Photoresponsive proteins for color recognition and their applications

Abstract

This protein is provided for, for example, improving color recognition, the protein having channel activity and comprising, at the position(s) corresponding to one or two or more positions selected from the group consisting of positions 53, 83, 87, 117, 120, 124, 137, 139, 142, 143, 146, 150, 169, 173, 177, 198, 204, 216, 217, 218, 231, 238, 245, and 247 in a first amino acid sequence represented by SEQ ID NO: 1, an amino acid residue different from the corresponding amino acid residue included in the first amino acid sequence.

Description

[Technical Field]

[0001] The present specification relates to a photoresponsive protein or a mutant thereof for color recognition and the use thereof. (CROSS-REFERENCE TO RELATED APPLICATIONS) This application is a related application to Japanese Patent Application No. 2020-44713, filed on March 13, 2020, and claims priority based on this Japanese application, and incorporates the entire contents of this Japanese application by reference. [Background technology]

[0002] Examples of eye diseases that can lead to blindness include retinitis pigmentosa and age-related macular degeneration. These diseases are thought to ultimately lead to blindness as a result of the degeneration or death of rod and cone cells, which are photoreceptor cells in the retina. Of these diseases, retinitis pigmentosa is a genetic disease, with over 100 causative genes reported. This means that the mechanisms leading to the degeneration and death of rod and cone cells vary widely from patient to patient, making it difficult to establish a clear clinical treatment. In fact, no treatment has yet been established. Age-related macular degeneration is also thought to have a genetic component, and several associated genes have been reported.

[0003] Light signals from the outside world are received by rod cells and cone cells on the retina and converted into electrical signals, which then reach retinal neurons, the optic nerve, and the visual cortex of the cerebral cortex, where they are perceived as images.

[0004] Rhodopsin, opsin, or color visual pigments are responsible for converting light signals into electrical signals in rod cells and cone cells. Currently, research is being conducted on treatments for retinitis pigmentosa, such as by introducing a gene encoding channelrhodopsin 2 (ChR2) derived from the phototactic algae Chlamydomonas into the remaining retinal ganglion cells, thereby endowing these cells with light-receiving ability and restoring the patient's visual function (Patent Document 1, Patent Document 2). [Prior art documents] [Patent documents]

[0005] [Patent Document 1] International Publication No. 2007 / 131180 [Patent Document 2] International Publication No. 2012 / 032103 Summary of the Invention [Problem to be solved by the invention]

[0006] When ChR2 senses light, Na + Ya Ca 2+ ChR2 is a photoreceptor cation channel (photoreceptor protein) that transports (transports) cations from the outside of the cell into the inside, or from the inside of the cell to the outside. In other words, ChR2 is a protein that can cause a change in membrane potential when the protein molecule alone senses light.

[0007] However, even algae-derived ChR2 is not yet sufficient to restore visual function in patients. For example, in order to restore visual function, it is also important to be able to recognize external information, which is naturally chromatic, more appropriately, along with color information.

[0008] The present specification provides light-responsive proteins and their uses for color recognition in vision. [Means for solving the problem]

[0009] The present inventors have discovered that a mutant of channelrhodopsin, a type of cation channel derived from the cryptoalgae Guillardia theta (G. Theta), has advantageous properties for color recognition. Based on this finding, the present specification provides the following means.

[0010] [1] The following position in the first amino acid sequence represented by SEQ ID NO: 1: A protein having channel activity, which comprises an amino acid residue different from an amino acid residue present in the first amino acid sequence at one or more positions selected from the group consisting of positions 53, 83, 87, 117, 120, 124, 137, 139, 142, 143, 146, 147, 150, 151, 169, 173, 177, 198, 204, 216, 217, 218, 231, 238, 245, and 247. [2] The protein according to [1], wherein the positions are one or more selected from the group consisting of positions 87, 117, 120, 124, 139, 142, 143, 146, 150, 169, 173, 177, 217, 218, 238, 245, and 247. [3] The protein according to [1], wherein the positions are one or more selected from the group consisting of positions 53, 83, 137, 146, 147, 151, 169, 177, 217, 218, and 247. [4] The protein according to [3], wherein the positions are one or more selected from the group consisting of positions 169, 177, 217, 218, and 247. [5] The protein according to [4], wherein the position is position 217. [6] The protein according to [3], wherein the positions are 147 and / or 151. [7] The protein according to [6], wherein the positions are positions 147 and 151. [8] The protein according to any one of [4] to [7], which has a maximum activity wavelength of less than 520 nm. [9] The protein according to [1], wherein the positions are one or more selected from the group consisting of positions 53, 83, 137, 146, and 218.

[10] The protein according to [9], wherein the position is position 146.

[11] The protein according to

[10] , wherein the positions are one or more selected from the group consisting of positions 150, 169, 177, and 218.

[12] The protein according to any one of [9] to

[11] , which has a maximum activity wavelength of 530 nm or longer.

[13] The protein according to [1] or [2], wherein the positions are one or more selected from the group consisting of positions 137, 146, 150, 177, 198, 238, 245, and 247.

[14] The protein according to

[13] , having a maximum activity wavelength of 520 nm or more and less than 530 nm.

[15] The protein according to [1], wherein the positions are one or more selected from the group consisting of positions 150, 169, 177, 218, and 247.

[16] The protein according to [1], wherein the positions are one or more selected from the group consisting of positions 87, 117, 120, 124, 139, 142, 143, 173, 204, 216, and 231.

[17] The protein according to any one of [1] to

[16] , further comprising a deletion, substitution or insertion of one or several amino acid residues.

[18] The protein according to any one of [1] to

[17] , wherein the protein has an amino acid substitution of any one of the following types at a position corresponding to the following position in the first amino acid sequence: [Table 1]

[19] The protein according to any one of [1] to

[18] , wherein the protein has an amino acid substitution of any one of the following types at a position corresponding to the following position in the first amino acid sequence: [Table 2]

[20] The protein described in any of [1] to

[19] , wherein a first ratio, which is the value corresponding to the channel activity at 440 nm to the value corresponding to the channel activity at the wavelength (λmax) at which the protein shows maximum channel activity, is 0.4 or more.

[21] The protein according to any one of [1] to

[20] , wherein a second ratio, which is the value corresponding to the channel activity at 600 nm to the value corresponding to the channel activity at the wavelength (λmax) at which the protein shows maximum channel activity, is 0.4 or more.

[22] The protein according to any one of [1] to

[21] , wherein the amino acid sequence of the protein has 90% or more identity with the first amino acid sequence.

[23] A method for improving or restoring photoresponsiveness for color recognition in the retina, using the protein according to any one of [1] to

[22] or a polynucleotide encoding said protein.

[24] A pharmaceutical composition for treating or preventing visual impairment, comprising the protein according to any one of [1] to

[22] or a polynucleotide encoding said protein.

[25] The pharmaceutical composition according to

[24] , wherein the visual disorder is selected from the group consisting of retinitis pigmentosa, age-related macular degeneration, diabetic retinopathy, retinal detachment, and color vision deficiency.

[26] A method for screening mutant proteins, comprising a step of evaluating the relationship between the wavelength of irradiated light and channel activity for a subject protein having an amino acid residue different from that in the first amino acid sequence at one or more positions in the first amino acid sequence represented by sequence number 1.

[27] A method for using the protein according to any one of [1] to

[22] or a polynucleotide encoding said protein to induce firing in muscle cells, cerebral epithelial neurons, or hippocampal neurons by irradiating them with light. [Brief explanation of the drawings]

[0011] [Figure 1] This figure shows the maximum activation wavelength (λmax act) of visual pigments in human rod cells and cone cells. It shows the maximum activation wavelength (498 nm) of the visual pigment (R) in rod cells and the maximum activation wavelengths (420 nm, 534 nm, and 564 nm) of the three visual pigments (S, M, L) in cone cells. [Figure 2](A) shows the maximum activity wavelength (λmax act) of the mutants obtained in the examples, (B) shows the activity spectra of the Gt_CCR4 wild type (WT), Y217F mutant, and Y146A / P218T mutant, and (C) shows the activity spectra of the WT, Y217F mutant, and T147C / G151A / Y217F mutant. [Figure 3] FIG. 1 shows the results of comparing the channel activity of mutants obtained in the examples when irradiated with light at a wavelength of 530 nm. [Figure 4] This figure shows the results of comparing the channel activity of the mutants obtained in the examples when irradiated with light at a wavelength of 530 nm, as well as the ratio of the channel activity at λmax of each mutant to the channel activity at 440 nm, and the ratio of the channel activity at λmax of each mutant to the channel activity at 660 nm, for the mutants obtained in the examples. [Figure 5] Figure 1 shows a schematic diagram of a light-gated ion channel (A), measurement of channel current upon light irradiation (B), components of the channel current (C), and channel current (D) and channel open rate (E) in ND7 / 23 cells expressing ChR2 and GtCCR4, respectively. [Figure 6] FIG. 1 shows the results of measuring channel current in ND7 / 23 cells expressing a single mutant having a single mutation in GtCCR4. [Figure 7] (A) shows the results of measuring channel activity in ND7 / 23 cells expressing wild-type ChR2; (B) shows the results of measuring channel activity in ND7 / 23 cells expressing wild-type GtCCR4; (C) shows the results of measuring channel activity in ND7 / 23 cells expressing a single mutant with the V83A mutation in GtCCR4; (D) shows the results of measuring channel activity in ND7 / 23 cells expressing a single mutant with the L146A mutation in GtCCR4; and (E, F) show the results of measuring channel activity in ND7 / 23 cells expressing a single mutant with a single mutation that has improved activity compared to wild-type GtCCR4. [Figure 8]FIG. 1 shows channel current (A) and channel open rate (B) in ND7 / 23 cells expressing a double mutant with two mutations in GtCCR4. [Figure 9] FIG. 10 shows the results of measuring channel current in ND7 / 23 cells expressing other single mutants having a single mutation in GtCCR4. [Figure 10] FIG. 1 shows the results of a light stimulation experiment on neural activity in primary cultured rat cerebral epithelial cells (A and B) and a comparison of light intensity dependence (C). DETAILED DESCRIPTION OF THE INVENTION

[0012] The present disclosure relates to a photoresponsive protein having photoresponsiveness for color recognition. This is based on the findings that the present inventors have discovered that GtCCR4 (hereinafter also referred to as "protein 1"), a cationic light-responsive protein derived from G. Theta and consisting of the amino acid sequence set forth in SEQ ID NO: 1, exhibits superior photoresponsiveness compared to the previously known ChR2 derived from Chlamydomonas, and that mutants obtained by introducing mutations into protein 1 have maximum active wavelengths lower and longer than the maximum active wavelength of approximately 520 nm at which protein 1 exhibits maximum channel activity, and have activity spectra different from those of protein 1.

