ANGPTL2 ANTISENSE OLIGONUCLEOTIDES AND USES THEREOF - Patent application
By designing antisense oligonucleotides for ANGPTL2 transcripts, the problem of high efficiency and low treatment cost of cardiovascular disease is solved, and effective inhibition of ANGPTL2 protein and transcripts is achieved, reducing the symptoms of related diseases and reducing the treatment cost.
Patent Information
- Application Number
- JP2021559064
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2019-04-03
- Filing Date
- 2020-04-02
- Publication Date
- 2025-08-19
- Estimated Expiration
- 2040-04-02
AI Technical Summary
Existing methods for treating cardiovascular diseases are costly and inefficient, and require the development of more economical and effective treatments.
Antisense oligonucleotides (ASOs) targeting ANGPTL2 transcripts, which are complementary to ANGPTL2 transcripts, are designed and used to significantly reduce the expression of ANGPTL2 protein and transcripts, including the use of sugar-modified nucleotides and phosphate sulfate ligation to form the gapmer structure.
Significantly reduce the expression of ANGPTL2 protein and transcripts, reduce or treat diseases associated with abnormal ANGPTL2 expression, such as cardiovascular disease, obesity, metabolic diseases and diabetes, and reduce treatment costs.
Smart Images

Figure 0007725370000003 
Figure 0007725370000004 
Figure 0007725370000005
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This PCT application claims the benefit of priority to U.S. Provisional Application No. 62 / 828,864, filed April 3, 2019, which is incorporated herein by reference in its entirety.
[0002] Sequence listings submitted electronically via EFS-WEB The contents of the sequence listing submitted electronically upon filing of this application (Name: 3338.144PC01_Seqlisting_ST25.txt, Size: 149,978 bytes; and Creation Date: April 2, 2020) are incorporated herein by reference in their entirety.
[0003] FIELD OF THE INVENTION The present invention relates to antisense oligomeric compounds (ASOs) that target angiopoietin-like 2 (ANGPTL2) transcripts in cells and reduce ANGPTL2 protein expression, which is beneficial for a wide range of medical disorders, including those associated with abnormal ANGPTL2 expression and / or activity (e.g., cardiovascular-related diseases or disorders). [Background technology]
[0004] background Angiopoietin-like 2 (ANGPTL2) is a secreted protein belonging to the angiopoietin-like family, which consists of eight members (ANGPTL1-8). ANGPTL2 is primarily expressed in the heart, adipose tissue, lung, kidney, and skeletal muscle and plays an important role in many biological processes, such as tissue repair and angiogenesis. Kim, I., et al., J Biol Chem 274(37):26523-8 (1999). The beneficial angiogenic properties of ANGPTL2 have been reported in some stroke patients. Buga, AM, et al., Front Aging Neurosci 6:44 (2014). ANGPTL2 has also been described to play an important role in the survival and expansion of hematopoietic stem and progenitor cells, regulating intestinal epithelial regeneration, and promoting beneficial innate immune responses. Broxmeyer, HE, et al., Blood Cells Mol Dis 48(1):25-29 (2012); Horiguchi, H., et al., EMBO J 36(4):409-424 (2017); Yugami, M., et al., J Biol Chem 291(36):18843-52 (2016). Summary of the Invention [Problem to be solved by the invention]
[0005] Despite scientific advances, heart-related diseases remain the leading cause of death for men and women worldwide. The American Heart Association estimates that by 2030, approximately 40% of the U.S. population will have some form of vascular disease, with direct medical costs projected to reach $818 billion. Benjamin, EJ, et al., Circulation 135:e146-e603 (2017). Therefore, new treatment options that are far more robust and cost-effective are highly desirable. [Means for solving the problem]
[0006] Summary of the Invention Provided herein are antisense oligonucleotides (ASOs) comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within an angiopoietin-like 2 (ANGPTL2) transcript. In some embodiments, the ASO is at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% complementary to a nucleic acid sequence within the ANGPTL2 transcript. In some embodiments, the ANGPTL2 transcript is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 196, SEQ ID NO: 197, SEQ ID NO: 198, SEQ ID NO: 199, and SEQ ID NO: 207.
[0007] In some embodiments, the ASOs disclosed herein can reduce ANGPTL2 protein expression in human cells (e.g., SK-N-AS cells) that express the ANGPTL2 protein. In some embodiments, ANGPTL2 protein expression is reduced by at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to ANGPTL2 protein expression in human cells not exposed to the ASO.
[0008] In some embodiments, the ASO can reduce ANGPTL2 transcript (e.g., mRNA) expression in human cells (e.g., SK-N-AS cells) that express the ANGPTL2 transcript. In some embodiments, ANGPTL2 transcript expression is reduced by at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100%, compared to ANGPTL2 transcript expression in human cells not exposed to the ASO.
[0009] In some embodiments, the ASO is a gapmer.
[0010] In some embodiments, the ASO comprises one or more nucleoside analogs. In some embodiments, one or more of the nucleoside analogs comprises 2'-O-alkyl-RNA; 2'-O-methyl RNA (2'-OMe); 2'-alkoxy-RNA; 2'-O-methoxyethyl-RNA (2'-MOE); 2'-amino-DNA; 2'-fluoro-RNA; 2'-fluoro-DNA; arabinonucleic acid (ANA); 2'-fluoro-ANA; bicyclic nucleoside analog (LNA); or a combination thereof. In some embodiments, one or more nucleoside analogs are affinity-enhancing 2'-sugar-modified nucleosides. In some embodiments, the affinity-enhancing 2'-sugar-modified nucleosides are LNA. In further embodiments, the LNA is selected from the group consisting of constrained ethyl nucleosides (cEt), 2',4'-constrained 2'-O-methoxyethyl (cMOE), α-L-LNA, β-D-LNA, 2'-O,4'-C-ethylene-bridged nucleic acid (ENA), amino-LNA, oxy-LNA, thio-LNA, and any combination thereof.
[0011] In certain embodiments, the ASO comprises one or more 5'-methyl-cytosine nucleobases.
[0012] In some embodiments, the ASO is capable of (i) reducing ANGPTL2 mRNA levels in SK-N-AS cells; (ii) reducing ANGPTL2 protein levels in SK-N-AS cells; (iii) reducing, alleviating, or treating one or more symptoms of a disease or disorder associated with abnormal ANGPTL2 expression and / or activity; or (iv) any combination thereof. In some embodiments, the disease or disorder associated with abnormal ANGPTL2 expression and / or activity comprises cardiovascular disease, obesity, metabolic disease, type 2 diabetes, cancer, or a combination thereof.
[0013] In certain embodiments, the contiguous nucleotide sequence of the ASO disclosed herein is complementary to a nucleic acid sequence comprising: (i) nucleotides 1 to 211 of SEQ ID NO:1; (ii) nucleotides 471 to 686 of SEQ ID NO:1; (iii) nucleotides 1,069 to 1,376 of SEQ ID NO:1; (iv) nucleotides 1,666 to 8,673 of SEQ ID NO:1; (v) nucleotides 8,975 to 12,415 of SEQ ID NO:1; (vi) nucleotides 12,739 to 18,116 of SEQ ID NO:1; (vii) nucleotides 18,422 to 29,875 of SEQ ID NO:1; or (viii) nucleotides 30,373 to 35,389 of SEQ ID NO:1. In some embodiments, the contiguous nucleotide sequence of the ASO is complementary to a nucleic acid sequence comprising: (i) nucleotides 37 to 161 of SEQ ID NO:1; (ii) nucleotides 521 to 636 of SEQ ID NO:1; (iii) nucleotides 1,119 to 1,326 of SEQ ID NO:1; (iv) nucleotides 1,716 to 8,623 of SEQ ID NO:1; (v) nucleotides 9,025 to 12,365 of SEQ ID NO:1; (vi) nucleotides 12,789 to 18,066 of SEQ ID NO:1; (vii) nucleotides 18,472 to 29,825 of SEQ ID NO:1; or (viii) nucleotides 30,423 to 35,339 of SEQ ID NO:1. In further embodiments, the contiguous nucleotide sequence of the ASO is complementary to a nucleic acid sequence comprising: (i) nucleotides 87-111 of SEQ ID NO:1; (ii) nucleotides 571-586 of SEQ ID NO:1; (iii) nucleotides 1,169-1,276 of SEQ ID NO:1; (iv) nucleotides 1,766-8,573 of SEQ ID NO:1; (v) nucleotides 9,075-12,315 of SEQ ID NO:1; (vi) nucleotides 12,839-18,016 of SEQ ID NO:1; (vii) nucleotides 18,522-29,775 of SEQ ID NO:1; or (viii) nucleotides 30,473-35,289 of SEQ ID NO:1. In certain embodiments, the contiguous nucleotide sequence is complementary to a nucleic acid comprising nucleotides 20,187-20,234 of SEQ ID NO:1. In other embodiments, the contiguous nucleotide sequence is complementary to a nucleic acid comprising nucleotides 20,202-20,219 of SEQ ID NO:1.
[0014] In one embodiment, the contiguous nucleotide sequence of an ASO disclosed herein comprises a nucleotide sequence selected from the sequences in Figure 2 (SEQ ID NO: 4 to SEQ ID NO: 193).
[0015] In certain embodiments, the contiguous nucleotide sequence of the ASO comprises SEQ ID NO:8, SEQ ID NO:20, SEQ ID NO:38, SEQ ID NO:46, SEQ ID NO:79, SEQ ID NO:84, SEQ ID NO:82, SEQ ID NO:88, SEQ ID NO:85, SEQ ID NO:90, SEQ ID NO:89, SEQ ID NO:93, SEQ ID NO:95, SEQ ID NO:97, SEQ ID NO:101, SEQ ID NO:111, SEQ ID NO:116, SEQ ID NO:120, SEQ ID NO:121, SEQ ID NO:122, SEQ ID NO:132, SEQ ID NO:142, SEQ ID NO:141, SEQ ID NO:143, SEQ ID NO:144, or SEQ ID NO:146. In certain embodiments, the contiguous nucleotide sequence comprises SEQ ID NO:141, SEQ ID NO:122, SEQ ID NO:8, SEQ ID NO:38, SEQ ID NO:95, SEQ ID NO:88, or SEQ ID NO:120. In other embodiments, the contiguous nucleotide sequence comprises SEQ ID NO:116, SEQ ID NO:118, SEQ ID NO:117, SEQ ID NO:120, SEQ ID NO:119, SEQ ID NO:121, SEQ ID NO:122, or a combination thereof.
[0016] In some embodiments, the ASO disclosed herein has a design selected from the group corresponding to the designs in Figure 2, where uppercase letters indicate sugar-modified nucleosides and lowercase letters indicate DNA. In some embodiments, the ASO has a length of 15-20 nucleotides.
[0017] In some embodiments, the contiguous nucleotide sequence of the ASO disclosed herein comprises one or more modified internucleoside linkages. In some embodiments, one or more modified internucleoside linkages are phosphorothioate linkages. In some embodiments, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the internucleoside linkages are modified. In some embodiments, each internucleoside linkage is a phosphorothioate linkage.
[0018] Also provided herein are conjugates comprising the ASO disclosed herein, wherein the ASO is covalently linked to at least one non-nucleotide or non-polynucleotide moiety. In some embodiments, the non-nucleotide or non-polynucleotide moiety comprises a protein, a fatty acid chain, a sugar residue, a glycoprotein, a polymer, or any combination thereof.
[0019] Also provided herein is a pharmaceutical composition comprising the ASO or conjugate disclosed herein and a pharmaceutically acceptable diluent, carrier, salt, or adjuvant. In some embodiments, the pharmaceutically acceptable salt comprises a sodium salt, a potassium salt, an ammonium salt, or any combination thereof. In some embodiments, the pharmaceutical composition further comprises at least one additional therapeutic agent. In some embodiments, the additional therapeutic agent is an ANGPTL2 antagonist. In some embodiments, the ANGPTL2 antagonist is an anti-ANGPTL2 antibody or a fragment thereof.
