Use of anti-EpCAM antibodies in cancer treatment
A combination of an anti-EpCAM antibody and a PD-L1 immune checkpoint inhibitor effectively targets EpCAM-positive cancers by inhibiting key signaling pathways and enhancing T cell activity, leading to significant tumor inhibition and survival extension.
Patent Information
- Application Number
- JP2022527232
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2019-11-14
- Filing Date
- 2020-11-16
- Publication Date
- 2025-06-20
- Estimated Expiration
- 2040-11-16
AI Technical Summary
Current cancer therapies are inadequate in effectively targeting EpCAM, a protein overexpressed in many adenocarcinomas and squamous cell carcinomas, which promotes tumor progression and immune evasion.
Administering a combination of an anti-EpCAM antibody and a PD-L1 immune checkpoint inhibitor to target the EGF-like domain I within the extracellular domain of EpCAM, thereby inhibiting AKT and MAPK signaling pathways and enhancing the cytotoxic activity of CD8+ T cells.
The combination therapy significantly inhibits tumor growth, prolongs survival, and enhances the efficacy of anti-PD-L1 therapy by reducing PD-L1 protein levels and increasing HtrA2 expression, promoting apoptosis in cancer cells.
Smart Images

Figure 0007696343000002 
Figure 0007696343000003 
Figure 0007696343000004
Abstract
Description
Technical Field
[0001] Priority This application claims the benefit of priority under 35 U.S.C. § 119(e) to U.S. Provisional Application No. 62 / 935,470, filed on November 14, 2019, which is hereby incorporated by reference in its entirety.
[0002] Sequence Listing This application contains a Sequence Listing that has been electronically submitted in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy, created on November 16, 2020, is named G4590-10700PCT_SeqListing.txt and is 2 kilobytes in size.
[0003] The present disclosure relates to the therapeutic use of anti-EpCAM antibodies. In particular, it describes a combination immunotherapy of an anti-EpCAM antibody and a PD-L1 immune checkpoint inhibitor.
Background Art
[0004] Epithelial cell adhesion molecule (EpCAM) is the most frequently expressed tumor-associated antigen, overexpressed in the majority of human adenocarcinomas and squamous cell carcinomas, and associated with poor prognosis in patients. EpCAM is continuously processed by a disintegrin and metalloprotease 17 (ADAM17), also known as tumor necrosis factor alpha-converting enzyme (TACE), and γ-secretase. Processing by these enzymes releases the extracellular domain (EpEX) and the intracellular domain (EpICD), respectively. After release, EpICD interacts with four and a half LIM domain protein 2 (FHL2) and β-catenin, translocates to the nucleus, and forms a complex that interacts with Lef-1, which binds to DNA. The EpICD complex promotes tumor formation of tumor-initiating cells (TICs) through upregulation of reprogramming genes and epithelial-mesenchymal transition (EMT). In addition, increased release of EpEX enhances EpICD production and upregulates reprogramming and EMT gene expression. EpEX has been reported to directly bind to EGFR and stimulate phosphorylation of EGFR and its downstream signaling pathways (5, 8, 10).Furthermore, EpEX-induced EGFR phosphorylation can activate ADAM17 and γ-secretase to further increase the excretion of EpEX and EpICD (Liang KH, Tso HC, Hung SH, Kuan, II, Lai JK, Ke FY, et al., Extracellular domain of EpCAM enhances tumor progression through EGFR signaling in colon cancer 16 cells. Cancer Lett 2018;433:165-75; Pan M, Schinke H, Luxenburger E, Kranz G, Shakhtour J, Libl D, et al., EpCAM ectodomain EpEX is a ligand of EGFR that counteracts EGF-mediated epithelial-mesenchymal transition through modulation of phospho-ERK1 / 2 in head and neck cancers. PLoS Biol 2018;16:e2006624; Liang K-H, Lai J-K, Kuan, II, Tso H-C, Wu H-C. EpCAM / EpEX regulate tumor progression through EGFR signaling in colon cancer cells. AACR; 2017). However, the domain of EpEX that binds to and activates EGFR has not been identified to date. SUMMARY OF THE INVENTION PROBLEMS TO BE SOLVED BY THE INVENTION
[0005] The present disclosure surprisingly found that EGF-like domain I within the extracellular domain of EpCAM (EpEX) binds to EGFR and activates both AKT and MAPK signaling, inhibiting FOXO3a function and stabilizing the PD-L1 protein, respectively. Treatment with an EpCAM-neutralizing antibody inhibits the phosphorylation of AKT and FOXO3a, increases FOXO3a nuclear translocation, upregulates HtrA2 expression to promote apoptosis, while reducing the PD-L1 protein level and enhancing the cytotoxic activity of CD8+ T cells. The findings in the present disclosure not only clarify the molecular mechanism underlying EpCAM signaling in cancer malignancies, but also suggest that therapeutic targeting of EpCAM may work well in combination with current immunotherapies. The combination of an anti-EpCAM antibody and an anti-PD-L1 antibody shows an unexpected effect in tumor removal and survival extension in metastases, suggesting a new combination therapy for cancer immunotherapy in subjects.
Means for Solving the Problems
[0006] In one aspect, the present disclosure provides a method for treating, inhibiting or removing cancer in a subject, comprising administering to the subject an effective amount of an inhibitor or antagonist that targets EGF-like domain I within EpEX.
[0007] In one embodiment, EGF-like domain I within EpEX comprises a peptide consisting of amino acids 27-59 of the EGF-like domain, or a variant thereof capable of binding to EGFR.
[0008] In some embodiments, an inhibitor or antagonist that targets EGF-like domain I within EpEX is a ribozyme, antisense oligonucleotide, short hairpin RNA (shRNA) molecule, or small interfering RNA (siRNA) molecule that specifically inhibits and / or reduces the expression or activity of EpCAM. In some further aspects, an inhibitor or antagonist that targets EGF-like domain I within EpEX is an shRNA or siRNA that knocks down the expression of EGFR, AKT, PD-L1, and / or MAPK, and / or the phosphorylation of FOXO3a, and / or increases the expression of HtrA2 and / or the nuclear translocation of FOXO3a. In a further embodiment, the shRNA comprises a nucleotide sequence consisting of GCAAATGGACACAAATTACAA (SEQ ID NO: 1), or a variant that specifically inhibits and / or reduces the expression and / or activity of EpCAM.
[0009] In some other embodiments, an inhibitor or antagonist that targets EGF-like domain I within EpEX is a small molecule, peptide, antibody, or antibody fragment that can partially or completely block EpCAM activity.
[0010] In some embodiments, an inhibitor or antagonist that targets EGF-like domain I within EpEX is an EpCAM-neutralizing antibody. Preferably, the antibody is EpAb2-6 or a variant that can neutralize EpCAM.
[0011] In another aspect, the present disclosure provides a method of treating, inhibiting, or removing cancer in a subject, the method comprising administering to a subject in need thereof an effective amount of an inhibitor or antagonist that targets EGF-like domain I within EpEX, and an inhibitor or antagonist that targets PD-L1 in an amount effective to inhibit the expression or activation of PD-L1.
[0012] In one embodiment, the inhibitor or antagonist targeting PD-L1 is a PD-L1 checkpoint inhibitor. In some embodiments, the PD-L1 checkpoint inhibitor is MEDI4736, atezolizumab, avelumab, or durvalumab.
[0013] In some embodiments, the inhibitor or antagonist targeting EGF-like domain I within EpEX is administered intermittently, simultaneously, separately, or sequentially with the inhibitor or antagonist targeting PD-L1.
[0014] In some embodiments, the cancer is melanoma, kidney cancer, prostate cancer, breast cancer, colorectal cancer, lung cancer, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, cutaneous or uveal malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, gastric cancer, testicular cancer, uterine cancer, fallopian tube carcinoma, endometrial carcinoma, cervical carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, non-Hodgkin's lymphoma, esophageal cancer, small intestine cancer, endocrine system cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, chronic or acute leukemia, central nervous system (CNS) neoplasm, primary CNS lymphoma, tumor angiogenesis, spinal cord axis tumor, brainstem glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid carcinoma, squamous cell carcinoma, or T cell lymphoma.
[0015] In one embodiment, the cancer is EpCAM overexpressing cancer, EGFR overexpressing or activating cancer, AKT overexpressing or overactivating cancer, MAPK overexpressing or activating cancer, FOXO3a inactivating cancer, HtrA2 inactivating cancer, or PD-L1 expressing cancer.
[0016] In further embodiments, the cancer is metastatic cancer or advanced cancer. In further embodiments, the cancer is metastatic colorectal cancer or small cell lung cancer, or advanced colorectal cancer or small cell lung cancer.
[0017] In one embodiment, the subject has EpCAM overexpression. In one embodiment, the subject has been treated with at least one anti-cancer therapy or anti-cancer agent.
Brief Description of the Drawings
[0018]
Figure 1A
Figure 1B
Figure 1C
Figure 1D
Figure 1E
Figure 1F
Figure 1G
Figure 1H
Figure 2A
Figure 2B
Figure 2C
Figure 2D
Figure 2E
Figure 2F
Figure 2G
Figure 2H
Figure 3A
Figure 3B
Figure 3C
Figure 3D
Figure 3E
Figure 3F
Figure 3G
Figure 3H
Figure 4A
Figure 4B
Figure 4C
Figure 4D
Figure 4E
Figure 4F
Figure 4G
Figure 4H
Figure 4I
Figure 4J
Figure 4K
Figure 4L
Figure 5A
Figure 5B
Figure 5C
Figure 5D
Figure 5E
Figure 5F
Figure 5G
Figure 5H
Figure 5I
Figure 5J
Figure 6A
Figure 6B
Figure 6C
Figure 6D
Figure 6E
Figure 6F
Figure 6G
Figure 6H
Figure 7
Figure 8A
Figure 8B
Figure 8C
Figure 9A
Figure 9B
Figure 9C
Figure 9D
Figure 9E
Figure 9F
Figure 9G
Figure 10A
Figure 10B
Figure 10C
Figure 10D
Figure 11A
Figure 11B
Figure 11C
Figure 12
Figure 13A
Figure 13B
Figure 13C
Figure 13D
Figure 14A
Figure 14B
Figure 14C
Figure 14D
Figure 14E
Figure 14F
Figure 15
Best Mode for Carrying Out the Invention
[0019] Definitions To more readily understand the present disclosure, certain terms are first defined below. Additional definitions of the following terms and other terms can be described throughout this specification. If the definitions of the terms described below conflict with the definitions in the applications or patents incorporated by reference, the definitions described in this application should be used to understand the meaning of those terms.
