Methods and compositions for activating gamma-globin gene expression

Abstract

The present invention discloses a new method for activating γ-globin gene transcription. [Means for Solving the Problem] The present invention uses a single-stranded oligonucleotide (ssODN) containing GATA or its antisense complementary sequence, TATC, as a guide sequence to perform gene editing in the γ-globin gene regulatory region to form an enhancer element containing GATA, thereby promoting the expression of the γ-globin gene in mature red blood cells. Hematopoietic stem cells gene-edited using the technology of the present invention retain normal function and can significantly improve the expression of fetal hemoglobin after differentiating into red blood cells, making them suitable for the clinical treatment of β-thalassaemia and sickle cell anemia.

Description

[Technical Field]

[0001] The present invention relates to the field of gene editing and to methods, compositions and uses thereof for activating γ-globin gene expression. 。 [Background technology]

[0002] Hemoglobin (Hb) is a specialized protein that carries and transports oxygen gas within red blood cells. It is composed of globin and heme. Adult hemoglobin is primarily a tetramer (α2β2) consisting of two α-globins and two β-globins, called adult hemoglobin (HbA). Mutations in the β-globin gene (HbB) can cause β-hemoglobin disorders (also called β-hemoglobinopathies), including sickle cell disease (SCD) and β-thalassemia (β-thal). Sickle cell anemia is caused by a point mutation in the β-globin structural gene, which can result in an abnormal hemoglobin (HbS). Beta-thalassemia is caused by partial or complete defects in the expression of the beta-globin gene, which can result in defective or absent adult hemoglobin (HbA). Reductions or deletions of globin chains in hemoglobin can lead to abnormal hemoglobin structure. Red blood cells containing such abnormal hemoglobin exhibit reduced deformability, a shortened lifespan, and may undergo in situ hemolysis in the bone marrow. After entering the peripheral circulation, they are rapidly destroyed by organs such as the spleen, potentially leading to anemia, iron accumulation in the body, and developmental abnormalities. Hemoglobinopathies affect millions of people worldwide, with approximately 330,000 children born with hemoglobinopathies each year, posing a serious threat to human health and life. Patients with thalassemia and sickle cell disease primarily experience relief through standard long-term blood transfusions and iron-removal therapy, but these treatments are not only incurable but also pose a significant security risk. Allogeneic hematopoietic stem cell transplantation is currently the only treatment available to cure thalassemia and sickle cell disease, but limitations such as a low bone marrow matching success rate and the risk of immune rejection make it difficult to widely apply clinically. Therefore, there is a growing need to develop new safe and effective treatment methods.

[0003] During human development, hemoglobin is not always composed of two α-globin and two β-globin forms. During embryonic development and immediately after birth, hemoglobin exists in a tetrameric form (α2γ2) consisting of two α-globin chains and two γ-globin chains, called fetal hemoglobin (HbF), which has a stronger oxygen affinity than HbA. As the fetus develops, the γ-globin gene gradually becomes silent, while the expression of the β-globin gene at the same genomic site gradually increases. After approximately six months of age, the composition and proportion of hemoglobin in the blood gradually stabilizes, with HbF being replaced by adult hemoglobin (HbA), leaving only very low levels of HbF (accounting for less than 1% of total hemoglobin).

[0004] As can be seen from the study, mutations at specific sites occur in a small proportion of individuals, activating the γ-globin gene transcription and resulting in an increased proportion of HbF in hemoglobin (also known as hereditary persistence of fetal hemoglobin, or HPFH). For example, several different mutations have been found in the promoter region of the γ-globin gene, including 13bp del c . from -114 to -102, 4bp del c . from -225 to -222, c .-114C>T, c .-117G>A, c .-158C>T, c .-167C>T, c .-170G>A, c .-175T>G, c .-175T>C, c .-195C>G, c .-196C>T, c .-198T>C, and c .-201C>T. These naturally occurring mutations can increase the ratio of HbF to total hemoglobin to varying degrees. Clinical studies have shown that a small number of patients with beta-thalassaemia or sickle cell anemia have the appropriate HPFH mutation in their genome, allowing the expression of HbF to compensate for the lack of HbA, thereby alleviating or alleviating the patient's anemia symptoms to some extent and reducing the need for blood transfusions. Inspired by this discovery, scientists are continuously exploring various methods for inducing HbF expression to achieve the goal of treating beta-hemoglobinopathies. For example, currently, drugs such as hydroxyurea are used in clinical settings to induce HbF expression and treat beta-hemoglobinopathies, but the level of HbF induction is low in many patients, preventing a thorough improvement in their condition.

[0005] Gene editing technology has brought new hope and new methods for treating genetic diseases such as hemoglobinopathies. In recent years, gene editing has undergone breakthrough development, making it possible and increasingly easy to artificially modify the base sequence at specific sites in the genome. Currently, relatively mature gene editing technologies include zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the clustered regularly interspaced short palindromic repeats (CRISPR) / Cas system (CRISPR-Cas system). By designing specific gene editing systems to cut targeted genomic DNA sites in living cells and creating double-strand breaks (DSBs), cells can utilize the non-homologous end joining (NHEJ) repair mechanism to repair DNA defects and randomly create mutations such as insertions, deletions, and base substitutions. For example, by providing an artificially designed DNA donor template at the same time as gene editing, cells can complete the repair using the homology-directed repair (HDR) mechanism, introducing the desired base mutation at the target site.

