TnpB-omega RNA gene editing system and application

By modifying the ωRNA backbone to adapt to the TnpB system, the problem of difficult delivery of large-sized proteins is solved, and efficient gene editing therapy is achieved, suitable for a variety of TnpB proteins, especially in mammalian cells, with significant gene editing activity.

CN120230749APending Publication Date: 2025-07-01LINGANG LAB
View PDF 0 Cites 5 Cited by

Patent Information

Application Number
CN202311837239.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-12-28
Publication Date
2025-07-01

AI Technical Summary

Technical Problem

Existing gene editing systems such as Cas9 and Cas12 are difficult to deliver efficiently to mammalian cells through a single AAV vector due to their large protein size, limiting the application of gene editing therapy.

Method used

A modified TnpB-ωRNA gene editing system was developed. By deleting stem ring structural fragments in the ωRNA skeleton, at least three stem ring structural fragments are retained to form a compact modified ωRNA skeleton, which can be carried in a single AAV vector with TnpB to improve drug delivery efficiency.

Benefits of technology

It achieves efficient gene editing in mammalian cells, improves the efficiency and therapeutic effect of gene editing, reduces off-target activity, and is suitable for TnpB proteins from various sources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004637928190000021
    Figure BDA0004637928190000021
  • Figure BDA0004637928190000071
    Figure BDA0004637928190000071
  • Figure HDA0004637928200000011
    Figure HDA0004637928200000011
Patent Text Reader

Abstract

The invention provides a modified TnpB-omega RNA gene editing system and application of the modified TnpB-omega RNA gene editing system. In particular, the present invention provides a modified TnpB related [omega] RNA skeleton. The modified omega RNA skeleton provided by the invention has at least three stem-loop structure fragments, and has a shorter length and a compact structure than a natural omega RNA skeleton, so that the modified omega RNA skeleton and TnpB can be jointly carried in a single AAV vector, the administration efficiency is improved, and high-efficiency gene editing is realized.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of gene editing. Specifically, the present invention relates to the TnpB-ωRNA gene editing system and its uses. Background Art

[0002] TnpB is a transposon-related RNA-guided endonuclease. Recent studies have demonstrated that TnpB is the ancestor of diverse Cas12 effector proteins. Research has shown that a 247-nucleotide (nt) non-coding RNA (termed ωRNA, also known as reRNA) derived from the right end of the transposon element is a component required for TnpB to recognize and cleave target DNA. TnpB, which is only approximately 400 amino acid (aa) residues, is much smaller than its evolutionary progeny proteins Cas12 and Cas9, the latter of which are mostly 1000 aa. Despite its small protein size, TnpB still exhibits double-stranded DNA cleavage activity programmed by ωRNA. Therefore, the genomic editing and therapeutic potential of TnpB in mammalian cells or tissues, especially cells or tissues from humans, remains to be explored.

[0003] Cas9 or Cas12 has achieved gene editing therapy for various diseases in different animal models and even human patients. Currently, AAV is the most commonly used delivery method and has been proven safe in human gene therapy3. However, the maximum cargo size limit of AAV is 4.7 kilobases (kb) pairs. Therefore, the large protein sizes of Cas9 and Cas12 usually hinder the effective in vivo delivery for disease intervention via a single AAV, which is exacerbated in the case of base and prime editors composed of Cas9 or Cas12 and additional fusion enzymes.

[0004] To address this challenge faced by gene editing therapies, it is necessary in the art to develop novel gene editing systems with a compact size and activity. Summary of the Invention

[0005] The object of the present invention is to provide a novel gene editing system with a compact size and powerful activity.

[0006] In a first aspect of the present invention, there is provided a modified ωRNA backbone for a TnpB gene editing system, wherein the modified ωRNA backbone lacks one or more stem-loop structure fragments at the 5'-end relative to the wild-type TnpB-ωRNA backbone, and the modified ωRNA backbone comprises at least 3 stem-loop structure fragments (SL fragments).

[0007] In another preferred example, each of the SL fragments independently has the structure shown in Formula I below:

[0008] Seq 正向 -X-Seq反向 (I),

[0009] Wherein,

[0010] Seq 正向 and Seq 反向 are complementary or substantially complementary nucleotide sequences;

[0011] X is a spacer sequence located between Seq 正向 and Seq 反向 , and the spacer sequence is not complementary to Seq 正向 and Seq 反向 .

[0012] In another preferred embodiment, the "substantially complementary" means that in Seq 正向 and Seq 反向 , ≥60% (preferably ≥70%, ≥80%, ≥85%, ≥90%, ≥95%, ≥97% or ≥99%) of the bases can form double strands through complementary base pairing.

[0013] In another preferred embodiment, Seq 正向 and Seq 反向 have the same length.

[0014] In another preferred embodiment, Seq 正向 and Seq 反向 have different lengths, and the lengths of Seq 正向 and Seq 反向 differ by 1-5 nt, preferably 1-3 nt, more preferably 1-2 nt.

[0015] In another preferred embodiment, the lengths of Seq 正向 and Seq 反向 are each independently ≥4 nt, preferably ≥10 nt, more preferably ≥20 nt.

[0016] In another preferred embodiment, the lengths of Seq 正向 and Seq 反向 are each independently 4 nt - 100 nt, preferably 10 nt - 100 nt, more preferably 20 nt - 100 nt.

[0017] In another preferred embodiment, the number of bases of X is ≥4 nt, preferably ≥6 nt, more preferably ≥10 nt.

[0018] In another preferred embodiment, the structure shown in formula I can form the secondary structure shown in formula II:

[0019]

[0020] Wherein, Seq 正向, Seq 反向 and the definition of X is as described above;

[0021] || represents the base complementary pairing relationship formed between Seq 正向 and Seq 反向 and forms a base complementary pairing relationship.

[0022] In another preferred embodiment, in the modified ωRNA backbone, one or more SL fragments have at least one nucleotide addition, deletion, modification, and / or substitution relative to the corresponding fragment in the wild-type ωRNA backbone.

[0023] In another preferred embodiment, in the modified ωRNA backbone, the Seq 正向 and / or Seq 反向 of one or more SL fragments is truncated relative to the wild-type ωRNA backbone, and the truncated Seq 正向 and / or Seq 反向 can still form a double strand.

[0024] In another preferred embodiment, the truncation is to truncate no more than 70% of the nucleotides, preferably no more than 60%, more preferably no more than 50%.

[0025] In another preferred embodiment, in the modified ωRNA backbone, relative to the wild-type ωRNA backbone, one or more G:U base pairs in the Seq 正向 and Seq 反向 of one or more SL fragments are replaced by G:C base pairs.

[0026] In another preferred embodiment, in the modified ωRNA backbone, the spacer sequence X of one or more SL fragments is truncated relative to the wild-type ωRNA backbone.

[0027] In another preferred embodiment, the truncation is to truncate no more than 90% of the nucleotides, preferably no more than 80%, more preferably no more than 70%.

[0028] In another preferred embodiment, the spacer sequence X of one or more SL fragments in the modified ωRNA backbone contains a sequence fragment shown as GAAA, or is as shown by GAAA.

[0029] In another preferred embodiment, the ωRNA backbone from the 5' to the 3' end contains the structure shown in the following formula III:

[0030] SL1-L1-SL2-L2-SL3 (III);

[0031] In the formula, each "-" is independently a bond;

[0032] L1 and L2 are each independently none or a linker;

[0033] SL1, SL2, and SL3 are each independently a stem-loop structure fragment as shown in Formula I above.

[0034] In another preferred embodiment, the nucleotide sequence of the modified ωRNA backbone has a length of 70 - 130 nt, preferably 80 - 120 nt, more preferably 85 - 100 nt.

[0035] In another preferred embodiment, the wild-type ωRNA backbone is ISDra2 TnpBωRNA or ISAam1TnpBωRNA.

[0036] In another preferred embodiment, the wild-type ωRNA backbone sequence is as shown in SEQ ID NO:1 or SEQ ID NO:3.

[0037] In another preferred embodiment, the spacer sequence X of the SL2 fragment contains a sequence fragment shown as GAAA, or is as shown in GAAA.

[0038] In another preferred embodiment, the nucleotide sequence of the modified ωRNA backbone is as shown in SEQ ID NO:2 or SEQ ID NO:4, or has a sequence identity of ≥80%, ≥85%, ≥90%, ≥95%, ≥96%, ≥97%, ≥98%, or ≥99% therewith.

[0039] In the second aspect of the present invention, there is provided a ωRNA, which comprises:

[0040] i) a ωRNA backbone as described in the first aspect of the present invention;

[0041] ii) a targeting segment that specifically binds to a target sequence.

[0042] In another preferred embodiment, the ωRNA has the following structure from the 5'-end to the 3'-end as shown in Formula I:

[0043] SF-L-T(IV);

[0044] In the formula, each "-" is independently a bond;

[0045] SF is a ωRNA backbone as described in the first aspect of the present invention;

[0046] L is none or a linker;

[0047] T is the targeting segment.

[0048] In another preferred embodiment, the length of the linker is 1 - 10 nt; preferably 1 - 4 nt.

[0049] In another preferred embodiment, the length of the targeting segment is 18 - 30 nt; preferably 20 - 24 nt.

[0050] In a third aspect of the present invention, there is provided a polynucleotide encoding the ωRNA backbone as described in the first aspect of the present invention or the ωRNA as described in the second aspect of the present invention.

[0051] In another preferred embodiment, the polynucleotide is cDNA, RNA, or a combination thereof.

[0052] In a fourth aspect of the present invention, there is provided a vector containing the polynucleotide as described in the third aspect of the present invention.

