An AAV vector containing a promoter of myelin protein zero for treating Schwann cell-related diseases such as Charcot-Marie-Tooth disease and its use

The use of AAV vectors with a minimal myelin-specific promoter allows for targeted gene therapy in Schwann cells, addressing the limitations of current treatments for CMT and other Schwann cell-related disorders by enhancing myelin production and improving disease outcomes.

JP7692369B2Active Publication Date: 2025-06-13THE CYPRUS FOUND FOR MUSCULAR DYSTROPHY RES
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
JP2021571874
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-06-03
Filing Date
2020-06-03
Publication Date
2025-06-13
Estimated Expiration
2040-06-03

AI Technical Summary

Technical Problem

Current treatments for Charcot-Marie-Tooth (CMT) disease and other Schwann cell-related disorders are limited, with no effective therapies available and existing viral vectors facing safety concerns and limitations in gene therapy approaches.

Method used

Development of an adeno-associated virus (AAV) vector system that specifically targets Schwann cells using a minimal myelin-specific promoter, enabling efficient delivery and expression of therapeutic polynucleotides, such as those encoding for Cx32 protein, to treat demyelinating neuropathies like CMT.

Benefits of technology

The AAV vector system achieves cell-type specific expression in Schwann cells, potentially leading to improved therapeutic outcomes for CMT and other Schwann cell-related diseases by enhancing myelin production and reducing disease symptoms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007692369000038
    Figure 0007692369000038
  • Figure 0007692369000039
    Figure 0007692369000039
  • Figure 0007692369000040
    Figure 0007692369000040
Patent Text Reader

Abstract

The present invention provides viral vectors for use in the treatment and prevention of Schwann cell-associated diseases by specifically delivering polynucleotides to Schwann cells and achieving Schwann cell-specific expression. The present invention has particular application in the treatment and prevention of Charcot-Marie-Tooth disease and other demyelinating neuropathies.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to viral vectors targeting Schwann cell-related diseases.

Background Art

[0002] Charcot-Marie-Tooth (CMT) disease encompasses many types of asymptomatic hereditary neuropathies, which together are considered one of the most common neurogenetic diseases, with a prevalence rate of 1 in 2500 in the general population (1, 2). CMT neuropathies are characterized by an increasing number of causative genes and the involvement of overlapping phenotypes caused by different genes. Furthermore, several different genes may cause the same phenotype. Despite the growing understanding of the complex genetic basis and diverse disease mechanisms underlying CMT neuropathies, currently there is no effective treatment for any form of CMT, and only symptomatic and supportive therapies can be provided to patients. Therefore, new treatment strategies for CMT are greatly needed. Over the past 20 years, efforts have been made to develop gene therapy for the treatment of CMT. Different gene therapy approaches are promising for the treatment of central nervous system and peripheral nervous system (PNS) diseases in the future, but several challenges remain to be overcome (3).

[0003] For example, (49) shows how it is possible to achieve a therapeutic effect in the treatment of CMT4C using a lentiviral vector. However, this effect is partial, and lentiviral vectors have limitations in terms of safety for human therapy in vivo. Previously, other vectors such as adeno-associated viral vectors (AAV) were not considered useful because of their maximum packaging capacity for inserts of approximately 4.4 kb in length, and the usefulness of AAV in gene therapy strategies was limited, especially when the gene to be replaced was relatively long, despite not being integrated into the host genome.

[0004] Gene therapy techniques targeting Schwann cells can be applied to many other diseases associated with Schwann cells other than CMT, including those caused by genetic factors and those not caused by genetic factors. Many of these diseases have multiple causes and are not well understood, so using viral vectors to target these diseases can be particularly advantageous.

[0005] Overall, there remains a need for improved methods of targeting diseases associated with Schwann cells, including demyelinating neuropathies such as CMT, to achieve better therapeutic effects.

Summary of the Invention

[0006] The inventors have developed, for the first time, a useful means of delivering a polynucleotide, such as a therapeutic polynucleotide, to Schwann cells of the peripheral nervous system (PNS) and driving the expression of the polynucleotide in Schwann cells in particular. The present invention can be applied to the treatment of diseases associated with Schwann cells and is considered particularly beneficial when applied to the treatment of demyelinating neuropathies such as Charcot-Marie-Tooth disease (CMT). However, the mechanism underlying the present invention is considered applicable to many other diseases that affect Schwann cells and is considered generally useful in any situation where delivery of a polynucleotide to Schwann cells is advantageous, for example, in the imaging of Schwann cells.

[0007] A feature of one aspect of the present invention is the use of an AAV vector to achieve transcription of a first nucleic acid that results in the production of a first polynucleotide of interest, particularly in Schwann cells of the PNS. In some embodiments, this cell-type specific expression is achieved using a myelin-specific promoter, and in some embodiments, this is achieved using a minimal myelin-specific promoter.

[0008] Another feature of the present invention is the provision of a minimal myelin-specific promoter, which, in some embodiments, is based on the sequence of the full-length myelin protein zero (Mpz) promoter. In some embodiments, viral vectors containing shorter minimal promoters enable larger nucleic acid sequences, such as those of therapeutic nucleic acids, to be included in the vector and delivered to Schwann cells. This has the advantageous property of providing a universal vector for delivering nucleic acids to Schwann cells, as current approaches are limited to genes that can be expressed from viral vectors due to their size, and is considered to be useful for treating a wide range of diseases.

[0009] [Detailed Description of the Invention]

[0010] The present invention is as defined by the claims.

[0011] The present invention generally provides viral vectors as described herein for use in medicine, and also provides methods of treatment including administration of a vector according to the present invention, for example, by any of the means described herein.

[0012] A first aspect of the present invention provides a viral vector for use in the treatment or prevention of a disease associated with Schwann cells. In some embodiments, the viral vector comprises a sequence of a first nucleic acid that can be transcribed into a first polynucleotide.

[0013] The viral vector can be any viral vector.

[0014] Viral vectors are well known in the art and include, by way of example and not limitation, adeno-associated viral vectors (AAV vectors), lentiviral vectors (e.g., those derived from human immunodeficiency virus (HIV)), and retroviral vectors (e.g., MMLV).

[0015] In some embodiments, the viral vector is an adeno-associated virus vector (AAV vector). In a preferred embodiment, the present invention provides an AAV vector for use in the treatment or prevention of a disease associated with Schwann cells, the AAV vector comprising a sequence of a first nucleic acid that can be transcribed into a first polynucleotide.

[0016] When the sequence of the first nucleic acid is transcribed, it is preferably transcribed, for example, in a target cell or a target organism. Accordingly, a further embodiment provides a viral vector for use in the treatment or prevention of a disease associated with Schwann cells, the viral vector comprising a sequence of a first nucleic acid that is transcribed into a first polynucleotide.

[0017] A further embodiment provides an AAV for use in the treatment or prevention of a disease associated with Schwann cells, the viral vector comprising a sequence of a first nucleic acid that is transcribed into a first polynucleotide.

[0018] The sequence of the first nucleic acid can be transcribed into the first polynucleotide in a target cell or a target organism, for example, in Schwann cells. Schwann cells can be in vivo, for example, in a mammalian organism, for example, a human, a cat, a dog, a mouse, a rabbit, a horse.

[0019] Schwann cells are glial cells of the peripheral nervous system (PNS), surround the axons of sensory and motor neurons, and produce the surrounding myelin sheath. The myelin sheath is composed of several protein components (e.g., myelin protein zero) and is an essential insulating component of neurons that enables the rapid conduction of nerve impulses (action potentials) along the nerve.

[0020] Some current virus vector-based therapeutic strategies utilize vectors with undesirable characteristics. For example, some virus vectors integrate into the host genome and can have clearly harmful consequences. Thus, in one embodiment, the virus vector is not a virus vector that integrates into the genome of the host cell, for example, it does not integrate into the nucleic acid of Schwann cells. In some embodiments, virus vectors that are not thought to integrate into the host genome are particularly preferred, including AAV and adenovirus vectors. AAV vectors infect target cells and the delivered genetic material does not integrate into the genome of the host cell. Instead, the delivered genetic material remains episomal.

[0021] Virus vectors that are thought to integrate into the host genome include retrovirus vectors, for example, lentivirus vectors. Thus, in one embodiment, the virus vector is not a vector that integrates into the host genome, for example, it is not a retrovirus vector, for example, it is not a lentivirus vector.

[0022] Some vectors are also unable to transduce Schwann cells. Those skilled in the art will understand the types of vectors that can and cannot transduce Schwann cells. Thus, in one embodiment, the virus vector of the present invention is not a virus vector that is unable to transduce Schwann cells. In some embodiments, the virus vector has the ability to transduce Schwann cells. "Transduce" means that the virus vector can infect a target cell and deliver the polynucleotide construct found therein to the target cell. Examples of such vectors include AAV and lentivirus vectors.

[0023] In one embodiment, the vector is a vector that can only incorporate inserts of a limited size before becoming unstable. For example, such vectors include AAV vectors.

[0024] Preferably, the viral vector is an AAV vector, and in some embodiments, the AAV vector is selected from the group consisting of or including AAV9 and AAVrh10. In particularly preferred embodiments, the AAV is AAV9.

[0025] Transcription of the first nucleic acid preferably occurs only or substantially only in Schwann cells. Thus, in some embodiments, the viral vector also includes a Schwann cell-specific promoter operably linked to the first nucleic acid.

[0026] The term "Schwann cell-specific promoter" includes the meaning of a promoter that results in significant expression in Schwann cells and no or low expression in non-Schwann cells. For example, a Schwann cell-specific promoter can drive high-level transcription from the first nucleic acid of Schwann cells (e.g., at least 95% of the total expression occurs in Schwann cells), but the expression of the first polynucleotide is low in other cell types, such as cell types of the central nervous system (e.g., less than 5% of the total expression occurs in cells other than Schwann cells). For example, in one embodiment, the ratio of transcription between Schwann cells and non-Schwann cells is at least 100:0, 95:5, 90:10, 85:15, 80:20, 75:25, 70:30, 65:35, 60:40, or 55:45.

[0027] In one embodiment, the level of transcription in Schwann cells is at least 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 250, 500, 750, 1000, 2500, 5000, 7500, 10000 times higher than in any other non-Schwann cells.

[0028] In one embodiment, the Schwann cell-specific promoter results in most of the expression that occurs in Schwann cells rather than in non-Schwann cells.

[0029] One of ordinary skill in the art will understand that even a very specific promoter may result in some expression in other cells or tissues. One of ordinary skill in the art is well aware of the differential expression levels between target and non-target cells or tissues that are required to classify a promoter as cell- or tissue-specific, e.g., Schwann cell-specific. For example, (66) and (67) show the identification of cell-specific promoters in the central nervous system (CNS). One of ordinary skill in the art will recognize that for a promoter to be cell-specific, it must contain regulatory elements (e.g., binding sites for transcription factors) that activate the promoter only in a specific cell type, and the promoter must be able to drive demonstrable expression of a reporter gene or other gene in vitro and in vivo.

[0030] Preferably, the Schwann cell-specific promoter results in transcription of the first nucleic acid at detectable levels only in Schwann cells. One of ordinary skill in the art is well aware of routine methods for detecting transcription, e.g., Northern blot, PCR-based techniques, and immunofluorescent labeling methods. In one embodiment, when detection is performed using Northern blot analysis, the Schwann cell-specific promoter results in detectable transcription of the first nucleic acid in Schwann cells, but not in non-Schwann cells, e.g., other cells of the peripheral nervous system or the brain, at detectable levels of transcription of the first nucleic acid. In another embodiment, when detection is performed using immunofluorescent labeling analysis with a cell marker, the Schwann cell-specific promoter results in detectable transcription of the first nucleic acid in Schwann cells, but not in non-Schwann cells, e.g., other cells of the peripheral nervous system or the brain, at detectable levels of transcription of the first nucleic acid.

[0031] For example, (32) and (33) show that Schwann cell-specific expression can be achieved both in vitro and in vivo using constructs driven by the full-length Mpz promoter using a lentiviral vector.

[0032] The Schwann cell-specific promoter, in some embodiments, includes a myelin-specific promoter. The term "myelin-specific promoter" generally refers to a promoter that drives the expression of a gene encoding a protein that constitutes the myelin sheath. Examples of myelin-specific promoters include, but are not limited to, the myelin protein zero (Mpz) promoter, the peripheral myelin protein 22 (PMP22) promoter, and the myelin-associated glycoprotein (Mag) promoter.

[0033] In some embodiments, the expression of the first polynucleotide is under the control of a full-length myelin protein zero (Mpz) promoter, such as the full-length rat myelin protein zero (Mpz) promoter, the sequence of which is defined in SEQ ID NO: 4. In some embodiments, the sequence of the Mpz promoter has at least 75% sequence homology or sequence identity with SEQ ID NO: 4, optionally at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with SEQ ID NO: 4.

[0034] It will be apparent to those skilled in the art that in some embodiments, it is preferred that the promoter sequence is derived from a human or humanized promoter sequence. In some embodiments, the expression of the first polynucleotide is under the control of a full-length human myelin protein zero (hP0) promoter, the sequence of which is defined in SEQ ID NO: 18. In some embodiments, the sequence of the hP0 promoter has at least 75% sequence homology or sequence identity with SEQ ID NO: 18, optionally at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with SEQ ID NO: 18.

[0035] As described above, it is considered advantageous when the promoter is as short as possible, especially in the case of vectors that can only accommodate limited insert sizes before becoming unstable. Thus, in some embodiments, the expression of the first polynucleotide is under the control of a promoter having a length of 100 bp to 1100 bp, and optionally, the promoter ranges in length from 200 bp to 900 bp, from 300 bp to 800 bp, from 400 bp to 700 bp, and optionally, the promoter is 500 bp to 600 bp in length, such as 410 bp in length. In the same or other embodiments, the promoter is less than 1100 bp in length, for example, less than 1000 bp, less than 900 bp, less than 800 bp, less than 700 bp, less than 600 bp, less than 500 bp, less than 400 bp, less than 300 bp, less than 200 bp, or less than 100 bp in length.

[0036] In some embodiments, the promoter is a naturally occurring Mpz promoter of the length defined herein. In alternative embodiments, the promoter is an engineered Mpz promoter of the length defined herein. A "naturally occurring promoter" means a promoter that has not been modified, shortened, or extended as compared to the corresponding promoter sequence found in wild-type Schwann cells. An "engineered promoter" means a wild-type promoter that has been modified in some way. For example, the sequence can be modified to have, for example, at least 75% sequence homology or sequence identity with a naturally occurring promoter sequence, optionally at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with a naturally occurring promoter sequence. In another or the same embodiment, the length of the promoter may also be modified. For example, the length of the wild-type promoter may be shortened from a longer sequence, for example, to a length of 100 bp to 1100 bp, optionally 200 bp to 900 bp, 300 bp to 800 bp, 400 bp to 700 bp, optionally 500 bp to 600 bp, for example, a length of 410 bp, or less than 1100 bp, for example, less than 1000 bp, 900 bp, 800 bp, 700 bp, 600 bp, 500 bp, 400 bp, 300 bp, 200 bp, or 100 bp.

[0037] In another embodiment, the length of the promoter may be increased as compared to the wild-type promoter.

[0038] One of ordinary skill in the art will understand that only a portion of a particular nucleic acid region that is considered to be a promoter may actually be required for promoter activity. In another example, the engineered promoter may contain a portion of the sequence of the wild-type promoter or may contain the entire sequence of the wild-type promoter as part of a longer promoter sequence. As described, preferably, the promoter is specifically active in Schwann cells. One of ordinary skill in the art can, for example, screen for the expression of a reporter gene in Schwann cells to determine whether a particular fragment of the full-length promoter results in Schwann cell-specific expression of the protein under the control of the promoter fragment. In some examples, the reporter gene is EGFP.

[0039] In another embodiment, the engineered promoter is a truncated form of the wild-type promoter and can have, for example, at least 75% sequence homology or sequence identity with the naturally occurring promoter sequence, optionally at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with the naturally occurring promoter sequence.

[0040] In addition to being a truncated form of the native promoter, the engineered promoter may additionally or alternatively contain mutations, substitutions, deletions, and insertions as compared to the native promoter sequence. For example, the engineered promoter may contain various different regions of the native promoter in one continuous sequence.

[0041] An engineered promoter that is shorter in length than the corresponding native or wild-type promoter may be referred to as a minimal promoter.

[0042] In some embodiments, the engineered promoter retains the same function as the corresponding naturally occurring promoter from which it is derived, i.e., it can still effectively drive the transcription of a polynucleotide sequence from the nucleic acid sequence to which the promoter is operably linked, and preferably, in a cell-specific manner, i.e., a Schwann cell-specific manner, can effectively drive transcription.

[0043] In some embodiments, the expression of the first polynucleotide can be under the control of, for example, a truncated naturally occurring myelin-specific promoter, referred to herein as the minimal myelin-specific promoter, optionally, which is the minimal myelin protein zero (Mpz) promoter. In some embodiments, the sequence of the minimal myelin-specific promoter comprises, or consists of, a 410 bp sequence defined in SEQ ID NO: 5, which is derived from the full-length rat Mpz promoter sequence. In some embodiments, the minimal myelin-specific promoter comprises, or consists of, a sequence having at least 75% sequence homology or sequence identity with SEQ ID NO: 5, optionally, at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with SEQ ID NO: 5.

[0044] In some embodiments, it is preferred that the minimal promoter is derived from a human or humanized promoter sequence. In some embodiments, the sequence of the minimal myelin-specific promoter comprises or consists of a 429 bp sequence defined in SEQ ID NO: 22, which is derived from the full-length human hP0 promoter sequence. In some embodiments, the minimal myelin-specific promoter has at least 75% sequence homology or sequence identity with SEQ ID NO: 22, optionally at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with SEQ ID NO: 22, and comprises or consists of a sequence having such identity or homology. The minimal myelin-specific promoter derived from rat Mpz or human hP0 is referred to herein as miniMpz.

[0045] "Sequence identity" or "sequence homology" means the sequence of identical base pairs in a particular DNA region. For example, in a sequence having 75% sequence homology or sequence identity to a reference sequence, 75% of the base pairs are identical.

[0046] The percent sequence identity between two polypeptides may be determined using a suitable computer program, such as the GAP program of the University of Wisconsin Genetic Computing Group, and it should be understood that the percent identity is calculated in relation to the polypeptides with the sequences optimally aligned.

[0047] The alignment may alternatively be performed using the Clustal W program (Thompson et al., (1994) Nucleic Acids Res 22, 4673-80). The parameters used may be as follows.