[0006] Currently, there are several international approaches to gene editing to enhance HbF expression in red blood cells. (1) Deleting or disrupting the erythroid enhancer element in the intron of the BCL11A gene on human chromosome 2 reduces BCL11A expression in red blood cells and relieves the repressive effect of BCL11A on γ-globin gene transcription. (2) Deleting or disrupting a portion of the promoter region of the γ-globin gene to prevent transcriptional repression or introducing naturally occurring HPFH mutations, such as a 13-base pair deletion (13bp del c) at sites -114 to -102. (3) Deleting a large DNA segment (3.5kb to 13.6kb) to delete a sequence containing an unknown repressor between the γ-globin gene and the β-globin gene, thereby promoting the binding of the γ-globin gene to the distal LCR enhancer. Although these methods have shown efficacy in activating HbF expression, their long-term efficacy and / or safety are still unclear, and new methods need to be further developed. Summary of the Invention [Problem to be solved by the invention]

[0007] The present invention provides a method for activating γ-globin gene transcription by gene editing. Effective active GATA element or its antisense Contains complementary sequences Using a single-stranded oligonucleotide (ssODN) that encodes a γ-globin gene, a small number of base mutations (deletions, substitutions, insertions, etc.) are created at appropriate locations in the promoter region of the γ-globin gene using gene editing technology (e.g., CRISPR-Cas gene editing system), and after editing, the sense or antisense strand of the promoter region of the γ-globin gene is To, For example, the sequence structure of NTG-N(7-8)-WGATAR or NAG-N(7-8)-WGATAR an erythroid enhancer containing an active GATA element,By forming this residue, transcription of the γ-globin gene in mature erythrocytes can be promoted, thereby improving HbF expression in erythrocytes. Among these, W is T or A, R is A or G, and N is A, G, C or T, more preferably C or T. N(7-8) refers to any 7 to 8 bases.

[0008] As shown in Figure 1, the principle of the present invention is to use gene editing technologies such as CRISPR-Cas to bind the single-stranded oligonucleotide (ssODN) of the present invention to efficiently edit stem cells and progenitor cells with erythrocyte differentiation potential, such as CD34+ hematopoietic stem cells, to create mutations in the promoters of the HBG1 and HBG2 genes (located on human chromosome 11) encoding human γ-globin, thereby artificially creating a single NTG-N(7-8)-WGATAR or NAG-N(7-8)-WGATAR sequence structure in the sense or antisense strand of the promoter. This sequence acts as an enhancer to enhance the expression of GATA1 after the target cells differentiate into erythrocytes. and TAL1 The primary goal is to recruit activators such as γ-globin to promote γ-globin expression.

[0009] The present invention provides NTG-N(7-8)-WGATAR sequence, NAG-N(7-8)-WGATAR sequence, or the corresponding reverse complement sequence The present invention provides an ssODN containing the following. The ssODN can be used for gene editing of the γ-globin gene. In the present invention, the ssODN structure contains a 5' homology arm, a replacement sequence, (Used to replace a single base sequence in the HBG1 or HBG2 gene) , and 3' homologous arms. In the ssODN structure, the NTG-N(7-8)-WGATAR sequence, the NAG-N(7-8)-WGATAR sequence, or the corresponding reverse complementary sequence The GATA or TATC sequence may be located at any position in the ssODN, for example, in the replacement sequence, the 5' homologous arm, the 3' homologous arm, the junction between the 5' homologous arm and the replacement sequence, or the junction between the 3' homologous arm and the replacement sequence. The length of one homologous arm may be 20 to 300 nt. In an embodiment of the present invention, the length of the ssODN homologous arm is about 40 nt. In some embodiments of the present invention, , the aboveThe ssODN is selected from the sequences represented by SEQ ID NO: 40 to SEQ ID NO: 65. In some examples, the 5' and 3' ends of the ssODN are modified with phosphorothioate.

[0010] The present invention discloses a composition for γ-globin gene editing, which comprises an ssODN, an sgRNA, and a CRISPR-Cas nuclease. In some embodiments of the present invention, the sgRNA target site in the gene editing system is selected from SEQ ID NO: 32 to SEQ ID NO: 39. Any one of In some embodiments of the present invention, the sgRNA is located in a sequence represented by SEQ ID NO: 69 to SEQ ID NO: 76. Any one of In some embodiments of the present invention, the Cas9 protein is a Cas9 protein derived from Streptococcus pyogenes. In the present invention, gRNA (guide RNA) is an RNA that binds to and guides a Cas nuclease, such as sgRNA (single guide RNA).

[0011] The present invention discloses an electrotransfer method for γ-globin gene editing, which uses electroporation technology to efficiently transfect a composition consisting of ssODN, sgRNA, and CRISPR-Cas nuclease into human hematopoietic stem cells and induce efficient gene editing.

