Compounds and Methods for Modulating SMN2
By developing compounds that modulate SMN2 RNA splicing to increase full-length SMN2 protein expression, the treatment for spinal muscular atrophy addresses the underlying molecular mechanism, improving muscle strength and respiratory function in SMA patients.
Patent Information
- Application Number
- JP2024027092
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-02-28
- Filing Date
- 2024-02-27
- Publication Date
- 2025-06-20
- Estimated Expiration
- 2041-02-26
AI Technical Summary
Current treatments for spinal muscular atrophy (SMA) do not effectively address the underlying molecular mechanism, leading to inadequate modulation of SMN2 RNA and insufficient alleviation of symptoms such as muscle weakness and respiratory issues.
Development of compounds and pharmaceutical compositions that modulate the splicing of SMN2 RNA, specifically increasing the inclusion of exon 7 and thereby enhancing the expression of full-length SMN2 protein, using oligomeric compounds such as modified oligonucleotides.
The proposed solution effectively increases the expression of full-length SMN2 protein, leading to improved muscle strength, respiratory function, and overall survival rates in SMA patients.
Smart Images

Figure 0007696466000001 
Figure 0007696466000002 
Figure 0007696466000003
Abstract
Description
Technical Field
[0001] Sequence Listing This application has been filed in electronic form together with a sequence listing. The sequence listing is provided as a file entitled BIOL0367WOSEQ_ST25.txt, created on February 26, 2021, with a size of 44 KB. The information in the electronic form of this sequence listing is hereby incorporated by reference in its entirety into this specification.
[0002] Compounds, methods, and pharmaceutical compositions for modulating SMN2 RNA in a cell or subject are provided. Such compounds, methods, and pharmaceutical compositions are useful for alleviating at least one symptom of a neurodegenerative disease. Such symptoms include a decrease in muscle strength; an inability to sit, stand, and / or walk with the back extended, or a decrease in that ability; a decrease in neuromuscular activity; a decrease in the electrical activity of one or more muscles; a decrease in respiration; an inability to eat, drink, and / or breathe without assistance, or a decrease in that ability; a decrease in body weight or a decrease in weight gain; and / or a decrease in survival rate.
Background Art
[0003] Proximal spinal muscular atrophy (SMA) is a hereditary neurodegenerative disease characterized by the loss of spinal motor neurons. SMA is an autosomal recessive disease with early onset and is a major genetic cause of death in infants. Since the severity of SMA varies among patients, it is classified into four types. Type I SMA is the most severe form, which develops at birth or within 6 months and usually results in death within 2 years. Children with type I SMA cannot sit or walk. Type II SMA is an intermediate form, and patients can sit but cannot stand or walk. Patients with type III SMA, a chronic disease, usually develop SMA at 18 months after birth (Lefebvre et al., Hum. Mol. Genet., 1998, 7, 1531-1536). Type IV SMA is a milder form and usually develops after 18 years of age, and in some cases, after 10 years of age. Patients with type IV SMA have limited mild motor impairments, can walk in adulthood, and generally have no problems with breathing or nutrition (Farrar et al., Ann. Neurol, 2017, 81, 355-368; D’Amico et al., Orphanet J. of Rare Diseases, 2011, 6:71).
[0004] The molecular mechanism of SMA is the loss of both copies of the survival motor neuron 1 (SMN1) gene, also known as the SMN telomeric type, which encodes a protein that is part of a multi-protein complex thought to be involved in snRNP biogenesis and recycling. A nearly identical gene, SMN2, may also be known as the SMN centromeric type, is present in a duplicated region of chromosome 5q13, and modulates disease severity. Although SMN1 and SMN2 may encode the same protein, normal SMN1 gene expression results in the expression of only the full-length survival motor neuron (SMN) protein, while SMN2 gene expression results in two different protein forms, the full-length SMN2 protein, and a truncated SMN2 protein, the SMNΔ7 protein. SMN2 contains a translational non-coding mutation at position +6 of exon 7, so exon 7 is inefficiently included in the SMN2 transcript. Thus, the major form of SMN2 is a truncated form lacking the unstable and inactive exon 7 (Cartegni and Krainer, Nat. Genet., 2002, 30, 377-384). SMN2 gene expression results in approximately 10-20% of the full-length SMN protein and 80-90% of the unstable / non-functional SMNΔ7 protein. The SMN protein plays a well-established role in spliceosome assembly and may also mediate mRNA transport at the axon and nerve terminal.
[0005] It is an object of the present invention to provide compounds, methods, and pharmaceutical compositions for treating SMA.
Summary of the Invention
[0006] Compounds, methods, and pharmaceutical compositions for modulating the splicing of SMN2 RNA in a cell or subject are provided. In certain embodiments, the compounds useful for modulating the splicing of SMN2 RNA are oligomeric compounds. In certain embodiments, the oligomeric compounds increase the amount of SMN2 RNA that includes exon 7. In certain embodiments, the oligomeric compounds increase the expression of full-length SMN2 protein. In certain embodiments, the oligomeric compounds include modified oligonucleotides. In certain embodiments, the subject is a neurodegenerative disease. In certain embodiments, the subject is spinal muscular atrophy (SMA).
[0007] Methods useful for alleviating at least one symptom of a neurodegenerative disease are also provided. In certain embodiments, the neurodegenerative disease is SMA. In certain embodiments, the symptoms include: decreased muscle strength; inability to sit, stand, and / or walk with the back straight, or a decrease in that ability; decreased neuromuscular activity; decreased electrical activity of one or more muscles; decreased respiration; inability to eat, drink, and / or breathe without assistance, or a decrease in that ability; weight loss or decreased weight gain; and / or decreased survival rate. In certain embodiments, modified oligonucleotides for treating SMA are provided herein.
Best Mode for Carrying Out the Invention
[0008] It should be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. As used herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of "or" means "and / or" unless otherwise specified. Further, the use of the term "including" and other forms such as "includes" and "included" are not restrictive. Also, terms such as "element" or "component" include both elements and components that include one unit and elements and components that include two or more subunits unless specifically stated otherwise.
[0009] The headings of the sections used in this specification are for structural purposes only and are not to be construed as limiting the subject matter of the invention described. All documents, or portions of documents, cited in this specification, including, but not limited to, patents, patent applications, articles, books, papers, and GenBank and NCBI reference sequence records, are hereby expressly incorporated by reference in their entirety for the part of the documents considered in this specification and for all of them.
[0010] Definitions Unless otherwise specified, the nomenclature, procedures, and techniques used in connection with analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described in this specification are well known and commonly used in the art. All patents, patent applications, patent application publications, and other publications and other data referred to throughout this disclosure, if admitted, are hereby incorporated by reference in their entirety.
[0011] Unless otherwise indicated, the following terms have the following meanings.
[0012] As used herein, "2'-deoxynucleoside" means a nucleoside containing a 2'-H(H) deoxyribosyl sugar moiety. In certain embodiments, the 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside and contains a 2'-β-D-deoxyribosyl sugar moiety having a β-D configuration as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, the 2'-deoxynucleoside may contain a modified nucleobase or may contain an RNA nucleobase (uracil). xynucleoside is a 2'-β-D-deoxynucleoside and contains a 2'-β-D-deoxyribosyl sugar moiety having a β-D configuration as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, the 2'-deoxynucleoside may contain a modified nucleobase or may contain an RNA nucleobase (uracil).
[0013] As used herein, "2'-MOE" means a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of the ribosyl sugar moiety. "2'-MOE sugar moiety" means a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of the ribosyl sugar moiety. Unless otherwise specified, the 2'-MOE sugar moiety is in the β-D configuration. "MOE" means O-methoxyethyl.
[0014] As used herein, "2'-MOE nucleoside" means a nucleoside containing a 2'-MOE sugar moiety.
[0015] As used herein, "2'-NMA" means an -O-CH2-C(=O)-NH-CH3 group in place of the 2'-OH group of the ribosyl sugar moiety. "2'-NMA sugar moiety" means a 2'-O-CH2-C(=O)-NH-CH3 group having a sugar moiety in place of the 2'-OH group of the ribosyl sugar moiety. Unless otherwise specified, the 2'-NMA sugar moiety is in the β-D configuration. "NMA" means O-N-methylacetamide.
[0016] As used herein, "2'-NMA nucleoside" means a nucleoside containing a 2'-NMA sugar moiety.
[0017] As used herein, "2'-OMe" means a 2'-OCH3 group in place of the 2'-OH group of the ribosyl sugar moiety. "2'-OMe sugar moiety" means a 2'-OCH3 group in place of the 2'-OH group of the ribosyl sugar moiety. Unless otherwise specified, the 2'-OMe sugar moiety is in the β-D configuration. "OMe" means O-methyl.
[0018] As used herein, "2'-OMe nucleoside" means a nucleoside containing a 2'-OMe sugar moiety.
[0019] As used herein, "2'-substituted nucleoside" means a nucleoside containing a 2'-substituted sugar moiety. As used herein with respect to the sugar moiety, "2'-substituted" means a sugar moiety containing at least one 2'-substituent other than H or OH.
[0020] As used herein, "5-methylcytosine" means cytosine modified with a methyl group attached to the 5-position. 5-Methylcytosine is a modified nucleobase.
[0021] As used herein, "administer" means to give a pharmaceutical to a subject.
[0022] As used herein, "remission" in the context of treatment means that at least one symptom improves compared to the same symptom in the absence of that treatment. In certain embodiments, remission is a decrease in the severity or frequency of a symptom, or a delay in the onset or progression of the severity or frequency of a symptom. In certain embodiments, the symptom is a decrease in muscle strength; an inability to sit, stand, and / or walk with the back straight, or a decrease in that ability; a decrease in neuromuscular activity; a decrease in the electrical activity of one or more muscles; a decrease in respiration; an inability to eat, drink, and / or breathe without assistance, or a decrease in that ability; a decrease in body weight or a decrease in weight gain; and / or a decrease in survival rate.
[0023] As used herein, "antisense activity" means any detectable and / or measurable change in the target nucleic acid due to hybridization of an antisense compound thereto. As used herein, "antisense compound" means an oligomeric compound or oligomeric duplex capable of obtaining at least one antisense activity.
[0024] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside containing a bicyclic sugar moiety.
[0025] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" means a modified sugar moiety containing two rings, wherein the second ring is formed via a bridge connecting two atoms within the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the furanosyl moiety is a ribosyl moiety. In certain embodiments, the bicyclic sugar moiety does not contain a furanosyl moiety.
[0026] As used herein, "cerebrospinal fluid" or "CSF" means the liquid that fills the space around the brain and spinal cord. "Artificial cerebrospinal fluid" or "aCSF" means a prepared or manufactured liquid having certain properties of cerebrospinal fluid.
[0027] As used herein, "cEt" means a 4'-to-2' bridge in place of the 2'-OH group of the ribosyl sugar moiety, the bridge having the formula 4'-CH(CH3)-O-2', and the bridging methyl group being in the S configuration. "cEt sugar moiety" is a bicyclic sugar moiety having a 4'-to-2' bridge in place of the 2'-OH group of the ribosyl sugar moiety, the bridge being 4'-CH(CH3)-O-2', and the bridging methyl group being in the S configuration. "cEt" means constrained ethyl.
[0028] As used herein, "cEt nucleoside" means a nucleoside containing a cEt sugar moiety.
[0029] As used herein, "chiral enriched population" means a population of a plurality of molecules of the same molecular formula, wherein the number or ratio of molecules within the population having a specific stereochemical configuration at a specific chiral center is greater than the number or ratio of molecules that would be expected to have the same specific stereochemical configuration at the same specific chiral center within the population if that specific chiral center were stereorandom. A chiral enriched population of molecules having multiple chiral centers within each molecule may include one or more stereorandom chiral centers. In certain embodiments, the molecule is a modified oligonucleotide. In certain embodiments, the molecule is a compound containing a modified oligonucleotide.
[0030] As used herein with respect to an oligonucleotide, "complementary" means that at least 70% of the nucleobases of the oligonucleotide or one or more portions thereof can hydrogen bond to the nucleobases of another nucleic acid or one or more portions thereof when the nucleobase sequences of the oligonucleotide and the other nucleic acid are aligned in opposite directions. Complementary nucleobases mean nucleobases that can form hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G). Complementary oligonucleotides and / or target nucleic acids need not have complementary nucleobases at each respective nucleoside. Rather, some mismatches are tolerated. As used herein with respect to an oligonucleotide or a portion thereof, "fully complementary" or "100% complementary" means that the oligonucleotide or a portion thereof is complementary to another oligonucleotide or target nucleic acid with each respective nucleobase of the shorter of the two oligonucleotides, or if the oligonucleotides are of the same length, with each respective nucleoside.
[0031] As used herein in connection with an oligonucleotide, "contiguous" refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are directly adjacent to each other. For example, "contiguous nucleobases" means nucleobases that are directly adjacent to each other in a sequence.
[0032] As used herein, "hybridization" means complementary pairing or annealing to an oligonucleotide and / or nucleic acid. Although not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which can be Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonds between complementary nucleobases.
[0033] As used herein, "internucleoside linkage" means a covalent bond between consecutive nucleosides in an oligonucleotide. As used herein, "modified internucleoside linkage" means any internucleoside linkage other than a phosphodiester internucleoside linkage. "Phosphorothioate internucleoside linkage" is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced by a sulfur atom.
[0034] As used herein, "mismatch" or "non-complementarity" means a nucleobase of a first oligonucleotide that is not complementary to the corresponding nucleobase of a second oligonucleotide or a target nucleic acid when the first and second oligomeric compounds are aligned.
[0035] As used herein, "motif" means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.
[0036] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety having modifications such as substituents that do not form a bridge between two atoms of the sugar to form a second ring. As used herein, "nucleobase" means an unmodified nucleobase or a modified nucleobase. As used herein, "unmodified nucleobase" includes adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, "modified nucleobase" is a moiety other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleobase. "5-Methylcytosine" is one of the modified nucleobases. A universal base is a nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, "nucleobase sequence" means the order of consecutive nucleobases in a target nucleic acid or oligonucleotide, regardless of any sugar or internucleoside linkage modifications.
[0037] As used herein, "nucleoside" means a compound containing a nucleobase and a sugar moiety. The nucleobase and the sugar moiety may each independently be unmodified or modified. As used herein, "modified nucleoside" means a nucleoside containing a modified nucleobase and / or a modified sugar moiety. As used herein, "linked nucleosides" means nucleosides that are linked in a continuous sequence (i.e., there are no additional nucleosides between the linked nucleosides).
[0038] As used herein, "oligomeric compound" means an oligonucleotide and, optionally, one or more additional features such as a conjugate group or a terminal group. The oligomeric compound may or may not pair with a second oligomeric compound that is complementary to the first oligomeric compound. A "single-stranded oligomeric compound" is an oligomeric compound that is not paired. The term "oligomeric duplex" means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of the oligomeric duplex may be referred to as a "duplex oligomeric compound". chain may be referred to as a "duplex oligomeric compound".
[0039] As used herein, "oligonucleotide" means a chain of linked nucleosides joined via internucleoside linkages, where each nucleoside and internucleoside linkage may or may not be modified. Unless otherwise indicated, an oligonucleotide is composed of 8 to 50 linked nucleosides. As used herein, "modified oligonucleotide" means an oligonucleotide in which at least one nucleoside or internucleoside linkage is modified. As used herein, "unmodified oligonucleotide" means an oligonucleotide that does not contain any nucleoside modifications or internucleoside modifications.
[0040] As used herein, "pharmaceutical composition" means a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition can contain an oligomeric compound and a sterile aqueous solution.
[0041] As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for use in administration to a subject. Certain such carriers enable the formulation of pharmaceutical compositions as, for example, pills, tablets, dragees, capsules, solutions, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In certain embodiments, the pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer, or sterile artificial cerebrospinal fluid.
[0042] As used herein, "pharmaceutically acceptable salt" means a physiologically and pharmaceutically acceptable salt of a compound. A pharmaceutically acceptable salt retains the desired biological activity of the parent compound and does not impart undesirable toxicological effects to the parent compound.
[0043] As used herein, "RNA" means an RNA transcript and includes mRNA precursors and mature mRNA unless otherwise specified.
[0044] As used herein in the context of a molecular population of the same molecular formula, "stereorandom chiral center" means a chiral center having a random stereochemical configuration. For example, in a molecular population containing stereorandom chiral centers, the number of molecules having a stereorandom chiral center in the (S) configuration may be the same as the number of molecules having a stereorandom chiral center in the (R) configuration, but is not necessarily the same. The stereochemical configuration of a chiral center is considered random if it is the result of a synthetic method not designed to control the stereochemical configuration. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate nucleoside internucleoside linkage.
[0045] As used herein, "subject" means a human or non-human animal.
[0046] As used herein, "sugar moiety" means an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" means a 2'-OH(H)β-D-ribosyl moiety (the "unmodified RNA sugar moiety") as found in RNA, or a 2'-H(H)β-D-deoxyribosyl sugar moiety (the "unmodified DNA sugar moiety") as found in DNA. The unmodified sugar moiety has one hydrogen at each of the 1', 3' and 4' positions, one oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" means a modified furanosyl sugar moiety or a sugar substitute.
[0047] As used herein, "sugar substitute" means a modified sugar moiety having other than a furanosyl moiety to which a nucleobase can be attached to another group such as, for example, an internucleoside linkage, a conjugate group, or a terminal group in an oligonucleotide. Modified nucleosides containing a sugar substitute can be incorporated at one or more positions within an oligonucleotide, and such oligonucleotides can hybridize to a complementary oligomeric compound or a target nucleic acid. As used herein, "standard in vivo assay" means the assay described in Example 2 and reasonable variations thereof.
[0048] As used herein, "symptom" means any physical feature or test result indicating the presence or extent of a disease or disorder. In certain embodiments, the symptom is apparent to the subject or a medical professional examining or testing the subject.
[0049] As used herein, "target nucleic acid" means a nucleic acid to which an antisense compound is designed to affect.
