Chemically Modified Oligonucleotides for RNA Editing

By employing AONs with MP linkages that form a double-stranded complex with target nucleic acids, the method effectively edits endogenous nucleic acids in mammalian cells, addressing the need for specific and efficient RNA editing to alleviate diseases.

JP7698881B2Active Publication Date: 2025-06-26PROQR THERAPEUTICS NV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
JP2021558932
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-04-03
Filing Date
2020-04-02
Publication Date
2025-06-26
Estimated Expiration
2040-04-02

AI Technical Summary

Technical Problem

There is a need for improved compounds that can specifically and effectively edit endogenous nucleic acids in mammalian cells using the naturally occurring ADAR enzyme to alleviate diseases.

Method used

The use of antisense oligonucleotides (AONs) that form a double-stranded complex with target nucleic acids, where the nucleotide opposite the target nucleotide is an orphan nucleotide, and the AON contains methylphosphonate (MP) linkages to enhance stability and specificity of RNA editing.

Benefits of technology

The described approach achieves higher stability and specificity of RNA editing, allowing for effective deamination of target adenosines in mammalian cells without the need for recombinant ADAR enzymes, thus providing a potential therapeutic solution for genetic disorders.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007698881000002
    Figure 0007698881000002
  • Figure 0007698881000003
    Figure 0007698881000003
  • Figure 0007698881000004
    Figure 0007698881000004
Patent Text Reader

Abstract

The present invention relates to single-stranded RNA-editing antisense oligonucleotides (AONs) for binding to target RNA molecules to deaminate a target nucleotide, preferably adenosine, present in a target RNA molecule and recruit an enzyme having nucleotide deamination activity, preferably an ADAR enzyme, in a cell, preferably a human cell, to deaminate the target nucleotide in the target RNA molecule. The AONs have at least one methylphosphonate-modified internucleoside linkage at a position that results in the AON being more stable compared to AONs that do not have the methylphosphonate modification at that position.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the medical field. In particular, the present invention relates to the field of RNA editing, which targets the RNA molecules of cells with antisense oligonucleotides (AONs) to specifically change the target nucleotides present in the target RNA molecules. The present invention aims to correct specific nucleotides such as mutated nucleotides that can cause diseases in target RNA molecules by engaging an enzyme having deaminase activity. More specifically, the present invention relates to AONs chemically modified at positions that are favorable for enhancing their stability in vivo and in vitro, thereby enhancing their RNA editing ability.

Background Art

[0002] RNA editing is a natural process in which eukaryotic cells often modify the sequences of their RNA molecules in a site-specific and accurate manner, thereby increasing the repertoire of RNAs encoded by the genome by several orders of magnitude. RNA editing enzymes have been described in eukaryotes throughout the animal and plant kingdoms, and these processes play important roles in controlling cell homeostasis in metazoans ranging from simple organisms (e.g., Caenorhabditis elegans) to humans. Examples of RNA editing are the conversion of adenosine (A) to inosine (I) and the conversion of cytidine (C) to uridine (U), which are caused by enzymes called adenosine deaminase and cytidine deaminase, respectively. The most widely studied RNA editing system is the system that includes adenosine deaminase enzymes.

[0003] Adenosine deaminase is a multi-domain protein containing a catalytic domain and two to three double-stranded RNA recognition domains, depending on the enzyme of interest. Each recognition domain recognizes a specific double-stranded RNA (dsRNA) sequence and / or structure. An important function of the catalytic domain is to convert A to I at approximately predefined positions in the vicinity in the target RNA by deamination of the nucleobase, but the catalytic domain also plays a role in recognizing and binding to parts of the dsRNA helix. Inosine is read as guanosine by the cell's translation machinery, and when the edited adenosine is in the coding region of the mRNA or pre-mRNA, the protein sequence can be recoded. The conversion from A to I also occurs in the 5' non-coding sequence of the target mRNA (resulting in an extended N-terminal protein) that creates a new translation start point upstream of the original start point, or in the 3' UTR or other non-coding parts of the transcript (which can affect RNA processing and / or stability). In addition, the conversion from A to I occurs at splice elements in the introns or exons of the pre-mRNA, thereby modifying the splicing pattern. As a result, exons can be included or skipped. Adenosine deaminase is part of a family of enzymes known as adenosine deaminases acting on RNA (ADAR), which includes the human deaminases hADAR1 and hADAR2, as well as hADAR3. However, for hADAR3, deaminase activity has not yet been shown.

[0004] The use of oligonucleotides to edit target RNAs to which adenosine deaminase is applied has been reported (e.g., Montiel-Gonzalez et al. PNAS 2013, 110(45):18285-18290, Vogel et al. 2014. Angewandte Chemie Int Ed 53:267-271, Woolf et al. 1995. PNAS 92:8298-8302). The disadvantage of the method described by Montiel-Gonzalez et al. (2013) is that a fusion protein consisting of the boxB recognition domain of the bacteriophage λN protein, genetically fused to the adenosine deaminase domain of the cleaved native ADAR protein, is required. The target cells are either required to be transduced with the fusion protein, which is a major obstacle, or transfected with a nucleic acid construct encoding the engineered adenosine deaminase fusion protein for expression. The system described by Vogel et al. (2014) has a similar drawback in that it is not clear how to first apply the system without genetically modifying ADAR and then transfect or transduce the cells with the target RNA to supply the genetically engineered protein to the cells. Clearly, this system cannot be easily applied for use in humans (e.g., in a therapeutic setting). The oligonucleotides of Woolf et al. (1995), which are 100% complementary to the target RNA sequence, appear to be the only ones that function by microinjection in cell extracts or Xenopus oocytes, suffer from a severe lack of specificity, and edit almost all adenosines in the target RNA strand that was complementary to the antisense oligonucleotide. Oligonucleotides, 34 nucleotides in length, with a 2'-O-methyl (2'-OMe) modification on each nucleotide were tested by Woolf et al. (1995) and shown to be inactive. A 34-mer RNA with 2'-OMe modifications on the 5 nucleotides at the 5' and 3' ends and modified with phosphorothioate (PS) linkages was also tested to confer stability against nucleases.This oligonucleotide of the central unmodified region was shown to be able to promote the editing of the target RNA by endogenous ADAR with terminal modifications that achieve protection against exonuclease degradation. However, this system did not show specific target adenosine deamination in the target RNA sequence. As described above, almost all adenosines opposite unmodified nucleotides in the antisense oligonucleotide were edited (thus, almost all adenosines opposite the nucleotides of the central unmodified region when the 5'- and 3'-terminal 5 nucleotides of the antisense oligonucleotide were modified, or almost all adenosines in the target RNA strand when the nucleotides were not modified).

[0005] It is known in the art that ADAR can act on any dsRNA. By a process sometimes referred to as "promiscuous editing", the enzyme edits dsRNAs that have a large number of As. Therefore, there is a need for methods and means to avoid such promiscuous editing and target only specific adenosines in a therapeutically applicable target RNA molecule. Vogel et al. (2014) showed that such off-target editing can be suppressed by using nucleotides modified with 2'-OMe in the oligonucleotide at positions opposite adenosines that should not be edited, and that unmodified nucleotides can be used directly opposite specifically targeted adenosines in the target RNA. However, it was not shown that a specific editing effect at the target nucleotide occurs without using a recombinant ADAR enzyme that covalently binds to the AON.

[0006] In International Publication Pamphlet No. WO 2016 / 097212, an antisense oligonucleotide (AON) for targeted editing of RNA is disclosed, which is characterized by the presence of a sequence complementary to the target RNA sequence (hereinafter referred to as the "targeting portion") and preferably a stem-loop structure not complementary to the target RNA (hereinafter referred to as the "recruiting portion"). Such an oligonucleotide is referred to as a "self-looping AON". The recruiting portion has the function of recruiting the natural ADAR enzyme present in the cell to the dsRNA formed by the hybridization of the target sequence and the targeting portion. Due to the presence of the recruiting portion, neither an entity to be conjugated nor the presence of a modified recombinant ADAR enzyme is required. In International Publication Pamphlet No. WO 2016 / 097212, the recruiting portion is described as a stem-loop structure that mimics either a natural substrate (e.g., GluB receptor) or a Z-DNA structure known to be recognized by the dsRNA-binding region of the ADAR enzyme. The stem-loop structure can be an intermolecular stem-loop structure formed by two separate nucleic acid strands or an intramolecular stem-loop structure formed within a single nucleic acid strand. The stem-loop structure of the recruiting portion described in International Publication Pamphlet No. WO 2016 / 097212 is an intramolecular stem-loop structure formed within the AON itself and capable of attracting ADAR. In International Publication Pamphlet No. WO 2017 / 220751 and International Publication Pamphlet No. WO 2018 / 041973, AONs are described that do not contain such a recruiting portion but are (substantially) complementary to a targeted region excluding one or more mismatches, or so-called "wobbles" or bulges. The only mismatch can be the nucleotide opposite the target adenosine, but in other embodiments, the AON has been described with respect to a number of bulges and / or wobbles when binding to the target sequence region. When the sequence of the AON was carefully selected to be able to attract ADAR, it was thought that AONs lacking a recruiting portion and the endogenous ADAR enzyme were capable of achieving RNA editing in vitro, ex vivo, and in vivo.An "orphan nucleotide" is defined as the nucleotide within the AON that is positioned directly opposite the target adenosine in the target RNA molecule and does not have a 2'-OMe modification. The orphan nucleotide can also be a DNA nucleotide (where the sugar does not have a 2'-modification) with 2'-O-alkyl modifications of the sugar in the rest of the AON (e.g., 2'-OMe), or can be within the so-called "Central Triplet" (an orphan nucleotide having two directly adjacent nucleotides within the AON) that contains specific chemical modifications that further improve the efficiency of RNA editing and / or enhance resistance to nucleases (or was DNA), or can be a nucleotide directly surrounding the Central Triplet. Such effects could even be further improved by using sense oligonucleotides (SONs) that "protect" the AON from degradation (described in WO 2018 / 134301 pamphlet). SUMMARY OF THE INVENTION PROBLEMS TO BE SOLVED BY THE INVENTION

[0007] Despite the achievements outlined above, there remains a need for improved compounds that can utilize the naturally occurring ADAR enzyme to more specifically and effectively edit endogenous nucleic acids in order to alleviate diseases, for mammalian cells, and even for the whole organism, with respect to (endogenous) cellular pathways and enzymes having deaminase activity. MEANS FOR SOLVING THE PROBLEMS

[0008] The present invention relates to an antisense oligonucleotide (AON) capable of forming a double-stranded complex with a target nucleic acid molecule in a cell for use in deaminating a target nucleotide, preferably adenosine, in the target nucleic acid molecule, wherein the nucleotide in the AON directly opposite the target nucleotide is an orphan nucleotide, and the AON contains one or more methylphosphonate (MP) linkages. Accordingly, the present invention provides an AON comprising a sequence configured for deamination of a target nucleotide, preferably adenosine, in a target nucleic acid molecule. Preferably, the AON is capable of engaging a substance such as an enzyme having deamination activity, and preferably, the target nucleotide is adenosine that is deaminated by an enzyme that deaminates to inosine. The numbering of the internucleotide linkages is such that linkage number 0 is the 5' linkage from the orphan nucleotide, and the linkage positions in the oligonucleotide are incremented positively towards the 5' end and negatively towards the 3' end. Preferably, the AON contains one or more MP linkages at linkage positions 0, -1, -2, -3, -4, -5, and / or -6, and more preferably, the AON contains MP linkages at linkage positions -0 and / or -2. In one embodiment, the AON contains a single MP linkage. In one embodiment, the orphan nucleoside and / or the 3' nucleoside of the orphan nucleoside are linked by an MP linkage to their respective 3'-proximal nucleosides (i.e., at linkage positions -1 and -2, respectively). Particularly preferred is the aspect in which the MP linkage results in an AON that is more stable compared to an AON lacking the MP linkage, as outlined in the non-limiting examples herein. In a preferred aspect, the AON of the present invention contains at least one nucleotide with a 2'-OMe or 2'-MOE ribose modification, and the orphan nucleotide does not have a 2'-OMe or 2'-MOE ribose modification.