[0048] High-speed pairwise alignment parameters: K-tuple (word) size: 1, window size: 5, gap penalty: 3, number of top diagonals: 5. Scoring method: x percent. Multiple alignment parameters: gap opening penalty; 10, gap extension penalty; 0.05. Scoring matrix: BLOSUM In one embodiment, the minimal Mpz promoter described herein can be generated as described in Example 9, for example, by using a 410 base pair region upstream of the start codon of a full-length promoter, such as a full-length myelin protein zero (Mpz) promoter. In another embodiment, the minimal Mpz promoter described herein can be generated as described in Example 13. The AAV vector has a maximum capacity to carry a polynucleotide of about 4.4 kb, and thus, the use of the shorter Mpz promoter described herein rather than the full-length Mpz promoter of about 1.1 kb in length has the advantage that a longer first nucleic acid sequence can be operably linked to the promoter region for packaging into AAV. In some embodiments, the promoter is, for example, 100 bp to 1100 bp in length, 200 bp to 900 bp, 300 bp to 800 bp, 400 bp to 700 bp, 500 bp to 600 bp, or 410 bp in length, or less than 1100 bp in length, for example, less than 1000 bp, less than 900 bp, less than 800 bp, less than 700 bp, less than 600 bp, less than 500 bp, less than 400 bp, less than 300 bp, less than 200 bp, or less than 100 bp, such as an engineered promoter or a minimal promoter, whereby the present invention can be applied to a wider range of longer genes than AAV vectors utilizing full-length promoters. For example, currently, there are some situations where a nucleic acid sequence of a particular length, such as a gene, cannot be inserted into AAV because, in the case of a longer promoter, for example, when a full-length Mpz promoter is used, the nucleic acid length may exceed the maximum capacity of AAV. For example, the first nucleic acid, such as a therapeutic gene, is longer than 3.0 - 3.3 kb in length (4.4 kb - 1.1 kb = 3.3 kb). In this case, the use of the advantageous shorter promoters described herein, such as the minimal myelin-specific promoter, enables the present invention to be applied, for example, to the replacement of larger genes such as the SH3TC2 gene that causes Charcot-Marie-Tooth type 4C (CMT4C) of about 3.9 kb in length.Other Schwann cell-related genes that may be close to the stability limit of AAV and are thus optimally delivered under the minimal Mpz promoter include EGR2 (2.98 kb) associated with CMT4E and FGD4 (2.3 kb) associated with CMT4H.

[0049] In further additional embodiments, the vectors described herein can be modified in the inverted terminal repeat segments to further reduce their size. For example, as described in Example 1, the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) can be removed and / or the polyA sequence can be replaced with a minimal synthetic polyA (68, 69). Such modifications can further reduce the size of the vector, allowing it to remain within the maximum capacity of AAV and enabling efficient packaging when delivering larger genes. In further additional embodiments, the size of the vector can be further reduced, for example, similarly, by using a minimal form of the protein-coding gene to be delivered, which can still produce a functional protein.

[0050] In some embodiments, the viral vectors described herein can be generated as described in Example 12. In some embodiments, the viral vector has the sequence shown in SEQ ID NO: 20, which has the WPRE removed and has a synthetic polyA sequence. In some embodiments, the synthetic polyA sequence comprises or consists of the minimal sequence necessary for efficient polyadenylation of the mRNA construct (68, 69). In some embodiments, the synthetic polyA sequence comprises or consists of the sequence of SEQ ID NO: 24 contained in the sequences of SEQ ID NOs: 20 and 21. In other embodiments, the synthetic polyA sequence has at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with SEQ ID NO: 24.

[0051] In some embodiments, the viral vector also includes binding sites for the Egr2 and Sox10 transcription factors. For example, the viral vector may also include enhancer elements to which transcription factors such as Egr2 and Sox10 can bind.

[0052] In some embodiments, the first nucleic acid of the viral vector is transcribed in some embodiments to a first polynucleotide that encodes and is translated into a first polypeptide or protein. In some embodiments, the first nucleic acid is an open reading frame (ORF) of a gene sequence or cDNA corresponding to a gene sequence. In some embodiments, the first nucleic acid is an ORF or cDNA of a wild-type or other therapeutically beneficial gene sequence. In a preferred embodiment, the first nucleic acid is an ORF or cDNA of a wild-type or therapeutically beneficial sequence of a neuropathy-related gene, and optionally, the neuropathy is a demyelinating neuropathy.

[0053] "Wild-type or therapeutically beneficial form" includes any form of gene sequence that encodes a polypeptide or protein that can be used to effectively treat a disease associated with Schwann cells. One of ordinary skill in the art will understand that in situations where a disease results from underproduction of a wild-type form of a polypeptide by Schwann cells, this is typically the wild-type form of the protein (i.e., that which occurs naturally in Schwann cells), but may also include forms of the protein having mutations or insertions or being truncated compared to the wild-type sequence so as to provide a therapeutic advantage, such as an increase in expression level, resistance to degradation, increase in stability, increase in activity, or advantageous acquisition of function, or to suppress a gain-of-function of toxicity. For example, in the latter case, the polypeptide can be an antibody that can bind to a gain-of-function mutant of toxicity and suppress its toxicity.

[0054] Those skilled in the art will recognize that protein expression is routinely achieved by introducing the ORF or cDNA of a relevant gene into a viral vector. In one embodiment, the first nucleic acid is a cDNA sequence that, when transcribed, produces a polynucleotide that is translated into a first polypeptide or protein. For example, the cDNA can be a cDNA sequence that is transcribed from GJB1 mRNA and then translated into the Cx32 protein.

[0055] Those skilled in the art will understand that in some cases, the use of the ORF sequence rather than the cDNA sequence may be preferred because the ORF sequence lacks additional non-coding elements found in cDNA and is smaller in size. This is particularly advantageous in the present invention when the viral vector is a vector that becomes unstable when its size exceeds a certain threshold.

[0056] In some additional embodiments, the sequence of the first nucleic acid described herein also optionally includes other regulatory elements in addition to the cDNA or ORF of the gene. These additional elements can be present downstream of the ORF.

[0057] As described above, the present invention is useful in the prevention or treatment of diseases associated with Schwann cells. "Diseases associated with Schwann cells" includes all diseases associated with abnormal functions of Schwann cells. This includes diseases associated with the destruction of the myelin sheath formed by Schwann cells and / or diseases associated with reduced expression of the myelin sheath formed by Schwann cells. In some embodiments, the disease associated with Schwann cells is a demyelinating neuropathy. Examples of demyelinating neuropathies include, but are not limited to, Charcot-Marie-Tooth disease (CMT).

[0058] "Diseases associated with Schwann cells" also, in that sense, includes diseases that are associated with Schwann cells but also, for example, with other cell types or tissues. Even if the present invention does not target any other cell type associated with a disease, the present invention is considered useful in such situations because improvement of Schwann cell function can alleviate some symptoms.

[0059] Accordingly, in one embodiment, the viral vectors described herein can be used for the treatment or prevention of diseases selected from the group consisting of Charcot-Marie-Tooth disease (CMT), hereditary neuropathy with liability to pressure palsies (HNPP), diabetes and other toxic peripheral neuropathies, and motor neuron disease (MND).

[0060] In some specific embodiments, the viral vectors described herein can be used for the treatment or prevention of Charcot-Marie-Tooth type 1X (CMT1X), Charcot-Marie-Tooth types 1A - 1F (i.e., CMT1A, CMT1B, CMT1C, CMT1D, CMT1E, and CMT1F), and Charcot-Marie-Tooth types 4A - 4H (i.e., CMT4A, CMT4B, CMT4C, CMT4D, CMT4E, CMT4F, CMT4G, and CMT4H). In more specific embodiments, the viral vectors described herein can be used to treat or prevent Charcot-Marie-Tooth type 1X. In an alternative more specific embodiment, the viral vectors described herein can be used to treat or prevent Charcot-Marie-Tooth disease type 4C.

[0061] Charcot-Marie-Tooth disease (CMT) is a group of demyelinating neuropathies caused by mutations in a number of different genes that result in phenotypic overlap. Charcot-Marie-Tooth type 1X (CMT1X) neuropathy is the second most common form of CMT (4, 5) and exhibits characteristic CMT1 symptoms including progressive weakness and atrophy starting in the muscles of the distal legs, difficulty walking, and frequent ankle sprains, and most affected males develop symptoms by age 10 or earlier (6-8). This disease progresses slowly, causing weakness in the anterior leg muscles, foot drop, foot deformities, weakness in the hand muscles, and loss of distal sensation, and sometimes painful sensory abnormalities until late puberty or early adulthood, and progresses slowly throughout life. Heterozygous females with CMT1X are either asymptomatic or may develop mild clinical symptoms as they age, although extremely severe neuropathy has been reported (9, 10). Transient CNS signs may occur in some, mainly younger, CMT1X patients (11). Intermediate slowing of motor nerve conduction velocity (MNCV) (30-40 m / sec) and progressive loss of motor units due to length-dependent axonal degeneration are typical electrophysiological features (6, 7). Nerve biopsy shows a mixture of axonal and demyelinating abnormalities (12, 13), with loss of thin myelin sheaths and large myelinated fibers replaced by groups of regenerating axons (6, 14).

[0062] Cx32 is a gap junction (GJ) channel that forms transmembrane proteins through non-compact myelin layers specifically expressed by myelinating Schwann cells of the peripheral nervous system (PNS) and a subset of oligodendrocytes in the CNS. The GJ channels formed by Cx32 play important homeostatic and signaling functions essential for the function and survival of myelin and axons (4, 5). The corresponding gene encoding Cx32 is GJB1.

[0063] To date, over 400 GJB1 mutations have been reported to occur throughout the entire open reading frame (ORF), with many occurring in two or more families, including 498 missense (71%), 3 stop-loss, 49 in-frame indels (7%), 25 stop-gain (4%), and 122 frameshift indels (17%): (http: / / hihg.med.miami.edu / code / http / CMT / public_html / index.html# / ). Some mutations have also been reported in non-coding GJB1 regions. Frameshift, premature stop, and non-coding mutations are likely to cause complete loss or rapid degradation of protein synthesis and are not expected to have a dominant negative effect. Some missense and in-frame mutations expressed in vitro showed intracellular retention (15 - 17) in the ER and / or Golgi (17 - 21) and were unable to form functional channels. Some also exerted a dominant negative effect on co-expressed WT Cx32 (15). Other variants formed functional channels with altered biophysical properties (19). Cx32 knockout (KO) mice with complete deletion of the Gjb1 / Cx32 gene develop a progressive mainly motor demyelinating peripheral neuropathy starting at about 3 months of age, accompanied by a decrease in the MNCV and motor amplitude of the sciatic nerve (24, 25). Expression of WT human Cx32 protein driven by the rat Mpz / P0 promoter prevented demyelination in Cx32 KO mice (26), supporting that loss of Schwann cell-autonomous expression of Cx32 is sufficient to cause CMT1X pathology.

[0064] Thus, several in vitro and in vivo studies of CMT1X mutants support the overall conclusion that loss of Cx32 function mainly leads to neuropathy in CMT1X (8, 17 - 19, 21 - 23). Therefore, in one embodiment, for example, when the viral vector contains the sequence of a first nucleic acid encoding a wild-type or therapeutically beneficial Cx32 protein, the gene replacement therapy using the viral vector and treatment method described herein is used to treat or prevent CMT1X.

[0065] Transgenic mice with mutations that cause CMT1X in a KO background did not show detectable Cx32 protein in the 175fs mutant strain (27), but R142W, T55I, R75W, and N175D transgenic mice showed retention of the mutant protein in the perinuclear region, similar to the in vitro pattern (above), and developed a demyelinating neuropathy similar to that of Cx32 KO mice (22, 28, 29). In the presence of the R142W, R75W, and N175D mutants retained in the Golgi apparatus (but not the T55I mutant retained in the ER), the expression of endogenous mouse WT Cx32 was decreased, suggesting that the mutants retained in the Golgi apparatus may have a dominant-negative effect on WT Cx32. This is not clinically relevant for CMT1X patients who express only one GJB1 allele per cell, but must be considered when planning gene addition therapy. None of the mutants expressed in vivo showed any other toxic or dominant effects on other co-expressed connexins (22, 28). The C-terminal mutants C280G and S281X were properly localized in Cx32 KO mice and prevented demyelination, but it remains unclear how they cause neuropathy in humans (30).

[0066] Therefore, CMT1X may also be caused by dominant negative mutations of the Cx32 protein. In this case, one of ordinary skill in the art will understand that the viral vector of the present invention is beneficial when it contains a first nucleic acid transcribed into a non-coding RNA directed to mutant Cx32 mRNA so as to prevent translation of the mutant protein itself. One of ordinary skill in the art will understand, for example, how to arrive at a suitable nucleic acid sequence that targets mutant Cx32 mRNA but not wild-type or therapeutically advantageous Cx32 mRNA. Thus, in one embodiment, a subject can be treated with a viral vector containing a first nucleic acid transcribed into a non-coding RNA that targets mutant Cx32, and the subject can also be treated with a second viral vector according to the present invention, the second viral vector containing a second nucleic acid encoding a wild-type or therapeutically advantageous Cx32 protein. In some embodiments, the first and second nucleic acids can be on the same viral vector according to the present invention. A similar approach can be taken in the treatment or prevention of any Schwann cell-related disease described herein.

[0067] In some embodiments, the first nucleic acid can be an ORF or cDNA of the wild-type gene sequence of a neuropathy-related gene. In some embodiments, the first nucleic acid can be the cDNA of the wild-type sequence of the gap junction beta 1 (GJB1) gene, which is thought to have the sequence defined in SEQ ID NO: 6. In some embodiments, the first nucleic acid has at least 75% sequence homology or sequence identity with SEQ ID NO: 6, optionally at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with SEQ ID NO: 6. In other embodiments, the first nucleic acid has at least 75% sequence homology or sequence identity with the ORF sequence of GJB1, optionally at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with the ORF sequence of GJB1.

[0068] CMT1X is caused by mutations in the GJB1 gene, resulting in underexpression of the wild-type functional Cx32 protein. Thus, in some embodiments, the viral vectors described herein can be for use in the treatment or prevention of CMT1X by delivery of a wild-type copy or other therapeutically beneficial copy of the open reading frame or cDNA of the GJB1 gene.

[0069] Charcot-Marie-Tooth disease type 4C (CMT4C) is considered the most prevalent autosomal recessive hereditary neuropathy among the rare recessive demyelinating CMT4 types of neuropathies, accounting for nearly half of all CMT4 cases (35). Patients with CMT4C typically present with foot deformities and scoliosis, weakness, reduced reflexes, and sensory loss during the first decade of life (36 - 38). Complications of the cranial nerves with hearing impairment, slow pupillary light reflex, and fasciculations of the tongue are common, and phenotypic variability has been described in patients with the same mutation (39 - 41). Electrophysiological studies of CMT4C patients have confirmed a demyelinating process with a median mean motor nerve conduction velocity (NCV) of 22.6 m / sec. Nerve biopsy findings are characterized by an increase in the basement membrane around myelinated, demyelinated, and unmyelinated axons, a relatively small number of onion bulb-like structures, and most typically large cytoplasmic extensions of Schwann cells (36, 37, 42).

[0070] Molecular genetics of CMT4C: By linkage analysis studies and homozygosity mapping (43), the disease locus on chromosome 5q32 was discovered, and subsequently, 11 different mutations, mostly truncating but also missense, were first discovered in the SH3TC2 gene (42). To date, at least 28 different SH3TC2 mutations have been described, which are more frequently seen among specific ethnic groups (44) and may have a founder effect (39). The cDNA length of the full transcript is 3864 bp. SH3TC2 encodes a 1,288 aa protein containing two Src homology 3 (SH3) domains and ten tetratricopeptide repeat (TPR) domains and does not share overall significant similarity with any other human protein of known function. The presence of SH3 and TPR domains suggests that SH3TC2 may function as a scaffold protein (42). SH3TC2 is well conserved among vertebrate species, but no invertebrate ortholog has been identified. SH3TC2 is present in several compartments of the endocytosis pathway, including early and late endosomes, as well as clathrin-coated vesicles near the trans-Golgi network and the plasma membrane. This localization changes in CMT4C (45).

[0071] The Sh3tc2- / - KO mouse model of CMT4C develops an early-onset but progressive peripheral neuropathy with reduced motor and sensory nerve conduction velocities and early-onset hypomyelination (46, 47). This phenotype is progressive, with increasing myelin pathology at 2 and 12 months of age. Mouse Sh3tc2 is specifically expressed in Schwann cells, localizes to the plasma membrane and the perinuclear endocytic recycling compartment, suggesting a potential function in the area of myelination and / or axonal interaction (48). Ultrastructural analysis of myelin in the peripheral nerves of mutant mice showed abnormal organization of the nodes of Ranvier, a phenotype confirmed in nerve biopsies from CMT4C patients. These findings suggested a role for the SH3TC2 gene product in myelination and the integrity of the nodes of Ranvier (46). Thus, Sh3tc2- / - mice recapitulate all the major features of CMT4C disease and provide an appropriate model for testing therapeutic approaches.

[0072] Thus, in some embodiments, the first nucleic acid can be the open reading frame (ORF) or cDNA of the wild-type sequence of the gene SH3 domain and tetratricopeptide repeat 2 (SH3TC2) gene. The ORF of SH3TC2 is considered to have the sequence defined in SEQ ID NO: 7. In some embodiments, the first nucleic acid has at least 75% sequence homology or sequence identity with SEQ ID NO: 7, optionally at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with SEQ ID NO: 7. In other embodiments, the first nucleic acid has at least 75% sequence homology or sequence identity with the cDNA sequence of SH3TC2, optionally at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with the cDNA sequence of SH3TC2.

[0073] As described above, CMT4C is caused by a mutation in the SH3TC2 gene, resulting in underexpression of the wild-type functional SH3TC2 protein. Thus, in some embodiments, the viral vectors described herein can be used, for example, for the treatment or prevention of CMT4C by delivering a wild-type copy or other therapeutically beneficial copy of the open reading frame or cDNA of SH3TC2 to increase the expression of wild-type SH3TC2.

[0074] In another embodiment, the viral vectors described herein can be used in methods for the treatment or prevention of other types of autosomal dominant demyelinating CMT.

[0075] CMT1B is caused by a mutation in the myelin protein zero (Mpz) gene, resulting in underexpression of the wild-type functional Mpz protein.

[0076] Thus, in some embodiments, the first nucleic acid can be the ORF or cDNA of the wild-type sequence of the myelin protein zero (MPZ) gene. The ORF of MPZ is thought to have the sequence defined in SEQ ID NO: 9. In some embodiments, the first nucleic acid has at least 75% sequence homology or sequence identity with SEQ ID NO: 9, optionally at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with SEQ ID NO: 9. In other embodiments, the first nucleic acid has at least 75% sequence homology or sequence identity with the cDNA sequence of MPZ, optionally at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with the cDNA sequence of MPZ.

[0077] Thus, in some embodiments, the viral vectors described herein can be used for the treatment or prevention of CMT1B by delivery of non-coding RNAs described herein that target and knockdown toxic mutant alleles of the MPZ gene in addition to delivery of wild-type copies of the open reading frame or cDNA of the MPZ gene or other therapeutically beneficial copies.

[0078] CMT1D is caused by mutations in the EGR2 gene, resulting in underexpression of the wild-type functional EGR2 protein.

[0079] Thus, in some embodiments, the first nucleic acid can be the ORF or cDNA of the wild-type sequence of the early growth response 2 (EGR2) gene. The ORF of EGR2 is thought to have the sequence defined in SEQ ID NO: 10. In some embodiments, the first nucleic acid has at least 75% sequence homology or sequence identity with SEQ ID NO: 10, optionally at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with SEQ ID NO: 10. In other embodiments, the first nucleic acid has at least 75% sequence homology or sequence identity with the cDNA sequence of EGR2, optionally at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with the cDNA sequence of EGR2.