[0012] The present invention further discloses hematopoietic stem cells, which can be transfected with a composition comprising the above-mentioned ssODN, sgRNA, and CRISPR-Cas nuclease using an electrical transcription method, and the promoter region of the γ-globin gene in the hematopoietic stem cells contains an active GATA element, thereby enhancing the expression of the γ-globin gene during differentiation into erythrocytes. [Effects of the Invention]

[0013] Compared with the prior art, the present invention has the following beneficial effects:

[0014] The ssODN of the present invention is introduced into cells together with a gene editing system (e.g., CRISPR-Cas, TALEN, ZFN, etc.) to guide gene editing of the promoter region of the γ-globin gene, resulting in a mutation at a specific site. Valid Activating GATA elements (e.g., NTG-N(7-8)-WGATAR sequence or NAG-N(7-8)-WGATAR sequence) In some embodiments of the present invention, ssODN and a CRISPR-Cas gene editing system are introduced into human hematopoietic stem cells using electrical transcription technology to obtain efficient gene editing in the promoter region of the γ-globin gene, and mutations are introduced at specific sites to produce the desired γ-globin gene. NTG-N(7-8)-WGATAR sequence or NAG-N(7-8)-WGATAR sequence After the hematopoietic stem cells differentiate into erythrocytes, the expression of γ-globin gene can be significantly improved, and the proportion of HbF in hemoglobin can be significantly improved. [Brief explanation of the drawings]

[0015] [Figure 1] 1 is a diagram illustrating the technical principle of the present invention. [Figure 2] (A) A diagram showing the wild-type sequence between gene editing target regions -92 and -66 of the HBG1 and HBG2 genes, the location of the gRNA target sequence used, and the desired mutated sequence after gene editing. (B) A diagram showing the wild-type sequence between gene editing target regions -129 and -98 of the HBG1 and HBG2 genes, the location of the gRNA target sequence used, and the desired mutated sequence after gene editing. (C) A diagram showing the wild-type sequence between gene editing target regions -175 and -153 of the HBG1 and HBG2 genes, the location of the gRNA target sequence used, and the desired mutated sequence after gene editing. (D) A diagram showing the wild-type sequence between gene editing target regions -192 and -160 of the HBG1 and HBG2 genes, the location of the gRNA target sequence used, and the desired mutated sequence after gene editing. (E) A diagram showing the wild-type sequence between gene editing target regions -428 to -406 of the HBG1 gene and -432 to -410 of the HBG2 gene, the location of the gRNA target sequence used, and the desired mutated sequence after gene editing. [Figure 3]Figure 1 shows data on genome editing efficiency of HBG1 and HBG2 by transfection of CRISPR-Cas plasmids in 293T cells. The data are from INDEL detection results of genomic DNA after transfection of CRISPR-Cas plasmids in 293T cells with Lipofectamine 2000™ for 4 days. The percentage of total indel mutations (% total mutations) is shown in the figure. [Figure 4] Figure 1 shows the HBG2 genome editing efficiency data by transfecting CRISPR-Cas plasmids with ssODNs in 293T cells. The data is from the HBG2 INDEL detection results after transfection of CRISPR-Cas plasmids and ssODNs in 293T cells with Lipofectamine 2000™ for 4 days. [Figure 5] Figure 1 shows the editing efficiency data of HBG2 genome by transfecting CRISPR-Cas plasmid with ssODN in K562 cells. The data is from INDEL detection results of HBG2 after transfection of CRISPR-Cas plasmid and ssODN in K562 cells by Lonza 4D electroporation for 4 days. [Figure 6] 1 shows the HBG2 genome editing efficiency data after electroporation of ribonucleotide protease (RNP) and ssODN into K562 cells. The data are from INDEL detection results of HBG2 4 days after electroporation of ssODN and CRISPR-Cas / sgRNA RNP into K562 cells. [Figure 7](A)-(C) show editing efficiency data for the HBG2 gene in mobilized peripheral blood CD34+ cells (mPBSCs) after RNP and ssODN were introduced by electroporation. The data are from INDEL detection results of genomic DNA 5 days after ssODN and CRISPR-Cas / sgRNA RNP were introduced into mPBSCs by electroporation to induce erythroid differentiation. (A) and (B) are Sanger sequencing maps, and (C) is the INDEL percentage result analyzed by synthego software. [Figure 8] This figure shows γ-globin mRNA expression data after gene editing in mobilized peripheral blood CD34+ cells (mPBSCs). The data are from qRT-PCR detection of mRNA 18 days after ssODN and CRISPR-Cas / sgRNA RNP were introduced into mPBSCs by electroporation and then erythroid differentiation was induced. In the figure, γ-globin mRNA expression was normalized using GAPDH expression level as an internal reference and the expression of γ-globin mRNA in unedited cells as a reference, n=3. [Figure 9] This figure shows HbF expression data after gene editing in mobilized peripheral blood CD34+ cells (mPBSCs). The data are from the results of HPLC detection of hemoglobin 18 days after ssODN and CRISPR-Cas / sgRNA RNP were introduced into mPBSCs by electroporation, followed by induction of erythroid differentiation. In the figure, HbF expression is expressed as a percentage of total hemoglobin. DETAILED DESCRIPTION OF THE INVENTION

[0016] To facilitate understanding of the present invention, the present invention will now be described in more detail with reference to the accompanying drawings. In the drawings, preferred embodiments of the present invention are shown. However, the present invention may be embodied in many different forms and is not limited to the embodiments set forth herein. On the contrary, these embodiments are provided to provide a more thorough and complete understanding of the present invention.

