Nucleic Acid Aptamer of Influenza Virus and Detection

Abstract

To provide a nucleic acid aptamer of A / H1N1pdm09 influenza virus.SOLUTION: The present invention discloses a nucleic acid aptamer having binding affinity to A / H1N1pdm09 influenza virus, comprising a nucleic acid including a specific base sequence, or the base sequence in which one or several bases are deleted, substituted, or added in the specific base sequence.SELECTED DRAWING: Figure 4

Description

Technical Field

[0001] The present disclosure relates to a nucleic acid aptamer against influenza A / H1N1pdm09 virus. The present disclosure relates to the detection of influenza A / H1N1pdm09 virus using the nucleic acid aptamer.

Background Art

[0002] Influenza viruses are classified into four types: A, B, C, and D. Types A and B cause annual epidemics in humans as seasonal influenza. Influenza A virus is classified into 144 subtypes according to the combination of hemagglutinin (16 types of H1 - H16) and neuraminidase (9 types of N1 - N9), which are proteins protruding on the virus surface, and are expressed as H1N1, H2N2, H3N2, etc.

[0003] In recent years, the influenza viruses that have infected humans and caused epidemics as the causative agents of seasonal influenza are influenza A / H1N1pdm09 virus (hereinafter also referred to as A / H1N1pdm09) that caused a global epidemic in 2009, and H3N2 virus (hereinafter also referred to as H3N2). Although these influenza viruses do not show a high fatality rate, there are reports of different clinical courses for each subtype, such that A / H1N1pdm09 causes cases of viral pneumonia and encephalopathy mainly in children and young people, which are more prominent compared to H3N2, and H3N2 causes cases of bacterial pneumonia after influenza mainly in the elderly (Non - Patent Document 1). In addition, since multiple A subtypes may co - circulate during the same season, there are also patients who are infected with influenza virus twice within one season (Non - Patent Document 2). Discriminating A subtypes is important not only from the perspective of treatment and observation but also from the perspective of preventing repeated and overlapping infections.

[0004] So far, antibodies and aptamers for subtype discrimination have been developed, and subtype discrimination test kits using these have also been developed (Patent Document 1, Non-Patent Document 3). However, since the subtypes that prevail vary by year and region, and since HA and NA, which are the targets of subtype discrimination, are present on the virus surface and are thus prone to mutation, it is not always possible to discriminate the prevailing strain.

Prior Art Documents

Patent Documents

[0005]

Patent Document 1

Non-Patent Documents

[0006]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Summary of the Invention

Problems to be Solved by the Invention

[0007] Among existing aptamers, a decrease in the binding ability to prevalent influenza A virus subtypes has been observed, making it difficult to discriminate subtypes using these aptamers. In order to create a diagnostic kit for discriminating influenza A virus subtypes, it is necessary to continuously respond to the mutations that occur in this virus at a high speed, and the development of aptamers that react to the current prevalent strain has been desired.

[0008] So far, a plurality of aptamers for discriminating influenza A subtypes have been developed, but no aptamer that binds to the current pandemic A / H1N1pdm09 strain has been obtained.

[0009] This disclosure provides a nucleic acid aptamer for the A / H1N1pdm09 influenza virus. This disclosure provides an agent and a method for detecting the A / H1N1pdm09 influenza virus.

Means for Solving the Problems

[0010] In one aspect, this disclosure relates to a nucleic acid aptamer having a binding ability to the A / H1N1pdm09 influenza virus, which consists of a nucleic acid containing the nucleotide sequence represented by any one of SEQ ID NOs: 4 to 11, or a nucleotide sequence in which one or several nucleotides are deleted, substituted, or added in the nucleotide sequence. In one aspect, this disclosure relates to a nucleic acid aptamer having a binding ability to the A / H1N1pdm09 influenza virus, which consists of a nucleic acid containing a base sequence shortened so as to retain the structure of the tip region portion having a binding ability to the A / H1N1pdm09 influenza virus in the secondary structure formed by a nucleic acid containing the nucleotide sequence represented by any one of SEQ ID NOs: 4 to 11, or a nucleotide sequence in which one or several nucleotides are deleted, substituted, or added in the nucleotide sequence.

[0011] In one aspect, this disclosure is a nucleic acid aptamer having a binding ability to the A / H1N1pdm09 influenza virus, wherein the aptamer has a motif consisting of the nucleotide sequence represented by positions 16 to 43 from the 5'-end of SEQ ID NO: 4. In one aspect, this disclosure is a nucleic acid aptamer having a binding ability to the A / H1N1pdm09 influenza virus, The nucleic acid aptamer relates to one in which the aptamer has a first motif consisting of a nucleotide sequence represented by the 12th to 24th positions from the 5'-end of SEQ ID NO: 6 and a second motif consisting of a nucleotide sequence represented by the 39th to 62nd positions from the 5'-end of SEQ ID NO: 6.

[0012] In another aspect, the present disclosure relates to a detection agent for influenza A (H1N1)pdm09 virus containing the nucleic acid aptamer of the present disclosure as an active ingredient. In another aspect, the present disclosure relates to a diagnostic agent for influenza A (H1N1)pdm09 virus containing the nucleic acid aptamer of the present disclosure as an active ingredient. In another aspect, the present disclosure relates to a method for detecting influenza A (H1N1)pdm09 virus, which includes a step of allowing the nucleic acid aptamer of the present disclosure to act on a test sample as an active ingredient. In another aspect, the present disclosure relates to a method for identifying at least one of influenza virus subtypes, strains, and clades, which includes a step of allowing the nucleic acid aptamer of the present disclosure to act on a test sample as an active ingredient.

Effect of the Invention

[0013] According to the present disclosure, in one aspect, a nucleic acid aptamer capable of binding to influenza A (H1N1)pdm09 virus can be provided. According to the present disclosure, in one aspect, an agent and a method for detecting influenza A (H1N1)pdm09 virus can be provided.

Brief Description of the Drawings

[0014]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Embodiments for Carrying Out the Invention

[0015] In the present disclosure, the A / H1N1pdm09 influenza virus is, in one or more embodiments, a clinical isolate of influenza that prevailed during the 2019 / 2020 season, and in one or more embodiments, a clinical isolate of the A / H1N1pdm09 influenza virus belonging to clade 6B.1A of the HA gene phylogenetic tree during the 2019 / 2020 season.

[0016] [Nucleic acid aptamer] A nucleic acid aptamer is generally a nucleic acid ligand artificially created to specifically bind to viruses, proteins, peptides, saccharides, metal ions, small molecules, etc. The nucleic acid aptamer of the present disclosure has the ability to bind to the A / H1N1pdm09 influenza virus. In the present disclosure, nucleic acids include, in one or more embodiments, DNA, RNA, and analogs thereof. DNA and RNA may each include, in one or more embodiments, chemically modified DNA and chemically modified RNA, respectively. Even if the base sequence of the nucleic acid aptamer of the present disclosure is represented by DNA or RNA, it may be included in the nucleic acid aptamer of the present disclosure as a nucleic acid with a read base sequence such that, for example, thymine and uracil are converted.