[0050] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
[0051] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
[0052] As used herein, "terminal group" means a chemical group or atomic group that covalently binds to the end of an oligonucleotide.
[0053] As used herein, "therapeutically effective amount" means the amount of an agent that produces a therapeutic effect in a subject. For example, a therapeutically effective amount improves the symptoms of a disease.
[0054] Specific embodiments The present disclosure provides each of the following non-limiting numbered embodiments.
[0055] Embodiment 1. An oligomeric compound comprising a modified oligonucleotide, wherein the modified oligonucleotide consists of 16, 17, 18, 19 or 20 linked nucleosides and has at least 15 or at least 16 consecutive nucleobases of any one of the nucleobase sequences of SEQ ID NOs: 20 to 50, and the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
[0056] Embodiment 2. An oligomeric compound comprising a modified oligonucleotide, wherein the modified oligonucleotide consists of 17, 18, 19 or 20 linked nucleosides and has at least 15, at least 16 or at least 17 consecutive nucleobases of any one of the nucleobase sequences of SEQ ID NOs: 20 to 27, 29 to 30 or 32 to 50, and the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
[0057] An oligomeric compound comprising a modified oligonucleotide, which consists of 3.18, 19 or 20 linked nucleosides and has a nucleobase sequence containing at least 15, at least 16, at least 17 or at least 18 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 20-27, 30 or 33-50, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage, said oligomeric compound.
[0058] Embodiment 4. Consisting of 19 or 20 linked nucleosides and having a nucleobase sequence containing at least 15, at least 16, at least 17, at least 18 or at least 19 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 20, 22, 24-27, 30, 33-50, said oligomeric compound comprising a modified oligonucleotide, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage, said oligomeric compound.
[0059] Embodiment 5. Consisting of 20 linked nucleosides and having a nucleobase sequence containing at least 15, at least 16, or at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 20, 22, 25, 27, 35, 39-46 or 49, said oligomeric compound comprising a modified oligonucleotide, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage, said oligomeric compound.
[0060] Embodiment 6. When measured over the entire nucleic acid base sequence of the modified oligonucleotide, the modified oligonucleotide has a nucleic acid base sequence that is at least 80%, 85%, 87.5%, 88.2%, 89%, 89.4%, 90%, 93.7%, 94%, 94.7%, 95% or 100% complementary to the nucleic acid base sequence of SEQ ID NO: 1. The oligomeric compound according to any one of Embodiments 1 to 5.
[0061] Embodiment 7. The modified oligonucleotide is sosososssssssssssss, ssosssssssssssoss, ssosssssosssssoss, ssosssosssosssoss, soossssssssssooss, sooosssssssssooss, sooossssssssoooss, ssssssssooosssssss, ssossssssssssssss, sssssossssssssssss, sssssssossssssssss, sssssssssossssssss, sssssssssssossssss, sssssssssssssossss, sssssssssssssssoss, sossssssssssssoss, sosssssssssosssss, sosssssssosssssss, sosssssosssssssss, sosssosssssssssss, sssssosssssssssoss, sssssssosssssssoss, sssssssssosssssoss, sssssssssssosssoss, sssssssssssssososs, soossssssssssssss, sssoossssssssssss, ssssssoossssssssss, ssssssssoossssssss, ssssssssssoossssss, ssssssssssssoossss, ssssssssssssssooss, ssssssssoooossssss, ssoooosssssssssss, ssssoooosssssssss, sssssssssoooosssss, ssssssssssoooosss, ssssssssssssooooss, sssssssooooossssss, sssssssoooooosssss, soooosssssssoooss, ssssssooooooosssss, sssssssssssssssoss, sssssssssssssosss, ssssssssssssssooss, sssssssssssssososs, ssssssssssssosssss, ssssssssssssososss, sssssssssssossosss, ssssssssssosssssss, ssssssssssosssosss, sssssssssosssssoss, sssssssssossssosss, ssssssssosssssssss,sssssssoossssssss, sssssosssssssssss, sssosssssssssssss, sosssssssssssssss, sossssssossssssss, soossssssssssssss, osssssssssssssssssso, sssssssssssssssssoo, sssssssssssssssssoss, ssssssssssssssssooss, sssssssssssssssososs, sssssssssosssssssss, sssssssssossssssoss, ssssssssoosssssssss, sosssssssssssssssss, , selected from sossssssssssssssoss, sosssssssosssssssss, sososssssssssssssss, soossssssssssssssss, sssssssssssssssss, sssssssssssssssssso, ossssssssssssssssss, sssssssssososso, ssssssssssssoss, ssssssssssososs, sssssssosssssssss, sssssssossssssoss, sossssssssssssssss, sosssssssssssssoss, sossssssosssssssss, sosossssssssssssss, ssssssssssooooss, ssssssssoooossss, ssssssssooossssss, ssssssoooossssss, ssssssooooosssss, ssssssoooooosssss, ssssssooooooossss, ssssoooossssssss, ssossssssssssoss, ssosssssossssoss, ssosssosssossoss, ssossossossososs, ssososososososss, ssoooossssssssss, soosssssssssooss, sooossssssssooss, sooosssssssoooss, soooossssssoooss, ssssssssssooooss, sssssssssoooosss, ssssssooossssss, ssssssoooosssss, ssssssooooosssss, ssssssoooooossss, ssssoooosssssss, ssssooooooossss, sssosssosssosss, ssosssssssssoss, ssossossossosss, ssossossosososs, ssososososososs, ssoooosssssssss, soossssssssooss, sooosssssssooss, sooossssssoooss, and soooosssssoooss, having a nucleoside internucleoside linkage motif (5' to 3'), where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage,The oligomeric compound according to any one of Embodiments 1 to 6.
[0062] Embodiment 8. The modified oligonucleotide has a internucleoside linkage motif selected from sssssssssssssssxs and sssssssssssssssssx, where "s" represents a phosphorothioate internucleoside linkage, "o" represents a phosphodiester internucleoside linkage, and "x" represents a methoxypropylphosphonate internucleoside linkage, the oligomeric compound according to any one of Embodiments 1 to 6.
[0063] Embodiment 9. The modified oligonucleotide has a internucleoside linkage motif selected from zzzzzzzzzzzzzzzzzz, sssssssssszzzzzz, sssszzzzzzssssss, zzoooooooooooooozz, zzzzoooooooooooozz, zzzzzooooooooozz, zzzzzzzooooooozz and ssoooooooooooooss, where "s" represents a phosphorothioate internucleoside linkage, "o" represents a phosphodiester internucleoside linkage, and "z" represents a mesylphosphoramidate internucleoside linkage, the oligomeric compound according to any one of Embodiments 1 to 6.
[0064] Embodiment 10. The modified oligonucleotide is eeeeeeeeeeeeeeeeeeeee, eeeeeeeeeeeeeeeeeeee, eeeeeeeeeeeeeeeeeee, eeeeeeeeeeeeeeeeee, eeeeeeeeeeeeeeeee, nnnnnnnnnnnnnnnnn, nnnnnnnnnnnnnnnnnn, nnnnnnnnnnnnnnnnnnn, nnnnnnnnnnnnnnnnnnnn, nnnnnnnnnnnnnnnnnnnnn, nennnnneneennnnnnn, nnnnnnnnnnnenneen, nennnnneneenenneen, nnnnnnnnnnnnnnnnnnne, nnnnnnnnnnnnnnnnnnnd, nnnnnnnnn nnnnnnnny, nnnnnnnnnnnnnnnnnndd, nnnnnnnnnnnnnnnnnned, nnnnnnnnnnnnnnnnnnde, nnnnnnnnnnnnnnnnnee, eeeeeeeeeeeeeeeeeedd, eeeeeeeeeeeeeeeeeeeed, eeeeeeeeeeeeeeeeeeede, nnnnnnnnnnnnnnnnnnd, nnnnnnnnnnnnnnnnnne, eeeeeeeeeeeeeeeeeeed, keekeekeekeekeeeek, keeekeeekeeekeeeek, keeeeekeeeeekeeeek, keeeeeeekeeeeeeeek, keeeeeeeeeeeeeeeek, eeekeekeekeekeekek, eeekeekeekeekeekee, eeeeeeekeekeekeekee, eeeeeeekeekeekeeeee, eeeeeeekeeeeekeeeee, keekeekeekeeeeeeee, eeeeeeeeekeekeekeek, keekeekeeeeeeeeeee, eeeeeeeeeeeekeekeek, keekeeeeeeeeeeeeee, eeeeeeeeeeeeeeekeek, keekeekeekeekeeek, keeeekeeekeeekeeek, keeeekeeeeekeeeek, keeeeeeekeeeeeeek,keeeeeeeeeeeeeeek, eekeekeekeekeekek, eekeekeekeekeekee, eeeeeekeekeekeekee, eeeeeekeekeekeeeee, eeeeeekeeeeekeeeee, keekeekeekeeeeeee, eeeeeeeekeekeekeek, keekeekeeeeeeeeee, eeeeeeeeeeekeekeek, keekeeeeeeeeeeeee, eeeeeeeeeeeeeekeek, keekeekeekeekeek, keeeekeeekeeekeek, keeeekeeeekeeeek, keeeeeeekeeeeeek, keeeeeeeeeeeeeek, kekeekeekeekeeke, eekeekeekeekeeke, eeeeeekeekeekeeke, eeeeeekeekeekeeee, eeeeeekeeeeekeeee, keekeekeekeeeeee, eeeeeeekeekeekeek, keekeekeeeeeeeee, eeeeeeeeeekeekeek, keekeeeeeeeeeeee, eeeeeeeeeeeeekeek, eeeeeeeeeeeeeeeeeeed, eeeeeeeeeeeeeeeeeeey, ennnnnnnnnnnnnnnnnn, and ennnnnnnnnnnnnnnnne, where the sugar moiety motif (from 5' to 3') is selected, where "e" represents a 2'-MOE sugar moiety, "n" represents a 2'-NMA sugar moiety, "k" represents a cEt sugar moiety, "d" represents a 2'-β-D-deoxyribosyl sugar moiety, and "y" represents a 2'-OMe sugar moiety, an oligomeric compound of any of Embodiments 1 to 9.,
[0065] Embodiment 11. The modified oligonucleotide has a sugar motif (from 5' to 3') selected from nnnnnnnnnnnnnnenn and nnnnnnnnnnnnnnnen, where "e" represents a 2'-MOE sugar moiety and "n" represents a 2'-NMA sugar moiety, an oligomeric compound of any of Embodiments 1 to 9.,
[0066] Embodiment 12. An oligomeric compound according to any one of Embodiments 1 to 9, wherein the modified oligonucleotide has a sugar motif of qqnqqqqqnqnnqnqqnn (from 5' to 3'), each "n" represents a 2'-NMA sugar moiety, and each "q" is independently selected from a 2'-O-(N,N-dimethyl)acetamide sugar moiety, a 2'-O-(N-ethyl)acetamide sugar moiety, a 2'-O-(N-propyl)acetamide sugar moiety, a 2'-O-(N-cyclopropyl)acetamide sugar moiety, and a 2'-O-(N-cyclopropylmethyl)acetamide sugar moiety.
[0067] Embodiment 13. An oligomeric compound according to any one of Embodiments 1 to 9, wherein the modified oligonucleotide contains at least one modified sugar moiety.
[0068] Embodiment 14. The oligomeric compound of Embodiment 13, wherein the modified oligonucleotide contains at least one bicyclic sugar moiety.
[0069] Embodiment 15. The oligomeric compound of Embodiment 14, wherein the bicyclic modified sugar moiety has a 4'-2' bridge, and the 4'-2' bridge is selected from -CH2-O- and -CH(CH3)-O-.
[0070] Embodiment 16. The oligomeric compound of Embodiment 13, wherein the modified oligonucleotide contains at least one non-bicyclic modified sugar moiety.
[0071] Embodiment 17. The oligomeric compound of Embodiment 16, wherein the non-bicyclic modified sugar moiety is any one of a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, a 2'-OMe sugar moiety, or a 2'-F sugar moiety.
[0072] Embodiment 18. The oligomeric compound of Embodiment 13, wherein the modified oligonucleotide contains at least one sugar substitute.
[0073] Embodiment 19. The oligomeric compound of Embodiment 18, wherein the sugar substitute is any one of morpholino, modified morpholino, PNA, THP, and F-HNA.
[0074] Embodiment 20. An oligomeric compound according to any one of Embodiments 1 to 6 and 10 to 19, wherein the modified oligonucleotide contains at least one modified internucleoside linkage.
[0075] Embodiment 21. An oligomeric compound according to Embodiment 20, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.
[0076] Embodiment 22. An oligomeric compound according to Embodiment 20 or Embodiment 21, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.
[0077] Embodiment 23. An oligomeric compound according to any one of Embodiments 1 to 20 or 22, wherein the modified oligonucleotide contains at least one phosphodiester internucleoside linkage.
[0078] Embodiment 24. An oligomeric compound according to any one of Embodiments 20, 22 or 23, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.
[0079] Embodiment 25. An oligomeric compound according to any one of Embodiments 13 to 19, wherein the modified oligonucleotide has an internucleoside linkage motif (5' to 3') selected from sososssssssssssss, soossssssssssssss, sosssosssssssssss, sosssssosssssssss, sosssssssosssssss, sssoossssssssssss, sssssssoossssssss, ssssssssssoossssss, and ssssssssssssoossss, where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage.
[0080] Embodiment 26. An oligomeric compound according to any one of Embodiments 1 to 25, wherein the modified oligonucleotide contains a modified nucleobase.
[0081] Embodiment 27. The oligomeric compound according to Embodiment 26, wherein the modified nucleobase is 5-methylcytosine.
[0082] Embodiment 28. The oligomeric compound according to any one of Embodiments 1 to 27, wherein the modified oligonucleotide consists of 16, 17, 18, 19 or 20 linked nucleosides.
[0083] Embodiment 29. The oligomeric compound according to any one of Embodiments 1 to 28, wherein the modified oligonucleotide contains 1 or 2 non-complementary nucleobases.
[0084] Embodiment 30. The oligomeric compound according to any one of Embodiments 1 to 29, wherein the modified oligonucleotide contains 1 or 2 cleavable moieties.
[0085] Embodiment 31. The oligomeric compound according to Embodiment 30, wherein the cleavable moiety is a phosphodiester nucleoside internucleoside linkage.
[0086] Embodiment 32. The oligomeric compound according to any one of Embodiments 1 to 31, consisting of the modified oligonucleotide.
[0087] Embodiment 33. The oligomeric compound according to any one of Embodiments 1 to 32, wherein the oligomeric compound is a single-stranded oligomeric compound.
[0088] Embodiment 34. The following chemical notation: m C es A eo m C es T eo T es T es m C es A es T es A es A es T es G es m C es T es G es Ges m C e A modified oligonucleotide (SEQ ID NO: 21) by, where A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage, the oligomeric compound comprising the modified oligonucleotide.
[0089] Embodiment 35. The following chemical notation: T eo T es m C es A es m C es T es T es T es m C es A es T es A es A es T es G es m C es T es G es G eo m C e A modified oligonucleotide (SEQ ID NO: 22) by, where A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, s is a phosphorothioate internucleoside linkage, An oligomeric compound comprising the modified oligonucleotide, wherein o is a phosphodiester nucleoside internucleoside linkage.
[0090] Embodiment 36. The following chemical notation: T eo T ns m C ns A ns m C ns T ns T ns T ns m C ns A ns T ns A ns A ns T ns G ns m C ns T ns G ns G no m C e The modified oligonucleotide according to (SEQ ID NO: 22), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, n is a 2'-NMA sugar moiety, s is a phosphorothioate nucleoside internucleoside linkage, o is a phosphodiester nucleoside internucleoside linkage. An oligomeric compound comprising the modified oligonucleotide.
[0091] Embodiment 37. The following chemical notation: m C ns A no m C ns T no T ns T ns m C ns A ns T ns A ns Ans T ns G ns m C ns T ns G ns G ns m C n A modified oligonucleotide (SEQ ID NO: 21) by, wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, n is a 2'-NMA sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage, an oligomeric compound comprising said modified oligonucleotide.
[0092] Embodiment 38. The following chemical structure:
Chemical formula
[0093] Embodiment 39. The modified oligonucleotide of Embodiment 38, which is a sodium salt or a potassium salt.
[0094] Embodiment 40. The following chemical structure:
Chemical formula
[0095] Embodiment 41. The following chemical structure:
Chemical formula
[0096] The modified oligonucleotide of Embodiment 41, which is a sodium salt or a potassium salt.
[0097] Embodiment 43. The following chemical structure:
Chemical formula
[0098] Embodiment 44. The following chemical structure:
Chemical formula
[0099] Embodiment 45. The modified oligonucleotide of Embodiment 44, which is a sodium salt or a potassium salt.
[0100] Embodiment 46. The following chemical structure:
Chemical formula
[0101] Embodiment 47. The following chemical structure:
Chemical formula
[0102] Embodiment 48. The modified oligonucleotide of Embodiment 47, which is a sodium salt or a potassium salt.
[0103] Embodiment 49. The following chemical structure:
Chemical formula
[0104] Pharmaceutical composition comprising an oligomer compound according to any one of Embodiments 1 to 36 or a modified oligonucleotide according to any one of Embodiments 38 to 49, and a pharmaceutically acceptable carrier or diluent.
[0105] Embodiment 51. The pharmaceutical composition according to Embodiment 50, comprising a pharmaceutically acceptable diluent, wherein the pharmaceutically acceptable diluent is artificial CSF (aCSF) or PBS.
[0106] Embodiment 52. The pharmaceutical composition according to Embodiment 51, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and artificial CSF (aCSF).
[0107] Embodiment 53. The pharmaceutical composition according to Embodiment 51, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and PBS.
[0108] Embodiment 54. A chiral enriched population of modified oligonucleotides according to any one of Embodiments 38 to 49, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate nucleoside internucleoside linkage having a specific stereochemical configuration.
[0109] Embodiment 55. The chiral enriched population according to Embodiment 54, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate nucleoside internucleoside linkage having an (Sp) configuration.