[0020] The invention further provides kits comprising the ASOs, conjugates, or pharmaceutical compositions disclosed herein and instructions for use. Also disclosed are diagnostic kits comprising the ASOs, conjugates, or pharmaceutical compositions of the invention and instructions for use.
[0021] Provided herein are methods for inhibiting or reducing ANGPTL2 protein expression in cells, comprising administering an ASO, conjugate, or pharmaceutical composition disclosed herein to a cell expressing ANGPTL2 protein, wherein ANGPTL2 protein expression in the cell is inhibited or reduced after administration. In one embodiment, the invention relates to an in vitro method for inhibiting or reducing ANGPTL2 protein expression in cells, comprising contacting a cell expressing ANGPTL2 protein with an ASO, conjugate, or pharmaceutical composition disclosed herein, wherein ANGPTL2 protein expression in the cell is inhibited or reduced after contact.
[0022] In some embodiments, ASO inhibits or reduces the expression of ANGPTL2 transcript (e.g., mRNA) in cells after administration or contact.In some embodiments, the expression of ANGPTL2 transcript (e.g., mRNA) is reduced by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or about 100% after administration, compared with cells not exposed to ASO.In further embodiments, the expression of ANGPTL2 protein is reduced by at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% after administration, compared with cells not exposed to ASO.In some embodiments, the cell is a brain cell, for example, a neuroblast cell (e.g., SK-N-AS cell).
[0023] Also provided herein is a method for reducing, alleviating, or treating one or more symptoms of a disease or disorder associated with abnormal ANGPTL2 expression and / or activity in a subject in need of treatment, comprising administering to the subject an effective amount of an ASO, conjugate, or pharmaceutical composition disclosed herein. The present invention also provides use of an ASO, conjugate, or pharmaceutical composition disclosed herein for the manufacture of a medicament. In certain embodiments, the medicament is for the treatment of a disease or disorder associated with abnormal ANGPTL2 expression and / or activity in a subject in need of treatment. In certain embodiments, the ASO, conjugate, or pharmaceutical composition of the present invention is for use in therapy. In certain embodiments, the ASO, conjugate, or pharmaceutical composition disclosed herein is for the treatment of a disease or disorder associated with abnormal ANGPTL2 expression and / or activity in a subject in need of treatment.
[0024] In some embodiments, the disease or disorder associated with abnormal ANGPTL2 expression and / or activity comprises cardiovascular disease, obesity, metabolic disease, type 2 diabetes, cancer, or a combination thereof. In some embodiments, the cardiovascular disease or disorder comprises atherosclerosis, coronary artery disease, stroke, heart failure, hypertensive heart disease, rheumatic heart disease, cardiomyopathy, cardiac arrhythmia, congenital heart disease, valvular heart disease, carditis, aortic aneurysm, peripheral arterial disease, thromboembolic disease, venous thrombosis, or any combination thereof. In some embodiments, the cardiovascular disease or disorder is heart failure. In some embodiments, heart failure comprises left-sided heart failure, right-sided heart failure, congestive heart failure, heart failure with reduced ejection fraction (HFrEF), heart failure with preserved ejection fraction (HFpEF), borderline heart failure (HFmrEF), hypertrophic cardiomyopathy (HCM), hypertensive heart disease (HHD), or hypertensive hypertrophic cardiomyopathy.
[0025] In some embodiments, the subject is a human. In some embodiments, the ASO, conjugate, or pharmaceutical composition of the invention is administered intracardially, orally, parenterally, intrathecally, intracerebroventricularly, pulmonary, topically, or intracerebroventricularly. [Brief explanation of the drawings]
[0026] [Figure 1]Figure 1A shows the human ANGPTL2 genomic sequence (corresponding to the reverse complement of residues 127,087,349 to 127,122,765 of the NCBI Reference Sequence, Accession No. NC_000009.12). SEQ ID NO: 1 is identical to the ANGPTL2 pre-mRNA sequence, except that the nucleotide "t" in SEQ ID NO: 1 is replaced by uracil "u" in the pre-mRNA. Figure 1B shows the human ANGPTL2 mRNA sequence (Accession No. NM_012098.2), except that the nucleotide "t" in SEQ ID NO: 2 is replaced by uracil "u" in the mRNA. Figure 1C shows the human CAMK2D protein sequence (Accession No. NP_036230.1) (SEQ ID NO: 3). Figure 1D shows two isoforms that can arise by alternative splicing. The sequence of ANGPTL2 isoform X1 (Accession No. XP_006717093.1, SEQ ID NO: 194) differs from the canonical sequence in Figure 1C as follows: 274-274: P→L; and 275-493: deletion. The sequence of ANGPTL2 isoform 2 (Accession No. Q9UKU9-2, SEQ ID NO: 195) differs from the canonical sequence in Figure 1C as follows: 1-302: deletion.
[0027] [Figure 2] Figure 2 shows exemplary ASOs targeting ANGPTL2 pre-mRNA. Each column in Figure 2 shows the designated sequence number for the ASO-only sequence, the target start and end sites on the ANGPTL2 pre-mRNA sequence, the design number (DES No.), the ASO sequence as designed, the ASO number (ASO No.), and the ASO sequence as chemical structure. For ASO designs, uppercase letters indicate nucleoside analogs, and lowercase letters indicate DNA.
[0028] [Figure 3]Figure 3 shows the percent reduction in ANGPTL2 mRNA expression in SK-N-AS cells after in vitro culture with various ASOs as described in Example 2. Cells were treated with 25 μM or 5 μM ASO. The reduction in ANGPTL2 mRNA expression (normalized to actin) is shown as a percent of the control.
[0029] [Figure 4] Figure 4 shows the potency (IC50) of various ASOs in reducing ANGPTL2 mRNA expression in SK-N-AS cells in vitro. As described in Example 2, SK-N-AS cells were cultured in vitro with a 10-point titration of various tested ASOs, and the potency (IC50) of the ASOs is shown as the ratio of ANGPTL2 to actin expression (M).
[0030] [Figure 5] Figure 5 shows the efficacy of exemplary ASOs in reducing ANGPTL2 mRNA expression in mice in vivo. Efficacy is shown as the percent reduction in ANGPTL2 mRNA expression (normalized to GAPDH) compared to the corresponding expression in saline-treated control mice. DETAILED DESCRIPTION OF THE INVENTION
[0031] Detailed Description of the Invention I. Definition For example, a "nucleotide sequence" is understood to refer to one or more nucleotide sequences. That is, the singular terms "one or more" and "at least one" can be used interchangeably herein.
[0032] Furthermore, "and / or," as used herein, should be construed as referring to each of two specified properties or components, with or without the other. Thus, the term "and / or" used herein in phrases such as "A and / or B" is intended to include "A and B," "A or B," "A" (alone) and "B" (alone). Similarly, the term "and / or" used in phrases such as "A, B and / or C" is intended to encompass each of the following embodiments: A, B and C; A, B or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).
[0033] When embodiments are described herein using the term "comprising," it is understood that similar embodiments other than those described using the terms "consisting of" and / or "consisting essentially of" are also provided.
[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary of Biochemistry and Molecular Biology, Revised, 2000, Oxford University Press provide those skilled in the art with a general dictionary of many of the terms used in this disclosure.
[0035] Units, prefixes, and symbols are written in the form accepted by the International System of Units (SI). Numerical ranges are inclusive of the numbers defining the range. Unless otherwise specified, nucleotide sequences are written left to right in 5' to 3' orientation. Amino acid sequences are written left to right in amino to carboxy orientation. The "headings" provided herein are not limitations of the various aspects of the invention, which can be taken from this specification as a whole. Accordingly, the terms defined below are more fully defined from this specification as a whole.
[0036] The term "about" means approximately, roughly, in the region, or within the region. When the term "about" is used in conjunction with a numerical range, the range is modified by extending above and below the numerical boundaries set forth. Generally, the term "about" can modify a numerical value, for example, by a range of 10 percent above or below (higher or lower than) the stated value. For example, when it is stated that "an ASO reduces ANGPTL2 protein expression in cells after ASO administration by at least about 60%, it is implied that ANGPTL2 protein levels are reduced in the range of 50% to 70%.
[0037] The term "nucleic acid" or "nucleotide" is intended to encompass multiple nucleic acids. In some embodiments, the term "nucleic acid" or "nucleotide" refers to an in vivo or in vitro target sequence, such as a pre-mRNA, mRNA, or DNA. When the term refers to a nucleic acid or nucleotide in a target sequence, the nucleic acid or nucleotide may be a naturally occurring sequence in a cell. In other embodiments, the term "nucleic acid" or "nucleotide" refers to a sequence in an ASO of the present invention. When the term refers to a sequence in an ASO, the nucleic acid or nucleotide is not naturally occurring, i.e., chemically synthesized, enzymatically produced, recombinantly produced, or any combination thereof. In some embodiments, the nucleic acid or nucleotide in the ASO is synthetic or recombinantly produced, but is not a naturally occurring sequence or fragment thereof. In other embodiments, the nucleic acid or nucleotide in the ASO is not naturally occurring because it contains at least one nucleotide analog that is not naturally occurring in nature. The term "nucleic acid" or "nucleoside" refers to a single nucleic acid segment, such as DNA, RNA, or an analog thereof, present in a polynucleotide. "Nucleic acid" or "nucleoside" includes naturally occurring or non-naturally occurring nucleic acids. In certain embodiments, the terms "nucleotide," "unit," and "monomer" are used interchangeably. When referring to a sequence of nucleotides or monomers, the reference is to a sequence of bases such as A, T, G, C, or U and their analogs.
[0038] As used herein, the term "nucleotide" refers to a glycoside containing a sugar moiety, a base moiety, and a covalently attached group (linking group), such as a phosphate or phosphorothioate internucleotide linking group, and covers both naturally occurring nucleotides, such as DNA or RNA, and non-naturally occurring nucleotides containing modified sugar and / or base moieties, also referred to herein as "nucleotide analogs." Here, a single nucleotide (unit) may also be referred to as a monomer or nucleic acid unit. In certain embodiments, the term "nucleotide analog" refers to a nucleotide having a modified sugar moiety. Non-limiting examples of nucleotides having modified sugar moieties (e.g., LNA) are disclosed elsewhere herein. In other embodiments, the term "nucleotide analog" refers to a nucleotide having a modified nucleobase moiety. Nucleotides having modified nucleobase moieties include, but are not limited to, 5-methyl-cytosine, isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 6-aminopurine, 2-aminopurine, inosine, diaminopurine, and 2-chloro-6-aminopurine.
[0039] The term "nucleobase" includes purine (e.g., adenine and guanine) and pyrimidine (e.g., uracil, thymine, and cytosine) moieties present in nucleosides and nucleotides that form hydrogen bonds during nucleic acid hybridization. As used herein, the term "nucleobase" also includes modified nucleobases that may differ from naturally occurring nucleobases but are functional during nucleic acid hybridization. As used herein, "nucleobase" refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine, as well as non-naturally occurring variants. Such variants are described, for example, in Hirao et al. (2012) Accounts of Chemical Research, vol. 45, page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry, Suppl. 37, 1.4.1. Nucleobase moieties can be represented by the letter code of each corresponding nucleobase, e.g., A, T, G, C, or U, where each letter can optionally include a modified nucleobase of equivalent function. For example, in exemplary oligonucleotides, the nucleobase moieties are selected from A, T, G, C, and 5-methylcytosine.