[0017] The nucleic acid aptamer of the present disclosure consists of a nucleic acid including a base sequence represented by any of SEQ ID NOs: 4 to 11, or a base sequence in which one or several bases are deleted, substituted, or added in the base sequence, in one or more embodiments. In one or more embodiments, the length of the nucleic acid aptamer of the present disclosure is preferably 100 bases or less, for example, 90 bases or less, 80 bases or less, 70 bases or less, 60 bases or less, 50 bases or less, or 40 bases or less. In one or more embodiments, the length of the nucleic acid aptamer of the present disclosure is 20 bases or more, 30 bases or more, 40 bases or more, or 50 bases or more. In one or more embodiments, the length of the nucleic acid aptamer of the present disclosure is 20 bases to 80 bases or 30 bases to 90 bases. The nucleotide sequences of SEQ ID NOs: 4 to 11 were obtained by a method of selecting nucleic acid aptamers that strongly bind to a specific target substance called the SELEX method. In the SELEX method, a nucleic acid library having a random sequence is prepared, nucleic acids bound to the target substance are selected, and cycles of PCR amplification are repeated multiple times to obtain nucleic acid aptamers that strongly bind to the target substance. Currently, various improved SELEX methods have been reported. The nucleotide sequences of SEQ ID NOs: 4 to 11 were obtained by performing a total of 10 cycles of selection by the SELEX method and cloning the resulting RNA pool that binds to a specific virus. Specifically, a DNA library having a 30-base random region in the center of the sequence was synthesized, PCR amplified, transcribed to create an RNA pool, and RNA that binds to the target influenza virus was selected and amplified from this RNA pool. By repeating this cycle 10 times, aptamers having the nucleotide sequences shown in SEQ ID NOs: 4 to 11, which have high specificity and binding affinity (affinity) for the A / H1N1pdm09 influenza virus, were obtained.

[0018] [Truncated aptamer] Generally, the secondary structure model of a nucleic acid aptamer can be predicted. The secondary structure of a nucleic acid aptamer is a stem-loop structure consisting of a terminal loop structure and a stem structure. The site that actually binds to the target substance is considered to be mainly the stem region including the terminal loop (hereinafter also referred to as the "terminal region part"). In one or more embodiments, the secondary structure model of the nucleic acid aptamer of the present disclosure composed of RNA having the nucleotide sequences of SEQ ID NOs: 4 to 11 is shown in FIGS. 2 and 3. In one or more embodiments, the nucleic acid aptamer of the present disclosure may include a nucleic acid aptamer in which the nucleotide sequences of SEQ ID NOs: 4 to 11 are truncated within a range that does not disrupt the structure of the terminal region part of the secondary structure. In one aspect, the present disclosure relates to a nucleic acid aptamer having a binding ability to A / H1N1pdm09 influenza virus, which consists of a nucleic acid containing a base sequence represented by any of SEQ ID NOs: 4 to 11, or a base sequence in which one or several bases are deleted, substituted or added in the base sequence, and is shortened so as to retain the structure of a portion having a binding ability to A / H1N1pdm09 influenza virus in the secondary structure formed by the nucleic acid. In the present disclosure, in one or more embodiments, the portion having a binding ability to A / H1N1pdm09 influenza virus is the tip region portion of the above-described secondary structure.

[0019] In the nucleic acid aptamer of the present disclosure, in one or more embodiments, the base sequence constituting the structure of the portion having a binding ability to A / H1N1pdm09 influenza virus includes any of the following base sequences. The base sequence represented by positions 15 to 44 from the 5'-end of SEQ ID NO: 4 or 7; The base sequence represented by positions 11 to 48 from the 5'-end of SEQ ID NO: 4 or 7 The base sequence represented by positions 11 to 25 from the 5'-end of SEQ ID NO: 6; The base sequences represented by positions 6 to 28 and 38 to 72 from the 5'-end of SEQ ID NO: 6; The base sequences represented by positions 1 to 28 and 38 to 77 from the 5'-end of SEQ ID NO: 6. In the nucleic acid aptamer of the present disclosure, in one or more embodiments, the base sequence constituting the structure of the tip region having a binding ability to A / H1N1pdm09 influenza virus includes any of the following base sequences. The base sequence represented by positions 25 to 40 from the 5'-end of SEQ ID NO: 4 or 7; The base sequence represented by positions 16 to 43 from the 5'-end of SEQ ID NO: 4 or 7; The base sequence represented by positions 15 to 44 from the 5'-end of SEQ ID NO: 4 or 7; The base sequence represented by positions 11 to 48 from the 5'-end of SEQ ID NO: 4 or 7; The nucleotide sequence shown by the 11th to 25th bases from the 5'-end of SEQ ID NO: 6.

[0020] In the nucleic acid aptamer of the present disclosure, "deletion, substitution or addition" of one or several bases is introduced, in one or more embodiments, within a range that maintains the structure of the portion having the binding ability to A / H1N1pdm09 influenza virus in the secondary structure, or is introduced at a position other than the structure of the said portion. In the present disclosure, several means 2, 3, 4, or 5 in one or more embodiments.

[0021] A nucleic acid aptamer containing a deletion or substitution of a base in the nucleotide sequence of SEQ ID NOs: 4 to 11 may have a binding ability at a level of 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more, or at a level that is approximately the same or the same as that of a nucleic acid aptamer having the corresponding nucleotide sequence, in one or more embodiments. A nucleic acid aptamer containing a deletion or substitution of a base in the nucleotide sequence of SEQ ID NOs: 4 to 11 may have a higher level of the above-mentioned binding ability than a nucleic acid aptamer having the corresponding nucleotide sequence, for example, it may have a binding ability at a level that is 10% or more, 20% or more, 30% or more, 40% or more, or 50% or more higher.

[0022] In one or more embodiments, the binding ability of the nucleic acid aptamers of the present disclosure can be evaluated by the binding amount to A / H1N1pdm09 influenza virus relative to the binding amount to H3N2 (Ark1819002) influenza virus. In one or more embodiments, the binding amount to A / H1N1pdm09 influenza virus relative to the binding amount to H3N2 (Ark1819002) influenza virus in the nucleic acid aptamers of the present disclosure is 3-fold or more, 5-fold or more, 10-fold or more, 20-fold or more, 50-fold or more, 60-fold or more, 70-fold or more, 80-fold or more, or 90-fold or more. In the present disclosure, the binding amount of the nucleic acid aptamer to influenza virus can be measured by RT-qPCR method. Specifically, it can be measured by the method described in the examples.

[0023] [Other aspects of the truncated aptamer 1] The inventor has found that in the nucleic acid aptamer formed of the base sequence represented by SEQ ID NO: 4, the base sequence represented by positions 16 to 43 from the 5'-end of SEQ ID NO: 4 is involved in the binding property to A / H1N1pdm09 influenza virus. Therefore, as another aspect, the nucleic acid aptamer of the present disclosure is a nucleic acid aptamer having a binding ability to A / H1N1pdm09 influenza virus and having a motif consisting of the base sequence represented by positions 16 to 43 from the 5'-end of SEQ ID NO: 4.

[0024] In one or more embodiments where the motif of this aspect is not particularly limited, it may have one or more loop structures, and preferably may have two loop structures and one stem structure located between the two loop structures. In one or more embodiments, the nucleic acid aptamer of this aspect has a structure formed by two loop structures and one stem structure located between the two loop structures.

[0025] In the present disclosure, the "loop structure" refers to a single-stranded loop (circular) structure in a single-stranded nucleic acid that does not form base pairs. The loop structure can also be referred to as a loop-shaped structure that is located between double strands forming a stem structure and does not form base pairs in one or more embodiments. The number of bases forming the loop structure is 5 or more and 50 or less (for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 34, 35, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) in one or more embodiments.

[0026] In the present disclosure, the "stem structure" refers to a chain structure formed by one or more sets of complementary bases in a single-stranded nucleic acid forming base pairs. The stem structure may be a chain structure in which a part of the constituent bases or two or more consecutive bases form base pairs completely or partially with each other in one or more embodiments. The number of bases forming the stem structure is 2 or more and 20 or less (for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) in one or more embodiments. The stem structure of the nucleic acid aptamer of this aspect includes two consecutive G-C base pairs in one or more embodiments.

[0027] In one or more embodiments, the nucleic acid aptamer of this aspect may have 2 or more bases added to each of the 5'-end and 3'-end of the base sequence constituting the motif. For example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 50, 60, 70, 80, 90, or 100 or more bases may be added. In one or more embodiments, a part or all of the added bases may form base pairs to form a stem structure.