[0013] For example, as shown in the upper part of Figure 1, human rod cells and cone cells have rod visual pigments with maximum activity wavelengths of 498 nm and cone visual pigments with maximum activity wavelengths of 420 nm, 534 nm, and 564 nm, respectively, in their cell membranes. These three types of cone visual pigments enable us to recognize the colors of information from the outside world.

[0014] A mutant of the first protein disclosed herein (hereinafter also referred to as the present mutant) can have maximum channel activity at one or more wavelengths different from that of the first protein, depending on the mutation mode. In other words, the present mutant can have a maximum active wavelength or activity spectrum different from that of the first protein due to the mutation. By expressing the present mutant on the cell membrane of the retina, such as a ganglion cell or bipolar cell, the cell is endowed with the ion permeability (transportability) specific to the mutant depending on the wavelength of light incident on the cell membrane, and channel activity based on this is exhibited.

[0015] For example, cells expressing one or more of the present mutants in their cell membranes can be used alone, or such cells expressing the present mutant can be used in combination with one or more other mutant-expressing cells expressing proteins, such as the first protein, that have a different maximum active wavelength or activity spectrum from the present mutant in their cell membranes. Examples of one or more cells expressing the present mutant or other mutants include cells selected from ganglion cells, bipolar cells, amacrine cells, and horizontal cells. When such cells expressing the present mutant or other mutants in addition to the present mutant-expressing cells are provided in the retina, these cells can exhibit channel activity in response to incident light. This allows the retina to acquire a photoresponsive ability that can ultimately contribute to providing or improving color recognition in the brain.

[0016] This protein, which is the origin of this mutant, has excellent expression levels on the cell membranes of retina cells such as ganglion cells and bipolar cells, as well as excellent ion permeability (transportability) and channel opening rate of the channel composed of this protein. Therefore, this mutant also exhibits photoresponsive ability for color recognition with high sensitivity.

[0017] By introducing a polynucleotide such as DNA encoding this mutant into retinal cells such as ganglion cells and bipolar cells using a viral vector, the mutant can be expressed in the cell membrane of the retina, such as ganglion cells and bipolar cells, and can exhibit highly sensitive light response ability for color recognition.

[0018] Therefore, the variant or a nucleotide encoding the variant is useful for restoring vision in patients with ocular diseases that cause degeneration of rod cells or cone cells, such as retinal degenerative diseases and color vision disorders.

[0019] As used herein, "maximum active wavelength" refers to the wavelength (λmax act) of irradiated light at which a photoresponsive protein exhibits maximum channel activity. Additionally, as used herein, "activity spectrum" refers to the spectrum of channel activity exhibited by a photoresponsive protein having photoresponsive channel activity in the wavelength range of approximately 400 nm to 700 nm.

[0020] Representative and non-limiting specific examples of the present disclosure will be described in detail below, with appropriate reference to the drawings. This detailed description is intended simply to provide those skilled in the art with details for implementing preferred examples of the present disclosure, and is not intended to limit the scope of the present disclosure. Furthermore, the additional features and inventions disclosed below can be used separately from or together with other features and disclosed inventions to provide further improved "photoresponsive proteins for color recognition and uses thereof."

[0021] Furthermore, the combinations of features and steps disclosed in the following detailed description are not essential to implementing the present disclosure in its broadest sense, but are described solely to specifically illustrate exemplary embodiments of the present disclosure. Furthermore, the various features of the exemplary embodiments described above and below, and the various features of those described in the independent and dependent claims, do not necessarily have to be combined in the exact embodiments described herein, or in the exact order listed, to provide additional and useful embodiments of the present disclosure.

[0022] All features described in this specification and / or claims are intended to be disclosed individually and independently of one another as limitations on the original disclosure and claimed particulars, apart from any configuration of features described in the examples and / or claims. Furthermore, all numerical ranges and group or aggregate descriptions are intended to disclose intermediate configurations thereof as limitations on the original disclosure and claimed particulars.

[0023] (Mutant of the first protein) (1) First protein The first protein has the amino acid sequence shown in SEQ ID NO: 1 and is characterized by this amino acid sequence. The first protein is a protein consisting of 367 amino acid residues with a DTD (aspartic acid-threonine-aspartic acid) motif corresponding to the DTD motif of bacteriorhodopsin, a light-driven proton pump derived from halophilic archaea, and has been found to have low amino acid sequence identity with previously identified cation channelrhodopsins 1 to 3 derived from G. Theta (33%, 34%, and 39%, respectively) (Biophysics and Physicobiology, Vol. 14, pp. 57-66 (2017)). As previously mentioned, the first protein is derived from G. Theta and has been identified by the present inventors as a light-responsive cation channel protein (ibid.). The first protein is a protein that transports Na + and H + (ibid.)

[0024] The DTD motif in the first protein is located at positions D116, T120, and D127. The DTD motif in bacteriorhodopsin, a light-driven proton pump, is located at positions D85, T89, and D96 in the amino acid sequence. The first protein also has this DTD motif, as well as positions K113, D242, and K246. In bacteriorhodopsin, these amino acids correspond to positions R82, D212, and K216.

[0025] Based on its amino acid sequence, etc., the first protein is considered to be an ion channel protein having a seven-transmembrane structure with seven helices. The first protein can have a region (extracellular region) that is located at or near a site exposed to the extracellular side from the plasma membrane and that constitutes the extracellular region of the ion channel, a region (gate region) that is located closer to the interior of the plasma membrane and that constitutes the permeation pathway of the ion channel, and a region (cytoplasmic region) that is located on the cytoplasmic side of the plasma membrane and that constitutes the cytoplasmic region of the ion channel.

[0026] According to the present inventors, these regions in the first protein can be assigned, for example, to the following amino acid residue positions or regions: Because the first protein has a DTD motif, it is believed that there is a correlation in amino acid sequence and molecular structure with the aforementioned bacteriorhodopsin (a light-driven proton pump derived from halophilic archaea), which also has a DTD motif. Therefore, the ion permeation pathway within the first protein is predicted based on the known molecular structure of bacteriorhodopsin. Unless otherwise specified, in this specification, the positions of amino acid residues shown in the first protein refer to the positions in the amino acid sequence set forth in SEQ ID NO: 1.

[0027] (Extracellular region) In the first protein, the extracellular region is thought to be the following amino acid sequence regions: positions 1 to 41, positions 92 to 115, positions 147 to 165, and positions 222 to 237.

[0028] (cytoplasmic region) In the first protein, the cytoplasmic region is predicted to be the following amino acid sequence regions: positions 51 to 82, positions 125 to 138, positions 174 to 213, and positions 250 to 367.

[0029] (Gate area) In addition, in the first protein, the gate regions are estimated to be the following amino acid sequence regions: positions 42 to 50, 83 to 91, 116 to 124, 139 to 146, 166 to 173, 214 to 221, and 238 to 249.

[0030] (channel activity) The first protein is a protein with photoresponsive cation channel activity that is also a light-driven proton pump. When expressed on a cell membrane, for example, when irradiated with green light of 530 nm, it pumps protons (H + ) and cations (Na + ) permeates the cell membrane, generating a channel current. The activity of generating a channel current upon light irradiation is generally referred to as channel activity.

[0031] The channel activity of the first protein can be measured, for example, by expressing the first protein in the cell membrane of an appropriate mammalian cell (preferably one that does not also have a light-responsive cation channel or a light-driven proton pump) and then irradiating the cell for a certain period of time with light of a certain intensity having a maximum absorption wavelength of approximately 530 nm, using a whole-cell recording patch clamp method. The whole-cell recording patch clamp method is a method for measuring the total amount of ions passing through the cell membrane of a single cell as charge transfer (current). The amount of channel current measured by this method can be used as the channel activity.

[0032] Specifically, the following method is exemplified: DNA encoding the amino acid sequence of the first protein (using mammalian codon usage as necessary) is synthesized, and then incorporated into a vector plasmid for mammalian cells such as peGFP-N1 to create a plasmid for introduction so that eGFP is tagged to the C-terminus of the first protein and sufficient amounts of the first protein are expressed. This plasmid is then introduced into mammalian cells such as ND / 723 cells using lipofection to transform them. Expression of the first protein on the cell membrane of the introduced cells can be confirmed by eGFP fluorescence.

[0033] For cells in which the first protein has been transiently expressed in the cell membrane in this way, electrophysiological measurements such as whole-cell recording patch clamp method are performed, for example, within 24 to 48 hours after introduction, while the first protein is stably expressed.

[0034] The measurement conditions for electrophysiological measurements using the whole cell recording patch clamp method or the like are not particularly limited, but for example, the following conditions can be used.

[0035] [Table 3]

[0036] In electrophysiological measurements such as whole-cell recording patch clamping, for example, the peak maximum current (Ip) generated when a cell is irradiated with light under the above conditions and the current (Is) that decays to a certain level during light irradiation can be used as the channel current value of the first protein. For example, either Ip or Is, or both, can be used as the channel activity of the first protein. Furthermore, the value obtained by dividing Is by Ip can be used as the channel open rate, which will be described later.

[0037] The present mutant may comprise an amino acid residue different from that in the first protein at one or more positions corresponding to the first amino acid sequence of the first protein. The present mutant may be a protein obtained by artificially modifying the first protein, or a naturally occurring protein or a modified version thereof. The present mutant also applies, for example, to proteins having an amino acid sequence that shares a certain level of identity with the first amino acid sequence. That is, the present mutant may be an artificial protein, or a naturally occurring protein or a modified version thereof, such as a cation ion channel derived from the same algae as the first protein, or from closely related algae or microorganisms, as long as it shares a certain level of identity with the first protein. Identity will be explained below.