[0017] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art of the present invention. The terms used in the description of the present invention herein are only for describing specific embodiments and are not intended to limit the present invention. The term "and / or" used herein includes any and all combinations of one or more associated items.

[0018] All raw materials used in the following examples are commercially available.

[0019] Herein, gene editing technology, for example, CRISPR-Cas-induced gene editing technology, is used to bind the single-stranded oligonucleotide (ssODN) of the present invention to efficiently edit stem cells and progenitor cells with the ability to differentiate into erythrocytes, such as CD34+ hematopoietic stem cells, to create mutations in the promoters of the HBG1 and HBG2 genes (located on human chromosome 11) encoding human γ-globin, thereby artificially creating a single NTG-N(7-8)-WGATAR or NAG-N(7-8)-WGATAR sequence structure (Figure 1) in the sense or antisense strand of the promoter. This sequence acts as an enhancer and activates GATA1 after the target cells differentiate into erythrocytes. and TAL1 can recruit transcriptional activators such as γ-globin to promote γ-globin expression.

[0020] GATA-1 is a transcriptional regulator specifically expressed in the erythroid system and plays an important role in the differentiation of erythrocytes. In erythrocytes, genes specifically expressed in erythrocytes, such as α-globin, β-globin, and heme biosynthetic enzymes, are all directly transcribed and activated by GATA-1. As a transcription factor, GATA-1 selectively targets the WGATA sequence element (W represents T or A, and R represents A or G) in chromatin DNA, which can be expressed as T / A(GATA)A / G. Its antisense complementary sequence is YTATCW, where Y represents T or C, which can be expressed as T / C(TATC)T / A. As can be seen from this, the "antisense complement" in the present invention is the usual "reverse complement" in the art. binds to, for example, the human β-globin gene promoter Multiple GATA sites have also been found in the GATA region. It is important to note that not all genes containing GATA sequences are activated by GATA-1. This is because GATA sequences are widely distributed throughout the genome and require certain combinations of upstream and downstream sequences (cis-elements) to function. For example, cis-regulatory elements such as CACCC or GC boxes near GATA sequences typically recruit GATA-1 and co-bind with the transcription factor EKLF. For example, the presence of an E-box element (CAGNTG, where N represents any base) or a half E-box element (NTG) near GATA sequences recruits GATA-1 and co-binds with the transcription factor TAL1. Genome-wide analysis of GATA-1 and TAL1 binding sites using ChIP-seq revealed that approximately three-quarters of GATA-1 / TAL1 binding sites exhibit clear sequence patterns, with a half E-box element (NTG) often present 7-8 bases upstream of the WGATA sequence, which may be represented as NTG-N(7-8)-WGATA. Studies have shown that such sequences are active GATA elements and are essential for the regulation of erythrocyte function. Some It has been demonstrated that gene expression can be enhanced. For example, the +58 enhancer in the BCL11A intron contains a CTG-N(7)-TGATAA sequence, and disruption of the GATA motif in this sequence significantly reduces BCL11A expression in erythrocytes.

[0021] The 1,400-base sequence upstream of the transcription start sites of the HBG1 and HBG2 genes is highly similar and is thought to be a promoter region. Through extensive investigation, the inventors of the present application discovered that although the promoter region of the γ-globin gene itself contains multiple GATA (or TATC) sequences as well as numerous TG sequences, γ-globin is barely expressed in mature erythrocytes. Through extensive investigation, the inventors of the present application discovered that the GATA (or TATC) and TG sequences in the γ-globin gene promoter are not positioned and oriented to form an effective active GATA element (e.g., TG-N(7-8)-WGATAR), and therefore transcriptional activators highly expressed in mature erythrocytes, such as GATA-1 / TAL1, cannot be recruited to bind (co-bind) to the promoter region of the γ-globin gene, resulting in silence and minimal expression of γ-globin in mature erythrocytes.

[0022] Through extensive research, the inventors of the present application have discovered that there are certain sites in the HBG1 and HBG2 promoter regions, and that if the sequence in the sense or antisense strand is changed (by substitution, deletion, insertion, etc.) by a small number of bases, an NTG-N(7-8)-WGATAR or NAG-N(7-8)-WGATAR sequence structure can be formed. The inventors of this application believe that by using a gene editing system to cut these sites and form DSBs, a certain percentage of the genome can be edited into the desired sequence structure by adding a donor DNA template (e.g., a single-stranded oligonucleotide (ssODN)) to guide HDR repair at these sites. Ultimately, a sequence such as NTG-N(7-8)-WGATAR or NAG-N(7-8)-WGATAR will be formed in the promoter region of the γ-globin gene. This allows transcriptional activators that are highly expressed in mature erythrocytes, such as GATA-1 / TAL1, to be recruited as enhancers and bind (co-bind) to the promoter region of the γ-globin gene, thereby promoting high expression of γ-globin in mature erythrocytes.