[0028] In one or more embodiments, the nucleic acid aptamer of this aspect includes the motif forming at least one loop structure, and a stem structure formed by bases added to each of the 5'-end and 3'-end of the base sequence constituting the motif. In one or more embodiments, the bases forming the loop structure are 5 to 20 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20). In one or more embodiments not particularly limited to the nucleic acid aptamer of this form, examples include nucleic acids containing any of the following base sequences. The base sequence shown from the 15th to the 44th from the 5'-end of SEQ ID NO: 4; The base sequence shown from the 14th to the 45th from the 5'-end of SEQ ID NO: 4; The base sequence shown from the 13th to the 46th from the 5'-end of SEQ ID NO: 4; The base sequence shown from the 12th to the 47th from the 5'-end of SEQ ID NO: 4; The base sequence shown from the 11th to the 48th from the 5'-end of SEQ ID NO: 4 In one or more embodiments not particularly limited to the nucleic acid aptamer of this form, examples include nucleic acids having a motif consisting of the base sequence shown from the 16th to the 43rd from the 5'-end of SEQ ID NO: 4 and having 85% or more identity with any of the above five sequences. In one or more embodiments, the base sequence of the above motif is retained in the aptamer.

[0029] In one or more embodiments, the nucleic acid aptamer of this aspect has the above motif and has 85% or more identity with the base sequence shown from the 1st to the 58th from the 5'-end of SEQ ID NO: 4. In one or more embodiments not particularly limited to the nucleic acid aptamer of this aspect, it may have one or more loop structures and one or more stem structures, preferably two loop structures formed by the above motif, one stem structure located between the two loop structures, and stem structures located at the 5'-end and 3'-end of the motif.

[0030] As used herein, a nucleic acid aptamer having "a nucleic acid sequence having at least 85% identity with the nucleotide sequence represented by SEQ ID NO." means that the nucleic acid aptamer is either the specified nucleotide sequence itself or has at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to the nucleotide sequence. The "identity %" of two nucleic acids can be determined by visual inspection or mathematical calculation. In one or more embodiments, the "identity %" of two nucleic acids can be determined using readily available sequence comparison computer programs. Examples of computer programs include, in one or more embodiments, the GCG Wisconsin Bestfit package (University of Wisconsin, U.S.A.; Devereux et al. (1984) Nucleic Acids Res. 12: 387), the BLAST package (Ausubel et al. (1999) ibid-Ch. 18), and FASTA (Atschul et al. (1990) J. Mol. Biol. 403-410). In one or more embodiments, a nucleic acid aptamer having at least 85% identity may retain the binding ability to the A / H1N1pdm09 influenza virus and / or the structure of the portion having the binding ability. In one or more embodiments, a nucleic acid aptamer having at least 85% identity may have a binding ability that is 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more or 95% or more, or at approximately the same or the same level as that of a nucleic acid aptamer having the corresponding nucleotide sequence. In one or more embodiments, a nucleic acid aptamer having at least 85% identity may have a higher level of the binding ability than a nucleic acid aptamer having the corresponding nucleotide sequence, for example, a level of the binding ability that is 10% or more, 20% or more, 30% or more, 40% or more or 50% or more higher.

[0031] [Other aspects of the truncated aptamer 2] The inventor has found that in the nucleic acid aptamer formed of the base sequence represented by SEQ ID NO: 6, the base sequence represented by positions 12 to 24 from the 5'-end of SEQ ID NO: 6 and the base sequence represented by positions 39 to 62 from the 5'-end of SEQ ID NO: 6 are involved in the binding ability to A / H1N1pdm09 influenza virus. Therefore, as another aspect, the nucleic acid aptamer of the present disclosure is a nucleic acid aptamer having a binding ability to A / H1N1pdm09 influenza virus, and has a first motif consisting of the base sequence represented by positions 12 to 24 from the 5'-end of SEQ ID NO: 6 and a second motif consisting of the base sequence represented by positions 39 to 62 from the 5'-end of SEQ ID NO: 6.

[0032] In one or more embodiments where the first motif is not particularly limited, it has a stem-loop structure. In one or more embodiments, the bases forming the loop structure are 5 or more and 10 or less (for example, 5, 6, 7, 8, 9, or 10).

[0033] In one or more embodiments, the nucleic acid aptamer of this aspect may have a loop structure formed by the base sequence containing the second motif. In one or more embodiments, the nucleic acid aptamer of this aspect may have 2 or more and 20 or less (for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) bases added to each of the 5'-end and 3'-end of the base sequence forming the loop structure. In one or more embodiments, some or all of the added bases may form base pairs to form a stem structure.

[0034] In one or more embodiments, the nucleic acid aptamer of this aspect includes a stem-loop structure formed by the first motif, a loop structure formed by a base sequence including the second motif, and a stem structure formed by bases added to each of the 5'-end and 3'-end of the base sequence constituting the loop structure. The stem-loop structure formed by the first motif is linked to the loop structure formed by the base sequence including the second motif via the stem structure. One or more non-limiting embodiments of the nucleic acid aptamer of this form include nucleic acids containing any of the following base sequences. The base sequences represented by the 6th to 28th and 38th to 72nd positions from the 5'-end of SEQ ID NO: 6; The base sequences represented by the 5th to 28th and 38th to 73rd positions from the 5'-end of SEQ ID NO: 6; The base sequences represented by the 4th to 28th and 38th to 74th positions from the 5'-end of SEQ ID NO: 6; The base sequences represented by the 3rd to 28th and 38th to 75th positions from the 5'-end of SEQ ID NO: 6; The base sequences represented by the 2nd to 28th and 38th to 76th positions from the 5'-end of SEQ ID NO: 6; The base sequences represented by the 1st to 28th and 38th to 77th positions from the 5'-end of SEQ ID NO: 6. One or more non-limiting embodiments of the nucleic acid aptamer of this form include nucleic acids having the above first and second motifs and having a base sequence with 85% or more identity to any of the above six sequences. In one or more embodiments, the base sequences of the above first and second motifs are retained in the aptamer.

[0035] In one or more embodiments, the nucleic acid aptamer of this aspect has the above-described first motif and second motif, and has at least 85% identity to the nucleotide sequence represented by positions 1 to 77 from the 5'-end of SEQ ID NO: 6. In one or more embodiments where it is not particularly limited, the nucleic acid aptamer of this aspect may have one or more loop structures and one or more stem structures, preferably a loop structure containing the first motif, a stem-loop structure formed by the second motif linked to the loop structure, and stem structures located at the 5'-end and 3'-end of the loop structure containing the first motif.

[0036] [Chemical modification] As described above, the nucleic acid aptamer of the present disclosure may include an aspect that has been chemically modified. When the nucleic acid is RNA, in order to add ribonuclease resistance, the nucleotide sequence of the nucleic acid aptamer may have chemically modified ribonucleotides. Such nucleic acid aptamers can be obtained, for example, by substituting the 2'-OH group of the ribose moiety of ribonucleotides in the nucleic acid aptamer with a fluoro group (2'-F) or a methoxy group (2'-OMe) by a conventional method, or by substituting the 2'-position of the ribose moiety with hydrogen (2'-deoxy). These chemical modifications are more effective for pyrimidine nucleotides because the pyrimidine nucleotide moiety is more easily degraded by ribonucleases. In one or more embodiments, these chemical modifications are introduced at locations other than the structure of the portion having the binding ability to the A / H1N1pdm09 influenza virus in the secondary structure. In one or more embodiments, these chemical modifications are performed on the ribose group of pyrimidine nucleotides in the loop region.

[0037] In one or more other embodiments, the chemical modification may be modification of the 5'-end and / or 3'-end of the nucleic acid aptamer with inverted deoxythymidine (idT) or polyethylene glycol (PEG). These improve the ribonuclease resistance of the aptamer RNA. Due to the ability to suppress the decrease in activity caused by degradation in the living body through chemical modification, the nucleic acid aptamer of the present disclosure can also be made into a pharmaceutical composition that exhibits an antiviral effect in the living body. In other aspects, the present disclosure relates to a pharmaceutical composition containing the nucleic acid aptamer of the present disclosure as an active ingredient and exhibiting an antiviral effect against the A / H1N1pdm09 influenza virus. In the present disclosure, "containing the nucleic acid aptamer of the present disclosure as an active ingredient" may, in one or more embodiments, also include a form containing the intermediate described below.

