HCV detection
A rapid HCV detection method using nucleic acid amplification primers addresses the limitations of existing tests by enabling early and efficient identification of HCV infection across multiple genotypes in resource-limited settings.
Patent Information
- Application Number
- JP2021531551
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2018-12-03
- Filing Date
- 2019-12-03
- Publication Date
- 2025-07-04
- Estimated Expiration
- 2039-12-03
AI Technical Summary
Current HCV detection methods are time-consuming and costly, making them unsuitable for use in populations with inadequate medical systems, and antibody-based tests can only detect infection 6 to 12 weeks after exposure, necessitating a rapid and early detection method for HCV infection.
A method using nucleic acid amplification primers that specifically hybridize to a conserved region of the HCV core nucleic acid sequence, enabling rapid point-of-care testing through isothermal nucleic acid amplification and detection of multiple HCV genotypes.
The method allows for rapid detection of HCV infection within 1-2 weeks, suitable for resource-limited settings, and can identify various genotypes without requiring laboratory facilities or thermal cyclers, facilitating timely intervention.
Smart Images

Figure 0007702867000003 
Figure 0007702867000004 
Figure 0007702867000005
Abstract
Description
Technical Field
[0001] The present invention relates to a method, a kit, a primer, a probe, a set of primers, a set of oligonucleotides, and an oligonucleotide for detecting hepatitis C virus (HCV) nucleic acid, particularly for point-of-care (POC) testing in a clinical setting, and to the use of these in the method.
Background Art
[0002] Hepatitis C is an infectious disease caused mainly by the hepatitis C virus (HCV), which affects the liver. During the initial infection, there are often only mild symptoms or no symptoms at all. The virus persists in the liver in about 75% - 85% of those initially infected. In the early stages of chronic infection, there are usually no symptoms. However, over the years, chronic infection often leads to liver disease, particularly cirrhosis. In some cases, cirrhotic patients develop complications such as liver failure, liver cancer, or dilated blood vessels in the esophagus and stomach.
[0003] HCV spreads mainly through intravenous drug use, inadequately sterilized medical devices, needle stick injuries in healthcare, and blood-to-blood contact related to transfusions. As of 2015, an estimated 143 million people (2%) worldwide were infected with hepatitis C (GBD 2015 Disease and Injury Incidence and Prevalence, Collaborators. (8 October 2016). Lancet, 388(10053):1545-1602). Hepatitis C is most commonly found in Africa and Central and East Asia. In 2015, approximately 167,000 people died from liver cancer and 326,000 people died from cirrhosis due to hepatitis C (GBD 2015 Mortality and Causes of Death, Collaborators. (8 October 2016). Lancet, 388(10053):1459-1544). There is no vaccine against hepatitis C. However, the development and approval of powerful and well-tolerated combinations of direct-acting antiviral drugs have revolutionized the treatment of HCV infection. These therapies result in cure rates of over 95% after 8 to 24 weeks of administration in most patient populations (Belperio et al., 2017, Ann Intern Med 167, 499-5045; Falade-Nwulia et al., 2017, Ann Intern Med, 166, 637-648).
[0004] HCV is an RNA virus of the Flaviviridae family covered by an envelope. HCV particles contain a lipid membrane envelope in which two viral envelope glycoproteins, E1 and E2, are embedded. E1 and E2 are involved in virus attachment and entry into cells. Inside the envelope, there is an icosahedral core containing the viral RNA material. HCV has a single-stranded plus-strand RNA genome consisting of a single open reading frame that is 9,600 nucleotide bases long. This single open reading frame is translated to produce a single protein product of approximately 3,000 amino acids, which is then further processed by cellular and viral proteases into 10 smaller proteins that enable virus replication in host cells or assembled into mature virus particles. There are untranslated regions (NTRs) at the 5' and 3' ends of this RNA, which are not translated into proteins but are important for the translation and replication of viral RNA.
[0005] The structural proteins produced by the hepatitis C virus include the core protein, E1, and E2. The non-structural (NS) proteins include NS2, NS3, NS4A, NS4B, NS5A, and NS5B. The proteins are arranged in the following order along the genome: N-terminus - core - envelope (E1) - E2 - p7 - NS2 - NS3 - NS4A - NS4B - NS5A - NS5B - C-terminus. The core protein has 191 amino acids.
[0006] HCV is classified into 7 major genotypes (1 - 7) and 67 subtypes (Smith et al., 2014 (Hepatology 2014;59;318 - 327). Genotypes differ by 30 - 35% of nucleotide sites for the complete genome (Ohno et al. (2007), J Clin Microbiol. 35(1):201 - 7). The difference in genome composition of subtypes of a genotype is usually 20 - 25%. Subtypes 1a and 1b are found worldwide and cause 60% of all cases.
[0007] The diagnosis of HCV is by a blood test to look for antibodies against the virus or its RNA. Several methods of HCV detection have been approved by the US FDA. · Antigens encoded by the hepatitis C virus (anti-HCV assay): ABBOTT HCV EIA 2.0 (Abbott Laboratories); Chiron RIBA HCV 3.0 Strip Immunoblot Assay (Chiron Corp); ABBOTT PRISM HCV (Abbott Laboratories); · Nucleic acid tests: UltraQual HCV RT-PCR Assay (National Genetics Institute); COBAS AmpliScreen HCV Test (Roche Molecular Systems, Inc.); Procleix HIV-1 / HCV Assay (Gen-Probe, Inc); Procleix Ultrio Assay (Gen-Probe, Inc); Procleix Ultrio Plus Assays (Gen-Probe, Inc); Hepatitis C Virus (HCV) Reverse Transcription (RT) Polymerase Chain Reaction (PCR) Assay (BioLife Plasma Services, L.P.); · ELISA test: Ortho HCV Version 3.0 ELISA Test System (Ortho-Clinical Diagnostics, Inc).
[0008] These methods are performed in a laboratory and are time-consuming and costly, so they are not suitable for use in populations where HCV infection is spreading and it is difficult to reach, and in environments where the medical system is inadequate. Also, antibody-based tests can generally only detect HCV infection 6 to 12 weeks after infection. Therefore, there is a need for a rapid test that is suitable for use in populations where it is difficult to reach and in environments where the medical system is inadequate, and can detect HCV as early as possible after infection.
Prior Art Documents
Non-Patent Literature
[0009]
Non-Patent Literature 1
Non-Patent Literature 2
Non-Patent Literature 3
Non-Patent Literature 4
Non-Patent Literature 5
Non-Patent Literature 6
Summary of the Invention
Means for Solving the Problems
[0010] The applicant has fully recognized that by using nucleic acid amplification primers that specifically hybridize to a conserved region of the HCV core nucleic acid sequence (or its complement), a rapid POC nucleic acid test capable of detecting several different HCV genotypes can be provided.
[0011] According to the present invention, there is provided a method for determining whether a sample contains HCV nucleic acid, comprising amplifying the nucleic acid of the sample or nucleic acid derived from the nucleic acid of the sample by an isothermal amplification reaction using a forward nucleic acid amplification primer and a reverse nucleic acid amplification primer, wherein each nucleic acid amplification primer specifically hybridizes to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1 to 6 or its complement.
[0012] The HCV core nucleic acid sequence is shown in Figure 2.
[0013] Conserved sequences can be identified by homology search using tools such as BLAST, HMMER, and Infernal. The homology search tool can employ individual nucleic acid sequences as input, or can use statistical models generated from multiple sequence alignments of known related sequences. Statistical models such as profile-HMM, and RNA covariance models incorporating structural information can be useful when searching for more distantly related sequences. Then, the input sequence is aligned against a database of sequences from related individuals or other species. Then, the resulting alignment is scored based on the number of matching bases and the number of gaps or deletions generated by the alignment. Permissible conservative substitutions can be identified using substitution matrices such as PAM and BLOSUM. High-scoring alignments are assumed to be derived from homologous sequences. Then, sequence conservation can be inferred by detecting highly similar homologs over a wide phylogenetic range.