[0053] In another preferred embodiment, the delivery vector is selected from lipid particles, sugar particles, metal particles, protein particles, liposomes, exosomes, viral vectors (such as replication-defective retroviruses, lentiviruses, adenoviruses or adeno-associated viruses).

[0054] In another preferred embodiment, the vector is an adeno-associated virus (AAV) vector.

[0055] In another preferred embodiment, the vector is an AAV9 vector.

[0056] In another preferred embodiment, the vector further contains a polynucleotide encoding the TnpB protein or a variant thereof.

[0057] In another preferred embodiment, the TnpB protein is derived from a prokaryotic transposon, a eukaryotic transposon, or a viral transposon.

[0058] In another preferred embodiment, the TnpB protein is derived from the IS200 or IS605 transposon family.

[0059] In another preferred embodiment, the source of the TnpB protein includes but is not limited to: ISDra2, ISAam1, ISBla1, etc.

[0060] In another preferred embodiment, the variant of the TnpB protein is a truncated TnpB protein.

[0061] In another preferred embodiment, the truncated TnpB protein is truncated by 1-30 amino acids, preferably 1-24 amino acids, more preferably 1-14 amino acids from the C-terminus.

[0062] In another preferred embodiment, the amino acid sequence of the TnpB protein is as shown in SEQ ID NO:5 or SEQ ID NO:6.

[0063] In another preferred embodiment, the sequence of the polynucleotide encoding the TnpB protein is as shown in SEQ ID NO:7.

[0064] In another preferred example, the vector further contains a polynucleotide encoding a donor template sequence.

[0065] In a fifth aspect of the present invention, there is provided a composition or complex for gene editing, which composition or complex contains:

[0066] A) an ωRNA as described in the second aspect of the present invention, a polynucleotide as described in the third aspect of the present invention, or a vector as described in the fourth aspect of the present invention; and

[0067] B) a TnpB protein or a variant thereof, or an expression vector thereof.

[0068] In another preferred example, the TnpB protein is derived from a prokaryotic transposon, a eukaryotic transposon, or a viral transposon.

[0069] In another preferred example, the TnpB protein is derived from the IS200 or IS605 transposon family.

[0070] In another preferred example, the source of the TnpB protein includes but is not limited to: ISDra2, ISAam1, ISBla1, etc.

[0071] In another preferred example, the variant of the TnpB protein is a truncated TnpB protein.

[0072] In another preferred example, the truncated TnpB protein is truncated by 1 - 30 amino acids, preferably 1 - 24 amino acids, more preferably 1 - 14 amino acids from the C-terminus.

[0073] In another preferred example, the amino acid sequence of the TnpB protein is as shown in SEQ ID NO:5 or SEQ ID NO:6.

[0074] In another preferred example, the composition further contains a polynucleotide encoding a donor template sequence, or a vector containing the polynucleotide.

[0075] In another preferred example, the composition is a pharmaceutical composition, and the composition further includes a pharmaceutically acceptable carrier.

[0076] In another preferred example, the complex is formed by assembling the ωRNA with the TnpB protein or a variant thereof.

[0077] In a sixth aspect of the present invention, there is provided the use of the ωRNA as described in the second aspect of the present invention, the polynucleotide as described in the third aspect of the present invention, the vector as described in the fourth aspect of the present invention, or the composition or complex as described in the fifth aspect of the present invention in the preparation of i) a drug for treating a disease or ii) a kit for gene editing.

[0078] In another preferred example, the disease can be treated by gene editing.

[0079] In another preferred example, the disease is selected from the group consisting of: liver diseases, Duchenne muscular dystrophy, amyotrophic lateral sclerosis (ALS), spinocerebellar ataxia (SCA), Huntington's disease (HTT), Angelman syndrome (AS), or a combination thereof.

[0080] In another preferred example, the disease is a liver disease, such as type I hereditary tyrosinemia.

[0081] In another preferred example, the gene editing is performed on cells selected from the group consisting of: immune cells, hematopoietic stem cells, induced pluripotent stem cells, or a combination thereof.

[0082] In a seventh aspect of the present invention, there is provided a kit for gene editing, the kit comprising the ωRNA as described in the second aspect of the present invention, the polynucleotide as described in the third aspect of the present invention, the vector as described in the fourth aspect of the present invention, or the composition or complex as described in the fifth aspect of the present invention.

[0083] In an eighth aspect of the present invention, there is provided a gene editing method, the gene editing method being performed using the ωRNA as described in the second aspect of the present invention, the polynucleotide as described in the third aspect of the present invention, the vector as described in the fourth aspect of the present invention, or the composition or complex as described in the fifth aspect of the present invention, or the kit as described in the seventh aspect of the present invention.

[0084] In a ninth aspect of the present invention, there is provided a method for preparing the modified ωRNA backbone as described in the first aspect of the present invention, comprising the steps of:

[0085] 1) Providing a wild-type TnpB-related ωRNA backbone;

[0086] 2) Truncating one or more stem-loop structure fragments starting from the 5'-end of the wild-type ωRNA, thereby obtaining a modified ωRNA backbone,

[0087] wherein the modified ωRNA backbone retains at least 3 stem-loop structure fragments (SL fragments).

[0088] In another preferred example, the SL fragment has the structure shown in Formula I above.

[0089] In another preferred example, the method further comprises the step of:

[0090] In the modified ωRNA backbone, replacing at least 1 (e.g., at least 3 or at least 5) G:U base pairs in one or more SL fragments with G:C base pairs.

[0091] In another preferred example, the method further comprises the step of:

[0092] In the modified ωRNA backbone, truncate the Seq of one or more SL fragments 正向 and / or Seq 反向 thereof.

[0093] In another preferred example, the method further comprises the step of:

[0094] In the modified ωRNA backbone, truncate the spacer sequence X of one or more SL fragments.

[0095] In another preferred example, the method further comprises the step of:

[0096] In the modified ωRNA backbone, replace the spacer sequence X of one or more SL fragments with a sequence fragment containing GAAA or as shown by GAAA.

[0097] In another preferred example, the method further comprises the step of:

[0098] Perform a gene editing efficiency test on the modified ωRNA backbone, so as to screen for ωRNA backbones with gene editing functions.

[0099] In another preferred example, the test is carried out using the TnpB gene editing system.

[0100] In the tenth aspect of the present invention, there is provided a method for screening ωRNA backbones that can be used in the TnpB gene editing system, comprising the steps of:

[0101] S1) Provide the ωRNA backbone sequence to be screened, and predict the secondary structure of the ωRNA backbone sequence;

[0102] S2) Determine whether the secondary structure has at least 3 stem-loop structures, so as to screen for ωRNA backbones that can be used in the TnpB gene editing system.

[0103] In another preferred example, the structure prediction is carried out using RNAfold software.

[0104] In another preferred example, if the secondary structure has at least 3 stem-loop structures, it is determined that the ωRNA backbone can be used in the TnpB gene editing system.

[0105] In another preferred example, the stem-loop structure has the structure shown in Formula I:

[0106] Seq 正向 -X-Seq 反向 (I),

[0107] In the formula,

[0108] Seq 正向 and Seq 反向 are complementary or substantially complementary nucleotide sequences;

[0109] X is a spacer sequence located between Seq 正向 and Seq 反向 , and the spacer sequence is not complementary to Seq 正向 and Seq 反向 .

[0110] In another preferred embodiment, the structure shown in Formula I can form a secondary structure shown in Formula II:

[0111]

[0112] In the formula, the definitions of Seq 正向 , Seq 反向 and X are as described above;

[0113] || represents the base complementary pairing relationship formed between Seq 正向 and Seq 反向 .

[0114] In the eleventh aspect of the present invention, a non-natural ωRNA backbone is provided, which is characterized in that the ωRNA backbone is obtained by screening using the method described in the tenth aspect of the present invention.

[0115] It should be understood that within the scope of the present invention, the above technical features of the present invention and the technical features specifically described below (such as in the examples) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be elaborated one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0116] The following drawings are used to illustrate the specific implementation of the present invention, rather than to limit the scope of the present invention defined by the claims.

[0117] Figure 1Shows efficient gene editing induced by injecting TnpB-ωRNA into mouse embryos. a. Domain comparison of SpCas9, IscB, LbCas12a, Un1Cas12f1 and TnpB ribozymes. b. Comparison of the editing efficiency of TnpB and Cas12f1 on the Tyr gene in mice. c. Color phenotypes of mice in which Un1Cas12f1 and TnpB edited the Tyr gene. d. Gene editing efficiency of TnpB-mediated Dmd gene. e. Immunostaining of dystrophin and laminin-2 in TA, DI and myocardium of wild-type and TnpB-mediated Dmd gene-edited mice. f. Protein immunoblotting detection of dystrophin and vinculin in three muscle tissues of wild-type and TnpB-mediated Dmd gene-edited mice. Data are presented as means±SEM. One dot represents one biological replicate. Significant differences under different conditions are indicated by asterisks. Unpaired two-tailed t-test. *P<0.05, ***P<0.001, NS no significant difference. Scale bar, 200 μm.

[0118] Figure 2 Shows engineering of TnpB-related ωRNA to improve gene editing efficiency. a. Schematic diagram of the reporter test mode for detecting TnpB-ωRNA cleavage. b. Predicted secondary structure of native ωRNA (231 nt). Native ωRNA was sequentially named six parts from S1 to S6. c. Reporter gene test results of engineered ωRNAs obtained by truncating S1 to S6 one by one. d. Reporter gene test results of engineered ωRNAs obtained by combining different truncations of S1 to S5. e. Predicted secondary structure of the ωRNA-v1 variant with simultaneous truncation of S1, S2 and S3. f. Reporter gene test results of ωRNA-v1 variants with different SL deletions and modifications. g. Predicted secondary structure of the final optimized ωRNA-v2 (ωRNA*) variant. h. Functional domain composition analysis of the ISDra2-TnpB protein structure. i. Modification of the ISDra2-TnpB protein in the reporter system. Data are presented as means±SEM. One dot represents one biological replicate.