[0038] [Labeled substance] In one or more embodiments, the nucleic acid aptamer of the present disclosure can be used for the detection of the A / H1N1pdm09 influenza virus as described below. The nucleic acid aptamer of the present disclosure includes a form labeled for detection. The label can be appropriately selected according to the detection method, and in one or more embodiments, examples include fluorescent dyes, digoxigenin, digoxin, biotin, radioactive substances, and the like.

[0039] [Intermediate] In one aspect, the present disclosure relates to an intermediate that can be converted in vivo or in vitro to the nucleic acid aptamer of the present disclosure. Examples of the intermediate include single-stranded DNA, double-stranded DNA, and RNA that contain the same base sequence as the base sequence of the nucleic acid aptamer of the present disclosure or a base sequence complementary to the base sequence and can be converted to the nucleic acid aptamer of the present disclosure by genetic engineering means in vitro or reactions in the living body or in cells. These DNAs and RNAs may include chemically modified forms thereof and combinations thereof. In one aspect, the present disclosure relates to single-stranded DNA, double-stranded DNA, or RNA that contains the same base sequence as the nucleic acid aptamer of the present disclosure or a base sequence complementary to the base sequence and can be converted to the nucleic acid aptamer of the present disclosure.

[0040] [Manufacturing method] In one or more embodiments, the aptamers of the present disclosure can be produced by chemical synthesis based on a nucleotide sequence. DNA aptamers can be chemically synthesized from the terminal bases using a DNA synthesizer with dNTPs as materials. For the synthesis of RNA, protection of the 2'-hydroxyl group at the ribose site is required, and various amidites have been developed as protecting groups, and the 2-cyanoethoxymethyl (CEM) group can be used. In one or more embodiments, the aptamers of the present disclosure can be produced by a method (in vitro transcription method) in which the above DNA corresponding to the RNA aptamer for synthetic purposes is chemically synthesized, PCR amplified, and the RNA aptamer is synthesized by a transcription reaction with RNA polymerase from the amplified DNA. In one or more embodiments, the aptamers of the present disclosure can also be obtained from complementary RNA by using RNA-dependent RNA polymerase.

[0041] [Detection method] In one or more embodiments, the nucleic acid aptamers of the present disclosure can be used for the detection of A / H1N1pdm09 influenza virus as described below. In one aspect, the present disclosure relates to a method for detecting A / H1N1pdm09 influenza virus (hereinafter, also referred to as "the detection method of the present disclosure") including a step of allowing the nucleic acid aptamer of the present disclosure to act on a test sample as an active ingredient. In one or more embodiments, the detection method of the present disclosure includes contacting the nucleic acid aptamer of the present disclosure with a test sample and measuring the binding between the nucleic acid aptamer of the present disclosure and the A / H1N1pdm09 influenza virus in the sample. Alternatively, the detection method of the present disclosure includes contacting the nucleic acid aptamer of the present disclosure with a test sample and measuring whether the nucleic acid aptamer of the present disclosure binds to the A / H1N1pdm09 influenza virus in the sample. To act as an active ingredient means, in one or more embodiments, to be used as an index for detection, to bind to the A / H1N1pdm09 influenza virus, or to be used as a major factor in the detection mechanism. In the present disclosure, the detection of a virus includes detecting the virus in a sample, and includes confirming the presence or absence of the virus in a sample suspected of containing the virus. If the presence or absence of the virus in the sample can be confirmed, at least one of the subtypes, strains, and clades (lineages) of the influenza virus contained in the sample can be identified or negated. In one aspect, the present disclosure relates to a test method for identifying or negating at least one of the subtypes, strains, and clades of an influenza virus, including the step of allowing the nucleic acid aptamer of the present disclosure to act on a test sample as an active ingredient. The test method of the present disclosure includes, in one or more embodiments, contacting the nucleic acid aptamer of the present disclosure with the test sample and measuring the binding of the nucleic acid aptamer of the present disclosure to the A / H1N1pdm09 influenza virus in the sample. Alternatively, the test method of the present disclosure includes contacting the nucleic acid aptamer of the present disclosure with the test sample and measuring whether the nucleic acid aptamer of the present disclosure binds to the A / H1N1pdm09 influenza virus in the sample.

[0042] In one or more embodiments, the test sample in the present disclosure includes collected specimens such as nasal and pharyngeal swabs and nasal secretions of a subject, and solutions obtained by infecting and growing these specimens in chicken fertilized eggs and cultured cells. In one or more embodiments, the test sample includes a sample containing the A / H1N1pdm09 strain or a sample that may contain it.

[0043] Detection method using a fluorescently labeled nucleic acid aptamer As one or more embodiments of the detection method of the present disclosure, a method using the nucleic acid aptamer of the present disclosure labeled with fluorescence will be described. The nucleic acid aptamer of the present disclosure labeled with a fluorescent dye such as fluorescein, rhodamine, Texas Red, etc. is brought into contact with a test sample to perform a binding reaction. After removing the unbound nucleic acid aptamer, the presence or amount of influenza A (H1N1)pdm09 virus can be detected or measured by detecting and / or measuring fluorescence or its intensity. For example, it can be carried out using a substrate on which either the labeled aptamer RNA or the test sample is immobilized. In addition, as a method of not immobilizing either the labeled aptamer or the test substance, it is also possible to perform the method by labeling either the aptamer of the present disclosure or the test sample with a substance that emits fluorescence during binding, and detecting and measuring the fluorescence or its intensity during binding. Examples of such fluorescent dyes include fluorescein, rhodamine, Texas Red, etc.

[0044] Detection method using surface plasmon resonance (SPR) As one or more embodiments of the detection method of the present disclosure, a method using the nucleic acid aptamer of the present disclosure without fluorescent labeling will be described. The SPR method can detect a minute mass change caused by the binding of a molecule immobilized on a sensor chip and a molecule passing over the sensor chip as a change in the refractive index of the reflected light. Either the aptamer RNA of the present disclosure or the target substance is immobilized on the surface of the gold thin film on the sensor chip by a well-known method, and a test substance or aptamer RNA is supplied thereto to measure the binding reaction of these molecules in real time. As an apparatus using the SPR method, for example, there is BiacoreT100 manufactured by GE Healthcare Biosciences.

[0045] Detection method using immunochromatography As one or more embodiments of the detection method of the present disclosure, a method using immunochromatography will be described. As one form, there is an immunochromatography method using the nucleic acid aptamer of the present disclosure as a capture substance for immobilizing the virus at the detection site of a test piece (support) for developing a sample. As one form, there is provided an immunochromatography method using the nucleic acid aptamer of the present disclosure as a capture substance for binding to and labeling a virus fixed to a detection site of a test piece (support). As one form, there is provided an immunochromatography method using one or two types of the nucleic acid aptamers of the present disclosure as a capture substance for fixing a virus to a detection site of a test piece (support) for developing a sample, and as a capture substance for binding to and labeling a virus fixed to a detection site of the test piece (support). In one or more embodiments, the nucleic acid aptamer of the present disclosure used as a capture substance for labeling can be the nucleic acid aptamer of the present disclosure in a labeled form.

[0046] [Diagnostic method] The detection method and inspection method of the present disclosure can be used for a diagnostic method of influenza. In other aspects, the present disclosure relates to a diagnostic method including confirming whether an A / H1N1pdm09 influenza virus is present in a test sample by the detection method or inspection method of the present disclosure, and determining from the result whether the subject who provided the sample is infected with the virus.