[0009] In one embodiment, the present invention relates to a pharmaceutical composition comprising an AON according to the present invention and a pharmaceutically acceptable carrier.

[0010] In another embodiment, the present invention relates to an AON according to the present invention or a pharmaceutical composition according to the present invention for use in the treatment or prevention of genetic disorders.

[0011] The present invention also relates to a method for deamination of at least one target nucleotide, preferably adenosine, present in a target RNA molecule in a cell, the method comprising the steps of supplying to the cell an AON or a pharmaceutical composition according to the present invention, enabling annealing of the AON to the target RNA molecule, enabling a mammalian enzyme having nucleotide deaminase activity to deaminate the target nucleotide in the target RNA molecule, and optionally, identifying the presence of the deaminated nucleotide in the target RNA molecule.

[0012] The present invention also relates to a method for deamination of at least one target nucleotide, preferably adenosine, present in a target RNA molecule, the method comprising the steps of supplying an AON according to the present invention, enabling annealing of the AON to the target RNA molecule, enabling a mammalian enzyme having nucleotide deaminase activity to deaminate the target nucleotide in the target RNA molecule, and identifying the presence of the deaminated nucleotide in the target RNA molecule.

[0013] One or more embodiments of the present invention will now be described by way of example only with reference to the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0014]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Modes for Carrying Out the Invention

[0015] There is always a need to improve the pharmacokinetic properties of RNA editing antisense oligonucleotides (AONs, sometimes referred to as "editing oligonucleotides" or "EONs") without adversely affecting the editing efficiency of the target adenosine in the target RNA. Many chemical modifications are present during the production of AONs, and their properties do not always meet the desire to improve effective RNA editing. In the search for better pharmacokinetic properties, although not all, some ribose 2'-O-methoxyethyl (or 2'-methoxyethoxy, or 2'-MOE) modifications were early found to surprisingly appear to be compatible with effective ADAR involvement and editing (WO 2019 / 158475 pamphlet). Similarly, although not all, some phosphorothioate (PS) linkages in the internucleotide linkages were early found to surprisingly appear to be compatible with effective ADAR involvement and editing (WO 2019 / 219581 pamphlet). Also, in AONs, although not all, some phosphonoacetate linkage modifications and / or unlocked nucleic acid (UNA) ribose modifications at some positions were early found to appear to be compatible with the effective involvement of enzymes having nucleotide deamination activity and subsequent deamination (PCT / EP 2020 / 053283 specification, unpublished). While the properties of phosphonoacetate and UNA modifications were known, their compatibility with the involvement of enzymes having nucleotide deamination activity and deamination reactions was not known.

[0016] The inventors of the present invention have now found that AONs can further engage enzymes with deaminase activity, which are important but were previously thought to be able to deaminate target nucleotides in target RNA molecules. On the other hand, the introduction of certain types of internucleoside bond modifications has been shown to enhance the stability of the overall AON in a significant manner, where orphan nucleosides in the AON are bound to their 3'-proximal nucleosides by this specific modified bond. These findings can, in principle, be applied to any form of base editing that utilizes synthetic oligonucleotides, whether natural or recombinant, truncated or full-length, and whether fused to other proteins or not, for example, those involving ADAR or the ADAR deaminase domain (e.g., Stafforst and Schneider, 2012, Angew Chem Int 51:11166-11169; Schneider et al., 2014, Nucleic Acids Res 42:e87; Montiel-Gonzalez et al., 2016, Nucleic Acids Res 44:e157). Those skilled in the art are aware of various enzymes with nucleotide deaminase activity such as ADAR1, ADAR2, APOBEC, or fusion proteins containing the active domains of such enzymes fused to other proteins for targeted RNA binding and the like. The present invention relates in particular to AONs containing methylphosphonate (MP) internucleoside bond modifications. The numbering of the internucleotide bonds is such that bond number 0 is the 5'-bond from the orphan nucleotide, and the bond positions in the oligonucleotide increase positively towards the 5'-end and negatively towards the 3'-end. In terms of nucleotide numbering, the orphan nucleotide is at position 0, and the nucleotide numbers increase positively towards the 5'-end and negatively towards the 3'-end. In certain embodiments of the present invention, the AON contains one or more MP bonds at bond positions 0, -1, -2, -3, -4, -5, and / or -6. At these positions, the MP bonds are particularly effective in stabilizing the AON without interfering with editing activity.In one embodiment, the AON comprises 7, 6, 5, 4, 3, 2, or 1 MP bond at binding positions 0, -1, -2, -3, -4, -5, and / or -6. In a preferred embodiment, the AON comprises MP bonds at binding positions 0, -1, -2, -3, -4, and / or -5; at binding positions 0, -1, -2, -3, and / or -4; at binding positions 0, -1, -2, and / or -3; at binding positions 0, -1, and / or -2. In a particularly preferred embodiment, the AON comprises MP modifications at positions 0 and / or -2. In one embodiment, the AON comprises an MP bond between an orphan nucleoside (opposite the target adenosine) and the nucleoside adjacent to the AON on the 3' side (i.e., binding position -1). In one embodiment, the AON comprises MP bonds at all binding positions. In another embodiment, the AON comprises a single MP bond. In certain embodiments, the AON is selected from an AON comprising an MP bond only at position 0; an AON comprising an MP bond only at binding position -1; an AON comprising an MP bond only at binding position -2; an AON comprising an MP bond only at binding position -3; an AON comprising an MP bond only at binding position -4; an AON comprising an MP bond only at binding position -5; an AON comprising an MP bond only at binding position -6; and an AON comprising MP bonds only at binding positions -2 and -4.

[0017] Here, it solves the problem of achieving higher stability of the AON while engaging an enzyme having nucleotide deaminase activity and maintaining the ability to obtain RNA editing of the target adenosine in the target RNA molecule.

[0018] The use of MPs to stabilize AONs is not a new concept (see, e.g., Agrawal et al. 1997. Proc Natl Acad Sci USA 94:2620-2625), but it was extremely surprising to find that, as shown herein, RNA editing was still possible in terms of the modifications within and around the nucleotides in RNA editing AONs that oppose the target nucleotides in the target RNA molecule, by having MP modifications in the bond connecting the orphan nucleoside to the neighboring nucleoside, preferably its 3' neighboring nucleoside. The present invention encompasses any AON capable of recruiting any protein (naturally expressed proteins, as well as foreign proteins including fusion proteins of different or the same origin) that binds to the target RNA molecule and has nucleotide (including adenosine) deaminase activity, provided that at least one internucleoside bond contains an MP bond, preferably the MP is present in the internucleoside bond connecting the AON nucleoside opposing the target nucleotide in the target RNA molecule to its 3' neighboring nucleoside, and the 3' neighboring nucleoside can be further bound to its respective 3' neighboring nucleoside by another MP bond. Thus, the present invention relates to an AON comprising nucleotides linked by internucleoside bonds, which, when forming a double-stranded nucleic acid structure by binding to a complementary target nucleic acid sequence, is capable of recruiting an enzyme having nucleotide deaminase activity to the target nucleotide in the complementary target nucleic acid sequence, and is characterized by being optimized for stability by the introduction of at least one MP-modified internucleoside bond. The chemical structure of the MP bond (between DNA nucleosides in the present invention) is shown in FIG. 1. An important role of this modification is to protect the polymer from nuclease-mediated degradation. In one aspect of the present invention, at least one internucleoside bond can be an unmodified phosphodiester bond if not modified by an MP. MP modifications can also be present in addition to modifications to the ribose 2' group.The ribose 2'-groups in AONs can independently be selected from 2'-H (i.e., DNA), 2'-OH (i.e., RNA), 2'-OMe, 2'-MOE, 2'-F, or a 2'-4' linkage (i.e., locked nucleic acid or LNA), or other 2'-substitutions as further outlined below. The 2'-4' linkage can be selected from linkers known in the art such as a methylene linker or a constrained ethyl linker. In all cases, the modification should be compatible with editing such that the oligonucleotide serves its role as an RNA editing AON. The AON can be further optimized for binding to enzymes having nucleotide deaminase activity by generating at least one unlocked nucleic acid (UNA) ribose modification at a position incompatible with the editing activity of enzymes having nucleotide deaminase activity. In a UNA modification, there is no carbon-carbon bond between the ribose 2' and 3' carbon atoms. Thus, the UNA ribose modification increases the local flexibility in the oligonucleotide. The UNA can result in effects such as improved pharmacokinetic properties due to improved resistance to degradation. The UNA can also be involved in reducing toxicity and off-target effects. Since the interference with binding to enzymes having nucleotide deaminase activity is significant, the UNA ribose modification should preferably be avoided in orphan nucleotides (UK Patent Application No. 1901873.8, unpublished). The UNA ribose modification can be the only ribose modification in the AON, but the UNA modification can be present in addition to the modification of the ribose 2'-group, either at a position different from the UNA modification or at the same position as the UNA modification. The ribose 2'-groups in AONs can independently be selected from 2'-H (i.e., DNA), 2'-OH (i.e., RNA), 2'-OMe, 2'-MOE, 2'-F, or a 2'-4' linkage (i.e., locked nucleic acid or LNA), or other 2'-substitutions as further outlined below. The 2'-4' linkage can be selected from linkers known in the art such as a methylene linker or a constrained ethyl linker.The different 2'-modifications are described in more detail in WO 2016 / 097212, WO 2017 / 220751, WO 2018 / 041973, WO 2018 / 134301, UK Patent Application No. 1808146.3 (unpublished), UK Patent Application No. 1901873.8 (unpublished), and PCT / EP 2019 / 053291 (unpublished). In all cases, the modification should be compatible with editing such that the oligonucleotide serves its role as an RNA editing AON. In all aspects of the invention, the enzyme having nucleotide deaminase activity is preferably ADAR1 or ADAR2. In a highly preferred embodiment, the AON is an RNA editing single-stranded AON targeting pre-mRNA or mRNA, the target nucleotide is preferably adenosine in the target RNA, and the adenosine is deaminated to inosine and read as guanosine by the translation machinery. In a more preferred aspect, the adenosine is located at a UGA or UAG stop codon and is edited to a UGG codon, or the two target nucleotides are the two adenosines at a UAA stop codon and the codon is edited to a UGG codon by deamination of both target adenosines, and the two nucleotides in the oligonucleotide are mismatched to the target nucleic acid.

[0019] The AON according to the present invention can include internucleoside linkage modifications other than MP linker modifications or in addition to MP linker modifications. In one embodiment, such another internucleoside linkage can be a phosphonoacetate-modified linkage. In another embodiment, the internucleotide linkage can be a phosphodiester, and the OH group of the phosphodiester is substituted with alkyl, alkoxy, aryl, alkylthio, acyl, -NR1R1, alkenyloxy, alkynyloxy, alkenylthio, alkynylthio, -S-Z+, -Se-Z+, or -BH3-Z+, where R1 is independently hydrogen, alkyl, alkenyl, alkynyl, or aryl, Z+ is an ammonium ion, alkylammonium ion, heteroaromatic iminium ion, or heterocyclic iminium ion, any of which is primary, secondary, tertiary, or quaternary, or Z is a monovalent metal ion, preferably a phosphorothioate (PS) linkage.