[0014] Optionally, the conserved HCV core nucleic acid sequence among different HCV genotypes is a nucleic acid sequence containing a maximum of 2 mismatches per 20 nucleotides for each of HCV genotypes 1 to 6.
[0015] Optionally, the conserved HCV core nucleic acid sequence among different HCV genotypes is a nucleic acid sequence that is identical for each of HCV genotypes 1 to 6.
[0016] Multiple sequence alignment can be used to visualize the saved arrays. The CLUSTAL format contains plain text keys for annotating the saved columns of the alignment and represents the saved sequences ( * ), conserved mutations (:), semi-conserved mutations (.), and non-conserved mutations (). Software such as MacVector can be used to perform multiple sequence alignment.
[0017] If necessary, the nucleic acid amplification primer hybridizes specifically to the HCV core nucleic acid sequence if it hybridizes under stringent conditions to the HCV core nucleic acid sequence or its complement that is conserved among at least HCV genotypes 1-6.
[0018] The stringency of hybridization is affected by conditions such as temperature, salt concentration, ionic strength, and hybridization buffer composition. Generally, low stringency conditions are selected to be approximately 30 °C lower than the thermal melting point (Tm) for a specific sequence at a given ionic strength and pH. Medium stringency conditions are when the temperature is 20 °C lower than Tm, and high stringency conditions are when the temperature is 10 °C lower than Tm. Tm is the temperature at which 50% of the target sequence hybridizes to a primer or probe with perfect match, at a given ionic strength and pH. Tm depends on solution conditions, base composition, and probe length. For example, longer sequences hybridize specifically at higher temperatures. The maximum rate of hybridization is obtained when Tm is lowered by about 16 °C to a maximum of 32 °C. The presence of monovalent cations in the hybridization solution reduces the electrostatic repulsion between the two nucleic acid strands, thereby promoting hybridization; this effect is seen for sodium concentrations up to 0.4 M (at higher concentrations, this effect can be ignored). Formamide decreases the melting temperature of DNA-DNA and DNA-RNA duplexes by 0.6 - 0.7 °C for each percent of formamide, and the addition of 50% formamide allows hybridization to be carried out at 30 - 45 °C, but the rate of hybridization decreases. Base pair mismatches decrease the duplex hybridization rate and thermal stability. On average, for large probes, Tm decreases by about 1 °C per % base mismatch. Tm can be calculated using the following equations depending on the type of hybrid. 1) DNA-DNA hybrid (Meinkoth and Wahl, Anal. Biochem., 138:267-284, 1984): T m = 81.5 °C + 16.6 × log 10 [Na + a + 0.41 × %[G / C b - 500 × [L c -1 - 0.61 × % formamide; 2) DNA-RNA or RNA-RNA hybrid: T m = 79.8 °C + 18.5(log 10 [Na + a ) + 0.58(%G / C b ) + 11.8(%G / C b ) 2 - 820 / L c ; 3) Oligo DNA or oligo RNA hybrid: When less than 20 nucleotides: T m = 2(l n ); When 20 - 35 nucleotides: T m = 22 + 1.46(l n ); a For other monovalent cations, it is accurate only in the range of 0.01 - 0.4 M. b It is accurate only for %GC in the range of 30% - 75%. c L = length of the double strand in base pairs. d Oligo, oligonucleotide; 1 n , = effective length of the primer = 2×(number of G / C) + (number of NT).
[0019] In addition to hybridization conditions, the specificity of hybridization typically also depends on the function of post-hybridization washing. To remove background arising from non-specific hybridization, the sample is washed with a dilute salt solution. Important factors in such washing include the ionic strength and temperature of the final wash solution: the lower the salt concentration and the higher the wash temperature, the higher the stringency of the wash. Wash conditions are typically carried out at a stringency equal to or below that of the hybridization. A positive hybridization gives a signal at least two-fold that of the background signal. Generally, stringent conditions suitable for nucleic acid hybridization assays or gene amplification detection procedures are as described above. Higher or lower stringency conditions may also be selected. Those skilled in the art are aware of the various parameters that can be varied during washing to maintain or change the stringency conditions.
[0020] For example, typical stringent conditions (also referred to as high stringency hybridization conditions) for DNA hybrids longer than 50 nucleotides include hybridization at 65 °C in 1×SSC or 42 °C in 1×SSC and 50% formamide, followed by washing at 65 °C in 0.3×SSC. The length of the hybrid is the expected length for the nucleic acids forming the hybrid. When nucleic acids of known sequence form a hybrid, the hybrid length can be determined by performing a sequence alignment and identifying the conserved regions described herein. 1×SSC is 0.15 M NaCl and 15 mM sodium citrate; the hybridization solution and wash solution may further contain 5×Denhardt's reagent, 0.5–1.0% SDS, 100 μg / ml denatured fragmented salmon sperm DNA, 0.5% sodium pyrophosphate.
[0021] For the purpose of defining the stringency level, reference can be made to Sambrook et al. (2001) Molecular Cloning: a laboratory manual, 3rd Edition, Cold Spring Harbor Laboratory Press, CSH, New York or Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989 and annual updates).
[0022] Optionally, the forward nucleic acid primer comprises the nucleic acid sequence of AGACTGCTAGCCGAGTAG (SEQ ID NO: 1), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with the nucleic acid sequence of SEQ ID NO: 1 along its full length.
[0023] Optionally, the reverse nucleic acid primer comprises the nucleic acid sequence of GCTCATGATGCACGGTCTACGAGA (SEQ ID NO: 2), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with the nucleic acid sequence of SEQ ID NO: 2 along its full length.
[0024] The positions in the HCV core region of the sequence corresponding to the sequence of SEQ ID NO: 1 (primer F2, forward primer) and the sequence corresponding to the reverse complement of the sequence of SEQ ID NO: 2 (primer R1.2, reverse primer) are shown in FIG. 2. The sequence alignment of the HCV core nucleic acid sequences for HCV genotypes 1-6 is shown in FIG. 3 together with the positions of the sequence corresponding to SEQ ID NO: 1 (primer F2) and the sequence corresponding to the reverse complement of SEQ ID NO: 2 (primer R1.2).
[0025] For example, nucleic acids can be derived from the nucleic acids of a sample by reverse transcribing the HCV core nucleic acids of the sample and amplifying the product of reverse transcription by an isothermal nucleic acid amplification reaction using forward and reverse nucleic acid amplification primers.
[0026] Optionally, the method of the present invention further comprises reverse transcribing the HCV RNA of the sample and amplifying the product of reverse transcription by an isothermal amplification reaction using forward and reverse nucleic acid amplification primers.
[0027] Any suitable method of isothermal nucleic acid amplification can be used in the method of the present invention. Some suitable methods of isothermal nucleic acid amplification are known to those skilled in the art. Optionally, isothermal nucleic acid amplification is transcription-based amplification. Such methods include amplification of RNA templates using reverse transcriptase (RT), RNase H and RNA polymerase activities, and include nucleic acid sequence-based amplification (NASBA), transcription-mediated amplification (TMA) and self-sustained sequence replication (3SR) (Chan and Fox, Rev. Med. Microbiol. 10: 185-196 (1999); Guatelli et al., Proc. Natl. Acad. Sci. 87: 1874-1878 (1990); Compton, Nature 350: 91-92 (1991)). NASBA and 3SR use RT derived from avian myeloblastosis virus (AMV) (also having RNase H activity), RNase H derived from Escherichia coli and T7 RNA polymerase. TMA uses Moloney murine leukemia virus (MMLV) RT (also having RNase H activity) and T7 RNA polymerase.