[0047] [Detection agent, diagnostic agent, kit] In one aspect, the present disclosure relates to a detection agent, a diagnostic agent, or a kit containing the nucleic acid aptamer of the present disclosure as an active ingredient for use in the detection method, inspection method, or diagnostic method of the present disclosure. The detection agent can be used in the detection method and inspection method of the present disclosure. The diagnostic agent can be used in the diagnostic method of the present disclosure. As one or more embodiments of a diagnostic agent, there is provided a companion diagnostic agent for a therapeutic agent against an A / H1N1pdm09 influenza virus. The kit can be used in the detection method, inspection method, and diagnostic method of the present disclosure. In the production of detection agents, diagnostic agents, and kits, they are appropriately used in combination with well-known pharmaceutically acceptable diluents, stabilizers, and other carriers. These may include reagents and test pieces used for detection in addition to the nucleic acid aptamers of the present disclosure.

[0048] The present disclosure may relate to one or more of the following non-limiting embodiments. 〔1〕 A nucleic acid aptamer having a binding ability to A / H1N1pdm09 influenza virus, comprising a nucleic acid containing a base sequence represented by any one of SEQ ID NOs: 4 to 11, or a base sequence in which one or several bases are deleted, substituted, or added in the base sequence. 〔2〕 A nucleic acid aptamer having a binding ability to A / H1N1pdm09 influenza virus, comprising a nucleic acid containing a base sequence shortened so as to retain the structure of a portion having a binding ability to A / H1N1pdm09 influenza virus in the secondary structure formed by a nucleic acid containing a base sequence represented by any one of SEQ ID NOs: 4 to 11, or a base sequence in which one or several bases are deleted, substituted, or added in the base sequence. 〔3〕 The nucleic acid aptamer according to any one of 〔1〕, 〔2〕, and 〔12〕 to 〔16〕, wherein the nucleic acid is RNA. 〔4〕 The nucleic acid aptamer according to any one of 〔1〕 to 〔3〕 and 〔12〕 to 〔16〕, wherein at least one ribose site of the nucleotides constituting the aptamer is chemically modified. 〔5〕 The nucleic acid aptamer according to 〔4〕, wherein the chemical modification is a modification by a fluoro group (2'-F) or a methoxy group (2'-OMe) at the 2'-position of the ribose site, or a substitution by hydrogen (2'-deoxy). 〔6〕 The nucleic acid aptamer according to any one of 〔1〕 to 〔5〕 and 〔12〕 to 〔16〕, wherein the 5'-end and / or 3'-end is modified. 〔7〕 Single-stranded DNA, double-stranded DNA, or RNA that contains the same nucleotide sequence as the nucleic acid aptamer described in any one of 〔1〕, 〔2〕, and 〔12〕 to 〔16〕 or a nucleotide sequence complementary to the nucleotide sequence, and can be converted into the nucleic acid aptamer described in any one of 〔1〕, 〔2〕, and 〔12〕 to 〔16〕. 〔8〕 A detection agent for A / H1N1pdm09 influenza virus, containing as an active ingredient the nucleic acid aptamer described in any one of 〔1〕 to 〔6〕 and 〔12〕 to 〔16〕. 〔9〕 A diagnostic agent for A / H1N1pdm09 influenza virus, containing as an active ingredient the nucleic acid aptamer described in any one of 〔1〕 to 〔6〕 and 〔12〕 to 〔16〕. 〔10〕 A method for detecting A / H1N1pdm09 influenza virus, including the step of allowing the nucleic acid aptamer described in any one of 〔1〕 to 〔6〕 and 〔12〕 to 〔16〕 to act on a test sample as an active ingredient. 〔11〕 A test method for identifying or negating at least one of influenza virus subtypes, strains, and clades, including the step of allowing the nucleic acid aptamer described in any one of 〔1〕 to 〔6〕 and 〔12〕 to 〔16〕 to act on a test sample as an active ingredient. 〔12〕 A nucleic acid aptamer having binding ability to A / H1N1pdm09 influenza virus, The aptamer has a motif consisting of the nucleotide sequence shown from the 16th to the 43rd positions from the 5'-end of SEQ ID NO: 4. 〔13〕 The motif forms at least one loop structure, The nucleic acid aptamer further has a stem structure formed by bases added to each of the 5'-end and 3'-end of the nucleotide sequence constituting the motif. 〔14〕 The nucleic acid aptamer according to 〔12〕 or 〔13〕, having 85% or more identity with the nucleotide sequence shown from the 1st to the 58th positions from the 5'-end of SEQ ID NO: 4. 〔15〕 A nucleic acid aptamer having binding ability to A / H1N1pdm09 influenza virus, The nucleic acid aptamer, wherein the aptamer has a first motif consisting of a nucleotide sequence shown by the 12th to 24th positions from the 5'-end of SEQ ID NO: 6, and a second motif consisting of a nucleotide sequence shown by the 39th to 62nd positions from the 5'-end of SEQ ID NO: 6. 〔16〕 The nucleic acid aptamer according to 〔15〕, wherein the aptamer has a loop structure formed by a nucleotide sequence containing the second motif, and further has a stem structure formed by nucleotides added to each of the 5'-end and 3'-end of the nucleotide sequence constituting the loop structure. 〔17〕 The nucleic acid aptamer according to 〔15〕 or 〔16〕, which has 85% or more identity to the nucleotide sequence shown by the 1st to 77th positions from the 5'-end of SEQ ID NO: 6.

[0049] Hereinafter, the present disclosure will be described in more detail by way of examples. However, these are illustrative and the present disclosure is not limited to these examples.

Examples

[0050] 1. In vitro selection of an aptamer specific to influenza A virus (H1N1)pdm09 (1-1) Acquisition and establishment of clinical isolates (1-1-1) Specimen collection from influenza-infected patients In the 2018 / 2019 season and the 2019 / 2020 season, the nasal cavity of patients suspected of influenza infection was wiped with a dedicated swab, or nasal discharge was collected, and the presence or absence of infection was determined using the influenza antigen detection kit SPOTCHEM FLORA FluAB manufactured by Arkray, Inc. If the patient was positive for influenza A, the nasal discharge of the patient was collected with a swab attached to the kit and suspended in 500 - 1000 μl of VTM (manufactured by Copan) or Dulbecco's Modified Eagle Medium (manufactured by Sigma-Aldrich) added with an antibiotic-antifungal agent mixture (manufactured by Nacalai Tesque, hereinafter referred to as antibiotic). (1-1-2) Isolation and culture of influenza virus Madin-Darby Canine Kidney (MDCK) cells were seeded in a 12-well plate to reach 100% confluence the next day and cultured overnight at 37°C in a 5% CO₂ environment. The next day, the supernatant of the cells that had reached 100% confluence was removed and washed twice with 500 μl of PBS(-). 200 μl of a diluted specimen collected from an influenza-infected patient was added to the MDCK cells and incubated at 34°C in a 5% CO₂ environment for 30 minutes to allow the virus to adhere to the cell surface. 800 μl of DMEM medium supplemented with an antibiotic and 2.5 μg / ml of acetyltrypsin (manufactured by Sigma-Aldrich) was added and cultured at 34°C in a 5% CO₂ environment for 5 to 7 days. 10 - 50 μl of the culture supernatant was collected every day of culture and measured using an influenza antigen detection kit (manufactured by Arkray) to monitor the amount of virus in the culture supernatant and determine the subtype of influenza. (1-1-3) Subtype discrimination of clinical isolates and nucleotide sequence analysis of hemagglutinin gene The entire culture supernatant of the cells with an increased virus amount was collected, centrifuged at 3000 rpm, and the supernatant was recovered (virus solution). The RNA of the influenza virus contained in 140 μl of this supernatant was extracted using a virus RNA extraction kit (manufactured by Qiagen). Subtype discrimination was performed on the extracted RNA by real-time PCR. For sequence analysis of the hemagglutinin gene, the virus RNA extracted with SuperScript (trade name) III One-Step RT-PCR System with Platinum Taq DNA Polymerase was reverse-transcribed, and the full-length hemagglutinin gene was amplified by PCR. It was confirmed by agarose electrophoresis that a fragment of the target size was amplified, and the nucleotide sequence analysis of this fragment was performed. The primers and protocols used for real-time PCR, cloning, and sequencing were carried out with reference to the 4th edition of the Influenza Diagnosis Manual. The resulting clinical isolates were confirmed to be a viral strain of influenza A (H1N1)pdm09 virus belonging to clade 6B.1A of the HA gene phylogenetic tree (hereinafter also referred to as [Ark19007(H1N1)pdm09]) and a viral strain of influenza A (H3N2) virus belonging to clade 3C.2a (hereinafter also referred to as [Ark1819002(H3N2)]).