[0119] Figure 3Characterization of the endogenous gene editing activity and off-target effects of TnpB-ωRNA. a. Experimental flow chart for detecting the editing efficiency of the original (wild-type) and optimized TnpB-ωRNA in HEK293T cells. b. Comparison of the gene editing efficiencies of wild-type and optimized TnpB-ωRNA at 14 human endogenous gene loci. c. Comparison of the gene editing activities of TnpB-ωRNA, TnpB-ωRNA*, SaCas9, and SpCas9. d. Off-target analysis of predicted off-target genomic loci using Cas-OFFinder. e. Genomic off-target analysis of TnpB-ωRNA using PEM-seq. Data are presented as means ± SEM. One dot represents one biological replicate. Significant differences under different conditions are indicated by asterisks. Unpaired two-tailed t-test. *P < 0.05, ***P < 0.001, NS no significant difference.

[0120] Figure 4 Comparison of the gene editing activities of TnpB-ωRNA, TnpB-ωRNA*, SaCas9, and SpCas9 in N2a is shown.

[0121] Figure 5 Statistics (a-d) of the targeting efficiencies of TnpB-ωRNA / ωRNA* at Tyr, Klkb1, Hpd, and Pcsk9 in N2a cells and comparison of the targeting efficiencies (e) are shown.

[0122] Figure 6 Statistics (a-d) of the targeting efficiencies of AAV-delivered TnpB-ωRNA / ωRNA* at Klkb1, Pcsk9, and Hpd in vivo are shown.

[0123] Figure 7Shows the treatment of lethal liver diseases by single AAV in vivo delivery of TnpB-ωRNA. a. Schematic of the AAV-TnpB-ωRNA / ωRNA* vector and gene therapy in the Fah- / - mouse model of type I hereditary tyrosinemia. b. Survival curves of diseased mice treated with AAV-TnpB-ωRNA / ωRNA* and AAV-TnpB (containing only TnpB without ωRNA). c. Body weight changes of diseased mice in different treatment groups during the observation period. d. Body weight ratio of the TnpB-ωRNA group or TnpB group relative to the TnpB-ωRNA*t group within 19 days after removal of NTBC. e. Histological analysis after staining the livers of mice from different groups with H&E and Sirius Red Staining. f. Western blot analysis of HPD protein in untreated and TnpB-ωRNA-treated HT1 mice. Data are presented as means±SEM. One dot represents one biological replicate. Significance differences under different conditions are indicated by asterisks. Unpaired two-tailed t-test. *P<0.05, ***P<0.001, NS no significant difference. Scale bar, 200 μm.

[0124] Figure 8 a-b show the comparison of the therapeutic efficacy of TnpB and Un1Cas12f1 in HT1 mice.

[0125] Figure 9 Shows the immunostaining of the livers of mice treated with AAV-TnpB-ωRNA and gene editing analysis of HPD.

[0126] Figure 10 Shows the plasma and urine biochemical analysis of the livers of mice treated with AAV-TnpB-ωRNA.

[0127] Figure 11 Shows the gene editing efficiency of TnpB from different sources. a. Schematic of the flow for screening ISAam1 / ISTva1 / ISNsp1 / ISBla1 / SpuFz1 targeting human DMD by flow cytometry. b. Statistical situation of the editing efficiency of different editing tools. c. Genotypes of the targeting sites of ISTva1 and ISBla1.

[0128] Figure 12Shows the engineering of TnpB-related ωRNA to improve gene editing efficiency. a. Schematic diagram of the process for verifying the engineered ISAam1-ωRNA using a reporter system. b. Schematic diagram of the predicted structure of ISAam1-ωRNA by RNAfold. c. and d. Efficiency of different ISAam1-ωRNAs after modification of the reporter system. e. Schematic diagram of the predicted structure of ωRNA-v1 by RNAfold. f. Efficiency of different ωRNA-v1s after modification. g. Schematic diagram of ωRNA-v2 after modification.

[0129] Figure 13 Shows the versatility of the engineered ωRNA. a. Schematic diagram of the process for verifying the engineered ωRNA using a reporter system. b. Schematic diagram of the predicted secondary structure of ISAam1-ωRNA by RNAfold. c. Schematic diagram of the predicted secondary structure of ISBla1-ωRNA by RNAfold. d. ωRNA* structure of ISDra2 after modification of the reporter system. e. Cleavage efficiency of connecting ωRNA* of ISDra2 to ISAam1 and ISBla1.

[0130] Figure 14 a-b show the analysis results of TnpB and SpCas9 antibodies in human blood. Detailed implementation

[0131] After extensive and in-depth research, the present inventors have developed for the first time a modified TnpB-ωRNA gene editing system and its uses. Specifically, the present invention provides a modified TnpB-related ωRNA backbone. The present invention discovers that the TnpB-related ωRNA presents a secondary structure feature of a multi-stem-loop structure, and truncating one or more stem-loop structure fragments starting from the 5'-end in the natural ωRNA backbone has basically no negative impact on gene editing efficiency. The present invention provides a modified ωRNA backbone having at least three stem-loop structure fragments, which has a shorter length and a more compact structure than the natural ωRNA backbone, and thus can be co-loaded with TnpB on a single vector (such as an AAV vector), improving the administration efficiency and achieving high-efficiency gene editing. On this basis, the present invention is completed.

[0132] Terms

[0133] To facilitate a better understanding of the present invention, certain technical and scientific terms are specifically defined below. Unless otherwise clearly defined herein, all other technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the art to which the present invention pertains. Before describing the present invention, it should be understood that the present invention is not limited to the specific methods and experimental conditions described, as such methods and conditions may vary. It should also be understood that the terms used herein are for the purpose of describing specific embodiments only and are not intended to be limiting, and the scope of the present invention will be limited only by the appended claims.

[0134] As used herein, when referring to a specifically recited numerical value, the term "about" means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes all values between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0135] As used herein, the terms "comprising", "including", "containing" are used interchangeably and include not only closed definitions, but also semi-closed and open definitions. In other words, the said terms include "consisting of" and "consisting essentially of".

[0136] As used herein, the components of the term "pharmaceutically acceptable carrier" refer to substances that are suitable for humans and / or animals without excessive adverse side effects (such as toxicity, irritation, and allergic reactions), that is, substances with a reasonable benefit / risk ratio.

[0137] As used herein, the term "therapeutically effective amount" refers to an amount that produces a function or activity in humans and / or animals and is acceptable to humans and / or animals. Those of ordinary skill in the art should understand that the said "therapeutically effective amount" may vary depending on factors such as the form of the pharmaceutical composition, the route of administration, the excipients of the drug used, the severity of the disease, and the combination with other drugs.

[0138] TnpB

[0139] As used in the present invention, the term "TnpB protein" refers to a transposon-related RNA-guided endonuclease. Recent biochemical studies have demonstrated that TnpB is the ancestor of the Cas12 effector protein in the type V CRISPR system, and a non-coding RNA (referred to as ωRNA, also known as reRNA) consisting of 247 nucleotides (nt) from the right end of the transposon element is a component required for TnpB to recognize and cleave target DNA. TnpB, which has only about 400 amino acid (aa) residues, is much smaller than its evolutionarily descendant protein Cas12 (mostly 1000 aa). Moreover, in vitro studies have shown that TnpB exhibits double-stranded DNA cleavage activity programmed by ωRNA. Therefore, the existence of this TnpB has the potential for genome editing and therapeutic applications.

[0140] In the present invention, in order to further optimize the TnpB system, TnpB-related ωRNAs were gradually engineered to identify the best ωRNA variants with the shortest sequence length and significantly improved gene editing activity compared to natural ωRNAs. Importantly, the optimized TnpB-ωRNA system can correct the disease phenotype in a tyrosineemia mouse model through single AAV in vivo delivery. Therefore, the present invention provides an engineered ultra-compact TnpB system with universal applicability in in vitro and in vivo genome editing.

[0141] The TnpB protein is mainly derived from the IS200 / 605 prokaryotic transposon family. The ωRNA (also known as reRNA) backbone related to the TnpB protein has a completely overlapping 3'-end with the RE sequence of the IS200 / IS605 transposon; while the TAM sequence is the same as the insertion site sequence upstream of the transposon. The TnpB system includes three major elements related to RNA-mediated editors: nuclease, gRNA backbone (ωRNA), and TAM sequence. It has been experimentally confirmed in the present invention that the ISDra2-ωRNA* structure can be applied to TnpB proteins from different sources. Therefore, the optimized TnpB-related ωRNAs of the present invention are applicable to TnpB proteins from multiple sources, including but not limited to ISDra2, ISBla1, ISTva1, ISNsp1, ISAam1, or combinations thereof.

[0142] ωRNA backbone

[0143] The present invention provides a class of ωRNA backbones.

[0144] As used in the present invention, the term "ωRNA" refers to the guide RNA used to direct the binding of the TnpB protein to a specific target nucleic acid in the genome in the TnpB system. The ωRNA contains an ωRNA backbone and a targeting segment.