[0028] Isothermal amplification methods such as transcription-based amplification methods have several advantages over amplification using polymerase chain reaction (PCR). The reaction occurs simultaneously in a single tube and is carried out under isothermal conditions, so a thermocycler is not required. The amplification reaction is faster than PCR (1×10 6 -fold amplification after 5 cycles can be observed compared to 1×10 9 -fold amplification after 20 cycles in PCR.). Since the DNA background does not interfere with transcription-based amplification, these methods are not affected by double-stranded DNA contamination. The amplification products are single-stranded and can be detected without the need for strand separation.
[0029] Optionally, the reverse nucleic acid primer further comprises, at its 5'-end, a promoter sequence for DNA-dependent RNA polymerase. Such a primer can be used for reverse transcription and for transcription-based isothermal amplification reactions, thereby minimizing the number of primers required to perform reverse transcription and isothermal nucleic acid amplification.
[0030] For example, the promoter sequence can be the T7 promoter sequence: 5’ TAATACGACTCACTATA G 3’ (SEQ ID NO: 6). T7 RNA polymerase initiates transcription at the underlined G in this promoter sequence. The polymerase then uses the opposite strand as a template and transcribes in the 5’→3’ direction. The first base in the transcript is G.
[0031] For example, a reverse nucleic acid primer having the T7 promoter sequence at its 5'-end can comprise the nucleic acid sequence of GCTCATGATGCACGGTCTACGAGATAATACGACTCACTATAG (SEQ ID NO: 7).
[0032] The transcription-based isothermal amplification reaction suitable for use in the method of the present invention is described below with reference to FIG. 4.
[0033] Antisense primer 1 contains a nucleic acid sequence complementary to a part of the target RNA (e.g., SEQ ID NO: 2, primer R1.2, reverse primer) so that the primer can specifically hybridize to the target RNA, and contains a single-stranded version of the promoter sequence for DNA-dependent RNA polymerase (e.g., SEQ ID NO: 7, T7 promoter sequence) at its 5'-end. Primer 1 is annealed to the RNA target. RNA-dependent DNA polymerase extends primer 1 to synthesize a complementary DNA (cDNA) copy of the RNA target. DNA / RNA double-strand specific ribonuclease digests the RNA of the RNA-cDNA hybrid. Sense primer 2 contains a nucleic acid sequence complementary to a part of the cDNA. Primer 2 anneals to the cDNA downstream of the part of the cDNA formed by primer 1. Primer 2 is extended by DNA-dependent DNA polymerase to generate a second DNA strand that extends through the DNA-dependent RNA polymerase promoter sequence at one end (thereby forming a double-stranded promoter). This promoter is used by DNA-dependent RNA polymerase to synthesize multiple RNAs complementary to the original target sequence. These RNA products then function as templates for the cyclic phase of the reaction, but the primer annealing step is reversed, i.e., primer 1 follows primer 2.
[0034] In a variant of this method, primer 2 may also contain a single-stranded version of the promoter sequence for DNA-dependent RNA polymerase. This results in the production of RNAs having the same sense as the original target sequence (and RNAs complementary to the original target sequence).
[0035] In some conventional transcription-based isothermal amplification reactions, it is known to cleave target RNA at the 5' end before it functions as a template for cDNA synthesis. An enzyme having RNase H activity is used to cleave the RNA portion of the RNA-DNA hybrid formed by adding an oligonucleotide (cleavage oligonucleotide) having a sequence complementary to the region adjacent to and overlapping the 5' end of the target RNA. The cleavage oligonucleotide may have its 3' end OH appropriately modified to prevent an elongation reaction. In some embodiments of the present invention, cleavage oligonucleotides can be used, but the method of the present invention is preferably carried out in the absence of cleavage oligonucleotides, thereby simplifying the amplification reaction and the required components.
[0036] Isothermal nucleic acid amplification is advantageous because it can be easily used in environments with limited resources. Such methods do not require the use of a thermal cycler, which may not be available in environments with limited resources. Examples of suitable methods are described in International Publication No. 2008 / 090340 and Lee et al., Journal of Infectious Diseases 2010;201(S1):S65-S71.
[0037] Examples of suitable reagents for carrying out reverse transcription of RNA and for isothermal amplification of the products of reverse transcription are shown in International Publication No. 2008 / 090340 and include, for example, the following enzyme activities: RNA-dependent DNA polymerase, DNA-dependent DNA polymerase, DNA / RNA double-strand specific ribonuclease, and DNA-dependent RNA polymerase.
[0038] In addition to the required enzyme activity, it will also be understood that it is necessary to provide appropriate nucleotide triphosphates (for transcription-based amplification, ribonucleotide triphosphates (rNTPs, i.e., rATP, rGTP, rCTP, and rUTP) and deoxyribonucleotide triphosphates (dNTPs, i.e., dATP, dGTP, dCTP, and dTTP) are required), appropriate primers for specific amplification of the target nucleic acid, an appropriate buffer for carrying out the amplification reaction, and any necessary cofactors required by the enzyme activity (e.g., magnesium ions). Examples of appropriate buffers include Tris-HCl, HEPES, or acetate buffers. Appropriate salts such as potassium chloride or sodium chloride can be provided. The appropriate concentrations of these components can be readily determined by those skilled in the art. Appropriate rNTP concentrations typically range from 0.25 to 5 mM, or from 0.5 to 2.5 mM. Appropriate dNTP concentrations typically range from 0.25 to 5 mM of dNTP or from 0.5 to 2.5 mM. Appropriate magnesium ion concentrations typically range from 5 to 15 mM.
[0039] Some conventional transcription-based amplification methods use very large amounts of T7 RNA polymerase (e.g., 142 units or more, where 1 unit incorporates 1 nmole of labeled nucleotide into acid-insoluble material in 1 hour at 37°C under standard assay conditions such as 40 mM Tris-HCl (pH 8.0), 50 mM NaCl, 8 mM MgCl2, 5 mM DTT, 400 μM rNTP, 400 μM 3 [H]-UTP (30 cpm / pmoles), 20 μg / ml T7 DNA, 50 μg / ml BSA, 100 μl reaction volume, 37°C, 10 minutes). The method of the present invention can be carried out using significantly less T7 RNA polymerase than such conventional methods, thereby reducing costs. For example, the method of the present invention can be carried out using less than 142 units, suitably less than 100 units or less than 50 units, e.g., 30 to 40 units of DNA-dependent RNA polymerase (e.g., T7 RNA polymerase).
[0040] Optionally, the nucleic acid of the sample is isolated prior to reverse transcribing the HCV RNA of the sample present in the isolated nucleic acid.
[0041] Many suitable methods for isolating nucleic acids are known to those skilled in the art. Some methods use chaotropic agents, such as guanidinium thiocyanate, and organic solvents to lyse cells and denature proteins. For example, Boom et al. (Journal of Clinical Microbiology, 1990, Vol. 28(3):495-503) describe a method of contacting a sample with silica particles in the presence of a lysis / binding buffer containing guanidinium thiocyanate. The released nucleic acid binds to the silica particles, which are then washed with a wash buffer containing guanidinium thiocyanate, then ethanol, and then acetone. Subsequently, the bound nucleic acid is eluted with an aqueous low-salt buffer (Tris-HCl, EDTA, pH 8.0).
[0042] Some methods avoid the need for chaotropic salts and organic solvents. For example, Hourfar et al. (Clinical Chemistry, 2005, 51(7):1217-1222) describe a method of mixing a sample with magnetic silica particles in the presence of a lysis / binding buffer containing a kosmotropic salt (ammonium sulfate) prior to the addition of proteinase K. After separation, the magnetic particles are washed with a wash buffer containing proteinase K and eluted with an elution buffer (Tris-HCl, pH 8.5) at 80°C. Other suitable methods are described in International Publication No. WO 2010 / 015835.
[0043] Isolation of the nucleic acid can be carried out using conventional binding buffers and / or elution buffers for use with a solid phase that can bind the nucleic acid in the presence of a binding buffer at a first pH and elute the nucleic acid therefrom at a second pH.