[0020] The singular terms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Similarly, the term "or" is intended to include "and" unless the context clearly dictates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below.
[0021] As used herein, the term "and / or" is intended to represent an inclusive disjunction. That is, "X and / or Y" is intended to mean, for example, X or Y or both. As a further example, "X, Y, and / or Z" is intended to mean X or Y or Z, or any combination thereof.
[0022] As used herein, the terms "inhibiting", "removing", "decreasing", "reducing", or "preventing", or any variation of these terms, include a measurable decrease or complete inhibition to achieve the desired result.
[0023] As used herein, the term "antibody" refers to an immunoglobulin molecule that can specifically bind to a target, such as a carbohydrate, polynucleotide, lipid, polypeptide, etc., via at least one antigen recognition site located in the variable region of the immunoglobulin molecule. As used herein, the term includes not only intact polyclonal or monoclonal antibodies, but also fragments thereof (e.g., Fab, Fab', F(ab')2, Fv), single chains (ScFv), mutants thereof, fusion proteins containing antibody portions (e.g., domain antibodies), and any other modified forms of immunoglobulin molecules containing antigen recognition sites. Antibodies include antibodies of any class, such as IgG, IgA or IgM (or subclasses thereof), and the antibody need not be of any particular class. Depending on the amino acid sequence of the constant domain of the heavy chain, immunoglobulins can be assigned to different classes. There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, and some of these may be further classified into subclasses (isotypes), such as IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The heavy chain constant domains corresponding to the different classes of immunoglobulins are called alpha, delta, epsilon, gamma and mu, respectively. The subunit structures and three-dimensional structures of different classes of immunoglobulins are well known.
[0024] As used herein, the term "individual" or "subject" is a vertebrate, such as a human or non-human animal, such as a mammal. Mammals include, but are not limited to, humans, primates, livestock, sport animals, rodents and pets. Non-limiting examples of non-human animal subjects include rodents, such as mice, rats, hamsters and guinea pigs; rabbits; dogs; cats; sheep; pigs; goats; cows; horses; and non-human primates, such as apes and monkeys.
[0025] As used herein, the term "treating" or "treatment" (and grammatical variations thereof, e.g., "treat") refers to a clinical intervention in an attempt to alter the course of a disease in an individual or cell being treated, and can be performed either for prophylaxis or during the course of clinical pathology. Therapeutic effects of treatment include, but are not limited to, preventing the occurrence or recurrence of a disease, alleviating symptoms, attenuating the direct or indirect pathological consequences of the disease, preventing metastasis, decreasing the rate of disease progression, improving or alleviating the disease state, and remission or improvement of prognosis.
[0026] As used herein, the term "effective amount" (or "therapeutically effective amount") is an amount sufficient to have an effect on a beneficial or desired clinical outcome upon treatment. In certain embodiments, a therapeutically effective amount refers to an amount capable of achieving one or more of an anti-cancer effect, prolongation of survival and / or prolongation of the period to recurrence. For example, but not limited to, a therapeutically effective amount can be an amount of an inhibitor or antagonist that minimizes, prevents, reduces, and / or alleviates the symptoms of cancer.
[0027] As used herein, the term "anti-cancer effect" refers to one or more of a reduction in the amount of aggregated cancer cells, a reduction in the cancer cell proliferation rate, a reduction in cancer progression, a reduction in cancer cell proliferation, a reduction in tumor mass, a reduction in tumor volume, a reduction in tumor cell proliferation, a reduction in tumor growth rate, and / or a reduction in tumor metastasis. In certain embodiments, an anti-cancer effect can refer to a response in a patient diagnosed with cancer that is a complete response, partial response, stable disease (without progression or recurrence), subsequent recurrence, or progression-free survival.
[0028] As used herein, the term "metastatic cancer" refers to cancer that has spread from the site in the body where it originated (primary site) to other parts of the body. When cancer cells leave a tumor, they can move through the bloodstream or lymphatic system to other parts of the body.
[0029] As used herein, the term "advanced cancer" is most often used to describe cancer that cannot be cured. This means cancer that does not completely go away with treatment and does not completely disappear.
[0030] As used herein, the term "synergistic" refers to a combination of therapies that is more effective than the additive effects of a single therapy.
[0031] Cross-talk between EGF-like domain I within EpEX, EGFR, AKT, FOXO3 and HtrA2 Cancer cells that overexpress EpCAM have stem cell-like characteristics, and their presence leads to high recurrence, metastasis, and drug resistance rates. AKT is a major mediator of EGFR signaling that promotes cell survival in part by inactivating apoptosis-promoting proteins. One such apoptosis-promoting protein that is inactivated by AKT phosphorylation is forkhead transcription factor O3a (FOXO3a). FOXO3a, also called FKHRL-1, is a member of the forkhead transcription factor family. Genes activated by FOXO proteins generally function to limit cell proliferation and promote death, and thus this family is considered tumor suppressors. When activated, FOXO3a accumulates in the nucleus and enhances the transcription of various genes involved in apoptosis and cell cycle control, such as BIM, FasL, and p21. Furthermore, AKT inactivation is an essential step in anoikis, and FOXO3a regulation by the PI3K / AKT pathway may be essential for this inactivation.
[0032] The present disclosure reports that the EGF-like domain I within EpEX binds to EGFR and activates both the AKT and ERK1 / 2 pathways. EpEX-induced AKT activation inhibits FOXO3a activity and decreases HtrA2 transcription. Furthermore, an inhibitor or antagonist that targets the EGF-like domain I within EpEX (e.g., a therapeutic antibody against EpCAM (preferably, EpAb2-6)) promotes nuclear translocation of FOXO3a and increases HtrA2 expression. Accordingly, the present disclosure provides a method of treating, inhibiting, or removing cancer in a subject, comprising administering to the subject an effective amount of an inhibitor or antagonist that targets the EGF-like domain I within EpEX.
[0033] One of ordinary skill in the art can determine an appropriate dosage of an inhibitor or antagonist that targets the EGF-like domain I within EpEX. The exact amount required will vary depending on the subject, the subject's medical condition, physical condition, age, gender, species and weight, the specific identity and formulation of the composition, and the like. The dosing regimen can be adjusted to induce an optimal therapeutic response. For example, several divided doses can be administered daily, or the dosage can be proportionally reduced as indicated by the exigencies of the therapeutic situation. An appropriate effective amount can be determined by one of ordinary skill in the art using only routine experimentation.
[0034] An inhibitor or antagonist that targets the EGF-like domain I In the EpCAM extracellular domain, it contains two EGF-like domains at amino acids 27-59 (the first EGF-like domain) and amino acids 66-135 (the second EGF-like domain), as well as a cysteine-free motif (Schnell U, Kuipers J, Giepmans BN. EpCAM proteolysis: new fragments with distinct functions? Bioscience reports 2013;33:e00030). Surprisingly, the EGF-like domain I-deleted EpCAM mutant (EpCAM ΔEGFI ) shows decreased binding to EGFR, while the EGF-like domain II-deleted EpCAM mutant (EpCAMΔEGFII ) showed enhanced interaction with EGFR. In certain embodiments of the present disclosure, EGF-like domain I within EpEX comprises a peptide consisting of amino acids 27-59 of the EGF-like domain, or a variant thereof capable of binding to EGFR.
[0035] Inhibitors or antagonists of EGF-like domain I include compounds, molecules, chemicals, polypeptides and proteins that target EGF-like domain I, and they can activate both the AKT and ERK1 / 2 pathways. Further, the present disclosure unexpectedly found that inhibitors or antagonists of EGF-like domain I can suppress cancer malignancy through inhibition of spheroid formation. Additionally, treatment with inhibitors or antagonists targeting EGF-like domain I within EpEX significantly prolongs metastasis and survival of subjects in cancer.
[0036] Non-limiting examples of inhibitors or antagonists of the EGF-like domain I include ribozymes, antisense oligonucleotides, short hairpin RNA (shRNA) molecules, and small interfering RNA (siRNA) molecules that specifically inhibit and / or reduce the expression or activity of EpCAM. Inhibitors or antagonists of the EGF-like domain I knockdown the expression of EGFR, AKT, PD-L1, and / or MAPK, and / or the phosphorylation of FOXO3a, and / or increase the expression of HtrA2 and / or the nuclear translocation of FOXO3a. In some examples, the inhibitor or antagonist of the EGF-like domain I is an antisense, shRNA, or siRNA nucleic acid sequence homologous to at least a portion of the EGF-like domain I nucleic acid sequence that inhibits and / or reduces the expression or activity of EpCAM, knockdowns the expression of EGFR, AKT, PD-L1, and / or MAPK, and / or the phosphorylation of FOXO3a, and / or increases the expression of HtrA2 and / or the nuclear translocation of FOXO3a. The partial homology to the EGF-like domain I sequence is at least about 75% or at least about 80% or at least about 85% or at least about 90% or at least about 95% or at least about 98%, and the percent homology can be determined, for example, by BLAST or FASTA software. In certain non-limiting embodiments, the complementary portion can consist of at least 10 nucleotides or at least 15 nucleotides or at least 20 nucleotides or at least 25 nucleotides or at least 30 nucleotides, and the antisense nucleic acid, shRNA, or siRNA molecule can be up to 15 or up to 20 or up to 25 or up to 30 or up to 35 or up to 40 or up to 45 or up to 50 or up to 75 or up to 100 nucleotides in length. The antisense, shRNA, or siRNA molecule can contain DNA or non-canonical or non-naturally occurring residues, for example, but not limited to, phosphorothioate residues. Preferably, the shRNA consists of the nucleotide sequence GCAAATGGACACAAATTACAA (SEQ ID NO: 1), or specifically inhibits and / or It includes variants that can be reduced.
[0037] The RNA molecules of the present disclosure can be expressed from vectors or produced chemically or synthetically. Methods for selecting appropriate dsRNAs or vectors encoding dsRNAs are well known in the art for genes whose sequences are known.