[0110] Embodiment 56. The chiral enriched population according to Embodiment 54, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate nucleoside internucleoside linkage having an (Rp) configuration.
[0111] Embodiment 57. The chiral enriched population according to Embodiment 54, wherein the population is enriched for modified oligonucleotides having a specific independently selected stereochemical configuration for each phosphorothioate nucleoside internucleoside linkage.
[0112] Embodiment 58. The chiral enriched population of Embodiment 57, wherein the population is enriched for a modified oligonucleotide having an (Sp) configuration at each phosphorothioate internucleoside linkage or for a modified oligonucleotide having an (Rp) configuration at each phosphorothioate internucleoside linkage.
[0113] Embodiment 59. The chirally enriched population of Embodiment 57, wherein the population is enriched for a modified oligonucleotide having an (Rp) configuration at one specific phosphorothioate internucleoside linkage and an (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.
[0114] Embodiment 60. The chiral enriched population of Embodiment 57, wherein the population is enriched for a modified oligonucleotide having at least three consecutive phosphorothioate internucleoside linkages with (Sp), (Sp), and (Rp) configurations in the 5' to 3' direction.
[0115] Embodiment 61. A population of modified oligonucleotides according to any of Embodiments 38 to 49, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.
[0116] Embodiment 62. A method of treating a disease associated with SMN1 or SMN2, comprising administering to a subject having or at risk of developing a disease associated with SMN1 or SMN2 a therapeutically effective amount of a pharmaceutical composition according to any of Embodiments 50 to 53, thereby treating the disease associated with SMN1 or SMN2.
[0117] Embodiment 63. The method of Embodiment 62, wherein the disease associated with SMN1 or SMN2 is a neurodegenerative disease.
[0118] Embodiment 64. The method of Embodiment 63, wherein the neurodegenerative disease is spinal muscular atrophy (SMA).
[0119] Embodiment 65. The method of Embodiment 64, wherein the SMA is any one of type I SMA, type II SMA, type III SMA, or type IV SMA.
[0120] Embodiment 66. The method of Embodiment 64 or Embodiment 65, wherein at least one symptom of SMA is alleviated.
[0121] Embodiment 67. The symptoms are a decrease in muscle strength; the inability to sit, stand, and / or walk with the back extended, or a decrease in that ability; a decrease in neuromuscular activity; a decrease in the electrical activity of one or more muscles; a decrease in respiration; the inability to eat, drink, and / or breathe without assistance, or a decrease in that ability; a decrease in body weight or a decrease in weight gain; and / or a decrease in survival rate. The method of Embodiment 66.
[0122] Embodiment 68. The method of any one of Embodiments 62 - 67, wherein the pharmaceutical composition is administered to the central nervous system or systemically.
[0123] Embodiment 69. The method of Embodiment 68, wherein the pharmaceutical composition is administered to the central nervous system and systemically.
[0124] Embodiment 70. The method of any one of Embodiments 62 - 67, wherein the pharmaceutical composition is administered intrathecally, systemically, subcutaneously, or intramuscularly.
[0125] Embodiment 71. A method for increasing SMN2 RNA containing exon 7, comprising contacting a cell, tissue, or organ with any oligomeric compound of Embodiments 1 - 37, any modified oligonucleotide of Embodiments 38 - 49, or any pharmaceutical composition of Embodiments 50 - 53.
[0126] Specific oligonucleotide In certain embodiments, provided herein are oligomeric compounds comprising oligonucleotides consisting of linked nucleosides. The oligonucleotides may be unmodified oligonucleotides (RNA or DNA), or may be modified oligonucleotides. Modified oligonucleotides contain at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides contain at least one modified nucleoside (including a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside linkage.
[0127] Certain modified nucleosides Modified nucleosides contain a modified sugar moiety or a modified nucleobase, or both a modified sugar moiety and a modified nucleobase.
[0128] Certain sugar moieties In certain embodiments, the modified sugar moiety is an un bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates may contain one or more substituents corresponding to substituents of other types of modified sugar moieties.
[0129] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety that includes a furanosyl ring having one or more substituents such that none of them crosslink two atoms of the furanosyl ring to form a bicyclic structure. Such non-crosslinking substituents may be at any position of the furanosyl, including but not limited to substituents at the 2′, 4′, and / or 5′ positions. In certain embodiments, one or more of the non-crosslinking substituents of the non-bicyclic modified sugar moiety are branched. Examples of suitable 2′-substituents for the non-bicyclic modified sugar moiety include, but are not limited to, 2′-F, 2′-OCH3 (“OMe” or “O-methyl”), and 2′-O(CH2)2OCH3 (“MOE” or “O-methoxyethyl”), and 2′-O-N-alkylacetamides, such as 2′-O-N-methylacetamide (“NMA”), 2′-O-N-dimethylacetamide, 2′-O-N-ethylacetamide, or 2′-O-N-propylacetamide. See, for example, U.S. Patent No. 6,147,200, Prakash et al., 2003, Org. Lett., 5, 403-6. “2′-O-N-methylacetamidonucleoside” or “2′-NMA nucleoside” is shown below. [Chemical Formula]
[0130] In certain embodiments, the 2′-substituent is halo, allyl, amino, azide, SH, CN, OCN, CF3, OCF3, O-C1-C 10 alkoxy, O-C1-C 10 substituted alkoxy, O-C1-C 10 alkyl, O-C1-C 10 substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n), or OCH2C(=O)-N(R m )(R n ) selected from among, where each R m and R n is independently H, an amino protecting group, or substituted or unsubstituted C1-C 10 alkyl, and the 2'-substituent is described in U.S. Patent No. 6,531,584 to Cook et al., U.S. Patent No. 5,859,221 to Cook et al., and U.S. Patent No. 6,005,087 to Cook et al. Specific embodiments of these 2'-substituents are hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl, and may be further substituted with one or more substituents independently selected from among. Examples of suitable 4'-substituents for the non-bicyclic modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in International Patent No. WO2015 / 106128 to Manoharan et al. Examples of suitable 5'-substituents for the non-bicyclic modified sugar moiety include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, the non-bicyclic modified sugar moiety includes multiple non-bridging sugar substituents, such as 2'-F-5'-methyl sugar moieties, as well as modified sugar moieties and modified nucleosides described in International Patent No. WO2008 / 101157 to Migawa et al. and U.S. Patent No. 2013 / 0203836 to Rajeev.
[0131] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), O(CH2), ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(=O)-N(R m )(R n)) and includes a sugar moiety containing an unbridged 2'-substituent selected from, where each R m and R n is independently H, an amino protecting group, or a substituted or unsubstituted C1-C 10 alkyl, such as OCH2C(=O)-N(H)CH3 ("NMA").
[0132] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside includes a sugar moiety containing an unbridged 2'-substituent selected from F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").
[0133] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside includes a sugar moiety containing an unbridged 2'-substituent selected from F, OCH3, OCH2CH2OCH3, and OCH2C(=O)-N(H)CH3.
[0134] Certain modified sugar moieties contain substituents that crosslink two atoms of the furanosyl ring to form a second ring, giving a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety includes a crosslink between the 4'-furanose ring atom and the 2'-furanose ring atom. Such 4'-to-2' crosslinked sugar substituents include, but are not limited to, 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (referred to as "constrained ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CH2OCH3)-O-2' (referred to as "constrained MOE" or "cMOE") and analogs thereof (see, e.g., U.S. Patent No. 7,399,845 to Seth et al., U.S. Patent No. 7,569,686 to Bhat et al., U.S. Patent No. 7,741,457 to Swayze et al. and U.S. Patent No. 8,022,193 to Swayze et al.), 4'-C(CH3)(CH3)-O-2' and analogs thereof (see, e.g., U.S. Patent No. 8,278,283 to Seth et al.), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., U.S. Patent No. 8,278,425 to Prakash et al.), 4'-CH2-O-N(CH3)-2' (see, e.g., U.S. Patent No. 7,696,345 to Allerson et al. and U.S. Patent No. 8,124,745 to Allerson et al.), 4'-CH2-C(H)(CH3)-2' (see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and analogs thereof (see, e.g., U.S. Patent No. 8,278,426 to Seth et al.), 4'-C(R a R b )-N(R)-O-2', 4'-C(R a R b )-O-N(R)-2', 4'-CH2-O-N(R)-2', and 4'-CH2-N(R)-O-2', where each R, R a and R b is independently H, a protecting group, or C1-C 12is alkyl (see, e.g., U.S. Patent No. 7,427,672 to Imanishi).
[0135] In certain embodiments, such a 4'-to-2' bridge is -[C(R a )(R b )] n -, -[C(R a )(R b )] n -O-, -C(R a )=C(R b )-, -C(R a )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O--Si(R a )2-, -S(=O) x - and -N(R a )- independently include 1 to 4 linking groups independently selected from, wherein, x is 0, 1, or 2, n is 1, 2, 3, or 4, each R a and R b is independently H, a protecting group, hydroxyl, C1-C 12 alkyl, substituted C1-C 12 alkyl, C2-C 12 alkenyl, substituted C2-C 12 alkenyl, C2-C 12 alkynyl, substituted C2-C 12 alkynyl, C5-C 20 aryl, substituted C5-C 20 aryl, a heterocyclic radical, a substituted heterocyclic radical, heteroaryl, a substituted heteroaryl, a C5-C7 alicyclic radical, a substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), a substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1), each J1 and J2 is independently H, C1-C 12 alkyl, substituted C1-C 12 alkyl, C2-C 12 alkenyl, substituted C2-C 12Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 Aminoalkyl, or a protecting group.
[0136] Additional bicyclic sugar moieties are known in the art, for example, Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al., J. Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379; U.S. Patent No. 7,053,207 to Wengel et al.; U.S. Patent No. 6,268,490 to Imanishi et al.; U.S. Patent No. U.S. to Imanishi et al.U.S. Patent No. 6,770,748; U.S. Reissue Patent No. RE44,779 to Imanishi et al.; U.S. Patent No. 6,794,499 to Wengel et al.; U.S. Patent No. 6,670,461 to Wengel et al.; U.S. Patent No. 7,034,133 to Wengel et al.; U.S. Patent No. 8,080,644 to Wengel et al.; U.S. Patent No. 8,034,909 to Wengel et al.; U.S. Patent No. 8,153,365 to Wengel et al.; U.S. Patent No. 7,572,582 to Wengel et al.; and U.S. Patent No. 6,525,191 to Ramasamy et al.; International Patent No. WO2004 / 106356 to Torsten et al.; International Patent No. WO1999 / 014226 to Wengel et al.; International Patent No. WO2007 / 134181 to Seth et al.; U.S. Patent No. 7,547,684 to Seth et al.; U.S. Patent No. 7,666,854 to Seth et al.; U.S. Patent No. 8,088,746 to Seth et al.; U.S. Patent No. 7,750,131 to Seth et al.; U.S. Patent No. 8,030,467 to Seth et al.; U.S. Patent No. 8,268,980 to Seth et al.; U.S. Patent No. 8,546,556 to Seth et al.; U.S. Patent No. 8,530,640 to Seth et al.; U.S. Patent No. 9,012,421 to Migawa et al.; U.S. Patent No. 8,501,805 to Seth et al.; and U.S. Patent Publication No. 2008 / 0039618 to Allerson et al., and U.S. Patent Publication No. US2015 / 0191727 to Migawa et al. See also.
[0137] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by the configuration of the isomers. For example, LNA nucleosides (described herein) can be in the α-L configuration or the β-D configuration.
[0138] [Chemical formula] α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA bicyclic nucleosides are incorporated into oligonucleotides that have shown antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In this specification, the general description of bicyclic nucleosides includes both isomeric configurations. In the exemplary embodiments of this specification, when the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are specified, unless otherwise indicated, they are in the β-D configuration.
[0139] In certain embodiments, the modified sugar moiety includes one or more non-bridging sugar substitutions and one or more bridging sugar substitutions (e.g., 5'-substitutions and 4'-2' bridging sugars).
[0140] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atoms of the sugar moiety are replaced with, for example, sulfur, carbon, or nitrogen atoms. In certain such embodiments, such modified sugar moieties also include bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates include 4'-sulfur atoms and substitutions at the 2'-position (see, e.g., U.S. Patent No. 7,875,733 to Bhat et al. and U.S. Patent No. 7,939,677 to Bhat et al.) and / or the 5'-position.
[0141] In certain embodiments, the sugar surrogate includes a ring having other than 5 atoms. For example, in certain embodiments, the sugar surrogate includes a 6-membered tetrahydropyran ("THP"). Such tetrahydropyrans can be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, e.g., Leumann, C.J. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA:
Chemical formula
[0142] In certain embodiments, modified THP nucleosides are provided wherein q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H. In certain embodiments, R1 is methoxy and R2 is H. In certain embodiments, R1 is methoxyethoxy and R2 is H.
[0143] In certain embodiments, the sugar substitute includes a ring having more than 5 atoms and more than 1 heteroatom. For example, the use of nucleosides containing a morpholino sugar moiety and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510, and U.S. Patent Nos. 5,698,685 to Summerton et al.; 5,166,315 to Summerton et al.; 5,185,444 to Summerton et al.; and 5,034,506 to Summerton et al.). As used herein, the term "morpholino" means a sugar substitute having the following structure:
Chemical formula
[0144] In certain embodiments, for example, the morpholino can be modified by adding or modifying various substituents to the above morpholino structure. Such sugar substitutes are referred to herein as "modified morpholinos."
[0145] In certain embodiments, the sugar substitute includes an acyclic moiety. Examples of nucleosides and oligonucleotides containing such acyclic sugar substitutes include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and the nucleosides and oligonucleotides described in International Patent No. 2011 / 133876 to Manoharan et al.
[0146] Many other bicyclic and tricyclic sugars and the ring structures of sugar substitutes that can be used in modified nucleosides are well known in the art.
[0147] Certain modified nucleobases In certain embodiments, a modified oligonucleotide includes one or more nucleosides that include an unmodified nucleobase. In certain embodiments, a modified oligonucleotide includes one or more nucleosides that include a modified nucleobase. In certain embodiments, a modified oligonucleotide includes one or more nucleosides called abasic nucleosides that do not include a nucleobase.
[0148] In certain embodiments, the modified nucleobase is a 5-substituted pyrimidine, 6-azapyrimidine, alkyl or alkynyl substituted pyrimidine, alkyl substituted purine, and N-2, N-6 and selected from O-6 substituted purines. In certain embodiments, the modified nucleobase is 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl(-CC-CH3)uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, degenerate bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp). Modified nucleobases can also include those in which the purine or pyrimidine base is replaced with another heterocycle, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone. Further nucleobases include those disclosed in U.S. Patent No. 3,687,808 to Merigan et al., The Concise Encyclopedia Of Polymer Those disclosed in Science And Engineering, Kroschwitz, J.I., Ed., John Wiley & Sons, 1990, 858 - 859, Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, Crooke, S.T. and Lebleu, B., Eds., CRC Press, 1993, 273 - 288, as well as those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S.T., Ed., CRC Press, 2008, 163 - 166 and 442 - 443 are included.
[0149] Publications teaching the preparation of specific ones of the above-mentioned modified nucleobases and other modified nucleobases include, but are not limited to, U.S. Patent No. 2003 / 0158403 to Manoharan et al.; U.S. Patent No. 2003 / 0175906 to Manoharan et al.; U.S. Patent No. 4,845,205 to Dinh et al.; U.S. Patent No. 5,130,302 to Spielvogel et al.; U.S. Patent No. 5,134,066 to Rogers et al.; U.S. Patent No. 5,175,273 to Bischofberger et al.; U.S. Patent No. 5,367,066 to Urdea et al.; U.S. Patent No. 5,432,272 to Benner et al.; U.S. Patent No. 5,434,257 to Matteucci et al.; U.S. Patent No. 5,457,187 to Gmeiner et al.; U.S. Patent No. 5,459,255 to Cook et al.; U.S. Patent No. 5,484,908 to Froehler et al.; U.S. Patent No. 5,502,177 to Matteucci et al.; U.S. Patent No. 5,525,711 to Hawkins et al.; U.S. Patent No. 5,552,540 to Haralambidis et al.; U.S. Patent No. 5,587,469 to Cook et al.; U.S. Patent No. 5,594,121 to Froehler et al.; U.S. Patent No. 5,596,091 to Switzer et al.; U.S. Patent No. 5,614,617 to Cook et al.; U.S. Patent No. 5,645,985 to Froehler et al.; U.S. Patent No. 5,681,941 to Cook et al.; U.S. Patent No. 5,811,534 to Cook et al.; U.S. Patent No. 5,750,692 to Cook et al.; U.S. Patent No. 5,948,903 to Cook et al.; U.S. Patent No. 5,587,470 to Cook et al.; U.S. Patent No. 5,457,191 to Matteuc U.S. Patent No. 5,763,588 to ci et al.; U.S. Patent No. 5,830,653 to Froehler et al.; U.S. Patent No. 5,808,027 to Cook et al.; U.S. Patent No. 6,166,199 to Cook et al.; and U.S. Patent No. 6,005,096 to Matteucci et al. are mentioned.
[0150] Specific modified nucleoside linkages In certain embodiments, the nucleosides of the modified oligonucleotide can be linked to each other using any internucleoside linkage. Two major classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiesters containing a phosphodiester bond (“P(O2)=O”) (also referred to as an unmodified or natural bond), phosphotriesters, methylphosphonates, methoxypropylphosphonates (“MOP”), phosphoramidates, mesylphosphoramidates, and phosphorothioates (“P(O2)=S”), and phosphorodithioates (“HS-P=S”). Representative phosphorus-free internucleoside linking groups include, but are not limited to, methylene methylimino (-CH2-N(CH3)-O-CH2-), thiodiesters, thiocarbamates (-O-C(=O)(NH)-S-), siloxanes (-O-SiH2-O-), and N,N’-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified internucleoside linkages, as compared to the naturally occurring phosphate bond, can be used to modify, usually increase, the nuclease resistance of the oligonucleotide. In certain embodiments, internucleoside linkages having chiral atoms can be prepared as a racemic mixture or as separate enantiomers. Methods for preparing phosphorus-containing and phosphorus-free internucleoside linkages are well known to those of ordinary skill in the art.