[0044] Optionally, the solid phase comprises ionizable groups that vary their charge according to ambient conditions. The pKa of the ionizable groups is suitable for the conditions under which it is desired to bind nucleic acids to the solid phase and release nucleic acids from the solid phase. Generally, nucleic acids bind to the solid phase at a pH lower than or approximately equal to the pKa and are released at a higher pH (usually above the pKa). Suitable solid phases for binding nucleic acids at a first pH and eluting the bound nucleic acids at a second pH higher than the first pH are well known to those of ordinary skill in the art. For example, at the first pH, the solid phase may contain a positive charge, and at the second pH, the solid phase may contain fewer positive charges, a neutral charge, or a negative charge. Alternatively or in addition, at the first pH, the solid phase may contain a neutral charge or fewer negative charges, and at the second pH, the solid phase may have a negative charge or more negative charges. Such a change in charge allows the nucleic acid to be adsorbed to the solid phase at the first pH and released at the second pH.
[0045] For example, the solid phase may comprise negatively ionizable groups having a pKa between the first pH and the second pH. Nucleic acids bind to the solid phase when the solid phase is neutral or less negatively charged and are released when the solid phase is negatively or more negatively charged. Alternatively or in addition, the solid phase may comprise positively ionizable groups having a pKa between the first pH and the second pH. Nucleic acids bind to the solid phase when the solid phase is positively charged and are released when the solid phase is neutral or less positively charged.
[0046] Examples of solid phases that can be used for nucleic acid extraction include solid phases comprising inorganic oxides such as silica or glass (e.g., as described in Boom et al. or Hourfar et al.), or aluminum oxide, sugar polymers, or charge-switch materials (e.g., as described in International Publication No. 02 / 48164).
[0047] The solid phase can be in any suitable form including, for example, a membrane, gel or particles such as magnetic particles. Silica membranes or gels, and magnetic silica particles are preferred examples. Silica membranes are particularly preferred. They are less expensive than magnetic silica particles (used, for example, by Hourfar et al.) and, unlike magnetic silica particles, do not require refrigerated storage.
[0048] The solid phase can be a solid phase in which nucleic acid binding is enhanced by the presence of a cosmotrope. Optionally, nucleic acid binding to the solid phase may be carried out in the presence of a cosmotrope. Such agents are known to enhance nucleic acid binding to solid phases such as silica-based solid phases.
[0049] The terms "chaotropic" and "cosmotropic" agents are derived from the Hofmeister series (Cacace et al., Q Rev Biophys 1997;30:241-77) which divides these agents according to their effect on the structure of macromolecules and water. A chaotrope can be defined as a substance that disrupts the solvent structure and a cosmotrope can be defined as a substance that enhances the solvent structure. Figure 1 of Cacace et al. shows the Hofmeister series and commonly occurring organic solutes that affect protein structure / function. Examples of chaotropic agents are known to those skilled in the art and include sodium iodide, sodium perchlorate, guanidinium thiocyanate and guanidinium hydrochloride. Examples of cosmotropic agents are known to those skilled in the art and include ammonium sulfate and lithium chloride.
[0050] Optionally, lysis is carried out using a binding buffer. Binding buffers that can be used for cell lysis are known to those skilled in the art. The lysis buffer used by Boom et al. contains guanidinium thiocyanate, Tris hydrochloride, pH 6.4, EDTA (adjusted to pH 8) and Triton X-100. Optionally, the lysis buffer does not contain a chaotropic agent. For example, a lysis / binding buffer containing a cosmotrope can be used. Optionally, the buffer is an acidic buffer, suitably a strong acidic buffer having a pKa (25°C) in the range of 3 - 5.
[0051] Optionally, the method of the present invention further comprises capturing the product of the isothermal amplification reaction by hybridizing the nucleic acid of the product of the isothermal amplification reaction to a nucleic acid capture probe, wherein the capture probe specifically hybridizes to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1-6 or its complement.
[0052] Optionally, if the capture probe hybridizes to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1-6 or its complement under stringent conditions, the capture probe specifically hybridizes to the HCV core nucleic acid sequence.
[0053] Optionally, the capture probe comprises the nucleic acid sequence of GCGAAAGGCCTTGTGGTACT (SEQ ID NO: 3), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 3 along its full length, or a complement thereof.
[0054] Optionally, the method of the present invention further comprises detecting the product of the isothermal amplification reaction by hybridizing the product of the isothermal amplification reaction to a nucleic acid detection probe, wherein the detection probe specifically hybridizes to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1-6 or its complement.
[0055] Optionally, if the detection probe hybridizes to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1-6 or its complement under stringent conditions, the detection probe specifically hybridizes to the HCV core nucleic acid sequence.
[0056] Optionally, the detection probe comprises the nucleic acid sequence of TGATAGGGTGCTTGCGAGTG (SEQ ID NO: 4), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 4 along its full length, or a complement thereof.
[0057] The positions within the HCV core region of sequences corresponding to the sequences of SEQ ID NO: 3 (probe CP2, capture probe) and SEQ ID NO: 4 (probe DP2, detection probe) are shown in Figure 2. The sequence alignment of the HCV core nucleic acid sequences for HCV genotypes 1-6 is shown in Figure 3 together with the positions of the sequences corresponding to SEQ ID NO: 3 (capture probe 2) and SEQ ID NO: 4 (detection probe).
[0058] For example, if the capture probe and the detection probe do not hybridize under stringent hybridization conditions to other nucleic acids present during the isothermal amplification reaction (i.e., non-HCV core nucleic acids including HCV nucleic acids outside the core region), the capture probe and the detection probe specifically hybridize to the HCV core nucleic acid sequence.
[0059] The sequence identity between nucleic acid sequences can be determined by comparing the sequence alignments. Molecules are identical at a position when the equivalent positions in the sequences being compared are occupied by the same nucleotide. Scoring the alignment as a percentage of identity is a function of the number of identical nucleotides at positions shared by the sequences being compared. When comparing sequences, in the optimal alignment, it may be necessary to introduce gaps into one or more of the sequences to account for the possibility of insertions and deletions in the sequences. For the same number of identical molecules in the sequences being compared, a sequence alignment with as few gaps as possible, reflecting a higher relatedness between the two compared sequences, will achieve a higher score than a sequence alignment with many gaps, and thus sequence comparison methods may use a gap penalty. Calculation of the maximum percent identity includes generation of the optimal alignment taking into account the gap penalty.
[0060] Suitable computer programs for performing array comparisons are widely available in the commercial and public sectors. Examples include MatGat (Campanella et al., 2003, BMC Bioinformatics 4:29; program available from http: / / bitincka.com / ledion / matgat), Gap (Needleman & Wunsch, 1970, J. Mol. Biol. 48:443-453), FASTA (Altschul et al., 1990, J. Mol. Biol. 215:403-410; program available from http: / / www.ebi.ac.uk / fasta), Clustal W 2.0 and X 2.0 (Larkin et al., 2007, Bioinformatics 23:2947-2948; program available from http: / / www.ebi.ac.uk / tools / clustalw2) and the EMBOSS Pairwise Alignment Algorithms (Needleman & Wunsch, 1970, supra; Kruskal, 1983, In: Time warps, string edits and macromolecules: the theory and practice of sequence comparison, Sankoff & Kruskal (eds), pp 1-44, Addison Wesley; program available from http: / / www.ebi.ac.uk / tools / emboss / align). All programs can be run using default parameters.
[0061] For example, array comparisons can be performed using the "needle" method of the EMBOSS Pairwise Alignment Algorithms, which determines the optimal alignment (including gaps) of two arrays when considering the entire length of the two arrays and provides a percent identity score.
[0062] Optionally, the detection probe is labeled with a visually detectable label (i.e., a label that can be visually detected without using measuring means). Examples of suitable visually detectable labels include colloidal metal sol particles, latex particles or textile dye particles. An example of colloidal metal sol particles is colloidal gold particles.
[0063] The product of isothermal nucleic acid amplification is labeled with a visually detectable label and can be captured and detected using a chromatographic test strip, as described, for example, in WO 2008 / 090340 and Lee et al., Journal of Infectious Diseases 2010;201(S1):S65 - S71.
