RBC count, hemoglobin, hematocrit value, mean corpuscular volume, mean corpuscular hemoglobin, mean corpuscular hemoglobin concentration, RBC distribution, platelet count, and mean platelet volume. Figure 24 provides data on the following WBC parameters: WBC count, percentage of lymphocytes, percentage of monocytes, percentage of granulocytes.

[0116] scAAV9.p546.CLN3 gene therapy prevents many of the cellular features of CLN3-Batten disease in Cln3Δ7 / 8 mice up to 24 months of age, including expression of ASM, subunit C, GFAP, and CD68. In addition, scAAV9.CB.CLN3 gene therapy prevents many of the cellular features of CLN3-Batten disease in Cln3 Δ7 / 8 mice up to 24 months of age, such as expression of ASM, subunit C, GFAP, CD68.

[0117] Example 7 Cln3 Δ7 / 8Sex-based histopathological analysis in a mouse model As described in Example 2, wild-type (WT) and Cln3Δ7 / 8 mice were administered either PBS, scAAV9.p546.CLN3, or scAAV9.CB.CLN3 gene therapy via intracerebroventricular (ICV) injection on postnatal day 1. In this study, mice were administered 5x10 10 vg / animal (4 μL volume).

[0118] Wild-type and CLN3 Δ7 / 8 mice were euthanized with CO 2 and perfused with PBS, and tissues were fixed with 4% PFA. Fixed brains were sectioned with a 50-μm vibratome (Leica VT10008). Sections were processed with standard fluorescent antibody and DAB staining protocols. Primary antibodies included anti-CD68 (AbD Serotec, MCA1957, 1:2000) and anti-ATP synthase subunit C (Abcam, ab181243, 1:1000). Secondary antibodies included anti-rat and anti-rabbit biotinylation (Vector Labs, BA-9400, 1:2000). Sections were imaged and analyzed using a 20x Aperio slide scanning microscope. Images were extracted from the following regions: CA2 / CA3 region of the hippocampus, polymorphic layer of the hippocampal dentate gyrus, basolateral part of the amygdala, claustrum, thalamic reticular nucleus, ventrolateral posterolateral / ventromedial posterior nucleus of the thalamus, dorsomedial and medial inferior regions of the thalamus, piriform cortex, posterior corpus callosum cortex, and layers 2 / 3 of the somatosensory cortex. Multiple images were taken from multiple tissues of each animal. The total immunoreactive area was quantified using threshold analysis in ImageJ.

[0119] Figure 25 shows that mice treated with scAAV9.p546.CLN3 showed different levels of Sub C accumulation in the CA3 region of the hippocampus based on sex at 12 months of age. At 12 months of age, treated female Cln3 Δ7 / 8 mice accumulated significantly more Sub C than wild-type, but Sub C accumulation in treated males did not differ from wild-type. However, this difference was not seen at any other time point analyzed.

[0120] Figure 26 shows that mice treated with scAAV9.p546.CLN3 exhibited slightly different levels of SubC accumulation in the piriform cortex (PIRC) based on gender at multiple time points. At 12 months of age, treated mutant CLN3 female mice accumulated significantly more SubC than wild-type, and AAV treatment did not prevent accumulation below PBS mutant levels, but treated male SubC accumulation did not differ from wild-type. However, this correlation was not seen at any of the other time points analyzed, and did not match the 18-month findings where treated female SubC accumulation was not significantly different from wild-type and was significantly lower than untreated mutant mice. At 18 months of age, treated male SubC accumulation becomes significantly higher than WT levels.

[0121] Figure 27 shows that scAAV9.p546.CLN3-treated mice exhibited different levels of SubC accumulation in the reticular thalamic nucleus (RTN) based on gender at multiple time points. At 6 months of age, treated mutant CLN3 female mice accumulated significantly more SubC than wild-type, but SubC accumulation in treated males did not differ from wild-type. At 12 months of age, treated males remained at wild-type levels, but treated females had significantly more SubC than both wild-type mice and untreated mutant mice. This difference between treated and untreated mutant females did not exist at 18 months, where SubC was significantly higher than WT but significantly lower than untreated mutants in both males and females.