[0023] Based on the purpose, gene editing can be divided into two types. One type disrupts the sequence or structure of the target site and is called knockout. The other type introduces a specific sequence mutation into the target site and is called knockin. A common method for introducing a specific sequence mutation is to simultaneously introduce a DNA donor template, allowing cells to use homologous recombination to replace the sequence in the template into the genome, thereby achieving knockin. The DNA template used for HDR can be plasmid DNA, linearized double-stranded DNA, DNA delivered by AAV, or single-stranded oligonucleotide (ssODN). ssODN is increasingly being used in gene editing due to its high efficiency and ease of synthesis, particularly for gene editing in in vitro cultured cells.

[0024] The ssODN structure includes a 5' homologous arm, a replacement sequence, and a 3' homologous arm. The homologous arms are sequences homologous to the DNA regions on either side of the target site to be edited and are used to position the target site in the chromosome. The 5' homologous arm and the 3' homologous arm are not usually adjacent to the corresponding sequences in the chromosome, but are spaced apart by a fixed distance, e.g., 1 to 20 nucleotides. These spaced apart sequences are the target of gene editing (pseudo-edited sequence), i.e., the sequence replaced by gene editing. The "replacement sequence" between the 3' end of the 5' homologous arm and the 5' end of the 3' homologous arm on the ssODN is the desired result of gene editing. Adding ssODN during gene editing induces homologous recombination repair during gene editing, and as a result of the repair, the pseudo-edited sequence in the cellular genome can be repaired to a replacement sequence. The length of the replacement sequence in the ssODN may be shorter than the pseudo-edited sequence. In this case, the result of gene editing is the deletion and / or replacement of the pseudo-edited sequence in the original genome. The length of the replacement sequence in the ssODN may be 0 bases. In this case, the pseudo-edited sequence in the genome is deleted. The length of the replacement sequence in the ssODN may be longer than the pseudo-edited sequence. In this case, the result of gene editing is the replacement and / or insertion of the pseudo-edited sequence.

[0025] The present invention is applicable to gene editing systems guided by site-specific nucleases, such as CRISPR-Cas, TALENs, and ZFNs. CRISPR-Cas is a gene editing technology that encompasses a variety of naturally occurring and engineered CRISPR-Cas systems, including, but not limited to, the CRISPR-Cas9 system and the CRISPR-Cas12 system. The CRISPR-Cas9 system operates by binding a CRISPR-derived RNA (crRNA) to a trans-activating RNA (tracrRNA) via base pairing to form a tracrRNA / crRNA complex. This complex guides the Cas9 nuclease protein to shear double-stranded DNA at the target site, where the crRNA is paired. The functions of the tracrRNA and crRNA can be replaced by a single artificially synthesized sgRNA with a guiding function. When using other CRISPR-Cas systems, the corresponding sgRNA or crRNA must be designed. When using a system such as TALEN or ZFN, it is necessary to design the corresponding TALEN or ZFN nuclease based on the editing site of the present invention.

[0026] Example 1: Selection of ssODN and CRISPR-Cas systems to introduce an active GATA element into the promoter of the γ-globin gene

[0027] By analyzing the sequences within approximately 1.4 kb upstream of the HBG1 and HBG2 transcription start sites (SEQ ID NOs: 1 and 2), the inventors discovered that the sequences in many sectors were altered (e.g., substitutions, deletions, or insertions) at several bases, forming NTG-N(7-8)-WGATAR or NAG-N(7-8)-WGATAR sequence structures. By analyzing whether the target mutation bases in these sectors were near NGG (a PAM identified by spCas9) and whether the breakpoints were appropriately positioned in the target sequence to be edited, five candidate target regions (Figure 2 (A)–(E)) were identified as having the highest potential for efficient gene editing. The transcription start sites, from closest to furthest, were as follows: Region 1: HBG1 and HBG2 promoter -92 to -66 (Figure 2(A)), Region 2: HBG1 and HBG2 promoter -129 to -98 (Figure 2(B)), Region 3: HBG1 and HBG2 promoter -175 to -153 (Figure 2(C)), Region 4: HBG1 gene and HBG2 gene -192 to -160 (Figure 2(D)), Region 5: HBG1 gene -428 to -406 and HBG2 gene -432 to -410 (Figure 2(E)).

[0028] Based on the sequence characteristics of the five candidate regions and the breakpoint locations predicted by the CRISPR-Cas9 gene editing system, the sequences within each region were analyzed to determine the appropriate mutation target type, such as those shown in Table 1 (SEQ ID NO: 3 to SEQ ID NO: 31). The underlined bases indicate the bases that need to be replaced, which is the desired result after gene editing. In the present invention, the length of the substituted bases is 0 to 6 bases, and the achieved effect is deletion, substitution, insertion, or a combination of deletion, substitution, and insertion.

[0029] [Table 1]

[0030] To achieve the goal of creating a double-stranded DNA break near the editing site within the region selected in Table 1, we selected the spCas9 CRISPR-Cas system (derived from Streptococcus pyogenes), which has high cleavage efficiency, and analyzed potential target sites with high cleavage efficiency. Sites 1 to 8 were selected as candidate target sites. The identified target site DNA sequences and PAM sequences (NGG) are listed in Table 2 (SEQ ID NO: 32 to SEQ ID NO: 39).