[0080] Thus, in some embodiments, the viral vectors described herein can be used for the treatment or prevention of CMT1D by delivery of the open reading frame or cDNA of the wild-type copy or other therapeutically beneficial copy of the EGR2 gene.

[0081] In another embodiment, the viral vectors described herein can be used in methods for treating or preventing other types of autosomal recessive demyelinating CMT. CMT4A is caused by mutations in the GDAP1 gene, which results in underexpression of the wild-type functional GDAP1 protein.

[0082] Thus, in some embodiments, the first nucleic acid can be the ORF of the wild-type sequence of the ganglioside-induced differentiation-associated protein 1 (GDAP1) gene. The ORF of GDAP1 is thought to have the sequence defined in SEQ ID NO: 11. In some embodiments, the first nucleic acid has at least 75% sequence homology or sequence identity with SEQ ID NO: 11, optionally at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with SEQ ID NO: 11. In other embodiments, the first nucleic acid has at least 75% sequence homology or sequence identity with the cDNA sequence of GDAP1, optionally at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with the cDNA sequence of GDAP1.

[0083] Thus, in some embodiments, the viral vectors described herein can be for use in the treatment or prevention of CMT4A by delivery of the open reading frame of the GDAP1 gene or a wild-type copy or other therapeutically beneficial copy of the cDNA.

[0084] CMT4D is caused by mutations in the NDRG1 gene, which results in underexpression of the wild-type functional NDRG1 protein.

[0085] Thus, in some embodiments, the first nucleic acid can be the ORF or cDNA of the wild-type sequence of the N-Myc downstream-regulated 1 (NDRG1) gene. The ORF of NDRG1 is thought to have the sequence defined in SEQ ID NO: 12. In some embodiments, the first nucleic acid has at least 75% sequence homology or sequence identity with SEQ ID NO: 12, optionally at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with SEQ ID NO: 12. In other embodiments, the first nucleic acid has at least 75% sequence homology or sequence identity with the cDNA sequence of NDRG1, optionally at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with the cDNA sequence of NDRG1.

[0086] Thus, in some embodiments, the viral vectors described herein can be for use in the treatment or prevention of CMT4D by delivery of a wild-type copy or other therapeutically beneficial copy of the open reading frame or cDNA of the NDRG1 gene.

[0087] CMT4E is caused by mutations in the EGR2 gene and results in underexpression of the wild-type functional EGR2 protein.

[0088] Thus, in some embodiments, the first nucleic acid can be the ORF or cDNA of the wild-type sequence of the early growth response 2 (EGR2) gene. The ORF of EGR2 is thought to have the sequence defined in SEQ ID NO: 10. In some embodiments, the first nucleic acid has at least 75% sequence homology or sequence identity with SEQ ID NO: 10, optionally at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with SEQ ID NO: 10. In other embodiments, the first nucleic acid has at least 75% sequence homology or sequence identity with the cDNA sequence of EGR2, optionally at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with the cDNA sequence of EGR2.

[0089] Thus, in some embodiments, the viral vectors described herein can be for use in the treatment or prevention of CMT4E by delivery of the wild-type copy or other therapeutically beneficial copy of the open reading frame or cDNA of the EGR2 gene.

[0090] Hereditary neuralgic amyotrophy (HNPP) is associated with mutations in the PMP22 gene, causing insufficient expression of the wild-type functional PMP22 protein.

[0091] Thus, in some embodiments, the first nucleic acid can be the open reading frame (ORF) or cDNA of the wild-type sequence of the peripheral myelin protein 22 (PMP22) gene. The ORF of PMP22 is thought to have the sequence defined in SEQ ID NO: 8. In some embodiments, the first nucleic acid has at least 75% sequence homology or sequence identity with SEQ ID NO: 8, optionally at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with SEQ ID NO: 8. In other embodiments, the first nucleic acid has at least 75% sequence homology or sequence identity with the cDNA sequence of PMP22, optionally at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with the cDNA sequence of PMP22.

[0092] Thus, in some embodiments, the viral vectors described herein can be for use in the treatment or prevention of HNPP by delivery of the wild-type copy or other therapeutically beneficial copy of the open reading frame or cDNA of the PMP22 gene.

[0093] In another embodiment, the first nucleic acid can be the ORF or cDNA of another gene associated with demyelinating neuropathy and / or Schwann cell dysfunction. Thus, in some embodiments, the viral vectors described herein can be for use in the treatment or prevention of diseases associated with demyelinating neuropathy and / or Schwann cell dysfunction by delivery of the wild-type copy or other therapeutically beneficial open copy of the open reading frame or cDNA of a gene associated with such diseases.

[0094] Motor neuron disease (MND) (also known as amyotrophic lateral sclerosis) is a neurodegenerative disease with complex causes that are not fully understood. In some embodiments, the viral vectors described herein can be used to deliver polynucleotides encoding trophic factors (e.g., brain-derived neurotrophic factor (BDNF), glial cell line-derived neurotrophic factor (GDNF), neurotrophin-3 (NT-3), vascular endothelial growth factor (VEGF)). Expression of such trophic factors in target cells is thought to be useful for the regeneration and preservation of stressed motor neurons.

[0095] Accordingly, in some embodiments, the viral vectors described herein are for use in a method of treating or preventing MND.

[0096] It will be apparent to those skilled in the art that the wild-type or therapeutically beneficial forms of the proteins disclosed herein can be expressed from the nucleotide sequence of the full gene, from the open reading frame sequence (ORF) alone, or from the cDNA sequence alone. All of these types of sequences are readily accessible by those skilled in the art from sequence databases, such as GenBank (accessible from https: / / www.ncbi.nlm.nih.gov / genbank / ).

[0097] In some embodiments, the first polynucleotide encodes and is translated into a first polypeptide or protein. In some embodiments, the first polynucleotide encodes a protein in its wild-type form. In some embodiments, the wild-type form of the protein is used to replace or supplement the expression of a mutant form of the same protein expressed by a subject in need thereof.

[0098] In some embodiments, the first polynucleotide may encode one or more wild-type or therapeutically beneficial forms of the following proteins: connexin 32, SH3 domain and tetratricopeptide repeat 2 (SH3TC2), peripheral myelin protein 22 (PMP22), myelin protein zero (MPZ); early growth response 2 (EGR2), ganglioside-induced differentiation-related protein 1 (GDAP1), N-Myc downstream-regulated 1 (NDRG1). Those skilled in the art will understand that the amino acid sequences of the proteins disclosed herein are readily accessible from sequence databases such as the NCBI protein database (accessible from: https: / / www.ncbi.nlm.nih.gov / protein).

[0099] Accordingly, in some embodiments, the present invention may be applied to a method of gene replacement by providing an AAV vector comprising a wild-type form or other therapeutically beneficial form of the gene to be replaced. In some non-limiting examples, the gene to be replaced can be mutated such that it does not encode a protein, such that it encodes a truncated form of the wild-type protein (e.g., there is a premature stop codon), such that it encodes a small amount of functional protein, or such that it encodes a non-functional mutant form of the protein.

[0100] In additional or alternative embodiments, the first nucleic acid encodes and is translated into trophic factors (e.g., brain-derived neurotrophic factor (BDNF), glial cell-derived neurotrophic factor (GDNF), neurotrophin-3 (NT-3), vascular endothelial growth factor (VEGF)). Trophic factors include biomolecules (e.g., proteins or peptides) that support the growth, differentiation, and / or development of developing and mature neurons. In another additional or alternative embodiment, the first polynucleotide encodes regenerative factors (e.g., angiogenin, Oct-6, Egr2, Sox-10). In another additional or alternative embodiment, the first polynucleotide encodes a growth factor (e.g., IGF).

[0101] The use of the vectors described herein for delivering nucleic acids encoding the above-described trophic factors, regenerative factors, and / or growth factors can be used in some embodiments to treat or prevent acquired peripheral neuropathies. In one example, diabetic and other toxic peripheral neuropathies can be treated by delivering the vectors described herein encoding trophic factors and / or growth factors to Schwann cells and axons. In another example, motor neuron disease (MND), also known as amyotrophic lateral sclerosis, can be treated by delivering the vectors described herein encoding trophic factors that can be delivered to the axons of stressed motor neurons to retrogradely preserve the motor neurons.

[0102] In another embodiment, administration of a viral vector comprising a first nucleic acid encoding a first protein or polypeptide results in an improvement in Schwann cell function and / or an increase in myelin sheath formation. In some embodiments, this improvement in function is achieved by an increase in myelin sheath formation by Schwann cells as compared to myelin sheath formation by Schwann cells in the subject prior to treatment, and the improvement in function can be detected by detection of an increase in myelin sheath production. In some embodiments, the improvement in function can be measured by an improvement in muscle strength and / or sciatic nerve conduction velocity and / or a change in the potential response of a blood biomarker as compared to measurement of muscle strength and / or sciatic nerve conduction velocity and / or the potential response of a blood biomarker in the subject prior to treatment. Those skilled in the art are aware of techniques for determining an improvement in Schwann cell function and / or an increase in myelin sheath formation. Some such techniques are provided in the examples.

[0103] In some specific embodiments, the increased formation of myelin sheaths by Schwann cells results in the improvement of myelination of peripheral nerves. The improvement of myelination of peripheral nerves means that the myelination of peripheral nerves is increased as compared to the subject before treatment. This includes a decrease in demyelinated fibers and remyelinated fibers, and / or a decrease in abnormally myelinated fibers. The improved myelination may also be associated with a decrease in the number of foamy macrophages, which are markers of inflammation, in some embodiments. The improvement of myelination may also be associated with an increase in the thickness of myelin and a decrease in the g ratio (the ratio of the diameter of the axon to the diameter of the myelinated fiber).

[0104] As described above, the first nucleic acid may encode a polypeptide or protein having a therapeutic benefit, for example, when a native protein is mutated or expressed at a level too low to provide a normal function.

[0105] In an alternative embodiment, it should be understood that the first nucleic acid can be transcribed into an RNA that is not mRNA, i.e., an RNA that is not translated into a protein. Thus, the first nucleic acid can be transcribed into a non-coding RNA.

[0106] "Non-coding RNA" means an RNA molecule that is not translated into a polypeptide or protein. Those skilled in the art will recognize such RNA polymers and how they can be used to affect the expression of polypeptides. In one embodiment, the first nucleic acid is transcribed into a non-coding microRNA (miR). In further additional alternative embodiments, the first nucleic acid is transcribed into a small hairpin-type RNA (shRNA). In a further embodiment, the first nucleic acid is transcribed into a guide RNA (gRNA), for example, as part of a CRISPR-based system.

[0107] When the viral vector is in the target organism, the expression of the non-coding RNA described above can result in a decrease in the expression of the target polynucleotide. Optionally, the target polynucleotide is a gene located in the target organism, and optionally, it is located in the cells of the target organism. In some embodiments, the target polynucleotide is a gene sequence. Thus, in some embodiments, the present invention described herein can be used to knockdown the expression of a target gene. "Knockdown" means that the expression of the target gene is reduced as compared to the expression level before treatment with the viral vector.

[0108] For example, the present invention can be applied to situations where a target nucleic acid, such as a target gene, is overexpressed. A first nucleic acid transcribed into non-coding RNA can be delivered using a viral vector to target, for example, the mRNA produced by the overexpressed gene for degradation (e.g., by the RISC complex in the art) or directly block the translation of the mRNA into protein. This embodiment of the present invention can also be applied to situations where the target nucleic acid itself is transcribed into non-coding RNA, and it is beneficial to reduce the level of host non-coding RNA in the cell.

[0109] This embodiment of the present invention can also be used to target harmful gain-of-function mutants and reduce the expression levels of their proteins or mRNAs.

[0110] Thus, in some embodiments, the expression of the non-coding RNA results in a decrease in the expression of the target nucleic acid, polynucleotide, or gene. In one embodiment, the expression or overexpression of the target polynucleotide in the target organism is thought to be associated with a disease related to Schwann cells. Optionally, the disease is a dominant demyelinating neuropathy (CMT1), and optionally, the target polynucleotide is a mutant allele of myelin protein zero (Mpz / P0), and the disease related to Schwann cells is CMT1B, or the target polynucleotide is another dominant gene related to CMT1.

[0111] In some embodiments, administration of a viral vector encoding a first nucleic acid results in the expression of non-coding RNA that leads to an improvement in Schwann cell function. As described above, in some embodiments, this improvement in function is achieved by an increase in myelin sheath formation by Schwann cells as compared to myelin sheath formation by Schwann cells in the subject prior to treatment. In some embodiments, this improvement in function can be measured by an improvement in muscle strength and / or sciatic nerve conduction velocity and / or a change in the potential response of a blood biomarker as compared to the measurement of muscle strength and / or sciatic nerve conduction velocity and / or the potential response of a blood biomarker in the subject prior to treatment.

[0112] In some embodiments, the viral vectors described herein include the sequence of a first nucleic acid encoding a first polypeptide or protein, and the vector may also include a second nucleic acid that is transcribed into non-coding RNA. Thus, in some embodiments, the invention can be used to knock down the expression of a mutant gene using non-coding RNA and to replace the mutant gene with a wild-type copy of the gene to effect a complete gene replacement. This approach is thought to be particularly useful when a subject in need of treatment has a gain-of-function mutation in a particular protein.

[0113] In some embodiments, the viral vector also includes the sequence of a second or third nucleic acid encoding a transcription factor capable of driving expression or increased expression from a Schwann cell-specific promoter, optionally a myelin-specific promoter or a minimal myelin-specific promoter as defined herein. Examples of such transcription factors that can drive the expression of a polynucleotide under the control of a Schwann cell-specific promoter include Egr2 and Sox10.

[0114] The viral vector may also contain a nucleic acid sequence encoding a Cas9 polypeptide or analog (such as dead-Cas9, etc.) that is routinely used in CRISPR technology and its variants.

[0115] It will be understood that the viral vectors described herein can be administered to a subject in a variety of ways. In a preferred embodiment, the viral vectors described herein are administered by intrathecal injection. "Intrathecal injection" includes injection into the spinal canal, such that the injected substance reaches the cerebrospinal fluid (CSF). In a particularly preferred embodiment, the viral vectors described herein are administered by lumbar intrathecal injection. The viral vectors described herein are also suitable for administration by thoracic intrathecal injection or cervical intrathecal injection. Alternatively, the viral vectors described herein can be administered by direct injection into a peripheral nerve. Alternatively, the viral vectors described herein can be administered by direct intravenous injection.

[0116] Intrathecal injection offers advantages over other administration methods such as intraneural injection and intravenous injection. Compared to intraneural injection, intrathecal injection provides a broader distribution to multiple spinal nerve roots and nerves. Intraneural injection, on the other hand, provides distribution only within the injected nerve. Additionally, intrathecal injection can be routinely performed in a clinic without the need for a surgical procedure and is considered safe, whereas intraneural injection requires a surgical procedure, exposes multiple nerves, has a higher risk, and is much more difficult to perform in a clinic.

[0117] Intravenous injection is easier to administer in a clinic but has the disadvantage of requiring a much higher dose of the vector to reach the nervous system compared to intrathecal delivery. Intravenous delivery may also lead to higher toxicity due to higher doses of the virus and the risk of liver toxicity. Additionally, intravenous injection may cause more immune reactions, whereas intrathecal delivery offers the possibility of avoiding the immune system with fewer immune responses.

[0118] When the AAV vectors described herein transduce target cells, the delivered genetic material is stable and remains episomal, provided that the target cells are differentiated but not dividing, as is the case with mature Schwann cells. Thus, a single administration of an AAV vector should be sufficient to achieve a therapeutic effect, and in some embodiments, the viral vectors described herein are administered by a single intrathecal injection. However, in some cases, it may be necessary to administer multiple doses of different AAV vectors at different time points. These different vectors may express different first polynucleotides or may express the same first polynucleotide and may differ in the type of AAV used. Thus, in some embodiments, the viral vectors disclosed herein may be useful for treating or preventing Schwann cell-related diseases associated with multiple different genes.

[0119] It should be understood that the viral vectors disclosed herein are suitable for use in human subjects. The viral vectors are also suitable for use in common mammals such as cats, dogs, mice, rabbits, horses, etc. The subject can be treated with the viral vectors disclosed herein either before the onset of symptoms of a Schwann cell-related disease or after the onset of symptoms of the disease. The subject to be treated can be of any age at the start of treatment. For example, as soon as it is confirmed that the subject has a mutation or other defect that impairs the performance of Schwann cells, the subject can be treated with the vector(s) of the present invention. This can be even before any symptoms appear.

[0120] It should be understood that the dose of the viral vector used is adjusted according to the requirements of the subject in need thereof and can be adjusted, for example, according to the age, weight or height of the subject. As a general example, 3.5×10 13 vector genomes (vg), a dose 3.3 times higher than 1.2×10 14 vg, and 1.8×10 14Dosing can be escalated (for intrathecal delivery) using a dose that is 5 times higher than the vg dose. Such doses have been previously used in clinical trials using AAV (e.g., https: / / clinicaltrials.gov / ct2 / show / NCT02362438[2]), and those skilled in the art will recognize that they can be applied to the present invention.

[0121] In addition to the method of treatment for preventing or treating diseases associated with Schwann cells, it will be apparent to those skilled in the art that the present invention also provides the viral vector itself. Thus, in another aspect, the present invention provides a viral vector as described herein comprising the nucleic acid sequences defined herein. In a preferred embodiment, the viral vector is AAV. In a particularly preferred embodiment, the AAV is AAV9. The preferences for the features of this aspect are as described elsewhere in this specification. For example, the preferences for the vector, nucleic acid, promoter, and Schwann cell-related diseases are as defined herein.

[0122] In a further aspect, the present invention provides a minimal myelin-specific promoter comprising, or consisting of, the sequence defined in SEQ ID NO: 5, or a sequence having at least 75% sequence homology or sequence identity with SEQ ID NO: 5, optionally at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with SEQ ID NO: 5. The preferences for the features of this aspect are as described in this specification. For example, the preferences for the vector, nucleic acid, promoter, and Schwann cell-related diseases are as defined herein.

[0123] In a further aspect, the present invention provides a minimal myelin-specific promoter comprising, or consisting of, the sequence defined in SEQ ID NO: 22, or a sequence having at least 75% sequence homology or sequence identity with SEQ ID NO: 22, optionally at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with SEQ ID NO: 22. The preferences for the features of this aspect are as described herein. For example, the preferences for vectors, nucleic acids, promoters, and Schwann cell-related diseases are as defined herein. In some embodiments, the present invention provides a human minimal myelin-specific promoter, which has at least 75%, 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence homology or sequence identity with SEQ ID NO: 22.

[0124] In a further aspect, the present invention provides a polynucleotide construct comprising a Schwann cell-specific promoter, optionally a myelin-specific promoter, comprising a myelin protein zero (Mpz) promoter or a minimal myelin-specific promoter as defined herein, operably linked to the sequence of a second nucleic acid that is optionally transcribed into a first polynucleotide, wherein the second nucleic acid is a) an open reading frame or cDNA or other element of a gene, or b) transcribed into a non-coding RNA.