[0064] Optionally, the sample is a liquid sample. Optionally, the sample is a biological sample, such as a liquid biological sample, obtained from a subject suspected of being infected with HCV. Optionally, the sample is a blood or plasma sample obtained from a subject suspected of being infected with HCV.
[0065] Optionally, the method of the present invention is an in vitro method.
[0066] The method of the present invention is particularly useful as a POC test for screening for HCV infection. In particular, the method of the present invention can be carried out rapidly without using laboratory facilities or a thermal cycler. HCV infection can be detected within 1 - 2 weeks of infection. Once a subject is identified as being infected with HCV, appropriate treatment can be administered to the subject and the infection can be monitored. Optionally, the subject can be retested to determine which HCV genotype is causing the infection and then treated with a treatment appropriate for that genotype.
[0067] According to the present invention, a kit for determining whether a sample contains HCV nucleic acid, A forward nucleic acid amplification primer and a reverse nucleic acid amplification primer for amplifying a template nucleic acid by isothermal amplification reaction, each nucleic acid amplification primer specifically hybridizing to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1-6 or its complement; A nucleic acid capture probe that specifically hybridizes to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1-6 or its complement; and / or A nucleic acid detection probe that specifically hybridizes to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1-6 or its complement, optionally comprising a visually detectable label for labeling the product of isothermal nucleic acid amplification; A kit comprising the same is also provided.
[0068] Optionally, the forward nucleic acid primer comprises the nucleic acid sequence of AGACTGCTAGCCGAGTAG (SEQ ID NO: 1), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 1 along its full length.
[0069] Optionally, the reverse nucleic acid primer comprises the nucleic acid sequence of GCTCATGATGCACGGTCTACGAGA (SEQ ID NO: 2), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 2 along its full length.
[0070] Optionally, the capture probe comprises the nucleic acid sequence of GCGAAAGGCCTTGTGGTACT (SEQ ID NO: 3), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 3 along its full length, or their complements.
[0071] Optionally, the detection probe comprises the nucleic acid sequence of TGATAGGGTGCTTGCGAGTG (SEQ ID NO: 4), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 4 along its full length, or a complement thereof.
[0072] Optionally, the kit of the present invention further comprises an RNA-dependent DNA polymerase, a DNA-dependent DNA polymerase, a DNA / RNA double-strand specific ribonuclease and a DNA-dependent RNA polymerase.
[0073] Optionally, the kit of the present invention further comprises appropriate nucleotide triphosphates (for transcription-based amplification, ribonucleotide triphosphates (rNTPs, i.e., rATP, rGTP, rCTP and rUTP) and deoxyribonucleotide triphosphates (dNTPs, i.e., dATP, dGTP, dCTP and dTTP) are required), an appropriate buffer for carrying out the amplification reaction, and any necessary cofactors required by the enzyme activity (such as magnesium ions). Examples of appropriate buffers include Tris-HCl, HEPES or acetate buffer. Appropriate salts such as potassium chloride or sodium chloride can be provided. Appropriate concentrations of these components can be readily determined by those skilled in the art. Appropriate rNTP concentrations typically range from 0.25 to 5 mM, or from 0.5 to 2.5 mM. Appropriate dNTP concentrations typically range from 0.25 to 5 mM of dNTP or from 0.5 to 2.5 mM. Appropriate magnesium ion concentrations typically range from 5 to 15 mM.
[0074] The kit of the present invention may further include a visually detectable label and / or a chromatographic test strip for labeling the product of isothermal nucleic acid amplification, and a reagent for capturing and detecting the product of isothermal nucleic acid amplification. Suitable labels, test strips and reagents, and methods for capturing and detecting the product of isothermal nucleic acid amplification by simple amplification-based assay (SAMBA) are described in WO 2008 / 090340 and Lee et al., Journal of Infectious Diseases 2010;201(S1):S65-S71.
[0075] The kit of the present invention may further include a reagent for isolating nucleic acid from a sample, for example, using the above-described method for nucleic acid extraction. Suitable reagents for nucleic acid extraction may include a lysis buffer for lysing cells present in the sample, a solid phase for binding nucleic acid, and a binding buffer for binding nucleic acid to the solid phase (optionally, the lysis buffer is the same as the binding buffer), and may optionally include a washing buffer for washing the nucleic acid bound to the solid phase and an elution buffer for eluting the nucleic acid from the solid phase. Suitable lysis, washing and elution buffers, and suitable solid phases for use with these buffers are described above.
[0076] The kit of the present invention may further include any of the following additional components: a lancet for obtaining a sample of whole blood from a subject by finger prick or heel prick; a blood collector for collecting a sample of blood from a subject; a positive and / or negative control; instructions for performing the test method of the present invention using the kit.
[0077] According to the present invention, there is also provided a set of primers for amplifying HCV nucleic acid by an isothermal nucleic acid amplification reaction, the set including a forward nucleic acid amplification primer and a reverse nucleic acid amplification primer, each nucleic acid amplification primer specifically hybridizing to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1 to 6 or its complement.
[0078] Optionally, the primer set includes the nucleic acid sequence of AGACTGCTAGCCGAGTAG (SEQ ID NO: 1), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 1 along its full length.
[0079] Optionally, the primer set includes the nucleic acid sequence of GCTCATGATGCACGGTCTACGAGA (SEQ ID NO: 2), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 2 along its full length.
[0080] Optionally, the forward nucleic acid primer and / or the reverse nucleic acid primer is at most 50 nucleotides in length.
[0081] According to the present invention, there is provided a set of oligonucleotides for amplifying HCV nucleic acid by an isothermal amplification reaction and for capturing and / or detecting the product of the amplification reaction, the primer set of the present invention; a nucleic acid capture probe that specifically hybridizes to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1 to 6 or its complement; and / or a nucleic acid detection probe that specifically hybridizes to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1 to 6 or its complement; A set of oligonucleotides comprising the same is also provided.
[0082] Optionally, the set of oligonucleotides includes the nucleic acid sequence of AGACTGCTAGCCGAGTAG (SEQ ID NO: 1), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 1 along its full length.
[0083] Optionally, the set of oligonucleotides comprises the nucleic acid sequence of GCTCATGATGCACGGTCTACGAGA (SEQ ID NO: 2), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 2 along its entire length.
[0084] Optionally, the set of oligonucleotides comprises the nucleic acid sequence of GCGAAAGGCCTTGTGGTACT (SEQ ID NO: 3), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 3 along its entire length, or a complement thereof.
[0085] Optionally, the set of oligonucleotides comprises the nucleic acid sequence of TGATAGGGTGCTTGCGAGTG (SEQ ID NO: 4), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 4 along its entire length, or a complement thereof.
[0086] Optionally, the capture and / or detection probe is up to 50 nucleotides in length.
[0087] According to the present invention, a nucleic acid sequence: AGACTGCTAGCCGAGTAG (SEQ ID NO: 1), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 1 along its entire length, or a complement thereof; a nucleic acid sequence: GCTCATGATGCACGGTCTACGAGA (SEQ ID NO: 2), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 2 along its entire length, or a complement thereof; The nucleic acid sequence GCGAAAGGCCTTGTGGTACT (SEQ ID NO: 3), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 3 along its full length, or a nucleic acid sequence comprising or consisting of these complements; or The nucleic acid sequence TGATAGGGTGCTTGCGAGTG (SEQ ID NO: 4), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 4 along its full length, or a nucleic acid sequence comprising or consisting of these complements; An oligonucleotide comprising the above is also provided.
[0088] The primer set, oligonucleotide set or oligonucleotide of the present invention can be used in the kit of the present invention or in the method of the present invention.
[0089] The primer, probe or oligonucleotide of the present invention, or of the primer or oligonucleotide set of the present invention, or of the kit of the present invention, or for use in the method of the present invention, can be at least 15, 20, 25, 30, 35, 40, 45, 50 nucleotides in length, or more than 50 nucleotides in length.