[0040] As used herein, the term "nucleoside" refers to a glycoside containing a sugar moiety and a base moiety, and therefore may be used to refer to a nucleotide unit covalently linked by an internucleotide bond between nucleotides of an ASO. In the field of biotechnology, the term "nucleotide" is often used to refer to a nucleic acid monomer or unit. In the context of ASOs, the term "nucleotide" may refer to a nucleic acid base sequence containing a single base, i.e., cytosine (DNA and RNA), guanine (DNA and RNA), adenine (DNA and RNA), thymine (DNA), and uracil (RNA), implying the presence of a sugar backbone and internucleotide bond. Similarly, in the context of oligonucleotides, particularly those in which one or more of the internucleotide linkage groups is modified, the term "nucleotide" may refer to a "nucleoside." For example, the term "nucleotide" may also be used to specify the presence or nature of an internucleoside bond.
[0041] As used herein, the term "antisense oligonucleotide" (ASO) is defined as an oligonucleotide that can modulate the expression of a target gene by hybridizing to a target nucleic acid, particularly a continuous sequence of the target nucleic acid. Antisense oligonucleotides are not inherently double-stranded and therefore are not siRNAs or shRNAs. In some embodiments, the antisense oligonucleotides disclosed herein are single-stranded. The single-stranded oligonucleotides disclosed herein can form hairpin or intermolecular duplex structures (duplexes between two molecules of the same oligonucleotide) as long as the degree of inter- or intra-self complementarity is less than 50% over the entire length of the oligonucleotide. The antisense oligonucleotides disclosed herein are modified oligonucleotides. As used herein, the term "antisense oligonucleotide" can refer to the entire sequence of an antisense oligonucleotide or, in some embodiments, the continuous nucleotide sequence thereof.
[0042] The terms "iRNA," "RNAi agent," "iRNA agent," and "RNA interference agent," as used interchangeably herein, refer to a substance that contains an RNA nucleoside and mediates targeted cleavage of an RNA transcript via the RNA-induced silencing complex (RISC) pathway. iRNA directs the sequence-specific degradation of mRNA through the process of RNA interference (RNAi). iRNA regulates, e.g., inhibits, the expression of a target nucleic acid in a cell, e.g., a cell in a subject, e.g., a mammalian subject. RNAi agents include single-stranded RNAi agents and double-stranded siRNAs, as well as short hairpin RNAs (shRNAs). The oligonucleotides or their consecutive nucleotide sequences of the present invention can be in the form of an RNAi agent or form part of an RNAi agent, such as an siRNA or shRNA. In certain embodiments of the present invention, the oligonucleotides or their consecutive nucleotide sequences of the present invention are RNAi agents, such as siRNAs.
[0043] The term siRNA refers to a small interfering ribonucleic acid (RNAi) agent. siRNA is a double-stranded RNA molecule, also known in the art as small interfering RNA or silencing RNA. siRNA generally comprises a sense strand (also referred to as a passenger strand) and an antisense strand (also referred to as a guide strand), each strand being 17-30 nucleotides long, generally 19-25 nucleosides long. The antisense strand is complementary, e.g., fully complementary, to the target nucleic acid (suitably the mature mRNA sequence), and the sense strand is complementary to the antisense strand such that the sense and antisense strands form a duplex or double-stranded region. The siRNA strands can form a blunt-ended duplex, or advantageously, the 3' ends of the sense and antisense strands can form a 3' overhang, e.g., of one, two, or three nucleosides. In some embodiments, both the sense and antisense strands have a 2-nt 3' overhang. The double-stranded region can therefore be, for example, 17 to 25 nucleotides in length, such as 21 to 23 nucleotides in length.
[0044] Once inside the cell, the antisense strand is incorporated into the RISC complex, which can mediate targeted degradation or target inhibition of the target nucleic acid. siRNAs generally contain modified nucleosides in addition to RNA nucleosides. Alternatively, in some embodiments, all of the nucleotides in the siRNA strand can be modified. Non-limiting examples of modifications include LNA (see, e.g., WO2004083430, WO2007085485), 2'-sugar-modified nucleosides such as 2'-fluoro, 2'-O-methyl, or 2'-O-methoxyethyl. In some embodiments, the passenger strand of the siRNA can be discontinuous (see, e.g., WO2007107162). Incorporation of thermolabile nucleotides in the seed region of the antisense strand of siRNA has been reported to be useful for reducing the off-target activity of siRNA (see, e.g., WO18098328).
[0045] In some embodiments, the dsRNA agent (such as siRNA) of the present invention comprises at least one modified nucleotide.In some embodiments, substantially all nucleotides of sense strand comprise modification; substantially all nucleotides of antisense strand comprise modification, or substantially all nucleotides of sense strand and substantially all nucleotides of antisense strand comprise modification.In still other embodiments, all nucleotides of sense strand comprise modification; all nucleotides of antisense strand comprise modification; or all nucleotides of sense strand and all nucleotides of antisense strand comprise modification.
[0046] In certain embodiments, the modified nucleotides may be independently selected from the group consisting of deoxy-nucleotides, 3'-terminal deoxy-thymine (dT) nucleotides, 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy modified nucleotides, locked nucleotides, unlocked nucleotides, conformationally locked nucleotides, constrained ethyl nucleotides, basic nucleotides, 2'-amino modified nucleotides, 2'-O-allyl modified nucleotides, 2'-C-alkyl modified nucleotides, 2'-hydroxyl modified nucleotides, 2'-methoxyethyl modified nucleotides, 2'-O-alkyl modified nucleotides, morpholino nucleotides, phosphoramidates, non-natural base containing nucleotides, unlinked nucleotides, tetrahydropyran modified nucleotides, 1,5-anhydrohexitol modified nucleotides, cyclohexenyl modified nucleotides, nucleotides containing phosphorothioate groups, nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphates, nucleotides containing 5'-phosphate mimetics, glycol modified nucleotides, and 2-O-(N-methylacetamido) modified nucleotides, and combinations thereof. Suitable siRNAs include a 5'-phosphate group or a 5'-phosphate mimic at the 5'-end of the antisense strand. In certain embodiments, the 5'-end of the antisense strand is an RNA nucleoside.
[0047] In certain embodiments, the dsRNA agent further comprises at least one phosphorothioate or methylphosphonate internucleoside linkage.
[0048] The phosphorothioate or methylphosphonate internucleoside linkages can be at the 3'-end of one or both strands (e.g., the antisense strand; or the sense strand); or the phosphorothioate or methylphosphonate internucleoside linkages can be at the 5'-end of one or both strands (e.g., the antisense strand; or the sense strand); or the phosphorothioate or methylphosphonate internucleoside linkages can be at both the 5'- and 3'-ends of one or both strands (e.g., the antisense strand; or the sense strand). In certain embodiments, the remaining internucleoside linkages are phosphodiester linkages.
[0049] The dsRNA agent can further comprise a ligand. In certain embodiments, the ligand is conjugated to the 3' end of the sense strand.
[0050] For biodistribution, the siRNA can be, for example, conjugated to a targeting ligand and / or formulated into lipid nanoparticles.
[0051] Other aspects of the invention relate to pharmaceutical compositions comprising these dsRNA, such as siRNA molecules, suitable for therapeutic use, and methods of inhibiting target gene expression by administering dsRNA, such as siRNA, molecules of the invention, for the treatment of various disease states, e.g., as disclosed herein.
[0052] The term " modified oligonucleotide " refers to the oligonucleotide that comprises one or more sugar-modified nucleosides and / or modified internucleoside linkages.The term " chimeric oligonucleotide " is used in the literature to refer to the oligonucleotide that comprises both sugar-modified nucleosides and non-sugar-modified nucleosides.In some embodiments, antisense oligonucleotide is the oligonucleotide that is produced by synthesis, and can be in isolated or purified form.
[0053] The term "contiguous nucleotide sequence" refers to a region of an oligonucleotide that is complementary to a target nucleic acid. This term is used interchangeably herein with the terms "contiguous nucleobase sequence" and "oligonucleotide motif sequence." In some embodiments, all nucleotides of an oligonucleotide constitute a contiguous nucleotide sequence. In some embodiments, an oligonucleotide comprises a contiguous nucleotide sequence, such as an FG-F' gapmer region, and can optionally include additional nucleotides, such as a nucleotide linker region that can be used to attach a functional group to the contiguous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid. It is understood that the contiguous nucleotide sequence of an oligonucleotide should not be longer than the oligonucleotide itself, and that the oligonucleotide should not be shorter than the contiguous nucleotide sequence.
[0054] As used herein, the term "modified nucleoside" or "nucleoside modification" refers to a nucleoside that has been modified by one or more modifications in the sugar moiety or (nucleic acid) base moiety relative to an equivalent DNA or RNA nucleoside. In certain embodiments, a modified nucleoside comprises a modified sugar moiety. The term modified nucleoside may also be used interchangeably with the terms "nucleoside analog" or modified "unit" or modified "monomer." Nucleosides with unmodified DNA or RNA sugar moieties are referred to herein as DNA or RNA nucleosides. Nucleosides with modifications in the base region of DNA or RNA nucleosides are still generally referred to as DNA or RNA if Watson-Crick base pairing is possible.
[0055] The term "modified internucleoside linkage" is defined as a linkage other than a phosphodiester (PO) linkage, covalently linking two nucleosides, as commonly understood by those skilled in the art. In certain embodiments, the modified internucleoside linkage is a phosphorothioate linkage.
[0056] As used herein, the term "nucleotide length" refers to the total number of nucleotides (monomers) in a sequence, such as a nucleoside antisense oligonucleotide sequence or a contiguous nucleotide sequence thereof. For example, the sequence tacatattatattactcctc (SEQ ID NO: 158) has 20 nucleotides, and therefore, the nucleotide length of this sequence is 20. The term "nucleotide length" is therefore used interchangeably with "number of nucleotides" herein.
[0057] As will be appreciated by those of skill in the art, the 5' terminal nucleotide of an oligonucleotide does not contain a 5' internucleotide linkage group, but may contain a 5' terminal group.
[0058] The term "alkyl," as used herein, alone or in combination, refers to a straight-chain or branched alkyl group of 1 to 8 carbon atoms, particularly a straight-chain or branched alkyl group of 1 to 6 carbon atoms, more particularly a straight-chain or branched alkyl group of 1 to 4 carbon atoms. Examples of straight-chain or branched C1-C8 alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, the isomeric pentyls, isomeric hexyls, isomeric heptyls, and isomeric octyls, particularly methyl, ethyl, propyl, butyl, and pentyl. A specific example of alkyl is methyl. Further examples of alkyl are mono-, di-, or trifluoromethyl, ethyl, or propyl, such as cyclopropyl (cPr) or mono-, di-, or trifluorocyclopropyl.
[0059] The term "alkoxy," alone or in combination, means a radical of the formula alkyl-O-, wherein the term "alkyl" has the meaning given above, such as methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, sec.butoxy, and tert.butoxy. A particular "alkoxy" is methoxy.
[0060] The term "protecting group," alone or in combination, refers to a group that selectively blocks a reactive site in a polyfunctional compound so that a chemical reaction can occur selectively at an other, unprotected reactive site. The protecting group can be removed. Examples of protecting groups are amino-, carboxy-, or hydroxy-protecting groups.
[0061] If one of the starting materials or compounds of the present invention contains one or more functional groups that are unstable or reactive under one or more reaction steps, a suitable protecting group (e.g., as described in "Protective Groups in Organic Chemistry" by T.W. Greene and P.G.M. Wuts, 3rd Ed., 1999, Wiley, New York) can be introduced before a critical step by applying methods well known in the art. Such protecting groups can be removed at a later stage of the synthesis using standard methods described in the literature. Examples of protecting groups are tert-butoxycarbonyl (Boc), 9-fluorenylmethylcarbamate (Fmoc), 2-trimethylsilylethylcarbamate (Teoc), carbobenzyloxy (Cbz), and p-methoxybenzyloxycarbonyl (Moz).
[0062] The compounds described herein may contain several asymmetric centers and may exist in the form of optically pure enantiomers, enantiomeric mixtures such as racemates, diastereomeric mixtures, diastereomeric racemates or diastereomeric racemic mixtures.