[0038] Here, the "positions corresponding to one or more positions in the first amino acid sequence" refer to the positions of one or more amino acid residues in the mutant that correspond to one or more positions in the first amino acid sequence when the amino acid sequence of the mutant is aligned with the first amino acid sequence. Here, alignment is synonymous with the alignment used in determining the identity of amino acid sequences and nucleotide sequences, as described below. For example, positions in the mutant that correspond to positions in the first amino acid sequence can be identified by aligning sequences using, for example, default parameters, using a known amino acid sequence alignment program such as BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) or Pfam (http: / / pfam.xfam.org / ).

[0039] The mutant can have a maximum active wavelength or activity spectrum different from that of the first protein. The maximum active wavelength of the first protein is approximately 520 nm. The maximum active wavelength of the activity spectrum can be determined by measuring the channel activity of the first protein by irradiating the channel with light having a wavelength in the range of 400 to 700 nm, e.g., 410 to 650 nm, with light of a certain wavelength, e.g., 10 nm, increasing from the short wavelength side to the long wavelength side, measuring the current response to each light irradiation, and determining the wavelength of light at which the maximum current value is obtained as the maximum active wavelength. The activity spectrum can be calculated from the current values obtained when the wavelength of the irradiated light is sequentially shifted from the short wavelength side to the long wavelength side. The light intensity during activity spectrum measurement can be, for example, 0.1 mW / mm 2 The light irradiation time can be set to 400 msec and the recording time can be set to 1 sec.

[0040] Various mutation sites in the first amino acid sequence for constructing this mutant are described below.

[0041] The position of the mutation contained in the present variant that contributes to color recognition in the retina is, for example, the following site in the first amino acid sequence: 53rd, 83rd, 87th, 117th, 120th, 124th, 137th, 139th, 142nd, 143rd, 146th, 150th, 169th, 173rd, 177th, 198th, 204th, 216th, 217th, 218th, 231st, 238th, 245th and 247th By providing amino acid substitution mutations at these positions, it is possible to shift the maximum activity wavelength to a shorter or longer wavelength side than the maximum activity wavelength of about 520 nm of the first protein, or to impart an activity spectrum different from that of the first protein.

[0042] Further, positions 147 and 151 in the first amino acid sequence are also included.

[0043] The substitution patterns at each mutation site are, for example, as follows: 53rd place: L53A, L53Y, L53N, L53M, L53L, L53I, L53C 83rd place: V83A, V83L, V83I, V83N, V83T, V83D, V83K 87th place: A87S, A787K, A87S 117th place: Y117A, Y117D, Y117F, Y117N 120th place:T120S 124th place: L124Q, L124C, L124T, L124A 137th place: K137A, K137E, K137R, K137H, K137D, K137C 139th place: T139A, A139D 142nd place:L142A 143rd place:F143A 146th place: L146A, L146M, L146I, L146V, L146Y, L146C 150th place:C150A 169th place:G169S 173rd place:F173Y, F173A 177th place:W177Y 198th place: K198A, K198R, K198H, K198D, K198C 204th place: K204A, K204E, K204R, K204H, K1204D, K204C 216th place: G216S, G216A, G216T, G216L, G216C, G216Y 217th place: Y217F, Y217N 218th place: P218A, P218T, P218S, P218G, P218C, P218H, P218N, P218V, P218D 231st place: Q231L, Q231A, Q231D, Q231E, Q231T 238th place:T238V 245th place: A245M 247th place: S247A, S247M

[0044] 147th place:T147C 151st place:G151A

[0045] (Mutation mode 1) Among these mutation sites, for example, one or more selected from the group consisting of positions 53, 83, 137, 146, 169, 177, 217, 218, and 247 tend to favor wavelength shifts and / or improved channel activity. For example, positions 169, 177, 217, 218, and 247 are advantageous for mutants with a λmax act of less than 520 nm, for example, 515 nm or less, while positions 53, 83, 137, 146, and 218 are advantageous for mutants with a λmax act of 530 nm or more.

[0046] For example, a mutation at position 53 tends to shift the maximum activity wavelength to a longer wavelength. Examples of such a substitution at position 53 include L53A in addition to L53N.

[0047] For example, a mutation at position 83 tends to shift the maximum active wavelength to a longer wavelength. Furthermore, such a mutation tends to improve overall channel activity. Examples of such a substitution at position 83 include V83A (λmax act: 540 nm) and V83T.

[0048] For example, a mutation at position 137 tends to shift the maximum active wavelength to a longer wavelength. Such a mutation also tends to improve overall channel activity. An example of a substitution at position 137 is K137A (λmax act: 530 nm).

[0049] For example, a mutation at position 146 tends to shift the maximum active wavelength to a longer wavelength. Such a mutation also tends to improve overall channel activity. An example of a substitution at position 146 is L146A (λmax act: 530 nm).

[0050] For example, a mutation at position 169 tends to shift the maximum active wavelength to a shorter wavelength side. An example of a substitution at position 169 is G169S (λmax act: 510 nm).

[0051] For example, a mutation at position 177 tends to shift the maximum active wavelength to a shorter wavelength side. An example of a substitution at position 177 is W177Y (λmax act: 510 nm).

[0052] For example, a mutation at position 217 tends to shift the maximum activity wavelength to a shorter wavelength. Examples of substitution at position 217 include Y217F (λmax act: 475 nm) and Y217N.

[0053] For example, mutations at position 218 tend to shift the maximum active wavelength toward longer and shorter wavelengths. Furthermore, such mutations tend to improve overall channel activity. Examples of substitutions at position 218 include P218T (λmax act: 510 nm), P218A (λmax act: 530 nm), as well as P218S, P218G, and P218.

[0054] For example, mutations at position 247 tend to shift the maximum active wavelength to either shorter or longer wavelengths. Furthermore, such mutations tend to improve overall channel activity. Examples of substitutions at position 247 include S247A (λmax act: 510 nm) and S247M (λmax act: 530 nm).

[0055] (Mutation mode 2) Furthermore, among the above mutation sites, for example, one or more mutations selected from the group consisting of positions 137, 146, 150, 177, 198, 245 and 247 have a λmax act of approximately 520 nm or more and less than 530 nm, but are advantageous in that they have high channel activity and contribute to improving channel activity when used as an additive mutant with other mutations.

[0056] An example of a mutation at position 137 is K137A, an example of a mutation at position 146 is L146A, an example of a mutation at position 150 is C150A, an example of a mutation at position 177 is W177Y, an example of a mutation at position 198 is K198A, an example of a mutation at position 245 is A245M, and an example of a mutation at position 247 is S247A, S247M.

[0057] (Mutation mode 3) Among the above mutation sites, for example, one or more selected from the group consisting of positions 150, 169, 177, 218, and 247 have been discovered "for the first time" as positions of amino acid residues that interact with retinal in the first protein or that are located in the vicinity thereof, or that affect the configuration of amino acid residues that interact with retinal, and are advantageous for obtaining a maximum activity wavelength or activity spectrum that is different from that of the first protein.

[0058] An example of a mutation at position 150 is C150A, an example of a mutation at position 169 is G169S, an example of a mutation at position 177 is W177Y, an example of a mutation at position 198 is K198A, an example of a mutation at position 218 is P218A, P218S, P218G, P218T, and an example of a mutation at position 247 is S247A, S247M.

[0059] (Mutation mode 4) Of the above mutation sites, for example, one or more selected from the group consisting of positions 87, 117, 120, 124, 139, 142, 143, 173, 204, 216, and 231 are thought to be amino acid residues in or near the gate region of the first protein that interacts with retinal, and are advantageous for obtaining a maximum activity wavelength or activity spectrum different from that of the first protein.

[0060] Mutations at position 87 include, for example, A87S, A787K, and A87S; mutations at position 117 include, for example, Y117A, Y117D, Y117F, and Y117N; mutations at position 120 include, for example, T120S; mutations at position 124 include, for example, L124C, L124T, and L124A; mutations at position 139 include, for example, T139A and T139D; mutations at position 142 include, for example, L142A; mutations at position 143 include, for example, F143A; mutations at position 173 include, for example, F173Y and F173A; mutations at position 204 include, for example, K204A and K204E; mutations at position 216 include, for example, G216S; and mutations at position 231 include, for example, Q231L.

[0061] For example, a mutation at position 117 may contribute to a shift in λmax act to shorter wavelengths below 520 nm. Examples of such mutations include Y117A, Y117F, and Y117N.

[0062] (Mutation 5) Among the above mutations, position 147 is located in the extracellular region near the gate region. Such a mutation may contribute to a shift in λmax act to less than 520 nm. It may also enhance channel activity itself. It may also contribute to improved channel activity when combined with other mutations in the gate region that contribute to a wavelength shift to λmax act to less than 520 nm. An example of a substitution at position 147 is T147C.

[0063] Furthermore, position 151 is located in the extracellular domain near the gate region. Such a mutation may contribute to a λmax act of less than 520 nm. It may also enhance the channel activity itself. It may also contribute to improving channel activity when used as an additive mutant with other mutations in the gate region that contribute to a wavelength shift to a λmax act of less than 520 nm. An example of a substitution at position 151 is G151A.

[0064] For example, a combination of mutations at positions 147 and 151 can contribute to a shift in λmax act to shorter wavelengths below 520 nm, as well as to an increase in channel activity.

[0065] Alternatively, mutations at positions 147 and / or 151 in the extracellular region near the gate region can be combined with mutations at position 217 in the gate region that tend to shift λmax act to shorter wavelengths. This additive mutant may be able to further shift λmax act at position 217 to shorter wavelengths. For example, an additive mutant combining T147C and G151A with Y217F can shift λmax act further beyond the 475 nm maximum activity wavelength of Y217F.

[0066] In consideration of channel activity, the mutant can have mutations selected from the gating region, for example, positions 83, 87, 146, and 216. Furthermore, mutations at positions 53, 76, 137, 198, and / or 204 in the cytoplasmic region can also be appropriately combined. Furthermore, mutations at positions 230 and / or 231 in the extracellular region can also be appropriately combined.