[0020] In the AON of the present invention, orphan nucleotides generally include ribose having a 2'-OH group or deoxyribose having a 2'-H group, preferably not including ribose having a 2'-OMe modification. Further, the AON of the present invention generally does not include a 2'-MOE modification at certain positions relative to the orphan nucleotides and further includes a 2'-MOE modification at other positions within the AON. The AON of the present invention preferably does not include the mobilizing moiety described in WO 2016 / 097212 pamphlet. The AON of the present invention preferably does not include a portion capable of forming an intramolecular stem-loop structure. The AON preferably does not include a 5'-terminal O6-benzylguanine modification. The AON preferably does not include a 5'-terminal amino modification. The AON preferably does not covalently bind to the SNAP tag domain.

[0021] The present invention relates to a method for deaminating at least one target adenosine present in a target RNA molecule within a cell, the method comprising the steps of supplying to the cell an AON according to a first aspect of the present invention or a composition according to a second aspect of the present invention, enabling uptake of the AON by the cell, enabling annealing of the AON to the target RNA molecule, enabling a mammalian enzyme having nucleotide deaminase activity to deaminate a target nucleotide in the target RNA molecule, and optionally, identifying the presence of the deaminated nucleotide in the target RNA molecule. Preferably, the presence of the target RNA molecule is detected by any of (i) sequencing the target sequence, (ii) assessing the presence of a functional, extended, full-length and / or wild-type protein when the target adenosine is located at a UGA or UAG stop codon and is edited to a UGG codon by deamination, (iii) assessing the presence of a functional, extended, full-length and / or wild-type protein when two target adenosines are located at a UAA stop codon and both target adenosines are edited to a UGG codon by deamination, (iv) assessing whether splicing of the pre-mRNA is altered by deamination, or (v) using a functional readout, wherein the target RNA after deamination encodes a functional, full-length, extended and / or wild-type protein. Accordingly, the present invention also relates to an AON that targets an early stop termination codon (PTC) present in a (pre)mRNA in order to modify the adenosine present in the stop codon to inosine (read as a G), and then results in read-through during translation and a full-length functional protein.In a particular embodiment, the present invention relates to an AON for use in the treatment of cystic fibrosis (CF), and in a further preferred embodiment, the present invention is an AON for use in the treatment of CF, wherein PTCs such as the G542X (UGAG), W1282X (UGAA), R553X (UGAG), R1162X (UGAG), Y122X (UAA, both adenosines), W1089X, W846X, and W401X mutations are modified to the amino acids encoded by the codons by RNA editing, thereby enabling translation into the full-length protein. The teachings of the present invention are applicable to all genetic diseases that can be targeted with an AON and treated by RNA editing, as outlined herein. Another particular preferred example is Usher syndrome type II resulting from mutations in the USH2A gene.

[0022] In one aspect, the present invention is an AON capable of forming a double-stranded complex with a target RNA molecule in a cell for use in deaminating a target adenosine at a disease-related splice mutation present in the target RNA molecule, wherein the orphan nucleotide (opposite the target adenosine) in the AON has no 2'-OMe modification, and the nucleotide directly 5' and / or 3' from the orphan nucleotide (which, together with the orphan nucleotide, forms the central triplet) has a sugar modification and / or a base modification that is stabilized by RNA editing and / or results in a more effective AON, and preferably at least one bond in the AON within the central triplet has an MP modification. In a preferred embodiment, at least one internucleoside bond connecting two nucleosides in the central triplet has an MP modification. In another preferred aspect, the orphan nucleotide is DNA, and in an even more preferred aspect, the orphan nucleotide, as well as the nucleotide 5' and / or 3' of the nucleotide opposite the target adenosine, are DNA nucleotides, but the remainder of the nucleotides in the AON (which are not DNA) are preferably ribonucleotides with 2'-O-alkyl modifications. When two nucleotides are DNA, all others can be RNA and can be 2'-OMe or 2'-MOE modified, while in certain aspects, the third nucleotide in the central triplet opposite the target adenosine can be RNA and cannot be modified, provided that the nucleotide opposite the target adenosine is not 2'-OMe modified. In a preferred embodiment, the AON according to the present invention includes 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches, wobbles, and / or bulges with the complementary target RNA region. Preferably, the nucleotide opposite the target adenosine is cytidine, deoxycytidine, uridine, deoxyuridine, or abasic. When the nucleotide opposite the target adenosine is cytidine or deoxycytidine, the AON includes at least one mismatch with the target RNA molecule.When the nucleotide opposite the target adenosine is uridine or deoxyuridine, the AON can be 100% complementary and have no mismatches, wobbles, or bulges in relation to the target RNA. However, in a preferred embodiment, one or more additional mismatches, wobbles, and / or bulges are present between the AON and the target RNA, whether the nucleotide opposite the target adenosine is cytidine, deoxycytidine, uridine, or deoxyuridine. In another preferred embodiment, the nucleotides directly 5’ and / or 3’ from the orphan nucleotide (along with the orphan nucleotide forming the central triplet) include ribose having a 2’-OH group, or deoxyribose having a 2’-H group, or a mixture of these two. The central triplet then consists of DNA-DNA-DNA, DNA-DNA-RNA, DNA-RNA-DNA, DNA-RNA-RNA, RNA-DNA-DNA, RNA-DNA-RNA, RNA-RNA-DNA, or RNA-RNA-RNA, and the central nucleotide has no 2’-OMe modification (in the case of RNA), and neither or both of the surrounding nucleotides have a 2’-OMe modification. Then, it is preferred that all other nucleotides in the AON have a 2’-O-alkyl group, preferably a 2’-OMe group, or a 2’-MOE group, or any modification disclosed herein. The AON of the present invention includes at least one MP-binding modification. The wobbles, mismatches, and / or bulges of the AON of the present invention with the target sequence do not prevent hybridization of the oligonucleotide to the target RNA sequence, but in addition to the efficiency of RNA editing by ADAR present in the cell at the position of the target adenosine. One skilled in the art can determine whether hybridization still occurs under physiological conditions. The AON of the present invention can recruit (engage) the mammalian ADAR enzyme present in the cell, and the ADAR enzyme includes its native dsRNA-binding domain as found in the wild-type enzyme.The AON according to the present invention can utilize endogenous cellular pathways and naturally available ADAR enzymes, or enzymes having ADAR activity that specifically edit target adenosines in the target RNA sequence (which may further be unknown ADAR-like enzymes). As disclosed herein, the single-stranded AON of the present invention can deaminate specific targets such as adenosine in the target RNA molecule. Ideally, only one nucleotide is deaminated. Alternatively, one, two, or three additional nucleotides may be deaminated, but preferably only one. The AON of the present invention can be designed and used for various nucleotide deaminase enzymes. A specific example is ADAR. Taking ADAR as an example, ADAR can be expressed naturally or can be artificially produced (e.g., by recombinant expression or protein synthesis). ADAR can be wild-type or can be modified. In combination with the characteristics of the AON of the present invention, modified recombinant ADAR expression is not required. The AON of the present invention is not particularly limited with respect to the conjugated substance that binds to the AON. However, the conjugated substance that binds to the AON is not required. Therefore, the AON lacking the conjugated substance that binds to the AON forms a preferred embodiment. The AON of the present invention is not particularly limited with respect to the mobilizing portion that is not complementary to the target RNA sequence. However, the presence of a long mobilizing portion that is not complementary to the target RNA sequence is not required. As a result, the AON lacking the long mobilizing portion that is not complementary to the target RNA sequence forms a preferred embodiment. In addition, the AON of the present invention enables specific deamination of target nucleotides present in the target nucleic acid molecule by a natural nucleotide deaminase enzyme, including the natural dsRNA binding domain found in wild-type enzymes, without the risk of random editing at other locations in the RNA / AON complex.

[0023] The present invention relates to an antisense oligonucleotide (AON) capable of forming a double-stranded complex with a target nucleic acid molecule in a cell for use in the deamination of a target nucleotide, preferably adenosine, in the target nucleic acid molecule, wherein the nucleotide in the AON directly opposite the target nucleotide is an orphan nucleotide, and the AON contains one or more methylphosphonate (MP) linkages. The AON of the present invention can engage a substance, preferably an enzyme, having deamination activity that is preferably endogenously present in a cell, preferably a mammalian cell, more preferably a human cell, to effect deamination of the target nucleotide in the target nucleic acid molecule. A preferred target nucleic acid molecule is an RNA molecule. The double-stranded AON / target nucleic acid molecule complex interacts by Watson-Crick type base pairing. Preferably, the orphan nucleotide does not have a 2'-OMe or 2'-MOE ribose modification. Preferably, the orphan nucleoside and / or the 3'-nucleoside of the orphan nucleoside are linked by MP linkages (i.e., at positions -1 and -2) to their respective 3'-proximal nucleosides. More preferably, both the orphan nucleoside and its 3'-proximal nucleoside are linked by MP-modified linkages to their respective 3'-proximal nucleosides, as exemplified in AON ADAR102-13 (Figure 2). In certain embodiments of the present invention, the AON contains one or more MP linkages at binding positions 0, -1, -2, -3, -4, -5, and / or -6, as exemplified in IDUA163, IDUA170, IDUA176, IDUA182, IDUA247, IDUA250, and IDUA254 (Figures 6 and 7). In one embodiment, the AON contains 7, 6, 5, 4, 3, 2, or 1 MP linkage at binding positions 0, -1, -2, -3, -4, -5, and / or -6. In a preferred embodiment, the AON contains MP linkages at binding positions 0, -1, -2, -3, -4, and / or -5, at binding positions 0, -1, -2, -3, and / or -4, at binding positions 0, -1, -2, and / or -3, at binding positions 0, -1, and / or -2.In a particularly preferred embodiment, the AON contains an MP linkage at positions 0 and / or -2, as illustrated in IDUA163 and IDUA176 (Figure 6). In one embodiment, the AON contains an MP linkage at all binding positions. In another embodiment, the AON contains a single MP linkage. In certain embodiments, the AON is selected from an AON that contains an MP linkage only at position 0 (as illustrated in IDUA163), an AON that contains an MP linkage only at binding position -1 (as illustrated in IDUA170), an AON that contains an MP linkage only at binding position -2 (as illustrated in IDUA176 and IDUA264), an AON that contains an MP linkage only at binding position -3 (as illustrated in IDUA182), an AON that contains an MP linkage only at binding position -4 (as illustrated in IDUA247), an AON that contains an MP linkage only at binding position -5 (as illustrated in IDUA250), an AON that contains an MP linkage only at binding position -6 (as illustrated in IDUA253), and an AON that contains an MP linkage only at binding positions -2 and -4 (as illustrated in IDUA267 and IDUA268). In a preferred embodiment, the MP linkage connects a DNA nucleoside to another nucleoside. In another preferred embodiment, the MP linkage connects a DNA nucleoside to a DNA nucleoside. In an important aspect of the invention, when compared to an in vitro stability assay, the MP linkage results in an AON that is more stable than an AON lacking the MP linkage. One skilled in the art can, based on this teaching, determine whether an MP modification results in an AON that is more stable than an AON lacking the MP modification at certain selected positions in the AON, as illustrated herein, by using the time-course in vitro stability assay disclosed by the inventors of the present invention (applying a nuclease mix containing phosphodiesterase I, DNase I, RNase A, and nuclease BAL-31 derived from Crotalus adamanteus venom, mixed in nuclease buffer and nuclease-free water), which is used as a non-limiting example of how stability can be tested in the laboratory).An AON comprising at least one MP-modified bond, which results in an AON that is more stable than an AON lacking MP modification at that position, engages a substance having deaminase activity, such as a deaminase enzyme, preferably an ADAR enzyme, to achieve RNA editing of a target nucleotide present in a target nucleic acid molecule, which is also an important aspect of the present invention. Thus, in a preferred embodiment, the ability of the AON to effect deamination of the target nucleotide is maintained at a level of at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, or at least 60% compared to an AON lacking one or more MP bonds. Similar to the stability assay, one of ordinary skill in the art can, based on this teaching, determine the level of the ability to achieve RNA editing and compare this to an AON lacking an MP bond at a specific position. In a preferred aspect, the AON further comprises at least one nucleotide comprising at least one phosphorothioate (PS) or phosphonoacetate internucleotide bond, and / or an unlocked nucleic acid (UNA) ribose modification. In a more preferred aspect, the PS bonds are present at both ends of the AON connecting to a maximum of five nucleosides at each end. In another preferred aspect, the AON of the present invention further comprises one or more nucleotides comprising a substitution at the 2'-position of the ribose, and the substitution is selected from the group consisting of -OH; -F; substituted or unsubstituted, straight-chain or branched lower (C1-C10) alkyl, alkenyl, alkynyl, alkaryl, allyl, or aralkyl, which may be interrupted by one or more heteroatoms; -O-, S-, or N-alkyl; -O-, S-, or N-alkenyl; -O-, S-, or N-alkynyl; -O-, S-, or N-allyl; -O-alkyl-O-alkyl; -methoxy; -aminopropoxy; -methoxyethoxy (2'-MOE); -dimethylaminooxyethoxy; and -dimethylaminoethoxyethoxy. In an even more preferred embodiment, the AON of the present invention comprises at least one nucleotide comprising a 2'-OMe or 2'-MOE ribose modification, and the orphan nucleotide does not have a 2'-OMe or 2'-MOE ribose modification.Most preferably, the AON of the present invention is capable of engaging in a cell with a substance, preferably an enzyme having deaminase activity, preferably an enzyme having adenosine deaminase activity, such as ADAR1 or ADAR2, more preferably ADAR2. Preferably, the enzyme having deaminase activity in the cell is a naturally occurring (endogenously present) human deaminase enzyme. The AON according to the present invention is preferably at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32 nucleotides in length. Also preferably, the AON is shorter than 100 nucleotides, more preferably shorter than 60 nucleotides.