[0038] In certain non-limiting embodiments, an inhibitor or antagonist of EGF-like domain I can be a small molecule, peptide, antibody, or antibody fragment that can partially or completely block EpCAM activity. An inhibitor or antagonist that targets EGF-like domain I within EpEX can be an EpCAM-neutralizing antibody that targets domain I. Preferably, the antibody is EpAb2-6 (UniProt ID: P16422) or a variant that can target domain I and neutralize EpCAM.
[0039] EpAb2-6 targets EpEX, blocks it, and induces apoptosis (Liang KH, Tso HC, Hung SH, Kuan, II, Lai JK, Ke FY et al., Extracellular domain of EpCAM enhances tumor progression through EGFR signaling in colon cancer 16 cells. Cancer Lett 2018;433:165-75; Liao MY, Lai JK, Kuo MY, Lu RM, Lin CW, Cheng PC et al., An anti-EpCAM antibody EpAb2-6 for the treatment of colon cancer. Oncotarget 2015;6:24947-68). By blocking the function of EpEX, EpAb2-6 treatment interrupts the EpEX / EGFR / ADAM17 axis, which represents a positive feedback loop that promotes EpCAM cleavage and subsequently increases EpEX and EpICD production. The present disclosure surprisingly found that EpAb2-6 treatment inhibits tumor spheroid formation and thus EpAb2-6 can suppress cancer malignancies.
[0040] A combination of an inhibitor or antagonist targeting EGF-like domain I within EpEX and an inhibitor or antagonist targeting PD-L1 In addition to mediating survival signals, EGFR activation is important for inducing immune evasion. EGFR activation mutations have been reported to be associated with increased PD-L1 expression in mouse models of EGFR-driven lung cancer and in bronchial epithelial cells with the expression of mutant EGFR. Furthermore, EGFR inhibitors can reduce PD-L1 expression in NSCLC cell lines with activated EGFR, suggesting that EGFR signaling may cause immune evasion. Further studies have shown that EGFR ligands, such as EGF, induce PD-L1 expression mainly at the level of post-translational modification. EGF has been shown to stabilize PD-L1 by inducing PD-L1 glycosylation, preventing the GSK3-dependent proteasomal degradation of PD-L1 by β-TrCP.
[0041] Furthermore, the MAPK signaling pathway, another important axis of EGFR signaling, is associated with PD-L1 mRNA expression. EGFR activation has been reported to increase PD-L1 expression via p-ERK1 / 2 / p-c-Jun. In addition to promoting PD-L1 transcription, MAPK signaling also stabilizes PD-L1 mRNA by attenuating TPP activity. Since EpCAM is an activator of EGFR signaling, EpCAM may promote evasion from immune surveillance. However, EpCAM-mediated immunosuppression and its mechanism have not been fully elucidated and remain unclear.
[0042] Among all antibody-based immunotherapies, anti-PD-1 / PD-L1 therapy has the most beneficial outcomes in the treatment of various malignancies. This fact emphasizes the importance of deeply understanding the process that controls PD-L1 expression. The present disclosure also surprisingly shows that EpCAM-mediated PD-L1 stabilization results in evasion from immune surveillance via the EpEX-EGFR-ERK signaling axis; and it has been found that EpCAM activates the PD-1 / PD-L1 pathway to inhibit antitumor immunity by suppressing T cell function. EpEX increases the stability of the PD-L1 protein rather than at the mRNA level, and blockade of the EGFR or MAPK signaling pathway attenuates EpEX-mediated PD-L1 protein stabilization. Furthermore, the combination of an anti-PD-L1 antibody and an EpCAM-neutralizing antibody shows enhanced therapeutic effects and high levels of tumor-infiltrating CD8+ T cells.
[0043] Accordingly, the present disclosure provides a method for treating, inhibiting or removing cancer in a subject, comprising administering to a subject in need thereof an inhibitor or antagonist in an effective amount that targets the EGF-like domain I within EpEX, and an inhibitor or antagonist that targets PD-L1 in an effective amount to inhibit the expression or activation of PD-L1.
[0044] In one embodiment, the inhibitor or antagonist that targets PD-L1 is a PD-L1 checkpoint inhibitor.
[0045] In some embodiments, PD-L1 checkpoint inhibitors include, but are not limited to, molecules that reduce, block, inhibit, suppress, or interfere with the signaling resulting from the interaction of PD-L1 with one or more of its binding partners, such as PD-1 and B7-1. In some embodiments, the PD-L1 checkpoint inhibitor is a molecule that inhibits the binding of PD-L1 to its binding partner. In some embodiments, the PD-L1 checkpoint inhibitor inhibits the binding of PD-L1 to PD-1 and / or B7-1.
[0046] Non-limiting examples of anti-PD-L1 antibodies include MEDI4736, atezolizumab, avelumab, or durvalumab.
[0047] Inhibitors or antagonists that target EGF-like domain I within EpEX can be present in combination and / or, in some embodiments, can be administered to a patient in a therapeutically effective amount that produces a synergistic effect when the inhibitor or antagonist is administered with an inhibitor or antagonist that targets PD-L1. Such effective amounts can vary depending on the characteristics of the patient, including sex, size, age, cancer type, cancer stage, route of administration, patient tolerance, toxicity or side effects, and other factors considered by a skilled physician in establishing an appropriate patient dosage.
[0048] The synergistic effect of the treatment combination enables the use of lower dosages of one or more of the therapeutic agents and / or the administration of the therapeutic agents less frequently to a patient having a cancer tumor. The ability to utilize lower dosages of the therapeutic agent and / or the ability to administer the therapy less frequently reduces the toxicity associated with the administration of the therapy to the subject without reducing the efficacy of the therapy in the treatment of solid lung cancer tumors. Additionally, the synergistic effect can result in improved efficacy of the therapeutic agent in the management, treatment, or amelioration of the cancer tumor. The synergistic effect of the combination of therapeutic agents can avoid or reduce adverse or undesirable side effects associated with the use of any single therapy.
[0049] Combination Also provided is a combination for cancer immunotherapy comprising an inhibitor or antagonist that targets EGF-like domain I within EpEX, and an inhibitor or antagonist that targets PD-L1. In some embodiments, the inhibitor or antagonist that targets EGF-like domain I within EpEX can be formulated with the inhibitor or antagonist that targets PD-L1, or the inhibitor or antagonist that targets EGF-like domain I within EpEX, and the inhibitor or antagonist that targets PD-L1 can be formulated separately. Each component of the combination can be supplied in separate individual containers.
[0050] In certain non-limiting embodiments, the pharmaceutical combination can be formulated using pharmaceutically acceptable carriers well known in the art suitable for oral administration. Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, capsules, solutions, gels, syrups, slurries, suspensions, etc. for oral or nasal ingestion by the patient being treated. In some embodiments, the pharmaceutical combination can be in a solid dosage form. In some embodiments, the tablets can be immediate release tablets. Alternatively or additionally, the tablets can be long-term or controlled release tablets. In some embodiments, the solid dosage can include both an immediate release portion and a long-term or controlled release portion.
[0051] In some embodiments, the pharmaceutical combination can be formulated using pharmaceutically acceptable carriers well known in the art suitable for parenteral administration. The terms "parenteral administration" and "administered parenterally" as used herein refer to a mode of administration other than enteral and topical administration, usually by injection, including, but not limited to, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion. For example, but not limited to, the combinations of the present disclosure can be administered intravenously to a patient in a pharmaceutically acceptable carrier, such as physiological saline.
[0052] Treatment of cancer The methods and combinations of the present disclosure can be used to treat cancer in a subject.
[0053] Non-limiting examples of preferred cancers for treatment include melanoma (e.g., metastatic malignant melanoma), kidney cancer, prostate cancer, breast cancer, colorectal cancer, and lung cancer. Examples of other cancers that can be treated using the methods of the present invention include bone cancer, pancreatic cancer, skin cancer, head and neck cancer, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, uterine cancer, fallopian tube carcinoma, endometrial carcinoma, cervical carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, non-Hodgkin's lymphoma, esophageal cancer, small intestine cancer, endocrine system cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, chronic or acute leukemia, e.g., acute myeloid leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia, solid tumors in children, lymphocytic lymphoma, bladder cancer, kidney or ureteral cancer, renal pelvis carcinoma, central nervous system (CNS) neoplasms, primary CNS lymphoma, tumor angiogenesis, spinal cord axis tumors, brainstem gliomas, pituitary adenomas, Kaposi's sarcoma, epidermoid carcinoma, squamous cell carcinoma, T-cell lymphoma, environmentally induced cancers, e.g., those induced by asbestos, and combinations of the foregoing cancers.
[0054] In some embodiments, the cancer is an EpCAM overexpressing cancer, an EGFR overexpressing or activating cancer, an AKT overexpressing or overactivating cancer, a MAPK overexpressing or activating cancer, a FOXO3a inactivating cancer, an HtrA2 inactivating cancer, or a PD-L1 expressing cancer. In further embodiments, the cancer is a metastatic cancer or a progressive cancer. In further embodiments, the cancer is metastatic colorectal cancer or small cell lung cancer, or progressive colorectal cancer or small cell lung cancer.
[0055] Accordingly, the combinations described herein can be administered to a subject in need thereof as a second, third, fourth, fifth, sixth or more treatment line. In one embodiment, the subject is EpCAM overexpressing. The combinations described herein can be administered to a subject who has been treated with at least one anti-cancer therapy or anti-cancer agent. In certain examples, the subject has undergone at least one anti-cancer therapy including, for example, chemotherapy, radiation therapy, surgery, targeted therapy, immunotherapy or combinations thereof. The subject can have cancer that is resistant / refractory to treatment with at least one anti-cancer agent.
[0056] The practice of the present invention uses conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry immunohistochemistry and immunology, within the skill of the art, unless otherwise indicated. Such techniques are well explained in the literature, for example, "Molecular Cloning: A Laboratory Manual", 2nd edition (Sambrook, 1989); "Oligonucleotide Synthesis" (Gait, 1984); "Animal Cell Culture" (Freshney, 1987); "Methods in Enzymology", "Handbook of Experimental Immunology" (Weir, 1996); "Gene Transfer Vectors for Mammalian Cells" (Miller and Calos, 1987); "Current Protocols in Molecular Biology" (Ausubel, 1987); "PCR: The Polymerase Chain Reaction", (Mullis, 1994); "Current Protocols in Immunology" (Coligan, 1991). These techniques are applicable to the production of the polynucleotides and polypeptides of the present invention and can themselves be considered in the production and practice of the present invention. In the following sections, techniques particularly useful for certain embodiments are considered.