[0125] The present invention also provides a viral vector comprising such a polynucleotide construct, for example, an AAV vector comprising the construct. The preferences of the features of this aspect are as described herein. For example, the preferences for the vector, nucleic acid, promoter, and Schwann cell-related diseases are as defined herein. For example, in one embodiment, the polynucleotide construct of the present invention comprises a Schwann cell-specific promoter, and the promoter is a) a minimal Schwann cell-specific promoter, optionally the minimal Mpz promoter described herein. For example, the promoter has a sequence having at least 75%, 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 97%, 98%, 99%, or 100% sequence homology or sequence identity with SEQ ID NO: 5 or SEQ ID NO: 22, or b) a full-length Mpz promoter, and optionally the promoter has a sequence having at least 75%, 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 97%, 98%, 99%, or 100% sequence homology or sequence identity with SEQ ID NO: 4 or SEQ ID NO: 18.

[0126] Preferably, the polynucleotide construct of the present invention comprises the human minimal Mpz or human full-length Mpz promoter described herein.

[0127] In a further aspect, the present invention provides the following viral vectors:

[0128] a) An AAV-Mpz.Egfp vector comprising an AAV9 vector, a myelin protein zero (Mpz) promoter, and an EGFP reporter gene (SEQ ID NO: 1), wherein optionally, the promoter has a sequence having at least 75%, 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence homology or sequence identity with SEQ ID NO: 4 or SEQ ID NO: 18, AAV-Mpz.Egfp vector,

[0129] b) An AAV9-Mpz-GJB1 vector comprising an AAV9 vector, a myelin protein zero (Mpz) promoter, and the open reading frame (ORF) of the gap junction beta 1 (GJB1) gene (SEQ ID NO: 2), wherein optionally, the promoter has a sequence having at least 75%, 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence homology or sequence identity with SEQ ID NO: 4 or SEQ ID NO: 18, AAV9-Mpz-GJB1 vector,

[0130] c) An AAV9-miniMpz.Egfp vector comprising an AAV9 vector, a minimal myelin protein zero (miniMpz) promoter, and an EGFP reporter gene (SEQ ID NO: 3), wherein optionally, the miniMPZ promoter has sequence homology having at least 75%, 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence homology or sequence identity with SEQ ID NO: 5 or SEQ ID NO: 22, AAV9-miniMpz.Egfp vector,

[0131] d) An AAV9 vector, a human myelin protein zero (hP0) promoter, and an open reading frame (ORF) of the gap junction beta 1 (GJB1) gene (SEQ ID NO: 17), an AAV9 - human Mpz - GJB1 vector,

[0132] e) An AAV9 vector, a human myelin protein zero (hP0) promoter, and an EGFP reporter gene (SEQ ID NO: 19), an AAV9 - human Mpz - Egfp vector,

[0133] f) An AAV9 vector, a minimal myelin protein zero (Mpz) promoter, and an open reading frame (ORF) of the SH3TC2 gene (SEQ ID NO: 20), an AAV9 - miniMpz - SH3TC2.myc.ITR vector,

[0134] g) An AAV9 vector, a human minimal myelin protein zero (hP0) promoter, and an open reading frame (ORF) of the SH3TC2 gene (SEQ ID NO: 21), an AAV9 - human - miniMpz - SH3TC2 vector,

[0135] h) An AAV9 vector, a human minimal myelin protein zero (hP0) promoter, and an EGFP reporter gene (SEQ ID NO: 23), an AAV9 - human - miniMpz - Egfp vector, or i) Optionally, an AAV where the AAV vector is AAV9.

[0136] The preferences for the features of this aspect are as described herein. For example, the preferences for the vector, nucleic acid, promoter, and Schwann cell - related disease are as defined herein.

[0137] In certain embodiments, the invention also provides a viral vector for use in a subject in need of treating or preventing a Schwann cell-related disease, the viral vector comprising a sequence of a first nucleic acid that is transcribed into a first polynucleotide, wherein transcription of the first nucleic acid is optionally under the control of a minimal myelin-specific promoter comprising the sequence defined by SEQ ID NO: 5 or SEQ ID NO: 22, or a sequence having at least 75% sequence homology or sequence identity with SEQ ID NO: 5 or 22, optionally at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with SEQ ID NO: 5 or 22. In one embodiment, the viral vector can be an AAV vector. In another alternative embodiment, the viral vector can be a lentiviral vector. Preferences for features of this aspect are as described herein. For example, preferences for the vector, nucleic acid, promoter, and Schwann cell-related disease are as defined herein.

[0138] In another aspect, the invention also provides a pharmaceutical composition comprising any of the viral vectors described herein. In some embodiments, the pharmaceutical composition comprises an appropriate amount of the viral vector and further comprises a pharmaceutically acceptable excipient, diluent, carrier, buffer, or adjuvant. Preferences for features of this aspect are as described herein. For example, preferences for the vector, nucleic acid, promoter, and Schwann cell-related disease are as defined herein.

[0139] As used herein, "pharmaceutical composition" means a therapeutically effective formulation for use in treating or preventing a Schwann cell-related disease.

[0140] The pharmaceutical composition is sufficiently storage-stable and can be prepared by methods known in the art suitable for administration to humans.

[0141] "Pharmaceutically acceptable" means a non-toxic material that does not reduce the effectiveness of the active ingredient, i.e., the biological activity of the viral vector. Such pharmaceutically acceptable buffers or excipients are well known in the art (see Remington’s Pharmaceutical Sciences, 18th edition, A.R Gennaro, Ed., Mack Publishing Company (1990) and handbook of Pharmaceutical Excipients, 3rd edition, A.Kibbe, Ed., Pharmaceutical Press (2000), which are incorporated herein by reference).

[0142] The term "buffer" is intended to mean an aqueous solution containing an acid-base mixture for the purpose of stabilizing the pH. Examples of buffers include Tris, Bicine, Tricine, MOPS, MOPSO, MOBS, Tris, HEPES, HEPBS, MES, phosphate, carbonate, acetate, citrate, glycolate, lactate, borate, ACES, ADA, tartrate, AMP, AMPD, AMPSO, BES, CABS, cacodylate, CHES, DIPSO, EPPS, ethanolamine, glycine, HEPPSO, imidazole, imidazole lactate, PIPES, SSC, SSPE, POPSO, TAPS, TABS, TAPSO, and TES.

[0143] The term "diluent" is intended to mean an aqueous or non-aqueous solution for the purpose of diluting the viral vector in a pharmaceutical preparation. The diluent can be one or more of saline, water, polyethylene glycol, propylene glycol, ethanol, or an oil (such as safflower oil, corn oil, peanut oil, cottonseed oil, or sesame oil).

[0144] The term "adjuvant" is intended to mean any compound added to a formulation to increase the biological effect of a viral vector. Adjuvants can be, for example, colloidal silver, zinc, copper, or silver salts with different anions, including but not limited to fluoride, chloride, bromide, iodide, thiocyanate, sulfite, hydroxide, phosphate, carbonate, lactate, glycolate, citrate, borate, tartrate, and acetates with different acyl compositions. Adjuvants can also be cationic polymers, such as PHMB, cationic cellulose ethers, cationic cellulose esters, deacetylated hyaluronic acid, chitosan, cationic dendrimers, cationic synthetic polymers, such as poly(vinylimidazole), and cationic polypeptides, such as polyhistidine, polylysine, polyarginine, and peptides containing these amino acids.

[0145] The excipient can be one or more of carbohydrates, polymers, lipids, and minerals. Examples of carbohydrates include, for example, lactose, sucrose, mannitol, and cyclodextrin added to the composition to facilitate lyophilization. Examples of polymers are starch, cellulose ether, cellulose, carboxymethyl cellulose, hydroxypropyl methyl cellulose, hydroxyethyl cellulose, ethyl hydroxyethyl cellulose, ethyl cellulose, methyl cellulose, propyl cellulose, alginate, carrageenan, hyaluronic acid and its derivatives, polyacrylic acid, polysulfonate, polyethylene glycol / polyethylene oxide, polyethylene oxide / polypropylene oxide copolymer, polyvinyl alcohol / polyvinyl acetate of different degrees of hydrolysis, poly(lactic acid), poly(glycolic acid) or its copolymers of various compositions, and polyvinyl pyrrolidone, all of different molecular weights, which are added to the composition, for example, for viscosity control, to achieve bioadhesion, or to protect the active ingredient from chemical and proteolytic degradation. Examples of lipids are fatty acids, phospholipids, mono-, di-, and triglycerides, ceramides, sphingolipids, and glycolipids (all with different acyl chain lengths and degrees of saturation), egg lecithin, soy lecithin, hydrogenated egg and soy lecithin, which are added to the composition for the same reasons as polymers. Examples of minerals are talc, magnesium oxide, zinc oxide, and titanium oxide, which are added to the composition to obtain advantages such as reduction of liquid accumulation or advantageous pigment properties.

[0146] In another aspect, the present invention provides the use of the viral vector described herein in a method for manufacturing a drug for the treatment or prevention of a disease associated with Schwann cells. In some embodiments, the disease causes disruption of the myelin sheath and / or reduction in the formation by Schwann cells. In a preferred embodiment, the disease is Charcot-Marie-Tooth disease. The preferences for the features of this aspect are as described herein, for example, the preferences for the vector, nucleic acid, promoter, and Schwann cell-related disease are as defined herein.

[0147] In yet another aspect, the present invention provides a method for treating or preventing a Schwann cell-related disease using any of the viral vectors described herein. In certain embodiments, the present invention provides a method for treating or preventing Charcot-Marie-Tooth disease. In preferred embodiments, the disease is Charcot-Marie-Tooth disease type 1X or 4C. The preferences of the features of this aspect are as described herein. For example, the preferences for the vector, nucleic acid, promoter, and Schwann cell-related disease are as defined herein.

[0148] One of ordinary skill in the art will understand that the viral vectors described herein can be used in the CRISPR / Cas system for gene editing or gene silencing, for example, by using a dead-Cas9 polypeptide. Thus, in another aspect, the present invention includes a viral vector or polynucleotide construct described herein for use in a CRISPR / Cas9 system comprising any one or more of the following:

[0149] a) a polynucleotide encoding a single-guide RNA (sgRNA) that targets a gene of interest, b) a polynucleotide encoding a Cas9 polypeptide, c) a polynucleotide encoding a polypeptide of interest.

[0150] The preferences of the features of this aspect are as described herein. For example, the preferences for the vector, nucleic acid, promoter, and Schwann cell-related disease are as defined herein.

[0151] It will be apparent to those skilled in the art that the viral vectors disclosed herein can have various uses other than the treatment or prevention of Schwann cell-related diseases. For example, the viral vectors disclosed herein can be used in methods of labeling Schwann cells with, for example, a fluorescent protein, such as green fluorescent protein (GFP) or enhanced green fluorescent protein (EGFP), or with other non-fluorescent reporters. In some examples, the labeling of Schwann cells can be used in methods of diagnosing diseases associated with Schwann cells.

[0152] The preferences for the features of this aspect are as described herein. For example, the preferences for the vector, nucleic acid, promoter, and Schwann cell-related diseases are as defined herein.

[0153] In another example, the viral vectors disclosed herein can be used in methods of inducing Schwann cells to differentiate into alternative cell types, such as neurons, oligodendrocytes, or astrocytes.

[0154] In yet another example, the viral vectors disclosed herein can be used in methods of stimulating Schwann cells to support regeneration in a subject in need of regeneration, for example, after injury or trauma. The preferences for the features of this aspect are as described herein. For example, the preferences for the vector, nucleic acid, promoter, and Schwann cell-related diseases are as defined herein.

[0155] In yet another example, the viral vectors disclosed herein may be suitable for use in ex vivo methods of treating diseases associated with Schwann cells. For example, target cells can be removed from a subject in need of treatment and transduced with the viral vectors described herein before being returned to the subject.

[0156] The preferences for the features of this aspect are as described herein. For example, the preferences for the vector, nucleic acid, promoter, and Schwann cell-related diseases are as defined herein.

[0157] The present invention also provides a cell transfected with the viral vector of the present invention, such as a Schwann cell.

[0158] The present invention also provides a cell comprising the nucleic acid construct of the present invention comprising a relevant promoter and a first nucleic acid. Those skilled in the art will recognize that the viral vector of the present invention can be produced in cultured cells, preferably HEK293 cells, as described, for example, in (58).

[0159] The vectors and methods described herein can be performed in vivo, but can also be used ex vivo or in vitro. For example, cells such as Schwann cells can be transfected ex vivo or in vitro for subsequent therapeutic or research purposes.

[0160] The present invention also provides a kit that can be used to implement any of the viral vectors described herein. For example, the present invention provides a kit for use with the viral vector or polynucleotide according to any of the preceding claims, the kit comprising

[0161] a) a viral vector as defined herein, b) a polynucleotide construct as defined herein, c) a viral vector, d) a viral vector comprising a polynucleotide construct as defined herein, e) a pharmaceutically acceptable carrier and / or excipient, f) a disposable syringe, for example a disposable syringe suitable for lumbar intrathecal injection, g) instructions for use, and comprises one or more of them.

[0162] In one embodiment, the kit comprises two or more viral vectors according to the present invention. For example, the kit can comprise two different viral vectors as defined herein.

[0163] In any of the therapeutic uses of the present invention, it will be apparent to those skilled in the art that two or more viral vectors according to the present invention can be administered to a subject. It will be apparent to those skilled in the art that this can be advantageous in some situations. For example, if two or more genes are known to be associated with Schwann cell-related diseases, multiple viral vectors can be administered, with each vector being directed to the expression of a different therapeutic protein. Alternatively, a single vector can express two or more therapeutic proteins or non-coding RNAs. In other situations such as those described above, one viral vector can be used to express, for example, Cas9 protein in Schwann cells, and different viral vectors can be used to express the relevant gRNAs for targeting Cas9 to the required nucleic acids.

[0164] A list or discussion of documents clearly published previously herein is not necessarily to be construed as an admission that the document is part of the prior art or common general knowledge.

[0165] Preferences and options for a given aspect, feature, or parameter of the present invention are to be regarded as disclosed in combination with any and all preferences and options in all other aspects, features, and parameters of the present invention, unless the context specifically indicates otherwise.

[0166] Accordingly, in order to illustrate how the disclosure of one aspect of the present invention relates to other aspects of the present invention and how these aspects can be combined, the present invention provides, in some embodiments, the following.

[0167] A viral vector for use in the treatment or prevention of a disease associated with Schwann cells, wherein the viral vector is an AAV, the viral vector comprises a first nucleic acid that can be transcribed into a first polynucleotide, and the expression of the first polynucleotide is under the control of a minimal myelin-specific (Mpz) promoter.

[0168] A viral vector for use in the treatment or prevention of diseases associated with Schwann cells, wherein the viral vector is an AAV, the viral vector comprises a first nucleic acid that can be transcribed into a first polynucleotide, and the expression of the first polynucleotide is a) a myelin protein zero (Mpz) promoter, optionally, the promoter has a sequence with at least 75%, 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence homology or sequence identity with SEQ ID NO: 4 or SEQ ID NO: 1, an Mpz promoter, or

[0169] b) a minimal myelin-specific promoter (miniMpz), optionally, comprising or consisting of the sequence defined in SEQ ID NO: 5 or SEQ ID NO: 22, optionally, the miniMPZ promoter has at least 75%, 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence homology or sequence identity with SEQ ID NO: 5 or SEQ ID NO: 22, a viral vector under the control of a minimal myelin-specific promoter (miniMpz).

[0170] A polynucleotide construct comprising a sequence of a first nucleic acid that is a minimal myelin-specific (Mpz) promoter operably linked to a sequence of a second nucleic acid, wherein the sequence of the second nucleic acid is either an open reading frame of a gene sequence or a non-coding RNA.

[0171] A minimal myelin-specific (Mpz) promoter that drives high-level expression in Schwann cells and is suitable for use in the viral vectors described herein.

[0172] The present invention also provides the following:

[0173] A viral vector for use in the treatment or prevention of CMT1X, comprising a human Mpz promoter (according to SEQ ID NO: 18) operably linked to the GJB1 gene, wherein the viral vector is AAV9, the viral vector,

[0174] Use of a viral vector in the manufacture of a medicament for the treatment or prevention of CMT1X, wherein the vector comprises a human Mpz promoter (according to SEQ ID NO: 18) operably linked to the GJB1 gene, and the viral vector is AAV9, the use, and

[0175] A method of treating or preventing CMT1X, comprising administering a viral vector to a patient in need thereof, wherein the viral vector comprises a human Mpz promoter (according to SEQ ID NO: 18) operably linked to the GJB1 gene, and the viral vector is AAV9, the method.

[0176] The present invention also provides the following:

[0177] A viral vector for use in the treatment or prevention of CMT4C, comprising a human minimal Mpz promoter (according to SEQ ID NO: 22) operably linked to the SH3TC2 gene, and being AAV9, the viral vector,

[0178] Use of a viral vector in the manufacture of a medicament for the treatment or prevention of CMT4C, wherein the vector comprises a human Mpz promoter (according to SEQ ID NO: 22) operably linked to the SH3TC2 gene, and the viral vector is AAV9, the use, and

[0179] A method of treating or preventing CMT4C, comprising administering a viral vector to a patient in need thereof, wherein the viral vector comprises a human Mpz promoter (according to SEQ ID NO: 22) operably linked to the SH3TC2 gene, and the viral vector is AAV9, the method.

[0180] The patients required include those who have shown one symptom of the diseases disclosed in this specification or have otherwise received a diagnosis thereof, and also include those who have or are suspected of developing one of the diseases disclosed in this specification.