[0067] In a preferred embodiment of the present mutant, at least one of the mutation sites is selected from the group consisting of positions 87, 117, 120, 124, 139, 142, 143, 146, 150, 169, 173, 177, 217, 218, 238, 245, and 247. The amino acid substitutions at these mutation sites are as described above.

[0068] For the above reasons, it may be advantageous for the mutant to have an amino acid substitution mutation at the mutation site below, or to adopt the following mutation mode at the mutation site.

[0069] [Table 4]

[0070] [Table 5]

[0071] In some cases, it is preferable that at least one mutation in the present mutant is selected from the mutation modes shown in Table 4 other than L53N, V83A, K137A, and K198A. In some cases, it is preferable that at least one mutation in the present mutant is selected from the mutation modes shown in Table 5 other than L53A, K204A, G549S, and Q231L.

[0072] Furthermore, the mutant may have substitution mutations of 1 to 30 or less, for example, 25 or less, for example, 20 or less, for example, 15 or less, for example, 10 or less, or for example, a few or less amino acid residues at positions other than those described above, or may further have substitution mutations, deletion mutations and / or insertion mutations of 1 to 30 or less, for example, 25 or less, for example, 20 or less, for example, 15 or less, for example, 10 or less, or for example, a few or less amino acid residues.

[0073] In addition to the mutations for color recognition described above, the mutant may also have the following mutations in the extracellular region, cytoplasmic region, and gate region. These mutation sites and mutation modes are based on the viewpoint of improving channel activity and / or aperture ratio, but may overlap with the mutation sites and mutation modes for color recognition.

[0074] (mutation in the extracellular domain) As described above, the extracellular domain is considered to be positions 1 to 41, 92 to 115, 147 to 165, and 222 to 237, and examples of positions for mutation within these amino acid domains include positions 39, 94, 98, 102, 110, 113, 114, 162, 224, and 225. Other examples include positions 230, 231, and 235. Substitution mutations include, for example, D39N, R94M, R94K, R94Q, H98A, D102N, N110L, K113A, K113N, Y114A, R162A, and S230E, and also include, for example, T224A, E225A, E225Q, Q231L, H235A, H235N, and H235M.

[0075] (Mutation in the cytoplasmic region) As described above, the cytoplasmic region is predicted to be at positions 51 to 82, 125 to 138, 174 to 213, and 250 to 367. Potential mutation positions within this amino acid region include, for example, positions 53, 61, 68, 74, 76, 80, 130, 137, 194, 195, and 198. Other possible mutation positions include positions 200, 204, 205, 209, 210, 253, and 254. Substitution mutations include, for example, K61A, R74A, E76Q, S80A, K137E, K137A, K198A, R200A, K204A, and K204E, and also include, for example, L53A, L53N, E68Q, W130A, E194Q, D195N, L205A, L209A, Y210F, L253N, L253S, L254N, and L254S.

[0076] (mutation in the gate region) As described above, the gate regions are estimated to be positions 42 to 50, 83 to 91, 116 to 124, 139 to 146, 166 to 173, 214 to 221, and 238 to 249. Potential mutation positions in this amino acid region include, for example, positions 46, 83, 84, 87, 90, 91, 116, 117, 120, 124, 139, 142, 143, 146, and 173. Other possible mutation positions include positions 214, 216, 217, 238, 242, and 245. Substitution mutations include, for example, L46A, V83A, V83T, V83D, V83K, N84P, N84K, A87S, A87N, A87K, T90A, Y91A, D116A, D116T, Y117A, T120S, L124C, L124T, and L124A, as well as T139A, T139D, L142A, F143A, L146A, F173A, F173Y, W214A, W214Y, G216S, Y217A, Y217F, Y217W, T238A, T238K, T238D, D242A and D242N, A245N, and A245S.

[0077] For example, such mutations include the substitution mutations shown in Table 6 below. Also included are the substitution mutations shown in Table 7. [Table 6]

[0078] [Table 7]

[0079] The mutant preferably comprises the DTD motif of the first protein. That is, it preferably comprises amino acid residues (D, T, and D, respectively) at positions corresponding to positions D116, T120, and D127 in the first amino acid sequence. Furthermore, the mutant preferably comprises, in addition to the DTD motif, one or more amino acid residues corresponding to positions K113, D242, and K246 in the first amino acid sequence.

[0080] The identity of the variant with the first amino acid sequence is not particularly limited, but may be, for example, 75% or more, for example, 80% or more, for example, 85% or more, for example, 90% or more, for example, 95% or more, for example, 97% or more, for example, 98% or more, for example, 99% or more, or for example, 99.5% or more. The similarity is, for example, 80% or more, for example, 85% or more, for example, 90% or more, for example, 95% or more, for example, 97% or more, for example, 98% or more, for example, 99% or more, or for example, 99.5% or more.

[0081] As used herein, identity or similarity, as known in the art, refers to the relationship between two or more proteins or two or more polynucleotides, as determined by comparing their sequences. In the art, "identity" refers to the degree of sequence invariance between amino acid sequences or polynucleotide sequences, as determined by alignment between amino acid sequences or polynucleotide sequences, or, in some cases, by alignment between stretches of such sequences. Similarly, similarity refers to the degree of relatedness between amino acid sequences or polynucleotide sequences, as determined by alignment between amino acid sequences or polynucleotide sequences, or, in some cases, by alignment between stretches of partial sequences. More specifically, it is determined by sequence identity and conservation (substitutions that maintain specific amino acid residues or physicochemical properties in a sequence). Similarity is also referred to as "similarity" in the BLAST sequence homology search results described below. Methods for determining identity and similarity are preferably designed to maximize the length of alignment between the compared sequences. Methods for determining identity and similarity are available as publicly available programs. For example, this can be determined using the BLAST (Basic Local Alignment Search Tool) program by Altschul et al. (e.g., Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ., J. Mol. Biol., 215: pp. 403-410 (1990), Altschul SF, Madden TL, Schaffer AA, Zhang J, Miller W, Lipman DJ., Nucleic Acids Res. 25: pp. 3389-3402 (1997)) or the alignment function of UniProtKB. The conditions for using software such as BLAST or UniProtKB are not particularly limited, but it is preferable to use the default values.

[0082] The amino acid sequence alignment can be determined by using an amino acid sequence alignment program (blastp) such as BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) with default parameters, for example.

[0083] (The maximum active wavelength of this mutant, λmax act, etc.) For example, as shown in Figure 1, the mutant can have various maximum activation wavelengths. Depending on the maximum activation wavelength λmax act of the mutant, it can be used as any of S cones, M cones, and L cones expressed in human cone cells. The maximum activation wavelength to substitute for each cone is set appropriately; for example, if λmax act is 400 nm or more and 515 nm or less, it can be used as, for example, an S cone, which has a sensitivity peak at short wavelengths in humans. For example, when the maximum activation wavelength λmax act of the mutant is 515 nm or more and 545 nm or less, it can be used as an M cone. For example, when the maximum activation wavelength λmax act is 540 nm or more and 600 nm or less, it can be used as an L cone.

[0084] Furthermore, the present mutant can be said to have a different activity spectrum from that of the first protein when the maximum activity wavelength is shifted to the shorter or longer wavelength side compared to that of the first protein. Furthermore, even if the present mutant has the same maximum activity wavelength as that of the first protein, it can also be said to have a different activity spectrum from that of the first protein when, for example, there is a shoulder peak near the peak of the activity spectrum or the peak of the activity spectrum of the first protein is sharper (the peak width is narrower).

[0085] For example, based on a first ratio, which is the ratio of the channel activity equivalent value at 440 nm to the channel activity equivalent value at the maximum activity wavelength of the present mutant, and a second ratio, which is the ratio of the channel activity equivalent value at 600 nm to the channel activity equivalent value at the maximum activity wavelength of the present mutant, it is possible to compare the activity spectra between the present mutants and between the present mutants and the first protein.

[0086] For example, the first protein has a first ratio of 0.3, a second ratio of about 0.18, a first ratio / second ratio of 1.67, and a second ratio / first ratio of 0.6. However, if the first ratio is, for example, about twice the second ratio or more, the maximum activity wavelength λmax act tends to be shifted to a shorter wavelength side than that of the first protein. If the first ratio is three or more times, for example, four or more times, greater than the second ratio, the maximum activity wavelength tends to be shifted even further to a shorter wavelength side. Furthermore, if the first ratio is, for example, 0.4 or more, for example, 0.5 or more, for example, 0.6 or more, for example, 0.7 or more, or for example, 0.8 or more, the maximum activity wavelength tends to be on the shorter wavelength side, and may also have a shoulder peak or the like on the shorter wavelength side of the maximum activity wavelength λmax act.

[0087] On the other hand, if the second ratio is, for example, 0.7 times or more, for example, 0.8 times or more, for example, 0.9 times or more, for example, 1.0 times or more, for example, 1.1 times or more, for example, 1.2 times or more, for example, 1.3 times or more, or for example, 1.4 times or more of the first ratio, the maximum activity wavelength λmax act tends to be shifted to a longer wavelength side than that of the first protein. Furthermore, for example, if the second ratio is, for example, 0.3 or more, for example, 0.4 or more, for example, 0.5 or more, for example, 0.6 or more, for example, 0.7 or more, for example, 0.8 or more, or for example, 0.9 or more, the maximum activity wavelength tends to be on the shorter wavelength side, and may also have a shoulder peak or the like on the longer wavelength side of the maximum activity wavelength λmax act.

[0088] The color response of the mutant can be characterized by the maximum active wavelength λmax act and the first and second ratios that define the activity spectrum.

[0089] This mutant has channel activity. The channel activity can be confirmed by the same method as described for the first protein. It is preferable that this mutant has a certain level of channel activity or higher. For example, when measured using the above-mentioned channel activity evaluation method and electrophysiological recording conditions (irradiation time 400 mS), the pA / pF is preferably 30 or higher, or, for example, 40 or higher.

[0090] Furthermore, this mutant has channel activity, and the channel activity at the maximum active wavelength, when measured according to the above-mentioned measurement method, is, for example, 30% or more, or, for example, 40% or more, or, for example, 50% or more, or, for example, 50% or more, or, for example, 60% or more, or, for example, 70% or more, or, for example, 80% or more, or, for example, 90% or more, or, for example, 100% or more of the channel activity pA / pF possessed by the first protein.