[0151] Representative internucleoside linkages having chiral centers include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides containing internucleoside linkages having chiral centers can be prepared as a population of modified oligonucleotides containing stereorandom internucleoside linkages or as a population of modified oligonucleotides containing phosphorothioate internucleoside linkages in a specific stereochemical configuration. In certain embodiments, the population of modified oligonucleotides contains phosphorothioate internucleoside linkages where all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be made using synthetic methods in which the stereochemical configuration of each phosphorothioate internucleoside linkage is randomly selected. Nevertheless, as will be well understood by those skilled in the art, each individual oligonucleotide molecule of each individual phosphorothioate has a defined stereoconfiguration. In certain embodiments, the population of modified oligonucleotides is enriched in modified oligonucleotides containing one or more specific phosphorothioate internucleoside linkages in a specifically selected stereochemical configuration. In certain embodiments, the specific phosphorothioate internucleoside linkages of that specific configuration are present in at least 65% of the molecules within the population. In certain embodiments, the specific phosphorothioate internucleoside linkages of that specific configuration are present in at least 70% of the molecules within the population. In certain embodiments, the specific phosphorothioate internucleoside linkages of that specific configuration are present in at least 80% of the molecules within the population. In certain embodiments, the specific phosphorothioate internucleoside linkages of that specific configuration are present in at least 90% of the molecules within the population. In certain embodiments, the specific phosphorothioate internucleoside linkages of that specific configuration are present in at least 99% of the molecules within the population. Such populations of chirally enriched modified oligonucleotides can be generated using synthetic methods known in the art, such as those described in Oka et al., JACS 2003, 125, 8307, Wan et al. Nuc. Acid. Res., 2014, 42, 13456, and International Patent No. WO2017 / 015555.In certain embodiments, at least one of the modified oligonucleotides in the (Sp) configuration is shown. Modified oligonucleotides having phosphorothioates are enriched. In certain embodiments, the population of modified oligonucleotides is enriched in modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, the modified oligonucleotides comprising (Rp) and / or (Sp) phosphorothioates each comprise one or more of the following formulas, where "B" represents a nucleobase.
Chemical formula
[0152] In certain embodiments, the modified oligonucleotide comprises an internucleoside motif of (5' to 3') soossssssssssssssssss. In certain embodiments, the particular stereochemical configuration of the modified oligonucleotide is (5' to 3') Sp-ooo-Sp-Sp-Sp-Rp-Sp-Sp-Rp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp or Sp-o-o-o-Sp-Sp-Sp-Rp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp, where each "Sp" represents a phosphorothioate internucleoside linkage in the S configuration, Rp represents a phosphorothioate internucleoside linkage in the R configuration, and "o" represents a phosphodiester internucleoside linkage.
[0153] Neutral internucleoside linkages include, but are not limited to, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl, and thioformacetal (3'-S-CH2-O-5'). Further neutral internucleoside linkages include nonionic linkages including siloxane (dialkylsiloxane), carboxylic acid ester, carboxamide, sulfide, sulfonic acid ester, and amide (see, for example, Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages containing mixed N, O, S, and CH2 component moieties.
[0154] In certain embodiments, the modified internucleoside linkage is any of those described in International Patent No. WO2021 / 030778, which is incorporated herein by reference.
[0155] Specific motif In certain embodiments, the modified oligonucleotide comprises one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, the modified oligonucleotide comprises one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, the modified oligonucleotide comprises one or more modified internucleoside linkages. In such embodiments, the modified oligonucleotide Modified, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages define a pattern or motif. In certain embodiments, the patterns of the sugar moiety, nucleobase, and internucleoside linkage are each independent of one another. Accordingly, a modified oligonucleotide can be described by its sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, a nucleobase motif describes a modification to a nucleobase that is independent of the sequence of nucleobases).
[0156] Specific sugar motifs In certain embodiments, an oligonucleotide comprises one or more modified sugar moieties and / or unmodified sugar moieties arranged along the oligonucleotide or a portion thereof in a defined pattern or sugar modification motif. In certain examples, such sugar motifs include, but are not limited to, any of the sugar modifications discussed herein.
[0157] In certain embodiments, the modified oligonucleotide has a gapmer motif defined by two outer regions or "wings" and a central or inner region or "gap". The three regions of the gapmer motif (5'-wing, gap, and 3'-wing) form a contiguous array of nucleosides, and at least a portion of the sugar moiety of each nucleoside in the wings is different from at least a portion of the sugar moiety of the nucleosides in the gap. Specifically, the sugar moiety of at least the nucleoside closest to the gap in each wing (the most 3'-side nucleoside of the 5'-wing and the most 5'-side nucleoside of the 3'-wing) is different from the sugar moiety of the adjacent gap nucleoside, thus defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are the same as each other. In certain embodiments, the gap contains one or more nucleosides having a sugar moiety different from the sugar moieties of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as each other (symmetric gapmer). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric sugar gapmer).
[0158] In certain embodiments, each wing of the gapmer contains 1 to 6 bicyclic nucleosides. In certain embodiments, each nucleoside in each wing of the gapmer contains a modified sugar moiety. In certain embodiments, at least 1, at least 2, at least 3, at least 4, at least 5, or at least 6 nucleosides in each wing of the gapmer contain a modified sugar moiety.
[0159] In certain embodiments, the gap of the gapmer contains 7 to 12 nucleosides. In certain embodiments, each nucleoside in the gap of the gapmer contains a 2'-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside in the gap of the gapmer contains a modified sugar moiety and each of the remaining nucleosides contains a 2'-deoxyribosyl sugar moiety.
[0160] Here, the lengths (number of nucleotides) of the three regions of the gapmer can be imparted using the notation [number of nucleotides in the 5'-wing] - [number of nucleotides in the gap] - [number of nucleotides in the 3'-wing]. Thus, a 5-10-5 gapmer consists of 5 linked nucleotides in each wing and 10 linked nucleotides in the gap. When a specific modification follows such a nomenclature, the modification is of each sugar moiety of each wing, and the gap nucleotides contain a 2'-deoxyribosyl sugar moiety. Thus, a 5-10-5 MOE gapmer consists of 5 linked 2'-MOE nucleotides in the 5'-wing, 10 linked 2'-deoxyribonucleotides in the gap, and 5 linked 2'-MOE nucleotides in the 3'-wing.
[0161] In certain embodiments, each nucleotide of the modified oligonucleotide or a portion thereof contains a 2'-substituted sugar moiety, a bicyclic sugar moiety, a sugar surrogate, or a 2'-deoxyribosyl sugar moiety. In certain embodiments, the 2'-substituted sugar moiety is selected from a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, a 2'-OMe sugar moiety, and a 2'-F sugar moiety. In certain embodiments, the bicyclic sugar moiety is selected from a cEt sugar moiety and an LNA sugar moiety. In certain embodiments, the sugar surrogate is selected from morpholino, modified morpholino, PNA, THP, and F-HNA.
[0162] In certain embodiments, the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 nucleosides comprising a modified sugar moiety. In certain embodiments, the modified sugar moiety is independently selected from a 2'-substituted sugar moiety, a bicyclic sugar moiety, or a sugar surrogate. In certain embodiments, the 2'-substituted sugar moiety is selected from a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, a 2'-OMe sugar moiety, and a 2'-F sugar moiety. In certain embodiments, the bicyclic sugar moiety is selected from a cEt sugar moiety and an LNA sugar moiety. In certain embodiments, the sugar surrogate is selected from morpholino, modified morpholino, THP, and F-HNA.
[0163] In certain embodiments, each nucleoside of the modified oligonucleotide comprises a modified sugar moiety ("fully modified oligonucleotide"). In certain embodiments, each nucleoside of the fully modified oligonucleotide comprises a 2'-substituted sugar moiety, a bicyclic sugar moiety, or a sugar surrogate. In certain embodiments, the 2'-substituted sugar moiety is selected from a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, a 2'-OMe sugar moiety, and a 2'-F sugar moiety. In certain embodiments, the bicyclic sugar moiety is selected from a cEt sugar moiety and an LNA sugar moiety. In certain embodiments, the sugar surrogate is selected from morpholino, modified morpholino, THP, and F-HNA. In certain embodiments, each nucleoside of the fully modified oligonucleotide comprises the same modified sugar moiety ("uniformly modified oligonucleotide"). In certain embodiments, the uniformly modified sugar motif is 7 to 20 nucleosides in length. In certain embodiments, each nucleoside of the uniformly modified sugar motif comprises a 2'-substituted sugar moiety, a bicyclic sugar moiety, or a sugar surrogate. In certain embodiments, the 2'-substituted sugar moiety is selected from a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, a 2'-OMe sugar moiety, and a 2'-F sugar moiety. In certain embodiments, the bicyclic sugar moiety is selected from a cEt sugar moiety and an LNA sugar moiety. In certain embodiments, the sugar surrogate is selected from morpholino, modified morpholino, THP, and F-HNA. In certain embodiments, a modified oligonucleotide having at least one fully modified sugar motif may also have at least one, at least two, at least three, or at least four 2'-deoxyribonucleosides.
[0164] Certain nucleobase motif In certain embodiments, the oligonucleotide comprises modified and / or unmodified nucleobases arranged along the oligonucleotide or a portion thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases of the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosine and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.
[0165] In certain embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is at the 3'-terminus of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides from the 3'-terminus of the oligonucleotide. In certain embodiments, the block is at the 5'-terminus of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides from the 5'-terminus of the oligonucleotide.
[0166] In certain embodiments, an oligonucleotide having a gapmer motif comprises a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of the oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynylpyrimidine.
[0167] Particular internucleoside linkage motifs In certain embodiments, the oligonucleotide comprises modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or a portion thereof in a defined pattern or motif. In certain embodiments, each internucleoside linkage group is a phosphodiester internucleoside linkage. In certain embodiments, each internucleoside linkage group of the modified oligonucleotide is a phosphorothioate internucleoside linkage. In certain embodiments, each internucleoside linkage of the modified oligonucleotide is independently selected from phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from stereorandom phosphorothioate, (Sp) phosphorothioate, and (Rp) phosphorothioate. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and all internucleoside linkages within the gap are modified. In certain such embodiments, some or all of the internucleoside linkages within the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, and this at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of those phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, all of the phosphorothioate internucleoside linkages within the wings are (Sp) phosphorothioate, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides comprising such internucleoside linkage motifs. In certain embodiments, one or more internucleoside linkages are mesylphosphoramidate internucleoside linkages.In certain embodiments, each internucleoside linkage is independently selected from phosphodiester internucleoside linkages, phosphorothioate internucleoside linkages, and mesylphosphoramidate internucleoside linkages. In certain embodiments, each internucleoside linkage is independently selected from phosphorothioate internucleoside linkages and mesylphosphoramidate internucleoside linkages. In certain embodiments, one or more internucleoside linkages are methoxypropylphosphonate internucleoside linkages. In certain embodiments, each internucleoside linkage is independently selected from phosphodiester internucleoside linkages, phosphorothioate internucleoside linkages, and methoxypropylphosphonate internucleoside linkages. In certain embodiments, each internucleoside linkage is independently selected from phosphorothioate internucleoside linkages and methoxypropylphosphonate internucleoside linkages.
[0168] In certain embodiments, the modified oligonucleotide comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, or at least nineteen phosphodiester internucleoside linkages. In certain embodiments, the modified oligonucleotide comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, or at least nineteen phosphorothioate internucleoside linkages. In certain embodiments, the modified oligonucleotide comprises at least one, at least two, at least three, at least four, or at least five phosphodiester internucleoside linkages, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain embodiments, the modified oligonucleotide comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, or at least nineteen phosphodiester internucleoside linkages. In certain embodiments, the modified oligonucleotide comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, or at least nineteen phosphorothioate internucleoside linkages. In certain embodiments, the modified oligonucleotide comprises at least one, at least two, at least three, at least four, or at least five phosphodiester internucleoside linkages, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages.
[0169] Specific length Without loss of activity, the length of the oligonucleotide can be increased or decreased. For example, in Woolf et al. Proc. Natl. Acad. Sci. USA, 1992, 89: 7305-7309, 1992, a series of oligonucleotides having a length of 13 to 25 nucleobases were tested for their ability to induce cleavage of a target nucleic acid in an oocyte injection model. An oligonucleotide 25 nucleobases in length containing 8 or 11 mismatched bases near the ends of the oligonucleotide was able to direct specific cleavage of the target nucleic acid, although to a lesser extent than an oligonucleotide without mismatches. Similarly, target-specific cleavage was obtained using oligonucleotides consisting of 13 nucleobases, including those having 1 or 3 mismatches.
[0170] In certain embodiments, the oligonucleotides (including modified oligonucleotides) can have any of a variety of lengths. In certain embodiments, the oligonucleotide consists of X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, provided that X is less than or equal to Y. For example, in certain embodiments, the oligonucleotide is 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 2 It may consist of 9, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 27, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 20, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.
[0171] In certain embodiments, the oligonucleotide consists of 16 linked nucleosides. In certain embodiments, the oligonucleotide consists of 17 linked nucleosides. In certain embodiments, the oligonucleotide consists of 18 linked nucleosides. In certain embodiments, the oligonucleotide consists of 19 linked nucleosides. In certain embodiments, the oligonucleotide consists of 20 linked nucleosides.
[0172] Particular modified oligonucleotides In certain embodiments, the above modifications (sugars, nucleobases, internucleoside linkages) are incorporated into the modified oligonucleotides. In certain embodiments, the modified oligonucleotides are characterized by their modification motifs and full lengths. In certain embodiments, such parameters are independent of each other. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified, and may or may not follow the gapmer modification pattern of the sugar modification. For example, the internucleoside linkages within the wing regions of a sugar gapmer may be the same as or different from each other, and may be the same as or different from the internucleoside linkages of the gap region of the sugar motif. Similarly, such sugar gapmer oligonucleotides may contain one or more modified nucleobases regardless of the sugar modification gapmer pattern. Unless otherwise indicated, any modification is independent of the nucleobase sequence.
[0173] A particular population of modified oligonucleotides A population of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be a stereorandom population or a chirally enriched population. All chiral centers of all modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of the chirally enriched population are enriched for the β-D-ribosyl sugar moiety and all phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of the chirally enriched population are enriched for both the β-D-ribosyl sugar moiety of a particular stereochemical configuration and at least one particular phosphorothioate internucleoside linkage.
[0174] Nucleobase sequence In certain embodiments, the oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequences. In certain embodiments, the oligonucle otides have nucleobase sequences that are complementary to an identified reference nucleic acid such as a second oligonucleotide or a target nucleic acid. In certain such embodiments, a portion of the oligonucleotide has a nucleobase sequence that is complementary to an identified reference nucleic acid such as a second oligonucleotide or a target nucleic acid. In certain embodiments, a portion or the entire nucleobase sequence of the oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a nucleic acid such as a second oligonucleotide or a target nucleic acid.
[0175] Certain oligomeric compounds In certain embodiments, provided herein is an oligomeric compound comprising an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and / or terminal groups. A conjugate group consists of one or more conjugate moieties and a conjugate linker that attaches the conjugate moiety to the oligonucleotide. The conjugate group may be attached to either or both ends and / or any internal position of the oligonucleotide. In certain embodiments, the conjugate group is attached to the 2'-position of the nucleoside of a modified oligonucleotide. In certain embodiments, a conjugate group attached to either or both ends of the oligonucleotide is a terminal group. In certain such embodiments, the conjugate group or terminal group is attached to the 3'-end and / or 5'-end of the oligonucleotide. In certain such embodiments, the conjugate group (or terminal group) is attached to the 3'-end of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 3'-end of the oligonucleotide. In certain embodiments, the conjugate group (or terminal group) is attached to the 5'-end of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 5'-end of the oligonucleotide.
[0176] Examples of terminal groups include, but are not limited to, conjugate groups, capping groups, phosphate moieties, protecting groups, abasic nucleosides, modified or unmodified nucleosides, and two or more nucleosides independently modified or unmodified.
[0177] Certain conjugate groups In certain embodiments, the oligonucleotide is covalently attached to one or more conjugate groups. In certain embodiments, the conjugate groups modify one or more properties of the conjugated oligonucleotide, including, but not limited to, pharmacodynamic properties, pharmacokinetic properties, stability properties, binding properties, absorption properties, tissue distribution properties, cell distribution properties, cell uptake properties, charge properties, and clearance properties. In certain embodiments, the conjugate groups impart new properties to the conjugated oligonucleotide, such as a fluorophore or reporter group that enables detection of the oligonucleotide. Specific conjugate groups and conjugate moieties have been described previously, for example, cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), phosphate (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioether, such as hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309, Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), thiocolesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains, such as dodecane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118, Kabanov et al., FEBS Lett., 1990, 259, 327-330, Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids, such as di- Hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654, Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or an adamantane acetic acid, palmitoyl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxy cholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; doi:10.1038 / mtna.2014.72 and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., International Patent No. WO2014 / 179620).
[0178] Conjugate moiety Examples of the conjugate moiety include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, sugars, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, thiocolesterol, cholic acid moieties, folic acid, lipids, lipophilic groups, phospholipids, biotin, phenazines, phenanthridines, anthraquinones, adamantanes, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.
[0179] In certain embodiments, the conjugate moiety comprises an active ingredient such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansyl sarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folic acid, benzothiadiazine, chlorothiazide, diazepine, indomethacin, barbiturate, cephalosporin, sulfa drug, diabetes therapeutic agent, antibacterial agent or antibiotic.
[0180] Conjugate linker The conjugate moiety is attached to the oligonucleotide via a conjugate linker. In certain oligomeric compounds, the conjugate linker is a single bond (i.e., the conjugate moiety is directly attached to the oligonucleotide via a single bond). In certain oligomeric compounds, the conjugate moiety is attached to the oligonucleotide via a more complex conjugate linker that includes one or more conjugate linker moieties that are subunits that make up the conjugate linker. In certain embodiments, the conjugate linker includes a chain structure such as a hydrocarbyl chain or an oligomer of repeating units such as ethylene glycol, nucleoside or amino acid units.