[0031] [Table 2]

[0032] According to the desired mutation types shown in Table 1 and the DNA strand (sense or antisense) identified by the sgRNA in Table 2, the corresponding guided gene editing was designed to repair the ssODN (Table 3: SEQ ID NO: 40 to SEQ ID NO: 65). The ssODN structure in the present invention included a 5' homologous arm, a replacement sequence, and a 3' homologous arm. In the ssODN structure, the NTG-N(7-8)-WGATAR sequence, the NAG-N(7-8)-WGATAR sequence, or the corresponding reverse complementary sequenceThe GATA or TATC sequence may be located at any position in the ssODN, such as the replacement sequence, the 5' homologous arm, the 3' homologous arm, the junction between the 5' homologous arm and the replacement sequence, or the junction between the 3' homologous arm and the replacement sequence. The homologous arms on both sides of the ssODN may be symmetrical or asymmetrical (different lengths on both sides). For ease of comparison between systems, tests were conducted using ssODNs with symmetrical homologous arms in the present invention. The homologous arms on both sides of the ssODN may be 20 to 300 nt in length. For ease of comparison between systems, the examples of the present invention use ssODNs with homologous arms of approximately 40 nt on both sides. The ssODN may be the sense or antisense strand of the editing region DNA (the homologous arm sequence is identical to the corresponding sense strand or antisense strand). The ssODN of the present invention was selected to have the same DNA strand as the sgRNA recognition site as the ssODN master sequence. The sequence of the ssODN may have 0, 1, 2, 3, 4, 5, or 6 substituted bases other than the homologous arm sequences on both sides, and the effect achieved may be deletion, substitution, insertion, or a combination of deletion, substitution, and insertion. The effect achieved may be a change in one or more bases in the genome, for example, the deletion or substitution of 1 to 20 bases. For the sequences shown in Table 3 (SEQ ID NO: 40 to SEQ ID NO: 65), the underlined bases are the homologous arms on both sides, which are about 40 nt in length, and the bases not underlined between the homologous arms on both sides are substituted bases, of which ssODN_16 has 0 substituted bases. The first three nucleotides on both ends of the ssODN are: Thiophosphate ( Phosphorothioate (SsODN) can be modified to enhance the stability of ssODN and improve its activity in gene editing.

[0033] [Table 3]

[0034] The sgRNA-spCas9 carrier (PX459, pSpCas9(BB)-2A-Puro) was used to express sgRNAs corresponding to the target sites in Table 2. This carrier can express a 100-nt sgRNA while expressing the spCas9 protein. The 5' end of the carrier is a 20-nt guide sequence. The remaining 80 nt is a universal sgRNA backbone sequence (SEQ ID NO: 66, GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAA GUGGCACCGAGUCGGUGCUUUU). To clone the sgRNA, we synthesized a guide strand oligo (same as the 20-nt target site sequence in Table 2) and a complementary oligo (cacc was added to the 5' end of the guide strand; if the first nucleotide at the 5' end of the guide strand was not guanine G, caccG was added to the 5' end of the guide strand, and aaac was added to the 5' end of the complementary strand; if a G was added to the 5' end of the guide strand, C was added to the 3' end of the complementary strand to complement it). The two oligos were mixed in equal amounts and annealed at 95°C. They were then ligated to PX459 support digested with the restriction enzyme BbsI. Successful cloning was confirmed by bacterial colony PCR and Sanger sequencing. PCR was performed using primers SEQ ID NO: 67 (5'-3': GGACTATCATATGCTTACCGTAAC) and SEQ ID NO: 68 (5'-3': GGCGGGCCATTTACCGTAAG). After successful cloning, eight plasmids were obtained, each expressing sgRNAs SEQ ID NO: 69 to SEQ ID NO: 76 (Table 4).

[0035] [Table 4]

[0036] The eight expressed plasmids were transfected into 293T cells using Lipofectamine 2000. TMPlease refer to the kit instructions. Transfected cells were cultured for 4 days, harvested, and genomic DNA was extracted. The HBG1 and HBG2 promoter gene segments were amplified using KOD Plus high-fidelity enzyme-based PCR with SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, and SEQ ID NO:78, respectively. The PCR products were purified and then sequenced using SEQ ID NO:77 and SEQ ID NO:79, respectively. Gene editing efficiency was analyzed using synthego software for the sequencing files. As shown in Figure 3, the editing efficiency of sgRNA-8 was relatively low (approximately 20%), while the overall editing efficiency (indels) of the other groups was approximately 40-50%.