[0091] Furthermore, the present mutant preferably has a channel open rate of at least a certain level. For example, when measured using the above-mentioned channel activity evaluation method under electrophysiological recording conditions (irradiation time 400 mS), the channel open rate (Is / Ip) is preferably, for example, 0.7 or more, for example, 0.8 or more, for example, 0.85 or more, for example, 0.9 or more, for example, 0.95 or more, for example, 0.97 or more, for example, 0.98 or more, or for example, 0.99 or more.

[0092] The channel opening rate of this mutant can also be measured in the same manner as for protein 1. When the opening rate (Is / Ip) of the first protein is taken as 100%, the channel opening rate of this mutant is not particularly limited, and may be, for example, 30% of that of the first protein, or for example, 40% or more, or for example, 50% or more, or for example, 50% or more, or for example, 60% or more, or for example, 70% or more, or for example, 80% or more, or for example, 90% or more, or for example, 100% or more.

[0093] Those skilled in the art can create and evaluate various mutants and additives based on the mutation positions and suitable substitution examples of the mutant disclosed in this specification, and obtain the mutant having the intended maximum active wavelength, activity spectrum, etc.

[0094] Those skilled in the art can, for example, fuse various proteins to the N-terminus or C-terminus of the first protein and the present mutant.

[0095] Those skilled in the art will understand that the mutant can be obtained, for example, by modifying DNA encoding the amino acid sequence of the first protein (SEQ ID NO: 2) by conventional mutagenesis, site-directed mutagenesis, molecular evolutionary techniques using error-prone PCR, or the like to obtain modified DNA, and then obtaining the modified DNA, etc. Methods for obtaining modified DNA include known methods such as the Kunkel method or the gapped duplex method, or methods equivalent thereto. For example, mutations can be introduced using various commercially available kits for mutagenesis that utilize site-directed mutagenesis methods.

[0096] For example, the mutant can be obtained by transforming a host such as P. pastoris with a DNA construct containing the modified DNA obtained in this manner, culturing the transformed cells according to conventional methods known to those skilled in the art, and recovering the mutant from the cultured cells or medium. For example, the mutant can be isolated using a combination of conventional purification techniques. Such techniques include ammonium sulfate fractionation, organic solvent treatment, centrifugation, ultrafiltration, various types of chromatography (e.g., gel filtration chromatography, ion exchange chromatography, affinity chromatography, hydrophobic interaction chromatography, etc.), high-performance liquid chromatography (HPLC), electrophoresis, etc.

[0097] Alternatively, modified DNA fused with DNA encoding a signal protein such as GFP can be introduced into mammalian neuronal cells such as ND7 / 23 cells, and expressed in the cell membrane to obtain the signal protein.

[0098] (Polynucleotide) The polynucleotide disclosed herein (hereinafter also simply referred to as the present polynucleotide) can encode the amino acid sequence of the present mutant. Such polynucleotides can take various forms, but the coding region for the amino acid sequence is DNA or RNA, typically DNA.

[0099] The polynucleotide may be in the form of a DNA fragment or RNA fragment, or may be in any known form suitable for transformation, such as a plasmid or vector.

[0100] The present polynucleotide can be obtained by artificially synthesizing the DNA for obtaining the present mutant, or, as described above, can be obtained as DNA based on the above-described method for obtaining a mutant.

[0101] (vector) The vector disclosed herein (hereinafter also referred to as the present vector) can comprise the present polynucleotide. The purpose of the present vector is to express the present mutant in a host cell. The expression vector can take various forms depending on the type of cell to be transformed, the purpose, etc.

[0102] The polynucleotide may be modified, for example, by adding appropriate regulatory and / or targeting sequences and / or adapting the coding sequence to the preferred codon usage of the selected host. For example, the targeting sequence may encode an N- or C-terminal extension that targets the light-induced ion channel to a specific site or compartment within the cell, such as the cell membrane, synapse, post-synaptic site, axon hillock, or endoplasmic reticulum. Those skilled in the art can easily construct such vectors based on the techniques known at the time of filing this application.

[0103] Methods for obtaining vectors for expressing the mutants and their components are well known to those skilled in the art in fields using GFP and other fields of genetic engineering, and can be carried out by those skilled in the art with appropriate reference to, for example, T. Maniatis, J. Sambrook et al.'s Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, 1982, 1989, 2001.

[0104] When the vectors disclosed in the present specification are used, for example, to restore the light responsiveness of retinal nerve cells for color recognition and to improve or restore vision (color vision), the following aspects are applicable.

[0105] The vector may be suitable for gene therapy of ocular diseases. In particular, it may be used for viral-mediated gene transfer. "Viral-mediated gene transfer" means that the vector is packaged in a virus and can then be delivered to a target site or cell. Examples of viruses suitable for gene therapy include retroviruses, adenoviruses, adeno-associated viruses, lentiviruses, poxviruses, alphaviruses, rabies viruses, Semliki Forest viruses, and herpes viruses. Gene therapy also encompasses non-viral methods, such as the application of naked DNA, lipoplexes and polyplexes, and dendrimers.

[0106] The vectors used for the treatment of ocular diseases include known vectors already used to restore visual function by introducing genes encoding therapeutic proteins, such as the AAV-2 viral vector, and promoters such as the CAG promoter, the human gap junction protein (connexin-36) promoter (Greenberg KP et al., 2007, In vivo Transgene Expression in ON-Type Retinal Ganglion Cells: Applications to Retinal Disease. ARVO abstract, 2007), and the mGluR6 promoter.

[0107] Cell-specific promoters can be used to target specific types of retinal neurons. A promoter that can target rod bipolar cells is the Pcp2 (L7) promoter (Tomomura, M et al., 2001, Eur J Neurosci. 14:57-63). The length of the active promoter is preferably less than 2.5 Kb so that it can be packaged into an AAV viral cassette.

[0108] (Transformation of target cells and transformed cells) The transformed cells disclosed herein (hereinafter also referred to as "transformed cells") harbor the polynucleotides in a manner that allows them to express the mutants. The transformed cells can be obtained by introducing the vectors described above or the polynucleotides in the form of naked DNA into target cells. Methods for introducing the polynucleotides into target cells include various conventionally known methods, such as the calcium phosphate method, transformation method, transfection method, conjugation method, protoplast method, electroporation method, lipofection method, lithium acetate method, and other methods.

[0109] Transformed cells can also be provided by introducing the present nucleotide into cells, for example, using a virus as described above. Depending on the production method and application, transformed cells may be ex vivo cells, in vivo cells, or cells produced ex vivo and transplanted into the body. Target cells as transformed cells will be described later.

[0110] (Use of the Protein, Polynucleotide, Vector, and Transformed Cell for Regenerating Vision, etc.) The present protein, the present polynucleotide, the present vector, and the present transformed cell (hereinafter also referred to as the present protein, etc.) can be used to improve visual disorders, including color vision deficiencies, or to restore visual function. That is, all of them can be used in research for the prevention or treatment of eye diseases and in optogenetic applications. Although not particularly limited, by expressing the present mutant in specific retinal cells or non-retinal cells such as nerve cells near the retina through gene therapy, the light responsiveness of the retina can be improved or restored. By imparting light responsiveness to the cells, vision can be improved or restored.

[0111] As used herein, examples of visual disorders or eye diseases include retinitis pigmentosa, age-related macular degeneration, retinal detachment, diabetic retinopathy, retinal vein occlusion, glaucoma, and color vision disorders, preferably retinitis pigmentosa or age-related macular degeneration. As used herein, treatment refers to improving or restoring the light responsiveness of neurons for color recognition in a state in which retinal function has been lost due to cell degeneration, death, or loss, thereby improving or restoring visual function, such as color vision, or inhibiting the progression of symptoms. As used herein, prevention refers to improving or restoring the light responsiveness of neurons, thereby preventing functional loss or delaying the onset of visual disorders, in situations in which the likelihood of cell degeneration, death, or loss is high and the risk of developing visual disorders is high. The "medicament for treating or preventing visual disorders, comprising a protein or a polynucleotide encoding the protein" disclosed herein includes those used for such gene therapy. For example, the pharmaceutical may be provided in the form of a vector for expressing the protein in target tissue. In this case, it is preferable to use an expression vector that has excellent transfection efficiency into cells, maintenance of replication in the cells, stability, expression efficiency, etc. Examples of such vectors include, but are not limited to, viral vectors such as adeno-associated virus vectors, retrovirus vectors, and lentivirus vectors, (autonomously replicating) plasmids, transposons, etc. The protein expression vector of the present invention can be produced according to the methods described, for example, in Tomita H et al., Invest Ophthalmol Vis Sci. 2007 Aug;48(8):3821-6; and Sugano E et al., Invest Ophthalmol Vis Sci. 2005 Sep;46(9):3341-8, and can be introduced into cells of target tissues, etc. The present mutant can also be used for research purposes such as visual regeneration or optogenetics.

[0112] The vectors intended for the treatment of ocular diseases, such as restoring vision, can be configured to target, for example, all types of ganglion cells (both ON and OFF ganglion cells) or all types of bipolar cells (rod bipolar cells and ON and OFF cone bipolar cells).

[0113] Therefore, the present specification provides a pharmaceutical composition comprising the present mutant for treating or preventing visual disorders, including, but not limited to, retinitis pigmentosa, age-related macular degeneration, retinal detachment, diabetic retinopathy, retinal vein occlusion, glaucoma, and color vision disorders.

[0114] Gene therapy using DNA encoding a photoresponsive protein is known, and the present protein can be applied to gene therapy for eye diseases or research purposes using similar techniques or methods similar to these.

[0115] (Use of this mutant in optogenetics) This mutant is also useful for optogenetics research into various neural pathways and for the treatment of neurological disorders. Generally, there is a potential difference (voltage difference) between the inside and outside of a neuron. Under normal (inhibited) conditions, the inside of the cell is approximately -70mV to -80mV compared to the outside of the cell. This state is called hyperpolarization. Neuronal activation (or firing or excitation) occurs when the potential difference between the inside and outside of the cell membrane rises to -40mV to -20mV (called depolarization), triggering activation of voltage-gated sodium channels. Because the first protein is a light-responsive cation channel, when expressed in the neuronal membrane, it generates a channel current by allowing cations to pass through in response to light irradiation. This depolarizes the cell membrane, resulting in neuronal activation (firing or excitation).