[0024] In another embodiment, the present invention relates to a pharmaceutical composition comprising an AON according to the present invention and a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are known to those skilled in the art.

[0025] In yet another embodiment, the present invention relates to the use of an AON according to the present invention or a pharmaceutical composition according to the present invention for the treatment or prevention of genetic disorders preferably selected from the group consisting of cystic fibrosis, Hurler syndrome, α-1-antitrypsin (A1AT) deficiency, Parkinson's disease, Alzheimer's disease, pigment deficiency, amyotrophic lateral sclerosis, asthma, β-thalassemia, CADASIL, Charcot-Marie-Tooth syndrome, chronic obstructive pulmonary disease (COPD), distal spinal muscular atrophy (DSMA), Duchenne / Becker muscular dystrophy, (dystrophic) epidermolysis bullosa, Fabry disease, factor V Leiden-related disorders, familial adenomatous polyposis, galactosemia, Gaucher disease, glucose-6-phosphate dehydrogenase, hemophilia, hereditary hemochromatosis, Hunter syndrome, Huntington's disease, inflammatory bowel disease (IBD), congenital polyagglutination syndrome, Leber congenital amaurosis (e.g., LCA10), Lesch-Nyhan syndrome, Lynch syndrome, Marfan syndrome, mucopolysaccharidosis, muscular dystrophy, myotonic dystrophy types I and II, neurofibromatosis, Niemann-Pick disease types A, B, and C, NY-eso1-related cancers, Peutz-Jeghers syndrome, phenylketonuria, Pompe disease, primary ciliary dyskinesia, prothrombin mutation-related disorders (e.g., prothrombin G20210A mutation), pulmonary hypertension, (autosomal dominant) retinitis pigmentosa, Sandhoff disease, severe combined immunodeficiency syndrome (SCID), sickle cell anemia, spinal muscular atrophy, Stargardt disease, Tay-Sachs disease, Usher syndrome (e.g., Usher syndrome types I, II, and III), X-linked immunodeficiency, Sturge-Weber syndrome, and cancer.

[0026] In another embodiment, the present invention relates to the use of an AON according to the present invention in the manufacture of a medicament for the treatment of genetic disorders preferably selected from the group consisting of cystic fibrosis, Hurler syndrome, α-1-antitrypsin (A1AT) deficiency, Parkinson's disease, Alzheimer's disease, pigment deficiency, amyotrophic lateral sclerosis, asthma, β-thalassemia, CADASIL, Charcot-Marie-Tooth syndrome, chronic obstructive pulmonary disease (COPD), distal spinal muscular atrophy (DSMA), Duchenne / Becker muscular dystrophy, (dystrophic) epidermolysis bullosa, Fabry disease, factor V Leiden-related disorders, familial adenomatous polyposis, galactosemia, Gaucher disease, glucose-6-phosphate dehydrogenase, hemophilia, hereditary hemochromatosis, Hunter syndrome, Huntington's disease, inflammatory bowel disease (IBD), congenital polyagglutination syndrome, Leber congenital amaurosis (e.g., LCA10), Lesch-Nyhan syndrome, Lynch syndrome, Marfan syndrome, mucopolysaccharidosis, muscular dystrophy, myotonic dystrophy types I and II, neurofibromatosis, Niemann-Pick disease types A, B, and C, NY-eso1-related cancer, Peutz-Jeghers syndrome, phenylketonuria, Pompe disease, primary ciliary dyskinesia, prothrombin mutation-related disorders (e.g., prothrombin G20210A mutation), pulmonary hypertension, (autosomal dominant) retinitis pigmentosa, Sandhoff disease, severe combined immunodeficiency syndrome (SCID), sickle cell anemia, spinal muscular atrophy, Stargardt disease, Tay-Sachs disease, Usher syndrome (e.g., Usher syndrome types I, II, and III), X-linked immunodeficiency, Sturge-Weber syndrome, and cancer.

[0027] In yet another embodiment, the present invention relates to a method for deamination of at least one target nucleotide, preferably adenosine, present in a target nucleic acid molecule, preferably an RNA target molecule, within a cell, the method comprising the steps of supplying the cell with an AON according to the present invention or a pharmaceutical composition according to the present invention, enabling annealing of the AON to the target nucleic acid molecule, enabling a mammalian enzyme having nucleotide deaminase activity to deaminate the target nucleotide in the target nucleic acid molecule, and optionally, identifying the presence of the deaminated nucleotide in the target nucleic acid molecule. The mammalian enzyme having nucleotide deaminase activity engaged by the use of the AON according to the present invention is preferably an adenosine deaminase enzyme and is capable of modifying the target nucleotide in the target nucleic acid molecule, and then the target nucleotide is preferably adenosine deaminated to inosine. Any step of identifying the presence of the deaminated nucleotide is preferably sequencing a region of the target nucleic acid molecule, the region containing the deaminated target nucleotide, sequencing, the target nucleotide being adenosine located at a UGA or UAG stop codon and, if edited to a UGG codon by deamination, assessing the presence of a functional, extended, full-length and / or wild-type protein, two target adenosines being located at a UAA stop codon and, if both target adenosines are edited to a UGG codon by deamination, assessing the presence of a functional, extended, full-length and / or wild-type protein, if the target RNA molecule is a pre-mRNA, assessing whether splicing of the pre-mRNA is modified by deamination, or using a functional readout, the functional readout being used by assessing whether the target nucleic acid molecule after deamination encodes a functional, full-length, extended and / or wild-type protein.

[0028] In another embodiment, the present invention is a method for the deamination of at least one target nucleotide, preferably adenosine, present in a target nucleic acid molecule, preferably a target RNA molecule, the method comprising the steps of providing an AON according to the present invention, enabling annealing of the AON to the target nucleic acid molecule to form a double-stranded nucleic acid complex, enabling a mammalian enzyme having nucleotide deaminase activity to deaminate the target nucleotide in the target nucleic acid molecule, and identifying the presence of the deaminated nucleotide in the target nucleic acid molecule.

[0029] In another embodiment, the present invention is a method of treating a subject, preferably a subject in need thereof, the subject suffering from a genetic disorder caused by a mutation involved in the occurrence of adenosine (e.g., PTC), deamination of adenosine to inosine alleviating, preventing or ameliorating the disease, the method comprising the steps of administering to the subject an AON or pharmaceutical composition according to the present invention, enabling formation of a double-stranded nucleic acid complex of the AON and its specifically complementary target nucleic acid in cells of the subject, enabling engagement of an endogenously present enzyme having deamination activity such as hADAR1 or hADAR2, and enabling the enzyme to deaminate the target adenosine in the target nucleic acid molecule to thereby alleviate, prevent or ameliorate the genetic disease. Genetic diseases that can be treated according to this method are preferably, but not limited to, the genetic diseases listed herein (see above).

[0030] Definitions As used herein, the terms "adenine," "guanine," "cytosine," "thymine," "uracil," and "hypoxanthine" (the nucleobases in inosine) refer to the nucleobases themselves. The terms "adenosine," "guanosine," "cytidine," "thymidine," "uridine," and "inosine" refer to the nucleobases attached to (deoxy)ribose sugars. The term "nucleoside" refers to a nucleobase attached to a (deoxy)ribose sugar without a phosphate group. "Nucleotide" consists of a nucleoside and one or more phosphate groups. Thus, the term "nucleotide" refers to each nucleobase-(deoxy)ribosyl-phospholinker, as well as any chemical modifications of the ribose moiety or phosphate group. Thus, the term includes nucleotides containing a locked ribose moiety (including a 2'-4' bridge containing a methylene group or any other group), unlocked nucleic acids (UNA), phosphodiesters, phosphonoacetates, phosphotriesters, phosphorothioates (PS), phosphorodi)thioates, methylphosphonates (MP), nucleotides containing linkers such as phosphoramidate linkers. Sometimes, the terms, adenosine and adenine, guanosine and guanine, cytidine and cytosine, uracil and uridine, thymine and thymidine / uridine, inosine and hypoxanthine are used interchangeably to refer to the corresponding nucleobase on the one hand, and the nucleoside or nucleotide on the other hand. Sometimes, the terms, nucleobase, nucleoside, and nucleotide are used interchangeably where the context is not clearly different, for example, when a nucleoside is attached to a neighboring nucleoside and the bond between these nucleosides is modified. In this case, the nucleoside can be considered a modified linker or the nucleotide can be considered a modified nucleotide. As described above, a nucleotide is a nucleoside and one or more phosphate groups.The terms "ribonucleoside" and "deoxyribonucleoside", or "ribose" and "deoxyribose", are as used in the art. References to "antisense oligonucleotide", "oligonucleotide", or "AON" always mean both oligonucleotides and deoxyoligonucleotides, unless the context otherwise indicates. References to "oligonucleotide" can always include the bases A, G, C, U, or I. References to "deoxyoligonucleotide" can always include the bases A, G, C, T, or I.