[0181] In certain embodiments, the conjugate linker includes one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker includes a group selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker includes a group selected from alkyl and amide groups. In certain embodiments, the conjugate linker includes a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker includes at least one phosphorus moiety. In certain embodiments, the conjugate linker includes at least one phosphate group. In certain embodiments, the conjugate linker includes at least It also contains one neutral linking group.
[0182] In certain embodiments, a conjugate linker containing the above conjugate linker is known in the art to be useful for attaching a conjugate group to a bifunctional linking moiety, such as a parent compound like the oligonucleotides provided herein. Generally, a bifunctional linking moiety contains at least two functional groups. One of the functional groups is selected to bind to a specific site on the parent compound, and the other is selected to bind to the conjugate group. Examples of functional groups used for bifunctional linking moieties include, but are not limited to, an electrophilic group for reacting with a nucleophilic group and a nucleophilic group for reacting with an electrophilic group. In certain embodiments, the bifunctional linking moiety contains one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
[0183] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include substituted or unsubstituted C1-C 10 alkyl, substituted or unsubstituted C2-C 10 alkenyl, or substituted or unsubstituted C2-C 10 alkynyl, including but not limited to, where a non-limiting list of preferred substituents includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.
[0184] In certain embodiments, the conjugate linker comprises from 1 to 10 linker nucleosides. In certain embodiments, the conjugate linker comprises from 2 to 5 linker nucleosides. In certain embodiments, the conjugate linker comprises exactly 3 linker nucleosides. In certain embodiments, the conjugate linker comprises a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise a modified sugar moiety. In certain embodiments, the linker nucleosides are unmodified. In certain embodiments, the linker nucleosides comprise a heterocyclic base optionally protected when selected from purine, substituted purine, pyrimidine, or substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoyl cytosine, 5-methyl cytosine, 4-N-benzoyl-5-methyl cytosine, adenine, 6-N-benzoyl adenine, guanine, and 2-N-isobutyryl guanine. It is generally desirable for the linker nucleosides to be cleaved from the oligomeric compound after reaching the target tissue. Thus, the linker nucleosides are generally linked to each other and to the remainder of the oligomeric compound via cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.
[0185] In this specification, the linker nucleosides are not considered part of the oligonucleotide. Thus, in embodiments where the oligomeric compound comprises an oligonucleotide consisting of a specific number or range of linked nucleosides and / or a specific complementarity percentage (%) to a reference nucleic acid, and the oligomeric compound also comprises a conjugate group comprising a conjugate linker that includes linker nucleosides, these linker nucleosides are not counted towards the length of the oligonucleotide and are not used in determining the complementarity percentage (%) of the oligonucleotide to the reference nucleic acid. For example, the oligomeric compound can comprise (1) a modified oligonucleotide consisting of 8 to 30 nucleosides, and (2) a conjugate group comprising 1 to 10 linker nucleosides adjacent to the nucleosides of the modified oligonucleotide. The total number of adjacent linked nucleosides in such an oligomeric compound is more than 30. . Alternatively, the oligomeric compound can comprise a modified oligonucleotide consisting of 8 to 30 nucleosides and not comprising a conjugate group. The total number of adjacent linked nucleosides in such an oligomeric compound is 30 or less. Unless otherwise specified, the conjugate linker comprises 10 or fewer linker nucleosides. In certain embodiments, the conjugate linker comprises 5 or fewer linker nucleosides. In certain embodiments, the conjugate linker comprises 3 or fewer linker nucleosides. In certain embodiments, the conjugate linker comprises 2 or fewer linker nucleosides. In certain embodiments, the conjugate linker comprises 1 linker nucleoside.
[0186] In certain embodiments, it is desirable for the conjugate group to be cleaved from the oligonucleotide. For example, in certain situations, an oligomeric compound containing a particular conjugate moiety may be readily taken up by a particular cell type, but after the oligomeric compound has been taken up, it is desirable for the conjugate group to be cleaved to release the unconjugated or parent oligonucleotide. Thus, a particular conjugate linker can include one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is a group of atoms that includes at least one cleavable bond. In certain embodiments, the cleavable moiety includes a group of atoms having 1, 2, 3, 4, or more than 4 cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved inside the cell or within an intracellular compartment such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme such as a nuclease.
[0187] In certain embodiments, the cleavable bond is selected from among an amide bond, an ester bond, an ether bond, one or both of the ester bonds of a phosphodiester bond, a phosphate ester bond, a carbamate bond, or a disulfide bond. In certain embodiments, the cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, the cleavable moiety includes a phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugate moiety or conjugate group.
[0188] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, the one or more linker nucleosides are linked to each other and / or to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such a cleavable bond is an unmodified phosphodiester bond. In certain embodiments, the cleavable moiety is a 2'-deoxyribonucleoside that is linked to either the 3'-terminal nucleoside or the 5'-terminal nucleoside of the oligonucleotide by a phosphate internucleoside bond and is covalently linked to the remainder of its conjugate linker or conjugate moiety by a phosphate or phosphorothioate internucleoside bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.
[0189] Certain terminal groups In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. Stabilized 5'-phosphates include, but are not limited to, 5'-phosphanates including 5'-vinylphosphonate. In certain embodiments, the terminal group comprises one or more abasic nucleosides and / or inverse nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides. In certain such embodiments, the 2'-linked nucleoside is an abasic nucleoside.
[0190] Oligomeric duplex In certain embodiments, the oligomeric compounds described herein include oligonucleotides having a nucleobase sequence complementary to the nucleobase sequence of a target nucleic acid. In certain embodiments, the oligomeric compound pairs with a second oligomeric compound to form an oligomeric duplex. Such an oligomeric duplex includes a first oligomeric compound having a portion complementary to the target nucleic acid and a second oligomeric compound having a portion complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of the oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a conjugate group, and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group. One or both of the oligomeric compounds of the oligomeric duplex may include a conjugate group. The oligonucleotides of each oligomeric compound of the oligomeric duplex may include non-complementary overhanging nucleosides.
[0191] Antisense activity In certain embodiments, the oligomeric compounds and oligomeric duplexes can provide at least one antisense activity by hybridizing to a target nucleic acid. Such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, an antisense compound has antisense activity if it reduces, modulates, or increases the amount or activity of a target nucleic acid by 25% or more in a standard cell assay. In certain embodiments, an antisense compound selectively affects one or more target nucleic acids. Such an antisense compound hybridizes to one or more target nucleic acids to provide one or more desired antisense activities and does not hybridize to one or more non-target nucleic acids or hybridizes to one or more non-target nucleic acids in a manner that does not result in significant undesired antisense activity, and includes a nucleobase sequence that does not hybridize to one or more non-target nucleic acids.
[0192] In certain antisense activities, hybridization of an antisense compound to a target nucleic acid recruits a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in cleavage of the target nucleic acid via RNaseH. RNaseH is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA of such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, provided herein are antisense compounds that are sufficiently "DNA-like" to induce RNaseH activity. In certain embodiments, one or more non-DNA-like nucleosides within the gap of a gapmer are tolerated.
[0193] In certain antisense activities, an antisense compound or a portion of an antisense compound is incorporated into an RNA-induced silencing complex (RISC), and ultimately the target nucleic acid is cleaved. For example, certain antisense compounds result in cleavage of the target nucleic acid by argonaute. Antisense compounds incorporated into RISC are RNAi compounds. RNAi compounds can be double-stranded (siRNA) or single-stranded (ssRNA).
[0194] In certain embodiments, hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in a change in splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of binding interactions of the target nucleic acid with a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in a change in translation of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in exon inclusion. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in an increase in the amount or activity of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in a modified splicing to result in RNA inclusion.
[0195] Antisense activity can be observed directly or indirectly. In certain embodiments, the observation or detection of antisense activity involves the observation or detection of a change in the amount of the target nucleic acid or a protein encoded by such a target nucleic acid, a change in the ratio of nucleic acid or protein splice variants, and / or a change in the phenotype of a cell or subject.
[0196] A specific target nucleic acid In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a portion complementary to the target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mature mRNA and mRNA precursors (including introns, exons, and untranslated regions). In certain embodiments, the target nucleic acid is mature mRNA. In certain embodiments, the target nucleic acid is an mRNA precursor. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, at least 50% of the target region is within an intron.
[0197] Complementarity / mismatch with the target nucleic acid It is possible to introduce mismatched bases without losing activity. For example, Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated that an oligonucleotide having 100% complementarity to bcl-2 mRNA and three mismatches to bcl-xL mRNA could reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide also showed potent antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested the ability of a series of tandem 14-nucleotide oligonucleotides, as well as 28- and 42-nucleotide oligonucleotides composed of the sequences of two or three tandem oligonucleotides respectively, to stop the translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14-nucleotide oligonucleotides, although at a lower level than the 28- or 42-nucleotide oligonucleotides alone, was able to inhibit translation.
[0198] In certain embodiments, the oligonucleotide is complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and contains a portion that is 100% or completely complementary to the target nucleic acid. In certain embodiments, the completely complementary portion has a length of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases.
[0199] In certain embodiments, the oligonucleotide contains one or more mismatched nucleobases to the target nucleic acid. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 from the 5' end of the oligonucleotide.
[0200] SMN2 In certain embodiments, the oligomeric compound comprises or consists of a modified oligonucleotide or a portion thereof that is complementary to a target nucleic acid encoding SMN2. In certain embodiments, SMN2 has the sequence shown in SEQ ID NO: 1 (GENBANK accession number NT_006713.14 truncated from nucleotides 19939708 to 19967777).
[0201] In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1 modulates splicing of the cell's SMN2 RNA. In certain embodiments, when a cell is contacted with an oligomeric compound complementary to SEQ ID NO: 1, the amount of SMN2 RNA containing exon 7 increases. In certain embodiments, when a cell is contacted with an oligomeric compound complementary to SEQ ID NO: 1, expression of the full-length SMN2 protein is increased. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide.
[0202] In certain embodiments, contacting a subject's cells with an oligomeric compound complementary to SEQ ID NO: 1 results in remission of one or more symptoms of a neurodegenerative disease. In certain embodiments, the neurodegenerative disease is SMA including type I SMA, type II SMA, type III SMA, and type IV SMA. In certain embodiments, the symptoms are any of: decreased muscle strength; inability or decreased ability to sit, stand, and / or walk with the back straight; decreased neuromuscular activity; decreased electrical activity of one or more muscles; decreased respiration; inability or decreased ability to eat, drink, and / or breathe without assistance; weight loss or decreased weight gain; and / or decreased survival rate.
[0203] In certain embodiments, when an oligomeric compound complementary to SEQ ID NO: 1 is administered according to a standard in vivo assay, it can increase SMN2 RNA containing exon 7 in vivo by at least 1-fold, 2-fold, or 3-fold. In certain embodiments, when an oligomeric compound complementary to SEQ ID NO: 1 is administered according to a standard in vivo assay, it can increase full-length SMN2 protein in vivo by at least 1-fold, 2-fold, or 3-fold.
[0204] A specific target nucleic acid in a specific tissue In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a portion complementary to the target nucleic acid, and the target nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissue is cells and tissues including the central nervous system (CNS). Such tissues include brain tissues such as spinal cord, cortex, and coronary brain tissue.
[0205] A specific pharmaceutical composition In certain embodiments, pharmaceutical compositions comprising one or more oligomeric compounds are described herein. In certain embodiments, the one or more oligomeric compounds each consist of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition includes a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists of sterile saline and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical-grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical-grade water. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical-grade PBS. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and artificial cerebrospinal fluid (“artificial CSF” or “aCSF”). In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical-grade.
[0206] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is of pharmaceutical grade.
[0207] In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients. In certain such embodiments, the excipients are selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.
[0208] In certain embodiments, the oligomeric compound can be mixed with pharmaceutically acceptable active and / or inactive substances to prepare a pharmaceutical composition or formulation. The compositions and methods for formulating a pharmaceutical composition are determined by a number of criteria including, but not limited to, the route of administration, the degree of the disease, or the dosage.
[0209] In certain embodiments, a pharmaceutical composition comprising an oligomeric compound includes any pharmaceutically acceptable salt of the oligomeric compound, an ester of the oligomeric compound, or a salt of such an ester. In certain embodiments, a pharmaceutical composition comprising an oligomeric compound comprising one or more oligonucleotides, when administered to a subject including a human, can (directly or indirectly) provide a biologically active metabolite or residue thereof. Thus, for example, the present disclosure is directed to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other biological equivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium salts and potassium salts. In certain embodiments, a prodrug includes one or more conjugate groups attached to an oligonucleotide, and the conjugate group is cleaved by an endogenous nuclease in the body. In certain embodiments, a prodrug includes one or more conjugate groups attached to an oligonucleotide, and the conjugate group is cleaved by an endogenous nuclease in the body.
[0210] Lipid moieties are used in various ways in nucleic acid therapies. In certain such methods, a nucleic acid such as an oligomeric compound is introduced into preformed liposomes or lipoplexes prepared from a mixture of cationic and neutral lipids. In certain methods, DNA complexes with mono- or polycationic lipids are formed in the absence of neutral lipids. In certain embodiments, the lipid moiety is selected to increase the distribution of a pharmaceutical to a particular cell or tissue. In certain embodiments, the lipid moiety is selected to increase the distribution of a pharmaceutical to adipose tissue. In certain embodiments, the lipid moiety is selected to increase the distribution of a pharmaceutical to muscle tissue.
[0211] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful in the preparation of certain pharmaceutical compositions, including those containing hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethyl sulfoxide are used.
[0212] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceuticals, including the oligomeric compositions provided herein, to a particular tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises liposomes coated with a tissue-specific antibody.
[0213] In certain embodiments, the pharmaceutical composition comprises a co-solvent system. Certain such co-solvent systems include, for example, benzyl alcohol, a non-polar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. Non-limiting examples of such co-solvent systems include the VPD co-solvent system, which is a solution of absolute ethanol containing 3 w / v% benzyl alcohol, 8 w / v% of the non-polar surfactant polysorbate 80(trademark), and 65 w / v % polyethylene glycol 300. The proportions of such co-solvent systems can be varied significantly without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of the co-solvent components can vary; for example, other surfactants may be used in place of polysorbate 80(trademark), the fraction size of the polyethylene glycol can vary, other biocompatible polymers can replace polyethylene glycol, for example, polyvinylpyrrolidone, and other sugars or polysaccharides can replace dextrose.
[0214] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for injectable administration (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain such embodiments, the pharmaceutical composition comprises a carrier and is formulated in an aqueous solution, such as water or a physiologically compatible buffer, such as Hank's solution, Ringer's solution, or a physiological saline buffer. In certain embodiments, other components (e.g., components that aid in dissolution or serve as preservatives) are included. In certain embodiments, injectable suspensions are prepared using suitable liquid carriers, suspending agents, etc. Certain pharmaceutical compositions for injection are provided in unit dosage form, e.g., in ampule units, or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions, or emulsions in an oily or aqueous vehicle and may contain formulating agents such as suspending agents, stabilizers, and / or dispersing agents. Specific solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
[0215] Under certain conditions, the specific compounds disclosed herein act as acids. Such compounds can be illustrated or described in their protonated (free acid) form, or in their ionized form associated with a cation (salt), but the aqueous solutions of such compounds exist in equilibrium between such forms. For example, the phosphate bonds of oligonucleotides in aqueous solution exist in equilibrium between the free acid, anion, and salt forms. Unless otherwise indicated, the compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such bonds, each of which is in equilibrium. Thus, an oligonucleotide in solution exists as a collection of forms at multiple positions, all in equilibrium. The term "oligonucleotide" is intended to include all such forms. The structures depicted do not necessarily represent a single form. Nevertheless, unless otherwise indicated, such figures are likewise intended to include the corresponding forms. In this specification, when the term "or its salt" follows a structure showing the free acid of a compound, it explicitly includes all such forms that may be fully or partially protonated / deprotonated / associated with a cation. In certain examples, one or more specific cations are specified.
[0216] In certain embodiments, the modified oligonucleotide or oligomeric compound is present in an aqueous solution containing sodium. In certain embodiments, the modified oligonucleotide or oligomeric compound is present in an aqueous solution containing potassium. In certain embodiments, the modified oligonucleotide or oligomeric compound is present in PBS. In certain embodiments, the modified oligonucleotide or oligomeric compound is present in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl so as to obtain the desired pH.