[0116] Therefore, for example, neurons as target cells are transformed using this vector or a virus incorporating this vector, and this mutant is expressed in the target cells. In this way, the transformed neurons generate channel currents when irradiated with light. By preparing such transformed neurons ex vivo and transplanting them into a living body, or by transforming neurons in vivo with this vector, a neural pathway that activates in response to external light irradiation can be constructed in the living body. In particular, this mutant, which has a maximum active wavelength λmax act on the long wavelength side, is suitable for optogenetic applications due to its high tissue penetration.

[0117] Therefore, a method of using the proteins disclosed herein or polynucleotides encoding the proteins to induce firing in muscle cells, cerebral epithelial neurons, or hippocampal neurons by irradiating them with light, such as blue light (430 to 440 nm), is presented.

[0118] (target cell) Target cells for transformation include, for example, yeasts such as Saccharomyces cerevisiae, Schizosaccharomyces Pombe or Pichia pastoris.

[0119] Other target cells include mammalian cells or insect cells, such as episomal vectors for transient expression in melanoma cells (e.g., BLM cell line), COS cells (produced by infection of "African green monkey kidney CV1" cells), HEK cells ("human embryonic kidney cells" e.g., HEK293 cells), BHK cells ("baby hamster kidney cells"), or CHO cells ("Chinese hamster ovary cells"), myeloma cells, or MDCK cells ("Madine-Darby canine kidney cells"), and insect cells such as Sf9 insect cells infected with baculovirus.

[0120] From the viewpoint of visual regeneration to obtain light responsiveness, target cells include mammalian photoreceptor cells; retinal rod cells; retinal cone cells; retinal ganglion cells; bipolar neurons; ganglion cells; pseudounipolar neurons; multipolar neurons; pyramidal neurons; Purkinje cells; or granule cells.

[0121] In terms of optogenetics, target cells include, for example, animal cells, including mammalian cells. Mammalian cells include, for example, neuroblastoma cells (e.g., NG108-15 cells), melanoma cells (e.g., BLM cell line), COS cells (produced from "African green monkey kidney CV1 cells"), HEK cells ("human embryonic kidney cells," e.g., HEK293 cells), or BHK cells ("baby hamster kidney cells"), or CHO cells ("Chinese hamster ovary cells"), myeloma cells, or MDCK cells ("Madby-Darby canine kidney cells"). Also possible are Sf9 insect cells infected with baculovirus.

[0122] Mammalian cells can also be, for example, electrically excitable cells. For example, hippocampal cells, bipolar neurons, ganglion cells, pseudounipolar neurons, multipolar neurons, pyramidal neurons, Purkinje cells, or granule cells. Electrically excitable cells also include various nerve cells, such as sensory neurons that respond to touch, sound, light, and many other stimuli that affect cells in sensory organs, motor neurons that receive signals from the brain and spinal cord to cause muscle contraction or affect glands, and interneurons that connect nerve cells within the same region of the brain or spinal cord. Further examples include cardiac, smooth, and skeletal muscles.

[0123] Target cells are also, for example, cells, tissues, and organs within an individual animal, such as fertilized eggs, ES cells, and iPS cells that can ultimately produce an individual animal or a part thereof. Examples of individual animals include flies, nematodes, mice, rats, and monkeys. Furthermore, the results obtained in this manner include transformed animals or parts thereof.

[0124] The target cells to be transformed can be isolated (and genetically modified), maintained, and cultured at an appropriate temperature and gas mixture (typically 37°C, 5% CO2), optionally in a cell culture vessel known to those skilled in the art and illustrated for specific cell lines or cell types in the Examples. Culture conditions can vary for each cell type, and changes in conditions for a specific cell type can result in different phenotypes. Aside from temperature and gas mixture, the most common variable in cell culture systems is the growth medium. The composition for the growth medium can vary in pH, glucose concentration, growth factors, and the presence of other nutrients, among other things. Growth medium is commercially available or can be prepared according to compositions available from the American Type Culture Collection (ATCC). Growth factors used in supplemented media are often derived from animal blood, such as calf serum. Additionally, antibiotics can be added to the growth medium. Among the common operations performed on cultured cells are medium changes and cell passage.

[0125] (Method for making neurons responsive to light) This mutant can confer light responsiveness to neurons. Therefore, this method can be used to improve visual impairment or restore visual function, and can also be applied to optogenetics. For example, by introducing a protein or polynucleotide that confers light responsiveness into neurons in areas of the mouse hippocampus thought to be involved in aggression or memory formation, it is possible to examine how these areas are actually involved in aggression or memory formation (Lin, D. et al., 2011, Nature. 470(7333):221-6 and OKUYAMA et al., 2016, Science (6307) 1536-1541).

[0126] Furthermore, for example, by imparting photoresponsiveness to central or peripheral neurons in humans or non-human animals and irradiating them with light of a predetermined wavelength and intensity, it is possible to generate channel currents, thereby activating the neurons, thereby verifying whether activation or inhibition of neurons in the relevant region is involved in a specific disease. Furthermore, such activation of neurons may restore central or peripheral neural circuits and treat neurodegenerative diseases, etc.

[0127] (light-responsive cells) According to the present specification, the target cells provided with photoresponsiveness for color recognition are provided as novel photoresponsive cells (photoresponsive materials). Such photoresponsive cells can be used in research related to neural activation, for example, in the field of optogenetics.

[0128] (Screening method) The screening method disclosed herein can include a step of evaluating the relationship between the wavelength of irradiation light and channel activity for a subject protein comprising an amino acid residue different from the first amino acid sequence at one or more positions corresponding to the first amino acid sequence represented by SEQ ID NO: 1. This screening method makes it possible to obtain mutants having channel activity for color recognition, originating from the first protein. Note that the channel activity can be measured, for example, by the electrophysiological measurement method described above. Furthermore, the channel activity can be measured using any one or a combination of two or more of the above-described Ip, Is, and channel open rate.

[0129] The mutants used as subjects in these screening methods can be obtained based on the methods for producing mutants already described. Furthermore, the methods already described can also be applied to the evaluation of channel activity. [Example]

[0130] Examples will be described below as specific examples to more specifically explain the disclosure of this specification. The following examples are intended to illustrate the disclosure of this specification, but are not intended to limit the scope thereof. [Example]

[0131] (Construction of a vector containing DNA encoding the GtCCR4 mutant, transformation of ND7 / 23 cells, and electrophysiological measurements of transformed cells, Part 1) Based on the amino acid sequence of GtCCR4 (SEQ ID NO: 1), various single and multiple mutations were designed. The nucleotide sequences encoding these mutations were determined using the codon usage described above, and the mutants were constructed using the QuickChange method (QuikChange Site-Directed Mutagenesis Kit, Agilent Technologies). The details of the substitution mutations in the mutants are shown in Figure 2.

[0132] These DNA fragments were amplified using the primers shown below. Vector DNA (pEGFP-N1) was also amplified by inverse PCR. The amplified DNA fragments and vector DNA fragments were then subjected to in-fusion reactions to generate pEGFP-GtCCR4mutant, incorporating each DNA fragment.

[0133] Primers for obtaining DNA fragments (encoding Gt CCR4-derived mutants) Forward primer: 5' CGAGCTCAAGCTTATGATGACAACAAGCGCCCCTAG 3' (SEQ ID NO: 3) Reverse primer: 5' GACCGGTGGATCCTGAACAGCCTCAGACTCTTGCA 3' (SEQ ID NO: 4) Primer for obtaining vector fragment of vector pEGFP-N1 Forward primer: 5'CATAAGCTTGAGCTCGAGATC3' (SEQ ID NO: 5) Reverse primer: 5'CAGGATCCACCGGTCGCCACC3' (SEQ ID NO: 6)

[0134] Next, ND7 / 23 cells, derived from mouse blastoma and rat dorsal root ganglia and derived from mouse blastoma and rat nerve, were cultured in DMEM (high glucose) + 5% FBS medium at 37°C in a CO2 incubator. The constructed vector was then introduced into these cells using the lipofection method (Lipofectamine 2000 (Thermo Fischer)). The expression of the GtCCR4 mutant in ND7 / 23 cells was confirmed by GFP fluorescence.

[0135] After gene transfer into the cells, electrophysiological measurements were performed using the whole-cell recording patch clamp method under the following conditions within 24 to 48 hours.

[0136] [Table 8]

[0137] In the electrophysiological measurements, the wavelength of the irradiated light was changed for each mutant, and the current response was measured to determine the wavelength dependency (activity spectrum) and the maximum activity wavelength λmax act.

[0138] (Measurement of activity spectrum and maximum activity wavelength) The wavelength dependence (activity spectrum) was measured with irradiated light: the light intensity was always 0.1 mW / mm 2The current response to each light irradiation was measured by first irradiating the cells with light of 410 nm wavelength, followed by irradiation with light of 10 nm longer wavelengths. This was repeated over a wavelength range up to 650 nm. Activity spectra were created from the steady-state current (Is) obtained with each wavelength. The wavelength of light at which the maximum current was obtained was defined as the maximum activity wavelength, λmax act. The maximum activity wavelength, λmax act, for each mutant is also shown in Figure 2. Figure 2 also shows the activity spectra for the wild-type (WT) and mutants (Y117A, Y117F, Y117N, Y217F, L146A / P218T, and T147C / G151A / Y217F).

[0139] (Evaluation of light response in the blue and red regions) Among the activity spectrum results obtained in the above experiment, the relative value (ratio) of the current value at 440 nm light irradiation to the current value at the maximum activity wavelength was defined as the responsiveness in the blue region, and the relative value (ratio) of the current value at 600 nm light irradiation to the current value at the maximum activity wavelength was defined as the responsiveness in the red region. These results are shown in Figures 3 and 4.