[0090] The primer, probe or oligonucleotide of the present invention, or of the primer or oligonucleotide set of the present invention, or of the kit of the present invention, or for use in the method of the present invention, can be at most 20, 25, 30, 35, 40, 45, 50, or 100 nucleotides in length.
[0091] The primer or oligonucleotide of the present invention, or a set of primers or oligonucleotides of the present invention, or a kit of the present invention, or for use in the method of the present invention, comprising the nucleic acid sequence: AGACTGCTAGCCGAGTAG (SEQ ID NO: 1), can be up to 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.
[0092] The oligonucleotide of the present invention, or a set of primers or oligonucleotides of the present invention, or a kit of the present invention, or for use in the method of the present invention, comprising a complement of the nucleic acid sequence: AGACTGCTAGCCGAGTAG (SEQ ID NO: 1), can be up to 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.
[0093] The primer or oligonucleotide of the present invention, or a set of primers or oligonucleotides of the present invention, or a kit of the present invention, or for use in the method of the present invention, comprising the nucleic acid sequence: GCTCATGATGCACGGTCTACGAGA (SEQ ID NO: 2), can be up to 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.
[0094] The oligonucleotides for use in the present invention, or in a primer or set of oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, which contain the complement of the nucleic acid sequence: GCTCATGATGCACGGTCTACGAGA (SEQ ID NO: 2), can be up to 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.
[0095] The probes or oligonucleotides for use in the present invention, or in a primer or set of oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, which contain the nucleic acid sequence: GCGAAAGGCCTTGTGGTACT (SEQ ID NO: 3), can be up to 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.
[0096] The probes or oligonucleotides for use in the present invention, or in a primer or set of oligonucleotides of the present invention, or in a kit of the present invention, or in a method of the present invention, which contain the complement of the nucleic acid sequence: GCGAAAGGCCTTGTGGTACT (SEQ ID NO: 3), can be up to 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides in length.
[0097] The probe or oligonucleotide of the present invention, or a set of primers or oligonucleotides of the present invention, or a kit of the present invention, or for use in the method of the present invention, which contains the nucleic acid sequence: TGATAGGGTGCTTGCGAGTG (SEQ ID NO: 4), can have a length of up to 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides.
[0098] The probe or oligonucleotide of the present invention, or a set of primers or oligonucleotides of the present invention, or a kit of the present invention, or for use in the method of the present invention, which contains the complement of the nucleic acid sequence: TGATAGGGTGCTTGCGAGTG (SEQ ID NO: 4), can have a length of up to 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 nucleotides.
[0099] The oligonucleotide of the present invention can contain or consist of a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical, or 100% identical, to the nucleotide sequence of any one of SEQ ID NOs: 1 to 4 or 7 over its entire length, or a sequence complementary thereto.
[0100] The oligonucleotide of the present invention can contain or consist of a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical, or 100% identical, to the nucleotide sequence of SEQ ID NO: 7 over its entire length, or a sequence complementary thereto.
[0101] Oligonucleotides can be labeled with, for example, a visually detectable label. In particular, an oligonucleotide comprising or consisting of the nucleic acid sequence of TGATAGGGTGCTTGCGAGTG (SEQ ID NO: 4), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 4 along its full length, or a complement thereof, can be labeled with a visually detectable label. Examples of visually detectable labels include colloidal metal sol particles, latex particles or textile dye particles. An example of colloidal metal sol particles is colloidal gold particles.
[0102] A set of primers or oligonucleotides of the present invention may comprise an oligonucleotide of the present invention.
[0103] A kit of the present invention may comprise a set of primers, a set of oligonucleotides or an oligonucleotide of the present invention.
[0104] According to the present invention, there is also provided the use of a set of primers, a set of oligonucleotides or an oligonucleotide of the present invention in the method of the present invention.
[0105] Embodiments of the present invention will be described below by way of example only with reference to the accompanying drawings.
Brief Description of the Drawings
[0106]
Figure 1
[0107]
Figure 2
[0108]
Figure 3-1
Chemical formula
Chemical formula
Figure 3-2
Figure 3-3
Figure 3-4
Figure 3-5
[0109]
Figure 4
[0110]
Figure 5
Example
[0111] Point-of-Care (POC) Nucleic Acid Testing for Detecting HCV Genotypes 1-6 HCV viral RNA was extracted, reverse transcribed, amplified by isothermal nucleic acid amplification, and the amplification products were detected by rapid visual detection using a dipstick, using a simple amplification-based assay (SAMBA) method similar to the method described in Lee et al., Journal of Infectious Diseases 2010;201(S1):S65-S71.
[0112] Briefly, the reverse nucleic acid amplification primer contains a nucleic acid sequence complementary to a portion of the HCV target RNA such that the primer can specifically hybridize to the target RNA, and contains a single-stranded version of the promoter sequence for DNA-dependent RNA polymerase at its 5' end. The reverse primer hybridizes to the RNA target. RNA-dependent DNA polymerase extends the reverse primer to synthesize a complementary DNA (cDNA) copy of the RNA target. DNA / RNA duplex-specific ribonuclease digests the RNA of the RNA-cDNA hybrid. The forward nucleic acid amplification primer contains a nucleic acid sequence complementary to a portion of the cDNA. The forward primer hybridizes to the cDNA downstream of the portion of the cDNA formed by the reverse primer. The forward primer is extended by DNA-dependent DNA polymerase to generate a second DNA strand that extends through the DNA-dependent RNA polymerase promoter sequence at one end (thereby forming a double-stranded promoter). This promoter is used by DNA-dependent RNA polymerase to synthesize multiple RNAs complementary to the original target sequence. These RNA products then function as templates for the cyclic phase of the reaction, but the primer hybridization step is reversed, i.e., the reverse primer follows the forward primer.
[0113] For isothermal amplification of HCV nucleic acids of genotypes 1-6, the following primer sequences were used: HCV primer F2 (forward primer): AGACTGCTAGCCGAGTAG (SEQ ID NO: 1); HCV primer REV1.2 (reverse primer) / T7 promoter: GCTCATGATGCACGGTCTACGAGATAATACGACTCACTATAG (SEQ ID NO: 7).
[0114] The amplification products were captured and detected using the following capture and detection probes: HCV probe CP2 (capture probe): GCGAAAGGCCTTGTGGTACT (SEQ ID NO: 3); HCV probe DP2 (detection probe): TGATAGGGTGCTTGCGAGTG (SEQ ID NO: 4).