[0063] As used herein, the term "bicyclic sugar" refers to a modified sugar moiety containing a 4- to 7-membered ring that includes a bridge connecting two atoms of the 4- to 7-membered ring to form a second ring resulting in a bicyclic structure. In certain embodiments, the bridge connects C2' and C4' of the ribose sugar ring of the nucleoside (i.e., a 2'-4' bridge), as observed in LNA nucleosides.
[0064] As used herein, a "coding region" or "coding sequence" is a portion of a polynucleotide consisting of codons translatable into amino acids. A "stop codon" (TAG, TGA, or TAA) is generally not translated into an amino acid but may be considered part of the coding region; however, any adjacent sequences, such as promoters, ribosome binding sites, transcription terminators, introns, untranslated regions ("UTRs"), etc., are not part of the coding region. The boundaries of a coding region are generally determined by a start codon at the 5'-terminus, which encodes the amino terminus of the resulting polypeptide, and a translation stop codon at the 3'-terminus, which encodes the carboxyl terminus of the resulting polypeptide.
[0065] As used herein, the term "non-coding region" refers to a nucleotide sequence that is not a coding region. Examples of non-coding regions include, but are not limited to, promoters, ribosome binding sites, transcription terminators, introns, untranslated regions ("UTRs"), non-coding exons, etc. Some exons are entirely or part of the 5' untranslated region (5'UTR) or 3' untranslated region (3'UTR) of each transcript. Untranslated regions are important for efficient translation of transcripts and for controlling the translation rate and half-life of the transcript.
[0066] The term "region," when used in the context of a nucleotide sequence, refers to a portion of that sequence. For example, the terms "region within a nucleotide sequence" or "region within the complement of a nucleotide sequence" refer to a sequence that is shorter than a particular nucleotide sequence but at least 10 nucleotides longer, located within the nucleotide sequence or the complement of the nucleotide sequence, respectively. The terms "subsequence" or "subsequence" can also refer to a region of a nucleotide sequence.
[0067] The term "downstream," when referring to a nucleotide sequence, means that the nucleic acid or nucleotide sequence is located 3' of a reference nucleotide sequence. In some embodiments, the downstream nucleotide sequence refers to the sequence following the transcription start site. For example, the translation start codon of a gene is located downstream of the transcription start site.
[0068] The term "upstream" refers to a nucleotide sequence located 5' to a reference nucleotide sequence.
[0069] As used herein, the term "regulatory region" refers to a nucleotide sequence located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding region that influences the transcription, RNA processing, stability, or translation of the associated coding region. Regulatory regions can include promoters, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing sites, effector binding sites, UTRs, and stem-loop structures. If the coding region is intended for expression in eukaryotic cells, polyadenylation signals and transcription termination sequences are usually located 3' of the coding sequence.
[0070] As used herein, the term "transcript" refers to a primary transcript synthesized by transcription of DNA and processed into messenger RNA (mRNA), i.e., precursor messenger RNA (pre-mRNA) and the processed mRNA itself. The term "transcript" can be used interchangeably with "pre-mRNA" and "mRNA." After a DNA strand is transcribed into a primary transcript, the newly synthesized primary transcript is modified in several ways to be converted into a mature, functional form to produce various proteins and RNAs, such as mRNA, tRNA, rRNA, lncRNA, miRNA, and others. Thus, the term "transcript" can include exons, introns, 5'UTR, and 3'UTR.
[0071] As used herein, the term "expression" refers to the process by which a polynucleotide produces a gene product, e.g., an RNA or a polypeptide. It includes, but is not limited to, transcription of a polynucleotide into messenger RNA (mRNA) and translation of mRNA into a polypeptide. Expression produces a "gene product." As used herein, a gene product can be a nucleic acid, e.g., a messenger RNA produced by transcription of a gene, or a polypeptide translated from a transcript. Gene products as described herein further include post-transcriptional modifications, e.g., polyadenylated or spliced nucleic acids, or post-translational modifications, e.g., methylation, glycosylation, lipid addition, conjugation to other protein subunits, or proteolytic cleavage of polypeptides.
[0072] As used herein, the term "identity" refers to the percentage of nucleotides in a contiguous nucleotide sequence in a nucleic acid molecule (e.g., an oligonucleotide) that are identical to a reference sequence (e.g., a sequence motif) over a contiguous nucleotide sequence. The percentage of identity is calculated by counting the number of aligned nucleobases that are identical (matched) between two sequences (the contiguous nucleotide sequence of a compound of the invention and the reference sequence), dividing by the total number of nucleotides in the oligonucleotide, and multiplying by 100. Therefore, the percentage of identity = (matches x 100) / length of the aligned region (e.g., contiguous nucleotide sequence). Insertions and deletions are not allowed in calculating the percentage identity of a contiguous nucleotide sequence. When determining identity, chemical modifications of nucleobases are disregarded (e.g., 5-methylcytosine is considered identical to cytosine for purposes of calculating percent identity), so long as the nucleobase retains its functional ability to form Watson-Crick base pairs (e.g., 5-methylcytosine is considered identical to cytosine for purposes of calculating percent identity).
[0073] Different regions in a single polynucleotide target sequence aligned with a polynucleotide control sequence can each have their own percent sequence identity.It is noted that percent sequence identity values can be rounded up to 1 / 10.For example, 80.11, 80.12, 80.13 and 80.14 are rounded down to 80.1, while 80.15, 80.16, 80.17, 80.18 and 80.19 are rounded up to 80.2.It is also noted that length values are always integers.
[0074] As used herein, the terms "homology" and "homology" are interchangeable with the terms "identity" and "same."
[0075] The term "naturally occurring variant thereof" refers to a variant of an ANGPTL2 polypeptide sequence or an ANGPTL2 nucleic acid sequence (e.g., a transcript) that occurs naturally within a defined taxon, such as a mammal, including a mouse, monkey, and human. Generally, when referring to a "naturally occurring variant" of a polynucleotide, the term also encompasses any allelic variant of ANGPTL2-encoding genomic DNA found at chromosomal location 9q33.3 due to chromosomal translocation or duplication (i.e., the reverse complement of residues 127,087,349 to 127,122,765 of GenBank Accession No. NC_000009.12) and RNA, such as mRNA, derived therefrom. A "naturally occurring variant" may also include a variant resulting from alternative splicing of the ANGPTL2 mRNA. When referring to a particular polypeptide sequence, for example, the term also includes naturally occurring forms of the protein, which may therefore be processed by co- or post-translational modifications, such as signal peptide cleavage, proteolytic cleavage, glycosylation, etc.
[0076] The terms "corresponding" and "corresponding to," when referring to two distinct nucleic acid or nucleotide sequences, can be used to designate regions of sequences that correspond or are similar to each other based on homology and / or functionality, although the number of nucleotides in a particular sequence may differ. For example, various isoforms of a gene transcript may have similar or conserved portions of nucleotide sequence, the numbering of which may differ in each isoform based on alternative splicing and / or other modifications. Furthermore, it is recognized that various numbering systems (e.g., numbering gene transcripts and sequences starting from the translation initiation codon or including the 5'UTR) can be used when characterizing nucleic acid or nucleotide sequences. Furthermore, the nucleic acid or nucleotide sequences of various variants of a gene or gene transcript may differ. However, as used herein, regions of variants that share nucleic acid or nucleotide sequence homology and / or functionality are considered to "correspond" to each other. For example, the nucleotide sequence of an ANGPTL2 transcript corresponding to nucleotides X through Y of SEQ ID NO:1 (the "reference sequence") refers to an ANGPTL2 transcript sequence (e.g., an ANGPTL2 pre-mRNA or mRNA) having an identical or similar sequence to nucleotides X through Y of SEQ ID NO:1, where X is the start site and Y is the end site (as shown in Figure 2). One skilled in the art can identify the corresponding X and Y residues in an ANGPTL2 transcript sequence by aligning the ANGPTL2 transcript sequence with SEQ ID NO:1.
[0077] The terms "corresponding nucleotide analog" and "corresponding nucleotide" are intended to indicate that the nucleic acid base in the nucleotide analog and the naturally occurring nucleotide have the same pairing or hybridization ability. For example, when the 2-deoxyribose unit of a nucleotide is linked to adenine, the "corresponding nucleotide analog" contains a pentose unit (different from 2-deoxyribose) linked to adenine.
[0078] The term "complementarity" refers to the ability of nucleosides / nucleotides to form Watson-Crick base pairs. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A)-thymine (T) / uracil (U). Oligonucleotides can contain nucleosides with modified nucleobases; for example, 5-methylcytosine (an example of the corresponding nucleotide analog of cytosine) is often used in place of cytosine. As such, the term "complementarity" is understood to encompass Watson-Crick base pairing between unmodified and modified nucleobases (see, e.g., Hirao et al. (2012) Accounts of Chemical Research, vol. 45, p. 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry, Suppl. 37, 1.4.1). As used herein, the terms "reverse complement," "reverse complementary," and "reverse complementarity" are interchangeable with the terms "complement," "complementary," and "complementarity." In certain embodiments, the term "complementary" refers to a 100% match or complementarity (i.e., perfect complementarity) with a contiguous nucleic acid sequence within an ANGPTL2 transcript. In certain embodiments, the term "complementary" refers to at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% match or complementarity with a contiguous nucleic acid sequence within an ANGPTL2 transcript. 37 1.4.1).
[0079] As used herein, the term "% complementary" refers to the percentage of nucleotides in a contiguous nucleotide sequence in a nucleic acid molecule (e.g., an oligonucleotide) that are complementary to a reference sequence (e.g., a target sequence or sequence motif) across a contiguous nucleotide sequence. The percentage of complementarity is therefore calculated by counting the number of aligned nucleobases that are complementary (Watson-Crick base pairs) between two sequences (when aligning the oligonucleotide sequence 5'-3' and 3'-5' of the target sequence), dividing by the total number of nucleotides in the oligonucleotide, and multiplying by 100. In such a comparison, nucleobases / nucleotides that do not align (form base pairs) are referred to as mismatches. Insertions and deletions are not allowed in calculating the % complementarity of a contiguous nucleotide sequence. In determining complementarity, chemical modifications of nucleobases are disregarded as long as the nucleobases retain the functional ability to form Watson-Crick base pairs (e.g., 5'-methylcytosine is considered identical to cytosine for purposes of calculating % identity).
[0080] The term "fully complementary" refers to 100% complementarity.
[0081] As used herein, the term "hybridize" or "hybridize" refers to two nucleic acid strands (e.g., an oligonucleotide and a target nucleic acid) forming hydrogen bonds between base pairs on opposite strands, thereby forming a duplex. The affinity of the binding between two nucleic acid strands is the strength of hybridization. The melting temperature (T), defined as the temperature at which half of the oligonucleotide becomes duplexed with the target nucleic acid, is also known as the melting temperature. m ) under physiological conditions, T m is not strictly proportional to affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515-537). The standard state Gibbs free energy ΔG° more accurately represents binding affinity, ΔG° = -RTln(K d ) where R is the gas constant and T is the absolute temperature, giving the dissociation constant (K d) Therefore, a very low ΔG° of the reaction between an oligonucleotide and a target nucleic acid reflects strong hybridization between the oligonucleotide and the target nucleic acid. ΔG° is the energy associated with the reaction when the aqueous concentration is 1M, pH is 7, and temperature is 37°C. The hybridization of an oligonucleotide to a target nucleic acid is a spontaneous reaction, and for spontaneous reactions, ΔG° is less than 0. ΔG° can be experimentally measured, for example, by using the isothermal titration calorimetry (ITC) method described by Hansen et al., 1965, Chem. Comm. 36-38 and Holdgate et al., 2005, Drug Discovery Today. Those skilled in the art are aware that commercially available devices are available for measuring ΔG°. ΔG° can also be numerically estimated using the nearest neighbor model described by Sugimoto et al., 1995, Biochemistry 34:11211-11216 and McTigue et al., 2004, Biochemistry 43:5388-5405, using appropriately derived thermodynamic parameters, as described by SantaLucia, 1998, Proc Natl Acad Sci USA. 95:1460-1465. To allow for modulation of its intended nucleic acid target by hybridization, the oligonucleotide of the present invention hybridizes to the target nucleic acid with an estimated ΔG° value of less than -10 kcal for an oligonucleotide that is 10 to 30 nucleotides long. In some embodiments, the degree or strength of hybridization is measured by the standard state Gibbs free energy ΔG°. The oligonucleotide may hybridize to the target nucleic acid with an estimated ΔG° value in the range of less than -10 kcal, for example, -15 kcal, for example, -20 kcal, and for example, -25 kcal, for an oligonucleotide that is 8 to 30 nucleotides in length. In some embodiments, the oligonucleotide hybridizes to the target nucleic acid with an estimated ΔG° value in the range of -10 to 60 kcal, for example, -12 to 40, for example, -15 to 30 kcal, or -16 to 27 kcal, for example, -18 to 25 kcal.