[0051] The selection of nucleic acid aptamers by the SELEX method shown in (1-2) to (1-4) below was carried out with modified conditions referring to the 4th edition of the Influenza Diagnosis Manual. (1-2) Preparation of RNA random pool A library of single-stranded DNA (ssDNA) with a central 30-base random region shown below was synthesized as a template (SEQ ID NO: 1), and PCR was performed using a 5'-terminal primer (SEQ ID NO: 2) and a 3'-terminal primer (SEQ ID NO: 3). SEQ ID NO: 1: AGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAG-(N)30-CCTTTCCTCTCTCCTTCCTCTTCT SEQ ID NO: 2: AGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAG SEQ ID NO: 3: AGAAGAGGAAGGAGAGAGGAAAGG Subsequently, in vitro transcription was performed using the T7 Ampliscribe kit (manufactured by Epicentre Technologies) to convert the amplified DNA library into an RNA library.

[0052] (1-3) Selection in vitro The RNA library obtained in (1-2) above (10 μg = 4 30 ≒1.15×10 18The different RNA sequences were dissolved in Binding buffer (0.01 M HEPES, 0.15 M NaCl, pH 7.4). To promote the equilibrium of the RNA conformation, it was denatured by treatment at 95 °C for 2 minutes and then cooled at room temperature for 10 minutes. To remove the RNA that binds non-specifically to the target, tRNA (total tRNA of E. coli (Roche)) was added to the RNA library solution as a competitor, and then the target virus solution was added. In each selection cycle, first, Ark1819002 (H3N2) was used as a countervirus for negative selection. The RNA that did not bind to this virus was recovered, and then Ark19007 (H1N1pdm09) was reacted for positive selection. The molecular ratios of the RNA (RNA pool), viral protein (Counter / target), and tRNA (Competitor) used in each selection cycle are as shown in Table 1.

[0053] 100 μL of the mixed solution of RNA, viral protein, and tRNA was incubated at room temperature for 10 minutes, and then passed through a wetted nitrocellulose acetate filter (HA WP filter, 0.45 μm, diameter 13.0 mm, Millipore) mounted on a "Pop-top" filter holder (Cytiva) to capture the RNA bound to the protein on the filter. Then, the filter was washed with 1 ml of Binding buffer. The RNA bound to the viral protein captured on the filter was eluted with Elution buffer (0.01 M HEPES, 0.15 M NaCl, 7 M Urea, pH 7.4), and the RNA was purified by ethanol precipitation. For the purified RNA, a reverse transcription reaction was performed in a 20 μl reaction solution using a primer (SEQ ID NO: 3), 0.4 mM dNTPs, 25 U PrimeScript (registered trademark) reverse transcriptase (Takara Bio), and the PrimeScript attached buffer to obtain cDNA. The dNTPs and reverse transcriptase were added after the denaturation and annealing steps (treatment at 95 °C for 2 minutes and then incubation at room temperature for 5 minutes). The reverse transcription was carried out at 42 °C for 45 minutes.

[0054] To 20 μl of the mixed solution after the reverse transcription reaction, 80 μl of a PCR mixed solution (PrimeSTAR (registered trademark) Max Premix (manufactured by TaKaRa Bio Inc.), 1 μM primer) was added, and amplification by PCR was performed. The PCR reaction solution was heated at 95°C for 30 seconds, and then cycles of 95°C for 20 seconds, 54°C for 15 seconds, and 72°C for 15 seconds were repeated for the number of times (10 - 18 cycles) until a band of the product of the appropriate size was obtained. The obtained PCR product was purified by ethanol precipitation and used for the transcription reaction. The in vitro transcription reaction was carried out overnight at 37°C using the T7 Ampliscribe kit. The transcription-synthesized RNA solution was treated with DNase I, and the reaction solution was fractionated on an 8% denaturing polyacrylamide gel. RNA was extracted from the gel, purified by ethanol precipitation, quantified, and used for the next selection and amplification cycles.

[0055] (1 - 4) Selection method and amplification cycle To obtain an RNA aptamer having high specificity and affinity for influenza virus, as shown in Table 1, the amounts of RNA and viral protein were changed for each selection cycle. To avoid enrichment of non-specifically binding RNA, in the 2nd, 4th, 6th, 8th, 9th, and 10th selection cycles, a 96-well titer plate (manufactured by Thermo Fisher) was used instead of a filter. For selection on the plate, first, 100 μg of the above viral protein per 1 ml of borate buffer at pH 8.0 was immobilized in each well and blocked with BSA (1% stock solution). Then, each well was washed and used for selection. The RNA pool obtained in the previous cycle was denatured in Binding buffer at 95°C for 2 minutes. Subsequently, after cooling at room temperature for 10 minutes, tRNA was added and added to the wells on which the viral protein was immobilized. After incubating for 10 minutes, it was washed with 300 μl of Binding buffer (4 times for the second and third selection cycles, 6 times for the sixth and eighth selection cycles, 8 times for the ninth and tenth selection cycles) to remove unbound RNA. Thereafter, the viral protein-bound RNA was recovered with heated Elution buffer (0.01 M HEPES, 0.15 M NaCl, 7 M Urea, pH 7.4), precipitated and purified with ethanol, and then regenerated by reverse transcription, PCR, and transcription in vitro.

[0056] [Table 1]

[0057] (1-5) Concentration evaluation of RNA To evaluate the progress of enrichment of high-affinity aptamers and their specificity, the binding activities of RNA pools in the 0th, 1st, 5th, and 10th selection cycles were analyzed by filter-binding quantification (RT-qPCR). RNA pools for each selection cycle were prepared and allowed to bind to Ark19007 (H1N1pdm09) and Ark1819002 (H3N2) in solution. The binding reaction was carried out by adding 10-fold molar excess of Escherichia coli tRNA as a non-specific competitive inhibitor, and mixing 50 nM RNA and 1.58 μg of viral protein (equivalent to 500 nM in terms of hemagglutinin molecular weight). The reaction solution was passed through a nitrocellulose-acetate filter to capture the RNA bound to the virus on the filter, and then washed with 2 ml of Binding buffer. The virus protein-bound RNA captured on the filter was immersed in 200 μl of Elution buffer, heated and eluted, and the RNA was recovered by ethanol precipitation. The total amount of RNA was reverse-transcribed in a 20 μl reaction solution containing 20 μM primer (SEQ ID NO: 3), 0.4 mM dNTPs, 25 U PrimeScript reverse transcriptase (manufactured by TakaraBio), and the buffer attached to Primescript. 10 μl of PowerSYBR Green Master Mix (manufactured by Thermo fisher) for real-time PCR, 1 μl of 5 μM forward primer, 1 μl of 5 μM reverse primer, and 9 μl of cDNA were mixed, and qPCR was performed using the reverse transcription product as a template. The binding activity was expressed as the ratio of the RNA binding amount of the RNA pool in each selection cycle to the RNA binding amount of the RNA pool to the virus in the 0th selection cycle (Figure 1). The proportion of RNA captured on the filter after the 10th selection cycle was 7.0-fold for the RNA binding to Ark19007 (H1N1pdm09) and 2.0-fold for the RNA binding to Ark1819002 (H3N2).

[0058] (1-6) Analysis of aptamers To obtain individual aptamers, the PCR products obtained in the 10th selection cycle were introduced into a TA cloning vector (manufactured by Invitrogen) and transformed into Escherichia coli. Individual plasmid DNAs were isolated using a plasmid purification kit (manufactured by Promega), the DNA base sequences were decoded, and the RNA base sequences corresponding to those DNA base sequences were determined. The clones of RNA whose sequences were decoded were classified into a total of 10 types of sequences.