[0140] As shown in Figure 2(A), each mutant exhibited various maximum activity wavelengths λmaxact depending on the type of mutation. Among them, Y117A, Y117F, Y117N, G169S, W177Y, Y217F, Y218T, S247A, and L146A / Y217F exhibited a shift in maximum activity wavelength to shorter wavelengths, demonstrating improved responsiveness in the blue region. Furthermore, L53N, V83A, L146A / P218T, and V83A / L146A / P218T exhibited a shift in maximum activity wavelength to longer wavelengths, demonstrating improved responsiveness in the red region. Although L146A has a maximum activity wavelength of 530 nm by itself, it was found to be advantageous in combination with other mutations.

[0141] Furthermore, as shown in Figure 2(B) and (C), Y217F, L146A / P218T, and T147C / G151A / Y217F were all found to be potential candidates for new visual pigments. Furthermore, as shown in Figure 2(C), T147C / G151A / Y217F had a maximum active wavelength shorter than Y217F, and its response to longer wavelengths was rapidly reduced, indicating that it is a mutant with a higher sensitivity to shorter wavelengths.

[0142] 3 and 4, the mutants with large relative current values upon irradiation at 440 nm were C150A, G169S, W177Y, Y217F, S247A, and L146A / Y217F. These relative values were 0.4 or greater and more than twice as large as the relative values upon irradiation at 600 nm. On the other hand, the mutants with large relative current values upon irradiation at 600 nm were V83A, L146A, P218T, L146A / C150A, L146A / G169S, L146A / W177Y, L146A / P218A, L146A / P218G, L146A / P218T, and V83A / L146A / P218T. These relative values were all 0.3 or more, and 0.6 times or more the relative value when irradiated with light at 440 nm. Note that L146A / P218T has two λmax act values, 510 nm and 560 nm, but the peak on the shorter wavelength side was a relative value at 440 nm, and the peak on the longer wavelength side was a relative value at 600 nm.

[0143] As shown in Figure 4, Y117A, Y117F, Y117N, T147C / G151A, and T147C / G151A / Y217F were also mutants with large relative current values when irradiated with 440 nm light. For Y117A, Y117F, and T147C / G151A, the relative current values were more than 6 times, more than 6 times, and more than 18 times larger, respectively, than when irradiated with 600 nm light. Furthermore, T147C / G151A / Y217F showed almost no current at 600 nm, indicating that it has superior response specificity at shorter wavelengths than these mutants.

[0144] From the above, it was found that mutants of the first protein, GtCCR4, can provide mutants that are advantageous for color recognition. [Example]

[0145] (Electrophysiological measurements in ND7 / 23 cells expressing GtCCR4, a cation channelrhodopsin derived from G. Theta) The vector prepared in Example 1 was introduced into the ND7 / 23 cells expressing GtCCR4 prepared in Example 1 in the same manner as in Example 1. For cells in which GtCCR4 expression was confirmed, electrophysiological measurements were performed using the whole-cell recording patch clamp method under the same conditions as in Example 1 within 24 to 48 hours after introduction.

[0146] Specifically, the cells were irradiated with light, and the peak maximum current (Ip) generated when the cells were irradiated with light for 400 ms and the steady current (Is) that decayed to a certain level during light irradiation were measured. Furthermore, the value obtained by dividing Is by Ip was used as the channel opening ratio. The measurement principle is shown in Figure 5A-C, and the measurement results are shown in Figure 5D-E.

[0147] As shown in Figure 5D and E, GtCCR4 generated a large channel current. Furthermore, both GtCCR4s exhibited high channel open ratios (0.81 and 0.85). These properties are thought to contribute to the restoration of vision by conferring light responsiveness to ganglion cells. Furthermore, the channel current value of Chlamydomonas-derived ChR2 in ND7 / 23 cells prepared in the same manner was approximately half that of GtCCR4, with a channel open ratio of 0.45.

[0148] From the above, it was found that GtCCR4 is advantageous in terms of channel activity and / or channel opening rate compared to ChR2. [Example]

[0149] (Construction of a vector containing DNA encoding the GtCCR4 mutant, transformation of ND7 / 23 cells, and electrophysiological measurements of transformed cells, Part 1) Based on the amino acid sequence of GtCCR4 (SEQ ID NO: 1), single mutants were designed with various single mutations. The nucleotide sequences encoding these mutants were determined using the codon usage described above, and they were constructed using the QuickChange method (QuikChange Site-Directed Mutagenesis Kit, Agilent Technologies). The details of the substitution mutations in the single mutants are also shown in Figure 6.

[0150] Using this DNA fragment, a pEGFP vector was prepared by In-Fusion reaction in the same manner as in Example 1. ND7 / 23 cells were then transformed in the same manner as in Example 1 to obtain transformants expressing each single mutant. Furthermore, electrophysiological measurements were performed on these transformants in the same manner as in Example 2. As controls, measurements were also performed on cells transformed with Chlamydomonas-derived ChR2 and wild-type GtCCR4. The results are shown in Figure 6.

[0151] As shown in Figure 6, several mutants exhibited superior channel current values compared to the wild-type. For example, E76Q, V83A, V83T, A87S, K137A, L146A, K198A, K204A, S230E, and Q231L exhibited high Ip and Is. Among these, E76Q, V83A, V83T, K137A, L146A, K198A, K204A, and Q231L exhibited superior channel activity compared to the wild-type. Furthermore, E76Q, V83A, V83T, K137A, and L146A also exhibited channel open fractions of approximately 1.

[0152] From the above, it was found that all of the above mutation positions are useful for regulating the channel activity of GtCCR4, and that the above mutation positions and amino acid substitution residues are advantageous amino acid substitution mutations with respect to channel activity and / or channel opening rate.

[0153] Furthermore, even mutations that showed channel activity equivalent to that of wild-type GtCCR4 exhibited channel activity and / or channel opening rates that were significantly higher than those of Chlamydomonas-derived ChR2, and were therefore considered to be useful mutation positions and substitution residues. [Example]

[0154] (Construction of a vector containing DNA encoding the GtCCR4 mutant, transformation of ND7 / 23 cells, and electrophysiological measurements of transformed cells, Part 2) Electrophysiological measurements were performed on transformed cells expressing the single mutants containing the E76Q, V83A, K137A, L146A, K198A, K204A, and Q231L single mutations prepared in Example 3. Simultaneously, electrophysiological measurements were also performed on transformed cells with Chlamydomonas-derived ChR2, wild-type GtCCR4, and the V83A mutant prepared in Example 3. The light irradiation conditions were as shown in Figure 7. The results are shown in Figure 7.

[0155] Figures 7A to 7D show the results for Chlamydomonas-derived ChR2, wild-type GtCCR4, the V83A mutant, and the L146A mutant, while Figures 7E to 7F show the results for various mutants. As shown in Figures 7A to 7F, the various mutants not only had higher channel current values than ChR2 and wild-type GtCCR4, but also had larger channel opening rates and were confirmed to have suppressed channel inactivation. Suppression of inactivation increases the total amount of channel current, and is therefore considered to be suitable for improving light responsiveness.

[0156] From the above, it was suggested that these mutants are all highly useful mutants, and that the mutation positions and substituted residues contribute to the channel activity and channel opening rate. [Example]

[0157] (Construction of a vector containing DNA encoding the double mutant of GtCCR4, transformation of ND7 / 23 cells, and electrophysiological measurements of transformed cells) For certain combinations of the single mutations identified in Examples 3 and 4, vectors were prepared in the same manner as in Examples 1 and 2, and electrophysiological measurements were performed in the same manner as in Example 2. At the same time, electrophysiological measurements were also performed on cells transformed with Chlamydomonas-derived ChR2 and wild-type GtCCR4. The results are shown in Figure 8.

[0158] As shown in Figure 8A, the double mutant exhibited channel activity approximately two to four times that of wild-type GtCCR4. Furthermore, as shown in Figure 8B, the channel opening rate was also higher than that of wild-type GtCCR4, at approximately 0.9 to 1.0. From the above, it was found that these single mutations are useful mutation positions and substitution residues individually, as well as useful mutation positions and substitution residues in the double mutant. Therefore, it was found that the mutation positions and substitution residues that are excellent as single mutations are also useful as double mutants. [Example]

[0159] (Construction of a vector containing DNA encoding the GtCCR4 mutant, transformation of ND7 / 23 cells, and electrophysiological measurements of transformed cells, Part 3) Based on the amino acid sequence of GtCCR4 (SEQ ID NO: 1), single mutants were designed with various single mutations, and the base sequences encoding them were determined using the codon usage described above. DNA fragments were then prepared using the QuickChange method. Subsequently, based on the same procedure as in Example 2, pEGFP vectors were prepared by In-Fusion reaction, and ND7 / 23 cells were transformed with these vectors to obtain transformants expressing each single mutant. Electrophysiological measurements were then performed on these transformants. As a control, measurements were also performed on wild-type GtCCR4 transformants. The details of the substitution mutations in the single mutants and the results of the electrophysiological measurements are shown in Figure 9.

[0160] As shown in Figure 9, several mutants showed superior channel current values compared to the wild type. For example, L53A, L53N, E76Q, V83T, G216S, and Q231L showed high Ip and Is. These mutants also showed superior channel opening rates, with L53A, L53N, E76Q, V83T, and Q231L in particular showing opening rates of approximately 1. In terms of activity, L53A, V83T, and Q231L were superior.

[0161] Furthermore, the activity of L46A, E68Q, R94K, F173Y, T224A, H235A, and H235N was roughly equivalent to that of the wild type, but they were considered to exhibit significantly higher channel activity and / or channel opening rate than Chlamydomonas-derived ChR2, and therefore were considered to be useful mutation positions and substitution residues.

[0162] From the above, it was found that all of the above mutation positions are useful for regulating the channel activity of GtCCR4, and that the above mutation positions and amino acid substitution residues are advantageous amino acid substitution mutations with respect to channel activity and / or channel opening rate. [Example]

[0163] (Nerve cell optical stimulation experiment) In this example, primary cultured rat cerebral epithelial cells expressing a photoresponsive protein in the cell membrane were irradiated with light of wavelengths that induce a response at various light intensities, and the cell membrane potential was measured to evaluate the light intensity dependence of light stimulation.