[0217] Here, specific dosages will be described. The dosage can be in the form of dosage units. For clarity, the dosage (or administration unit) of a modified oligonucleotide or oligomeric compound in milligram units refers to the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As described above, in an aqueous solution, the free acid is in equilibrium with the anionic and salt forms. However, for the purpose of calculating the dosage, it is assumed that the modified oligonucleotide or oligomeric compound is present as a solvent-free, sodium acetate-free, anhydrous free acid. For example, when the modified oligonucleotide or oligomeric compound is in a solution containing sodium (e.g., physiological saline), the modified oligonucleotide or oligomeric compound can be partially or completely deprotonated and associate with Na+ ions. However, the mass of the proton is still counted in the weight of the dosage, and the mass of the Na+ ion is not counted in the weight of the dosage. Thus, for example, the dosage or administration unit of 10 mg of Compound No. 1263789, Compound No. 1287717, Compound No. 1287745, and Compound No. 1358996 is equal to the number of completely protonated molecules with a weight of 10 mg. This corresponds to 10.53 mg of solvent-free, sodium acetate-free, anhydrous sodiumated Compound No. 1263789, 10.53 mg of solvent-free, sodium acetate-free, anhydrous sodiumated Compound No. 1287717, 10.52 mg of solvent-free, sodium acetate-free, anhydrous sodiumated Compound No. 1287745, and 10.51 mg of solvent-free, sodium acetate-free, anhydrous sodiumated Compound No. 1358996. When the oligomeric compound contains a conjugate group, the mass of the conjugate group is included in the calculation of the dosage of such an oligomeric compound. If the conjugate group also has an acid, the conjugate group is assumed to be completely protonated for the purpose of calculating the dosage. are in equilibrium. However, for the purpose of calculating the dosage, it is assumed that the modified oligonucleotide or oligomeric compound is present as a solvent-free, sodium acetate-free, anhydrous free acid. For example, when the modified oligonucleotide or oligomeric compound is in a solution containing sodium (e.g., physiological saline), the modified oligonucleotide or oligomeric compound can be partially or completely deprotonated and associate with Na+ ions. However, the mass of the proton is still counted in the weight of the dosage, and the mass of the Na+ ion is not counted in the weight of the dosage. Thus, for example, the dosage or administration unit of 10 mg of Compound No. 1263789, Compound No. 1287717, Compound No. 1287745, and Compound No. 1358996 is equal to the number of completely protonated molecules with a weight of 10 mg. This corresponds to 10.53 mg of solvent-free, sodium acetate-free, anhydrous sodiumated Compound No. 1263789, 10.53 mg of solvent-free, sodium acetate-free, anhydrous sodiumated Compound No. 1287717, 10.52 mg of solvent-free, sodium acetate-free, anhydrous sodiumated Compound No. 1287745, and 10.51 mg of solvent-free, sodium acetate-free, anhydrous sodiumated Compound No. 1358996. When the oligomeric compound contains a conjugate group, the mass of the conjugate group is included in the calculation of the dosage of such an oligomeric compound. If the conjugate group also has an acid, the conjugate group is assumed to be completely protonated for the purpose of calculating the dosage.
[0218] A specific composition Compound No.: 1263789 In certain embodiments, Compound No. 1263789 is a modified oligonucleotide having the sequence (5' to 3') of CACTTTCATAATGCTGGC (SEQ ID NO: 21), wherein each nucleoside is a 2'-MOE sugar moiety, the internucleoside linkages between nucleosides 2-3 and 4-5 are phosphodiester internucleoside linkages, and the internucleoside linkages between nucleosides 1-2, 3-4, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, and 17-18 are phosphorothioate internucleoside linkages, and each cytosine is 5-methylcytosine.
[0219] In certain embodiments, Compound No. 1263789 has the following chemical notation (5' to 3'): m C es A eo m C es T eo T es T es m C es A es T es A es A es T es G es m C es T es G es G es m C e (represented by SEQ ID NO: 21), where A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase 、 G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.
[0220] In certain embodiments, compound 1263789 is represented by the following chemical structure:
Chem.
[0221] Structure 1. Compound number 1263789 In certain embodiments, the sodium salt of compound 1263789 is represented by the following chemical structure:
Chem.
[0222] Structure 2. Sodium salt of compound number 1263789 Compound number: 1287717 In certain embodiments, compound number 1287717 is a modified oligonucleotide having the sequence (5' to 3') of TTCACTTTCATAATGCTGGC (SEQ ID NO: 22), wherein each nucleoside contains a 2'-MOE sugar moiety, the internucleoside linkages between nucleosides 1-2 and 19-20 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 17-18, and 18-19 are phosphorothioate internucleoside linkages, and each cytosine is 5-methylcytosine.
[0223] In certain embodiments, compound 1287717 has the following chemical notation (5' to 3'): T eo T es m C es A es m C es T es T es T es m C es A es T es Aes A es T es G es m C es T es G es G eo m C e (SEQ ID NO: 22), represented by Here, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase 、 G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.
[0224] In certain embodiments, compound 1287717 is represented by the following chemical structure:
Chemical Structure
[0225] Structure 3. Compound No. 1287717 In certain embodiments, the sodium salt of compound 1287717 is represented by the following chemical structure:
Chemical Structure
[0226] Structure 4. Sodium salt of compound No. 1287717 Compound No.: 1287745 In certain embodiments, compound number 1287745 is a modified oligonucleotide having the sequence (5' to 3') of TTCACTTTCATAATGCTGGC (SEQ ID NO: 22), wherein each of nucleosides 1 and 20 contains 2'-MOE, each of nucleosides 2 to 19 contains 2'-NMA, the internucleoside linkages between nucleosides 1 to 2 and 19 to 20 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, and 18 to 19 are phosphorothioate internucleoside linkages, and each cytosine is 5-methylcytosine.
[0227] In certain embodiments, compound number 1287745 has the following chemical notation (5' to 3'): T eo T ns m C ns A ns m C ns T ns T ns T ns m C ns A ns T ns A ns A ns T ns G ns m C ns T ns G ns G no m C e represented by (SEQ ID NO: 22), wherein, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase 、 G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, n is a 2'-NMA sugar moiety, s is a phosphorothioate internucleoside linkage, and o is a phosphodiester internucleoside linkage.
[0228] In certain embodiments, Compound 1287745 is represented by the following chemical structure: [Chemical Structure]
[0229] Structure 5. Compound No. 1287745 In certain embodiments, the sodium salt of Compound 1287745 is represented by the following chemical structure: [Chemical Structure]
[0230] Structure 6. Sodium salt of Compound No. 1287745 Compound No.: 1358996 In certain embodiments, Compound No. 1358996 is a modified oligonucleotide having the sequence (5' to 3') of CACTTTCATAATGCTGGC (SEQ ID NO: 21), wherein each nucleoside is a 2'-NMA sugar moiety, the internucleoside linkages between nucleosides 2-3 and 4-5 are phosphodiester internucleoside linkages, and the internucleoside linkages between nucleosides 1-2, 3-4, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, and 17-18 are phosphorothioate internucleoside linkages, and each cytosine is 5-methylcytosine.
[0231] In certain embodiments, Compound No. 1358996 has the following chemical notation (5' to 3'): m C ns A no m C ns T no T ns T ns m Cns A ns T ns A ns A ns T ns G ns m C ns T ns G ns G ns m C n (SEQ ID NO: 21), represented by Here, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase 、 G is a guanine nucleobase, T is a thymine nucleobase, n is a 2'-NMA sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.
[0232] In certain embodiments, compound 1358996 is represented by the following chemical structure:
Chemical Structure
[0233] Structure 7. Compound No. 1358996 In certain embodiments, the sodium salt of compound 1358996 is represented by the following chemical structure:
Chemical Structure
[0234] Structure 8. Sodium salt of compound No. 1358996 Certain comparative compositions In certain embodiments, Spinraza® (nusinersen; compound number 396443), which is approved for the treatment of SMA, is a comparative compound (see, e.g., Chiroboga, et al., Neurology, 86(10):890-897, 2016; Finkel, et al., Lancet, 338(10063):3017-3026, 2016; Finkel, et al., N.Engl.J.Med., 377(18):1723-1732 2017; Mercuri, et al., N.Engl.J.Med., 378(7):625-635, 2018; Montes, et al., Muscle Nerve. 60(4):409-414, 2019; Darras, et al., Neurology, 92(21):e2492-e2506, 2019). Spinraza® has been previously described in International Patent No. WO2010120820, which is incorporated herein by reference, and has the sequence (5’ to 3’) of TCACTTTCATAATGCTGG (SEQ ID NO: 23), wherein each nucleoside contains a 2’-MOE sugar moiety, each internucleoside linkage is a phosphorothioate internucleoside linkage, and each cytosine is 5-methylcytosine.
[0235] In certain embodiments, although not approved for human treatment, other previously described compounds including compound numbers 387954, 396442, 443305, and 819735 are comparative compounds.
[0236] Compound number 387954 has been previously described in International Patent No. WO2014 / 179620, which is incorporated herein by reference. Compound number 387954 has the sequence (5’ to 3’) of ATTCACTTTCATAATGCTGG (SEQ ID NO: 20), wherein each nucleoside is a 2’-MOE sugar moiety, each internucleoside linkage is a phosphorothioate internucleoside linkage, and each cytosine is 5-methylcytosine.
[0237] Compound number 396442 was previously described in International Patent No. WO2010 / 120820, which is incorporated herein by reference. Compound number 396442 has the sequence (5’ to 3’) of CACTTTCATAATGCTGGC (SEQ ID NO: 21), where each nucleoside is a 2’-MOE sugar moiety, each internucleoside linkage is a phosphorothioate internucleoside linkage, and each cytosine is 5-methylcytosine.
[0238] Compound number 443305 was previously described in International Patent No. WO2018 / 014041, which is incorporated herein by reference. Compound number 443305 has the sequence (5’ to 3’) of TCACTTTCATAATGCTGG (SEQ ID NO: 23), where each nucleoside is a 2’-NMA sugar moiety, each internucleoside linkage is a phosphorothioate internucleoside linkage, and each cytosine is 5-methylcytosine.
[0239] Compound number 819735 was previously described in International Patent No. WO2018 / 014041, which is incorporated herein by reference. Compound number 819735 has the sequence (5’ to 3’) of CACTTTCATAATGCTGGC (SEQ ID NO: 21), where each nucleoside is a 2’-NMA sugar moiety, each internucleoside linkage is a phosphorothioate internucleoside linkage, and each cytosine is 5-methylcytosine. [Table 1]
[0240] In certain embodiments, the compounds described herein are superior to the compounds described in International Patent Nos. WO2007 / 002390, WO2010 / 120820, WO2015 / 161170, and WO2018 / 014041 because they exhibit one or more improved properties (e.g., potency, efficacy, and tolerability).
[0241] For example, Compound No. 1263789, Compound No. 1287745, and Compound No. 1358996 each showed improved in vivo potency compared to Compound No. 396443. As shown in Example 5, Compound No. 1263789, Compound No. 1287745, and Compound No. 1358996 achieved ED 50 values of 13.3, 8.8, and 7.4, respectively, in the spinal cord. In comparison, Compound No. 396443 achieved an ED 50 value of 22.0 in the spinal cord. Thus, in this assay, each of Compound No. 1263789, Compound No. 1287745, and Compound No. 1358996 was more potent than Compound No. 396443.
[0242] For example, Compound No. 1263789, Compound No. 1287717, Compound No. 1287745, and Compound No. 1358996 each showed improved 3-hour FOB scores compared to Compound No. 396443, Compound No. 387954, and Compound No. 443305. As shown in Example 6, at 700 μg, Compound No. 1263789, Compound No. 1287717, Compound No. 1287745, and Compound No. 1358996 achieved 3-hour FOB scores of 0, 3.25, 1, and 0, respectively. In comparison, Compound No. 396443 achieved a 3-hour FOB score of 4.0 at half the dose (350 μg), and Compound No. 387954 and Compound No. 443305 achieved 3-hour FOB scores of 4.0 and 4.75, respectively, at the same dose (700 μg). Thus, in this assay, each of Compound No. 1263789, Compound No. 1287717, Compound No. 1287745, and Compound No. 1358996 was more tolerable than Compound No. 396443, Compound No. 387954, and Compound No. 443305.
[0243] For example, Compound No. 1263789, Compound No. 1287717, Compound No. 1287745, and Compound No. 1358996 each showed improved long-term tolerance as compared to Compound No. 396442 and Compound No. 819735. As shown in Example 7, Compound No. 1263789, Compound No. 1287717, Compound No. 1287745, and Compound No. 1358996 showed no adverse events and no Purkinje cell loss, and showed less than twice the cortical GFAP mRNA of the control. In comparison, 396442 and 819735 each showed adverse events, loss of Purkinje cells, and cortical GFAP mRNA more than twice that of the control in certain treated animals. Thus, in this assay, each of Compound No. 1263789, Compound No. 1287717, Compound No. 1287745, and Compound No. 1358996 was more tolerant than Compound No. 396442 and Compound No. 819735.
[0244] Incorporation by reference of non-limiting disclosures Each of the documents and patent publications recited herein is hereby incorporated by reference in its entirety. Although specific compounds, compositions, and methods are specifically described herein according to certain embodiments, the following examples are illustrative only of the compounds described herein and are not intended to be limiting. Each of the references cited in this application, such as GenBank accession numbers, is hereby incorporated by reference in its entirety.
[0245] The Sequence Listing accompanying this application identifies each sequence as either "RNA" or "DNA" as appropriate, but in reality, those sequences can be modified with any combination of chemical modifications. One of ordinary skill in the art will readily recognize that designations such as "RNA" or "DNA" for describing modified oligonucleotides are optional in certain instances. For example, an oligonucleotide containing a nucleoside with a 2'-OH sugar moiety and a thymine base can be described as DNA with a modified sugar moiety (2'-OH instead of 2'-H of DNA) or as RNA with a modified base (thymine (methylated uracil) instead of uracil of RNA). Thus, the nucleic acid sequences provided herein, including those in the Sequence Listing, are intended to encompass nucleic acids containing natural or modified RNA and / or DNA in any combination, including but not limited to such nucleic acids containing such nucleic acids with modified nucleobases. As a further example, without limitation, an oligomeric compound having a nucleobase sequence of "ATCGATCG" can, regardless of being modified or unmodified, be such a compound containing RNA bases having a sequence such as "AUCGAUCG", and those having some DNA bases and some RNA bases such as "AUCGATCG", and "AT The nucleic acid sequences provided herein, including but not limited to these, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to such nucleic acids containing such nucleic acids with modified nucleobases. As a further example, without limitation, an oligomeric compound having a nucleobase sequence of "ATCGATCG" can, regardless of being modified or unmodified, be such a compound containing RNA bases having a sequence such as "AUCGAUCG", and those having some DNA bases and some RNA bases such as "AUCGATCG", and "AT m CGAUUCG" (where m C represents a cytosine base having a methyl group at the 5-position), and any oligomeric compound having such a nucleobase sequence, including but not limited to these.
[0246] The specific compounds described herein (e.g., oligonucleotides) contain one or more asymmetric centers and thus can give rise to enantiomers, diastereomers, and other stereoisomeric arrangements that can be defined as (R) or (S) with respect to absolute stereochemistry, as α or β in the case of sugar anomers, or as (D) or (L) in the case of amino acids, etc. The compounds provided herein that are depicted or described as having a specific stereoisomeric arrangement include only the compounds shown. The compounds provided herein that are depicted or described by undefined stereochemistry include all such possible isomers in their stereorandom and optically pure forms, unless otherwise specified. Similarly, all cis and trans isomers and tautomers of the compounds of this specification are included, unless otherwise specified. The oligomeric compounds described herein include chirally pure or enriched mixtures, as well as racemic mixtures. For example, oligomeric compounds having multiple phosphorothioate nucleoside internucleoside linkages include compounds in which the chirality of the phosphorothioate nucleoside internucleoside linkages is either controlled or random. Unless otherwise specified, the compounds described herein are intended to include the corresponding salts.
[0247] The compounds described herein include variants in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated element. For example, compounds herein that contain a hydrogen atom 1 encompass all possible deuterium substitutions for each of the H hydrogen atoms. Isotope substitutions encompassed by the compounds of this specification include, but are not limited to, 1 in place of H 2 H or 3 H, 12 in place of C 13 C or 14 C, 14 in place of N 15 N, 16 in place of O 17 O or 18 O, and 32 in place of S 33 S,34 S, 35 S, or 36 S. In certain embodiments, non-radioactive isotope substitution can impart new properties beneficial for use as a therapeutic or research tool to an oligomeric compound. In certain embodiments, radioactive isotope substitution can render the compound suitable for research or diagnostic purposes such as imaging.
Examples
[0248] The following examples illustrate, but do not limit, certain embodiments of the present disclosure. Further, when particular embodiments are provided, the inventors contemplate the general applicability of those particular embodiments.
[0249] Example 1: Design of Modified Oligonucleotides Complementary to Human SMN2 Nucleic Acid Modified oligonucleotides complementary to human SMN2 nucleic acid were designed and synthesized as shown in the following table.
[0250] The modified oligonucleotides in the following table are 16, 17, 18, 19, or 20 nucleosides in length as indicated. The modified oligonucleotides include a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, a cEt sugar moiety, a 2'-OMe sugar moiety, and / or a 2'-β-D-deoxyribosyl sugar moiety as indicated. Each internucleoside linkage of the modified oligonucleotide is either a phosphorothioate internucleoside linkage or a phosphodiester internucleoside linkage as indicated. Cytosine is either non-methylated cytosine or 5-methylcytosine as indicated.
[0251] Each of the modified oligonucleotides listed in the following table is 100% complementary to SEQ ID NO: 1 (GENBANK accession number NT_006713.14 truncated at nucleotides 19939708 to 19967777), unless otherwise specified. Non-complementary nucleobases are shown in the column of the nucleic acid sequence in underlined bold italic font. Each of the modified oligonucleotides listed in the following table targets the active site of the SMN2 transcript for exon 7 inclusion. The "start site" indicates the most 5'-terminal nucleoside to which the modified oligonucleotide is complementary to the target nucleic acid sequence. The "stop site" indicates the most 3'-terminal nucleoside to which the modified oligonucleotide is complementary to the target nucleic acid sequence.
[0252] Table 2 The modified oligonucleotides in Table 2 below are 16, 17, 18, 19, or 20 nucleosides in length. Each nucleoside contains a 2'-MOE sugar moiety. The sugar motif of each modified oligonucleotide is listed in the sugar motif column, where each "e" represents a 2'-MOE sugar moiety. Each internucleoside linkage is either a phosphorothioate internucleoside linkage or a phosphodiester internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide is provided in the internucleoside linkage motif column, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine is 5-methylcytosine. Each of the modified oligonucleotides listed in the following Table 2 is 100% complementary to SEQ ID NO: 1 (GENBANK accession number NT_006713.14 truncated at nucleotides 19939708 to 19967777), unless otherwise specified. Non-complementary nucleobases are shown in the column of the nucleic acid sequence in underlined bold italic font. The "start site" indicates the most 5'-terminal nucleoside to which the modified oligonucleotide is complementary to the target nucleic acid sequence. The "stop site" indicates the most 3'-terminal nucleoside to which the modified oligonucleotide is complementary to the target nucleic acid sequence. [Table 2-1]
Table 2-2
Table 2-3
Table 2-4
Table 2-5
[0253] Table 3 The following modified oligonucleotides in Table 3 are 16, 17, 18, 19, or 20 nucleosides in length. Each nucleoside contains a 2'-NMA sugar moiety. The sugar motif of each modified oligonucleotide is listed in the sugar motif column, where each "n" represents a 2'-NMA sugar moiety. Each internucleoside linkage is either a phosphorothioate internucleoside linkage or a phosphodiester internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide is provided in the internucleoside linkage motif column, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine is 5-methylcytosine.