[0059] P30-10-h1-1: GGGAGAAUUCCGACCAGAAGUAGUAGCCCGGGUGUGGGUUUAUGGUCGCCCCUUUCCUCUCUCCUUCCUCUUCU (SEQ ID NO: 4) P30-10-h1-2: GGGAGAAUUCCGACCAGAAGGCGCGAUUGUGGUUGUGGUGGGUGGGCGCGCCUUUCCUCUCUCCUUCCUCUUCU (SEQ ID NO: 5) P30-10-h1-3: GGGAGAAUUCCGACCAGAAGUGUCGAUGUGUAUCUUAUUUGUUUGUUUGUUUGUUUGUUUGUCCUUUCCUCUCUCCUUCCUCUUCU (SEQ ID NO: 6) P30-10-h1-4: GGGAGAAUUCCGACCAGAAGGCUAUGGGUUGAGUUCUGUAUGGGUGGGUGCCUUUCCUCUCUCCUUCCUCUUCU (SEQ ID NO: 7) P30-10-h1-5: GGGAGAAUUCCGACCAGAAGUCCCCUCCCUCGUAUCGUAUGUGCGUUUGCCCUUUCCUCUCUCCUUCCUCUUCU (SEQ ID NO: 8) P30-10-h1-6: GGGAGAAUUCCGACCAGAAGUAGUAGCCCGGGUGUGGGUUUAUGGCCGCCCCUUUCCUCUCUCCUUCCUCUUCU (SEQ ID NO: 9) P30-10-h1-7: GGGAGAAUUCCGACCAGAAGUAGUAGCCCGGGUGUGGGUUUAUGGUCGUCCCUUUCCUCUCUCCUUCCUCUUCU (SEQ ID NO: 10) P30-10-h1-8: GGGAGAAUUCCGACCAGAAGGCGCGAUUGUGUUGUGGUGGGUGGGCGCGCCUUUCCUCUCUCCUUCCUCUUCU (SEQ ID NO: 11) P30-10-h1-9: GGGAGAAUUCCGACCAGAAGGAACAUUUGUGGGUGGUGUGGGUGGCUGUUCCUUUCCUCUCUCCUUCCUCUUCU (SEQ ID NO: 12) P30-10-h1-10: GGGAGAAUUCCGACCAGAAGGGUCGGUGUAUAAUUGUAGUUUUGUUGUUGUUGUUGUUGUUGCCUUUCCUCUCUCCUUCCUCUUCU (SEQ ID NO: 13)

[0060] Among the nucleotide sequences of RNAs selected targeting Ark19007 (H1N1pdm09), the aptamer P30-10-h1-1 (SEQ ID NO: 4) accounted for 63.5% of the total, and the aptamer P30-10-h1-2 (SEQ ID NO: 5) accounted for 17.3% of the total. P30-10-h1-3 (SEQ ID NO: 6) and P30-10-h1-4 (SEQ ID NO: 7) each accounted for 3.8% of the total, and P30-10-h1-5 to P30-10-h1-10 (SEQ ID NOs: 8 to 13) each accounted for 1.9% of the total. Furthermore, P30-10-h1-6 and P30-10-h1-7 had sequences that differed by only one base compared to P30-10-h1-1. Secondary structure prediction of the aptamers was performed using the secondary structure analysis software "The mfold Web Server" (analyzable at http: / / unafold.rna.albany.edu / ?q=mfold / RNA-Folding-Form). Although multiple structures may be predicted for each aptamer RNA, the structure predicted to be the most stable for each aptamer RNA was shown (Figures 2 and 3).

[0061] 2. Affinity analysis of aptamers and each viral protein by filter binding quantification method (RT-qPCR method) The binding efficiency between the 10 aptamers selected in 1. above and the influenza virus clinical isolate Ark19007 (H1N1pdm09) was determined by the filter binding quantification method (described above 1-5) (Comparative Examples 1, 2, and Experimental Examples 1 to 10). The results are shown in Table 2 and Figure 4. As comparative examples, D-12 (SEQ ID NO: 14) and D-26 (SEQ ID NO: 15), which are known aptamers specific to the hemagglutinin of A / California / 07 / 2009 (H1N1)pdm09 influenza virus, were used (Japanese Patent Laid-Open No. 2012-100636). Note that D-26 was used as D26(2'-F) in which the OH at the 2'-position of the pyrimidine base was replaced with F. Aptamer D12: GGAGCUCAGCCUUCACUGCCAAAGUGCGAGGCAGUGUGGUGCUGUCCUACGAGUUCUAAAGUUCGUUAGGAAGGCAGCUCAACAUGUUUAACAGGCACCACCGUCGGAUCC (SEQ ID NO: 14) Aptamer D26: GGAGCUCAGCCUUCACUGCCAAAAAGUUAGGCCAGCAAAUUGCGAGCUGAUCCGGUGACUGGCUACAGGAGGCCUUGUCCACGGCCGUAUUGGCACCACCGUCGGAUCC (SEQ ID NO: 15)

[0062] The aptamers P30-10-h1-1, P30-10-h1-2, P30-10-h1-3, P30-10-h1-4, P30-10-h1-5, P30-10-h1-6, P30-10-h1-7, and P30-10-h1-8 (Experimental Examples 1 to 8) had a higher binding amount to Ark19007 (H1N1pdm09) compared to Ark1819002 (H3N2). It was shown that P30-10-h1-1, P30-10-h1-2, P30-10-h1-3, P30-10-h1-4, P30-10-h1-5, P30-10-h1-6, P30-10-h1-7, and P30-10-h1-8 are aptamers with strong binding ability compared to the existing aptamers D12 and D26(2′-F). The aptamer RNA binding amounts to Ark19007 (H1N1pdm09) and Ark1819002 (H3N2) were as shown in Table 2.

[0063]

Table 2

[0064] <Binding evaluation of mutant aptamers> To identify the sequences required for the binding of the aptamer to the target substance, as shown in Fig. 6, mutant aptamers with partial sequence deletions, insertions or mutations were created, and their binding to Ark19007 (H1N1pdm09) was evaluated. Specifically, biotinylated aptamers (P30-10-h1-1 (SEQ ID NO: 4) and P30-10-h1-3 (SEQ ID NO: 6)) obtained by the SELEX method were used, and the binding of this biotinylated aptamer to the viral protein was measured by adding an unlabeled mutant aptamer to determine the degree of inhibition, thereby evaluating the binding ability of the mutant aptamer to the viral protein.

[0065] Based on the predicted secondary structure of the RNA aptamer as described in Fig. 2, the region (motif) required for binding to the viral protein is presumed to be the sequence of the stem-loop structure. In P30-10-h1-1, first, four mutant aptamers (SEQ ID NOs: 16-19) with the regions described in Fig. 7 deleted were created, and their aptamer binding inhibitory activities were evaluated. Specifically, P30-10-h1-1_D1 (SEQ ID NO: 16) had 16 bases deleted from the 3'-end of P30-10-h1-1 (SEQ ID NO: 4). P30-10-h1-1_D2 (SEQ ID NO: 17) had the 7th to 10th bases and the 49th to 52nd bases deleted from the 5'-end of P30-10-h1-1 (SEQ ID NO: 4). P30-10-h1-1_D3 (SEQ ID NO: 18) had the 18th to 24th bases deleted from the 5'-end of P30-10-h1-1 (SEQ ID NO: 4). P30-10-h1-1_D4 (SEQ ID NO: 19) had the 30th to 35th bases deleted from the 5'-end of P30-10-h1-1 (SEQ ID NO: 4). As a result, the mutant aptamers of P30-10-h1-1_D3 (SEQ ID NO: 18) and P30-10-h1-1_D4 (SEQ ID NO: 19) did not show the binding inhibitory activity of the biotinylated aptamer. Therefore, it was presumed that the sites deleted by these mutant aptamers were regions (motifs) necessary for binding to the viral protein (Fig. 8). That is, the base sequences shown from the 17th to 24th positions from the 5'-end and from the 30th to 35th positions from the 5'-end of SEQ ID NO: 4 are expected to be core sequences (motifs) necessary for binding to the viral protein.