Brief Description of the Drawings

[0181]

Figure 1

[0182]

Figure 2-1

Figure 2-2

[0183]

Figure 3-1

Figure 3-2

[0184]

Figure 4

[0185]

Figure 5

[0186]

Figure 6-1

Figure 6-2

[0187]

Figure 7-1

Figure 7-2

[0188]

Figure 8-1

Figure 8-2

[0189]

Figure 9

[0190]

Figure 10

[0191]

Figure 11-1

Figure 11-2

[0192]

Figure 12

[0193]

Figure 13

[0194]

Figure 14-1

Figure 14-2

[0195]

Figure 15-1

Figure 15-2

[0196]

Figure 16-1

Figure 16-2

[0197]

Figure 17

[0198] [Sequence]

[0199] SEQ ID NO: 1: AAV-Mpz.Egfp construct TIFF0007692369000001.tif243153 TIFF0007692369000002.tif41153

[0200] Bold = ITR sequence Italic = Mpz promoter Underline = EGFP Italic Underlined Part = WPRE Array

[0201] Array No. 2: AAV-Mpz.GJB1 Construct TIFF0007692369000003.tif244153 TIFF0007692369000004.tif45153

[0202] Bold = ITR Array Italic = Mpz Promoter Underlined Part = Cx32 Italic Underlined Part = WPRE Array

[0203] Array No. 3: AAV-miniMpz.Egfp Construct TIFF0007692369000005.tif243153 TIFF0007692369000006.tif9153

[0204] Bold = ITR Array Italic = mini-Mpz Promoter Underlined Part = EGFP Italic Underlined Part = WPRE Array

[0205] Array No. 4: Mpz Promoter TIFF0007692369000007.tif54154

[0206] Array No. 5: MiniMpz Promoter TIFF0007692369000008.tif21153

[0207] Array No. 6: Connexin-32 (Cx32): GenBank: AY408135.1 TIFF0007692369000009.tif42153

[0208] Array No. 7: SH3 Domain and Tetratricopeptide Repeat 2 (SH3TC2): GenBank: BC114486.1 TIFF0007692369000010.tif174153

[0209] Accession number 8: Peripheral myelin protein 22 (PMP22): NCBI Reference Sequence: NM_000304.4 TIFF0007692369000011.tif82153

[0210] Accession number 9: Myelin protein zero (MPZ): GenBank: AK313555.1 TIFF0007692369000012.tif41153

[0211] Accession number 10: Early growth response 2 (EGR2): NCBI Reference Sequence: NM_000399.5 TIFF0007692369000013.tif133153

[0212] Accession number 11: Ganglioside-induced differentiation-associated protein 1 (GDAP1): NCBI Reference Sequence: NM_018972.3 TIFF0007692369000014.tif50153

[0213] Accession number 12: N-Myc downstream regulated 1 (NDRG1): NCBI Reference Sequence: NM_001135242.1 TIFF0007692369000015.tif58153

[0214] Accession number 17: AAV-human-Mpz-GJB1 construct TIFF0007692369000016.tif242153 TIFF0007692369000017.tif41153

[0215] Bold = ITR sequence Italic = Human Mpz promoter Underlined part = Cx32 Italic underlined part = WPRE sequence

[0216] Accession number 18: Human hP0 promoter TIFF0007692369000018.tif45153

[0217] Sequence number 19: AAV-human-Mpz-Egfp mock construct TIFF0007692369000019.tif243153 TIFF0007692369000020.tif37153

[0218] Bold = ITR sequence Italic = human Mpz promoter Underlined = EGFP Italic and underlined = WPRE sequence

[0219] Sequence number 20: AAV-minMpz-SH3TC2.myc.ITR for therapeutic SH3TC2 gene replacement TIFF0007692369000021.tif241153 TIFF0007692369000022.tif114153

[0220] Bold = ITR sequence Italic = mini Mpz promoter Underlined = SH3TC2 Italic and underlined = synthetic minimal polyA

[0221] Sequence number 21: AAV-human-miniMpz-SH3TC2 TIFF0007692369000023.tif241153 TIFF0007692369000024.tif113153

[0222] Bold = ITR sequence Italic = mini human hP0 promoter Underlined = SH3TC2 Italic and underlined = synthetic minimal polyA

[0223] Sequence number 22: mini human hP0 promoter TIFF0007692369000025.tif22153

[0224] Accession number 23: AAV-human-miniMpz-Egfp TIFF0007692369000026.tif242154 TIFF0007692369000027.tif9153

[0225] Bold = ITR sequence Italic = Small human hP0 promoter Underlined = EGFP Italic underlined = WPRE sequence

[0226] Accession number 24: Minimal synthetic polyA sequence TIFF0007692369000028.tif4120

Example

[0227] Next, the present invention will be described with reference to the following non-limiting examples.

[0228] Example 1: AAV transfer plasmid cloning

[0229] The AAV vectors were designed to provide Schwann cell-specific expression of Cx32 (pAAV-Mpz.GJB1, full vector) or the reporter gene EGFP (pAAV-Mpz.Egfp, mock vector), both of which were shown to drive specific expression in Schwann cells under the 1.127 kB Mpz promoter (26, 32). These vectors were cloned using the AAV construct pAM / Mbp-EGFP-WPRE-bGH (57), which contains the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) and the bovine growth hormone polyadenylation sequence (bGHpA) adjacent to the AAV2 inverted terminal repeat, as the starting plasmid (Figures 1 and 9).

[0230] The specific details of how the three constructs AAV-Mpz.Egfp, AAV-Mpz.GJB1, and AAV-miniMpz.Egfp were cloned are as follows:

[0231] 264 - P0 - EGFP - WPRE (= AAV - Mpz.Egfp - SEQ ID NO:1)

[0232] To digest the promoter sequence using XhoI and EcoRV restriction enzymes, the pBluescript SK+ plasmid containing the Mpz promoter sequence was used. The AAV vector was also digested using the same enzymes. After ligation and transformation, the correct assembly of the expression cassette was confirmed by restriction digestion mapping and direct sequencing using primers covering the entire coding sequence.

[0233] 264 - Mpz(P0) - Cx32 - WPRE (= AAV - Mpz.GJB1 - SEQ ID NO:2)

[0234] The Mpz / Cx32 ORF was PCR - amplified from a previously created lentiviral construct. The primers used for amplification were P0 - Cx32 - F 5’ - AGGGGTACCCTTCCTGTTCAGACT - 3’ (SEQ ID NO:13) and P0 - Cx32 - R 5’ - CCGCTCGAGGGATCCTC AGCAG - 3’ (SEQ ID NO:14). The PCR product (2030bp) was gel - purified using the Qiagen gel extraction kit and digested with KpnI and XhoI. The AAV vector was also digested with the same restriction enzymes. The entire expression cassette was confirmed by direct sequencing of the ORF.

[0235] 264 - Mpz(P0)min - EGFP - WPRE (= AAV - miniMpz.Egfp - SEQ ID NO:3)

[0236] The AAV vector 264 was digested with HindIII and self-ligated. Subsequently, a linker was inserted into the vector. Mpzmin was PCR amplified from the rat Mpz promoter sequence using the following primers: KpnI-P0-F: 5'-GGGGTACCGCTCTCAGGCAAG-3' (SEQ ID NO: 15) and AgeI-P0-R: 5'-AAACCGGTTGGCAGAGCGTCTGT-3' (SEQ ID NO: 16). The insert (420 bp) was then directionally cloned into the AAV vector 264. EGFP was digested from another construct using AgeI and HindIII and directly ligated.

[0237] Example 2: Generation, Purification, and Titration of AAV Vectors

[0238] The generation of AAV9 vectors was performed according to a published protocol (58). The pAAV-Mpz.Egfp and pAAV-Mpz.GJB1 plasmids were cross-packaged into the AAV9 capsid (a capsid plasmid provided by Dr. A. Bosch of the University of Barcelona, Spain and originally developed by Dr. James Wilson of the University of Pennsylvania Vector Core, PA, USA).

[0239] Pseudotype 9 AAV virus stocks were generated as previously described (59). Recombinant AAV (rAAV) vectors were generated by triple transfection of HEK293 cells. Briefly, 48 hours after transfection, the cells were harvested by centrifugation (200 g, 10 minutes) and resuspended in 30 ml of 20 mM NaCl, 2 mM MgCl 8 2 and lysed by three freeze-thaw cycles in a dry ice / ethanol bath followed by centrifugation (10,000 g, 30 minutes). The supernatant was collected and filtered through a 0.45 μm filter. The rAAV vectors were purified by iodixanol gradient ultracentrifugation. 2, and resuspended in 50 mM Tris-HCl (pH 8.5) and lysed by 3 freeze-thaw cycles. The cell lysate was clarified by centrifugation (2000 g, 10 min), and rAAV particles were purified from the supernatant by an iodixanol gradient as follows: The clarified lysate was treated with 50 U / ml Benzonase (Novagen; 1 h at 37 °C) and centrifuged (3000 g, 20 min). The supernatant containing the vector was collected and adjusted to 200 mM NaCl using a 5 M stock solution. To precipitate the virus from the clarified cell lysate, polyethylene glycol (PEG 8000; Sigma) was added to a final concentration of 8%, and the mixture was incubated (3 h, 4 °C) and centrifuged (8000 g, 15 min). The pellet containing rAAV was resuspended in 20 mM NaCl, 2 mM MgCl 2 , and 50 mM Tris-HCl (pH 8.5) and incubated at 4 °C for 48 h. rAAV particles were purified using the iodixanol method as described (59). If necessary, rAAV was concentrated and desalted with PBSMK using an Amicon Ultra-15 centrifugal filter device (Millipore). Titration was evaluated by PicoGreen quantification (60) and calculated as viral genomes per milliliter (vg / ml).

[0240] Example 3: Intrathecal Vector Delivery

[0241] After making a small skin incision along the lower lumbar level to visualize the spine, an AAV vector was delivered to the L5-L6 intervertebral space of anesthetized mice at a slow rate of 5 μl / min. A 50 μL Hamilton syringe (Hamilton, Giarmata, Romania) connected to a 26-gauge needle was used to inject a total volume of 20 μL containing 0.5 - 1×10 11 vector genomes (vg) of the AAV vector. Tail flick was considered to indicate successful intrathecal administration.

[0242] Example 4: Gene Expression Targeting Schwann Cells via AAV9

[0243] Two-month-old wild-type mice were treated with the AAV9-Mpz-Egfp vector described in Examples 1 and 3 above. Samples were analyzed by DNA extraction from PNS tissue and confirmation of the presence of viral DNA measured as vector copy number (VCN) at 4 and 6 weeks post-injection (Table 1) as previously described (33). Immunofluorescent staining of lumbar nerve root sections and immunoblots of lumbar nerve roots, femoral nerves, and sciatic nerves were also performed at 4 and 8 weeks post-injection as described below (Table 2).

[0244] Immunofluorescence staining: For immunostaining, mice were anesthetized with avertin according to a protocol approved by the facility, and then perfused transcardially with saline followed by fresh 4% paraformaldehyde in 0.1 M PB buffer. The lumbosacral spinal cord with attached spinal nerve roots, as well as the bilateral sciatic and femoral nerves, were dissected. While all tissues were frozen for cryosectioning, the sciatic and femoral nerves were isolated and teased into fibers under a stereoscope. The teased fibers or sections were permeabilized with cold acetone and incubated with a blocking solution of 5% BSA (Sigma-Aldrich, Munich, Germany) containing 0.5% Triton-X (Sigma-Aldrich, Munich, Germany) for 1 hour at room temperature (RT). The primary antibodies used were as follows: mouse monoclonal antibody against contactin-associated protein (Caspr, 1:50; a gift from Dr. Elior Peles of the Weizmann Institute of Science), rabbit antiserum against EGFP (1:1,000; Invitrogen, United States of America), Capr2 (1:200, Alomone Labs, Israel) and Cx32 (1:50; Sigma, Munich, Germany), all diluted in the blocking solution and incubated overnight at 4°C. The slides were then washed with PBS and incubated with fluorescein and rhodamine-conjugated mouse and rabbit cross-affinity purified secondary antibodies (1:500; Jackson ImmunoResearch, United States of America) for 1 hour at room temperature (RT). Cell nuclei were visualized with DAPI (1 μg / ml; Sigma, Munich, Germany). The slides were mounted with a fluorescence mounting medium and images were taken under a fluorescence microscope equipped with a digital camera using Axiovision software (Carl Zeiss MicroImaging; Oberkochen, Germany).

[0245] The expression rate of the Egfp reporter gene was quantified by counting the number of EGFP-positive Schwann cells as a percentage of the total Schwann cells in the lumbar nerve roots and sciatic nerve. The expression of Cx32 was quantified by visualizing the nodal regions of myelinated fibers with an axonal domain marker including paranodal proximal Kv1.2 and paranodal Caspr by double staining with Cx32. The number of nodal regions positive for Cx32 immunoreactivity was counted as a percentage of the total nodal regions in the lumbar nerve roots and sciatic nerve.

[0246] Immunoblot analysis: Immunoblot analysis of nerve root and peripheral nerve lysates was used to detect the expression of either the reporter gene Egfp or Cx32 in the tissues of injected mice. Immunoblots of lysates from lumbar nerve roots, femoral nerves, and sciatic nerves collected 4 weeks after injection were incubated with rabbit anti-Egfp (1:1000; Abcam) and anti-Cx32 (clone 918, 1:3,000) primary antibodies, followed by an HRP-conjugated anti-rabbit secondary antibody (Jackson ImmunoResearch, diluted 1:3,000). Bound antibodies were visualized by an enhanced chemiluminescence system (GE Healthcare Life Sciences).

[0247] The results are shown in Figure 2 below, and Tables 1 and 2. High expression levels of the reporter gene EGFP (enhanced green fluorescent protein) can be detected particularly in myelinated cells of the PNS including Schwann cells, lumbar spinal nerve roots, and distal sciatic nerve, which indicates specific expression of the EGFP reporter gene in lumbar nerve root and sciatic nerve samples, suggesting that tissue-specific expression in Schwann cells is achieved using this vector delivery system.

[0248]

Table 1

[0249]

Table 2

[0250] Example 5: Expression of Intrathecally Delivered AAV9-Mpz.GJB1 Vector in 2-Month-Old Cx32 KO and R75W KO Mice

[0251] The AAV9-Mpz.GJB1 vector was generated as described in Example 1 above (5×10 12 vg / ml) and delivered to 2-month-old and 6-month-old Cx32 KO mice by lumbar intrathecal (i.th.) injection (5×10 10 vg in 20 μl). Analysis of VCN from DNA extracted from PNS tissues as described above (33) for each cell of different tissues revealed a broad in vivo distribution (Figure 3A) with the highest levels in the liver, including the spinal nerve roots and sciatic nerves (55). Immunostaining analysis and immunoblot analysis were performed as described above. Cx32 was expressed in more than 60 - 70% of the paranodal myelin regions of myelinated Schwann cells in the lumbar nerve roots and sciatic nerve fibers (Figures 3B - 3D). High levels of AAV9-delivered Cx32 expression could also be detected by Western blot of PNS tissue lysates of injected mice, in contrast to non-injected Cx32 KO mice (Figure 3F).

[0252] To determine whether an AAV9-Mpz.GJB1 viral vector that allows for higher expression levels could overcome the interference effect of the Golgi retention mutant observed with lentiviral vectors in previous studies (29, 34), the inventors also injected 2-month-old R75W knockout (R75W KO) mice. Importantly, paranodal localization of AAV9-delivered Cx32 was also detected in R75W / KO tissues, despite co-expression of the interfering Golgi retention R75W mutant that shows typical perinuclear localization (Figure 3E). Thus, AAV9 shows the potential to provide widespread high-level Schwann cell target gene expression that may overcome the interference effect of a representative Golgi retention CMT1X mutant.

[0253] These results are shown in Figure 3 below, as well as Tables 3 and 4, which show that delivery of a copy of the wild-type GJB1 gene using a vector results in successful expression of Cx32 in both Cx32 knockout mice and R75W knockout mice. The R75W Golgi retention mutant (Figure 3E) also achieves expression of Cx32, despite the presence of the R75W Cx32 mutant protein in the perinuclear region, which was not possible in previous studies without using an AAV vector.

[0254] [Table 3]

[0255] [Table 4]

[0256] Example 6: Behavioral analysis of 6-month-old Cx32 KO mice injected with AAV9-Mpz.GJB1 (complete) compared to littermates treated with AAV9-Mpz.Egfp (mock)

[0257] Treatment of mice: The gene therapy study was conducted using two groups of 6-month-old Cx32 knockout (KO) mice. Based on previous studies using similar models, it was considered appropriate to have a minimum of 8 - 12 mice per treatment group for each measured outcome to evaluate statistically significant differences (32, 33). The animals were treated at 6 months of age after the onset of the disease state (which is known to begin after 3 months of age).

[0258] Littermate mice were randomized to receive either AAV9-Mpz.GJB1 (complete) treatment or AAV9-Mpz.Egfp (mock treatment as a control group) and assigned a coding number for further identification.

[0259] Behavioral tests: Next, mice were evaluated by the behavioral tests described below by an examiner unaware of the treatment conditions, before treatment and again at 8 and 10 months of age (Figure 4 and Table 5).

[0260] Rotarod test: Motor balance and coordination were determined as previously described (61) using an accelerating rotarod apparatus (Ugo Basile, Varese, Italy). Animal training consisted of three trials per day for three consecutive days with a 15-minute rest period between trials. Mice were placed on the rod and the speed was gradually increased from 4 revolutions per minute to 40 revolutions per minute (rpm). The test was performed on the fourth day using two different speeds, 20 rpm and 32 rpm. The latency to fall was calculated for each speed. The test continued until the mouse fell off the rod or until the mouse remained on the rod for 600 seconds, after which it was removed. Each mouse was placed on the rotarod three times at each speed used, and three different values were obtained for each speed. The average value for each mouse at the two different speeds was used.

[0261] Grip strength test: To measure grip strength, mice were held by the tail and lowered towards the apparatus (Ugo Basile, Varese, Italy) until they grasped the grid with their hind paws. The mouse was gently pulled back until it released the grid. The measured force value in g was indicated by the instrument. Each session consisted of three consecutive trials and the measured values were averaged. The hind limb strength was compared between mice treated with AAV9.Mpz-GJB1 and mice treated with AAV9.Mpz-Egfp.

[0262] Older Cx32 KO mice treated with the complete AAV9-Mpz.GJB1 therapeutic vector left significantly better results in these tests compared to their littermates injected with the AAV9-Mpz.Egfp mock (non-therapeutic) vector (n = 20 mice per group).

[0263] The results are shown in Figure 4 and Table 5 below. This indicates that the motor ability (measured by both the rotarod test and the grip strength test) of the GJB1-treated group was improved at 2 months after injection (8 months of age), and this improvement remained stable until 10 months of age. Mock-treated mice did not show improvement in motor ability.

[0264]

Table 5

[0265] Example 7: Sciatic Nerve Motor Conduction Test

[0266] After the onset of neuropathy, Cx32 KO mice at 6 months of age were treated as described in Example 6 above, and then a motor nerve conduction test was performed at 10 months of age as described below.

[0267] Motor nerve conduction velocity (MNCV): MNCV was measured in vivo using a bipolar electrode with a supramaximal rectangular pulse (5 V) of 0.05 milliseconds to stimulate at the sciatic notch and distal to the ankle of anesthetized animals, and then using a published method (62) from both sciatic nerves. The latency of the compound muscle action potential (CMAP) was recorded by a bipolar electrode inserted between the second and third toes of the hind paw and measured from the start of the negative M-wave deflection from the stimulus artifact. MNCV was calculated by dividing the distance between the stimulating and recording electrodes by the result of subtracting the distal latency from the proximal latency.

[0268] The results of the MNCV test performed at 10 months of age are shown in Figure 5 and Table 6 below. This indicates that when measured at 10 months in Cx32 KO mice treated with GJB1, the motor nerve conduction velocity was improved compared to the mock-treated control group (n = 10 mice), approaching the wild-type level.

Table 6

[0269] Example 8: Morphological analysis of the anterior spinal nerve roots, sciatic nerve, and femoral nerve of Cx32 KO mice after intrathecal delivery of AAV9-Mpz.GJB1 compared to a mock-treated mouse vector.

[0270] Cx32 KO mice were treated at 6 months of age as described in Example 6 above and examined at 10 months of age, 4 months later.