[0115] The HCV primers / probes were tested against at least three different samples for each of the six HCV genotypes. The results are recorded in Figure 5. HCV genotypes 1-6 were efficiently detected. In certain embodiments, for example, the following items are provided. (Item 1) A method for determining whether a sample contains HCV nucleic acid, comprising amplifying the nucleic acid of the sample or nucleic acid derived from the nucleic acid of the sample by an isothermal amplification reaction using a forward nucleic acid amplification primer and a reverse nucleic acid amplification primer, wherein each nucleic acid amplification primer specifically hybridizes to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1 to 6 or a complement thereof. (Item 2) The method according to item 1, wherein the forward nucleic acid primer comprises the nucleic acid sequence of AGACTGCTAGCCGAGTAG (SEQ ID NO: 1), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 1 along its full length. (Item 3) The method according to item 1 or 2, wherein the reverse nucleic acid primer comprises the nucleic acid sequence of GCTCATGATGCACGGTCTACGAGA (SEQ ID NO: 2), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 2 along its full length. (Item 4) The method according to any of the above items, further comprising reverse transcribing the HCV RNA of the sample and amplifying the product of the reverse transcription by an isothermal amplification reaction using the forward and reverse nucleic acid amplification primers. (Item 5) The method according to item 5, wherein the reverse nucleic acid primer further comprises a promoter sequence for DNA-dependent RNA polymerase at its 5' end, and the reverse transcription is performed using the reverse nucleic acid primer. (Item 6) The method according to item 4 or 5, further comprising isolating the nucleic acid of the sample before reverse transcribing the HCV RNA of the sample present in the isolated nucleic acid. (Item 7) The method according to any of the above items, further comprising capturing the product of the isothermal amplification reaction by hybridizing the nucleic acid of the product of the isothermal amplification reaction to a nucleic acid capture probe, wherein the capture probe specifically hybridizes to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1 to 6 or a complement thereof. (Item 8) The method according to item 7, wherein the capture probe comprises a nucleic acid sequence of GCGAAAGGCCTTGTGGTACT (SEQ ID NO: 3), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 3 along its full length, or a complement thereof. (Item 9) The method according to any of the preceding items, further comprising detecting the product of the isothermal amplification reaction by hybridizing the product of the isothermal amplification reaction with a nucleic acid detection probe, wherein the detection probe specifically hybridizes to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1 to 6 or a complement thereof. (Item 10) The method according to item 9, wherein the detection probe comprises a nucleic acid sequence of TGATAGGGTGCTTGCGAGTG (SEQ ID NO: 4), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 4 along its full length, or a complement thereof. (Item 11) The method according to item 9 or 10, wherein the detection probe is labeled with a visually detectable label. (Item 12) The method according to any of items 7 to 11, wherein the capture and / or detection of the product of the isothermal amplification reaction is performed by a chromatographic dipstick assay. (Item 13) The method according to any of the preceding items, wherein the sample is a biological sample obtained from a subject suspected of being infected with HCV. (Item 14) The method according to any of the preceding items, wherein the sample is a blood or plasma sample obtained from a subject suspected of being infected with HCV. (Item 15) The method according to any of the preceding items, which is an in vitro method. (Item 16) A kit for determining whether a sample contains HCV nucleic acid, a forward nucleic acid amplification primer and a reverse nucleic acid amplification primer for amplifying a template nucleic acid by an isothermal amplification reaction, wherein each nucleic acid amplification primer specifically hybridizes to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1 to 6 or a complement thereof; A nucleic acid capture probe that specifically hybridizes to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1 to 6 or its complement; and / or A nucleic acid detection probe that specifically hybridizes to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1 to 6 or its complement, optionally comprising a visually detectable label for labeling the product of the isothermal nucleic acid amplification, the nucleic acid detection probe; A kit comprising the same. (Item 17) The kit according to item 16, wherein the forward nucleic acid primer comprises the nucleic acid sequence of AGACTGCTAGCCGAGTAG (SEQ ID NO: 1), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 1 along its full length. (Item 18) The kit according to item 16 or 17, wherein the reverse nucleic acid primer comprises the nucleic acid sequence of GCTCATGATGCACGGTCTACGAGA (SEQ ID NO: 2), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 2 along its full length. (Item 19) The kit according to any one of items 16 to 18, wherein the capture probe comprises the nucleic acid sequence of GCGAAAGGCCTTGTGGTACT (SEQ ID NO: 3), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 3 along its full length, or a complement thereof. (Item 20) The kit according to any one of items 16 to 19, wherein the detection probe comprises the nucleic acid sequence of TGATAGGGTGCTTGCGAGTG (SEQ ID NO: 4), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 4 along its full length, or a complement thereof. (Item 21) The kit according to any one of items 16 to 20, further comprising an RNA-dependent DNA polymerase, a DNA-dependent DNA polymerase, a DNA / RNA double-strand specific ribonuclease and a DNA-dependent RNA polymerase. (Item 22) The kit according to any one of items 16 to 21, further comprising a lancet for obtaining a sample of whole blood from a subject by finger puncture or heel puncture. (Item 23) The kit according to any one of items 16 to 22, further comprising a blood collector for collecting a sample of blood from a subject. (Item 24) The kit according to any one of items 16 to 23, further comprising a chromatography test strip for capturing and detecting the product of the isothermal nucleic acid amplification. (Item 25) The kit according to any one of items 16 to 24, further comprising a lysis / binding buffer, an elution buffer, and optionally a washing buffer for extracting nucleic acids from a blood or plasma sample. (Item 26) A set of primers for amplifying HCV nucleic acid by an isothermal nucleic acid amplification reaction, comprising a forward nucleic acid amplification primer and a reverse nucleic acid amplification primer, wherein each nucleic acid amplification primer specifically hybridizes to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1 to 6 or its complement. (Item 27) The set of primers according to item 26, wherein the forward nucleic acid primer comprises the nucleic acid sequence of AGACTGCTAGCCGAGTAG (SEQ ID NO: 1), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with the nucleic acid sequence of SEQ ID NO: 1 along its entire length. (Item 28) The set of primers according to item 26 or 27, wherein the reverse nucleic acid primer comprises the nucleic acid sequence of GCTCATGATGCACGGTCTACGAGA (SEQ ID NO: 2), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with the nucleic acid sequence of SEQ ID NO: 2 along its entire length. (Item 29) The set of primers according to any one of items 26 to 28, wherein the forward and / or the reverse nucleic acid primer has a maximum length of 50 nucleotides. (Item 30) A set of oligonucleotides for amplifying HCV nucleic acid by an isothermal nucleic acid amplification reaction and for capturing and / or detecting the product of the amplification reaction, a set of primers according to any one of items 26 to 29; a nucleic acid capture probe that specifically hybridizes to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1 to 6 or its complement; and / or A nucleic acid detection probe that specifically hybridizes to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1 to 6 or its complement; A set of oligonucleotides comprising the same. (Item 31) (Item 30) The set of oligonucleotides according to item 30, wherein the forward nucleic acid primer comprises the nucleic acid sequence of AGACTGCTAGCCGAGTAG (SEQ ID NO: 1), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 1 along its full length. (Item 32) (Item 30 or 31) The set of oligonucleotides according to item 30 or 31, wherein the reverse nucleic acid primer comprises the nucleic acid sequence of GCTCATGATGCACGGTCTACGAGA (SEQ ID NO: 2), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 2 along its full length. (Item 33) (Any one of Items 30 to 32) The set of oligonucleotides according to any one of Items 30 to 32, wherein the capture probe comprises the nucleic acid sequence of GCGAAAGGCCTTGTGGTACT (SEQ ID NO: 3), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 3 along its full length, or a complement thereof. (Item 34) (Any one of Items 30 to 33) The set of oligonucleotides according to any one of Items 30 to 33, wherein the detection probe comprises the nucleic acid sequence of TGATAGGGTGCTTGCGAGTG (SEQ ID NO: 4), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 4 along its full length, or a complement thereof. (Item 35) (Any one of Items 30 to 34) The set of oligonucleotides according to any one of Items 30 to 34, wherein the capture and / or detection probe is at most 50 nucleotides in length. (Item 36) An oligonucleotide comprising: The nucleic acid sequence of AGACTGCTAGCCGAGTAG (SEQ ID NO: 1), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 1 along its full length, or a complement thereof; The nucleic acid sequence of GCTCATGATGCACGGTCTACGAGA (SEQ ID NO: 2), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 2 along its full length, or a complement thereof; The nucleic acid sequence of GCGAAAGGCCTTGTGGTACT (SEQ ID NO: 3), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 3 along its full length, or a complement thereof; or The nucleic acid sequence of TGATAGGGTGCTTGCGAGTG (SEQ ID NO: 4), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 4 along its full length, or a complement thereof; An oligonucleotide comprising any of the above. (Item 37) The oligonucleotide according to item 36, which has a maximum length of 25, 30, 35, 40, 45 or 50 nucleotides. (Item 38) A kit according to any of items 16 - 25, comprising a set of primers according to any of items 26 - 29, a set of oligonucleotides according to any of items 30 - 35, or an oligonucleotide according to item 36 or 37. (Item 39) Use of a set of primers according to any of items 26 - 29, a set of oligonucleotides according to any of items 30 - 35, or an oligonucleotide according to item 36 or 37, in the method according to any of items 1 - 15.