[0145] As used in the present invention, the term "ωRNA backbone" refers to the part of the ωRNA that assembles with the nuclease (TnpB) to form a complex. Under natural conditions, the ωRNA backbone related to the TnpB protein has a completely overlapping 3'-end with the RE sequence of the IS200 / IS605 transposon. The ωRNA backbone of the present invention can be obtained by modifying the natural ωRNA backbone or can be screened from artificially constructed sequences.

[0146] The ωRNA backbone of the present invention contains at least 3 stem-loop structure fragments (SL fragments). In one embodiment, the ωRNA backbone of the present invention consists of 3, 4, 5, or 6 SL fragments. The SL fragments can be linked by bonds or connected by linkers. The length of the linker can be 1-6 nt, preferably 1-4 nt.

[0147] As used in the present invention, the term "stem-loop structure fragment" refers to a fragment having the structure shown in Formula I:

[0148] Seq 正向 -X-Seq 反向 (I),

[0149] wherein,

[0150] Seq 正向 and Seq 反向 are complementary or substantially complementary nucleotide sequences;

[0151] X is a spacer sequence located between Seq 正向 and Seq 反向 , and the spacer sequence is not complementary to Seq 正向 and Seq 反向 .

[0152] The "stem" in the stem-loop structure fragment of the ωRNA backbone of the present invention refers to a double-strand formed by base complementary pairing between Seq 正向 and Seq 反向 . The complementary pairing can be complete or incomplete, that is, there may be some unpaired bases in Seq 正向 and Seq 反向 . These unpaired bases may form bulges, but do not affect or substantially affect the formation of the overall stem-loop structure. In a preferred embodiment, in Seq 正向 and Seq 反向 , ≥60% (preferably ≥70%, ≥80%, ≥85%, ≥90%, ≥95%, ≥97% or ≥99%) of the bases can form a double-strand through complementary pairing.

[0153] The two nucleic acid strands (Seq 正向 and Seq 反向 ) constituting the "stem" can have the same or different lengths. In the ωRNA backbone obtained by modifying the natural ωRNA backbone, the "stem" can be truncated. The length of the "stem" refers to the total number of bases from the first base participating in complementary pairing at the 5'-end to the last base participating in complementary pairing in Seq 正向 . In one embodiment, the length of the "stem" is at least 4 bp. In one embodiment, the "stem" has at least 4 pairs of complementary pairing bases.

[0154] In the ωRNA backbone obtained by modifying the natural ωRNA backbone, nucleotide substitution can be performed on the "stem". For example, one or more G:U base pairs in the "stem" of the natural stem-loop structure can be replaced with G:C base pairs.

[0155] In the ωRNA backbone stem-loop structure fragment of the present invention, the "loop" refers to the unpaired single-stranded region formed by the spacer sequence X. The length of the "loop" part can be ≤5 nt. In one embodiment, the "loop" part may include, or be composed of, the sequence shown as 5'-GAAA-3'.

[0156] In the ωRNA backbone obtained by modifying the natural ωRNA backbone, nucleotide substitution can be performed on the "loop". For example, the part or all of the "loop" in the natural stem-loop structure can be replaced with the GAAA sequence.

[0157] As used in the present invention, the term "targeting segment" refers to the fragment in ωRNA that specifically binds to the target sequence. In some embodiments of the present invention, the targeting segment is located at the 3'-end of ωRNA. The length of the targeting segment can be 18-30 nt; preferably 20-24 nt, such as 20, 21, 22, 23, or 24 nt. The targeting segment and the ωRNA backbone can be connected by a linker. The length of the linker can be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nt.

[0158] ωRNA backbone construction method

[0159] The present invention provides a method for obtaining the ωRNA backbone of the present invention. The construction method of the present invention can be based on the modification of the natural ωRNA backbone, or can be based on the screening of artificial constructed sequences.

[0160] In one embodiment, the construction method of the present invention is based on the modification of the natural ωRNA backbone, and it includes the steps:

[0161] 1) Provide a wild-type TnpB-related ωRNA backbone;

[0162] 2) Remove one or more stem-loop structure fragments starting from the 5'-end of the wild-type ωRNA, so as to obtain a modified ωRNA backbone,

[0163] wherein, the modified ωRNA backbone retains at least 3 stem-loop structure fragments (SL fragments).

[0164] In one embodiment, the method may include replacing at least 1 (such as at least 3 or at least 5) G:U base pairs in one or more SL fragments with G:C base pairs.

[0165] In one embodiment, the method may include truncating Seq 正向 and / or Seq 反向 of one or more SL fragments. The length of the truncated fragment can be the original Seq 正向 and / or Seq 反向Up to 60%, up to 50%, up to 40%, up to 30%, up to 20%, or up to 10% of the length. Preferably, truncation can start from the base connected to the loop.

[0166] In one embodiment, the method may include truncating the spacer sequence X (i.e., the "loop" part) of one or more SL fragments. In one embodiment, the method may include replacing the spacer sequence X of one or more SL fragments with a sequence fragment containing GAAA or as shown by GAAA.

[0167] In another embodiment, the construction method of the present invention is based on screening artificial construction sequences, which includes the steps:

[0168] S1) Provide the ωRNA backbone sequence to be screened, and predict the secondary structure of the ωRNA backbone sequence;

[0169] S2) Determine whether the secondary structure has at least 3 stem-loop structures, so as to screen the ωRNA backbone that can be used in the TnpB gene editing system.

[0170] In one embodiment, if the secondary structure has at least 3 stem-loop structures, it is determined that the ωRNA backbone can be used in the TnpB gene editing system.

[0171] In the present invention, the structure prediction of the ωRNA backbone can be performed using RNAfold software or any other method known in the art.

[0172] Polynucleotides and vectors

[0173] The present invention provides polynucleotides encoding the ωRNA backbone or ωRNA of the present invention. The present invention also provides vectors containing the polynucleotide.

[0174] In some embodiments, the vector of the present invention may further contain a polynucleotide encoding the TnpB protein or a variant thereof. In some embodiments, the vector of the present invention may further contain a polynucleotide of one or more donor templates for homologous recombination repair. The nucleic acids encoding ωRNA, TnpB protein, and donor polynucleotides may be located in the same vector or different vectors.

[0175] The terms "polynucleotide" and "nucleic acid" are used interchangeably herein and refer to polymeric forms of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. Thus, the term includes, but is not limited to, single-stranded, double-stranded or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids or polymers comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural or derivatized nucleobases. The terms "polynucleotide" and "nucleic acid" are understood to include single-stranded (such as sense or antisense strands) and double-stranded polynucleotides as may be appropriate for the described embodiments. "Sequence identity" between two nucleic acid sequences refers to the percentage of the number of identical residues between the sequences out of the total number of residues, and the calculation of the total number of residues is determined based on the type of mutation.

[0176] The term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it is linked. It is a replicon, such as a plasmid, phage or cosmid, into which another DNA segment can be inserted to effect replication of the inserted segment. Generally, a vector is capable of replication when combined with appropriate control elements. In some cases, a vector system comprises a single vector. Alternatively, a vector system comprises multiple vectors. A vector can be a viral vector.

[0177] Vectors include, but are not limited to, single-stranded, double-stranded or partially double-stranded nucleic acid molecules; nucleic acid molecules comprising one or more free ends, no free ends (such as circular); nucleic acid molecules comprising DNA, RNA or both; and other polynucleotide variants known in the art. One type of vector is a "plasmid", which refers to a circular double-stranded DNA loop into which other DNA segments can be inserted, for example, by standard molecular cloning techniques. Another type of vector is a viral vector, in which DNA or RNA sequences of viral origin are present in the vector for packaging into a virus (such as retroviruses, replication-defective retroviruses, adenoviruses, replication-defective adenoviruses and adeno-associated viruses). Viral vectors also include polynucleotides carried by the virus for transfection into host cells. Some vectors are capable of autonomous replication in the host cells into which they are introduced (such as bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). After introduction into host cells, other vectors (such as non-episomal mammalian vectors) are integrated into the genome of the host cell and thus replicated along with the host genome. In addition, some vectors are capable of directing the expression of genes operably linked thereto. Such vectors are referred to herein as "expression vectors". Vectors that are expressed in eukaryotic cells and vectors that result in expression in eukaryotic cells may be referred to herein as "eukaryotic expression vectors". Common expression vectors useful in recombinant DNA technology are generally in the form of plasmids.

[0178] The recombinant expression vector may contain the nucleic acid of the present invention in a form suitable for expressing the nucleic acid in a host cell, which means that the recombinant expression vector contains one or more regulatory elements that can be selected according to the host cell to be used for expression, and the nucleic acid is operably linked to the nucleic acid sequence to be expressed. In the recombinant expression vector, "operably linked" is intended to mean that the target nucleotide sequence is linked to the regulatory element in a manner that allows the nucleotide sequence to be expressed (e.g., in an in vitro transcription / translation system or in a host cell when the vector is introduced into the host cell). Advantageous vectors include lentiviruses and adeno-associated viruses, and the types of these vectors can also be selected to target specific types of cells.

[0179] Compositions and complexes

[0180] The present invention also provides compositions or complexes for gene editing. In one embodiment, the composition contains the ωRNA and TnpB protein of the present invention. The TnpB protein can be a wild-type (full-length) TnpB protein or a truncated variant thereof. The TnpB protein in the composition has nuclease activity, for example, capable of cleaving DNA or RNA. In some instances, the composition further contains one or more donor template polynucleotides for homologous recombination repair. In some embodiments, two or more components in the compositions herein can form a complex. For example, the components are independent molecules but interact directly or indirectly with each other.