[0037] [Table 5]

[0038] Example 2: Transfection of ssODN with sgRNA-spCas9 carrier into 293T cells for gene editing

[0039] The eight sgRNA-spCas9 vectors described above were transfected into 293T cells together with appropriate ssODNs to determine whether the addition of ssODNs would guide the formation of the desired mutation type (HDR repair) after gene editing. According to the location of the sgRNA breakpoint, the eight sgRNA-spCas9 vectors were each combined into 30 different combinations according to the sgRNA + ssODN combination methods listed in Table 6. Lipofectamine 2000 TMUsing a reagent, ssODN was added during transfection of the plasmid, delivering the ssODN into the cells along with the plasmid. The transfected cells were cultured for 4 days, harvested, and genomic DNA extracted. Because the gene editing efficiencies of HBG1 and HBG2 were almost directly correlated, with HBG2 often being slightly higher than HBG1 (Figure 3), only the HBG2 genome editing efficiency was selected for comparison in subsequent experiments. According to the method described in Example 1, the HBG2 promoter gene segment was amplified by PCR, purified, and sequenced. Analysis of gene editing efficiency using synthego software revealed that transfection with ssODN and sgRNA-spCas9 carriers improved editing efficiency, resulting in 10-20% gene editing and the desired mutation type in many groups (Figure 4).

[0040] [Table 6]

[0041] Example 3: Transfection of ssODN and sgRNA-spCas9 carriers into K562 cells for gene editing by electroporation

[0042] Liposomes (e.g., Lipofectamine 2000 TMBecause the efficiency of transfecting suspension cells with plasmids using a cloning reagent (e.g., sgRNA-1, sgRNA-2, sgRNA-5, ssODN) is low, electroporation is typically used for transfection of suspension cells. Some of the sgRNA and ssODN combinations described in Example 2 were transfected into K562 cells using a lonza-4D electrotransfer system, with the system's K562 cell transfection program running. The transfected cells were cultured for 4 days, harvested, and genomic DNA was extracted. The HBG2 promoter gene segment was amplified by PCR and sequenced. Gene editing efficiency was analyzed using synthego software, and the sequencing results showed that electrotransferring sgRNA-1, sgRNA-2, sgRNA-5, and ssODN combinations into K562 cells achieved high editing efficiency (Figure 5), slightly higher than that of 293T cells. The electrotransfer of ssODN and sgRNA-spCas9 carriers to induce the desired mutations was also slightly higher than that of 293T cells.

[0043] Example 4: Transfection of ssODN and spCas9 protein / sgRNA RNP into K562 cells by electroporation to achieve efficient gene editing

[0044] In contrast to the plasmid-expressed CRISPR-Cas system, the CRISPR-Cas system delivered in the form of ribonucleotide protease (RNP) has higher gene editing efficiency and is less likely to induce apoptosis. Using commercial spCas9 protein and chemically synthesized sgRNA-1, sgRNA-2, and sgRNA-5 (sequences identical to the corresponding sgRNAs in Table 4 but without chemical modifications at the termini), RNP-1, RNP-2, and RNP-5 were incubated and packaged in vitro. The RNP and a combination of ssODNs were delivered into K562 cells by electroporation. The transfected cells were cultured for 4 days, harvested, and genomic DNA was extracted. The HBG2 promoter gene segment was amplified by PCR and sequenced. As can be seen from the sequencing results, gene editing efficiency was analyzed using synthego software (Figure 6). Adding ssODN during electrotransfer of RNPs into K562 significantly increased the overall gene editing efficiency by approximately 2-fold compared to the combination without ssODN (Figure 6). At the same time, ssODN and RNPs can induce a higher rate of gene editing to form the desired mutation type (Figure 6).

[0045] Example 5: Electroporation delivers ssODN and spCas9 protein / sgRNA RNP into human hematopoietic stem / progenitor cells for efficient gene editing and significant enhancement of HBG expression

[0046] Human CD34+ cells (mPBSCs) derived from mobilized peripheral blood were resuscitated and cultured for 2 days in StemSpan serum-free expansion medium (SFEM) enriched with human cell factors (SCF, TPO, and Flt3L, each at 100 ng / ml). The ssODN and spCas9 / sgRNA RNP were then delivered to mPBSCs using the EO-100 program in a lonza-4D electrotransfer system. After electrotransfer, the mPBSCs were cultured for another day in SFEM enriched with human cell factors (SCF, TPO, and Flt3L, each at 100 ng / ml). Then, the mPBSCs were induced to differentiate into erythrocytes in three stages: Stage 1: They were cultured for 7 days in IMDM medium containing supplements such as EPO, SCF, human AB serum, insulin, transferrin, heparin, IL-3, and cortisone dihydrogenase. On day 5 after differentiation induction, 2 x 10e5 cells were taken and genomic DNA was extracted. The HBG2 promoter segment was amplified by PCR, transferred to a Sanger microscope, and sequenced. Similar to the results in K562 cells, electrotransferring ssODN and spCas9 / sgRNA RNP into mPBSC cells resulted in efficient gene editing, with the desired mutation rate reaching 30% in some groups (Figure 7(A)-(C)).

[0047] Seven days after induction of differentiation, electrotransferred mPBSC cells and untreated mPBSC cells (control, NC) were cultured for four days in IMDM medium containing additives such as EPO, SCF, human AB serum, insulin, transferrin, and heparin. Finally, they were cultured for seven days in IMDM medium containing additives such as EPO, human AB serum, insulin, transferrin, and heparin. Eighteen days after induction of differentiation, both electrotransferred and untreated mPBSC cells displayed a distinct deep red color after centrifugation. They contained a large number of red blood cells, demonstrating that the electrotransferred mPBSC cells were capable of normal red blood cell differentiation.