[0057] The present disclosure is further illustrated by, but should not be construed as further limiting, the following examples. The content of all figures and all references, patents and published patent applications cited throughout this application are hereby expressly incorporated by reference into this specification.
[0058] [Examples] Materials and Methods Chemicals and Antibodies Antibodies against human EpCAM and p84 were purchased from Abcam, and the antibody against β-catenin was purchased from Santa Cruz. The anti-α-tubulin antibody was purchased from Sigma-Aldrich. Polyclonal antibodies for detecting total ERK and Thr202 / Tyr204-phosphorylated ERK, total AKT and Ser473-phosphorylated AKT, total FOXO3a, Ser253-phosphorylated FOXO3a, Ser318 / 321-phosphorylated FOXO3a, and The32-phosphorylated FOXO3a, active (non-phosphorylated Ser33 / Ser37 / Thr41) β-catenin, HtrA2, cytochrome c, COX IV, XIAP and PD-L1 were purchased from Cell Signaling Technology. U0126 (MEK inhibitor), wortmannin (PI3K inhibitor) and MG132 (proteasome inhibitor) were obtained from Selleck Chemicals.
[0059] Cell Culture Human lung adenocarcinoma cells (H441), lung cancer cells (H460), embryonic kidney cells (HEK293T), colorectal cancer cells (HCT116), and colorectal adenocarcinoma cells (SW620) were obtained from the American Type Culture Collection (ATCC). H441 and H460 were cultured in RPMI 1640 medium (Gibico), and HEK293T, HCT116 and SW620 cells were cultured in DMEM (Gibico). All cells were maintained in a humidified incubator at 37 °C with 5% CO2 in a conditioned medium supplemented with 10% fetal bovine serum (FBS; Gibico) and 100 μg / ml penicillin / streptomycin (P / S; Gibico).
[0060] Western blot Cells were lysed in RIPA buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Nonidet P-40, 1% sodium deoxycholate, 2.5 mM sodium pyrophosphate) containing protease inhibitor (Roche) and phosphatase inhibitor (Roche) to extract whole cell lysates. Next, the lysates were quantified using the Pierce™ BCA Protein Assay Kit (Thermo). The lysates were mixed with 5× sample buffer (50 mM Tris-HCl, pH 6.8, 2% SDS, β-mercaptoethanol, 0.1% bromophenol blue, 10% glycerol), separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE), and transferred to a PVDF membrane (Millipore). Nonspecific antibody binding sites on the PVDF membrane were blocked with 3% bovine serum albumin (BSA) in TBS-T (TBS buffer containing 0.1% Tween 20), and the membrane was incubated overnight at 4 °C with the indicated antibody, followed by incubation with an HRP-conjugated secondary antibody (Jackson ImmunoResearch Laboratories) for 1 hour at room temperature (RT). Subsequently, protein bands were visualized with chemiluminescence reagent (Millipore) and detected with a UVP BioSpectrum 600 Imagine (UVP). Protein expression was quantified by Gel-Proanalyzer 3.1 (Media Cybernetics).
[0061] Production and purification of EpEX-6×His recombinant protein The DNA fragment encoding EpEX (amino acids 24 - 262 of EpCAM) was amplified by PCR using PfuTurbo DNA polymerase and cloned into the pSecTag2 vector using a C-terminal 6×His tag to generate pSecTag2-EpEX-6×His. The EpEX-6×His fusion protein was produced using the Expi293F™ expression system (Thermo) and purified by Ni affinity column (GE Healthcare).
[0062] Extracellular interaction between EpEX-Fc and EGFR HCT116 cells were harvested with 10 mM EDTA in PBS and incubated with EpEX-Fc for 1 hour at 4°C. After incubation, 2 mM DTSSP (Thermo) was used as a crosslinking agent to stabilize the interaction between EpEX-Fc and EGFR. To stop the crosslinking reaction, Tris, pH 7.5 was added to a final concentration of 20 mM. Membrane proteins were extracted using the Mem-PER eukaryotic membrane protein extraction reagent kit (Thermo). Finally, the EpEX-Fc-EGFR complex was pulled down with Dynabeads® Protein G (Invitrogen) and probed by Western blot.
[0063] Construction of EpCAM EGF-like domain deletion EpCAM contains, in its extracellular domain, two EGF-like domains at amino acids 27-59 (the first EGF-like domain) and 66-135 (the second EGF-like domain), as well as a cysteine-free motif (Schnell U, Kuipers J, Giepmans BN. EpCAM proteolysis: new fragments with distinct functions? Bioscience reports 2013;33:e00030). EpCAM EGF-like domain deletion was generated by the first forward mutagenic deletion primer (5'-GCAGCTCAGGAAGAATCAAAGCTGGCTGCC-3') (SEQ ID NO: 2), the first reverse mutagenic deletion primer (5'-GGCAGCCAGCTTTGATTCTTCCTGAGCTGC-3') (SEQ ID NO: 3), the second forward primer (5'-AAGCTGGCTGCCAAATCTGAGCGAGTGAGA-3') (SEQ ID NO: 4) and the second reverse primer (5'-TCTCACTCGCTCAGATTTGGCAGCCAGCTT-3') (SEQ ID NO: 5) using the standard QuikChange™ deletion mutagenesis system. PCR amplification was performed using KAPA HiFi Hot Start DNA polymerase (Kapa Biosystems), and the product was treated with the restriction enzyme DpnI (Thermo Scientific) to digest the methylated parental DNA.
[0064] Cycloheximide chase assay The stability of PD-L1 was evaluated using cycloheximide, a protein synthesis inhibitor. Cells were treated with cycloheximide for 0, 2, 4 or 6 hours. Proteins were extracted and Western blot was performed to detect the PD-L1 protein level.
[0065] Immunoprecipitation assay Cells were lysed in lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% NP-40) containing protease inhibitor (Roche). For immunoprecipitation (IP), cell lysates were incubated with antibodies for 6 h at 4 °C. Next, 20 μl of Dynabeads® Protein G was added and the mixture was incubated for 2 h at 4 °C to pull down antibody-bound proteins. IP samples were washed three times with PBS, denatured in sample buffer, and analyzed by Western blot.
[0066] Generation of monoclonal antibodies and purification of IgG The generation of EpAb2-6 and control IgG was performed as previously described (Liao MY, Lai JK, Kuo MY, Lu RM, Lin CW, Cheng PC et al., An anti-EpCAM antibody EpAb2-6 for the treatment of colon cancer. Oncotarget 2015; 6:24947-68). This protocol was approved by the Institutional Animal Care and Use Committee of Academia Sinica (ASIACUC: 11-04-166).
[0067] Lentivirus-mediated short hairpin RNA (shRNA) knockdown All lentiviral shRNA constructs were purchased from the RNAi Core Facility of Academia Sinica (Taipei, Taiwan). Lentivirus production, infection, and selection were performed according to the protocol from the RNAi Consortium (Academia Sinica, Taiwan). To produce lentivirus, HEK293T cells were transiently co-transfected with the shRNA plasmid, packaging (pCMV-ΔR8.91), and envelope (pMD.G) expression plasmids using PolyJet DNA transfection reagent (SignaGen Laboratories). The next day, to improve virus production, the transfection solution was replaced with medium containing 1% BSA. Two days after transfection, the medium containing lentivirus was collected. Cells were further cultured for 48 hours in the lentivirus-containing medium supplemented with 8 μg / ml polybrene. Transduced cells were selected with 2 μg / ml puromycin for 4 days, and the knockdown efficiency was measured by Western blot. The target sequence of the human EpCAM-specific shRNA was shRNA, 5'-GCAAATGGACACAAATTACAA-3' (SEQ ID NO: 1). Luciferase shRNA (shLuc) was used as a negative control.
[0068] RNA extraction, cDNA synthesis, quantitative reverse transcription polymerase chain reaction (qRT-PCR) Total RNA extraction, first-strand cDNA synthesis, and SYBR-green-based real-time PCR were performed as described in the manufacturer's instructions. To extract total RNA, cells were lysed using TRIzol reagent (Invitrogen), and proteins and phenol were removed from TRIzol using chloroform. After centrifugation, the upper colorless layer was recovered and mixed with isopropanol to precipitate the RNA pellet. Next, the RNA pellet was washed with 70% ethanol, air-dried at room temperature, and dissolved in RNase-free water. For first-strand cDNA synthesis, 5 μg of total RNA was used for reverse transcription using oligo(dT) primers and SuperScriptIII reverse transcriptase (Invitrogen) at 50 °C for 60 minutes. The target gene levels were evaluated by quantitative PCR (qPCR) using LightCycler 480 SYBR Green I Master Mix (Roche) and LightCycler 480 System (Roche). To normalize all qPCR reactions, GAPDH mRNA expression was measured as an endogenous housekeeping control. The qPCR reaction was 5 minutes at 95 °C, followed by 40 cycles of denaturation at 95 °C for 10 seconds, annealing at 60 °C for 10 seconds, and extension at 72 °C for 30 seconds. The final results were calculated from three independent experiments.
[0069] Immunofluorescence assay For immunofluorescence, 2×10 4 Cells were seeded on 12-mm coverslips in 24-well culture plates, fixed with 2% paraformaldehyde, and incubated with 0.1% Triton X-100 to increase cell membrane permeability. Next, the samples were blocked with 1% BSA for 1 hour at room temperature and stained overnight at 4 °C with the primary antibody. The slides were washed and stained for 40 minutes with the secondary antibody conjugated with FITC or Alexa568 and DAPI. Next, the coverslips were washed with PBS and mounted in mounting solution (Vector Laboratories). The slides were examined with a confocal microscope (Leica TCS-4 SP5).
[0070] Apoptosis Protein Array HCT116 cells were stimulated with 20 μg / ml of EpAb2-6 for 6 hours, and the apoptosis array was performed according to the manufacturer's instructions (R&D Systems; ARY009). The membrane (array) was detected by UVP BioSpectrum 600 Imagine (UVP). The array was quantified with Gel-Pro Analyzer 3.1 (Media Cybernetics, Inc.).