[0254] Each modified oligonucleotide listed in the following Table 3 is 100% complementary to SEQ ID NO: 1 (nucleotides 19 939708 to 19967777 of GENBANK accession number NT_006713.14 truncated). "Start site" indicates the most 5'-side nucleoside to which the modified oligonucleotide is complementary to the target nucleic acid sequence. "Stop site" indicates the most 3'-side nucleoside to which the modified oligonucleotide is complementary to the target nucleic acid sequence.
Table 3-1
Table 3-2
[0255] Table 4 The following modified oligonucleotides in Table 4 are 18 or 19 nucleosides in length. Each nucleoside contains either a 2'-MOE sugar moiety or a 2'-NMA sugar moiety. The sugar motif of each modified oligonucleotide is set forth in the sugar motif sequence, where each "e" represents a 2'-MOE sugar moiety and each "n" represents a 2'-NMA sugar moiety. Each internucleoside linkage is a phosphorothioate internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide is provided in the internucleoside linkage motif sequence, where each "s" represents a phosphorothioate internucleoside linkage. Each cytosine is 5-methylcytosine.
[0256] Each modified oligonucleotide listed in Table 4 below is 100% complementary to SEQ ID NO: 1 (GENBANK accession number NT_006713.14 truncated at nucleotides 19939708-19967777) unless otherwise indicated. Non-complementary nucleobases are shown in the nucleic acid sequence column in underlined bold italic font. "Start site" indicates the most 5'-side nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. "Stop site" indicates the most 3'-side nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. [Table 4]
[0257] Table 5 The following modified oligonucleotides in Table 5 are 16, 17 or 18 nucleosides in length. Each nucleoside contains either a 2'-MOE sugar moiety or a cEt sugar moiety. The sugar motif of each modified oligonucleotide is set forth in the sugar motif sequence, where each "e" represents a 2'-MOE sugar moiety and each "k" represents a cEt sugar moiety. Each internucleoside linkage is a phosphorothioate internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide is provided in the internucleoside linkage motif sequence, where each "s" represents a phosphorothioate internucleoside linkage. Each cytosine is 5-methylcytosine.
[0258] Each of the modified oligonucleotides listed in Table 5 below is 100% complementary to SEQ ID NO: 1 (GENBANK accession number NT_006713.14 truncated at nucleotides 19939708 to 19967777). "Start site" refers to the most 5'-terminal nucleoside to which the modified oligonucleotide is complementary to the target nucleic acid sequence. "Stop site" refers to the most 3'-terminal nucleoside to which the modified oligonucleotide is complementary to the target nucleic acid sequence. [Table 5-1] [Table 5-2] [Table 5-3]
[0259] Table 6 The modified oligonucleotides in Table 6 below are 19 or 20 nucleosides in length. Each nucleoside contains a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, a 2'-OMe sugar moiety, or a 2'-β-D-deoxyribosyl sugar moiety. The sugar motif of each modified oligonucleotide is described in the sugar motif sequence, where each "e" represents a 2'-MOE sugar moiety, each "n" represents a 2'-NMA sugar moiety, each "y" represents a 2'-OMe sugar moiety, and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety. Each internucleoside linkage is either a phosphorothioate internucleoside linkage or a phosphodiester internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide provided in the internucleoside linkage motif sequence is (5' to 3'): sssssssssssssssssso, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Cytosine is either non-methylated cytosine or 5-methylcytosine, and each lowercase "c" in the nucleobase sequence represents non-methylated cytosine, and each uppercase "C" in the nucleobase sequence represents 5-methylcytosine.
[0260] Unless otherwise specified, each nucleobase of the modified oligonucleotides listed in Table 6 below is complementary to SEQ ID NO: 1 (GENBANK accession number NT_006713.14 truncated at nucleotides 19939708-19967777). Non-complementary nucleobases are shown in the column of the nucleic acid sequence in underlined bold italic font. The "start site" indicates the most 5'-terminal nucleoside to which the modified oligonucleotide is complementary to the target nucleic acid sequence. The "stop site" indicates the most 3'-terminal nucleoside to which the modified oligonucleotide is complementary to the target nucleic acid sequence. [Table 6-1] [Table 6-2]
[0261] Table 7 The modified oligonucleotides in Table 7 below are 19 or 20 nucleosides in length. Each nucleoside contains a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, or a 2'-β-D-deoxyribosyl sugar moiety. The sugar motif of each modified oligonucleotide is described in the sugar motif column, where each "e" represents a 2'-MOE sugar moiety, each "n" represents a 2'-NMA sugar moiety, and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety. Each internucleoside linkage is either a phosphorothioate internucleoside linkage or a phosphodiester internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide provided in the internucleoside linkage motif column is (5' to 3'): ssssssssssssssssssoo, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine is 5-methylcytosine.
[0262] Unless otherwise specified, each nucleobase of the modified oligonucleotides listed in Table 7 below is complementary to SEQ ID NO: 1 (GENBANK accession number NT_006713.14 truncated at nucleotides 19939708 to 19967777). Non-complementary nucleobases are shown in the column of the nucleic acid sequence in underlined bold italic font. The "start site" indicates the most 5'-terminal nucleoside to which the modified oligonucleotide is complementary to the target nucleic acid sequence. The "stop site" indicates the most 3'-terminal nucleoside to which the modified oligonucleotide is complementary to the target nucleic acid sequence. [Table 7-1] [Table 7-2] [Table 7-3]
[0263] Table 8 The modified oligonucleotides in Table 8 below are each 19 nucleosides in length. Each nucleoside contains a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, or a 2'-β-D-deoxyribosyl sugar moiety. The sugar motif of each modified oligonucleotide is described in the sugar motif column, where each "e" represents a 2'-MOE sugar moiety, each "n" represents a 2'-NMA sugar moiety, and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety. Each internucleoside linkage is either a phosphorothioate internucleoside linkage or a phosphodiester internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide provided in the internucleoside linkage motif column is (5' to 3'): sssssssssssssososso, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine is 5-methylcytosine.
[0264] Each nucleobase of the modified oligonucleotides listed in Table 8 below is complementary to SEQ ID NO: 1 (GENBANK accession number NT_006713.14 truncated at nucleotides 19939708 to 19967777), unless otherwise specified. Non-complementary nucleobases are shown in the column of the nucleic acid sequence in underlined bold italic font. The "starting site" indicates the most 5'-side nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. The "stopping site" indicates the most 3'-side nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. [Table 8]
[0265] Table 9 The modified oligonucleotides in Table 9 below are each 19 nucleosides in length. Each nucleoside contains a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, or a 2'-β-D-deoxyribosyl sugar moiety. The sugar motif of each modified oligonucleotide is described in the sugar motif column, where each "e" represents a 2'-MOE sugar moiety, each "n" represents a 2'-NMA sugar moiety, and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety. Each internucleoside linkage is either a phosphorothioate internucleoside linkage or a phosphodiester internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide provided in the internucleoside linkage motif column is (5' to 3'): sssssssssssssssosso, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine is 5-methylcytosine. The internucleoside linkage motif of each modified oligonucleotide is (5' to 3'): sssssssssssssssosso, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine is 5-methylcytosine.
[0266] Unless otherwise specified, each nucleobase of the modified oligonucleotides listed in Table 9 below is complementary to SEQ ID NO: 1 (GENBANK accession number NT_006713.14 truncated at nucleotides 19939708 to 19967777). Non-complementary nucleobases are shown in the column of the nucleic acid sequence in underlined bold italic font. The "starting site" indicates the most 5'-side nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. The "stopping site" indicates the most 3'-side nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. [Table 9]
[0267] Table 10 The modified oligonucleotides in Table 10 below are each 19 nucleosides in length. Each nucleoside contains a 2'-MOE sugar moiety or a 2'-NMA sugar moiety. The sugar motif of each modified oligonucleotide is described in the sugar motif column, where each "e" represents a 2'-MOE sugar moiety and each "n" represents a 2'-NMA sugar moiety. Each internucleoside linkage is either a phosphorothioate internucleoside linkage or a phosphodiester internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide provided in the internucleoside linkage motif column is (5' to 3'): ossssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine is 5-methylcytosine.
[0268] Unless otherwise specified, each nucleobase of the modified oligonucleotides listed in Table 10 below is complementary to SEQ ID NO: 1 (GENBANK accession number NT_006713.14 truncated at nucleotides 19939708 to 19967777). Non-complementary nucleobases are shown in the column of the nucleic acid sequence in underlined bold italic font. The "starting site" indicates the most 5'-side nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. The "stopping site" indicates the most 3'-side nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Indicates the most 5'-terminal nucleoside for which the ribonucleotide is complementary to the target nucleic acid sequence. "Stop site" indicates the most 3'-terminal nucleoside for which the modified oligonucleotide is complementary to the target nucleic acid sequence.
Table 10
[0269] Table 11 The following modified oligonucleotides in Table 11 are each 20 nucleosides in length. Each nucleoside contains a 2'-MOE sugar moiety or a 2'-NMA sugar moiety. The sugar motif of each modified oligonucleotide is described in the sugar motif sequence, where each "e" represents a 2'-MOE sugar moiety and each "n" represents a 2'-NMA sugar moiety. Each internucleoside linkage is either a phosphorothioate internucleoside linkage or a phosphodiester internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide provided in the internucleoside linkage motif sequence is (5' to 3'): osssssssssssssssso, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine is 5-methylcytosine.
[0270] Each modified oligonucleotide listed in Table 11 below is 100% complementary to SEQ ID NO: 1 (GENBANK accession number NT_006713.14 truncated at nucleotides 19939708 to 19967777). "Start site" indicates the most 5'-terminal nucleoside for which the modified oligonucleotide is complementary to the target nucleic acid sequence. "Stop site" indicates the most 3'-terminal nucleoside for which the modified oligonucleotide is complementary to the target nucleic acid sequence.
Table 11
[0271] Example 2: Activity of a modified oligonucleotide complementary to human SMN2 in transgenic mice, single administration (35 μg) The activity of the selected modified oligonucleotide was tested in human SMN2 transgenic mice. The Taiwan strain of SMNIII type mice was obtained from Jackson Laboratory (Bar Harbor, Maine). These mice lack mouse SMN and are homozygous for human SMN2 (mSMN- / -; hSMN2+ / +; FVB.Cg-Tg(SMN2)2HungSMN1tm1Hung / J, stock number 005058; Bar Harbor, Maine), or heterozygous for mouse SMN obtained by breeding HOM / HOM (stock number 00005058) to FVB / NJ (stock number 001800), and heterozygous for human SMN2 (mSMN+ / -; hSMN2+ / -; FVB.Cg-Tg(SMN2)2HungSMN1tm1Hung / J).
[0272] Treatment Homozygous or heterozygous transgenic mice were each divided into groups of 4 mice. Each mouse was administered a single dose of 35 μg of the modified oligonucleotide by ICV bolus injection. Comparative compounds numbers 387954, 396442, and 396443 were also tested in this assay. A group of 4 mice was administered PBS as a negative control.
[0273] RNA analysis Two weeks after treatment, the mice were sacrificed and RNA was extracted from cortical brain tissue and spinal cord for real-time qPCR analysis of SMN2 RNA. The primer-probe set hSMN2vd#4_LTS00216_MGB (forward sequence: GCTGATGCTTTGGGAAGTATGTTA (SEQ ID NO: 11); reverse sequence CACCTTCCTTCTTTTTGATTTTGTC, designated herein as SEQ ID NO: 12; probe sequence TACATGAGTGGCTATCATACT (SEQ ID NO: 13)) was used to analyze exon 7 (exon 7 +) containing SMN2 RNA was determined. Using the primer-probe set hSMN2_Sumner68_PPS50481 (forward sequence: CATGGTACATGAGTGGCTATCATACTG (SEQ ID NO: 14); reverse sequence: TGGTGTCATTTAGTGCTGCTCTATG (SEQ ID NO: 15); probe sequence CCAGCATTTCCATATAATAGC (SEQ ID NO: 16)), the amount of SMN2 RNA excluding exon 7 (exon 7 - ) was determined. The total SMN2 RNA level was measured using the primer-probe set hSMN2_LTS00935 (forward sequence: CAGGAGGATTCCGTGCTGTT (SEQ ID NO: 17); reverse sequence: CAGTGCTGTATCATCCCAAATGTC (SEQ ID NO: 18); probe sequence: ACAGGCCAGAGCGAT (SEQ ID NO: 19)).
[0274] The results are expressed as the fold change in RNA levels compared to the PBS control, normalized to the total SMN2 level. Tables 12 - 18 represent different experiments respectively.
Table 12
Table 13
Table 14
Table 15
Table 16
Table 17
Table 18
[0275] Example 3: Activity of a modified oligonucleotide complementary to human SMN2 in transgenic mice, single administration (15 μg) The activity of the selected modified oligonucleotide was tested in human SMN2 transgenic mice essentially as described in Example 2 above. Comparative compound numbers 396 443 and 819735 were also tested in this assay. The transgenic mice were divided into groups of 4 mice each. Each mouse was administered a single dose of 15 μg of the modified oligonucleotide by ICV bolus injection. A group of 4 mice was administered PBS as a negative control. Two weeks after treatment, the mice were sacrificed and RNA was extracted from the cortical brain tissue and spinal cord for real-time qPCR analysis of SMN2 RNA. The results are expressed as the fold change in RNA levels compared to the PBS control, normalized to the total SMN2 level. Tables 19 - 23 represent different experiments respectively. [Table 19] [Table 20] [Table 21] [Table 22] [Table 23]
[0276] Example 4: Activity of a modified oligonucleotide complementary to human SMN2 in transgenic mice, single dose (70 μg) The activity of the modified oligonucleotides was tested in human SMN2 transgenic mice essentially as described in Example 2 above. The transgenic mice were divided into groups of 4 mice each. Each mouse received a single dose of 70 μg of the modified oligonucleotide via ICV bolus injection. One group of 4 mice received PBS as a negative control. After two weeks of treatment, the mice were sacrificed and RNA was extracted from cortical brain tissue and spinal cord for real-time qPCR analysis of SMN2 RNA. Results are expressed as fold change in RNA levels compared to PBS control, normalized to total SMN2 levels. [Table 24]
[0277] Example 5: Transgenic mice, multiple doses of modified oocytes complementary to human SMN2 Oligonucleotide activity The activity of selected modified oligonucleotides above was tested in human SMN2 transgenic mice essentially as described in Example 2 above. Comparative compound no. 396443 was also tested in this assay. Transgenic mice were divided into groups of 4 mice each. Each mouse received a single ICV injection of modified oligonucleotides at multiple doses as shown in the table below. One group of 4 mice received PBS as a negative control. After two weeks of treatment, mice were sacrificed and RNA was extracted from coronal brain and spinal cord for real-time qPCR analysis of SMN2 RNA. Results are expressed as fold change in RNA levels compared to PBS control, normalized to total SMN2 levels. Exon inclusion (exon 7) + )'s ED 50 was calculated using GraphPad Prism7 using a nonlinear regression, four-parameter dose-response curve [Y=Bottom+(Top-Bottom) / (1+(10^logEC50 / X)^HillSlope)]. [Table 25]
[0278] Example 6: Tolerance of Modified Oligonucleotides Complementary to SMN2 in Wild-Type Mice in a 3-Hour Test The above-described modified oligonucleotides were tested in wild-type female C57 / Bl6 mice to evaluate tolerance. Each of the wild-type female C57 / Bl6 mice was injected once ICV with 700 μg of the modified oligonucleotides described in the following table. Comparative compound number 396443 was also tested in this assay at a dose of 350 μg. Comparative compound numbers 387954, 3 96442, 443305, and 819735 were also tested in this assay at a dose of 700 μg. Each treatment group consisted of 4 mice. A group of 4 mice was administered PBS as a negative control for each experiment (identified in the separate tables below). The mice were evaluated 3 hours after injection according to 7 different criteria. The criteria were as follows. (1) The mice were active, sensitive, and had a good response. (2) The mice stood up or rounded their backs without stimulation. (3) The mice showed some movement without stimulation. (4) When the mice were lifted, they showed forward movement. (5) When the mice were lifted, they showed some movement. (6) The mice reacted when their tails were pinched. (7) Regular breathing. For each of the 7 criteria, a subscore of 0 was given if the criterion was met and a subscore of 1 was given if it was not (Functional Observation Composite Score or FOB). After evaluating all 7 criteria, the scores were summed and averaged within each treatment group. The results are shown in the following tables. Tables 26 to 49 represent different experiments, respectively. [Table 26] [Table 27] [Table 28] [Table 29] [Table 30]
Table 31
Table 32
Table 33
Table 34
Table 35
Table 36
Table 37
Table 38
Table 39
Table 40
Table 41
Table 42
Table 43
Table 44
Table 45
Table 46
Table 47
Table 48
Table 49
[0279] Example 7: Tolerance of Modified Oligonucleotides Complementary to Human SMN2 in Rats, Long-Term Evaluation In another test conducted under the same conditions, the selected modified oligonucleotides were tested in Sprague-Dawley rats to evaluate the long-term tolerance of the oligonucleotides. Comparative compound numbers 396442 and 819735 were also tested in this assay. Each Sprague-Dawley rat was administered a single intrathecal (IT) delivery dose of 3 mg of the oligonucleotide or PBS. One week after treatment, the body weight of each animal was measured, and a trained observer evaluated adverse events weekly. Adverse events were defined as neurological dysfunctions that were not typical in PBS-treated control animals and included, but were not limited to, abnormal limb extension, abnormal gait, tremors, abnormal respiration, paralysis, and contractions. The occurrence of adverse events was defined as the week after dosing when the dysfunction was first recorded. If no adverse events were observed, the occurrence was none (-). The occurrence of adverse events usually correlates with growth retardation defined by the lack of weight gain / maintenance similar to PBS-treated animals. A similar tolerance evaluation is described in Oestergaard et al., Nucleic Acids Res., 2013 Nov, 41(21), 9634-9650 and Southwell et al., Mol Ther., 2014 Dec, 22(12), 2093-2106.