[0122] Figure 28 shows that scAAV9.p546.CLN3-treated mice exhibited different levels of SubC accumulation in the somatosensory cortex based on gender at 12 months. At 12 months of age, AAV treatment did not reduce SubC accumulation compared to untreated mutant females, but SubC accumulation in treated males was prevented and did not differ from wild-type. However, this difference was not seen at any of the other time points analyzed.

[0123] Figure 29 shows that mice treated with scAAV9.p546.CLN3 showed different levels of Sub C accumulation in the VPM / VPL of the thalamus based on gender at 12 months. At 6 months of age, treated females accumulated significantly less Sub C than untreated mutant females but significantly more than wild-type females. This difference persisted from 12 to 18 months, but there was no difference between wild-type and treated males at any time point analyzed.

[0124] Figure 30 shows that mice treated with scAAV9.p546.CLN3 showed different levels of Sub C accumulation in the basolateral amygdala (BLA) based on gender at 12 months. At 12 months of age, AAV did not significantly prevent Sub C accumulation in treated female animals. At the 18-month time point, Sub C accumulation in treated females remained significantly higher than that in wild-type but lower than that in untreated females. By 18 months, treated males began to have significantly more Sub C than wild-type males, resulting in a similar outcome as seen in the female group.

[0125] Figure 31 shows that scAAV9.p546.CLN3-treated mice showed different levels of Sub C accumulation in the polymorphic layer of the dentate gyrus (DG) based on gender at 12 and 18 months. At 12 months of age, treated females appeared to accumulate significantly more Sub C than both wild-type and untreated mutant females. Raw images (not shown) revealed a darkened granular cell layer surrounding the polymorphic layer of the dentate gyrus that could potentially affect the results of thresholding. This dark area was present only in this group and only at the 12-month time point. This increase was no longer seen in females at 18 months, but in treated males at 18 months, they began to show more Sub C accumulation than wild-type males.

[0126] Figure 32 shows that scAAV9.p546.CLN3 - treated mice exhibit different levels of Sub - C accumulation in the cerebellum based on gender at 12 and 18 months. At 12 months, treated females accumulated significantly less Sub - C than untreated mutant females but significantly more than wild - type females. This difference was also seen at 18 months, but there was no difference between wild - type and treated males at any time point analyzed.

[0127] Figure 33 shows that mice treated with scAAV9.p546.CLN3 exhibit different levels of Sub - C accumulation in the dorsomedial nucleus based on gender at 12 and 18 months. At 12 months, treated females accumulated significantly less Sub - C than untreated mutant females but significantly more than wild - type females. This difference was also seen at 18 months, but there was no difference between wild - type and treated males at any time point analyzed.

[0128] Figure 34 shows that there is no difference in the level of Sub - C accumulation in the retrosplenial cortex (RSC) based on gender in mice treated with scAAV9.p546.CLN3. There was no difference between wild - type and treated males at any time point analyzed.

[0129] Figure 35 shows that mice treated with scAAV9.p546.CLN3 exhibit different levels of activated microglia (CD68 + ) in the somatosensory cortex (S1BF) based on gender at 6 months. At 6 months, treated females had increased microglial activation compared to wild - type and untreated females, while treated males had higher levels than wild - type but lower than untreated. There was no gender difference at 12 and 18 months.

[0130] Figure 36 shows that mice treated with scAAV9.p546.CLN3 exhibit different levels of microglial activation in the VPM-VPL, thalamus based on gender. At 6 months of age, treated females have increased microglial activation compared to wild-type and untreated females, while treated males have higher levels than wild-type but lower than untreated. This difference is also seen at 12 months. The same is true for the 18-month-old female group, but treated males did not show a significant difference from wild-type at this time point.

[0131] Figure 37 shows that scAAV9.p546.CLN3 mice exhibit different levels of activated microglia (CD68 + ) in the medial dorsal nucleus (MD) based on gender. At 6 months of age, treated females have increased microglial activation compared to wild-type and untreated females, and treated males have higher levels than wild-type but are not different from untreated males. At both 12 and 18 months of age, treated males have higher microglial activation than wild-type and lower activation than untreated males, while the treatment does not seem to affect females.