[0066] Since these refer to two loop structures, six mutant aptamers with mutations in the bases in the region connecting the two loop structures were prepared as shown in Fig. 9 (SEQ ID NOs: 20 to 25). Among the prepared mutant aptamers, del1 and del2 are deletion types (deletion of the bases within the square frame in Fig. 9), in1 and in2 are insertion types (insertion at the arrow positions in Fig. 9), and mt1 and mt2 are point mutation types (substitution of the bases within the square frame in Fig. 9). Specifically, P30-10-h1-1_del1 (SEQ ID NO: 20) had the 27th base (C) and the 38th base (G) deleted from the 5'-end of P30-10-h1-1 (SEQ ID NO: 4). P30-10-h1-1_del2 (SEQ ID NO: 21) had the 25th and 26th bases (AG) and the 38th and 39th bases (GU) deleted from the 5'-end of P30-10-h1-1 (SEQ ID NO: 4). P30-10-h1-1_in1 (SEQ ID NO: 22) had one base (A) inserted between the 27th base (C) and the 28th base (C) from the 5'-end of P30-10-h1-1 (SEQ ID NO: 4), and one base (A) inserted between the 37th base (G) and the 38th base (G). P30-10-h1-1_in2 (SEQ ID NO: 23) had two bases (CC) inserted between the 27th base (C) and the 28th base (C) from the 5'-end of P30-10-h1-1 (SEQ ID NO: 4), and two bases (GG) inserted between the 37th base (G) and the 38th base (G). P30-10-h1-1_mt1 (SEQ ID NO: 24) had the 39th base (U) from the 5'-end of P30-10-h1-1 (SEQ ID NO: 4) mutated to C. P30-10-h1-1_mt2 (SEQ ID NO: 25) had the 27th base (C) from the 5'-end of P30-10-h1-1 (SEQ ID NO: 4) mutated to A. As a result of evaluating the binding inhibitory activity of these mutant aptamers against the H1N1pdm09 virus protein, none of the mutant aptamers showed binding inhibitory activity (Fig. 10). Therefore, it was shown that the stem-loop structure containing two loop structures (from the 16th to the 43rd positions from the 5'-end of SEQ ID NO: 4) is an important region (motif) for binding to the virus protein.

[0067] Similarly, for P30-10-h1-3 (Accession No. 6), three types of mutant aptamers (Accession Nos. 26-28) were prepared as shown in Fig. 11, and their binding inhibitory activities against H1N1pdm09 virus protein were evaluated. P30-10-h1-3_compl1 (Accession No. 26) was mutated at the 31st to 35th bases from the 5'-end of P30-10-h1-3 (Accession No. 6). Specifically, the 31st base (U) was mutated to A, the 32nd base (A) was mutated to G, the 33rd base (U) was mutated to A, the 34th base (C) was mutated to U, and the 35th base (U) was mutated to A. P30-10-h1-3_compl2 (Accession No. 27) was mutated at the 15th to 21st bases from the 5'-end of P30-10-h1-3 (Accession No. 6). Specifically, the 15th base (C) was mutated to A, the 16th base (A) was mutated to C, the 17th base (G) was mutated to U, the 18th base (A) was mutated to U, the 19th base (A) was mutated to C, the 20th base (G) was mutated to U, and the 21st base (U) was mutated to G. P30-10-h1-3_del1 (Accession No. 28) had a 24-base deletion from the 39th to 62nd bases from the 5'-end of P30-10-h1-3 (Accession No. 6). As a result, the binding inhibitory activities of P30-10-h1-3_compl2 and P30-10-h1-3_del1 decreased (Fig. 12). Therefore, it was suggested that these mutated regions are important for binding to the virus protein. That is, the nucleotide sequence shown from the 12th to 24th bases from the 5'-end of Accession No. 6 and the nucleotide sequence shown from the 39th to 62nd bases from the 5'-end of Accession No. 6 are predicted to be core sequences (motifs) necessary for binding to the virus protein or to partially contain core sequences.

Claims

1. A nucleic acid aptamer having a binding ability to A / H1N1pdm09 influenza virus, which consists of a nucleic acid containing a base sequence represented by any one of SEQ ID NOs: 4 to 11, or a base sequence in which 1 to 5 bases are deleted, substituted or added in the base sequence, and the deletion, substitution or addition is introduced within a range that maintains the structure of a portion having a binding ability to A / H1N1pdm09 influenza virus in the secondary structure, or is introduced at a location other than the structure of the portion.

2. A nucleic acid aptamer having a binding ability to A / H1N1pdm09 influenza virus, which consists of a nucleic acid containing a base sequence represented by any one of SEQ ID NOs: 4 to 11, or a base sequence in which 1 to 5 bases are deleted, substituted or added in the base sequence, and the base sequence is shortened so as to maintain the structure of a portion having a binding ability to A / H1N1pdm09 influenza virus in the secondary structure formed by the nucleic acid.

3. The nucleic acid aptamer according to claim 1 or 2, wherein the nucleic acid is RNA.

4. The nucleic acid aptamer according to any one of claims 1 to 3, wherein at least one ribose site of the nucleotides constituting the aptamer is chemically modified.

5. The nucleic acid aptamer according to claim 4, wherein the chemical modification is a modification with a fluoro group (2'-F) or a methoxy group (2'-OMe) for the 2'-position of the ribose site, or a substitution with hydrogen (2'-deoxy).

6. The nucleic acid aptamer according to any one of claims 1 to 5, wherein the 5'-end and / or 3'-end is modified.

7. A single-stranded DNA, double-stranded DNA, or RNA that contains the same nucleotide sequence as the nucleic acid aptamer according to claim 1 or 2 or a nucleotide sequence complementary to the nucleotide sequence, and can be converted into the nucleic acid aptamer according to claim 1 or 2.

8. A detection agent for A / H1N1pdm09 influenza virus, which contains the nucleic acid aptamer according to any one of claims 1 to 6 as an active ingredient.

9. A diagnostic agent for A / H1N1pdm09 influenza virus, which contains the nucleic acid aptamer according to any one of claims 1 to 6 as an active ingredient.

10. A method for detecting A / H1N1pdm09 influenza virus, which includes a step of allowing the nucleic acid aptamer according to any one of claims 1 to 6 to act on a test sample as an active ingredient.

11. A test method for identifying or negating at least one of influenza virus subtypes, strains, and clades, which includes a step of allowing the nucleic acid aptamer according to any one of claims 1 to 6 to act on a test sample as an active ingredient.

12. A nucleic acid aptamer having a binding ability to A / H1N1pdm09 influenza virus, wherein the aptamer, is a motif consisting of the nucleotide sequence shown from the 16th to 43rd positions from the 5'-end of SEQ ID NO: 4, and forms at least one or more loop structures. and a stem structure formed by bases added to each of the 5'-end and 3'-end of the nucleotide sequence constituting the motif.

13. The nucleic acid aptamer according to claim 12, which has 90% or more identity with the nucleotide sequence shown from the 1st to 58th positions from the 5'-end of SEQ ID NO:

4.

14. A nucleic acid aptamer having a binding ability to A / H1N1pdm09 influenza virus, wherein the aptamer, It has a first motif consisting of the nucleotide sequence shown from the 12th to the 24th from the 5'-end of SEQ ID NO: 6, and a second motif consisting of the nucleotide sequence shown from the 39th to the 62nd from the 5'-end of SEQ ID NO: 6, and It has a loop structure formed by the nucleotide sequence containing the second motif, and a stem structure formed by the nucleotides added to each of the 5'-end and 3'-end of the nucleotide sequence constituting the loop structure, A nucleic acid aptamer having 90% or more identity to the nucleotide sequence shown from the 1st to the 77th from the 5'-end of SEQ ID NO: 6.

Images