[0048] Toward the end of differentiation induction, mRNA was extracted from a portion of the cells, and HBG mRNA expression levels were detected by reverse transcription-real-time quantitative PCR (RT-qPCR). Compared to non-transfected cells (NC), transfection of RNP-2 with ssODN_6, ssODN_13, ssODN_14, ssODN_15, and ssODN_17 significantly increased HBG mRNA expression (Figure 8), with the highest increase being more than three-fold.

[0049] Using a glycosylated hemoglobin A1c detection system (VARIANT II TURBO HbA1c kit-2.0), hemoglobin was detected by HPLC after differentiation of hematopoietic stem cells electrotransferred to the RNP-2 group into red blood cells. The results showed that after gene editing with the addition of ssODN, fetal hemoglobin content (HbF) was significantly improved, reaching 27%-36%, more than double the 13.3% in the control group (Figure 9).

[0050] As can be seen from the results of the above examples, the present invention provides a gene editing method for improving γ-globin gene expression, which is different from the prior art. When the ssODN according to the present invention is used for γ-globin gene editing, it is possible to improve the expression of HBG1 and HBG2 genes after gene editing. promoter By guiding the formation of desired mutations at specific sites in the region, an active GATA element can be produced. (e.g., NTG-N(7-8)-WGATAR sequence or NAG-N(7-8)-WGATAR sequence) The element can positively regulate the expression of γ-globin after the gene-edited cells (e.g., hematopoietic stem cells) differentiate into erythrocytes, thereby activating or significantly enhancing γ-globin gene expression. Therefore, the present invention has potential application value in gene therapy for β-hemoglobinopathies.

[0051] The technical features of the above embodiments can be combined in any manner. For the sake of simplicity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered within the scope of the present specification.

[0052] It should be understood that the above examples are merely illustrative of some embodiments of the present invention, and the descriptions are specific and detailed, but do not limit the scope of the present invention. It is clear that a person skilled in the art can make some modifications and improvements without departing from the spirit of the present invention, and all of these fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. An in vitro method for activating γ-globin gene expression in a target cell, comprising: artificially forming an NTG-N(7-8)-WGATAR sequence or a NAG-N(7-8)-WGATAR sequence in the sense strand or antisense strand of the gamma-globin gene promoter region by gene editing technology to form an enhancer element containing the NTG-N(7-8)-WGATAR sequence or the NAG-N(7-8)-WGATAR sequence in the promoter region of the gamma-globin gene; wherein W is T or A, R is A or G, and N is A, G, C, or T; wherein the sequence to be produced is a sequence represented by any one of SEQ ID NOs: 10, 17 to 19, and 21 and their reverse complementary sequences; The method wherein the target cells are cells with erythroid differentiation potential.

2. A pharmaceutical composition comprising an ssODN and a gene editing system targeting an HBG1 or HBG2 gene promoter region, The gene editing system is a CRISPR-Cas editing system, a TALEN editing system, or a ZFN editing system; The ssODN is used together with the gene editing system to artificially create a sequence in the promoter region, and the created sequence is represented by any one of SEQ ID NOs: 10, 17-19, 21 and their reverse complements.

3. The pharmaceutical composition of claim 2, wherein the ssODN comprises any one of the sequences shown in SEQ ID NOs: 45, 52 to 54, and 56.

4. The pharmaceutical composition of claim 2, wherein the CRISPR-Cas editing system is a CRISPR-Cas9 or CRISPR-Cas12 system.

5. The pharmaceutical composition according to claim 4, wherein the Cas9 nuclease in the CRISPR-Cas9 system is derived from Streptococcus pyogenes.

6. 3. The pharmaceutical composition of claim 2, wherein the CRISPR-Cas editing system comprises a gRNA and a Cas protein, or comprises an mRNA encoding a Cas protein and a gRNA, or comprises a plasmid expressing a Cas protein and a gRNA.

7. 3. The pharmaceutical composition of claim 2, wherein the CRISPR-Cas editing system comprises a ribonucleoprotein complex consisting of a gRNA and a Cas protein.

8. A kit for activating a γ-globin gene, comprising: (1) The ssODN according to claim 2; (2) Cas9 or Cas12 protein, a DNA sequence encoding the Cas9 or Cas12 protein, its transcript, and / or a recombinant expression vector expressing the same; A kit comprising:

9. A recombinant cell comprising: the gamma-globin gene promoter region in the recombinant cell comprises an enhancer element comprising the NTG-N(7-8)-WGATAR sequence or the NAG-N(7-8)-WGATAR sequence; wherein W is T or A, R is A or G, and N is A, G, C, or T; the γ-globin gene promoter region comprises any one of SEQ ID NOs: 10, 17 to 19, and 21, and their reverse complement sequences; The recombinant cell is a cell having the ability to differentiate into erythrocytes.

10. The recombinant cell of claim 9, wherein the recombinant cell is a hematopoietic stem cell.

11. Use of the pharmaceutical composition according to any one of claims 2 to 7, the kit according to claim 8, or the recombinant cell according to claim 9 or 10 in the preparation of a medicament for treating anemia.

12. The use according to claim 11, wherein the anemia is beta-thalassemia or sickle cell anemia.

Images