[0132] Figure 38 shows that mice treated with scAAV9.p546.CLN3 exhibit different levels of activated microglia in the submedial nucleus (SM) based on gender. At 6 months of age, treated females have increased microglial activation compared to wild-type and untreated females, while treated males are not significantly different from untreated males, and both are more active than wild-type. By 12 months, the treatment does not seem to affect the degree of microglial activation in either gender. By 18 months, treated males have a decrease in microglial activation to wild-type levels, while treated females remain activated to the same extent as untreated females.

[0133] The aforementioned data indicate that scAAV9.p546.CLN3-treated animals have the accumulation of ATP synthase subunit C and CD68 in several regions of the Cln3 Δ7 / 8 mouse brain +It shows that the disease state varies based on gender with respect to the activation of microglia. The pathological differences due to gender seem to be specific to females. At the 12 - month time point, most of the differences are most consistently seen, many are shown only at 12 months and not at 18 months.

[0134] Preferred embodiments of the invention have been shown and described herein, but it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Those skilled in the art will envision numerous variations, modifications, and substitutions without departing from the invention. It should be understood that various alternative forms to the embodiments described herein may be employed. The following claims define the scope of the invention, and it is intended that methods and structures within the scope of these claims and their equivalents be encompassed thereby.

[0135] All documents referenced in this application are hereby incorporated by reference in their entirety.

Claims

**Claim 1** A nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO:

4. **Claim 2** Self-complementary recombinant adeno-associated virus 9 (scAAV9) comprising the nucleic acid molecule of claim 1. **Claim 3** The scAAV9 of claim 2, comprising a single-stranded genome. **Claim 4** rAAV particles comprising the nucleic acid molecule of claim 1. **Claim 5** The rAAV particles of claim 4, comprising a single-stranded genome. **Claim 6** A composition comprising the scAAV9 of claim 2 or 3, the nucleic acid molecule of claim 1, or the rAAV particles of claim 4 or 5, and a pharmaceutically acceptable excipient, carrier or diluent. **Claim 7** The composition of claim 6, wherein the excipient comprises a non-ionic hypotonic compound, a buffer, a polymer, a salt, or a combination thereof. **Claim 8** A composition for treating CLN3-Batten disease in a subject, comprising a therapeutically effective amount of the scAAV9 of claim 2 or 3, the nucleic acid molecule of claim 1, the rAAV particles of claim 4 or 5, or the composition of claim 6 or 7. **Claim 9** The composition of claim 8, formulated for administration via a route selected from the group consisting of intrathecal, intraventricular, intracerebral, intravenous, and combinations thereof. **Claim 10** The composition of claim 8, formulated for intrathecal administration. **Claim 11** The composition of claim 8, formulated for intraventricular administration. **Claim 12** The composition of claim 8, formulated for intravenous administration.

13. 1 x 10 per dose １２ ~1×10 １５ 13. The composition of any one of claims 8 to 12, comprising the rAAV particles of .vg.

14. 6 × 10 per dose １３ ~1.2 × 10 １４ vg of said rAAV particles, the composition according to any one of claims 8 to 12. **Claim 15** Administration of the composition results in (a) a decrease or delay in lysosomal accumulation of autofluorescent storage material, (b) a decrease or delay in lysosomal accumulation of ATP synthase subunit C, (c) a decrease or delay in glial (astrocyte and / or microglia) activation, (d) a decrease or delay in astrocytosis, (e) a decrease or delay in brain volume loss measured by MRI, (f) a decrease or delay in the onset of seizures, (g) stabilization, a decrease or delay in progression, or improvement in one or more of the UBDRS assessment scales, resulting in a decrease in one or more symptoms of CLN3-Batten disease as compared to the subject or an untreated CLN3-Batten disease patient prior to administration of the composition. The composition according to any one of claims 8 to 12. **Claim 16** The composition according to any one of claims 8 to 12, wherein after administration of the rAAV particles, the subject is placed in the Trendelenburg position.

Images