[0082] As used herein, the term "DES number" or "DES No." refers to a unique number assigned to a nucleotide sequence having a specific pattern of nucleosides (e.g., DNA) and nucleoside analogs (e.g., LNA). As used herein, ASO designs are indicated by a combination of uppercase and lowercase letters. For example, DES-0190 refers to the ASO sequence gagcctttacatgccg (SEQ ID NO: 5), which has an ASO design of LLDDDDDDDDDDDDLL (i.e., GAgcctttacatgcCG), where L (i.e., uppercase) indicates a nucleoside analog (e.g., LNA) and D (i.e., lowercase) indicates a nucleoside (e.g., DNA).
[0083] As used herein, the term "ASO number" or "ASO No." refers to a unique number assigned to a nucleotide sequence having a detailed chemical structure of components, such as nucleosides (e.g., DNA), nucleoside analogs (e.g., beta-D-oxy-LNA), nucleobases (e.g., A, T, G, C, U, or MC), and backbone structure (e.g., phosphorothioate or phosphorodiester). For example, ASO-0190 may refer to (5'-3')oxyGsoxyAsDNAgsDNAcsDNAcsDNAtsDNAtsDNAtsDNAasDNAcsDNAasDNAtsDNAgsDNAcsoxyMCsoxyG.
[0084] Annotations for ASO chemistry are as follows: beta-D-oxy LNA nucleotides are designated by oxyN, where N designates a nucleotide base such as thymine (T), uridine (U), cytosine (C), 5-methylcytosine (MC), adenine (A), or guanine (G), and thus include oxyA, oxyT, oxyMC, oxyC, and oxyG. DNA nucleotides are designated by DNAn, where lowercase n designates a nucleotide base such as thymine (t), uridine (u), cytosine (c), 5-methylcytosine (Mc), adenine (a), or guanine (g), and thus include DNAa, DNAt, DNAc, DNAMc, and DNAg. The letter M before C or c indicates 5-methylcytosine. The letter s indicates a phosphorothioate internucleotide linkage.
[0085] "Effectiveness" is usually IC unless otherwise specified. 50 or EC 50 The IC value is expressed in μM, nM, or pM. Potency can also be expressed as percent inhibition. 50 is the median inhibitory concentration of the therapeutic molecule. EC 50 is the median effective concentration of a therapeutic molecule relative to the vehicle or control (e.g., saline). In functional assays, the IC 50 EC is the concentration of a therapeutic molecule that reduces a biological response, e.g., mRNA transcription or protein expression, by 50% of the biological response achieved by the therapeutic molecule. 50 IC is the concentration of a therapeutic molecule that produces 50% of a biological response, e.g., mRNA transcription or protein expression. 50 or EC 50 can be calculated by a number of means known in the art.
[0086] As used herein, for example, the term "inhibition" of the expression of ANGPTL2 gene transcripts and / or ANGPTL2 protein refers to ASO that reduces the expression of ANGPTL2 gene transcripts and / or ANGPTL2 protein in cells or tissues.In some embodiments, the term "inhibition" refers to complete inhibition (100% inhibition or undetectable level) of ANGPTL2 gene transcripts or ANGPTL2 protein.In other embodiments, the term "inhibition" refers to at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 99% inhibition of ANGPTL2 gene transcripts and / or ANGPTL2 protein expression in cells or tissues.
[0087] "Subject" or "individual" or "animal" or "patient" or "mammal" refers to any subject, particularly a mammalian subject, for whom diagnosis, prognosis, or treatment is desired. Mammalian subjects include, for example, humans, domestic animals, farm animals, sport animals, and zoo animals, including humans, non-human primates, dogs, cats, guinea pigs, rabbits, rats, mice, horses, cows, bears, etc.
[0088] The term "pharmaceutical composition" refers to a preparation that is in a form that allows the biological activity of the active ingredient to be effective and does not contain additional ingredients that are unacceptably toxic to the subject to which the composition is administered. Such compositions may be sterile.
[0089] An "effective amount" of an ASO disclosed herein is an amount sufficient to carry out a specifically stated purpose. An "effective amount" can be determined empirically and routinely in relation to the stated purpose.
[0090] The terms "treat" or "treatment" or "for treating" or "alleviate" or "for alleviation," etc., refer to both (1) therapeutic measures that cure, slow, reduce, and / or halt the progression of symptoms of a diagnosed pathological condition or disorder, and (2) prophylactic or preventative measures that prevent and / or delay the onset of the target pathological condition or disorder. Thus, those in need of treatment include those already with the disorder; those predisposed to having the disorder; and those in whom the disorder is to be prevented. In certain embodiments, a subject is successfully "treated" for a disease or condition disclosed elsewhere herein if the patient exhibits, for example, complete, partial, or transient reduction or elimination of symptoms associated with the disease or disorder.
[0091] II. Antisense Oligonucleotides Targeting ANGPTL2 The present invention employs antisense oligonucleotides (ASOs) for use in modulating the function of ANGPTL2 nucleic acids, e.g., nucleic acid molecules encoding mammalian ANGPTL2, such as ANGPTL2 transcripts, including ANGPTL2 precursor mRNA and ANGPTL2 mRNA, or naturally occurring variants of such nucleic acid molecules encoding mammalian ANGPTL2. In the context of this specification, the term "ASO" refers to a molecule formed by the covalent linkage of two or more nucleotides (i.e., oligonucleotides).
[0092] An ASO comprises a contiguous nucleotide sequence of about 10 to about 30, e.g., 10-20, 14-20, 16-20, or 15-25 nucleotides in length. In some embodiments, the ASOs disclosed herein are 15-20 nucleotides in length. As used herein, the terms "antisense ASO," "antisense oligonucleotide," and "oligomer" are interchangeable with the term "ASO."
[0093] Citation of a SEQ ID NO: includes the specific nucleic acid base sequence, but does not include the complete chemical structure of any design. Furthermore, the ASOs shown in the figures herein represent representative designs, but are not limited to the specific design shown in the figures unless otherwise specified. Herein, a single nucleotide (unit) may also be referred to as a monomer or unit. When a specific ASO number is cited herein, the reference includes the sequence, the specific ASO design, and the chemical structure. When a specific DES number is cited herein, the reference includes the sequence and the specific ASO design. For example, when SEQ ID NO:5 is cited in the claims (or this specification), it includes only the nucleotide sequence gagcctttacatgccg. When DES-0190 is cited in the claims (or this specification), it includes the nucleotide sequence gagcctttacatgccg with the ASO design GAgcctttacatgcCG. Alternatively, the design of ASO-0190 can be described as SEQ ID NO:5, where the first, second, 15th, and 16th nucleotides from the 5' end are modified nucleotides, e.g., LNA, and each of the other nucleotides is an unmodified nucleotide (e.g., DNA). The ASO number includes the sequence and ASO design, as well as specific details of the ASO. Thus, for example, ASO-0190 described herein refers to: oxyGsoxyAsDNAgsDNAcsDNAcsDNAtsDNAtsDNAtsDNAasDNAcsDNAasDNAtsDNAgsDNAcsoxyMCsoxyG, where "s" indicates a phosphorothioate linkage.
[0094] In various embodiments, the ASO of the present invention does not contain RNA (units). In some embodiments, the ASO contains one or more DNA units. In some embodiments, the ASO of the present invention is a linear molecule or is synthesized as a linear molecule. In some embodiments, the ASO is a single-stranded molecule and does not contain a short region, e.g., at least 3, 4, or 5 consecutive nucleotides, that is complementary to an equivalent region within the same ASO (i.e., double-stranded) - in this regard, the ASO is not (essentially) double-stranded. In some embodiments, the ASO is not essentially double-stranded. In some embodiments, the ASO is not siRNA. In various embodiments, the ASO of the present invention can comprise the entire continuous nucleotide region. Thus, in some embodiments, the ASO is not substantially self-complementary.
[0095] In other embodiments, the invention includes fragments of ASOs. For example, the invention includes at least one nucleotide, at least two contiguous nucleotides, at least three contiguous nucleotides, at least four contiguous nucleotides, at least five contiguous nucleotides, at least six contiguous nucleotides, at least seven contiguous nucleotides, at least eight contiguous nucleotides, or at least nine contiguous nucleotides of an ASO disclosed herein. Fragments of any of the sequences disclosed herein are contemplated as part of the invention.
[0096] II.A. Target Suitably, the ASO of the present invention can downregulate (for example, reduce or eliminate) the expression of ANGPTL2 mRNA or protein.In this regard, the ASO of the present invention can generally affect the indirect inhibition of ANGPTL2 protein in mammalian cells, such as human cells, through the reduction of ANGPTL2 mRNA level.In particular, the present invention relates to ASO that targets one or more regions of ANGPTL2 mRNA precursor (for example, intron region, exon region, and / or exon-intron junction region).
[0097] Angiopoietin-related protein 2 (ANGPTL2) is also known as angiopoietin-like protein 2, ARP2, HARP, ARAP1, and angiopoietin-like 2. The sequence of the ANGPTL2 gene can be found under publicly available GenBank Accession No. NC_000009.12. The sequence of the ANGPTL2 pre-mRNA transcript (SEQ ID NO: 1) corresponds to the reverse complement of residues 127,087,349 to 127,122,765 of NC_000009.12. The sequence of the ANGPTL2 protein is available under publicly available Accession Nos. NP_036230.1 (canonical sequence), XP_006717093.1, and Q9UKU9-2.
[0098] Variants of the human ANGPTL2 gene product are known. For example, the sequence of ANGPTL2 isoform X1 (Accession No. XP_006717093.1; SEQ ID NO: 194) differs from the canonical sequence (SEQ ID NO: 3) as follows: 274-274: P→L; and 275-493: deletion. The sequence of ANGPTL2 isoform 2 (Accession No. Q9UKU9-2; SEQ ID NO: 195) differs from the canonical sequence (SEQ ID NO: 3) as follows: 1-302: deletion. Thus, the ASOs disclosed herein can be designed to reduce or inhibit expression of natural variants of the ANGPTL2 protein.