[0031] In preferred embodiments, the AONs of the invention are oligonucleotides that can include chemical modifications and can include deoxynucleotides (DNA) at certain specific positions. The terms oligonucleotide, oligo, ON, oligonucleotide composition, antisense oligonucleotide, AON, (RNA) editing oligonucleotide, EON, and RNA (antisense) oligonucleotide can be used interchangeably herein. References to nucleotides in oligonucleotide constructs such as cytosine always include 5-methylcytosine, 5-hydroxymethylcytosine, and β-D-glucosyl-5-hydroxy-methylcytosine; references to adenine always include N6-methyladenine and 7-methyladenine; references to uracil always include dihydrouracil, 4-thiouracil, and 5-hydroxymethyluracil; and references to guanine always include 1-methylguanine. References to nucleosides or nucleotides always include ribofuranose derivatives such as 2'-deoxy, 2'-hydroxy, and other modifications including 2'-O-substituted variants such as 2'-O-methyl, and 2'-4' bridged variants. References to oligonucleotides always include that the linkage between two mononucleotides can be a phosphodiester linkage and its modifications, including phosphonoacetate, phosphodiester, phosphotriester, PS, phosphor(di)thioate, MP, phosphoramidate linkers, and the like.

[0032] The term "comprising" includes "including" as well as "consisting of". For example, a composition "comprising" X can consist exclusively of X or can include something additional, such as X + Y. The term "about" with respect to a numerical value X is arbitrary and, for example, means X ± 10%. The word "substantially" does not exclude "completely". For example, a composition "substantially free of" Y may be completely free of Y. In this context, the word "substantially" may be omitted from the definitions of the present invention.

[0033] As used herein, the term "complementary" refers to the fact that an AON hybridizes to a target sequence under physiological conditions. This term does not mean that every nucleotide of the AON has perfect base pairing with its opposing nucleotide of the target sequence. In other words, while an AON can be complementary to a target sequence, there can be mismatches, wobbles, and / or bulges between the AON and the target sequence such that the cell RNA editing enzyme can still edit the target adenosine while the AON still hybridizes to the target sequence under physiological conditions. Thus, the term "substantially complementary" also means that there are sufficiently matching nucleotides between the AON and the target sequence such that the AON hybridizes to the target RNA under physiological conditions, regardless of the presence of mismatches, wobbles, and / or bulges. As shown herein, an AON can be complementary but can also include one or more mismatches, wobbles, and / or bulges with the target sequence as long as the AON hybridizes to its target under physiological conditions.

[0034] With respect to a nucleic acid sequence, the term "downstream" means further along the sequence in the 3' direction, and the term "upstream" means the reverse. Thus, in any sequence encoding a polypeptide, the start codon is upstream of the stop codon on the sense strand but downstream of the stop codon on the antisense strand.

[0035] References to "hybridization" typically refer to specific hybridization and exclude non-specific hybridization. Specific hybridization is carried out using techniques well known in the art under selected experimental conditions, and it can be ensured that many of the stable interactions between the probe and the target are in a state where the probe and the target have at least 70%, preferably at least 80%, more preferably at least 90% sequence identity. The term "mismatch" is used herein to refer to opposing nucleotides in a double-stranded RNA complex that do not form perfect base pairs according to the Watson-Crick type base pair rules. The mismatched nucleotides are G-A, C-A, U-C, A-A, G-G, C-C, U-U pairs. In some embodiments, the AONs of the present invention contain less than 4 mismatches, for example, 0, 1, or 2 mismatches. Wobble base pairs are G-U, I-U, I-A, and I-C base pairs.

[0036] The AONs of the present invention contain nucleotides that directly oppose the target nucleotides present in the target RNA molecule. The nucleotides in the AON that directly oppose the target nucleotides are defined herein as "orphan nucleotides". "Central triplet" is defined as the region within the AON consisting of the orphan nucleotide and its 3' and 5' neighboring nucleotides (thus, central triplet = three nucleotides with an orphan nucleotide in the center).

[0037] The term "splice mutation" refers to a mutation in a gene encoding pre-mRNA, where the splicing mechanism is dysfunctional in the sense that the splicing of introns from exons is disrupted, and abnormal splicing results in subsequent translation being out of frame, leading to premature termination of the encoded protein. In many cases, such shorter proteins are rapidly degraded and do not have any functional activity as described herein. The exact mutation need not be a target for RNA editing, and an adenosine in the proximity or vicinity of the splice mutation may be the target nucleotide, which may be corrected to a splice mutation that returns to the normal state by conversion to I. Those skilled in the art are aware of methods for determining whether normal splicing is restored after RNA editing of adenosines within the site or region of the splice mutation.

[0038] The AON according to the present invention can be chemically modified almost entirely of the nucleoside, for example, by supplying a 2'-O-methylated sugar moiety (2'-OMe) and / or a 2'-O-methoxyethyl sugar moiety (2'-MOE) to the nucleoside. However, the orphan nucleotide preferably does not contain a 2'-OMe modification, and in a more preferred embodiment, at least one neighboring nucleotide, and in a preferred embodiment, both of the two neighboring nucleotides sandwiching each nucleotide opposite to the target adenosine, further do not contain a 2'-OMe modification. A complete modification in which all nucleotides of the AON have a 2'-OMe modification results in a non-functional oligonucleotide as long as RNA editing (known in the art) is performed, probably because it interferes with ADAR activity at the targeted position. Generally, adenosine in the target RNA can be protected from editing by generating a nucleotide opposite with a 2'-OMe group, or by generating guanine or adenine as the opposite base, and these two nucleobases can also reduce the editing of the opposite adenosine. Various chemical properties and modifications are known in the field of oligonucleotides that can be readily used according to the present invention. The normal internucleoside bond between nucleotides can be modified by mono- or dithioation of the phosphodiester bond to obtain phosphorothioate ester or phosphorodithioate ester, respectively. Other modifications of the internucleoside bond, including amidation and peptide linkers, are also possible. The MP bond can be formed using known chemical properties disclosed, for example, in Agrawal et al. 1997. Proc Natl Acad Sci USA 94:2620-2625. In a preferred embodiment, the AON of the present invention contains 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides.

[0039] It is known in the art that RNA editing substances (e.g., human ADAR enzymes) can edit dsRNA structures by changing their specificity depending on several factors. One important factor is the degree of complementarity of the duplexes that result in the dsRNA sequence. Perfect complementarity of the duplexes usually results in the catalytic domain of hADAR, which deaminates adenosine in a non-specific manner and reacts more or less with any adenosine it encounters. The specificity of hADAR1 and 2 can be enhanced by introducing chemical modifications and / or ensuring some mismatches in the dsRNA, and perhaps assisting in the positioning of the dsRNA binding domain in a way that is not yet clearly defined. Alternatively, the deamination reaction itself can be improved by generating an AON that contains a mismatch opposite the adenosine to be edited. The mismatch is preferably created by generating a targeting moiety that has a cytidine opposite the adenosine to be edited. As an alternative, uridine can also be used opposite adenosine, although of course, no "mismatch" occurs due to the pairing of U and A. When adenosine is deaminated on the target strand, the target strand obtains inosine, which is "read" as G by the cell's biochemical machinery for the most biochemical processes. Therefore, after the conversion from A to I, I can perfectly base-pair with the opposing C in the targeting moiety of the oligonucleotide construct according to the present invention, thus resolving the mismatch. After the mismatch is resolved by editing, the substrate is released, the oligonucleotide construct-editing substance complex is released from the target RNA sequence, and then becomes available for downstream biochemical processes such as splicing and translation. Also, since the targeted oligonucleotide should not bind too tightly to the target RNA, the on / off ratio is important. The desired level of specificity for editing the target RNA sequence can depend on each target. In accordance with the instructions in this patent application, one of ordinary skill in the art will be able to design the complementary portion of the oligonucleotide as needed and, with some trial and error, will be able to obtain the desired result.

[0040] RNA editing molecules present in cells are typically proteinaceous in nature, such as the ADAR enzymes found in metazoans, including mammals. Preferably, the editing agent of the cell is an enzyme, more preferably adenosine deaminase or cytidine deaminase, and even more preferably adenosine deaminase. These are enzymes having ADAR activity. The most interesting ones are human ADAR, hADAR1, and hADAR2, including any of its isoforms such as hADAR1 p110 and p150. RNA editing enzymes known in the art can be appropriately designed for the oligonucleotide constructs according to the present invention, including adenosine deaminases acting on RNA (ADAR), such as hADAR1 and hADAR2 in human or human cells, as well as cytidine deaminase. Human ADAR3 (hADAR3) has been described in the prior art, but according to reports, it has no deaminase activity. hADAR1 exists in two isoforms, the long 150 kDa inducible interferon, and the shorter 100 kDa form, and is known to be generated by alternative splicing from normal pre-mRNA. As a result, the level of the 150 kDa isoform present in cells can be affected by interferon, particularly interferon gamma (IFN-γ). hADAR1 is also induced by TNF-α. This provides an opportunity to develop combination therapies, whereby IFN-γ or TNF-α, and the AON according to the present invention, are administered to a patient either simultaneously or subsequently, in any order, either as a combination product or as separate products. Certain disease states may already coincide with high IFN-γ or TNF-α levels in certain tissues of a patient, creating an additional opportunity for more specific editing of the diseased tissue. It will be understood by those skilled in the art that the degree to which the editing agent within the cell is reoriented to other target sites can be regulated by changing the affinity of the AON according to the present invention for the recognition domain of the editing molecule. The exact modification can be determined through some trial and error, as well as / or by computational methods based on the structural interaction between the AON and the recognition domain of the editing molecule.In addition, or alternatively, the extent to which the editing substances present in the cells are mobilized and reoriented can be regulated by the administration and dosing regimen of the AON. This is typically determined by the (in vitro) experimenter or clinician in a Phase I and / or Phase II clinical trial.

[0041] The present invention relates to the modification of target RNA sequences in eukaryotic cells, preferably metazoan cells, more preferably mammalian cells, and most preferably human cells. The present invention can be used in cells derived from any organ, such as skin, lung, heart, kidney, liver, pancreas, intestine, muscle, gland, eye, brain, blood, etc. The present invention is particularly suitable for modifying the sequences of cells, tissues, or organs involved in the disease state of a (human) subject. The cells can be located in vitro, ex vivo, or in vivo. One advantage of the present invention is that it can be used in cells in situ in the living body, but can also be used in cells under culture. In some embodiments, the cells are treated ex vivo and then introduced into the living body (e.g., reintroduced into the organism from which they originally originated). The present invention can also be used to edit target RNA sequences in cells within so-called organoids. Organoids are considered three-dimensional in vitro-derived tissues, but are driven using specific conditions that generate individual isolated tissues (see, for example, Lancaster & Knoblich, Science 2014, vol. 345 no. 6194 1247125). In a therapeutic setting, organoids can be useful because they can be reintroduced into a patient as autologous material that is less likely to be rejected than normal transplants since they can be derived from the patient's cells in vitro. The cells to be treated generally have a genetic mutation. The mutation can be heterozygous or homozygous. The present invention is typically used to modify point mutations such as mutations from N to A (where N can be G, C, U (T at the DNA level)), preferably mutations from G to A, or mutations from N to C (where N can be A, G, U (T at the DNA level)), preferably mutations from U to C.