[0271] Mice were perfused transcardially with 2.5% glutaraldehyde in 0.1 M PB buffer. The lumbar spinal cord with multiple spinal nerve roots attached, as well as the femoral nerve and sciatic nerve, were dissected, fixed overnight at 4°C, then osmium tetroxide stained, dehydrated, and embedded in Araldite resin (all purchased from Agar Scientific, Essex, UK). Transverse semi-thin sections (1 μm) of the lumbar spinal cord containing the roots and central portions of the femoral motor nerve and sciatic nerve were obtained and stained with alkaline toluidine blue (Sigma-Aldrich, Munich, Germany). Sections were visualized with 10x, 20x, and 40x objective lenses and captured with a Nikon DS-L3 camera (Nikon Eclipse-Ni; Tokyo, Japan). Images of the entire root or transverse nerve sections were acquired at a final magnification of 100 - 200x, and a series of partially overlapping regions covering the cross-sectional area of the root or nerve were captured at a final magnification of 400x. These images were used to examine the degree of abnormal myelination in both groups as previously described (22, 32, 63). Briefly, demyelinated, remyelinated, and normally myelinated axons were counted using the following criteria: Axons greater than 1 μm without a myelin sheath were considered demyelinated, axons with a myelin sheath less than 10% of the axon diameter and / or "onion bulb-like structures" (i.e., circumferentially arranged Schwann cell processes and extracellular matrix) were considered remyelinated, and other myelinated axons were considered normally myelinated.

[0272] Furthermore, as an index of inflammation, the number of foamy macrophages present throughout the cross-section of each root or nerve was counted. Macrophages were identified in semi-thin sections at 400x magnification as cells that contain myelin debris, lack a basement membrane, and extend small microvilli-like processes, as previously described (64, 65). Macrophage counts were calculated as a ratio per 1,000 myelinated fibers to account for differences in size between different spinal nerve roots and nerves. All pathological analyses were performed blinded to the treatment conditions of each mouse.

[0273] The results are shown in FIGS. 6 and 7 (ventral spinal nerve roots), FIGS. 7 and 8 (sciatic nerve), and FIGS. 8 and 9 (femoral motor nerve). These results indicate that myelination of the spinal nerve roots, sciatic nerve, and femoral nerve was improved, with a concomitant improvement in the ratio of abnormally myelinated fibers and fewer demyelinated and remyelinated fibers compared to the mock-treated control group. All samples showed a decrease in the number of foamy macrophages in the GJB1 treatment group, suggesting a reduction in inflammation in the treatment group.

[0274] [Table 7]

[0275] [Table 8]

[0276] [Table 9]

[0277] Example 9: Development of an AAV vector for Schwann cell-targeted expression driven by the miniMpz element

[0278] The AAV9-based approach described in the above example has a high potential for clinical translation for treating other demyelinating CMT types, including CMT4C. However, it is necessary to overcome the limitation of the small transgene capacity of the AAV vector.

[0279] To promote gene expression targeting Schwann cells via AAV, the inventors cloned the minimal Mpz promoter. Starting from the 1.127 kb full-length Mpz promoter (SEQ ID NO: 4), based on enhancer / ChIP-seq data indicating that the functional regulatory elements (Egr2 and Sox10 binding sites) of the full-length Mpz promoter are located 400 bp upstream of the start codon (56), the inventors chose this strategy to achieve target expression in Schwann cells using a promoter of the smallest size to remain within the carrying capacity of the AAV vector. The inventors PCR-amplified 410 bp from the Mpz promoter upstream of the start codon and then further cloned this miniMpz promoter into the AAV transfer plasmid together with Egfp downstream as a reporter gene to generate the AAV9-miniMpz.Egfp vector (SEQ ID NO: 3 and FIG. 9).

[0280] When this AAV9-miniMpz.Egfp vector was verified in vivo in 2-month-old wild-type (WT) mice using the same delivery method described in Example 3 by single lumbar intrathecal injection, it was shown to drive the expression of the reporter gene EGFP in a high percentage of myelinated Schwann cells throughout the entire PNS. This showed broad expression of the vector mainly limited to the myelinated Schwann cells of the PNS tissue, with an expression rate exceeding 50% and a high vector copy number (VCN) in the lumbar spinal nerve roots and peripheral nerves (FIG. 10).

[0281] In combination with EGFP, spinal cord tissue immunostaining from AAV9-miniMpz-Egfp-injected mice was performed in the same manner as described in Example 4 using cell markers including neuron NeuN, astrocyte GFAP, and oligodendrocyte CC-1 in white and gray matter, showing that the miniMpz-driven construct was present only in a very small subset of about 2-3% of both CNS neurons and glial cells quantified from n = 3-5 mice (Figure 11).

[0282] The results are shown in Figure 10 (lumbar nerve roots and sciatic nerve) and Figure 11 (lumbar spinal cord), which show that the expression of EGFP was appropriately distributed in the lumbar nerve roots and sciatic nerve and minimal in the lumbar spinal cord, indicating that after injection, in vivo distribution of the vector and expression of the EGFP reporter protein were seen in Schwann cells of the peripheral nervous system.

[0283] Example 10: Efficacy of gene therapy treatment in a model of CMT1X when treated before onset at the early stage of neuropathy

[0284] A group of 2-month-old Cx32 knockout (KO) mice (n = 10 mice per group), which are a model of CMT1X, were injected with either a therapeutic (complete) AAV9-Mpz-GJB1 vector or a negative control (mock) vector AAV9-Mpz-Egfp at 2 months of age. Behavioral analysis was performed before treatment and at 4 and 6 months of age. Electrophysiological analysis was performed at 6 months of age, followed by morphological analysis of semi-thin sections of peripheral nerve tissue. The same protocol as described in Examples 6-8 above was used, except that the mice were treated at 2 months of age.

[0285] This data provides a model of pre-onset treatment of mice at the early stage (2 months of age) of neuropathy in addition to post-onset treatment at the late stage of 6 months (Examples 6-8).

[0286] Behavioral results of treated vs mock-treated 6-month-old Cx32 KO mice

[0287] Using either a therapeutic (complete) vector or a negative control (mock) vector, a group of 2-month-old Cx32 knockout (KO) mice, which are a model of CMT1X, were treated, and the motor ability of the mice at 4 months and 6 months of age was examined. The completely treated group showed significantly improved muscle strength at both time points compared to the mock-treated group (Figures 12A and 12B). The completely treated group also showed a significant improvement over time after treatment (Figure 12C), while the mock-treated mice showed no improvement.

[0288] Electrophysiological studies in pre-onset treated versus mock-treated 6-month-old Cx32 KO mice

[0289] Figure 13 shows electrophysiological studies of treated (complete) and mock-treated 6-month-old Cx32 KO mice that showed a significant improvement in sciatic nerve conduction velocity after gene therapy treatment.

[0290] Figure 13 shows that the sciatic nerve conduction velocity of AAV9-Mpz-GJB1 (full-length vector) treated pre-onset was significantly improved compared to Cx32 KO mice treated with the mock vector.

[0291] Morphological studies of peripheral nerve tissue in treated versus mock-treated 6-month-old Cx32 KO mice

[0292] Semithin sections of the anterior lumbar nerve roots (Figure 14), intermediate sciatic nerve (Figure 15), and femoral motor nerve (Figure 16) of treated versus mock-treated 6-month-old Cx32 KO mice were examined, and the ratio of abnormally myelinated fibers and the number of macrophages were quantified in the completely treated group compared to 6-month-old mock-treated Cx32 KO mice.

[0293] As shown in each of Figures 14, 15, and 16, the treated animals had fewer demyelinated (*) or remyelinated (r) fibers and fewer foamy macrophages compared to the mock-treated mice. This suggests an improvement in myelination and a reduction in inflammation in the treated group.

[0294] Example 11: Development of a humanized therapeutic vector for treating CMT1X

[0295] The vector described in Example 1 is controlled by the rat Mpz promoter. To humanize this construct to make it more suitable for clinical use, the inventors also cloned the human hP0 promoter (SEQ ID NO: 18), which can be used in preclinical dose-response studies and non-human primate (NHP) toxicity and biodistribution studies, into the human-Mpz-GJB1 construct (SEQ ID NO: 17). The human P0 sequence was PCR amplified from genomic DNA using primers for introducing KpnI and AgeI restriction enzymes. The primers were KpnhP0-F-5’-AGGGGTACCGCCTGGCATAAAC-3’ (SEQ ID NO: 25) and AgehP0-R-5’-AATTTACCGGTGCTGGGGCAG-3’ (SEQ ID NO: 26). After ligation of hP0, the Cx32 ORF was excised from the existing construct using BamHI and XhoI. Cx32 was ligated into the AAV transfer construct, and correct assembly of the expression cassette was confirmed by restriction digestion mapping and direct sequencing.

[0296] A humanized mock vector plasmid (human-Mpz-Egfp) was also generated for use as a control (SEQ ID NO: 19).

[0297] Example 12: Development and expression analysis of a therapeutic vector for treating CMT4C

[0298] A small Mpz-SH3TC2.myc construct similar to that described in Example 9, which utilizes the small rat-derived Mpz promoter of SEQ ID NO: 5 above, was developed by using the SH3TC2 gene insert and further modifying the ITR-ITR segment to remain within a range of approximately 4700 bp (including removal of WPRE and substitution of polyA with minimal synthetic polyA) (68, 69) to enable efficient packaging into AAV9. The sequence of this therapeutic vector is shown in SEQ ID NO: 20.

[0299] Expression analysis of this novel therapeutic vector (mini-Mpz-SH3TC2.myc) was performed in a group of CMT4C model mice. These results complement the development of the minimal Mpz promoter vector that drives reporter gene expression described in Example 9 above.

[0300] A novel AAV-miniMpz-SH3TC2.myc construct was generated and packaged into AAV9 serotype to achieve a titer of 5×10 12 vg / ml. The vector (a total of 1×10 11 vg in a volume of 20 μl) was delivered by lumbar intrathecal injection to 5-month-old Sh3tc2− / − mice (n = 5), and expression was examined 5 weeks after injection into fixed lumbar nerve roots and bilateral sciatic nerve sections.

[0301] Expression of SH3TC2 was detected in a high percentage of myelinated Schwann cells with a characteristic perinuclear granular appearance and sometimes along the entire length of Schwann cells throughout the PNS, including nerve roots and sciatic nerves (Figures 17A - 17F). Quantification of the percentage of SH3TC2 immunoreactive Schwann cells showed an expression rate of 54.67% on average in lumbar nerve roots and 45.39% in sciatic nerves (Figure 17G).

[0302] These results indicate that the construct achieved good levels of expression in myelinated Schwann cells throughout the PNS.

[0303] Example 13: Development of a humanized therapeutic vector for treating CMT4C

[0304] The small-sized Mpz-SH3TC2.myc (SEQ ID NO: 20) construct (described in Example 12 above, preclinical expression analysis), which is very suitable for preclinical trials (because the minimal rat Mpz promoter and myc tag are included in SH3TC2), was modified (SEQ ID NO: 21) to be more suitable for clinical use.

[0305] The myc tag was removed and the minimal rat promoter was replaced with the corresponding sequence (SEQ ID NO: 22) of the minimal human Mpz promoter. This vector can be used for the final preclinical dose-response study and NHP toxicity and biodistribution studies before proceeding to clinical applications. A humanized mock vector plasmid (human-miniMpz-Egfp) was also generated (SEQ ID NO: 23).

[0306] [References]