[0181] The term "target sequence" or "target nucleic acid" refers to the target gene locus or fragment to be edited, and the targeting segment of the ωRNA is designed to be a sequence complementary thereto. Hybridization between the target sequence and the targeting segment of the ωRNA promotes the formation of a complex targeting DNA or RNA. Complete complementarity is not necessarily required, as long as there is sufficient complementarity to cause hybridization and promote the formation of a complex targeting the nucleic acid. The target sequence can contain RNA polynucleotides. In one embodiment, the target sequence is located in the nucleus or cytoplasm of a cell. In one embodiment, the target sequence can be in an organelle of a eukaryotic cell, such as a mitochondrion or a chloroplast. The sequence that can be used for recombination into the targeted locus containing the target sequence is called a "template". In one aspect, the recombination is homologous recombination.

[0182] In one embodiment, the formation of a complex targeting a nucleic acid (comprising an ωRNA hybridized to a target sequence and complexed with an effector protein TnpB for one or more target nucleic acids) results in the cleavage of one or both nucleic acid strands in or near the target sequence (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50 or more base pairs therefrom). In one embodiment, one or more vectors driving the expression of one or more elements of the nucleic acid targeting system are introduced into a host cell such that the expression of these elements of the nucleic acid targeting system can direct the formation of the complex targeting the nucleic acid at one or more target sites. For example, the effector protein TnpB and ωRNA targeting the nucleic acid can each be operably linked to separate regulatory elements on separate vectors. Alternatively, two or more of these elements expressed from the same or different regulatory elements can be combined in a single vector.

[0183] Kit and method

[0184] The present invention provides a kit for gene editing, which kit comprises the ωRNA of the present invention, or its coding nucleic acid or vector. The kit may further comprise the TnpB protein.

[0185] The components contained in the kit of the present invention can be suitable for any container well-known in the art, and the components in the kit can be located in the same or different containers.

[0186] The kit of the present invention also provides a specific buffer. The buffer is a buffer well-known in the art, including but not limited to Tris buffer, HEPES buffer, phosphate buffer and combinations thereof. In certain embodiments, such buffers also have specific ionic components, such as iron ions, magnesium ions, etc.

[0187] In addition, the kit of the present invention may further comprise other reagents, such as reagents required for amplification, reagents required for reverse transcription, reagents required for transcription, or combinations thereof. Typical examples of other reagents include but are not limited to: primers, dNTPs, rNTPs, polymerases, isothermal amplification enzymes, reverse transcriptases, transcriptases, RNase inhibitors, deionized water, etc.

[0188] Accordingly, various aspects of the present invention also encompass methods and uses of the compositions and systems described herein in genome engineering, such as for altering or manipulating the expression of one or more genes or one or more gene products in prokaryotic or eukaryotic cells in vitro, in vivo or ex vivo. In some examples, the target nucleic acid is a target sequence within genomic DNA (including nuclear genomic DNA, mitochondrial DNA or chloroplast DNA).

[0189] The present invention provides a method for gene editing, the method comprising delivering the composition, complex or vector of the present invention to a cell or cell population comprising a target nucleic acid. Gene editing can result in modification of the gene product or modification of the amount or expression of the gene product. In some instances, the target sequence of the polynucleotide is a disease-related target sequence.

[0190] The main advantages of the present invention include:

[0191] 1) The present invention provides an ωRNA backbone modified based on the natural ωRNA backbone, which has a shorter length and a compact structure compared to the natural ωRNA backbone, and thus can be co-loaded with TnpB in a single AAV vector, improving the administration efficiency and achieving high-efficiency gene editing.

[0192] 2) The present invention discovers that the TnpB-related ωRNA presents a secondary structural feature of a multi-stem-loop structure, and truncating one or more stem-loop structure fragments starting from the 5'-end in the natural ωRNA backbone has basically no negative impact on the gene editing efficiency. Based on this, the present invention provides a method for screening potential ωRNAs applicable to the TnpB gene editing system and artificially constructed ωRNAs.

[0193] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions noted in the following embodiments are usually in accordance with conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or in accordance with the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are by weight percentage and weight parts.

[0194] Materials and Methods

[0195] Plasmid Construction

[0196] The pCBh-TnpB-hU6-BpiI plasmid encodes codon-optimized human TnpB driven by the CBh promoter and ωRNAs driven by hU6 with a BpiI cloning site. sgRNAs and ωRNAs applicable to Un1Cas12f1, TnpB and other Cas proteins are designed, and then DNA oligonucleotides are synthesized and cloned into pCAG-Un1Cas12f1 or pCAG-TnpB to obtain CRISPR targeting plasmids. The AAV9 vector is used in this study.

[0197] Cell Culture, Transfection and Flow Cytometry Analysis

[0198] HEK293T cells were maintained in Dulbecco's modified eagle medium (DMEM) (Gibco, 11965092) supplemented with 10% fetal bovine serum in a humidified incubator at 37°C with 5% CO2. For gene editing analysis, 1 μg of TnpB or CRISPR plasmid and a reporter plasmid were co-transfected using polyethyleneimine (PEI) transfection reagent. After culturing the transfected cells for 48 hours, the cell pellet was resuspended and then analyzed and sorted using BD FACSAria II for deep sequencing. Flow cytometry analysis was performed using FlowJo X (v.10.0.7).

[0199] In vitro transcription of TnpB and ωRNA

[0200] Transcription was performed using the mMESSAGE mMACHINE T7 Ultra kit (Invitrogen, AM1345). Forward and reverse primers were constructed, and PCR was performed using pCX2280 to amplify the ωRNA template and add the T7 promoter to the ωRNA template. The PCR product was purified using the Omega gel extraction kit (Omega, D2500-02), and transcription was performed using the MEGAshortscript Kit (Invitrogen, AM1354) with the product as the template. TnpB mRNA and ωRNA were purified using the MEGAclear Kit (Invitrogen, AM1908), eluted with RNase-free water, and stored at -80°C.

[0201] Zygote injection and embryo transfer

[0202] Eight-week-old B6D2F1 female mice were superovulated and then mated with B6D2F1 male mice. Zygotes were collected from the oviduct. A mixture of TnpB mRNA (50 ng / μL) and ωRNA (100 ng / μL) was injected into the cytoplasm of the zygotes using a FemtoJet microinjector (Eppendrof). The injected embryos were cultured in KOSM medium supplemented with amino acids in a humidified incubator at 37°C with 5% CO2 overnight and then transferred into the oviducts of pseudopregnant ICR surrogate mice at 0.5 days post coitum (0.5-d.p.c.).

[0203] Targeted deep sequencing

[0204] To analyze the editing efficiency of the TnpB gene, DNA was extracted from successfully transfected cells or tissues treated with AAV-TnpB-ωRNA using the TIANamp Genomic DNA Kit (TIANGEN) according to the manufacturer's operating guidelines. Then, it was amplified using Phanta max High-Fidelity DNA Polymerase (Vazyme, P505-d1) for Sanger or deep sequencing methods. Deep DNA sequencing libraries were generated by adding Illumina flow cell binding sequences and specific barcodes to the 5′ and 3′ ends of the primer sequences. The products were collected and sequenced using 150 bp paired-end sequencing on an Illumina Hiseq instrument. The FASTQ-formatted data was parsed using Cutadapt (v.2.8) according to the barcode sequences used.

[0205] CRISPResso2 was used for gene editing analysis.

[0206] PEM-seq analysis

[0207] Genomic off-target analysis was performed according to the conventional PEM-seq procedure in the art. 20 μg of genomic DNA from the TnpB editing group or the control group was fragmented using a Covaris shaker to generate DNA fragments of 300 - 700 bp. Biotinylated primers were used to label the 5′ ends of the DNA fragments with biotin through a round of PCR extension reaction. The remaining primers were removed using AMPure XP beads, and then purified using streptavidin beads. Single-stranded DNA on the streptavidin beads was ligated with a bridge adapter containing a 14 bp random molecular tag, and the PCR products were amplified by nested PCR to further enrich the DNA fragments containing induced DSB events. The products were labeled with Illumina adapter sequences. The prepared sequencing libraries were sequenced using 150 bp paired-end sequencing on a Hi-seq 2500.

[0208] AAV virus preparation

[0209] Adeno-associated virus serotype 8 (AAV8) was used in this study. Before packaging into the AAV8 vector, the TnpB plasmid with ωRNA was sequenced, and then the AAV vector was formed by transfecting HEK293T cells with the helper plasmid. The virus titer determined by qPCR targeting the terminal inverted repeats was 5×10 13 (AAV-TnpB-ωRNA) genome copies / mL.

[0210] Gene editing treatment of the tyrosinemia mouse model

[0211] Mice were housed in cages under a 12-hour light / dark cycle at 18 - 23 °C and 40 - 60% humidity. Food and water were available ad libitum. When specifically indicated, Fah - / - 10 mg / L of NTBC (Sigma-Aldrich, Cat. No. PHR1731) was added to the drinking water of the mice. When injecting virus particles, 200 μl of AAV8 (4 × 10 11 vg / mouse) in physiological saline was injected into male and female mice aged 8 - 10 weeks via the tail vein. After injection, the mice were placed in an environment without NTBC in the drinking water, and their body weights were recorded every 3 - 5 days. Mice were collected for histological and DNA analysis on day 75 without NTBC administration. Control mice without NTBC administration were collected and analyzed when their body weights decreased by more than 20%.