[0042] Although it is not desirable to restrict the theory, RNA editing by hADAR1 and hADAR2 is thought to occur in the nucleus during transcription or splicing, or in cytoplasmic primary transcripts that can edit, for example, mature mRNA, miRNA, or ncRNA. Different isoforms of the editing enzyme are known to be differentially localized, for example, hADAR1 p110, which is mostly found in the nucleus, and hADAR1 p150, which is mostly found in the cytoplasm. RNA editing by cytidine deaminase is thought to occur at the mRNA level.

[0043] Many genetic diseases are caused by G-to-A mutations, and adenosine deamination at the mutated target adenosine, especially when related to PTC, reverses the mutation to the codon where the functional full-length and / or wild-type protein is generated, so these are preferred target diseases. Preferred examples of genetic diseases that can be prevented and / or treated with the oligonucleotides according to the present invention are any diseases in which modification of one or more adenosines in the target RNA results in a (potential) beneficial change. Particularly preferred are Usher syndrome and CF, and more specifically, RNA editing of adenosine in disease-inducing PTC in CFTR RNA is preferred. Those skilled in the art of CF mutations recognize that 1000-2000 mutations are known in the CFTR gene, including G542X, W1282X, R553X, R1162X, Y122X, W1089X, W846X, W401X, 621+1G>T, or 1717-1G>A.

[0044] It should be apparent that the targeted editing according to the present invention can be applied to any adenosine (or cytosine), whether mutated or wild-type nucleotides at a given sequence. For example, the editing can be used to create RNA sequences with different properties. Such properties can be coding properties (resulting in proteins with different sequences or lengths that confer modified protein properties or functions), or binding properties (causing inhibition or overexpression of the RNA itself or a target or binding partner; the entire expression pathway can be modified by recording miRNA or its cognate sequences with the target RNA). The function or localization of a protein can be directly changed by functional domains or recognition motifs, including but not limited to signal sequences, targeting or localization signals, recognition sites for proteolytic cleavage or translation or post-translational modifications, catalytic sites of enzymes, binding sites for binding partners, signals for degradation or activation, etc. These and other forms of RNA, as well as protein "engineering", are encompassed by the present invention for use as diagnostic, preventive, therapeutic, investigative tools, etc. in medicine or biotechnology, whether for the prevention, delay, or treatment of disease, or for any other purpose.

[0045] The amount, dosage, and dosing regimen of the AON administered can vary depending on the cell type, the disease being treated, the target population, the mode of administration (e.g., systemic vs. local), the severity of the disease, and the acceptable level of side activity, but these can be evaluated by trial and error during in vitro studies, preclinical trials, and clinical trials and should be evaluated. The test is particularly straightforward when a phenotypic change is produced that is readily detectable by the modified sequence. Higher doses of AON may compete to bind to nucleic acid editing substances (e.g., ADAR) within the cell, thereby depleting the amount of substance that does not perform RNA editing, but any such effects for a given AON and a given target will be revealed by normal dosing studies.

[0046] One suitable test technique involves delivering the AON to a cell line or test organism and then collecting biopsy samples at various subsequent time points. The sequence of the target RNA can be evaluated in the biopsy sample, and the percentage of cells having the modification can then be readily determined. Once this test has been performed, information can then be retained and subsequent deliveries can be made without the need to collect biopsy samples. Thus, the method of the invention can include the step of identifying the presence of a desired change in the target RNA sequence of a cell, thereby verifying that the target RNA sequence has been modified. This step typically involves sequencing the relevant portion of the target RNA, or its cDNA copy (or, if the target RNA is pre-mRNA, the cDNA copy of its splicing product), as described above, so that sequence changes can be readily verified. Alternatively, the change can be evaluated at the protein level (length, glycosylation, function, etc.) or by some functional readout such as, for example, (induced) current if the protein encoded by the target RNA sequence is an ion channel.

[0047] After RNA editing has occurred intracellularly, the modified RNA can be diluted over time, for example, by cell division or limitations in the half-life of the RNA being edited. Thus, in terms of practical therapy, the method of the invention can include repeated delivery of the AON until sufficient target RNA has been modified to provide a visible benefit to the patient and / or to maintain the benefit over time.

[0048] Since the AONs of the invention are particularly suitable for therapeutic use, the invention provides a pharmaceutical composition comprising an AON of the invention and a pharmaceutically acceptable carrier. In some embodiments of the invention, the pharmaceutically acceptable carrier can simply be an aqueous saline solution. This can be usefully isotonic or hypertonic, particularly for pulmonary delivery. The invention also provides a delivery device (e.g., a syringe, inhaler, nebulizer) comprising the pharmaceutical composition of the invention.

[0049] The present invention also provides the AONs of the present invention for use in a method for altering a target RNA sequence in mammalian, preferably human cells, as described herein. Similarly, the present invention provides the use of the AONs of the present invention in the manufacture of a medicament for altering a target RNA sequence in mammalian, preferably human cells, as described herein.

[0050] The present invention also relates to a method for deaminating at least one specific target adenosine present in a target RNA sequence in a cell, the method comprising the steps of supplying the cell with an AON according to the present invention, enabling uptake of the AON by the cell, enabling annealing of the AON to the target RNA molecule, enabling a mammalian ADAR enzyme comprising a natural dsRNA binding domain found in wild-type enzymes to deaminate the target adenosine in the target RNA molecule to inosine, and optionally, identifying the presence of inosine in the RNA sequence.

[0051] In a preferred embodiment, depending on the maximum deamination effect of the conversion from A to I, the identifying step includes sequencing the target RNA, assessing the presence of a functional, extended, full-length, and / or wild-type protein, assessing whether the splicing of the pre-mRNA is modified by deamination, or using a functional readout, where the target RNA after deamination encodes a functional, full-length, extended, and / or wild-type protein. Identification of deamination to inosine can also be an assessment of a functional readout, such as whether a functional protein is present, or even an assessment of whether a disease caused by the presence of adenosine is (partially) reversed, since deamination of adenosine to inosine can result in a protein that is no longer troubled by the mutated A at the target position. The functional assessment for each of the diseases described herein generally follows methods known to those of ordinary skill in the art. A very suitable method for identifying the presence of inosine after deamination of the target adenosine is, of course, RT-PCR and sequencing using methods well known to those of ordinary skill in the art.

[0052] The AON according to the present invention is appropriately administered as a suspension in an aqueous solution, such as physiological saline, or at a concentration in the range of 1 ng / ml to 1 g / ml, preferably 10 ng / ml to 500 mg / ml, more preferably 100 ng / ml to 100 mg / ml, optionally containing additive substances, excipients, or other components suitable for pharmaceutical use. The dosage can suitably be in the range of about 1 μg / kg to about 100 mg / kg, preferably about 10 μg / kg to about 10 mg / kg, more preferably about 100 μg / kg to about 1 mg / kg. Administration can be by inhalation (e.g., by nebulizer), intranasal, oral, injection or infusion, intravenous, subcutaneous, intradermal, intracranial, intravitreal, intramuscular, intratracheal, intraperitoneal, rectal, etc. The administration can be in solid form, powder, pill, gel, eyedrop form, or any other form suitable for pharmaceutical use in humans.

Example

[0053] [Example 1] Antisense oligonucleotides (AONs) containing methylphosphonate (MP) linkage modifications are more stable than AONs lacking such MP modifications as determined using in vitro biochemical degradation assays. The presence of a 2'-OMe modification of the sugar moiety of the nucleotide opposite the target adenosine in the target RNA molecule is known to reduce the deamination of the specific target adenosine to inosine compared to AONs without such 2'-OMe modifications. Unfortunately, the absence of such sugar modifications at this specific position renders the AON unstable. The inventors of the present invention wondered whether such could be resolved by instead having internucleotide linkage modifications between two DNA nucleotides. In contrast, two methylphosphonate (MP) linkages were introduced in an AON between two DNA nucleosides, one of which is opposite the target adenosine present in the target mouse IDUA RNA molecule, and their respective 3'-proximal nucleosides. The structure of the MP-modified DNA-DNA linkage is shown in FIG. 1. FIG. 2 shows the sequences of the mouse IDUA target molecule as well as the complementary AONs used, showing the absence of modifications between DNA nucleosides (capital letters in FIG. 2) in AON ADAR102-1, and the presence of MP modifications between the two DNA nucleosides marked with ^ in ADAR102-13 and their respective 3'-proximal nucleosides. The sequences of ADAR102-21 (having 2'-OMe modifications at all positions of the AON, as well as PS modifications in the linkage between this cytidine and its 3'-proximal adenosine and in the two preceding 5' linkages), and ADAR102-25 (having two DNA nucleosides with PS linkages similar to ADAR102-21 at the same positions as ADAR102-1) are not shown.

[0054] All four oligonucleotides, ADAR102-1 (2×DNA, without binding modification), ADAR102-25 (2×DNA, PS modification), ADAR102-21 (PS modification), and ADAR102-13 (2×DNA, MP modification) were tested in a biochemical stability assay. All oligonucleotides were diluted to a concentration of 25 μM in nuclease-free water (Ambion), and 10 μl of each oligonucleotide was incubated at 37 °C with 10 μl of liver lysate and 10 μl of nuclease mix. The liver lysate was prepared as follows: 3.5 g of wild-type C57BI / 6J mouse liver was homogenized at 4 °C using a GentleMacs homogenizer from Miltenyi Biotech in 9 ml of 100 mM Tris-HCl, pH 8, and 1 mM MgOAc, centrifuged at 4000 rpm for 5 minutes at 4 °C, and then aliquoted into 1 ml aliquots determined by the 12 mg / ml protein concentrate of the Pierce BCA Protein Assay Kit and stored at -80 °C for further use. The nuclease mix was prepared as follows: 5 μl of phosphodiesterase I from Crotalus adamanteus venom (Sigma), 5 μl of DNase I (New England BioLAbs), 5 μl of RNase A (Thermo Scientific), and 5 μl of nuclease BAL-31 (New England BioLAbs) were mixed together in 30 μl of nuclease BAL-31 buffer (New England BioLAbs) and 10 μl of nuclease-free water (Ambion). Incubation of the oligonucleotides was stopped at predetermined time points (0, 30, and 120 minutes) by adding an equal volume of denaturing sample buffer (8 M urea, 20 mM EDTA, 5 mM Tris-HCl, pH 7.5, 30% glycerol, 0.005% xylene cyanol, 0.01% bromophenol blue). The samples were then resolved on a 15% mini-PROTEAN TBE-urea gel, 15 wells, 15 μl, denaturing, using a BioRad Mini-PROTEAN Tetra cell gel electrophoresis system from BioRad.The gel was stained with toluidine blue O (Sigma-Aldrich) for 30 minutes and destained with water. The gel was imaged using a BioRad Gel Doc XR+ imaging device equipped with a white light conversion screen and analyzed using the ImageJ program.

[0055] The results are shown in Figure 3 and clearly show that the presence of a PS bond between two DNA nucleotides (of ADAR102-25) does not result in additional stability when compared to ADAR102-1 in which the two DNA nucleotides are linked by a normal phosphodiester bond under the conditions tested. The upper panel shows the results with ADAR102-21 having 2'-OMe modification as well as a PS bond, actually showing that the presence of 2'-OMe increases the stability of the oligonucleotide. Surprisingly, an oligonucleotide having no 2'-OMe modification at the same position as the oligonucleotide introduced an MP bond but resulted in being very stable in the oligonucleotide and seemed to be almost as stable as the 2'-OMe modified oligonucleotide in this stability assay. It was concluded that the introduction of an MP bond in the oligonucleotide resulted in a stability equivalent to that of the 2'-OMe sugar modification.