[0099] An example of a target nucleic acid sequence for an ASO is ANGPTL2 pre-mRNA. SEQ ID NO: 1 represents the human ANGPTL2 genomic sequence (i.e., the reverse complement of nucleotides 127,087,349 to 127,122,765 of GenBank Accession No. NC_000009.12). SEQ ID NO: 1 is identical to the ANGPTL2 pre-mRNA sequence, except that the nucleotide "t" in SEQ ID NO: 1 is represented as "u" in the pre-mRNA. In certain embodiments, the "target nucleic acid" comprises an ANGPTL2 protein-encoding nucleic acid or a naturally occurring variant thereof and an RNA nucleic acid derived therefrom, e.g., an intron of a pre-mRNA. In other embodiments, the target nucleic acid comprises an ANGPTL2 protein-encoding nucleic acid or a naturally occurring variant thereof and an RNA nucleic acid derived therefrom, e.g., an exon region of a pre-mRNA. In yet other embodiments, the target nucleic acid comprises an ANGPTL2 protein-encoding nucleic acid or a naturally occurring variant thereof and an RNA nucleic acid derived therefrom, e.g., an exon-intron junction of a pre-mRNA. In some embodiments, for example, when used in research or diagnostics, the "target nucleic acid" can be a cDNA or a synthetic oligonucleotide derived from the DNA, or an RNA nucleic acid target. The ANGPTL2 protein sequence encoded by the ANGPTL2 pre-mRNA is shown as SEQ ID NO: 3. See Figures 1C and 1D. In other embodiments, the target nucleic acid includes the untranslated region, for example, 5'UTR, 3'UTR, or both, of the ANGPTL2 protein-encoding nucleic acid or a naturally occurring variant thereof.
[0100] In certain embodiments, an ASO of the invention hybridizes to a region within an intron of an ANGPTL2 transcript, e.g., SEQ ID NO: 1. In certain embodiments, an ASO of the invention hybridizes to a region within an exon of an ANGPTL2 transcript, e.g., SEQ ID NO: 1. In other embodiments, an ASO of the invention hybridizes to a region within an exon-intron junction of an ANGPTL2 transcript, e.g., SEQ ID NO: 1. In certain embodiments, an ASO of the invention hybridizes to a region within an ANGPTL2 transcript (e.g., an intron, exon, or exon-intron junction), e.g., SEQ ID NO: 1, wherein the ASO has a design of the formula: 5' ABC 3', as described elsewhere herein (e.g., in Section II.G).
[0101] In some embodiments, the ASO targets mRNA encoding a specific isoform of the ANGPTL2 protein (see isoforms in Figure ID). In some embodiments, the ASO targets all isoforms of the ANGPTL2 protein.
[0102] In certain embodiments, the ASO comprises a contiguous nucleotide sequence (eg, 10-30 nucleotides in length) that is complementary to a nucleic acid sequence within an ANGPTL2 transcript, eg, a region corresponding to SEQ ID NO:1. In certain embodiments, the ASO comprises a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence or region within the sequence ("target region") of an ANGPTL2 transcript, wherein the nucleic acid sequence corresponds to (i) nucleotides 1-211 of SEQ ID NO:1; (ii) nucleotides 471-686 of SEQ ID NO:1; (iii) nucleotides 1,069-1,376 of SEQ ID NO:1; (iv) nucleotides 1,666-8,673 of SEQ ID NO:1; (v) nucleotides 8,975-12,415 of SEQ ID NO:1; (vi) nucleotides 12,739-18,116 of SEQ ID NO:1; (vii) nucleotides 18,422-29,875 of SEQ ID NO:1; or (viii) nucleotides 30,373-35,389 of SEQ ID NO:1, wherein, optionally, the ASO has one of the designs described herein or chemical structures shown elsewhere herein (e.g., Figure 1).
[0103] In certain embodiments, the target region corresponds to nucleotides 87-111 of SEQ ID NO:1. In other embodiments, the target region corresponds to nucleotides 571-586 of SEQ ID NO:1. In certain embodiments, the target region corresponds to nucleotides 1,169-1,276 of SEQ ID NO:1. In further embodiments, the target region corresponds to nucleotides 1,766-8,573 of SEQ ID NO:1. In certain embodiments, the target region corresponds to nucleotides 9,075-12,315 of SEQ ID NO:1. In certain embodiments, the target region corresponds to nucleotides 12,839-18,016 of SEQ ID NO:1. In further embodiments, the target region corresponds to nucleotides 18,522-29,775 of SEQ ID NO:1. In certain embodiments, the target region corresponds to nucleotides 30,473-35,289 of SEQ ID NO:1.
[0104] In certain embodiments, the target region corresponds to nucleotides 87-111 of SEQ ID NO: 1 ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' and / or 5' end. In other embodiments, the target region corresponds to nucleotides 571-586 of SEQ ID NO: 1 ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' and / or 5' end. In certain embodiments, the target region corresponds to nucleotides 1,169-1,276 of SEQ ID NO: 1 ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' and / or 5' end. In certain embodiments, the target region corresponds to nucleotides 1,766 to 8,573 ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' and / or 5' end of SEQ ID NO: 1. In certain embodiments, the target region corresponds to nucleotides 9,075 to 12,315 ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' and / or 5' end of SEQ ID NO: 1. In further embodiments, the target region corresponds to nucleotides 12,839 to 18,016 ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' and / or 5' end of SEQ ID NO: 1. In certain embodiments, the target region corresponds to nucleotides 18,522 to 29,775 ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' and / or 5' end of SEQ ID NO: 1. In certain embodiments, the target region corresponds to nucleotides 30,473 to 35,289 ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' and / or 5' end of SEQ ID NO: 1.
[0105] In certain embodiments, the target region corresponds to nucleotides 20,103-20,282 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 20,103-20,282 of SEQ ID NO: 1 ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In certain embodiments, the target region corresponds to nucleotides 20,202-20,221 of SEQ ID NO: 1 ±1, ±5, ±10, ±15, ±20, or ±25 nucleotides at the 3'-end and / or 5'-end of nucleotides 20,202-20,221 of SEQ ID NO: 1.
[0106] In some embodiments, the ASOs of the invention hybridize to multiple target regions within the ANGPTL2 transcript (e.g., precursor mRNA, SEQ ID NO: 1). In some embodiments, the ASOs hybridize to two different target regions within the ANGPTL2 transcript. In some embodiments, the ASOs hybridize to three different target regions within the ANGPTL2 transcript. In some embodiments, ASOs that hybridize to multiple regions within the ANGPTL2 transcript (e.g., precursor mRNA, SEQ ID NO: 1) exhibit a stronger reduction in ANGPTL2 expression (e.g., a lower EC 50 (having the following characteristics).
[0107] In some embodiments, the ASO of the present invention can hybridize with a target nucleic acid (e.g., an ANGPTL2 transcript) under physiological conditions, i.e., in vivo conditions. In some embodiments, the ASO of the present invention can hybridize with a target nucleic acid (e.g., an ANGPTL2 transcript) in vitro. In some embodiments, the ASO of the present invention can hybridize with a target nucleic acid (e.g., an ANGPTL2 transcript) in vitro under stringent conditions. The stringency conditions for in vitro hybridization depend, among other factors, on production cell uptake, RNA accessibility, temperature, binding free energy, salt concentration, and time (see, e.g., Stanley T Crooke, Antisense Drug Technology: Principles, Strategies and Applications, 2009). nd (See, e.g., "The Journal of Biochemistry," Vol. 1, No. 1, pp. 111-114, 2007, CRC Press, 2007). Generally, high- to moderate-stringency conditions are used in in vitro hybridization to allow hybridization between substantially similar nucleic acids, but not between dissimilar nucleic acids. An example of stringent hybridization conditions includes hybridization in 5x saline-sodium citrate (SSC) buffer (0.75 M sodium chloride / 0.075 M sodium citrate) for 1 hour at 40°C, followed by washing the sample 10 times in 1x SSC at 40°C and 5 times in 1x SSC buffer at room temperature. In vivo hybridization conditions consist of intracellular conditions (e.g., physiological pH and intracellular ionic conditions) that determine hybridization of antisense oligonucleotides with target sequences. In vivo conditions can be mimicked in vitro by using relatively low stringency conditions. For example, hybridization can be performed in vitro in 2×SSC (0.3 M sodium chloride / 0.03 M sodium citrate), 0.1% SDS at 37° C. A wash solution containing 4×SSC, 0.1% SDS at 37° C. can be used, with a final wash in 1×SSC at 45° C.
[0108] In certain embodiments, the ASOs of the present invention can downregulate ANGPTL2 transcripts from one or more species (e.g., humans, non-human primates, dogs, cats, guinea pigs, rabbits, rats, mice, horses, cows, and bears). In certain embodiments, the ASOs disclosed herein can downregulate ANGPTL2 transcripts in both humans and rodents (e.g., mice or rats). Thus, in certain embodiments, the ASOs can downregulate (e.g., reduce or eliminate) the expression of ANGPTL2 mRNA or ANGPTL2 protein in both humans and rodents (e.g., mice or rats).
[0109] The sequence of mouse ANGPTL2 transcript is known in the art. For example, the sequence of mouse ANGPTL2 gene can be obtained under the public GenBank Accession Number NC_000068.7. The sequence of mouse ANGPTL2 pre-mRNA transcript corresponds to residues 33,215,951 to 33,247,725 of NC_000068.7. The sequence of mouse ANGPTL2 pre-mRNA transcript is known and available under Accession Numbers: NM_011923.4 (SEQ ID NO: 196), XM_006498051.1 (SEQ ID NO: 197), BC138610.1 (SEQ ID NO: 198) and BC138609.1 (SEQ ID NO: 199). The sequence of the mouse ANGPTL2 protein is available under the publicly available Accession Numbers: NP_036053.2 (SEQ ID NO: 200), Q9R045.2 (SEQ ID NO: 201), EDL08598.1 (SEQ ID NO: 202), EDL08597.1 (SEQ ID NO: 203), AAI38611.1 (SEQ ID NO: 204), AAI38610.1 (SEQ ID NO: 205) and XP_006498114.1 (SEQ ID NO: 206).
[0110] The sequence of the rat ANGPTL2 transcript is also known in the art. The rat ANGPTL2 gene can be found under the publicly available GenBank Accession Number NC_005102.4. The sequence of the rat ANGPTL2 pre-mRNA transcript corresponds to residues 12,262,822 to 12,292,665 of NC_005102.4. The sequence of the rat ANGPTL2 mRNA transcript is known and available under Accession Number: NM_133569.1 (SEQ ID NO: 207). The sequence of the rat ANGPTL2 protein is available under the publicly available Accession Numbers: NP_598253.1 (SEQ ID NO: 208) and EDL93193.1 (SEQ ID NO: 209).
[0111] II.B. ASO Sequence An ASO of the invention comprises a contiguous nucleotide sequence corresponding to the complement of a region of an ANGPTL2 transcript, eg, a nucleotide sequence corresponding to SEQ ID NO:1.
[0112] In certain embodiments, the invention provides ASOs of 10 to 30, e.g., 10 to 15, 10 to 20, or 10 to 25 nucleotides in length (e.g., 15 to 20 nucleotides in length), wherein the contiguous nucleotide sequence has at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to a region within the complement of an ANGPTL2 transcript, such as SEQ ID NO: 1 or a naturally occurring variant thereof. Thus, for example, the ASO hybridizes to a single-stranded nucleic acid molecule having the sequence of SEQ ID NO: 1, or a portion thereof.
[0113] An ASO can comprise a contiguous nucleotide sequence that is sufficiently complementary (fully complementary) to an equivalent region of a nucleic acid encoding a mammalian ANGPTL2 protein (e.g., SEQ ID NO: 1). An ASO can comprise a contiguous nucleotide sequence that is sufficiently complementary (fully complementary) to a nucleic acid sequence or region within a sequence corresponding to nucleotides XY of SEQ ID NO: 1, where X and Y are the start and end sites, respectively, as shown in Figure 2.
[0114] In one embodiment, the nucleotide sequence or contiguous nucleotide sequence of an ASO of the invention has at least about 80% sequence identity, e.g., at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96% sequence identity, at least about 97% sequence identity, at least about 98% sequence identity, at least about 99% sequence identity, e.g., about 100% sequence identity (homology), to a sequence selected from SEQ ID NOs: 4-193 (i.e., the sequences in Figure 2). In one embodiment, the ASO has a design described elsewhere herein or a chemical structure shown elsewhere herein (e.g., Figure 2).