[0164] Light stimulation refers to the activation (firing, excitation) of neurons by light irradiation. In this example, the following electrophysiological experiment was performed to evaluate light stimulation. Specifically, rat cerebral epithelial cells were isolated and cultured in a petri dish. These are called primary culture cells. GtCCR4 (WT) and Chr2 (WT) were expressed in these primary culture cells as described in Examples 1 and 2, and the cells were irradiated for a certain period with light of various intensities at maximum absorption wavelengths of 530 nm and 488 nm, respectively. Excitation (depolarization) and hyperpolarization (inhibition) of single neurons were measured using the current-clamp patch clamp method with whole-cell recording, and the time change in cell membrane potential was measured.

[0165] Specifically, we synthesized DNA (using mammalian codon usage) encoding the amino acid sequences of GtCCR4 and ChR2, and incorporated it into a neuronal vector plasmid carrying the CAMK2 promoter so that eYFP was tagged to the C-terminus of these proteins. This plasmid was then transfected into primary cultured rat cerebral epithelial cells using the calcium phosphate method. Expression of each protein on the cell membrane of transfected cells was confirmed by eYFP fluorescence.

[0166] In this way, we transiently expressed each protein in the cell membrane of primary cultured cells, and within 16 days after transfection, we performed electrophysiological measurements such as whole-cell patch clamp recording, while each protein was stably expressed.

[0167] The measurement conditions for the whole-cell recording patch clamp current clamp method were as follows.

[0168] [Table 9]

[0169] The measurement procedure was as follows. The solution in the prepared cell dish was replaced with the extracellular solution (6) above. Next, the cells were observed under a microscope and cells that emitted strong eYFP fluorescence were selected. The interior of the glass pipette (4) above was filled with the intracellular solution (6) above and connected to the headstage attached to the current amplifier (1). The position of the glass pipette was controlled using the micromanipulator (5) above, and the tip of the glass pipette was moved approximately 2–3 microns above the cell. The micromanipulator was then used to gradually lower the glass pipette until it was in contact with the cell. The pressure inside the glass pipette was then reduced to completely seal the cell membrane against the pipette tip. The pipette resistance, which was 5–10 MΩ at this time, increased to approximately 1 GM. Further pressure reduction inside the pipette enabled whole-cell recording.

[0170] After reaching the above state, the cell membrane potential was measured using the patch clamp current clamp method. When neurons were inhibited, the membrane potential showed a value of -70 to -80 mV. However, when cells expressing proteins with photoresponsive activity were irradiated with light, the cells depolarized, causing the membrane potential to rise to -20 to -40 mV, after which spike-like neural activation (excitation, firing) was observed. The effect of light stimulation of these proteins was verified by measuring the degree of depolarization under the above conditions, i.e., the frequency of spike-like neural excitation. The results are shown in Figure 10.

[0171] As shown in Figure 10 (A) to (C), GtCCR4 was found to be activated at a lower light intensity than Chr2. Comparing the EC50, GtCCR4 was activated at 0.02 mW / mm 2 ,Chr2 is 0.15mW / mm 2 The difference was more than sevenfold. This means that GtCCR4 has more than seven times the light sensitivity of Chr2. These results indicate that GtCCR4 mutants with activity equivalent to or greater than that of GtCCR4 have the same light intensity dependency as GtCCR4, meaning that even low-intensity light is sufficient to stimulate cells expressing the protein on their membranes.

[0172] According to the present specification, the following disclosures are included. (1) The following position in the first amino acid sequence represented by SEQ ID NO: 1: A protein having channel activity, which comprises an amino acid residue different from an amino acid residue present in the first amino acid sequence at one or more positions selected from the group consisting of positions 53, 83, 87, 117, 120, 124, 137, 139, 142, 143, 146, 150, 169, 173, 177, 198, 204, 216, 217, 218, 231, 238, 245, and 247. (2) The protein according to (1), wherein the positions are one or more selected from the group consisting of positions 87, 117, 120, 124, 139, 142, 143, 146, 150, 169, 173, 177, 217, 218, 238, 245, and 247. (3) The protein according to (1), wherein the positions are one or more selected from the group consisting of positions 53, 83, 137, 146, 169, 177, 217, 218, and 247. (4) The protein according to (3), wherein the positions are one or more selected from the group consisting of positions 169, 177, 217, 218, and 247. (5) The protein according to (4), having a maximum activity wavelength of less than 520 nm. (6) The protein according to (3), wherein the positions are one or more selected from the group consisting of positions 53, 83, 137, 146, and 218. (7) The protein according to (6), having a maximum activity wavelength of 530 nm or longer. (8) The protein according to (1), wherein the positions are one or more selected from the group consisting of positions 137, 146, 150, 177, 198, 238, 245, and 247. (9) The protein according to (8), having a maximum activity wavelength of 520 nm or more but less than 530 nm. (10) The protein according to (1) or (2), wherein the positions are one or more selected from the group consisting of positions 150, 169, 177, 218, and 247. (11) The protein according to (1), wherein the positions are one or more selected from the group consisting of positions 87, 117, 120, 124, 139, 142, 143, 173, 204, 216, and 231. (12) The protein according to any one of (1) to (11), further comprising a deletion, substitution, or insertion of one or several amino acid residues. (13) The protein according to any one of (1) to (12), wherein the protein has an amino acid substitution of any one of the following types at a position corresponding to the following position in the first amino acid sequence: [Table 10] (14) The protein according to any one of (1) to (12), wherein the protein has an amino acid substitution of any one of the following types at a position corresponding to the following position in the first amino acid sequence: [Table 11] (15) The protein according to any one of (1) to (14), wherein a first ratio, which is the value corresponding to the channel activity at 440 nm to the value corresponding to the channel activity at the wavelength (λmax) at which the protein exhibits maximum channel activity, is 0.4 or more. (16) The protein according to any one of (1) to (15), wherein a second ratio, which is the value corresponding to the channel activity at 600 nm to the value corresponding to the channel activity at the wavelength (λmax) at which the protein shows maximum channel activity, is 0.4 or more. (17) The protein according to any one of (1) to (16), wherein the amino acid sequence of the protein has 90% or more identity with the first amino acid sequence. (18) A method for improving or restoring photoresponsiveness for color recognition in the retina, using the protein according to any one of (1) to (17) or a polynucleotide encoding said protein. (19) A pharmaceutical composition for treating or preventing visual impairment, comprising the protein according to any one of (1) to (17) or a polynucleotide encoding said protein. (20) The pharmaceutical composition according to (19), wherein the visual disorder is selected from the group consisting of retinitis pigmentosa, age-related macular degeneration, retinal detachment, diabetic retinopathy, and color vision deficiency. (21) A method for screening mutant proteins, comprising a step of evaluating the relationship between the wavelength of irradiated light and channel activity for a subject protein having an amino acid residue different from that in the first amino acid sequence at one or more positions in the first amino acid sequence represented by sequence number 1. [Sequence List Free Text]

[0173] SEQ ID NOs: 3 to 6: Primers

Claims

1. In the first amino acid sequence represented by SEQ ID NO: 1, L53N, V83A, Y117A, Y117F, Y117N, K137A, L146A, G169S, W177Y, K198A, Y217F, P218A, P218T, A245M, S247A, S247M, L146A / C150A, L146A / G169S , L146A / W177Y, L146A / Y217F, L146A / P218G, L146A / P218S, L146A / P218T, T147C / G151A, V83A / L146A / P218T, and T147C / G151A / Y217F; Furthermore, the present invention provides a protein having an amino acid sequence which may have one or several deletions, substitutions or insertions of amino acid residues at positions other than the following positions in the first amino acid sequence: 53, 83, 87, 117, 120, 124, 137, 139, 142, 143, 146, 147, 150, 151, 169, 173, 177, 198, 204, 216, 217, 218, 231, 238, 245 and 247, which has an amino acid sequence which has 90% or more identity with the first amino acid sequence and which has channel activity.

2. A first amino acid sequence represented by SEQ ID NO: 1, comprising one or more amino acid substitutions selected from the group consisting of L53N, V83A, Y117A, Y117F, Y117N, K137A, L146A, G169S, W177Y, K198A, Y217F, P218A, P218T, A245M, S247A, S247M, L146A / C150A, L146A / G169S, L146A / W177Y, L146A / Y217F, L146A / P218G, L146A / P218S, L146A / P218T, and V83A / L146A / P218T; Furthermore, the present invention provides a protein having an amino acid sequence which may have one or several deletions, substitutions or insertions of amino acid residues at positions other than the following positions in the first amino acid sequence: 53, 83, 87, 117, 120, 124, 137, 139, 142, 143, 146, 150, 169, 173, 177, 198, 204, 216, 217, 218, 231, 238, 245 and 247, which has an amino acid sequence which is 90% or more identical to the first amino acid sequence and has channel activity.

3. The protein described in claim 1, wherein the first amino acid sequence has one amino acid substitution selected from the group consisting of Y217F, L146A / Y217F, L146A / P218T, V83A / L146A / P218T, and T147C / G151A / Y217F.

4. The protein described in claim 2, wherein the first amino acid sequence has one amino acid substitution selected from the group consisting of Y217F, L146A / Y217F, L146A / P218T, and V83A / L146A / P218T.

5. The protein according to any one of claims 1 to 4, wherein a first ratio, which is a channel activity equivalent value at 440 nm to a channel activity equivalent value at a wavelength (λmax) at which the protein exhibits maximum channel activity, is 0.4 or more.

6. The protein according to any one of claims 1 to 5, wherein a second ratio, which is the channel activity equivalent value at 600 nm to the channel activity equivalent value at the wavelength (λmax) at which the protein shows maximum channel activity, is 0.4 or more.

7. The protein according to any one of claims 1 to 6, wherein the amino acid sequence of the protein has 95% or more identity with the first amino acid sequence.

8. An agent for improving or restoring photoresponsiveness for color recognition in the retina, comprising the protein according to any one of claims 1 to 7, a polynucleotide encoding said protein, or a vector comprising said polynucleotide.

9. A pharmaceutical composition for treating or preventing visual impairment, comprising the protein according to any one of claims 1 to 7, or a polynucleotide encoding said protein, or a vector comprising said polynucleotide.

10. 10. The pharmaceutical composition of claim 9, wherein the visual disorder is selected from the group consisting of retinitis pigmentosa, age-related macular degeneration, diabetic retinopathy, retinal detachment, and color vision deficiency.

Images