[0056] [Example 2] RNA Editing with AONs Having Stabilizing MP Bond Modifications The inventors next wondered whether the MP modification, while resulting in a more stable AON, would still prevent RNA editing, similar to the low efficiency of RNA editing observed with AONs having a PS modification between DNA nucleotides in the AON (data not shown). Thus, although the MP modification was known here to enhance the stability of the AON, it was explored whether it would enable RNA editing as opposed to the 2'-OMe modification which results in an AON that is stable (while providing stability) but not effective for RNA editing.

[0057] In contrast, ADAR102-1 and ADAR102-13 were compared with the following RNA editing assay. First, both AONs were annealed to mouse IDUA target RNA. Annealing was performed in buffer (5 mM Tris-Cl, pH 7.4, 0.5 mM EDTA, and 10 mM NaCl) at a target RNA to AON ratio of 1:3 (6 nM AON and 2 nM target at the final concentration of the editing reaction). The samples were heated at 95 °C for 3 minutes and then slowly cooled to room temperature. Next, the editing reaction was carried out. The annealed double-stranded AON / target RNA was mixed with protease inhibitor (cOmplete, mini, EDTA-free protease I, Sigma-Aldrich), RNase inhibitor (RNasin, Promega), poly A (Qiagen), tRNA (Invitrogen), and editing reaction buffer (15 mM Tris-Cl, pH 7.4, 1.5 mM EDTA, 3% glycerol, 60 mM KCl, 0.003% NP-40, 3 mM MgCl2, and 0.5 mM DTT). The reaction was initiated by adding purified ADAR2 generated by GenScript to the mixture to a final concentration of 8 nM and incubated at 37 °C for given time points (0, 2, 5, 10, 20, 40, and 60 minutes). The reaction was stopped by adding 190 μL of boiling water and then the mixture was incubated at 95 °C for 5 minutes. Next, the stopped reaction mixture was used as a template for cDNA synthesis using Maxima reverse transcriptase and hexamer (Thermo Fisher). The cDNA was diluted 10-fold and 1 μL of this dilution was used as a template for digital droplet PCR (ddPCR). The ddPCR assay for absolute quantification of nucleic acid target sequences was performed using BioRad's QX-200 droplet digital PCR system. 1 μl of the diluted cDNA obtained from the RT cDNA synthesis reaction was used in a total mixture of 20 μl of the reaction mixture containing ddPCR Supermix (Bio Rad) for probes without dUTP, and the Taqman SNP genotyping assay with the following forward and reverse primers was combined with the following gene-specific probes: Forward primer: 5’-CTCACAGTCATGGGGCTC-3’ (SEQ ID NO: 4) Reverse primer: 5’-CACTGTATGATTGCTGTCCAAC-3’ (SEQ ID NO: 5) Wild-type probe (FAM NFQ-labeled): 5’-AGAACAACTCTGGGCAGAGGTCTCA-3’ (SEQ ID NO: 6) Mutant-type probe (HEX NFQ-labeled): 5’-AGAACAACTCTAGGCAGAGGTCTCA-3’ (SEQ ID NO: 7)

[0058] A 20 μl total volume PCR mix containing cDNA was filled into the middle row of a ddPCR cartridge (BioRad) using a multi-channel pipette. The replicates were split into two cartridges. The following was filled with 70 μl of droplet generation oil for probes (BioRad). After replacement of the rubber gasket, droplets were generated with a QX200 droplet generator. 40 μl of the oil emulsion was transferred from the upper row of the cartridge to a 96-well PCR plate. The PCR plate was sealed with tin foil at 170 °C for 4 minutes using a PX1 plate sealer and then the following PCR program was performed: 1 cycle of enzyme activation at 95 °C for 10 minutes, 40 cycles of denaturation at 95 °C for 30 seconds and annealing / extension at 63.8 °C for 1 minute, 1 cycle of enzyme inactivation at 98 °C for 10 minutes followed by storage at 8 °C. After PCR, the plate was read and analyzed with a QX200 droplet reader.

[0059] The results are shown in Figure 4 and clearly show that the use of ADAR102-13 resulted in up to 30% RNA editing, although it was somewhat reduced compared to AON (ADAR102-1) that does not contain a binding modification between the DNA nucleotides opposite the target adenosine. This clearly shows that the presence of the MP modification that binds two DNA nucleotides opposite the target adenosine in the target RNA molecule to their respective 3’-proximal nucleosides enabled RNA editing. Together with the fact that the modification enhances the stability of the AON, these two features are thought to provide an improved RNA editing tool compared to what has been demonstrated in the prior art.

[0060] [Example 3] RNA Editing with AONs Having Stabilizing MP Binding Modifications The inventors next wondered where the MP modification could be implemented within the AON and still enable RNA editing. AONs having the MP modification at binding positions 0 to -6 relative to the orphan nucleoside were synthesized and tested. The editing assay was performed as in Example 2 with the following changes: the final concentrations were 1 nM target RNA, 24 nM AON, and 3 nM ADAR2, and 3 mM MgSO4 was used instead of 3 mM MgCl2 in the editing reaction buffer. The reaction was carried out as described in Example 2, and stopped at time points 0 sec, 30 sec, 1 min, 2 min, 5 min, 10 min, 25 min, and 50 min by adding 95 μl of a boiled 3 mM EDTA solution to 5 μl aliquots obtained from the reaction.

[0061] Next, 6 μl aliquots of the stopped reaction mixture were used as templates for cDNA synthesis using the Maxima reverse transcriptase kit (Thermo Fisher) with a target RNA-specific primer (5’-GGAAACGTAGGTTGGGGTGTG-3’, SEQ ID NO: 8). Initial denaturation of the RNA was performed at 95 °C for 5 min in the presence of the primer and dNTPs, followed by gentle cooling to 10 °C, and then first-strand synthesis was carried out at an extension temperature of 62 °C in a total volume of 20 μl according to the manufacturer's instructions.

[0062] The product was amplified for pyrosequencing analysis by PCR with 1 μl of cDNA as template using the Amplitaq Gold 360 DNA Polymerase Kit (Applied Biosystems) according to the manufacturer's instructions. The following primers were used at a concentration of 10 μM: pyrosequence forward 2 IDUA, 5'-AGTACTCACAGTCATGGGGCTCA-3' (SEQ ID NO: 9), and pyrosequence reverse 2 IDUA biotin, 5'-GCCAGGACACCCACTGTATGAT-3' (SEQ ID NO: 10). The latter primer also contains biotin conjugated to its 5' end for automated processing during the pyrosequencing reaction, if required. PCR was performed using the following thermal cycle protocol: an initial denaturation at 95°C for 5 min, followed by 40 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s, and a final extension at 72°C for 7 min.

[0063] As the base pair of inosine with cytidine during cDNA synthesis in the reverse transcription reaction, the nucleotide incorporated at the position to be edited during PCR is guanosine. The percentage of guanosine (edited) to adenosine (unedited) was defined by pyrosequencing. Pyrosequencing of the PCR product and subsequent data analysis were performed on a PyroMark Q48 Autoprep instrument (QIAGEN) according to the manufacturer's instructions with a 10 μl input of the PCR product and 4 μM of the following sequencing primer: IDUA sequence 2, 5'-TGGGGCTCATGGCCCT-3' (SEQ ID NO: 11). The settings specifically defined for this target RNA strand included two sets of sequence information. The first set defined the sequence for the instrument to analyze, and the possibility of either adenosine or guanosine at a specific position was indicated by " / ": 5'-GTTGGATGGAGAACAAC TCTA / GGGCAGAGGTCTCAA / GAGGCTGGGGCT-3' (SEQ ID NO: 12). It should be noted that two positions were analyzed by sequencing: the target site and a control site that should not be edited (the results show only the target site). The second set defined the order in which the sequencing reagents corresponding to each nucleotide were dispensed and also included a blank control (i.e., a nucleotide that should not be incorporated at a specific position), which was used by the instrument to define the background signal. The dispensing order was defined for this analysis as follows: CGTGATGAGACACTCGTAGCAGAGTCTGCAGAGCTGCA (SEQ ID NO: 13). The analysis performed by the instrument showed the results for the selected nucleotide as the percentage of adenosine and guanosine detected at that position. Thus, the extension from A to I at the selected position was measured by the percentage of guanosine at that position.

[0064] The results in FIGS. 6 and 7 show that an AON having an MP bond between any of the nucleotides in the region proximal to the orphan nucleotide enables RNA editing. It was observed that the modifications at positions 0 and -2 resulted in RNA editing characteristics similar to those of the positive control AON. Other positions may have MPs. These do not seem to be very effective for RNA editing, either in terms of the final level of editing achieved or in terms of the kinetics of the reaction.

[0065] [Example 4] RNA Editing in Cells by AONs with Stable MP-Bond Modifications The inventors next explored the ability of AONs to perform editing in cells, but there is RNA with the sequence of the target site used in Examples 2 and 3. The cells in question are a mouse embryonic fibroblast cell line, and the endogenous Idua gene has a G-to-A mutation (resulting in an A at the target site) that leads to the formation of a premature stop codon (W392X). These cells additionally overexpress Idua W392X RNA from a stably integrated cDNA construct. Briefly, 150,000 cells were seeded 24 hours prior to transfection and transfected with 100 nM AON and Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions (at a ratio of 1 μl of Lipofectamine 2000 to 1 μg of AON). RNA was extracted from the cells 48 hours after transfection using the Direct-zol RNA MiniPrep (Zymo Research) kit according to the manufacturer's instructions, and cDNA was prepared using the Maxima reverse transcriptase kit (Thermo Fisher) according to the manufacturer's instructions with a combination of random hexamer and oligo dT primers. The cDNA was diluted 4-fold, and 1 μL of this dilution was used as a template for digital droplet PCR (ddPCR), which was performed as detailed in Example 2.