Claims
**Claim 1** A method for determining whether a sample contains HCV nucleic acid, comprising amplifying the nucleic acid of the sample or nucleic acid derived from the nucleic acid of the sample by an isothermal amplification reaction using a forward nucleic acid amplification primer and a reverse nucleic acid amplification primer, wherein each nucleic acid amplification primer specifically hybridizes to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1-6 or its complement, wherein the forward nucleic acid amplification primer comprises the nucleic acid sequence of AGACTGCTAGCCGAGTAG (SEQ ID NO: 1), or a nucleic acid sequence having at least 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 1 along its full length, and the reverse nucleic acid amplification primer comprises the nucleic acid sequence of GCTCATGATGCACGGTC TACGAGA (SEQ ID NO: 2), or a nucleic acid sequence having at least 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 2 along its full length. **Claim 2** The method according to claim 1, further comprising reverse-transcribing the HCV RNA of the sample and amplifying the product of the reverse transcription by an isothermal amplification reaction using the forward and reverse nucleic acid amplification primers. **Claim 3** The method according to claim 2, wherein the reverse nucleic acid amplification primer further comprises a promoter sequence for DNA-dependent RNA polymerase at its 5'-end, and the reverse transcription is performed using the reverse nucleic acid amplification primer. **Claim 4** The method according to claim 2 or 3, further comprising isolating the nucleic acid of the sample before reverse-transcribing the HCV RNA of the sample present in the isolated nucleic acid. **Claim 5** The method according to any one of claims 1-4, further comprising capturing the product of the isothermal amplification reaction by hybridizing the nucleic acid of the product of the isothermal amplification reaction to a nucleic acid capture probe, wherein the capture probe specifically hybridizes to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1-6 or its complement. **Claim 6** The method according to claim 5, wherein the capture probe comprises a nucleic acid sequence of GCGAAAGGCC TTGTGGTA CT (SEQ ID NO: 3), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 3 along its full length, or a complement thereof.
7. The method according to any one of claims 1 to 6, further comprising detecting the product of the isothermal amplification reaction by hybridizing the product of the isothermal amplification reaction with a nucleic acid detection probe, wherein the detection probe specifically hybridizes to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1 to 6 or a complement thereof.
8. The method according to claim 7, wherein the detection probe comprises a nucleic acid sequence of TGATAGGG TGCTT GCGAGTG (SEQ ID NO: 4), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 4 along its full length, or a complement thereof.
9. The method according to claim 7 or 8, wherein the detection probe is labeled with a visually detectable label.
10. The method according to any one of claims 5 to 9, wherein the capture and / or detection of the product of the isothermal amplification reaction is performed by a chromatography dipstick assay.
11. The method according to any one of claims 1 to 10, wherein the sample is a biological sample obtained from a subject suspected of being infected with HCV.
12. The method according to any one of claims 1 to 11, wherein the sample is a blood or plasma sample obtained from a subject suspected of being infected with HCV.
13. The method according to any one of claims 1 to 12, which is an in vitro method.
14. A kit for determining whether a sample contains HCV nucleic acid, comprising: A forward nucleic acid amplification primer and a reverse nucleic acid amplification primer for amplifying a template nucleic acid by an isothermal amplification reaction, wherein each nucleic acid amplification primer specifically hybridizes to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1 to 6 or a complement thereof; A nucleic acid capture probe that specifically hybridizes to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1-6 or its complement; and / or A nucleic acid detection probe that specifically hybridizes to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1-6 or its complement, optionally comprising a visually detectable label for labeling the product of the isothermal nucleic acid amplification; comprising wherein the forward nucleic acid amplification primer comprises the nucleic acid sequence of AGACTGCTAGCCGAGTAG (SEQ ID NO: 1), or a nucleic acid sequence having at least 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 1 along its full length, and the reverse nucleic acid amplification primer comprises the nucleic acid sequence of GCTCATGATGCACGGTC TACGAGA (SEQ ID NO: 2), or a nucleic acid sequence having at least 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 2 along its full length, a kit.
15. The kit according to claim 14, wherein the capture probe comprises the nucleic acid sequence of GCGAAAGGCC TTGTGGTACT (SEQ ID NO: 3), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 3 along its full length, or a complement thereof.
16. The kit according to claim 14 or 15, wherein the detection probe comprises the nucleic acid sequence of TGATAGGG TGCTTGC GAGTG (SEQ ID NO: 4), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 4 along its full length, or a complement thereof.
17. The kit according to any one of claims 14-16, further comprising an RNA-dependent DNA polymerase, a DNA-dependent DNA polymerase, a DNA / RNA double-strand specific ribonuclease and a DNA-dependent RNA polymerase.
18. The kit according to any one of claims 14-17, further comprising a lancet for obtaining a sample of whole blood from a subject by finger puncture or heel puncture.
19. The kit according to any one of claims 14-18, further comprising a blood sampler for collecting a sample of blood from a subject.
20. The kit according to any one of claims 14 to 19, further comprising a chromatographic test strip for capturing and detecting the product of the isothermal nucleic acid amplification.
21. The kit according to any one of claims 14 to 20, further comprising a lysis / binding buffer, an elution buffer, and optionally a washing buffer for extracting nucleic acids from a blood or plasma sample.
22. A primer set for amplifying HCV nucleic acid by an isothermal nucleic acid amplification reaction, comprising a forward nucleic acid amplification primer and a reverse nucleic acid amplification primer, each nucleic acid amplification primer specifically hybridizing to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1 to 6 or its complement, wherein the forward nucleic acid amplification primer comprises the nucleic acid sequence of AGACTGCTAGCCGAGTAG (SEQ ID NO: 1), or a nucleic acid sequence having at least 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 1 along its full length, and the reverse nucleic acid amplification primer comprises the nucleic acid sequence of GCTCATGATGCACGGTC TACGAGA (SEQ ID NO: 2), or a nucleic acid sequence having at least 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 2 along its full length. A primer set.
23. The primer set according to claim 22, wherein the forward and / or the reverse nucleic acid amplification primer has a maximum length of 50 nucleotides.
24. A set of oligonucleotides for amplifying HCV nucleic acid by an isothermal nucleic acid amplification reaction and for capturing and / or detecting the product of the amplification reaction, the primer set according to claim 22 or 23; a nucleic acid capture probe that specifically hybridizes to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1 to 6 or its complement; and / or a nucleic acid detection probe that specifically hybridizes to an HCV core nucleic acid sequence conserved among at least HCV genotypes 1 to 6 or its complement; comprising a set of oligonucleotides.
25. The capture probe comprises a nucleic acid sequence of GCGAAAGGCC TTGTGGTA CT (SEQ ID NO: 3), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 3 along its full length, or a complement thereof, the set of oligonucleotides according to claim 24.
26. The detection probe comprises a nucleic acid sequence of TGATAGGG TGCTT GCGAGT G (SEQ ID NO: 4), or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleic acid sequence of SEQ ID NO: 4 along its full length, or a complement thereof, the set of oligonucleotides according to claim 24 or 25.
27. The set of oligonucleotides according to any one of claims 24 to 26, wherein the capture and / or detection probe is at most 50 nucleotides in length.
28. The kit according to any one of claims 14 to 21, comprising the set of primers according to claim 22 or 23, or the set of oligonucleotides according to any one of claims 24 to 27.
29. Use of the set of primers according to claim 22 or 23, or the set of oligonucleotides according to any one of claims 24 to 27, in the method according to any one of claims 1 to 13.
Citation Information
Patent Citations
Real-time fluorescence nucleic acid isothermal amplification detection kit for HCV (hepatitis C virus)
CN105483283A
Improved detection signal and capture in dipstick assays
JP2004512498A
Nucleic acid isolation
JP2004521881A
Nucleic acid isolation
JP2011530278A
Method for amplifying hepatitis C virus nucleic acid
JP2012515534A