[0071] Flow Cytometry Analysis Cells were harvested, washed, resuspended in FACS buffer (PBS containing 1% FBS), and 10 5 Cells were transferred to a 96-well U-bottom plate. Cells were stained with different antibodies for 1 hour at 4°C and then with the indicated phycoerythrin (PE)-conjugated secondary antibody for 1 hour at 4°C. Next, the cells were washed twice with FACS buffer and resuspended in 400 μl of FACS buffer. Fluorescence signals were analyzed using flow cytometry (BD FASCSCanto™ II) and measured with FCS Express V3 software. Data were collected from three independent experiments.
[0072] Chromatin Immunoprecipitation Briefly, HCT116 cells (1×10 5 ) were treated with 20 μg / ml of EpAb2-6 for 6 hours and subsequently cross-linked and fixed in 1% formaldehyde. Fixation was stopped by adding glycine to a final concentration of 200 mM, and then the fixed chromatin complex was sonicated to an average length of 250 base pairs using a MISONIX sonicator 3000. The sonicated protein-DNA complex was subjected to immunoprecipitation using an antibody against 2 μg of FOXO3a. The immunoprecipitated DNA was recovered with a PCR purification kit (Qiagen), and the amount of target DNA was detected by PCR.
[0073] Dual Luciferase Reporter Assay The human HtrA2 proximal promoter fragment covering regions -1628 to +86 and 700 to +86 (the transcription start site is designated as +1) was PCR amplified and then cloned into the firefly luciferase reporter plasmid pGL4.18 vector (Promega). To evaluate the effect of EpA2-6 on HtrA2 promoter activity, HCT116 and SW620 cells (1×10 4 / well) seeded on 24-well dishes were transiently transfected for 24 hours with the HtrA2 promoter reporter construct in combination with a plasmid expressing Renilla luciferase using the PolyJet transfection reagent (SignaGen Laboratories, USA), and then stimulated with 20 μg / ml of EpAb2-6 for 6 hours. Cell lysates were prepared and subjected to a luciferase activity assay using a dual-luciferase reporter assay kit (Promega, USA). Firefly luciferase activity was normalized to Renilla luciferase activity, and the final data are presented as the fold induction of luciferase activity compared to the EpAb2-6-IgG control. Data are represented as mean ± SD from three independent experiments.
[0074] Apoptosis and mitochondrial membrane potential assays Cells (2×10 5 ) were seeded in 24-well dishes and treated with 20 μg / ml of control IgG or EpAb2-6 for 6 hours. Apoptotic cells and mitochondrial membrane potential were detected using the FITC Annexin V apoptosis detection kit (BD Biosciences) and MitoStatus Red (BD Biosciences), respectively. Apoptotic cells and mitochondrial membrane potential were analyzed using a flow cytometer (Thermo Fisher Scientific). To ensure reproducibility, each measurement was performed at least three times. The effect of gene knockdown in EpAb2-6-induced apoptosis is shown in Table 1 in the supplementary material.
[0075]
Table 1
[0076] Immunohistochemistry Human lung cancer tissue microarrays were purchased from Super BioChip. After endogenous hydrogen peroxide was depleted with 3% hydrogen peroxide in methanol for 30 minutes, the tissue microarrays were blocked with 1% BSA for 1 hour and then exposed to anti-PD-L1 (clone 28-2, abcam) or EpAb3-5 (Liao MY, Lai JK, Kuo MY, Lu RM, Lin CW, Cheng PC, et al. An anti-EpCAM antibody EpAb2-6 for the treatment of colon cancer. Oncotarget 2015;6:24947-68) at 4°C overnight. After washing with PBST, the tissue microarrays were processed using the standard procedure of the Super Sentivie™ IHC detection system (BioGenex) and stained with DAB. Nuclei were stained with Mayer's hematoxylin solution (Wako).
[0077] Isolation and culture of PBMCs and T cells For experiments using PBMCs, blood samples were collected from healthy donors and collected into 10 ml Vacutainer® tubes containing the anticoagulant EDTA (BD Bioscience). After centrifugation at 1500 rpm for 10 minutes, the plasma was removed from the samples and mixed with an equal volume of PBS. The mixture was layered on Ficoll-Paque Plus (Ficoll:blood = 1:2) and centrifuged at 1500 rpm for 30 minutes. The PBMC layer (buffy coat) was collected and washed twice with PBS containing 0.5% BSA and 2 mM EDTA. Purified CD3 +To obtain T cells, PBMCs were positively selected by anti-CD3 magnetic beads (MACS) according to a standard protocol. They were cultured and activated for 48 hours with 25 μl of anti-CD3 / anti-CD28-coated Dynabeads (Invitrogen) in RPMI 1640 supplemented with 10% FBS, 100 μg / ml P / S, 12.5 ng / ml IL-2 (Gibico), and 1 ng / ml IL-15 (MACS). The protocol was approved by the Institutional Review Board of Academia Sinica (AS IRB: AS-IRB01-19049).
[0078] In vivo cell survival assay HCT116-GFP cells were intravenously injected into NOD / SCID mice, and EpAb2-6 or an equal dosage of control IgG was intravenously administered (the antibody was delivered at 20 mg / kg) to mice with circulating HCT116-GFP cells 1 hour after cell injection. Next, blood samples were obtained from the facial vein of the mice, and the fluorescence intensity of the whole blood was quantified at the indicated time points. Fluorescence was measured at an excitation wavelength of 355 nm and an emission wavelength of 440 nm using a microplate reader (Molecular Devices, SpectraMax M5).
[0079] Human subcutaneous colorectal cancer research Subcutaneous studies were performed as previously reported (Liao MY, Lai JK, Kuo MY, Lu RM, Lin CW, Cheng PC, et al., An anti-EpCAM antibody EpAb2-6 for the treatment of colon cancer. Oncotarget 2015;6:24947-68). The protocol was approved by the Animal Care and Use Committee of Academia Sinica (ASIACUC: 11-04-166).
[0080] Orthotopic transplantation and treatment research The orthotopic assay was performed as previously reported (Wu CH, Kuo YH, Hong RL, Wu HC. alpha-Enolase-binding peptide enhances drug delivery efficiency and therapeutic efficacy against colorectal cancer. Sci Transl Med 2015;7:290ra91). Briefly, NSG mice (NOD.Cg-Prkdcscid Il2rgtm1Wjl / SzJ) were used for orthotopic transplantation of HCT116 cells previously infected with Lenti-luc virus (lentivirus containing the luciferase gene). Mice were anesthetized by i.p. injection of Avertin, 2,2,2-tribromo-ethanol (Sigma-Aldrich) at a dose of 250 mg / kg. Tumor development was monitored by bioluminescence imaging. For the orthotopic treatment study, tumor-bearing mice were treated with control IgG or EpAb2-6 (20 mg / kg). Tumor progression was monitored by quantification of bioluminescence. The body weight and survival rate of the mice were measured. Animal experiments were conducted according to the guidelines of Academia Sinica in Taiwan. The protocol was approved by the Animal Experiment Ethics Committee of Academia Sinica (ASIACUC: 11-04-166).
[0081] Gene Set Enrichment Analysis, GSEA A gene expression matrix was obtained from the LUAD project in TCGA. The top 25% of samples with the highest EpCAM expression were defined as the "EpCAM_High" group, and the bottom 25% of samples with the lowest EpCAM expression were defined as the "EpCAM_Low" group. Next, the data were analyzed using the T cell activation and T cell proliferation gene sets provided by the GSEA website.
[0082] Statistical analysis All data are presented as mean ± standard deviation (SD) from at least three independent experiments. Unless otherwise specified, the Student's t-test was used to calculate the significant difference from each control for each experimental condition. A P-value < 0.05 ( * ), < 0.01 ( ** ) or < 0.001 ( *** ) indicates significance. Survival analysis was performed using the log-rank test. The correlation coefficient was calculated using Spearman analysis.
[0083] [Example 1] EpEX binds to EGFR via its EGF-like domain I To verify that EpEX interacts with EGFR, the inventors used the cross-linker DTSSP to stabilize the EpEX-EGFR complex. The binding of EpEX to EGFR was confirmed by IP and Western blotting (Figure 1A). To evaluate the direct binding of recombinant EpEX to the extracellular domain of EGFR (EGFR ECD ), the inventors performed ELISA to probe the direct interaction between purified EpEX and EGFR ECD protein (Figure 1B).
[0084] To examine whether membrane-bound EpCAM can bind to EGFR, the inventors performed immunoprecipitation experiments using HEK293T cells overexpressing EpCAM-V5 and EGFR-Flag. The interaction between exogenous EpCAM and EGFR was detected by co-IP (Figure 1C). In the EpCAM extracellular domain, it contains two EGF-like domains at amino acids 27 - 59 (the first EGF-like domain) and amino acids 66 - 135 (the second EGF-like domain), and a cysteine-free motif. To identify the specific region of EpEX that binds to EGFR, the inventors constructed different EGF-like domain-deleted EpCAM mutants. Surprisingly, the EGF-like domain I-deleted EpCAM mutant (EpCAM ΔEGFI ) showed decreased binding to EGFR, while the EGF-like domain II-deleted EpCAM mutant (EpCAM ΔEGFII) showed enhanced interaction with EGFR (Figure 1D). Soluble EpEX with EGFR ECD To further evaluate the binding to, HEK293T cells were co-transfected with different vectors expressing soluble EGFR ECD -Flag or EpEX-Fc, and the protein complexes in the medium were examined (Figure 1E). Soluble EGF-like domain II deleted EpEX-Fc (EpEX ΔEGFII -Fc) showed significantly increased affinity, while EGF-like domain I deleted EpEX-Fc (EpEX ΔEGFI -Fc) showed decreased affinity for EGFR ECD -Flag compared to EpEX-Fc (Figure 1F). Overall, we found that both membrane-bound EpCAM and secreted EpEX bind to EGFR, and deletion of EGF domain I decreases this binding (Figures 1C - 1F).
[0085] Similar results were observed using purified wild-type or mutant EpEX and EGFR ECD recombinant proteins. Recombinant EpEX ΔEGFII protein had a stronger binding affinity for EGFR than the wild-type control, and EpEX ECD protein lost the ability to bind to EGFR ΔEGFI (Figure 1G). Furthermore, EpEX ECD protein induced EGFR signaling similar to the wild-type control, while EpEX ΔEGFII protein did not (Figure 1H). These results suggest that EGF-like domain I in EpEX is a major domain involved in EpEX-EGFR interaction and activation of EGFR signaling. ΔEGFI protein did not induce it (Figure 1H). These results suggest that EGF-like domain I in EpEX is a major domain involved in EpEX-EGFR interaction and activation of EGFR signaling.