[0066] The results in Figure 8 show that AON without MP (IDUA103) exhibits variable editing that does not clearly differentiate from the background, as defined by control samples with either untreated (NT) cells or cells treated only with Lipofectamine 2000 (mock). In contrast, AON with MP binding modification can promote editing in cells above this background level. This represents the ability of the AON to withstand nuclease degradation and to mobilize endogenous editing enzymes. The present invention also relates to the following aspects. (1) An antisense oligonucleotide (AON) capable of forming a double-stranded complex with the target nucleic acid molecule in a cell for use in deaminating a target nucleotide, preferably adenosine, in the target nucleic acid molecule, wherein the nucleotide in the AON directly opposite the target nucleotide is an orphan nucleotide, and the AON contains one or more methylphosphonate (MP) linkages. (2) The AON according to (1) above, wherein the orphan nucleotide does not have a 2'-OMe or 2'-MOE ribose modification. (3) The numbering of the internucleotide linkages is such that the bond number 0 is the 5' bond from the orphan nucleotide, the bond position in the oligonucleotide increases positively towards the 5' end and negatively towards the 3' end, and the AON contains one or more MP linkages at bond positions 0, -1, -2, -3, -4, -5, and / or -6. (4) The AON according to (3) above, containing an MP linkage at bond position -0 and / or -2. (5) The AON according to any one of (1) to (4) above, wherein the MP linkage connects a DNA nucleoside to another nucleoside. (6) The AON according to (5) above, wherein the MP linkage connects a DNA nucleoside to a DNA nucleoside. (7) The AON according to any one of (1) to (6) above, further comprising at least one phosphorothioate or phosphonoacetate internucleotide linkage and / or at least one nucleotide containing an unlocked nucleic acid (UNA) ribose modification. (8) Further comprising one or more nucleotides containing a substitution at the 2'-position of the ribose, said substitution being selected from the group consisting of -OH; -F; substituted or unsubstituted, linear or branched lower (C1-C10) alkyl, alkenyl, alkynyl, alkaryl, allyl, or aralkyl, which may be interrupted by one or more heteroatoms; -O-, S-, or N-alkyl; -O-, S-, or N-alkenyl; -O-, S-, or N-alkynyl; -O-, S-, or N-allyl; -O-alkyl-O-alkyl; -methoxy; -aminopropoxy; -methoxyethoxy; -dimethylaminooxyethoxy; and -dimethylaminoethoxyethoxy, the AON according to any one of (1) to (7) above. (9) Comprising at least one nucleotide containing a 2'-OMe or 2'-MOE ribose modification, the orphan nucleotide having no 2'-OMe or 2'-MOE ribose modification, the AON according to any one of (1) to (8) above. (10) An AON according to any one of (1) to (9) above, which is capable of engaging an enzyme having deaminase activity, preferably an enzyme having adenosine deaminase activity, such as human ADAR1 or ADAR2, in a cell. (11) Having a length of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32 nucleotides, shorter than 100 nucleotides, preferably shorter than 60 nucleotides, the AON according to any one of (1) to (10) above. (12) A pharmaceutical composition comprising an AON according to any one of (1) to (11) above and a pharmaceutically acceptable carrier. (13) Use of an AON according to any one of (1) to (11) above, or a pharmaceutical composition according to (12) above, for the treatment or prevention of a genetic disorder preferably selected from the group consisting of cystic fibrosis, Hurler syndrome, α-1-antitrypsin (A1AT) deficiency, Parkinson's disease, Alzheimer's disease, pigment deficiency, amyotrophic lateral sclerosis, asthma, β-thalassemia, CADASIL, Charcot-Marie-Tooth syndrome, chronic obstructive pulmonary disease (COPD), distal spinal muscular atrophy (DSMA), Duchenne / Becker muscular dystrophy, (dystrophic) epidermolysis bullosa, Fabry disease, factor V Leiden-related disorder, familial adenomatous polyposis, galactosemia, Gaucher disease, glucose-6-phosphate dehydrogenase, hemophilia, hereditary hemochromatosis, Hunter syndrome, Huntington's disease, inflammatory bowel disease (IBD), congenital polyagglutination syndrome, Leber congenital amaurosis (e.g., LCA10), Lesch-Nyhan syndrome, Lynch syndrome, Marfan syndrome, mucopolysaccharidosis, muscular dystrophy, myotonic dystrophy type I and type II, neurofibromatosis, Niemann-Pick disease type A, type B and type C, NY-eso1-related cancer, Peutz-Jeghers syndrome, phenylketonuria, Pompe disease, primary ciliary disease, prothrombin mutation-related disorder (e.g., prothrombin G20210A mutation), pulmonary hypertension, (autosomal dominant) retinitis pigmentosa, Sandhoff disease, severe combined immunodeficiency syndrome (SCID), sickle cell anemia, spinal muscular atrophy, Stargardt disease, Tay-Sachs disease, Usher syndrome (e.g., Usher syndrome type I, type II, and type III), X-linked immunodeficiency, Sturge-Weber syndrome, and cancer. (14) A method for deamination of at least one target nucleotide, preferably adenosine, present in a target RNA molecule within a cell, comprising: (i) supplying the cell with an AON according to any one of (1) to (11) above or a pharmaceutical composition according to (12) above; (ii) enabling annealing of the AON to the target RNA molecule; (iii) enabling a mammalian enzyme having nucleotide deaminase activity to deaminate the target nucleotide in the target RNA molecule; and (iv) optionally, identifying the presence of the deaminated nucleotide in the target RNA molecule A method comprising. (15) wherein step (iv) is a) sequencing a region of the target RNA molecule comprising the deaminated target nucleotide, b) when the target nucleotide is adenosine located at a UGA or UAG stop codon and is edited to a UGG codon by deamination, assessing the presence of a functional, extended, full-length, and / or wild-type protein, c) when two target adenosines are located at a UAA stop codon and are both edited to a UGG codon by deamination of both target adenosines, assessing the presence of a functional, extended, full-length, and / or wild-type protein, d) when the target RNA molecule is a pre-mRNA, assessing whether splicing of the pre-mRNA is modified by deamination, or e) using a functional readout, wherein the target RNA molecule after deamination encodes a functional, full-length, extended, and / or wild-type protein The method according to (14) above, comprising. (16) A method for deamination of at least one target nucleotide, preferably adenosine, present in a target RNA molecule, comprising (i) supplying an AON according to any one of (1) to (11) above, (ii) enabling annealing of the AON to the target RNA molecule, (iii) enabling a mammalian enzyme having nucleotide deaminase activity to deaminate the target nucleotide in the target RNA molecule, and (iv) identifying the presence of the deaminated nucleotide in the target RNA molecule A method comprising.

Claims

Claim 1 An antisense oligonucleotide (AON) capable of forming a double-stranded complex with a target nucleic acid molecule in a cell for use in deaminating a target nucleoside, preferably adenosine, in the target nucleic acid molecule, wherein the nucleotide in the AON directly opposite the target nucleoside is an orphan nucleotide, the numbering of the internucleoside bonds is such that bond number 0 is the 5'-bond from the orphan nucleotide, the binding position in the oligonucleotide is incremented positively (+) towards the 5'-end and negatively towards the 3'-end, and the AON contains one or more methylphosphonate (MP) bonds at binding positions 0, -1, -2, -3, -4, -5, and / or -6, and the MP bond has the following chemical structure: 【Chemical 1】 An antisense oligonucleotide (AON) having the above. Claim 2 The AON according to claim 1, wherein the orphan nucleotide does not have a 2'-OMe or 2'-MOE ribose modification. Claim 3 The AON according to claim 1 or 2, containing an MP bond at binding positions -0 and / or -2. Claim 4 The AON according to any one of claims 1 to 3, wherein the MP bond connects a DNA nucleoside to another nucleoside. Claim 5 The AON according to claim 4, wherein the MP bond connects a DNA nucleoside to a DNA nucleoside. Claim 6 The AON according to any one of claims 1 to 5, further comprising at least one phosphorothioate or phosphonoacetate internucleoside bond and / or at least one nucleotide containing an unlocked nucleic acid (UNA) ribose modification. Claim 7 Further comprising one or more nucleotides comprising a substitution at the 2'-position of the ribose, said substitution being selected from the group consisting of: -OH; -F; substituted or unsubstituted, linear or branched lower (C1-C10) alkyl, alkenyl, alkynyl, alkaryl, allyl, or aralkyl, which may be interrupted by one or more heteroatoms; -O-, S-, or N-alkyl; -O-, S-, or N-alkenyl; -O-, S-, or N-alkynyl; -O-, S-, or N-allyl; -O-alkyl-O-alkyl; -methoxy; -aminopropoxy; -methoxyethoxy; -dimethylaminooxyethoxy; and -dimethylaminoethoxyethoxy, the AON according to any one of claims 1 to 6.

8. An AON according to any one of claims 1 to 7, comprising at least one nucleotide comprising a 2'-OMe or 2'-MOE ribose modification, wherein the orphan nucleotide does not have a 2'-OMe or 2'-MOE ribose modification.

9. An AON according to any one of claims 1 to 8, which is capable of engaging an enzyme having deaminase activity, preferably an enzyme having adenosine deaminase activity, such as human ADAR1 or ADAR2, in a cell.

10. An AON according to any one of claims 1 to 9, which is at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32 nucleotides in length and shorter than 100 nucleotides, preferably shorter than 60 nucleotides.

11. A pharmaceutical composition comprising an AON according to any one of claims 1 to 10 and a pharmaceutically acceptable carrier.

12. Use of an AON according to any one of claims 1 to 10 or a pharmaceutical composition according to claim 11 for the treatment or prevention of a genetic disorder preferably selected from the group consisting of cystic fibrosis, Hurler syndrome, α-1-antitrypsin (A1AT) deficiency, Parkinson's disease, Alzheimer's disease, achromatopsia, amyotrophic lateral sclerosis, asthma, β-thalassemia, CADASIL, Charcot-Marie-Tooth syndrome, chronic obstructive pulmonary disease (COPD), distal spinal muscular atrophy (DSMA), Duchenne / Becker muscular dystrophy, (dystrophic) epidermolysis bullosa, Fabry disease, factor V Leiden-related disorder, familial adenomatous polyposis, galactosemia, Gaucher disease, glucose-6-phosphate dehydrogenase, hemophilia, hereditary hemochromatosis, Hunter syndrome, Huntington's disease, inflammatory bowel disease (IBD), congenital polyagglutination syndrome, Leber congenital amaurosis (e.g., LCA10), Lesch-Nyhan syndrome, Lynch syndrome, Marfan syndrome, mucopolysaccharidosis, muscular dystrophy, myotonic dystrophy types I and II, neurofibromatosis, Niemann-Pick disease types A, B, and C, NY-eso1-related cancer, Peutz-Jeghers syndrome, phenylketonuria, Pompe disease, primary ciliary diseases, prothrombin mutation-related disorders (e.g., prothrombin G20210A mutation), pulmonary hypertension, (autosomal dominant) retinitis pigmentosa, Sandhoff disease, severe combined immunodeficiency syndrome (SCID), sickle cell anemia, spinal muscular atrophy, Stargardt disease, Tay-Sachs disease, Usher syndrome (e.g., Usher syndrome types I, II, and III), X-linked immunodeficiency, Sturge-Weber syndrome, and cancer. **Claim 13** A method for deaminating at least one target nucleoside, preferably adenosine, present in a target RNA molecule in vitro or ex vivo, comprising: (i) supplying to the cell an AON according to any one of claims 1 to 10 or a pharmaceutical composition according to claim 11; (ii) enabling annealing of the AON to the target RNA molecule; (iii) enabling a mammalian enzyme having nucleotide deaminase activity to deaminate the target nucleoside in the target RNA molecule; and optionally, identifying the presence of the deaminated target nucleoside in the target RNA molecule A method comprising the steps of: **Claim 14** where step (iv) comprises: a) sequencing a region of the target RNA molecule that contains the deaminated target nucleoside; b) when the target nucleoside is an adenosine located at a UGA or UAG stop codon and is edited to a UGG codon by deamination, assessing the presence of a functional, extended, full-length, and / or wild-type protein; c) when two target adenosines are located at a UAA stop codon and both are edited to a UGG codon by deamination of both target adenosines, assessing the presence of a functional, extended, full-length, and / or wild-type protein; d) when the target RNA molecule is a pre-mRNA, assessing whether splicing of the pre-mRNA is modified by deamination; or e) using a functional readout when the target RNA molecule after deamination encodes a functional, full-length, extended, and / or wild-type protein The method according to claim 13, comprising the steps of: **Claim 15** A method for deaminating at least one target nucleoside, preferably adenosine, present in a target RNA molecule in vitro or ex vivo, comprising: (i) supplying an AON according to any one of claims 1 to 10; (ii) enabling annealing of the AON to the target RNA molecule; (iii) enabling a mammalian enzyme having nucleotide deaminase activity to deaminate the target nucleoside in the target RNA molecule; and (iv) identifying the presence of the deaminated nucleoside in the target RNA molecule A method comprising the steps of:

Citation Information

Patent Citations

  • Targeted RNA editing

    WO2016097212A1

  • Single-stranded RNA-editing oligonucleotides

    WO2017220751A1