[0115] In one embodiment, the ASO (or a portion of consecutive nucleotides thereof) is selected from or comprises one of the sequences selected from the group consisting of SEQ ID NOs: 4-193, or a region of at least 10 consecutive nucleotides thereof, wherein the ASO (or a portion of consecutive nucleotides thereof) optionally comprises one or two mismatches when compared to the corresponding ANGPTL2 transcript.
[0116] In one embodiment, the ASO (or a portion of consecutive nucleotides thereof) is selected from or comprises one of the sequences selected from the group consisting of SEQ ID NOs: 4-193, or a region of at least 12 consecutive nucleotides thereof, wherein the ASO (or a portion of consecutive nucleotides thereof) may optionally contain one or two mismatches when compared to the corresponding ANGPTL2 transcript.
[0117] In one embodiment, the ASO (or a portion of consecutive nucleotides thereof) is selected from or comprises one of the sequences selected from the group consisting of SEQ ID NOs: 4-193, or a region of at least 14 consecutive nucleotides thereof, wherein the ASO (or a portion of consecutive nucleotides thereof) may optionally contain one or two mismatches when compared to the corresponding ANGPTL2 transcript.
[0118] In one embodiment, the ASO (or a portion of consecutive nucleotides thereof) is selected from or comprises one of the sequences selected from the group consisting of SEQ ID NOs: 4-193, or a region of at least 15 or 16 consecutive nucleotides thereof, wherein the ASO (or a portion of consecutive nucleotides thereof) may optionally contain one or two mismatches when compared to the corresponding ANGPTL2 transcript.
[0119] In certain embodiments, the ASO comprises a sequence selected from the group consisting of SEQ ID NO:8, SEQ ID NO:20, SEQ ID NO:38, SEQ ID NO:46, SEQ ID NO:76, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:85, SEQ ID NO:87, SEQ ID NO:89, SEQ ID NO:90, SEQ ID NO:93, SEQ ID NO:95, SEQ ID NO:97, SEQ ID NO:101, SEQ ID NO:111, SEQ ID NO:116, SEQ ID NO:119, SEQ ID NO:121, SEQ ID NO:122, SEQ ID NO:132, SEQ ID NO:141, SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO:144, SEQ ID NO:146, and combinations thereof.
[0120] In certain embodiments, the ASO comprises a sequence selected from the group consisting of SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:121, SEQ ID NO:122, and combinations thereof.
[0121] In one embodiment, the ASO of the invention binds to a target nucleic acid sequence (e.g., an ANGPTL2 transcript) and inhibits or reduces expression of the ANGPTL transcript by at least 10% or 20% compared to the normal (i.e., control) expression level in the cell, for example, by at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% compared to the normal expression level (e.g., the expression level in a cell not exposed to the ASO).
[0122] In certain embodiments, an ASO of the invention can reduce ANGPTL2 mRNA expression in SK-N-AS cells in vitro by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% when the cells are contacted with 25 μM ASO, compared to SK-N-AS cells not contacted with the ASO (e.g., contacted with saline).
[0123] In certain embodiments, an ASO of the invention can reduce ANGPTL2 mRNA expression in SK-N-AS cells in vitro by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% when the cells are contacted with 5 μM ASO, compared to SK-N-AS cells not contacted with the ASO (e.g., contacted with saline).
[0124] In one embodiment, the ASO of the present invention has at least one property selected from the group consisting of: (i) reducing mRNA levels encoding ANGPTL2 in SK-N-AS cells; (ii) reducing ANGPTL2 protein levels in SK-N-AS cells; (iii) reducing, alleviating, or treating one or more symptoms of a cardiovascular disease or disorder, and (iv) any combination thereof.
[0125] In certain embodiments, the ASO, or its contiguous nucleotide sequence, when hybridized with a target sequence can tolerate one or two mismatches and still bind sufficiently to the target and exhibit the desired effect, i.e., downregulation of the target mRNA and / or protein. Mismatches can be offset by, for example, increasing the length of the ASO nucleotide sequence and / or increasing the number of nucleotide analogs, as disclosed elsewhere herein.
[0126] In some embodiments, the ASO or its contiguous nucleotide sequence contains no more than one mismatch when hybridized to the target sequence. In other embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence contains no more than one mismatch, and preferably no mismatch, when hybridized to the target sequence.
[0127] II.C. ASO Chief An ASO can comprise a contiguous nucleotide sequence totaling 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 contiguous nucleotides in length. When a range is given for the length of an ASO or contiguous nucleotide sequence, the range includes the minimum and maximum lengths of the range provided, e.g., 10 to 30 (or between 10 and 30) includes both 10 and 30.
[0128] In certain embodiments, the ASO comprises a contiguous nucleotide sequence totaling about 15-20, 15, 16, 17, 18, 19, or 20 contiguous nucleotides in length.
[0129] II.D. Nucleosides and Nucleoside Analogues In some embodiments of the present invention, ASO comprises one or more non-naturally occurring nucleoside analogs. As used herein, "nucleoside analogs" refer to variants of natural nucleosides, such as DNA or RNA nucleosides, due to modifications in sugar and / or base moieties. In principle, analogs are simply "unchanged" or "equivalent" to natural nucleosides in oligonucleotides, i.e., they have no functional effect on the process by which oligonucleotides inhibit target gene expression. Such "equivalent" analogs can still be useful, for example, if they are easy or inexpensive to produce, or more stable under storage or production conditions, or represent tags or labels. However, in some embodiments, analogs have a functional effect on the process by which ASOs inhibit expression, for example, by increasing binding affinity to the target and / or increasing resistance to intracellular nucleases and / or increasing ease of transport into cells. Specific examples of nucleoside analogs are described, for example, in Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213, and in Scheme 1.
[0130] II.D.1. Nucleobases The term "nucleobase" refers to the purine (e.g., adenine and guanine) and pyrimidine (e.g., uracil, thymine, and cytosine) moieties present in nucleosides and nucleotides that form hydrogen bonds during nucleic acid hybridization. In the present disclosure, the term "nucleobase" also encompasses modified nucleobases that may differ from naturally occurring nucleobases but are functional during nucleic acid hybridization. In some embodiments, the nucleobase moiety is modified by nucleobase modification or substitution. As used herein, "nucleobase" refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine, as well as non-naturally occurring variants. Such variants are described, for example, in Hirao et al., (2012) Accounts of Chemical Research, vol. 45, page 2055, and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry, Suppl. 37, 1.4.1.
[0131] In certain embodiments, the nucleobase moiety is modified by changing the purine or pyrimidine to a modified purine or pyrimidine, such as a substituted purine or substituted pyrimidine, such as a nucleobase selected from isocytosine, pseudoisocytosine, 5-methyl-cytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil, 5-thiazolo-uracil, 2-thio-uracil, 2'thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.
[0132] Nucleobase moieties can be represented by the letter code of each corresponding nucleobase, for example, A, T, G, C, or U, where each letter optionally includes a functionally equivalent modified nucleobase. For example, in the exemplified oligonucleotide, the nucleobase moiety is selected from A, T, G, C, and 5-methyl-cytosine. Optionally, for LNA gapmers, 5-methyl-cytosine LNA nucleosides can be used.
[0133] II.D.2. Sugar modification The ASOs of the invention may contain one or more nucleosides having a modified sugar moiety, i.e., a sugar moiety that is modified when compared to the ribose sugar moiety found in DNA and RNA. Many nucleosides with modified ribose sugar moieties have been produced, primarily for the purpose of improving certain properties of oligonucleotides, such as affinity and / or nuclease resistance.
[0134] Such modifications include those in which the ribose ring structure is modified, for example, by substitution with a hexose ring (HNA) or, generally, a bicyclic ring having a biradical bridge between the C2' and C4' carbons of the ribose ring (LNA), or an unlinked ribose ring (e.g., UNA), which generally lacks a bond between the C2' and C3' carbons. Other sugar-modified nucleosides include, for example, bicyclohexose nucleic acids (WO 2011 / 017521) or tricyclic nucleic acids (WO 2013 / 154798). Modified nucleosides also include nucleosides in which the sugar moiety is replaced with a non-sugar moiety, for example, in the case of peptide nucleic acids (PNAs) or morpholino nucleic acids.
[0135] Sugar modifications also include modifications made by changing the substituents on the ribose ring to groups other than the hydrogen or 2'-OH group naturally found in RNA nucleosides. Substituents can be introduced, for example, at the 2', 3', 4', or 5' positions. Nucleosides with modified sugar moieties also include 2'-modified nucleosides, such as 2'-substituted nucleosides. Indeed, much more focus has been placed on the development of 2'-substituted nucleosides, and many 2'-substituted nucleosides have been found to have beneficial properties, such as nucleoside resistance and enhanced affinity, when incorporated into oligonucleotides.
[0136] II.D.2.a 2'-Modified Nucleosides 2' sugar-modified nucleosides are nucleosides that have a substituent other than H or -OH at the 2' position (2'-substituted nucleosides) or contain a 2'-linked biradical, including 2'-substituted nucleosides and LNA (2'-4' biradical bridge) nucleosides. For example, 2'-modified sugars can provide oligonucleotides with enhanced binding affinity (e.g., affinity-enhanced 2' sugar-modified nucleosides) and / or increased nuclease resistance. Examples of 2'-substituted modified nucleosides include 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), and 2'-fluoro-ANA nucleosides. For further examples, see, e.g., Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443; Uhlmann, Curr. Opinion in Drug Development, 2000, 3(2), 293-213; and Deleavy and Damha, Chemistry and Biology 2012, 19, 937. Below are diagrams of some 2'-substituted modified nucleosides. [ka]
[0137] II.D.2.b Locked nucleic acid nucleosides (LNAs). An "LNA nucleoside" is a 2'-modified nucleoside ("2'-4' bridge") that contains a biradical linking the C2' and C4' ends of the ribose sugar ring of the nucleoside, restricting or locking the conformation of the ribose ring. These nucleosides are also referred to in the literature as bridged nucleic acids or bicyclic nucleic acids (BNAs). The locking of the ribose conformation is associated with increased hybridization affinity (duplex stabilization) when LNAs are incorporated into oligonucleotides to complementary RNA or DNA molecules. This can be routinely determined by measuring the melting temperature of the oligonucleotide / complement duplex.
[0138] Non-limiting exemplary LNA nucleosides are described in WO99 / 014226, WO00 / 66604, WO98 / 039352, WO2004 / 046160, WO00 / 047599, WO2007 / 134181, WO2010 / 077578, WO2010 / 036698, WO2007 / 090071, WO2009 / 006478, WO2011 / 156202, WO2008 / 154401, WO2009 / 067647, WO2008 / 150729, Morita et al., Bioorganic & Med. Chem. Lett. 12, 73-76, Seth et al., J. Org. Chem. 2010, Vol 75(5) pp. 1569-81 and Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225-1238 and Wan and Seth, J. Medical Chemistry 2016, 59, 9645-9667.
[0139] Further non-limiting exemplary LNA nucleosides are disclosed in Scheme 1. [ka]
[0140] In some embodiments, the LNA nucleoside is beta-D-oxy-LNA, 6'-methyl-beta-D-oxy-LNA, such as (S)-6'-methyl-beta-D-oxy-LNA (ScET) or / and ENA. In some embodiments, the LNA is beta-D-oxy-LNA.
[0141] II.E Nuclease-mediated degradation Nuclease-mediated degradation is an oligonucleotide that, when duplexed with a complementary nucleotide sequence, is capable of mediating the degradation of such sequence.
[0142] In certain embodiments, oligonucleotides can function via nuclease-mediated degradation of target nucleic acids, where the oligonucleotides of the invention are capable of recruiting nucleases, particularly endoribonucleases (RNases), such as RNase H, e.g., RNase H1. Examples of oligonucleotide designs that act via a nuclease-mediated mechanism are oligonucleotides that generally contain a region of at least five or six DNA nucleosides, flanked on one or both sides by affinity-enhancing nucleosides, e.g., gapmers, headmers, and tailmers.