[0212] Histological analysis

[0213] Liver tissues were collected and fixed in 4% PFA overnight for tissue sectioning. The following antibodies were used: anti-HPD antibody (Santa Cruz, sc-390279; diluted 1:100), anti-P21 antibody (Abcam, ab109199; diluted 1:200), anti-dystrophin antibody (Abcam, ab15277; diluted 1:100), anti-laminin-2 antibody (Sigma-Aldrich, L0663; diluted 1:100). Immunohistochemistry, immunofluorescence, Sirius Red Staining, and hematoxylin and eosin staining (H&E) were performed according to standard operating procedures.

[0214] Serum and urine biochemistry

[0215] Blood was collected by retro-orbital puncture after sacrificing the mice. Urine was collected every 24 hours for a total of three times. Plasma tyrosine levels were measured on a high-performance liquid chromatograph (HPLC1200) according to standard procedures, and plasma ALT, AST, and total bilirubin levels were determined using diagnostic ELISA Kits (Abcam). Succinylacetone levels were measured using high-performance liquid chromatography (ACQUITY UPLC I-Class) coupled with a tandem mass spectrometer (AB Sciex API 4000 LC-MS / MS).

[0216] TnpB protein expression and purification

[0217] To express TnpB in Escherichia coli, a prokaryotic TnpB expression plasmid (pCX2691) was constructed by cloning the TnpB fragment into a pET2b-derived plasmid. Then the TnpB expression plasmid was transformed into Rosetta(DE3) competent cells, and the cells were grown in LB medium supplemented with ampicillin (100 μg / ml) at 37 °C. When the OD600 reached 0.6 - 0.8, TnpB expression was induced with IPTG. The induced cells were further cultured at 16 °C for 14 - 16 hours. Next, the bacteria were pelleted by centrifugation and resuspended in lysis buffer (20 mM Tris-HCl pH 7.0, 250 mM NaCl, 5 mM 2-mercaptoethanol, 25 mM imidazole, 2 mM PMSF and 5% (v / v) glycerol). After shaking, the cell lysate was centrifuged to remove cell debris, and the supernatant was loaded onto a Ni 2+ -HiTrap Chelating HP column (GE Healthcare). The TnpB protein was eluted with imidazole. The collected TnpB was dissolved in storage buffer (20 mM Tris-HCl (pH 8.0 at 25 °C), 250 mM NaCl, 2 mM DTT and 50% (v / v) glycerol) and stored at -20 °C for further use.

[0218] ELISA analysis of TnpB and SpCas9 antibodies

[0219] The ELISA procedure was performed using standard methods in the art. At 4 °C, a 96-well plate (0.5 μg / well) was coated with antigens (TnpB, spCas9, human albumin) in coating buffer. Then the wells of the plate were washed 5 times with TBST wash buffer for 3 minutes each time. Next, the plate was blocked with 5% bovine serum albumin (BSA) blocking solution at room temperature. Then the serum samples were diluted 50-fold with 1% BSA dilution solution, and the diluted samples were added to the wells of the 96-well plate and incubated with shaking at 37 °C for 1 hour (200 rpm). Next, the plate was washed as described before. Then a horseradish peroxidase HRP-conjugated goat anti-human IgG secondary antibody (Epigentek, cat# A-9000, diluted 1:5,000) was applied to the plate and incubated at room temperature for 1 hour. Next, 3,3',5,5'-tetramethylbenzidine substrate solution was added and developed for 15 minutes, and then sulfuric acid was added to terminate the reaction. The absorbance at 450 nm was measured using a SpectraMax i3X microplate reader. Adult serum was provided by the Reproductive Medicine Center of the International Peace Maternity and Child Health Hospital.

[0220] Immunoblotting

[0221] To detect HPD expression in mouse liver, mouse liver tissues were first incubated in RIPA Lysis and Extraction Buffer. Equal amounts of proteins were separated on SDS polyacrylamide electrophoresis gels. The primary antibodies were as follows: anti-HPD antibody (SantaCruz, sc-390279; diluted 1:500). To analyze the anti-TnpB / SpCas9 antibody, 1 μg aliquots of TnpB and 1 μg of SpCas9 were separately dissolved in buffer and then loaded onto a 10% SDS polyacrylamide electrophoresis gel for electrophoresis. The samples were then transferred to PVDF membranes and blocked with 5% BSA in TBST at room temperature for 1 hour. The blots were washed 3 times in TBST on a shaker for a total of 8 minutes and then incubated with a secondary antibody, horseradish peroxidase HRP-conjugated goat anti-human IgG, for 1 hour. After incubation with a chemiluminescent substrate (#WP20005, Invitrogen), the membranes were evaluated and observed using Image Lab TM Software.

[0222] Statistical analysis

[0223] The number of independent biological replicates is shown in the figures. Data are presented as mean ± SEM. Unpaired two-tailed t-tests were used to evaluate differences. P < 0.05 was considered to be statistically significant (*P < 0.05, **P < 0.01, ***P < 0.001, ****, P < 0.0001)

[0224] Example 1 Evaluation of TnpB gene editing activity

[0225] To investigate the mammalian gene editing potential of TnpB, several genomic loci were selected to evaluate the editing activity of ISDra2 TnpB from Deinococcus radiodurans (hereinafter referred to as TnpB).

[0226] First, ωRNA targeting the mouse Tyr gene was transcribed in vitro and co-injected with TnpB mRNA into mouse embryos ( Figure 1 b). The injected embryos were then transferred into surrogate female mice to generate gene-edited offspring. Since the Tyr gene makes the fur of C57BL / 6 mice black, it was expected that the efficiency of TnpB-induced gene disruption could be evaluated by directly observing the color change of the mice in TnpB-injected mice. It was found that TnpB treatment completely changed all newly born mice from black to albino white ( Figure 1 c). In contrast, similar embryo injections using Un1Cas12f1 and sgRNA targeting the Tyr gene did not change the color of the newly born miceFigure 1 c), indicating that the disruption efficiency of Un1Cas12f1 on the Tyr gene is significantly lower than that of TnpB.

[0227] Further deep sequencing of the Tyr gene showed that Un1Cas12f1 and TnpB achieved 20% and 90% indel mutations respectively ( Figure 1 b). Although the target adjacent motifs (TAMs, also known as PAMs) that recognize the target sequences in Cas12f1 and TnpB are different, the inventors selected a region with a 17bp overlap (about 20bp) in the Tyr gene as the targeting sequences for both enzymes. Therefore, the higher editing efficiency presented by TnpB relative to Cas12f1 is mainly related to its intrinsic activity.

[0228] To further evaluate the gene editing activity of TnpB, 6 additional sites were selected in the mouse Dmd gene as targets in mouse embryos ( Figure 1 d). The ωRNA targeting these sites was co-injected with TnpB mRNA. The deep sequencing results showed that TnpB showed an average editing efficiency of 90% for these 6 sites in the Dmd gene ( Figure 1 d). Moreover, the above gene editing results were also confirmed by immunostaining of dystrophin protein specifically expressed in muscle tissue encoded by the Dmd gene. Contrary to wild-type mice, the expression of dystrophin was undetectable in the myocardium, diaphragm (DI), and tibialis anterior muscle (TA) of TnpB-treated mice ( Figure 1 e), indicating that the injection of TnpB and ωRNA completely disrupted the Dmd gene. Finally, these immunostaining results were also confirmed by protein immunoblotting (Western blotting) of dystrophin in different muscle tissues ( Figure 1 f). Therefore, the results indicate that TnpB has much stronger gene editing activity than Un1Cas12f1 in mammalian tissues.

[0229] Example 2 Construction and activity test of ωRNA variants related to TnpB

[0230] The native ωRNA or wild-type ωRNA (cognate ωRNA) derived from ISDra2 has a backbone size of 231 nt, which is much longer than the sgRNA backbones in most single-effector Cas proteins. To truncate and optimize ωRNA, first, the secondary structure of ωRNA was predicted using the RNAfold web server (http: / / rna.tbi.univie.ac.at / cgi-bin / RNAWebSuite / RNAfold.cgi), and a stepwise strategy for truncating ωRNA was adopted. According to the stem-loop structures in the predicted structure, ωRNA was divided into 6 parts, which were named S1 to S6 for the truncation experiments respectively ( Figure 2 b). To facilitate the screening of ωRNA variants, a gene-editing reporter format was designed by placing the TnpB-targeted DNA in a separated and frameshifted GFP gene, in which GFP can only be expressed after being repaired by single-strand annealing repair (SSA) following editing of the TnpB-targeted sequence ( Figure 2 a). The expression of the reporter gene was detected when using the native ωRNA, demonstrating that GFP expression can be activated under the condition of treatment with TnpB guided by ωRNA targeting the frameshift mutation in the GFP gene ( Figure 2 a).

[0231] To truncate and optimize ωRNA, S1 to S6 were deleted one by one first, and then the corresponding reporter gene expression was detected. The results showed that only deleting S4 or S6 abolished the activity of TnpB ( Figure 2 c), indicating that S1, S2, S3, and S5 are non-essential parts for the normal function of ωRNA. Moreover, deleting the sequence of S1 slightly increased the activity of TnpB ( Figure 2 c).

[0232] To test the effect of combinatorial deletion of S1 to S6, S2 to S5 were further deleted on the basis of the ωRNA variant with S1 deleted, and the reporter gene expression test was carried out. It was found that the ωRNA-v1 with S1, S2, and S3 deleted simultaneously not only supported the normal function of TnpB but also greatly improved the gene-editing efficiency ( Figure 2 d). These results suggest that S4 to S6 in the ωRNA sequence are decisive for the enzymatic activity of TnpB.