[0307] 1. Baets J, De Jonghe P, Timmerman V. Recent advances in Charcot-Marie-Tooth disease. Curr Opin Neurol. 2014;27(5):532-40. 2. Kleopa KA, Scherer SS. Inherited Neuropathies. Neurol Clinics North America. 2002;20:679-709. 3. Kleopa KA, Kagiava A, Sargiannidou I. Gene Therapy for CMT Inherited Neuropathy. In: Duan D, Mendell J (eds): Muscle Gene Therapy. 2019;https: / / doi.org / 10.1007 / 978-3-030-03095-7_35 (Springer, Cham). 4. Bergoffen J, Scherer SS, Wang S, Oronzi-Scott M, Bone L, Paul DL, et al. Connexin mutations in X-linked Charcot-Marie-Tooth disease. Science. 1993;262:2039-42. 5. Kleopa KA, Scherer SS. Molecular genetics of X-linked Charcot-Marie-Tooth disease. Neuromolecular Med. 2006;8:107-22. 6. Hahn AF, Brown WF, Koopman WJ, Feasby TE. X-linked dominant hereditary motor and sensory neuropathy. Brain. 1990;113:1511-25. 7. Birouk N, Le Guern E, Maisonobe T, Rouger H, Gouider R, Gugenheim M, et al. X-linked Charcot-Marie-Tooth disease with connexin 32 mutations - clinical and electrophysiological study. Neurology. 1998;50:1074-82. 8. Shy ME, Siskind C, Swan ER, Krajewski KM, Doherty T, Fuerst DR, et al. CMT1X phenotypes represent loss of GJB1 gene function. Neurology. 2007;68:849-55. 9. Dubourg O, Tardieu S, Birouk N, Gouider R, Leger JM, Maisonobe T, et al. Clinical, electrophysiological and molecular genetic characteristics of 93 patients with X-linked Charcot-Marie-Tooth disease. Brain. 2001;124:1958-67. 10. Liang GSL, de Miguel M, Gomez-Hernandez JM, Glass JD, Scherer SS, Mintz M, et al. Severe neuropathy with leaky connexin32 hemichannels. Ann Neurol. 2005;57:749-54. 11. Al-Mateen M, Craig AK, Chance PF. The Central Nervous System Phenotype of X-Linked Charcot-Marie-Tooth Disease: A Transient Disorder of Children and Young Adults. J Child Neurol. 2014;29:342-8 12. Hahn AF, Ainsworth PJ, Bolton CF, Bilbao JM, Vallat J-M. Pathological findings in the X-linked form of Charcot-Marie-Tooth disease: a morphometric and ultrastructural analysis. Acta Neuropathol. 2001;101:129-39. 13. Hattori N, Yamamoto M, Yoshihara T, Koike H, Nakagawa M, Yoshikawa H, et al. Demyelinating and axonal features of Charcot-Marie-Tooth disease with mutations of myelin-related proteins (PMP22, MPZ and Cx32): a clinicopathological study of 205 Japanese patients. Brain. 2003;126:134-51. 14. Kleopa KA, Zamba-Papanicolaou E, Alevra X, Nicolaou P, Georgiou D-M, Hadjisavvas A, et al. Phenotypic and cellular expression of two novel connexin32 mutations causing CMT1X. Neurology. 2006;66:396-402. 15. Omori Y, Mesnil M, Yamasaki H. Connexin 32 mutations from X-linked Charcot-Marie-Tooth disease patients: functional defects and dominant negative effects. Mol Biol Cell. 1996;7(6):907-16. 16. Yoshimura T, Satake M, Ohnishi A, Tsutsumi Y, Fujikura Y. Mutations of connexin32 in Charcot-Marie-Tooth disease type X interfere with cell-to-cell communication but not cell proliferation and myelin-specific gene expression. J Neurosci Res. 1998;51(2):154-61. 17. Yum SW, Kleopa KA, Shumas S, Scherer SS. Diverse trafficking abnormalities of Connexin32 mutants causing CMTX. Neurobiol Dis. 2002;11:43-52. 18. Deschenes SM, Walcott JL, Wexler TL, Scherer SS, Fischbeck KH. Altered trafficking of mutant connexin32. J Neurosci. 1997;17:9077-84. 19. Oh S, Ri Y, Bennett MVL, Trexler EB, Verselis VK, Bargiello TA. Changes in permeability caused by connexin 32 mutations underlie X-linked Charcot-Marie-Tooth disease. Neuron. 1997;19(4):927-38. 20. Martin PEM, Mambetisaeva ET, Archer DA, George CH, Evans WH. Analysis of gap junctions assembly using mutated connexins detected in Charcot-Marie-Tooth X-linked disease. J Neurochem. 2000;74:711-20. 21. Kleopa KA, Yum SW, Scherer SS. Cellular mechanisms of connexin32 mutations associated with CNS manifestations. J Neurosci Res. 2002;68:522-34. 22. Sargiannidou I, Vavlitou N, Aristodemou S, Hadjisavvas A, Kyriacou K, Scherer SS, et al. Connexin32 mutations cause loss of function in Schwann cells and oligodendrocytes leading to PNS and CNS myelination defects. J Neurosci. 2009;29:4748-61. 23. Sargiannidou I, Kim GH, Kyriakoudi S, Eun BL, Kleopa KA. A start codon CMT1X mutation associated with transient encephalomyelitis causes complete loss of Cx32. Neurogenetics. 2015;16(3):193-200. 24. Anzini P, Neuberg DH-H, Schachner M, Nelles E, Willecke K, Zielasek J, et al. Structural abnormalities and deficient maintenance of peripheral nerve myelin in mice lacking the gap junction protein connexin32. J Neurosci. 1997;17:4545-61. 25. Scherer SS, Xu Y-T, Nelles E, Fischbeck K, Willecke K, Bone LJ. Connexin32-null mice develop a demyelinating peripheral neuropathy. Glia. 1998;24:8-20. 26. Scherer SS, Xu YT, Messing A, Willecke K, Fischbeck KH, Jeng LJ. Transgenic expression of human connexin32 in myelinating Schwann cells prevents demyelination in connexin32-null mice. J Neurosci. 2005;25:1550-9. 27. Abel A, Bone LJ, Messing A, Scherer SS, Fischbeck KF. Studies in transgenic mice indicate a loss of connexin32 function in X-linked Charcot-Marie-Tooth disease. J Neuropathol Exp Neurol. 1999;58:702-10. 28. Jeng LJ, Balice-Gordon RJ, Messing A, Fischbeck KH, Scherer SS. The effects of a dominant connexin32 mutant in myelinating Schwann cells. Mol Cell Neurosci. 2006;32:283-98. 29. Kagiava A, Karaiskos C, Richter J, Tryfonos C, Lapathitis G, Sargiannidou I, et al. Intrathecal gene therapy in mouse models expressing CMT1X mutations. Hum Mol Genet. 2018;27(8):1460 - 73. 30. Huang Y, Sirkowski EE, Stickney JT, Scherer SS. Prenylation - defective human connexin32 mutants are normally localized and function equivalently to wild - type connexin32 in myelinating Schwann cells. J Neurosci. 2005;25:7111 - 20. 31. Hahn AF, Ainsworth PJ, Naus CCG, Mao J, Bolton CF. Clinical and pathological observations in men lacking the gap junction protein connexin 32. Muscle Nerve. 2000:S39 - S48. 32. Sargiannidou I, Kagiava A, Bashiardes S, Richter J, Christodoulou C, Scherer SS, et al. Intraneural GJB1 gene delivery improves nerve pathology in a model of CMT1X. Ann Neurol. 2015;78:303 - 16. 33. Kagiava A, Sargiannidou I, Theophilidis G, Karaiskos C, Richter J, Bashiardes S, et al. Intrathecal gene therapy rescues a model of demyelinating peripheral neuropathy. Proc Natl Acad Sci USA. 2016;113(17):E2421-9. doi:10.1073 / pnas.1522202113. 34. Kyriakoudi S, Sargiannidou I, Kagiava A, Olympiou M, Kleopa KA. Golgi-retained Cx32 mutants interfere with gene addition therapy for CMT1X. Hum Mol Genet. 2017;26(9):1622-33. 35. Fridman V, Bundy B, Reilly MM, Pareyson D, Bacon C, Burns J, et al. CMT subtypes and disease burden in patients enrolled in the Inherited Neuropathies Consortium natural history study: a cross-sectional analysis. J Neurol Neurosurg Psychiatry. 2015;86(8):873-8. 36. Kessali M, Zemmouri R, Guilbot A, Maisonobe T, Brice A, LeGuern E, et al. A clinical, electrophysiologic, neuropathologic, and genetic study of two large Algerian families with an autosomal recessive demyelinating form of Charcot-Marie-Tooth disease. Neurology. 1997;48(4):867-73. 37. Gabreels-Festen A, van Beersum S, Eshuis L, LeGuern E, Gabreels F, van Engelen B, et al. Study on the gene and phenotypic characterisation of autosomal recessive demyelinating motor and sensory neuropathy (Charcot-Marie-Tooth disease) with a gene locus on chromosome 5q23-q33. J Neurol Neurosurg Psychiatry. 1999;66(5):569-74. 38. Azzedine H, Ravise N, Verny C, Gabreels-Festen A, Lammens M, Grid D, et al. Spine deformities in Charcot-Marie-Tooth 4C caused by SH3TC2 gene mutations. Neurology. 2006;67(4):602-6. 39. Gooding R, Colomer J, King R, Angelicheva D, Marns L, Parman Y, et al. A novel Gypsy founder mutation, p.Arg1109X in the CMT4C gene, causes variable peripheral neuropathy phenotypes. J Med Genet. 2005;42(12):e69. 40. Colomer J, Gooding R, Angelicheva D, King RH, Guillen-Navarro E, Parman Y, et al. Clinical spectrum of CMT4C disease in patients homozygous for the p.Arg1109X mutation in SH3TC2. Neuromuscul Disord. 2006;16(7):449-53. 41. Varley TL, Bourque PR, Baker SK. Phenotypic variability of CMT4C in a French-Canadian kindred. Muscle Nerve. 2015. 42. Senderek J, Bergmann C, Stendel C, Kirfel J, Verpoorten N, De Jonghe P, et al. Mutations in a Gene Encoding a Novel SH3 / TPR Domain Protein Cause Autosomal Recessive Charcot-Marie-Tooth Type 4C Neuropathy. Am J Hum Genet. 2003;73:1106-19. 43. LeGuern E, Guilbot A, Kessali M, Ravise N, Tassin J, Maisonobe T, et al. Homozygosity mapping of an autosomal recessive form of demyelinating Charcot-Marie-Tooth disease to chromosome 5q23-q33. Hum Mol Genet. 1996;5(10):1685-8. 44. Lassuthova P, Mazanec R, Vondracek P, Siskova D, Haberlova J, Sabova J, et al. High frequency of SH3TC2 mutations in Czech HMSN I patients. Clin Genet. 2011;80(4):334-45. 45. Lupo V, Galindo MI, Martinez-Rubio D, Sevilla T, Vilchez JJ, Palau F, et al. Missense mutations in the SH3TC2 protein causing Charcot-Marie-Tooth disease type 4C affect its localization in the plasma membrane and endocytic pathway. Hum Mol Genet. 2009;18(23):4603-14. 46. Arnaud E, Zenker J, de Preux Charles AS, Stendel C, Roos A, Medard JJ, et al. SH3TC2 / KIAA1985 protein is required for proper myelination and the integrity of the node of Ranvier in the peripheral nervous system. Proc Natl Acad Sci USA. 2009;106(41):17528-33. 47. Gouttenoire EA, Lupo V, Calpena E, Bartesaghi L, Schupfer F, Medard JJ, et al. Sh3tc2 deficiency affects neuregulin-1 / ErbB signaling. Glia. 2013;61(7):1041-51. 48. Zoupi L, Savvaki M, Karagogeos D. Axons and myelinating glia: An intimate contact. IUBMB Life. 2011;63(9):730-5. 49. Schiza N, Georgiou E, Kagiava A, Medard J-J, Richter J, Tryfonos C, et al. Gene replacement therapy in a model of Charcot-Marie-Tooth 4C neuropathy. Brain. 2019;142(5):1227-1241. 50. Tanguy Y, Biferi MG, Besse A, Astord S, Cohen-Tannoudji M, Marais T, et al. Systemic AAVrh10 provides higher transgene expression than AAV9 in the brain and the spinal cord of neonatal mice. Front Mol Neurosci. 2015;8:36. 51. Foust KD, Nurre E, Montgomery CL, Hernandez A, Chan CM, Kaspar BK. Intravascular AAV9 preferentially targets neonatal neurons and adult astrocytes. Nat Biotechnol. 2009;27(1):59 - 65. 52. Gurda BL, De Guilhem De Lataillade A, Bell P, Zhu Y, Yu H, Wang P, et al. Evaluation of AAV-mediated Gene Therapy for Central Nervous System Disease in Canine Mucopolysaccharidosis VII. Mol Ther. 2016;24(2):206 - 16. 53. Calcedo R, Wilson JM. Humoral Immune Response to AAV. Front Immunol. 2013;4:341. 54. Jackson KL, Dayton RD, Klein RL. AAV9 supports wide-scale transduction of the CNS and TDP-43 disease modeling in adult rats. Mol Ther Methods Clin Dev. 2015;2:15036. 55. Meyer K, Ferraiuolo L, Schmelzer L, Braun L, McGovern V, Likhite S, et al. Improving single injection CSF delivery of AAV9-mediated gene therapy for SMA: a dose-response study in mice and nonhuman primates. Mol Ther. 2015;23(3):477-87. 56. Jang SW, Svaren J. Induction of myelin protein zero by early growth response 2 through upstream and intragenic elements. J Biol Chem. 2009;284(30):20111-20. 57. von Jonquieres G, Mersmann N, Klugmann CB, Harasta AE, Lutz B, Teahan O, et al. Glial promoter selectivity following AAV-delivery to the immature brain. PLoS One. 2013;8(6):e65646. 58. Georgiou E, Sidiropoulou K, Richter J, Papaneophytou C, Sargiannidou I, Kagiava A, et al. Gene therapy targeting oligodendrocytes provides therapeutic benefit in a leukodystrophy model. Brain. 2017;140(3):599-616. 59. Zolotukhin S, Byrne BJ, Mason E, Zolotukhin I, Potter M, Chesnut K, et al. Recombinant adeno-associated virus purification using novel methods improves infectious titer and yield. Gene Ther. 1999;6(6):973-85. 60. Piedra J, Ontiveros M, Miravet S, Penalva C, Monfar M, Chillon M. Development of a rapid, robust, and universal picogreen-based method to titer adeno-associated vectors. Hum Gene Ther Methods. 2015;26(1):35-42. 61. Savvaki M, Panagiotaropoulos T, Stamatakis A, Sargiannidou I, Karatzioula P, Watanabe K, et al. Impairment of learning and memory in TAG-1 deficient mice associated with shorter CNS internodes and disrupted juxtaparanodes. Mol Cell Neurosci. 2008;39:478-90. 62. Zielasek J, Martini R, Toyka KV. Functional abnormalities in P0-deficient mice resemble human hereditary neuropathies linked to P0 gene mutations. Muscle Nerve. 1996;19(8):946-52. 63. Vavlitou N, Sargiannidou I, Markoullis K, Kyriacou K, Scherer SS, Kleopa KA. Axonal pathology precedes demyelination in a mouse model of X-linked demyelinating / type I Charcot-Marie Tooth neuropathy. J Neuropathol Exp Neurol. 2010;69:945-58. 64. Kobsar I, Berghoff M, Samsam M, Wessig C, Maurer M, Toyka KV, et al. Preserved myelin integrity and reduced axonopathy in connexin32-deficient mice lacking the recombination activating gene-1. Brain. 2003;126:804-13. 65. Groh J, Heinl K, Kohl B, Wessig C, Greeske J, Fischer S, et al. Attenuation of MCP-1 / CCL2 expression ameliorates neuropathy in a mouse model for Charcot-Marie-Tooth 1X. Hum Mol Genet. 2010;19:3530-43. 66. Shevtsova, Z., et al. (2005). “Promoters and serotypes: targeting of adeno-associated virus vectors for gene transfer in the rat central nervous system in vitro and in vivo.” Exp Physiol;90(1):53-59 67. von Jonquieres, G., et al. (2016). “Recombinant Human Myelin-Associated Glycoprotein Promoter Drives Selective AAV-Mediated Transgene Expression in Oligodendrocytes.” Front Mol Neurosci; 9:13 68. Levitt, N., Briggs, D., Gil, A., and Proudfoot, N.J. (1989). Definition of an efficient synthetic poly(A) site. Genes Dev. 3, 1019-1025. 69. Bailey RM, Armao D, Nagabhushan Kalburgi S, Gray SJ. Development of Intrathecal AAV9 Gene Therapy for Giant Axonal Neuropathy. Mol Ther Methods Clin Dev. 2018 Feb 15;9:160-171.

[0308] Next, embodiments of the present invention will be described in the following numbered paragraphs.

[0309] 1. A viral vector for use in a subject in need of treatment or prevention of a disease associated with Schwann cells, the viral vector comprising a sequence of a first nucleic acid that can be transcribed into a first polynucleotide and being an AAV vector. 2. The viral vector for use according to paragraph 1, wherein the expression of the first polynucleotide is under the control of a Schwann cell-specific promoter, optionally a myelin-specific promoter. 3. The viral vector for use according to paragraph 1 or 2, wherein the expression of the first polynucleotide is under the control of a full-length myelin protein zero (Mpz) promoter, and the full-length promoter is a full-length rat or human myelin protein promoter. 4. Expression of the first polynucleotide is under the control of a promoter having a length of 100 bp to 1100 bp, optionally, the promoter is in the range of 200 bp to 900 bp in length, 300 bp to 800 bp in length, 400 bp to 700 bp in length, optionally, the promoter is in the range of 500 bp to 600 bp in length, optionally, the promoter is 410 bp in length, a viral vector for use in paragraphs 1 to 3. 5. The promoter is a full-length or minimal myelin-specific promoter, optionally a minimal myelin protein zero (Mpz) promoter, optionally, the promoter has at least 75% sequence homology or sequence identity with SEQ ID NO: 5 or SEQ ID NO: 22, optionally, at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with SEQ ID NO: 5 or SEQ ID NO: 22, a viral vector for use in paragraph 4. 6. A viral vector for use in any one of the preceding paragraphs, wherein the vector has the ability to transduce Schwann cells. 7. A viral vector for use in any one of the preceding paragraphs, wherein the vector is not integrated into the genome of the host cell. 8. An AAV vector is selected from the group consisting of AAV9 and AAVrh10, a viral vector for use in any one of the preceding paragraphs. 9. An AAV vector is AAV9, a viral vector for use in paragraph 8. 10. A viral vector for use in any one of the preceding paragraphs, wherein the first polynucleotide encodes and is translated into the first polypeptide or protein. 11. The first nucleic acid is a) A wild-type or therapeutically beneficial sequence of a neuropathy-related gene, optionally selected from the group consisting of or comprising any one of the following genes: gap junction beta 1 (GJB1), SH3 domain and tetratricopeptide repeat 2 (SH3TC2), peripheral myelin protein 22 (PMP22), myelin protein zero (MPZ), early growth response 2 (EGR2), ganglioside-induced differentiation-associated protein 1 (GDAP1), N-Myc downstream-regulated 1 (NDRG1), or other genes associated with demyelinating neuropathy and Schwann cell dysfunction, or b) A sequence having at least 75% sequence homology or sequence identity, optionally at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with a wild-type sequence of a neuropathy-related gene, such as any one of the following genes: gap junction beta 1 (GJB1), SH3 domain and tetratricopeptide repeat 2 (SH3TC2), peripheral myelin protein 22 (PMP22), myelin protein zero (MPZ), early growth response 2 (EGR2), ganglioside-induced differentiation-associated protein 1 (GDAP1), N-Myc downstream-regulated 1 (NDRG1), or other genes associated with demyelinating neuropathy and Schwann cell dysfunction, and Optionally, the first nucleic acid comprises a sequence having at least 75% sequence homology or sequence identity, optionally at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with SEQ ID NOs: 6 - 12, for use in the viral vector of paragraph 10. 12. The viral vector for use according to paragraph 10 or 11, wherein the first nucleic acid is optionally transcribed into a wild-type form of an open reading frame (ORF) or cDNA that encodes one or more polypeptides selected from the group consisting of or comprising connexin 32, SH3 domain and tetratricopeptide repeat 2 (SH3TC2), peripheral myelin protein 22 (PMP22), myelin protein zero (MPZ), early growth response 2 (EGR2), ganglioside-induced differentiation-related protein 1 (GDAP1), N-Myc downstream regulated 1 (NDRG1). 13. The viral vector for use according to paragraph 10 or 11, wherein the first nucleic acid comprises the wild-type open reading frame (ORF) of the gap junction beta 1 (GJB1) gene. 14. The viral vector for use according to any one of paragraphs 1 to 13, wherein the vector can drive the expression from the first polynucleotide, optionally can drive the expression of the first polynucleotide, optionally the first polypeptide is connexin 32 (Cx32) protein, and optionally wild-type Cx32. 15. The viral vector for use according to any one of paragraphs 1 to 10, wherein the first polynucleotide encodes one or more of a trophic factor (e.g., BDNF, GDNF, NT-3, VEGF), a regenerative factor (e.g., angiogenin, Oct-6, Egr2, Sox-10), a growth factor (e.g., IGF). 16. The viral vector for use according to any one of the preceding paragraphs, wherein administration of the viral vector results in expression of the first protein from the first polynucleotide, which results in improvement of Schwann cell function and / or increased formation of myelin sheaths. 17. The viral vector for use according to paragraphs 1 to 9, wherein the first polynucleotide does not encode a polypeptide, and optionally the first polynucleotide is a non-coding RNA. 18. The viral vector for use according to paragraph 17, wherein the non-coding RNA is a small hairpin-type RNA (shRNA), a microRNA (miRNA), a guide RNA (gRNA). 19. When the viral vector is in the target organism, the expression of the non-coding RNA causes a decrease in the expression of the target polynucleotide, optionally, the target polynucleotide is a gene located in the target organism, and optionally located in the cells of the target organism, a viral vector for use in any one of paragraphs 17 or 18. 20. The expression or overexpression of the target polynucleotide in the target organism is considered to be related to a disease associated with Schwann cells, optionally, the disease is Charcot-Marie-Tooth disease (CMT1), optionally, the target polynucleotide is a mutant allele of myelin protein zero (Mpz / P0), and the disease associated with Schwann cells is CMT1B, or the target polynucleotide is another dominant gene associated with CMT1, a viral vector for use in paragraph 19. 21. A viral vector for use in any one of paragraphs 17 to 20, wherein the administration of the viral vector results in an improvement in the function of Schwann cells and / or an increase in the formation of myelin sheaths. 22. A viral vector for use in any one of the preceding paragraphs, wherein the disease associated with Schwann cells causes destruction of the myelin sheath by Schwann cells and / or a decrease in formation. 23. A viral vector for use in any one of the preceding paragraphs, wherein the disease is selected from the group consisting of Charcot-Marie-Tooth disease (CMT), hereditary neuropathy with liability to pressure palsies (HNPP), diabetes and other toxic peripheral neuropathies, and motor neuron disease (MND). 24. A viral vector for use in any one of the preceding paragraphs, wherein the disease is Charcot-Marie-Tooth disease (CMT). 25. A viral vector for use in paragraph 24, wherein the disease is selected from Charcot-Marie-Tooth type 1X (CMT1X), Charcot-Marie-Tooth types 1A - 1F (CMT1A - 1F), and Charcot-Marie-Tooth types 4A - 4H (CMT4A - 4H). 26. A viral vector for use in paragraph 25, wherein the disease is Charcot-Marie-Tooth type 1X (CMT1X). 27. A viral vector for use according to paragraph 25, wherein the disease is Charcot-Marie-Tooth type 4C (CMT4C). 28. A viral vector for use according to paragraph 16 or 21, wherein the improved function results from an increase in myelin sheath formation by Schwann cells as compared to myelin sheath formation by Schwann cells in the subject prior to treatment. 29. The increase in myelin sheath formation by Schwann cells results in an improvement in one or more of the following parameters when compared to the subject prior to treatment: a) Muscle strength, b) Sciatic nerve conduction velocity, and / or c) Response of a blood biomarker A viral vector for use according to paragraph 28. 30. A viral vector for use according to paragraph 28 or 29, wherein the improvement in myelin sheath formation by Schwann cells results in an improvement in myelination of the peripheral nerve. 31. A viral vector for use according to any one of the preceding paragraphs, wherein the AAV is administered to the subject by intrathecal injection or intravenous injection, preferably the AAV is administered by intrathecal injection. 32. A viral vector for use according to paragraph 31, wherein the AAV is administered by one of the routes of lumbar intrathecal injection, thoracic intrathecal injection, or cervical intrathecal injection. 33. A viral vector for use according to paragraph 32, wherein the viral vector is administered by lumbar intrathecal injection. 34. A viral vector for use according to paragraphs 31 - 33, wherein the AAV is administered by a single intrathecal injection. 35. A viral vector for use according to any one of the preceding paragraphs, wherein the subject in need is a human subject. 36. A viral vector as defined by any of the preceding paragraphs. 37. A cell transduced with a viral vector as defined by any of the preceding paragraphs, optionally a Schwann cell. 38. A minimal myelin-specific promoter having at least 75% sequence homology or sequence identity with SEQ ID NO: 5 or SEQ ID NO: 22, optionally having at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence identity or sequence homology with SEQ ID NO: 5 or SEQ ID NO: 22. 39. A minimal myelin-specific promoter comprising or consisting of the sequence of SEQ ID NO: 5 or SEQ ID NO: 22. 40. A polynucleotide construct comprising a myelin protein zero (Mpz) promoter optionally operably linked to a second nucleic acid sequence and a minimal myelin-specific promoter defined in paragraph 38 or 39, optionally comprising a sequence of a first nucleic acid which is a myelin-specific promoter, wherein the second nucleic acid is transcribed into the first polynucleotide and the sequence of the second nucleic acid is a) an open reading frame or cDNA or other element of a gene, or b) transcribed into a non-coding RNA. 41. A viral vector comprising a minimal myelin-specific promoter according to either of paragraphs 38 or 39, or the polynucleotide construct of paragraph 40. 42. A viral vector for use according to any one of paragraphs 1 to 35, or the viral vector of paragraph 36 or 41, wherein the vector has the ability to transduce Schwann cells. 43. A viral vector for use according to any one of the preceding paragraphs, wherein the vector is not integrated into the genome of the host cell. 44. a) AAV, optionally AAV9 b) An AAV-Mpz.Egfp vector comprising an AAV9 vector, a myelin protein zero (Mpz) promoter, and an EGFP reporter gene c) An AAV9-Mpz-GJB1 vector comprising an AAV9 vector, a myelin protein zero (Mpz) promoter, and an open reading frame (ORF) of a gap junction beta 1 (GJB1) gene. d) An AAV9-miniMpz.Egfp vector comprising an AAV9 vector, a minimal myelin protein zero (miniMpz) promoter, and an EGFP reporter gene. e) An AAV9-human Mpz-GJB1 vector (SEQ ID NO: 17) comprising an AAV9 vector, a full-length human myelin protein zero (hP0) promoter, and an open reading frame (ORF) of a gap junction beta 1 (GJB1) gene. f) An AAV9-human Mpz-Egfp vector (SEQ ID NO: 19) comprising an AAV9 vector, a full-length human myelin protein zero (hP0) promoter, and an EGFP reporter gene. g) An AAV9-miniMpz-SH3TC2.myc.ITR vector (SEQ ID NO: 20) comprising an AAV9 vector, a minimal rat myelin protein zero (Mpz) promoter, and an open reading frame (ORF) of a SH3TC2 gene. h) An AAV9-human-miniMpz-SH3TC2 vector (SEQ ID NO: 21) comprising an AAV9 vector, a human minimal myelin protein zero (hP0) promoter, and an open reading frame (ORF) of a SH3TC2 gene, or i) An AAV9-human-miniMpz-Egfp vector (SEQ ID NO: 23) comprising an AAV9 vector, a human minimal myelin protein zero (hP0) promoter, and an EGFP reporter gene, the viral vector according to any one of paragraphs 42 or 43. 45. A pharmaceutical composition comprising any of the viral vectors of the preceding paragraphs. 46. The pharmaceutical composition of paragraph 45, wherein the composition comprises an appropriate amount of the viral vector and further comprises a pharmaceutically acceptable carrier and / or excipient. Use of a viral vector according to any of the preceding paragraphs in the manufacture of a medicament for the treatment or prevention of a disease associated with Schwann cells, optionally wherein the disease causes destruction and / or reduced formation of myelin sheaths by Schwann cells and optionally wherein the disease is Charcot-Marie-Tooth disease. 46. A viral vector or polynucleotide construct according to any of the preceding paragraphs for use in the CRISPR / Cas9 system, wherein the viral vector or polynucleotide a) comprises a polynucleotide encoding a single guide RNA (sgRNA) targeting a gene of interest, b) comprises a polynucleotide encoding a Cas9 polypeptide, c) comprises one or more of a polynucleotide encoding a polypeptide of interest, a viral vector or polynucleotide construct. 47. A viral vector according to any of the preceding paragraphs for use in a method of labeling Schwann cells, for example with a fluorescent protein such as green fluorescent protein (GFP) or enhanced green fluorescent protein (EGFP), or another non-fluorescent reporter, optionally wherein the labeling of Schwann cells can be used in a method of diagnosing a disease associated with Schwann cells. 48. A viral vector according to any one of paragraphs 1 to 43 for use in a method of inducing Schwann cells to differentiate into an alternative cell type (e.g., oligodendrocyte, astrocyte, or neuron). 49. A viral vector according to any one of paragraphs 1 to 43 for use in a method of stimulating Schwann cells to support regeneration of a subject in need thereof, optionally after injury or trauma. 50. A kit for use in the prevention or treatment of a disease associated with Schwann cells, labeling of Schwann cells, or regeneration of Schwann cells, comprising a) a viral vector as defined in any of the preceding paragraphs, b) a polynucleotide construct as defined by paragraph 40, c) a viral vector, d) a viral vector comprising a polynucleotide construct as defined by paragraph 40, e) a pharmaceutically acceptable carrier and / or excipient, f) a disposable syringe, for example a disposable syringe suitable for lumbar intrathecal injection, g) instructions for use, a kit comprising one or more of them. 51. A kit according to paragraph 50, wherein the kit comprises two or more viral vectors as defined by any one of the preceding paragraphs, and optionally the kit comprises 2, 3, 4, 5, 6, 7, 8, 9 or 10 different viruses as defined by any one of the preceding paragraphs. 52. A viral vector for use in treating or preventing a disease associated with Schwann cells in a subject in need thereof, wherein the viral vector comprises a sequence of a first nucleic acid that can be transcribed into a first polynucleotide, and the expression of the first polynucleotide is optionally under the control of a minimal myelin-specific promoter comprising or consisting of the sequence defined by SEQ ID NO: 5 or SEQ ID NO: 22, and optionally the viral vector is an AAV vector.