[0086] [Example 2] Inhibition of EpEX increases nuclear accumulation of FOXO3a and induces apoptosis Since the inventors found that EpEX activates EGFR via the EpEX domain I, the inventors further investigated whether EpEX-mediated EGFR activation is important for cancer progression. AKT is a major downstream effector of EGFR and partially promotes cell survival by inactivating FOXO3a. Inhibition of AKT / FOXO3a signaling has been suggested to be an essential step in apoptosis and may inhibit tumorsphere formation in the SKOV3 ovarian cancer cell line. To evaluate whether EpEX affects FOXO3a function, the inventors examined FOXO3a phosphorylation and intracellular localization. Immunoblotting analysis showed that EpEX induced phosphorylation of AKT and FOXO3a in a time-dependent manner (Figure 2A), and that EpEX-induced phosphorylation of FOXO3a was inhibited by AG1478 (EGFR inhibitor) or wortmannin (PI3K inhibitor) (Figure 2B). Furthermore, after EpEX treatment, FOXO3a translocated from the nucleus to the cytoplasm (Figure 2C). Since EpEX acts via EGFR, the inventors used EGF, a well-known ligand of EGFR, as an inducer. Similar to EpEX treatment, EGF induced nuclear exclusion of FOXO3a (Figures 8A-8C). Therefore, the inventors concluded that EpEX inhibits FOXO3a activity via the EGFR-AKT pathway.
[0087] Previously, the inventors developed a neutralizing antibody EpAb2-6 that targets EpEX and induces apoptosis (Liang KH, Tso HC, Hung SH, Kuan, II, Lai JK, Ke FY, et al., Extracellular domain of EpCAM enhances tumor progression through EGFR signaling in colon cancer 16 cells. Cancer Lett 2018;433:165-75; Liao MY, Lai JK, Kuo MY, Lu RM, Lin CW, Cheng PC, et al., An anti-EpCAM antibody EpAb2-6 for the treatment of colon cancer. Oncotarget 2015;6:24947-68). EpAb2-6 was employed to block EpEX. By blocking the function of EpEX, EpAb2-6 treatment is known to disrupt the EpEX / EGFR / ADAM17 axis, which represents a positive feedback loop that promotes EpCAM cleavage and subsequently increases EpEX and EpICD production (Liang KH, Tso HC, Hung SH, Kuan, II, Lai JK, Ke FY, et al., Extracellular domain of EpCAM enhances tumor progression through EGFR signaling in colon cancer 16 cells. Cancer Lett 2018;433:165-75). Indeed, a decrease in ADAM17 and γ-secretase activities and soluble EpEX release was observed after EpAb2-6 treatment (Figures 9A-9C). Furthermore, nuclear activated β-catenin, as well as downstream genes including reprogramming genes and EMT-related genes, were also decreased in EpAb2-6-treated cells (Figures 9D and 9E). Next, the inventors investigated whether EpCAM contributes to anchorage-independent growth. For this purpose, a soft agar colony formation assay was performed using colon cancer cell lines. EpAb2-6-treated cells formed significantly smaller and fewer colonies compared to control cells (Figure 9F).Furthermore, the inventors cultured these adherent colon cancer cells into tumor spheres and found that EpAb2-6 treatment inhibited tumor sphere formation (Figure 9G). These results suggest that targeting EpCAM with the specific antibody EpAb2-6 is a potentially feasible strategy for suppressing colon cancer malignancies.
[0088] Nuclear accumulation of FOXO3a promotes apoptosis of cancer cells after treatment with various chemotherapeutic drugs or EGFR inhibitors. Therefore, the inventors desired to clarify whether inhibiting the function of EpEX would promote nuclear FOXO3a accumulation. Blocking the function of EpEX by EpAb2-6 treatment also decreased the phosphorylation of AKT and FOXO3a (Figure 2D), and subsequently increased the nuclear accumulation of FOXO3a, but decreased the nuclear translocation of β-catenin (Figure 2E). Downstream genes of FOXO3a (BIM, p21, and FASL) were also upregulated in HCT116 cells using EpAb2-6 treatment compared to the IgG control (Figure 2F). Using immunofluorescence staining, FOXO3a and β-catenin were detected in both the cytoplasm and nucleus of colon cancer cells. However, after EpAb2-6 treatment, FOXO3a increased in the nucleus, but nuclear β-catenin decreased both in vitro (Figure 2G) and in vivo (Figure 2H). Thus, inhibition of EpEX enhances the nuclear translocation of FOXO3a and, as a result, upregulates downstream genes involved in promoting apoptosis.
[0089] To evaluate whether EpAb2-6 induces apoptosis via EGFR / AKT / FOXO3a, the inventors used shRNA to knockdown EGFR, AKT, and FOXO3a expression in colon cancer cells and examined the effect of EpAb2-6 on cancer cell apoptosis. All EGFR-, AKT-, and FOXO3a-knockdown cells were less sensitive to EpAb2-6-induced apoptosis than control cells, and EpAb2-6-induced apoptosis was completely suppressed in EpCAM knockout (KO) cells (Figures 10A - 10D). In summary, the inventors' data show that EpEX induces phosphorylation of FOXO3a and inactivates its biological function; on the other hand, blocking the function of EpEX inhibits phosphorylation of FOXO3a, promotes nuclear accumulation of FOXO3a, and activates the expression of its downstream pro-apoptotic genes.
[0090] [Example 3] HtrA2 acts downstream of FOXO3a and contributes to EpAb2-6-induced apoptosis To gain further insight into the mechanism of EpAb2-6-induced apoptosis, the inventors compared the expression of 35 apoptosis-related signaling proteins in control IgG- and EpAb2-6-treated colon cancer cells. The inventors found that, of the 35 apoptosis-related proteins, two showed a substantial increase in expression after EpAb2-6 treatment compared to the IgG control. These proteins were heat shock protein A2 (HtrA2) and X-linked inhibitor of apoptosis protein (XIAP) (Figure 3A).
[0091] Immunoblotting and qPCR experiments showed that EpAb2-6 treatment enhanced the protein and mRNA expression of HtrA2 in HCT116 cells (Figure 3B). According to previous studies, HtrA2 can be released into the cytoplasm, where it contributes to apoptosis (Bhuiyan MS, Fukunaga K, Mitochondrial serine protease HtrA2 / Omi as a potential therapeutic target. Curr Drug Targets 2009;10:372-83). As expected, the inventors found that EpAb2-6 induced the release of cytochrome c and HtrA2 from mitochondria to the cytosol (Figure 3C). Furthermore, EpAb2-6 treatment induced dissipation of the mitochondrial membrane potential (Figure 3D).
[0092] The HtrA2 mRNA level increased after EpAb2-6 treatment, indicating that transcriptional regulation of the HtrA2 gene was induced by EpAb2-6. To examine this hypothesis, HCT116 cells were transiently transfected with a reporter for the HtrA2 promoter; a region containing 1704 bases upstream of the HtrA2 translation start site was used to drive the expression of the firefly luciferase gene (pGL4.18-HtrA2-1) (Figure 3E). EpAb2-6 treatment resulted in an induction of approximately 4-fold of the HtrA2 promoter activity compared to the IgG control, indicating that the HtrA2 gene is indeed a transcriptional target of EpAb2-6-induced signaling (Figure 3E). To further elucidate the molecular mechanism controlling HtrA2 gene transcription, the HtrA2 promoter sequence was analyzed using the PROMO virtual laboratory website. This analysis revealed a putative cis-acting response element (-1283 to -1299) for the FOXO transcription factor. Interestingly, to the best of the inventors' knowledge, there is no previously published evidence showing that FOXO3a controls HtrA2 promoter activity.
[0093] Therefore, the inventors generated a reporter construct without the FOXO3a response element (pGL4.18-HtrA2-2) to examine whether HtrA2 promoter activity is controlled by FOXO3a, as shown in Figure 3E. Indeed, the increase in luciferase activity induced by EpAb2-6 disappeared in the absence of the FOXO3a response element (Figure 3E).
[0094] To further elucidate whether FOXO3a directly controls the HtrA2 promoter, chromatin immunoprecipitation (ChIP) analysis was performed using primers adjacent to the putative FOXO3a response element (-1283 to -1299). FOXO3a occupied the HtrA2 promoter after EpAb2-6 treatment and was not observed in FOXO3a knockdown cells (Figure 3F). These results indicated that FOXO3a increases HtrA2 transcription through direct binding to the HtrA2 promoter. Next, the inventors investigated whether HtrA2 plays an important role in EpAb2-6-induced cell death. In this experiment, the inventors used shRNA to knockdown HtrA2 expression in colon cancer cells. In HtrA2 knockdown cells, EpAb2-6 treatment induced fewer apoptotic cells (Figure 3G) and disruption of mitochondrial membrane potential (Figure 3H) than shLuc (control knockdown) cells. Therefore, FOXO3a-mediated HtrA2 transcription is thought to be involved in EpAb2-6-induced apoptosis.
[0095] [Example 4] EpCAM expression is positively correlated with PD-L1 stabilization Activation of EGFR has been reported to be associated with an increase in PD-L1 expression in a mouse model of EGFR-induced lung cancer and in bronchial epithelial cells with mutant EGFR expression, suggesting that EGFR signaling is important for the induction of immune evasion. Next, further studies showed that increased EGFR signaling upregulates PD-L1 expression by various mechanisms. Furthermore, EpCAM plays an important role in EGFR activation. Based on these findings, the inventors decided to investigate whether EpCAM controls PD-L1 expression via EGFR activation. Since the HCT116 cell expression of PD-L1 is extremely low, H441 cells with high PD-L1 expression were substituted for HCT116 cells as an experimental model for further studies.