[0233] The secondary structure of the ωRNA with S1, S2, and S3 deleted combinatorially showed a typical stem-loop conformation, which has 3 distinguishable consecutive stem-loop (SL) domains, named SL1, SL2, and SL3 respectively ( Figure 2e). To further determine the effects of these three SL domains on TnpB activity, reporter assays were performed by iteratively removing SL1, SL2, and SL3. Additionally, two other ωRNA variants were prepared by partially deleting the SL2 subdomain ( Figure 2 g) or replacing G:U with G:C ( Figure 2 e, as indicated by the arrow).

[0234] The results showed that SL1, SL2, and SL3 are essential for the normal function of TnpB because variants lacking any single SL completely blocked the activation of the reporter gene ( Figure 2 f). However, partially replacing the SL2 domain with the 5’-GAAA-3’ loop sequence enhanced TnpB activity ( Figure 2 f). Replacing the G:U pairing with G:C pairing had no additional effect on TnpB activity ( Figure 2 f).

[0235] Based on these results, the optimal ωRNA variant ωRNA-v2 (or ISDra2-ωRNA*) with improved TnpB efficacy was finally identified. The predicted secondary structure of ωRNA* showed three compact stem-loop domains compared to the loose structural organization of the native ωRNA ( Figure 2 g).

[0236] According to the results of the ISDra2 TnpB functional domain analysis ( Figure 2 h), the C-terminal domain (CTD) of ISDra2 TnpB was gradually truncated to construct ISDra2 TnpB variants. The editing efficiency was tested using ISDra2-ωRNA* in combination with ISDra2 TnpB. The results showed that, compared to the wild-type ISDra2 TnpB (408aa), all C-terminal truncated ISDra2 TnpB variants showed a certain reduction in editing efficiency ( Figure 2 i). The following examples all used the wild-type (408aa) ISDra2 TnpB.

[0237] Example 3 Endogenous Gene Editing Test of the TnpB-ωRNA System

[0238] To further confirm the reporter assay results of ωRNA*, 14 endogenous genomic sites were selected in HEK293T to further evaluate its gene editing efficacy ( Figure 3 a). Among the 14 human test sites, compared to the original ωRNA, 10 target sites edited with ωRNA* showed a significantly increased TnpB gene editing efficiency ( Figure 3b). Meanwhile, to investigate whether ωRNA* has broad improvement activity in mammalian cells, the gene editing activities of TnpB-ωRNA and TnpB-ωRNA* were compared with those of SaCas9 and SpCas9 in mouse N2a cells. The results showed that the activity of TnpB-ωRNA* was similar to that of SaCas9 and slightly lower than that of SpCas9( Figure 3 c, Figure 4 ).

[0239] Further gene editing studies targeting four disease-related genes, Klkb1, Tyr, Hpd, and Pcsk9, were conducted in mouse N2a cells. It was found that ωRNA* showed significantly higher gene editing efficiency than the original ωRNA at all genomic loci( Figure 5 ). Statistical analysis showed that the gene editing efficacy of ωRNA* was twice that of wild-type ωRNA in N2a( Figure 5 ). More particularly, ωRNA* could even support TnpB to edit at some sites where the editing efficiency of natural ωRNA was very low. Moreover, TnpB-ωRNA and -ωRNA* were packaged with AAV to evaluate their gene editing efficiency in mice, and the results also confirmed that TnpB-ωRNA* had significantly improved efficacy in vivo( Figure 6 ). Therefore, the gradually modified ωRNA* showed enhanced TnpB targeting activity both in vitro and in vivo.

[0240] Example 4 Characterization of TnpB off-target activity

[0241] To study the off-target effect of TnpB, when designing ωRNA targeting the target site in the Hpd gene, potential off-target genomic sites were predicted using Cas-OFFinder16 for off-target analysis( Figure 3 d). Among the top 10 predicted off-target sites, no gene editing events caused by TnpB-ωRNA targeting Hpd were detected( Figure 3 d). Also, genomic-level off-target analysis was performed using PEM-seq17, which identifies potential translocations between target and non-target sites. The PEM-seq results showed that no chromosomal translocations occurred when engineering TnpB-ωRNA was used to edit the Hpd gene( Figure 3 e).

[0242] The results showed that the TnpB-ωRNA editing system had high specificity, with a low or no off-target rate.

[0243] Example 5 Treatment of fatal liver disease by in vivo delivery of TnpB-ωRNA via a single AAV

[0244] Given the extremely compact size of TnpB, it is highly conducive to in vivo delivery via a single AAV for gene editing therapy. To uncover this potential in disease intervention, Hpd was selected as the therapeutic target for gene editing therapy of type I hereditary tyrosinemia (HT1) in the Fah- / - mouse model. Adult Fah- / - mice were administered AAV-TnpB (containing only TnpB, without ωRNA), AAV-TnpB-ωRNA, or AAV-TnpB-ωRNA*( Figure 7 a). Subsequently, without administering the p-hydroxyphenylpyruvate dioxygenase (HPD) inhibitor nitisinone (NTBC) to the mice, the therapeutic effect of gene editing was observed.

[0245] The results showed that all Fah- / - mice treated with AAV-TnpB-ωRNA and -ωRNA* remained alive on day 75 without the administration of NTBC, but all mice in the experimental group treated with only TnpB had died by approximately day 65( Figure 7 b). Moreover, the body weight of Fah- / - mice treated with AAV-TnpB-ωRNA increased after a short period of weight loss( Figure 7 c, d). Notably, the mice in the AAV-TnpB-ωRNA* treatment group did not show weight loss( Figure 7 c, d), indicating a better therapeutic effect compared to wild-type TnpB-ωRNA. Additionally, although treatment with Un1Cas12f1 could also rescue HT1 mice, the weight loss it caused was more obvious than that of AAV-TnpB-ωRNA and -ωRNA*( Figure 8 ). Mice not treated with ωRNA showed rapid weight loss until death( Figure 7 c).

[0246] The results indicate that improving gene editing activity with engineered ωRNA* can enhance the therapeutic effect on diseases.

[0247] To investigate the therapeutic effect presented by gene editing treatment histologically, H&E and Sirius Red Staining were performed, and it was found that the pathological fibrosis in the livers of TnpB-ωRNA / ωRNA* mice was significantly reduced, while a large amount of liver fibrosis occurred in mice not treated with ωRNA( Figure 7 e).

[0248] Meanwhile, the expression of HPD in treated and untreated mice was also analyzed. The results showed that the HPD protein was significantly reduced in mice treated with AAV-TnpB-ωRNA, and there were a large number of HPD-negative liver regions in vivo( Figure 9a, b). To study the gene editing results in vivo, mouse liver tissues were collected for deep gene sequencing analysis. The results showed that AAV-TnpB-ωRNA and AAV-TnpB-ωRNA* treated mice showed 20% and 60% indels respectively within 1 month ( Figure 9 c, d). Consistent with this, the liver metabolic function was also significantly alleviated after AAV-TnpB-ωRNA treatment, which could be shown by the blood biochemical results of alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin, and tyrosine ( Figure 10 a-d). The succinylacetone levels in TnpB-ωRNA treated mice were also analyzed, further confirming that TnpB-ωRNA treatment could significantly reduce the levels of succinylacetone in the plasma and urine of treated mice ( Figure 10 e, f), which was consistent with the performance of applying TnpB-ωRNA to treat HT1.

[0249] The above results verified that the use of a single AAV for in vivo delivery of engineered TnpB-ωRNA could achieve disease control.

[0250] Example 6 Identification of the TnpB homolog gene editing system

[0251] To evaluate the anti-TnpB immunity in the population, ELISA and immunoblot analyses were performed on human blood samples, and it was found that some individuals (but not all) did not have antibodies against TnpB in their bodies ( Figure 14 ), which was similar to SpCas9. Therefore, considering the natural diversity of TnpB, in order to improve the universality of the TnpB editing system in the population, more TnpB homologs need to be identified. The key element ωRNA of TnpB that targets and cleaves DNA is associated with transposons. Therefore, three TnpB enzymes, ISTva1, ISNsp1, and ISBla1, were predicted and mined through bioinformatics based on transposon information.

[0252] To identify the gene editing efficiency of TnpB enzymes derived from SpuFz1, ISAam1, ISTva1, ISNsp1, and ISBla1, human DMD was selected as the target, and TnpB-ωRNA targeting vectors carrying the mCherry reporter gene were constructed respectively. These vectors were transfected into HEK293T cells, and transfected positive cells were screened by flow cytometry, and DNA extraction and amplicon sequencing were performed to count their gene editing status ( Figure 11 a).

[0253] The results showed that TnpB derived from ISAam1 had relatively high targeting efficiency ( Figure 11b). Therefore, it was selected as a candidate gene editor for subsequent optimization.

[0254] Example 7 Modification and Identification of the ISAam1-TnpB-ωRNA System

[0255] The size of the natural ωRNA or wild-type (cognate ωRNA) backbone related to ISAam1-TnpB is 182 nt. Similar to Example 2, to achieve truncation and optimization of ωRNA, the secondary structure of ωRNA was first predicted. According to the stem-loop structures in the predicted structure, ωRNA was divided into 4 parts, named S1 to S4 respectively ( Figure 12 b). In the same way as the above method, the GFP reporter gene vector was used to identify the editing efficiency ( Figure 12 a).

[0256] First, S1 to S4 were deleted one by one in ωRNA, and then the corresponding reporter gene expression was detected. The results showed that the activity of TnpB could still be maintained after deleting S1 ( Figure 12 c), indicating that S1 is not an essential part for ωRNA to function normally.