[0310] It should be understood that various changes and modifications to the presently preferred embodiments described herein will be apparent to those skilled in the art. Such changes and modifications can be made without departing from the spirit and scope of the invention and without sacrificing its intended advantages. Accordingly, such changes and modifications are intended to be covered by the following claims.

Claims

1. A viral vector for use in the treatment or prevention of Charcot-Marie-Tooth disease in a subject in need thereof, comprising a sequence of a first nucleic acid that can be transcribed into a first polynucleotide and being an adeno-associated virus (AAV) vector, wherein the expression of the first polynucleotide is under the control of a promoter, and the promoter is a) a full-length myelin protein zero (Mpz) promoter, or b) a minimal myelin protein zero (miniMpz) promoter, selected from a) the full-length Mpz promoter being a full-length rat or full-length human Mpz promoter, the promoter having a sequence with at least 90% sequence identity to SEQ ID NO: 4 or SEQ ID NO: 18, or 100% sequence homology to SEQ ID NO: 4 or SEQ ID NO: 18, or b) the minimal Mpz promoter being a rat or human minimal Mpz promoter, the promoter having a sequence with at least 90% sequence identity to SEQ ID NO: 5 or SEQ ID NO: 22, 100% sequence homology to SEQ ID NO: 5 or SEQ ID NO: 22, the viral vector.

2. wherein the expression of the first polynucleotide is under the control of a promoter, and the promoter is a) having a length of 100 bp to 1100 bp, and / or b) having a length of less than 1100 bp, the viral vector for use according to Claim 1.

3. The viral vector for use according to Claim 1 or 2, wherein the AAV vector is selected from AAV9 or AAVrh10.

4. The viral vector for use according to any one of Claims 1 to 3, wherein the first nucleic acid encodes and is translated into a first polypeptide or protein.

5. The first nucleic acid is a) a wild-type or therapeutically beneficial sequence of a gene selected from the group consisting of the following genes: gap junction beta 1 (GJB1), SH3 domain and tetratricopeptide repeat 2 (SH3TC2), peripheral myelin protein 22 (PMP22), myelin protein zero (MPZ), early growth response 2 (EGR2), ganglioside-induced differentiation-related protein 1 (GDAP1), N-Myc downstream-regulated 1 (NDRG1), or any other gene associated with Charcot-Marie-Tooth disease, or b) a sequence having at least 90% sequence identity or 100% sequence homology with the wild-type sequence of a gene selected from the group consisting of gap junction beta 1 (GJB1), SH3 domain and tetratricopeptide repeat 2 (SH3TC2), peripheral myelin protein 22 (PMP22), myelin protein zero (MPZ), early growth response 2 (EGR2), ganglioside-induced differentiation-related protein 1 (GDAP1), N-Myc downstream-regulated 1 (NDRG1), or other genes associated with Charcot-Marie-Tooth disease, The viral vector for use according to claim 4, wherein the first nucleic acid comprises a sequence having at least 90% sequence identity or 100% sequence homology with SEQ ID NOs: 6-12.

6. The first nucleic acid comprises a wild-type open reading frame (ORF) or cDNA that is transcribed into a first polynucleotide encoding one or more polypeptides, or the vector is capable of driving expression from the first nucleic acid and capable of driving expression of the first polypeptide, and comprises or consists of connexin 32 (Cx32), SH3 domain and tetratricopeptide repeat 2 (SH3TC2), peripheral myelin protein 22 (PMP22), myelin protein zero (MPZ), early growth response 2 (EGR2), ganglioside-induced differentiation-related protein 1 (GDAP1), N-Myc downstream-regulated 1 (NDRG1), or is selected from the group consisting thereof. The viral vector for use according to claim 4 or 5.

7. The viral vector for use according to any one of claims 1-3, wherein the first nucleic acid does not encode a polypeptide.

8. The first polynucleotide is a non-coding RNA, The viral vector for use according to any one of claims 1-3, wherein the non-coding RNA is small hairpin RNA (shRNA), microRNA (miRNA), or guide RNA (gRNA).

9. A viral vector for use according to any one of claims 1 to 8, wherein the disease is selected from Charcot-Marie-Tooth type 1X (CMT1X), Charcot-Marie-Tooth types 1A to 1F (i.e., CMT1A, CMT1B, CMT1C, CMT1D, CMT1E, and CMT1F), and Charcot-Marie-Tooth types 4A to 4H (i.e., CMT4A, CMT4B, CMT4C, CMT4D, CMT4E, CMT4F, CMT4G, and CMT4H).

10. The viral vector for use according to any one of claims 1 to 9, wherein the AAV is administered to the subject by intrathecal injection or intravenous injection.

11. The viral vector for use according to any one of claims 1 to 10, wherein the AAV is administered by one of the following routes: lumbar intrathecal injection, thoracic intrathecal injection, or cervical intrathecal injection.

12. A minimal myelin-specific promoter, which is minimal myelin protein zero (miniMpz), and consists of a sequence having at least 90% sequence identity with SEQ ID NO: 5 or SEQ ID NO: 22, or consists of the sequence of SEQ ID NO: 5 or SEQ ID NO:

22.

13. A polynucleotide construct, comprising the sequence of a first nucleic acid that is a Schwann cell-specific promoter, wherein the Schwann cell-specific promoter is the minimal Schwann cell-specific promoter according to claim 12, operatively linked to the sequence of a second nucleic acid, wherein the second nucleic acid is transcribed into a first polynucleotide, and the second nucleic acid is a) an open reading frame or cDNA or other element of a gene, or b) transcribed into a non-coding RNA.

14. The viral vector for use according to any one of claims 1 to 11, wherein the vector has the ability to transduce Schwann cells and / or the vector is not integrated into the genome of the host cell.

15. a) An AAV-Mpz.Egfp vector comprising an AAV9 vector, the myelin protein zero (Mpz) promoter, and the EGFP reporter gene, wherein the promoter consists of the sequence of SEQ ID NO: 4 or SEQ ID NO:

18. b) An AAV9-Mpz-GJB1 vector comprising an AAV9 vector, said myelin protein zero (Mpz) promoter, and the open reading frame (ORF) of said gap junction beta 1 (GJB1) gene, wherein said promoter has a sequence having at least 90% or 100% sequence identity with SEQ ID NO: 4 or SEQ ID NO: 18, AAV9-Mpz-GJB1 vector, c) An AAV9-miniMpz.Egfp vector comprising an AAV9 vector, said minimal myelin protein zero (miniMpz) promoter, and said EGFP reporter gene, wherein said miniMPZ promoter consists of a sequence having at least 90% or 100% sequence identity with SEQ ID NO: 5 or SEQ ID NO: 22, AAV9-miniMpz.Egfp vector, d) An AAV9-human Mpz-GJB1 vector comprising an AAV9 vector, said human myelin protein zero (hP0) promoter, and the open reading frame (ORF) of said gap junction beta 1 (GJB1) gene (SEQ ID NO: 17), e) An AAV9-human Mpz-Egfp vector comprising an AAV9 vector, said human myelin protein zero (hP0) promoter, and said EGFP reporter gene (SEQ ID NO: 19), f) An AAV9-miniMpz-SH3TC2.myc.ITR vector comprising an AAV9 vector, a minimal myelin protein zero (Mpz) promoter, and the open reading frame (ORF) of said SH3TC2 gene (SEQ ID NO: 20), g) An AAV9-human-miniMpz-SH3TC2 vector comprising an AAV9 vector, a human minimal myelin protein zero (hP0) promoter, and the open reading frame (ORF) of said SH3TC2 gene (SEQ ID NO: 21), h) An AAV9-human-miniMpz-Egfp vector comprising an AAV9 vector, a human minimal myelin protein zero (hP0) promoter, and said EGFP reporter gene (SEQ ID NO: 23), or i) An AAV9-Mpz-GJB1 vector comprising an AAV9 vector, said minimal myelin protein zero (miniMpz) promoter, and the open reading frame (ORF) of said gap junction beta 1 (GJB1) gene, wherein said miniMPZ promoter has a sequence having at least 90% or 100% sequence identity with SEQ ID NO: 5 or SEQ ID NO: 22, the viral vector according to claim 14, comprising an AAV9-Mpz-GJB1 vector.

16. A kit for use in the prevention or treatment of Charcot-Marie-Tooth disease, a) the viral vector according to any one of claims 1 to 11, 14 to 15, b) the polynucleotide construct according to claim 13, c) a viral vector comprising the polynucleotide construct according to claim 13, the kit comprising one or more of the foregoing.

17. d) a viral vector, e) a pharmaceutically acceptable carrier and / or excipient, f) a disposable syringe, g) instructions for use, the kit according to claim 16, further comprising one or more of the foregoing.

18. A viral vector, a) an AAV-Mpz.Egfp vector comprising an AAV9 vector, said myelin protein zero (Mpz) promoter, and said EGFP reporter gene, wherein said vector comprises the sequence of SEQ ID NO: 1 and said promoter consists of the sequence of SEQ ID NO: 4 or SEQ ID NO: 18, an AAV-Mpz.Egfp vector, b) an AAV9-Mpz-GJB1 vector comprising an AAV9 vector, said myelin protein zero (Mpz) promoter, and the open reading frame (ORF) of said gap junction beta 1 (GJB1) gene, wherein said vector comprises the sequence of SEQ ID NO: 2 and said promoter has a sequence having at least 90% or 100% sequence identity with SEQ ID NO: 4 or SEQ ID NO: 18, an AAV9-Mpz-GJB1 vector, c) An AAV9-miniMpz.Egfp vector comprising an AAV9 vector, said minimal myelin protein zero (miniMpz) promoter, and said EGFP reporter gene, wherein said vector comprises the sequence of SEQ ID NO: 3, and said miniMPZ promoter consists of a sequence having at least 90% or 100% sequence identity with SEQ ID NO: 5 or SEQ ID NO: 22, an AAV9-miniMpz.Egfp vector, d) An AAV9-human Mpz-GJB1 vector comprising an AAV9 vector, said human myelin protein zero (hP0) promoter, and the open reading frame (ORF) of said gap junction beta 1 (GJB1) gene (SEQ ID NO: 17), wherein said vector comprises the sequence of SEQ ID NO: 17, e) An AAV9-human Mpz-Egfp vector comprising an AAV9 vector, said human myelin protein zero (hP0) promoter, and said EGFP reporter gene (SEQ ID NO: 19), wherein said vector comprises the sequence of SEQ ID NO: 19, f) An AAV9-miniMpz-SH3TC2.myc.ITR vector comprising an AAV9 vector, a minimal myelin protein zero (Mpz) promoter, and the open reading frame (ORF) of said SH3TC2 gene (SEQ ID NO: 20), wherein said vector comprises the sequence of SEQ ID NO: 20, g) An AAV9-human-miniMpz-SH3TC2 vector comprising an AAV9 vector, a human minimal myelin protein zero (hP0) promoter, and the open reading frame (ORF) of said SH3TC2 gene (SEQ ID NO: 21), wherein said vector comprises the sequence of SEQ ID NO: 21, or, h) An AAV9-human-miniMpz-Egfp vector comprising an AAV9 vector, a human minimal myelin protein zero (hP0) promoter, and said EGFP reporter gene (SEQ ID NO: 23), wherein said vector comprises the sequence of SEQ ID NO: 23, a viral vector.

19. A viral vector for use according to any one of claims 1 to 11, 14, a) An AAV-Mpz.Egfp vector comprising an AAV9 vector, said myelin protein zero (Mpz) promoter, and said EGFP reporter gene, wherein said vector comprises the sequence of SEQ ID NO: 1 and said promoter has a sequence having at least 90% or 100% sequence identity with SEQ ID NO: 4 or SEQ ID NO: 18, the AAV-Mpz.Egfp vector, b) An AAV9-Mpz-GJB1 vector comprising an AAV9 vector, said myelin protein zero (Mpz) promoter, and the open reading frame (ORF) of said gap junction beta 1 (GJB1) gene, wherein said vector comprises the sequence of SEQ ID NO: 2 and said promoter has a sequence having at least 90% or 100% sequence identity with SEQ ID NO: 4 or SEQ ID NO: 18, the AAV9-Mpz-GJB1 vector, c) An AAV9-miniMpz.Egfp vector comprising an AAV9 vector, said minimal myelin protein zero (miniMpz) promoter, and said EGFP reporter gene, wherein said vector comprises the sequence of SEQ ID NO: 3 and said miniMPZ promoter has a sequence having at least 90% or 100% sequence identity with SEQ ID NO: 5 or SEQ ID NO: 22, the AAV9-miniMpz.Egfp vector, d) An AAV9-human Mpz-GJB1 vector comprising an AAV9 vector, said human myelin protein zero (hP0) promoter, and the open reading frame (ORF) of said gap junction beta 1 (GJB1) gene (SEQ ID NO: 17), wherein said vector comprises the sequence of SEQ ID NO: 17, e) An AAV9-human Mpz-Egfp vector comprising an AAV9 vector, said human myelin protein zero (hP0) promoter, and said EGFP reporter gene (SEQ ID NO: 19), wherein said vector comprises the sequence of SEQ ID NO: 19, f) An AAV9-miniMpz-SH3TC2.myc.ITR vector comprising an AAV9 vector, a minimal myelin protein zero (Mpz) promoter, and the open reading frame (ORF) of said SH3TC2 gene (SEQ ID NO: 20), wherein said vector comprises the sequence of SEQ ID NO: 20, g) An AAV9- human - miniMpz - SH3TC2 vector comprising an AAV9 vector, a human minimal myelin protein zero (hP0) promoter, and the open reading frame (ORF) of the SH3TC2 gene (SEQ ID NO: 21), wherein the vector comprises the sequence of SEQ ID NO: 21, or, h) An AAV9 - human - miniMpz - Egfp vector comprising an AAV9 vector, a human minimal myelin protein zero (hP0) promoter, and the EGFP reporter gene (SEQ ID NO: 23), wherein the vector comprises the sequence of SEQ ID NO: 23, a viral vector. **Claim 20** A viral vector for use according to any one of claims 1 to 11, 14, 19, or the viral vector according to claim 18, a) not containing the WPRE sequence of SEQ ID NO: 20, and / or b) a synthetic polyA sequence comprising or consisting of a sequence having at least 80%, or 82%, or 84%, or 86%, or 88%, or 90%, or 92%, or 94%, or 96%, or 97%, or 98%, or 99%, or 100% sequence homology with SEQ ID NO: 24.

Citation Information

Patent Citations

  • Method for treating peripheral neuropathy and motor neuron disease

    JP2017513861A

  • Methods and compositions relating the treatment of tumors

    WO2018106753A1

  • MiRNA DETARGETING SYSTEM FOR TISSUE SPECIFIC INTERFERENCE

    WO2019070741A1

  • Methods and materials for NT-3 gene therapy

    WO2019079755A1