[0280] At the end of the experiment, the rats were sacrificed and tissues were collected. Histopathology was performed with calbindin staining It was performed on cerebellar sections using []. As shown in the table below, loss of Purkinje cells was observed in calbindin-stained cerebellar sections. The cerebellum and spinal cord were also evaluated using an antibody specific to the modified oligonucleotide. Animals showing no uptake of the oligonucleotide were excluded from the histopathological analysis. Histology of animals sacrificed early due to adverse events was not completed. Furthermore, cortical GFAP, a marker of astroglia (Abdelhak, et al., Scientific Reports, 2018, 8, 14798), was measured using RT-PCR, and it is shown below that the average increase exceeds 2-fold.
Table 50
[0281] Example 8: Tolerance and Pharmacokinetics of Modified Oligonucleotides in Non-Human Primates with Single or Repeated Dosing Cynomolgus monkeys were treated with a modified oligonucleotide to investigate the local and systemic tolerance and pharmacokinetics of the modified oligonucleotide. Each group received artificial CSF or the modified oligonucleotide as a single lumbar intrathecal bolus injection (IT), or in the case of the repeated dosing group, an IT bolus injection was performed on the first day of the experiment and then at subsequent time points. Tissues were collected one week after the last injection.
[0282] In the single-dose study, a single dose of the modified oligonucleotide was administered to the monkeys and tolerance was evaluated. Representative doses for the single-dose study in adult cynomolgus monkeys include 1 mg, 3 mg, 7 mg, and 35 mg.
[0283] In the repeated-dose study, the monkeys were administered an IT bolus dose on the first day of the study and then IT bolus injections weekly (e.g., on days 8, 15, and 22 in a 4-week study) or monthly (e.g., on days 29, 57, and 84 in a 13-week study). Representative doses for the repeated-dose study in adult cynomolgus monkeys include 1 mg, 3 mg, 7 mg, and 35 mg. include 1 mg, 3 mg, 7 mg, and 35 mg.
[0284] The tolerance evaluation is based on physical and neurological examinations including clinical observation, body weight, food consumption, sensorimotor reflexes, brain and spinal cord reflexes, coagulation, hematology, clinical chemistry (blood and cerebrospinal fluid (CSF)), cell count, and anatomical pathology evaluation. Macroscopic abnormalities are recorded and a complete autopsy is performed. Organ weights are measured and microscopic examinations are carried out. Blood is collected for complement analysis. Additionally, blood, CSF, and tissue (at autopsy) are collected for toxicokinetic evaluation.
[0285] The tolerance of the modified oligonucleotide is analyzed in brain and spinal cord tissues by measuring the Aif1 and Gfap levels in cynomolgus monkeys treated with the modified oligonucleotide or the control. Samples of the brain and spinal cord are collected, snap-frozen in liquid nitrogen, and stored frozen (-60°C to -90°C). At the time of sampling, a 2-mm biopsy punch is used to collect samples from the frozen tissue for RNA analysis. The punches are obtained from multiple brain and spinal cord regions.
[0286] Example 9: Phase Ia Human Clinical Trial Using Compound Numbers 1263789, 1287717, 1287745, or 1358996 The safety, tolerance, pharmacokinetics, pharmacodynamics, and efficacy of modified oligonucleotides complementary to human SMN2 are evaluated in a clinical trial setting. Single and / or multiple administrations of the modified oligonucleotide are evaluated in patients with confirmed SMA such as type I SMA, type II SMA, type III SMA, or type IV SMA.
[0287] The safety of the patients is closely monitored during the trial period. The evaluation of safety and tolerance includes physical examination and standard neurological evaluation (including fundus), vital signs (HR, BP, orthostatic changes, body weight), ECG, AE and concomitant medications, Columbia Suicide Severity Rating Scale (C-SSRS), CSF safety laboratory (cell count, protein, glucose), plasma laboratory tests (clinical chemistry, hematology), and urine tests.
[0288] An effectiveness assessment appropriate for age and type is selected, for example, the Hammersmith Functional Motor Scale for Children (HFMSE), a highly reliable and validated tool used to evaluate the motor function of children with SMA; the Pediatric Quality of Life (PedsQL™) Measure 4.0 Generic Scale, the Pediatric Quality of Life 3.0 Neuromuscular Module; Compound Muscle Action Potential (CMAP); Motor Unit Number Estimation (MUNE); Upper Limb Module (ULM); and Six Minute Walk Test (6MWT) (Darras, et al., Neurology, 2019, 92: e2492 - e2506).
[0289] Example 10: Design of Modified Oligonucleotides Complementary to Human SMN2 Nucleic Acid Modified oligonucleotides complementary to human SMN2 nucleic acid were designed and synthesized as shown in the following table.
[0290] Each modified oligonucleotide listed in the following table is 100% complementary to SEQ ID NO: 1 (GENBANK accession number NT_006713.14 truncated at nucleotides 19939708 - 19967777). "Start site" indicates the most 5'-side nucleoside where the modified oligonucleotide is complementary to the target nucleic acid sequence. "Stop site" indicates the most 3'-side nucleoside where the modified oligonucleotide is complementary to the target nucleic acid sequence.
[0291] The modified oligonucleotides in the following table are 18 nucleosides in length. Each nucleoside contains either a 2'-MOE sugar moiety or a 2'-NMA sugar moiety. The sugar motif of each modified oligonucleotide is described in the sugar motif column, where each "e" represents a 2'-MOE sugar moiety and each "n" represents a 2'-NMA sugar moiety. Each internucleoside linkage is a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, a methoxypropylphospho It is either a sulfonate nucleoside internucleoside linkage or a mesyl phosphoramidate (MsP) nucleoside internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide is provided in the internucleoside linkage motif sequence, where each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, each "x" represents a methoxypropylphosphonate internucleoside linkage, and each "z" represents a mesyl phosphoramidate (MsP) nucleoside internucleoside linkage. Each cytosine is 5-methylcytosine. The modified oligonucleotide 449320 has been previously described in International Patent No. WO2015 / 161170A2.
Table 51
[0292] All of the modified oligonucleotides in the following table consist of the sequence (5' to 3'): TCACTTTCATAATGCTGG (SEQ ID NO: 23). Each modified oligonucleotide described in the following table is 100% complementary to SEQ ID NO: 1 (as described above). The "starting site" indicates the most 5'-terminal nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. The "stopping site" indicates the most 3'-terminal nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
[0293] The modified oligonucleotides in the following table are 18 nucleosides in length. Each nucleoside contains either a 2'-MOE sugar moiety or a 2'-NMA sugar moiety. The sugar motif of each modified oligonucleotide is described in the sugar motif sequence, where each "e" represents a 2'-MOE sugar moiety and each "n" represents a 2'-NMA sugar moiety. Each internucleoside linkage is phosphorothio It is any one of an ate nucleoside internucleoside linkage, a phosphodiester nucleoside internucleoside linkage, or a mesyl phosphoramidate (MsP) nucleoside internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide is provided in the internucleoside linkage motif sequence, where each "s" represents a phosphorothioate nucleoside internucleoside linkage, each "o" represents a phosphodiester nucleoside internucleoside linkage, and each "z" represents a mesyl phosphoramidate (MsP) nucleoside internucleoside linkage. Each cytosine is 5-methylcytosine. The modified oligonucleotides in the following table are conjugated to a 6-palmitamidohexyl phosphate conjugate group attached to the 5'-OH of the oligonucleotide. The structure of the conjugate group is as follows. [Chemical formula] [Table 52]
[0294] All of the modified oligonucleotides in the following table consist of the sequence (5' to 3'): TCACTTTCATAATGCTGG (SEQ ID NO: 23), with the starting site 27062 and the stopping site 27079 of SEQ ID NO: 1 (described above), where the "starting site" indicates the most 5'-side nucleoside to which the modified oligonucleotide is complementary to the target nucleic acid sequence, and the "stopping site" indicates the most 3'-side nucleoside to which the modified oligonucleotide is complementary to the target nucleic acid sequence.
[0295] The modified oligonucleotides in the following table are 18 nucleoside in length. The sugar and internucleoside linkage motifs of each modified oligonucleotide are shown in the columns of sequence and chemical notation, where each subscript letter "n" represents a 2'-NMA sugar moiety, each subscript letter "[DMA]" represents a 2'-O-(N,N-dimethyl)acetamide moiety, each subscript letter "[NEA]" represents a 2'-O-(N-ethyl)acetamide moiety, each subscript letter "[NPA]" represents a 2'-O-(N-propyl)acetamide moiety, each subscript letter "[NcPA]" represents a 2'O-(N-cyclopropyl)acetamide moiety, each subscript letter "[McPA]" represents a 2'-O-(N-cyclopropylmethyl)acetamide moiety, and each subscript letter "s" represents a phosphorothioate internucleoside linkage. Each cytosine is 5-methylcytosine, and the superscript letter "m" before a cytosine residue ( m C) represents 5-methylcytosine. The structure of each sugar shown in the following table is as follows.
Chemical formula
Table 53
[0296] Example 11: Activity of a modified oligonucleotide complementary to human SMN2 in transgenic mice with a single administration (35 μg) The activity of the selected modified oligonucleotide described above was tested in human SMN2 transgenic mice essentially as described in Example 2 above.
[0297] Treatment Transgenic mice were divided into groups of 4 mice each. Each mouse received a single ICV bolus of modified oligonucleotide at the doses shown in the table below. One group of 4 mice received PBS as a negative control. After two weeks of treatment, mice were sacrificed and RNA was extracted from coronal brain and spinal cord for real-time qPCR analysis of SMN2 RNA. Results are expressed as fold change in RNA levels compared to PBS control, normalized to total SMN2 levels. Exon inclusion (exon 7) + )'s ED 50 was calculated using GraphPad Prism7 using a nonlinear regression, four-parameter dose-response curve [Y=Bottom+(Top-Bottom) / (1+(10^logEC50 / X)^HillSlope)].
[0298] RNA analysis After two weeks of treatment, the mice were sacrificed and RNA was extracted from the cortical brain tissue and spinal cord to characterize SMN2 Real-time qPCR analysis of RNA was performed. The primer-probe set hSMN2vd#4_LTS00216_MGB was used to identify exon 7 (exon 7 + ) The amount of SMN2 RNA was measured. The primer probe set hSMN2_Sumner68_PPS50481 was used to detect exon 7 (exon 7 - The amount of SMN2 RNA excluding the 100% SMN2 mRNA was measured. Total SMN2 RNA levels were measured using primer probe set hSMN2_LTS00935. Results are expressed as fold change in RNA levels compared to PBS control, normalized to total SMN2 levels. [Table 54] [Table 55]
[0299] Example 12: Activity of modified oligonucleotides complementary to human SMN2 in transgenic mice, single dose (15 μg) The activity of the selected modified oligonucleotide was tested in human SMN2 transgenic mice essentially as described in Example 2 above.
[0300] Treatment The transgenic mice were divided into groups of four mice each. Each mouse was administered a single ICV bolus of the modified oligonucleotide at the doses shown in the following table. PBS was administered to one group of four mice as a negative control. Two weeks after treatment, the mice were sacrificed and RNA was extracted from the cerebral cortex and spinal cord for real-time qPCR analysis of SMN2 RNA. The results are expressed as the fold change in RNA level compared to the PBS control, normalized to the total SMN2 level. Exon inclusion (exon 7 + ) of ED 50 was calculated using GraphPad Prism7 with a non-linear regression, four-parameter dose-response curve [Y = Bottom + (Top - Bottom) / (1 + (10^lo gEC50 / X)^HillSlope)].
[0301] RNA analysis Two weeks after treatment, the mice were sacrificed and RNA was extracted from the cortical brain tissue and spinal cord for real-time qPCR analysis of SMN2 RNA. The amount of SMN2 RNA containing exon 7 (exon 7 + ) was measured using the primer-probe set hSMN2vd#4_LTS00216_MGB. The amount of SMN2 RNA excluding exon 7 (exon 7 - ) was measured using the primer-probe set hSMN2_Sumner68_PPS50481. The total SMN2 RNA level was measured using the primer-probe set hSMN2_LTS00935. The results are expressed as the fold change in RNA level compared to the PBS control, normalized to the total SMN2 level.
Table 56
[0302] Example 13: Transgenic mouse, activity of modified oligonucleotide complementary to human SMN2 in multiple administrations The activity of the selected modified oligonucleotide was tested in human SMN2 transgenic mice essentially as described in Example 2 above.
[0303] Treatment The transgenic mice were divided into groups of 4 mice each. Each mouse received a single ICV injection of the modified oligonucleotide in multiple administrations as shown in the following table. A group of 4 mice was administered PBS as a negative control. Two weeks after treatment, the mice were sacrificed, and RNA was extracted from the cerebral cortex and spinal cord for real-time qPCR analysis of SMN2 RNA. The results are expressed as the fold change in RNA level compared to the PBS control, normalized to the total SMN2 level. Exon inclusion (exon 7 + ) of ED 50 was calculated using GraphPad Prism7 with a non-linear regression, 4-parameter dose-response curve [Y = Bottom + (Top - Bottom) / (1 + (10^logEC50 / X)^HillSlope)].
[0304] RNA analysis Two weeks after treatment, the mice were sacrificed, and RNA was extracted from the cortical brain tissue and spinal cord for real-time qPCR analysis of SMN2 RNA. The amount of SMN2 RNA containing exon 7 (exon 7 + ) was measured using the primer-probe set hSMN2vd#4_LTS00216_MGB. The amount of SMN2 RNA excluding exon 7 (exon 7 - ) was measured using the primer-probe set hSMN2_Sumner68_PPS50481. The total SMN2 RNA level was measured using the primer-probe set hSMN2_LTS00935. The results are expressed as the fold change in RNA level compared to the PBS control, normalized to the total SMN2 level.
Table 57
Table 58-1
Table 58-2
Table 59
[0305] Example 15: Tolerance of Modified Oligonucleotides Complementary to SMN2 in Wild-Type Mice The above modified oligonucleotides were tested in wild-type female C57 / Bl6 mice to evaluate the tolerance of the oligonucleotides. Each of the wild-type female C57 / Bl6 mice was administered a single ICV injection of 700 μg of the modified oligonucleotides described in the following table. Each treatment group consisted of 4 mice. A group of 4 mice was administered PBS as a negative control for each experiment (identified in the separate tables below). The mice were evaluated 3 hours after injection according to 7 different criteria. The criteria were as follows: (1) The mice were active, sensitive, and had a good response. (2) The mice stood up or rounded their backs without stimulation. (3) The mice showed some movement without stimulation. (4) When the mice were lifted, they showed forward movement. (5) When the mice were lifted, they showed some movement. (6) The mice reacted when their tails were pinched. (7) Regular breathing. For each of the 7 criteria, a subscore of 0 was given if the criterion was met and a subscore of 1 was given if it was not (Functional Observation Battery or FOB). After evaluating all 7 criteria, the scores were summed for each mouse and averaged within each treatment group. The results are shown in the following table.
Table 60
Claims
1. The chemical structure: 【Chemistry 1】 23. A pharmaceutical composition for treating spinal muscular atrophy (SMA), comprising a modified oligonucleotide based on the formula (I) or a salt thereof, and a pharma- ceutically acceptable diluent.
2. 2. The pharmaceutical composition of claim 1, which is a sodium or potassium salt.
3. The chemical structure: 【Chemistry 2】 23. A pharmaceutical composition for treating spinal muscular atrophy (SMA), comprising a modified oligonucleotide based on and a pharma- ceutically acceptable diluent.
4. The following chemical notations: m C ns A no m C ns T no T ns T ns m C ns A ns T ns A ns A ns T ns G ns m C ns T ns G ns G ns m C n A pharmaceutical composition for treating spinal muscular atrophy (SMA) comprising an oligomeric compound comprising a modified oligonucleotide according to (SEQ ID NO:21) and a pharma- ceutical acceptable diluent, wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; n is a 2'-NMA sugar moiety; s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage; The above pharmaceutical composition.
5. The pharmaceutical composition according to any one of claims 1 to 4, wherein the SMA is any of SMA type I, SMA type II, SMA type III, or SMA type IV.
6. The pharmaceutical composition of claim 5, wherein at least one symptom of SMA is ameliorated.
7. 7. The pharmaceutical composition of claim 6, wherein the symptoms are any of the following: muscle weakness; inability or reduced ability to sit, stand and / or walk upright; reduced neuromuscular activity; reduced electrical activity of one or more muscles; reduced breathing; inability or reduced ability to eat, drink and / or breathe without assistance; weight loss or reduced weight gain; and / or reduced survival rate.
8. The pharmaceutical composition according to any one of claims 1 to 7, wherein the pharma- cerebrospinal fluid (aCSF) or phosphate buffered saline (PBS) is used as the pharma- ceutical composition.
9. The pharmaceutical composition of claim 8 , wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and aCSF.
10. The pharmaceutical composition of claim 8 , wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and PBS.
11. 9. The pharmaceutical composition of claim 8, wherein the pharmaceutical composition consists essentially of said oligomeric compound and aCSF.
12. 9. The pharmaceutical composition of claim 8, wherein the pharmaceutical composition consists essentially of the oligomeric compound and PBS.
13. The pharmaceutical composition of claim 8 , wherein the pharmaceutical composition is administered intrathecally.
Citation Information
Patent Citations
Compounds and methods for modulation of SMN2
JP2019525918A
Compositions and methods for modulation of SMN2 splicing in a subject
WO2015161170A2