[0257] To test the effect of combined deletion of S1 to S4, S2 to S4 were further deleted on the basis of the ωRNA variant with S1 deleted, and the reporter gene expression test was carried out. It was found that the deletion of other parts (S2, S3, and S4) except S1 would affect the normal function of TnpB ( Figure 12 d). These results suggest that S2 to S4 in the ωRNA sequence play a decisive role in the enzymatic activity of TnpB.

[0258] The secondary structure of ωRNA after deleting S1 also has 3 distinguishable consecutive stem-loop (SL) domains. The effect of partial replacement of the SL domain with the 5’-GAAA-3’ loop sequence on the activity of TnpB was further tested. The results showed that partial replacement of the 5’-GAAA-3’ loop sequence on the first SL domain from the 5' end (i.e., Figure 12 S1R1 in e) significantly reduced the cleavage activity of TnpB, and the replacement on the second SL domain (i.e., Figure 12 S2R1 in e) had a smaller effect on its activity, and a certain editing efficiency was still retained ( Figure 12 f).

[0259] The results suggest that the stem region of the stem-loop structure may need to have a certain minimum length to support the overall three-stem-loop conformation. Finally, through the above S2R1 modification, an 88-nt ωRNA-v2 (or ISAam1-ωRNA*) variant was obtained, which has three compact stem-loop domains compared with the loose structural organization of natural ωRNA ( Figure 12 g).

[0260] Example 8: Modified ωRNA backbone applicable to various TnpBs

[0261] To verify whether the modified ωRNA backbone of the present invention is applicable to different TnpB homologs, the modified ISDra2-ωRNA*(99nt) in the above examples was paired with TnpB enzymes from different sources, and the gene editing efficiency was tested using the GFP fluorescence gene reporter vector ( Figure 13 a). The wild-type ISAam1-ωRNA structure is as Figure 13 shown in b; the wild-type ISBla1-ωRNA structure is as Figure 13 shown in c, and the modified ISDra2-ωRNA* structure is as Figure 13 shown in d. After connecting the modified ISDra2-ωRNA* with ISAam1 and ISBla1, it was found that ISAam1 and ISBla1 could be cleaved, and their efficiency is as Figure 13 shown in e.

[0262] The results showed that ISDra2-ωRNA* is also applicable to TnpBs from ISAam1 and ISBla1 sources, suggesting that the modified ωRNA of the present invention has broad applicability and is helpful for the exploration and application of a new gene editing tool library for TnpB.

[0263] Sequence:

[0264] ISDra2 TnpBωRNA sequence (231bp) (SEQ ID NO:1):

[0265] ATTCAAGAATCCCGAAGTGAAGAATCTTGCCGTCCGTACATGGACTTGCCCGAACTGTGGGGAAACCCATGACCGAGACGAGAACGCTGCGCTGAACATTCGGCGTGAAGCGTTGGTGGCTGCGGGAATCTCAGACACCTTAAACGCTCATGGAGGCTATGTCAGACCTGCTTCGGCGGGCAATGGTCTGCGAAGTGAGAATCACGCGACTTTAGTCGTGTGAGGTTCAA

[0266] ISDra2 TnpBωRNA-v2 sequence (99bp) (SEQ ID NO:2):

[0267] GGTGGCTGCGGGAATCTCAGACACCTTAAACGCTCATGGAGGCTATg aaaATGGTCTGCGAAGTGAGAATCACGCGACTTTAGTCGTGTGAGGTTCAAISAam1 TnpB ωRNA sequence (182bp) (SEQ ID NO:3):

[0268] GACAGGGACGTCAATGCGGCAATCAATATCAAACATGAGGGCATGAAACGATTAGCAATAGCCTAACTTGTCCTCGAACCGTGGGACACACGGGGATCGCTCAGTCAACTTCCCGTCATGAGATGGGATTACCTGAGAAGCCCCCACCTCTAAGCGAAGCGTAGGTGGTGGGAGCATGTCAC

[0269] ISAam1 TnpB ωRNA-v2 sequence (88bp) (SEQ ID NO:4):

[0270] GACACGAACCGTGGGACACACGGGGATCGCTCAGgaaaCTGAGAAGC CCCCACCTCTAAGCGAAGCGTAGGTGGTGGGAGCATGTCAC

[0271] ISDra2 TnpB protein amino acids (408aa) (SEQ ID NO:5):

[0272] MIRNKAFVVRLYPNAAQTELINRTLGSARFVYNHFLARRIAAYKESGKGLTYGQTSSELTLLKQAEETSWLSEVDKFALQNSLKNLETAYKNFFRTVKQSGKKVGFPRFRKKRTGESYRTQFTNNNIQIGEGRLKLPKLGWVKTKGQQDIQGKILNVTVRRIHEGHYEASVLCEVEIPYLPAAPKFAAGVDVGIKDFAIVTDGVRFKHEQNPKYYRSTLKRLRKAQQTLSRRKKGSARYGKAKTKLARIHKRIVNKRQDFLHKLTTSLVREYEIIGTEHLKPDNMRKNRRLALSISDAGWGEFIRQLEYKAAWYGRLVSKVSPYFPSSQLCHDCGFKNPEVKNLAVRTWTCPNCGETHDRDENAALNIRREALVAAGISDTLNAHGGYVRPASAGNGLRSENHATLVV

[0273] ISDra2 TnpB protein amino acids (378 aa) (SEQ ID NO: 6):

[0274] MIRNKAFVVRLYPNAAQTELINRTLGSARFVYNHFLARRIAAYKESGKGLTYGQTSSELTLLKQAEETSWLSEVDKFALQNSLKNLETAYKNFFRTVKQSGKKVGFPRFRKKRTGESYRTQFTNNNIQIGEGRLKLPKLGWVKTKGQQDIQGKILNVTVRRIHEGHYEASVLCEVEIPYLPAAPKFAAGVDVGIKDFAIVTDGVRFKHEQNPKYYRSTLKRLRKAQQTLSRRKKGSARYGKAKTKLARIHKRIVNKRQDFLHKLTTSLVREYEIIGTEHLKPDNMRKNRRLALSISDAGWGEFIRQLEYKAAWYGRLVSKVSPYFPSSQLCHDCGFKNPEVKNLAVRTWTCPNCGETHDRDENAALNIRREALVAAGI

[0275] ISDra2 TnpB protein DNA sequence (378 aa) (SEQ ID NO: 7):

[0276]

[0277] All documents mentioned in this invention are cited herein by reference as if each individual document was cited by reference. In addition, it should be understood that after reading the above teachings of this invention, those skilled in the art can make various changes or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims of this application.

Claims

1. A modified ωRNA backbone for the TnpB gene editing system, characterized in that, The modified ωRNA backbone lacks one or more stem-loop structure fragments at the 5' end relative to the wild-type TnpB-ωRNA backbone, and the modified ωRNA backbone contains at least 3 stem-loop structure fragments (SL fragments).

2. The ωRNA backbone according to claim 1, characterized in that, Each of the SL fragments independently has the structure shown in Formula I below: Seq 正向 -X-Seq 反向 (I), In the formula, Seq 正向 and Seq 反向 are complementary or substantially complementary nucleotide sequences; X is the spacer sequence located between Seq 正向 and Seq 反向 , and the spacer sequence is not complementary to Seq 正向 and Seq 反向 .

3. The ωRNA backbone according to claim 1, characterized in that, The nucleotide sequence of the modified ωRNA backbone is as shown in SEQ ID NO: 2 or SEQ ID NO: 4, or has a sequence identity of ≥80%, ≥85%, ≥90%, ≥95%, ≥96%, ≥97%, ≥98% or ≥99% thereto.

4. A ωRNA, characterized in that, The ωRNA includes: i) the ωRNA backbone as described in claim 1; ii) a targeting segment that specifically binds to a target sequence.

5. A polynucleotide, characterized in that, The polynucleotide encodes the ωRNA backbone as described in claim 1 or the ωRNA as described in claim 4.

6. A carrier, characterized in that, The vector contains the polynucleotide as described in claim 5.

7. A composition or complex for gene editing, characterized in that, The composition or complex contains: A) the ωRNA as described in claim 4, the polynucleotide as described in claim 5 or the vector as described in claim 6; and B) TnpB protein or its analogue, or its expression vector.

8. Use of the ωRNA as described in claim 4, the polynucleotide as described in claim 5, the vector as described in claim 6, or the composition or complex as described in claim 7 in the preparation of i) a drug for treating a disease or ii) a kit for gene editing.

9. The use according to claim 8, wherein, The disease is selected from the group consisting of: liver diseases, Duchenne muscular dystrophy, amyotrophic lateral sclerosis (ALS), spinocerebellar ataxia (SCA), Huntington's disease (HTT), Angelman syndrome (AS), or a combination thereof.

10. A method for obtaining a modified ωRNA backbone as described in claim 1, characterized in that, Comprising the steps of: 1) providing a wild-type TnpB-related ωRNA backbone; 2) truncating one or more stem-loop structure fragments starting from the 5' end of the wild-type ωRNA to obtain a modified ωRNA backbone, wherein the modified ωRNA backbone retains at least 3 stem-loop structure fragments (SL fragments).

Citation Information

Cited By

  • One-pot rapid nucleic acid detection system based on SfaTnpB combined isothermal amplification technology and application of one-pot rapid nucleic acid detection system

    CN120425031A

  • Optimized omega RNA and gene editing application thereof

    CN120718906A

  • An optimized omega rna and its gene editing applications

    CN120718906B

  • Omega RNA for detecting bovine nodular skin disease virus, fluorescence detection kit, visual kit and application thereof

    CN121320353A

  • ωRNA detection kit, fluorescence detection kit, visualization kit and their applications for detecting bovine nodular dermatosis virus

    CN121320353B