[0096] First, the inventors sought to clarify whether EpCAM is involved in evasion from immune surveillance. To reconstitute immune cells, PBMCs were intravenously injected into immunodeficient NSG mice having shLuc H441 xenografts on the left side and shEpCAM H441 xenografts on the right side. EpCAM knockdown cells showed a decrease in tumor weight, confirming that EpCAM promotes tumor progression (Figures 4A and 4B). Interestingly, the shLuc tumors in mice receiving PBMC injection were not different from the shLuc tumors in mice without PBMC. However, the shEpCAM tumors with PBMC were smaller than the tumors without PBMC, indicating the possibility that EpCAM inhibits anti-tumor immunity (Figures 4A and 4B). By flow cytometry analysis, the inventors found that CD8 + T cells were enriched in the shEpCAM tumor tissue (Figure 4C), and Western blot analysis showed that PD-L1 expression was decreased in the shEpCAM tumor tissue (Figure 4D). These results indicate that EpCAM promotes PD-L1 expression in vivo and reduces tumor-associated CD8 + T cells.
[0097] To investigate the correlation between EpCAM and PD-L1 expression, the inventors analyzed PD-L1 mRNA expression in two NSCLC cell lines: H441 (high EpCAM expression) and H460 (non-EpCAM expression). Compared to H441 cells, H460 cells showed higher levels of PD-L1 mRNA, but lower levels of PD-L1 protein (Figure 4E). This finding was confirmed by flow cytometry analysis of PD-L1 and EpCAM (Figure 4F). The stability of PD-L1 may serve as an important regulator at the protein level. Indeed, the cycloheximide chase assay showed that the half-life of PD-L1 in H460 cells was reduced compared to that in H441 cells (Figure 4G). These findings suggest that the low PD-L1 protein level in H460 cells is due to the reduced stability of the PD-L1 protein.
[0098] To investigate whether EpCAM affects the stability of the PD-L1 protein, the inventors overexpressed EpCAM in H460 cells (no low endogenous PD-L1 and EpCAM expression). The inventors found that EpCAM expression increased the PD-L1 protein level but did not change its mRNA level (Figures 11A and 11B). By cycloheximide chase assay, it was confirmed that the half-life of the PD-L1 protein was increased by EpCAM overexpression (Figure 11C). Furthermore, knockdown of EpCAM in H441 cells (high endogenous EpCAM expression) decreased the PD-L1 protein level and protein half-life but did not change the mRNA level (Figures 4H and 4I). Consistent with this idea, H441 cells with CMV promoter-driven overexpression of PD-L1-Myc lacking endogenous regulatory elements, such as the PD-L1 promoter, 3'UTR, and 5'UTR, also showed a decrease in the PD-L1 protein when EpCAM was knocked down (Figure 4J). Furthermore, to verify the inventors' findings in samples from human cancer patients, the PD-L1 and EpCAM protein levels were examined in both lung and colon tumor specimens. Similar to the inventors' results in lung cancer cell lines, the PD-L1 protein level was highly correlated with EpCAM expression in the lung tumor tissue array (Figure 4K). On the other hand, since most of the specimens in the colon tissue array showed only weak staining for PD-L1, the inventors could not draw a clear conclusion despite the strong signal for EpCAM (Figures 12A - 12B). Furthermore, GSEA analysis showed genes related to T cell activation and proliferation enrichment in low EpCAM expression of lung cancer specimens (Figure 4L). Therefore, the inventors concluded that EpCAM expression is positively correlated with PD-L1 protein stability.
[0099] [Example 5] EpEX stabilizes PD-L1 via the EGFR-ERK pathway Activation of the EGFR signaling pathway can increase PD-L1 expression through various mechanisms. Thus, EpEX may control PD-L1 expression via the EGFR signaling. Furthermore, EpICD translocates to the nucleus and associates with FHL2 and β-catenin in a complex that transcribes downstream genes. Therefore, the inventors tested whether EpEX or EpICD is sufficient to cause PD-L1 stabilization. To test whether endogenous EpEX or EpICD is required for PD-L1 protein stabilization, an ADAM17 inhibitor (TAPI) and a γ-secretase inhibitor (DAPT) were utilized to prevent the generation of endogenous EpEX and EpICD, respectively. Blocking the excretion of endogenous EpEX rather than EpICD caused a reduction in the PD-L1 protein level. Notably, no change in the PD-L1 mRNA level was observed, suggesting that endogenous EpEX is important for PD-L1 protein stability (Figure 5A). Furthermore, the inventors' results showed that after treating H441 cells with EpEX or EGF, the PD-L1 protein level increased in a dose-dependent and time-dependent manner (Figures 5B and 5C). The PD-L1 mRNA level did not increase after EpEX or EGF treatment (Figure 5C). These results suggest that EpEX can increase the PD-L1 protein level, but EpICD cannot.
[0100] IFN-γ is known to induce PD-L1 expression via STAT family-mediated transcription. Next, the inventors examined whether endogenous EpEX and EpICD are also involved in IFN-γ-mediated PD-L1 upregulation. PD-L1 mRNA was upregulated in H441 cells treated with IFN-γ and DMSO, IFN-γ and TAPI, and IFN-γ and DAPT (Figure 13A).
[0101] Surprisingly, the PD-L1 protein level did not increase much in the presence of TAPI, similar to that in IFN-γ and DMSO-treated cells (Figure 13B). In other words, despite the fact that PD-L1 mRNA expression was increased by IFN-γ stimulation, the protein level could not be fully upregulated without the production of EpEX. In addition, PD-L1 protein expression was not impaired in IFN-γ and DAPT-treated cells (Figure 13B). PD-L1 mRNA levels increased in all cells treated with IFN-γ, but the protein level was upregulated only in cells treated with IFN-γ and EpEX or IFN-γ and EGF (Figures 13C and 13D). Thus, EpEX is considered to be an essential factor for PD-L1 protein upregulation.
[0102] The EGFR signaling pathway is important for PD-L1 expression in cancer cells, and our previous studies have shown that EpEX can induce EGFR signaling. Therefore, we speculated that EpEX may act through the EGFR signaling pathway to prevent PD-L1 degradation. Indeed, shRNA knockdown of EGFR in H441 cells attenuated the EpEX- or EGF-enhanced PD-L1 level (Figure 5D). Next, we investigated whether the EGFR-downstream signaling pathway is involved in the EpEX- and EGF-mediated upregulation of PD-L1. Treatment with gefitinib suppressed both the EpEX- and EGF-induced upregulation of the PD-L1 protein level. Importantly, U0126, a MEK inhibitor but not an AKT inhibitor, also abolished the EpEX-mediated upregulation of PD-L1 (Figure 5E). These results demonstrated that, similar to EGF, the EpEX-mediated upregulation of PD-L1 requires signal transduction through the MAPK pathway.
[0103] Both ERK and AKT signaling were able to control PD-L1 expression via different mechanisms. Therefore, the inventors desired to know which signaling pathway was more important for PD-L1 expression in their system. Inhibition of ERK signaling decreased PD-L1 expression in a time-dependent manner, while inhibition of AKT signaling did not (Figure 14A). Next, the inventors attempted to verify that the MAPK pathway affects the stability of the PD-L1 protein. In the presence of U0126 and cycloheximide, the turnover rate of PD-L1 was higher than that of the DMSO control (Figure 14B). Next, to prevent misinterpretation of the effects due to non-specific targeting, the MAPK pathway was blocked using different inhibitors. Indeed, trametinib and U0126, which are different MEK inhibitors, and SCH772984, which is an ERK inhibitor, all decreased the PD-L1 protein level and increased the polyubiquitination of PD-L1 (Figures 14C and 14D).
[0104] Glycosylation of PD-L1 at N192, N200, and N219 antagonizes GSK3β binding and normally induces phosphorylation-dependent proteasomal degradation of PD-L1 by β-TrCP. Thus, non-glycosylated PD-L1 is less stable compared to glycosylated PD-L1. Consistent with this mechanism, PD-L1 was upregulated in GSK3β knockdown cells (Figure 14E). However, both EpEX and EGF may induce upregulation of PD-L1 in GSK3β knockdown cells (Figure 14F), suggesting that GSK3β is not required for EpEX- or EGF-mediated stabilization of PD-L1.
[0105] Next, the inventors tested whether EpAb2-6 could downregulate PD-L1 and attenuate EpEX production. After EpAb2-6 treatment, the PD-L1 protein level was downregulated both in vitro and in vivo (Figure 5F). Consistent with our other findings, EpAb2-6 also decreased the stability of the PD-L1 protein and increased the polyubiquitination of PD-L1 (Figures 5G and 5H). Notably, EpAb2-6 treatment inhibited the PD-L1 protein level in lung cancer cells and cell lines derived from other EpCAM-positive cancer types, including breast cancer (BT474 and MCF7) and oral cancer (Cal27) (Figure 5I). Furthermore, using an apoptosis assay, the inventors found that co-culturing cancer cells with either EpAb2-6 or T cells induced cancer cell apoptosis, and co-culturing cancer cells in the presence of both EpAb2-6 and T cells was more effective in inducing apoptosis (Figure 5J).
[0106] [Example 6] EpAb2-6 extends the survival of metastatic and orthotopic mouse models and improves the efficacy of anti-PD-L1 therapy in a PBMC cell line-derived xenograft (CDX) model Next, the inventors used an animal model of metastatic colon cancer to test whether EpAb2-6 treatment could increase the median overall survival of metastatic tumor-bearing mice. EpAb2-6 reduced the fluorescence intensity of mouse blood with circulating HCT116-GFP cells, suggesting that EpAb2-6 decreased the number of HCT116-GFP cells in mouse blood vessels in vivo (Figure 6A). SW620 cells were intravenously injected into NOD / SCID mice, and then, 24 and 96 hours after cell injection, the mice were intravenously treated with EpAb2-6 or an equal volume of control IgG (the antibody was delivered at 20 mg / kg / dose for a total dose of 40 mg / kg). The median survival of the EpAb2-6 treatment group was significantly increased compared to that of the control IgG group (Figure 6B, P < 0.005 by log-rank test).
[0107] Since subcutaneous models may not accurately reproduce human colon cancer biology, orthotopic mouse models of colorectal cancer were also established to study the efficacy of the inventors' therapeutic antibodies in the colorectal tumor microenvironment. The inventors investigated the antitumor ability of EpAb2-6 in an orthotopic model of HCT116-Luc tumors that stably express firefly luciferase. Before the first therapeutic injection (8 days after tumor cell transplantation), growing orthotopic tumors were monitored by bioluminescence imaging (Figure 6C). Mice were treated every 2 days for 16 days with either control IgG or EpAb2-6 (20 mg / kg). In particular, the EpAb2-6 treatment group showed metastasis at 55 days, while the control group showed metastasis at 45 days (Figure 6C). Also, no significant change in body weight was observed during the treatment period (Figure 15). At the end of the study, the median survival times of the control IgG or EpAb2-6 treatment groups were 50 days and 116.5 days, respectively (Figure 6D). From these results, the inventors concluded that EpAb2-6 treatment can extend the survival of tumor-bearing mice.
[0108] Based on the inventors' observation that EpAb2-6 treatment reduces PD-L1 expression in vitro and in vivo, the inventors wished to further evaluate whether EpAb2-6 could improve the therapeutic effect of anti-PD-L1 treatment in vivo. Since EpAb2-6 does not have cross-reactivity with mouse EpCAM, it is not possible to evaluate the therapeutic effect of EpAb2-6 on immunotherapy using a syngeneic mouse model. As shown in Figure 6E, H441 cells were subcutaneously injected into NSG mice to establish a PBMC-H441 xenograft mouse model. Two weeks later, 10 7 PBMC cells were intravenously injected into the mice, and the anti-PD-L1 antibody atezolizumab and EpAb2-6 were administered twice a week for 1 month. Treatment with atezolizumab or EpAb2-6 alone inhibited tumor growth in PBMC-H441 mice, and combination therapy resulted in a much better tumor suppression effect (Figures 6F and 6G). At the end of the treatment, tumor tissues were collected and CD8 + T cells were analyzed by flow cytometry. In mice receiving combination therapy, CD8 +The T cell population increased (Figure 6H). Collectively, these data indicate that inhibition of EpCAM by EpAb2-6 can enhance the efficacy of anti-PD-L1 therapeutics in PBMC-H441 xenograft mice.
[0109] This is the first study showing that inhibition of EpCAM correlates with an increase in HtrA2 gene expression. Furthermore, this upregulation occurs via FOXO3a and induces apoptosis. EpEX increases the stability of the PD-L1 protein, and combination immunotherapy with anti-EpCAM and anti-PD-L1 antibodies provides a novel strategy for cancer treatment. The present invention includes, for example, the following embodiments: [Embodiment 1]A method for treating, inhibiting or removing cancer in a subject, comprising administering to the subject an effective amount of an inhibitor or antagonist that targets EGF-like domain I within the extracellular domain (EpEX) of EpCAM. [Embodiment 2]The method according to Embodiment 1, wherein the EGF-like domain I within EpEX comprises a peptide consisting of amino acids 27-59 of the EGF-like domain, or a variant thereof capable of binding to EGFR. [Embodiment 3]The method according to Embodiment 1, wherein the inhibitor or antagonist that targets EGF-like domain I within EpEX is a ribozyme, antisense oligonucleotide, short hairpin RNA (shRNA) molecule or small interfering RNA (siRNA) molecule that specifically inhibits and / or reduces the expression or activity of EpCAM. [Embodiment 4]The method according to Embodiment 1, wherein the inhibitor or antagonist that targets EGF-like domain I within EpEX is an shRNA or siRNA that knocks down the expression of EGFR, AKT, PD-L1 and / or MAPK, and / or the phosphorylation of FOXO3a, and / or increases the expression of HtrA2 and / or the nuclear translocation of FOXO3a. [Embodiment 5] The method according to embodiment 4, wherein the shRNA comprises the nucleotide sequence consisting of GCAAATGGACACAAATTACAA (SEQ ID NO: 1), or a variant that specifically inhibits and / or reduces the expression or activity of EpCAM. [Embodiment 6] The method according to embodiment 1, wherein the inhibitor or antagonist targeting EGF-like domain I in EpEX is a small molecule, peptide, antibody or antibody fragment capable of partially or completely blocking EpCAM activity. [Embodiment 7] The method according to embodiment 1, wherein the inhibitor or antagonist targeting EGF-like domain I in EpEX is an EpCAM neutralizing antibody. [Embodiment 8] The method according to embodiment 7, wherein the antibody is EpAb2-6 or a variant capable of neutralizing EpCAM. [Embodiment 9] A method for treating, inhibiting or removing cancer in a subject, comprising administering to a subject in need thereof an effective amount of an inhibitor or antagonist targeting EGF-like domain I in EpEX, and an inhibitor or antagonist targeting PD-L1 in an amount effective to inhibit the expression or activation of PD-L1. [Embodiment 10] The method according to embodiment 9, wherein the inhibitor or antagonist targeting PD-L1 is a PD-L1 checkpoint inhibitor. [Embodiment 11] The method according to embodiment 10, wherein the PD-L1 checkpoint inhibitor is MEDI4736, atezolizumab, avelumab or durvalumab. [Embodiment 12] The method according to embodiment 9, wherein the inhibitor or antagonist targeting EGF-like domain I in EpEX is administered intermittently, simultaneously, separately or continuously with the inhibitor or antagonist targeting PD-L1. [Embodiment 13] The method according to Embodiment 9, wherein the cancer is melanoma, kidney cancer, prostate cancer, breast cancer, colorectal cancer, lung cancer, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, uterine cancer, fallopian tube carcinoma, endometrial carcinoma, cervical carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, non-Hodgkin's lymphoma, esophageal cancer, small intestine cancer, endocrine system cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, chronic or acute leukemia, central nervous system (CNS) neoplasm, primary CNS lymphoma, tumor angiogenesis, spinal cord axis tumor, brainstem glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid cancer, squamous cell carcinoma or T cell lymphoma. [Embodiment 14] The method according to Embodiment 9, wherein the cancer is EpCAM overexpressing cancer, EGFR overexpressing or activating cancer, AKT overexpressing or overactivating cancer, MAPK overexpressing or activating cancer, FOXO3a inactivating cancer, HtrA2 inactivating cancer or PD-L1 expressing cancer. [Embodiment 15] The method according to Embodiment 9, wherein the cancer is metastatic cancer or advanced cancer. [Embodiment 16] The method according to Embodiment 9, wherein the cancer is metastatic colorectal cancer or small cell lung cancer, or advanced colorectal cancer or small cell lung cancer. [Embodiment 17] The method according to Embodiment 9, wherein the subject has EpCAM overexpression. [Embodiment 18] The method according to Embodiment 9, wherein the subject has been treated with at least one anti-cancer therapy or anti-cancer agent. [Embodiment 19] The method according to Embodiment 9, wherein the EGF-like domain I in EpEX comprises a peptide consisting of amino acids 27-59 of the EGF-like domain, or a variant thereof capable of binding to EGFR. [Embodiment 20] The method according to Embodiment 9, wherein the inhibitor or antagonist targeting the EGF-like domain I in EpEX is a ribozyme, antisense oligonucleotide, short hairpin RNA (shRNA) molecule or small interfering RNA (siRNA) molecule that specifically inhibits and / or reduces the expression or activity of EpCAM. [Embodiment 21] The method according to embodiment 9, wherein an inhibitor or antagonist targeting EGF-like domain I in EpEX is an shRNA or siRNA that knockdowns the expression of EGFR, AKT, PD-L1 and / or MAPK, and / or the phosphorylation of FOXO3a, and / or increases the expression of HtrA2 and / or the nuclear translocation of FOXO3a. [Embodiment 22] The method according to embodiment 21, wherein the shRNA comprises a nucleotide sequence consisting of GCAAATGGACACAAATTACAA (SEQ ID NO: 1), or a variant that specifically inhibits and / or reduces the expression or activity of EpCAM. [Embodiment 23] The method according to embodiment 9, wherein an inhibitor or antagonist targeting EGF-like domain I in EpEX is a small molecule, peptide, antibody or antibody fragment that can partially or completely block EpCAM activity. [Embodiment 24] The method according to embodiment 9, wherein an inhibitor or antagonist targeting EGF-like domain I in EpEX is an EpCAM-neutralizing antibody. [Embodiment 25] The method according to embodiment 24, wherein the antibody is EpAb2-6 or a variant that can neutralize EpCAM.
Claims
1. Use of a combination comprising an effective amount of EpAb2-6 antibody and an amount of a PD-L1 checkpoint inhibitor effective to inhibit the expression or activation of PD-L1 in the manufacture of a medicament for treating, inhibiting or removing cancer in a subject, wherein the PD-L1 checkpoint inhibitor is atezolizumab.
2. The use according to claim 1, wherein the EpAb2-6 antibody is administered intermittently, simultaneously, separately or continuously with the PD-L1 checkpoint inhibitor.
3. The use according to claim 1, wherein the cancer is melanoma, renal cancer, prostate cancer, breast cancer, colorectal cancer, lung cancer, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, cutaneous or uveal malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, gastric cancer, testicular cancer, uterine cancer, fallopian tube carcinoma, endometrial carcinoma, cervical carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, non-Hodgkin lymphoma, esophageal cancer, small intestine cancer, endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, chronic or acute leukemia, central nervous system (CNS) neoplasm, primary CNS lymphoma, tumor angiogenesis, spinal cord axis tumor, brainstem glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid carcinoma, squamous cell carcinoma or T cell lymphoma.
4. The use according to claim 1, wherein the cancer is EpCAM overexpressing cancer, EGFR overexpressing or activating cancer, AKT overexpressing or overactivating cancer, MAPK overexpressing or activating cancer, FOXO3a inactivating cancer, HtrA2 inactivating cancer or PD-L1 expressing cancer.
5. The use according to claim 1, wherein the cancer is metastatic cancer or advanced cancer.
6. The use according to claim 1, wherein the cancer is metastatic colorectal cancer or small cell lung cancer, or advanced colorectal cancer or small cell lung cancer.
7. The use according to claim 1, wherein the subject has EpCAM overexpression.
8. The use according to claim 1, wherein the subject is being treated with at least one anti-cancer therapy or anti-cancer agent.
9. A composition for treating, inhibiting or removing cancer in a subject for use in combination with a PD-L1 checkpoint inhibitor in an amount effective to inhibit the expression or activation of PD-L1, the composition comprising an effective amount of the EpAb2-6 antibody, wherein the PD-L1 checkpoint inhibitor is atezolizumab.
Citation Information
Patent Citations
Anti-epithelial cell adhesion molecule (EpCAM) antibody and method of use thereof
JP2015517982A