[0143] II.F. RNase H Activity and Recruitment The RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H and induce the degradation of complementary RNA molecules when duplexed with the complementary RNA molecule. WO01 / 23613 provides an in vitro method for determining RNase H activity, which can be used to determine the ability to recruit RNase H. Generally, an oligonucleotide is considered to be able to recruit RNase H if, when provided with a complementary target nucleic acid sequence, it has an initial rate, measured in pmol / l / min, of at least 5%, for example, at least 10% or 20% of the initial rate determined using an oligonucleotide that has the same base sequence as the modified oligonucleotide being tested, but contains only DNA monomers, and all monomers in the oligonucleotide are phosphorothioate linkages, and using the method provided in Examples 91-95 of WO01 / 23613. In certain embodiments, recombinant human RNase H1 can be used to determine the ability of an oligonucleotide to recruit RNase H and induce degradation of a complementary RNA molecule when duplexed with the complementary RNA molecule.
[0144] In one embodiment, an oligonucleotide is considered to be essentially incapable of recruiting RNase H if, when provided with a complementary target nucleic acid, it has an initial RNase H rate, measured in pmol / l / min, of less than 20%, e.g., less than 10%, e.g., less than 5%, of the determined initial rate using an oligonucleotide having the same base sequence as the test oligonucleotide but containing only DNA monomers, no 2' substitutions, and phosphorothioate linkages between all monomers in the oligonucleotide, and determined using the methods described in Examples 91-95 of WO 01 / 23613.
[0145] II.G. ASO Design The ASOs of the invention can contain nucleotide sequences containing both nucleosides and nucleoside analogs, and can be in the form of gapmers, blockmers, mixmers, headmers, tailmers, or totalmers. Examples of gapmer, blockmer, mixmer, headmer, tailmer, or totalmer configurations that can be used in the ASOs of the invention are described in U.S. Patent Publication 2012 / 0322851.
[0146] As used herein, the term "gapmer" refers to an antisense oligonucleotide containing a region (gap) of an RNase H-recruiting oligonucleotide flanked at 5' and 3' by one or more affinity-enhancing modified nucleosides (flanks). The terms "headmer" and "tailmer" refer to oligonucleotides that can recruit RNase H when one of the flanks is missing, i.e., when only one end of the oligonucleotide contains an affinity-enhancing modified nucleoside. For headmers, the 3' flank is missing (i.e., the 5' flank contains an affinity-enhancing modified nucleoside), and for tailmers, the 5' flank is missing (i.e., the 3' flank contains an affinity-enhancing modified nucleoside). The term "LNA gapmer" refers to a gapmer oligonucleotide in which at least one of the affinity-enhancing modified nucleosides is an LNA nucleoside. The term "mixed wing gapmer" refers to an LNA gapmer in which the flanking regions comprise at least one LNA nucleoside and at least one DNA nucleoside or a non-LNA modified nucleoside, such as at least one 2'-substituted modified nucleoside, such as 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), and 2'-fluoro-ANA nucleoside.
[0147] Other "chimeric" ASOs, termed "mixmers," consist of alternating compositions of (i) DNA or nucleoside analog monomers that are recognizable and cleavable by RNases and (ii) non-RNase recruiting nucleoside analog monomers.
[0148] A "totalmer" refers to a single-stranded ASO that contains only non-naturally occurring nucleotides or nucleotide analogs.
[0149] In some embodiments, in addition to enhancing the affinity of the ASO to the target region, some nucleoside analogs also mediate RNase (e.g., RNase H) binding and cleavage. Because α-L-LNA monomers recruit RNase H activity to some extent, in some embodiments, the gap region (e.g., region B herein) of an ASO containing α-L-LNA monomers has a reduced number of monomers that can be recognized and cleaved by RNase H, introducing greater flexibility into the mixer structure.
[0150] II.G.1. Gapmar Design In some embodiments, the ASO of the invention is a gapmer and includes a contiguous stretch of nucleotides (e.g., one or more DNAs) capable of recruiting an RNase, such as RNase H, herein referred to as region B (B), where region B is flanked on both the 5' and 3' ends by regions of nucleoside analogs 5' and 3' to the contiguous stretch of nucleotides in region B - these regions are referred to as regions A (A) and C (C), respectively. In some embodiments, the nucleoside analogs are sugar-modified nucleosides (e.g., high-affinity sugar-modified nucleosides). In some embodiments, the sugar-modified nucleosides in regions A and C enhance the affinity of the ASO for the target nucleic acid (i.e., affinity-enhancing 2'-sugar-modified nucleosides). In some embodiments, the sugar-modified nucleosides are 2'-sugar-modified nucleosides, such as LNA or a high-affinity 2'-sugar modification such as 2'-MOE.
[0151] In a gapmer, the 5'- and 3'-most nucleosides of region B are DNA nucleosides, positioned adjacent to nucleoside analogs (e.g., high-affinity sugar-modified nucleosides) of regions A and C, respectively. In certain embodiments, regions A and C can be further defined by having nucleoside analogs at their ends most distal from region B (i.e., at the 5'-end of region A and the 3'-end of region C).
[0152] In one embodiment, an ASO of the invention has a nucleotide sequence of the formula (5' to 3')ABC, where (A) (the 5' region or first wing sequence) contains at least one nucleoside analog (e.g., 1 to 5 LNA units); (B) contains at least four consecutive nucleosides (e.g., 4 to 28 DNA units) that are capable of recruiting RNase (when duplexed with a complementary RNA molecule, such as a pre-mRNA or mRNA target); and (C) (the 3' region or second wing sequence) contains at least one nucleoside analog (e.g., 1 to 5 LNA units).
[0153] II.H. Internucleotide Bonds The monomers of the ASOs described herein are linked via linking groups. Suitably, each monomer is linked to the 3' adjacent monomer via a linking group.
[0154] Those skilled in the art will understand that in this disclosure, the 5' monomer at the end of an ASO does not include a 5' linking group, but may or may not include a 5' terminal group.
[0155] The term "linking group" or "internucleoside linkage" is intended to mean a group that allows for the covalent bonding of two nucleosides. Specific and preferred examples include phosphate and phosphorothioate groups.
[0156] The nucleosides or consecutive nucleoside sequences of the ASO of the invention are linked via a linking group. Suitably, each nucleoside is linked to the 3' adjacent nucleoside via a linking group.
[0157] In some embodiments, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% of the internucleoside linkages are modified.
[0158] In certain embodiments, all internucleoside linkages between nucleosides of the antisense oligonucleotide or its contiguous nucleotide sequence are phosphorothioate internucleoside linkages.
[0159] II.I. Conjugates As used herein, the term conjugate refers to an ASO covalently attached to a non-nucleotide moiety (conjugate moiety or region C or third region).
[0160] Conjugation of the ASO of the present invention to one or more non-nucleotide moieties can improve the pharmacological effects of the ASO, for example, by affecting the activity, cellular distribution, cellular uptake, or stability of the ASO. In certain embodiments, the non-nucleotide moiety modifies or enhances the pharmacokinetics of the ASO by improving the cellular distribution, bioavailability, metabolism, excretion, permeability, and / or cellular uptake of the ASO. In certain embodiments, the non-nucleotide moiety can target the ASO to a specific organ, tissue, or cell type, thereby enhancing the efficacy of the ASO in that organ, tissue, or cell type. In other embodiments, the non-nucleotide moiety reduces the activity of the ASO in non-target cell types, tissues, or organs, such as off-target activity or activity in non-target cell types, tissues, or organs. WO93 / 07883 and WO2013 / 033230 provide suitable conjugate moieties. Further suitable conjugate moieties are those capable of binding to the asialoglycoprotein receptor (ASGPr). In particular, trivalent N-acetylgalactosamine conjugate moieties are suitable for binding to ASGPr (see, e.g., WO2014 / 076196, WO2014 / 207232 and WO2014 / 179620).
[0161] In some embodiments, the non-nucleotide moiety (conjugate moiety) is selected from the group consisting of carbohydrates, cell surface receptor ligands, drug substances, hormones, lipophilic substances, polymers, proteins, peptides, toxins (e.g., bacterial toxins), vitamins, viral proteins (e.g., capsids), and combinations thereof.
[0162] II.J. Activated ASO As used herein, the term "activated ASO" refers to an ASO that has been covalently attached (i.e., functionalized) to at least one functional moiety that allows for covalent attachment to one or more conjugate moieties of the ASO, i.e., a moiety that is not itself a nucleic acid or monomer, so as to form a conjugate described herein. Generally, the functional moiety includes a chemical group capable of covalently attaching to the ASO, e.g., via the 3'-hydroxyl group or exocyclic NH2 group of an adenine base, a spacer that may be hydrophilic, and a terminal group (e.g., amino, sulfhydryl, or hydroxyl group) to which a conjugate moiety can be attached. In some embodiments, this terminal group is unprotected, e.g., an NH2 group. In other embodiments, the terminal group is protected by any suitable protecting group, such as those described in "Protective Groups in Organic Synthesis" by Theodora W Greene and Peter GM Wuts, 3rd edition (John Wiley & Sons, 1999).
[0163] In some embodiments, the ASO of the present invention is functionalized at the 5'-end to allow covalent attachment of a conjugate moiety to the 5'-end of the ASO. In other embodiments, the ASO of the present invention can be functionalized at the 3'-end. In still other embodiments, the ASO of the present invention can be functionalized along the backbone or at the heterocyclic base moiety. In still other embodiments, the ASO of the present invention can be functionalized at more than one location independently selected from the 5'-end, 3'-end, backbone, and base.
[0164] In some embodiments, activated ASOs of the invention are synthesized by incorporating one or more monomers that are covalently linked to a functional moiety during synthesis. In other embodiments, activated ASOs of the invention are synthesized using unfunctionalized monomers, and the ASO is functionalized after synthesis is complete.
[0165] III. Pharmaceutical Compositions and Routes of Administration The ASO of the present invention can be used in pharmaceutical preparations and compositions. In some embodiments, such compositions contain a pharmaceutically acceptable diluent, carrier, salt, or adjuvant. Pharmaceutically acceptable diluents include phosphate-buffered saline (PBS), and pharmaceutically acceptable salts include, but are not limited to, sodium salts and potassium salts. In some embodiments, the pharmaceutically acceptable diluent is sterile phosphate-buffered saline. Therefore, the pharmaceutical composition can be a pharmaceutical solution containing the oligonucleotide or conjugate disclosed herein or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable diluent (also referred to as a pharmaceutically acceptable solvent), such as phosphate-buffered saline.
[0166] In some embodiments, the ASOs disclosed herein are in the form of a salt, such as a pharmaceutically acceptable salt, such as a sodium salt, potassium salt, or ammonium salt.
[0167] In certain embodiments, the ASO or conjugate or a pharmaceutically acceptable salt thereof disclosed herein is in a solid form, e.g., a powder (e.g., a lyophilized powder) or dessicate form.
[0168] The ASO of the invention can be included in a unit dosage form, such as in a pharmaceutically acceptable carrier or diluent, in an amount sufficient to deliver a therapeutically effective amount to a patient.
[0169] The pharmaceutical composition of the present invention can be administered in many ways, depending on whether local or systemic treatment is desired and the site to be treated.For example, parenteral administration such as intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion can be used; in some embodiments, ASO is administered intracardially or intracerebroventricularly as a bolus injection.In some embodiments, ASO is administered subcutaneously.
[0170] The pharmaceutical preparations of the present invention, which can be conveniently presented in unit dosage form, can be prepared by conventional techniques well known in the pharmaceutical industry. Such techniques include combining the active ingredient with pharmaceutical carriers or additives. Generally, the preparations are prepared by uniformly and intimately combining the active ingredient with liquid carriers or pulverized solid carriers or both, and then, if necessary, shaping the product.
[0171] Pharmaceutical preparations may include sterile diluents, buffers, tonicity adjusting agents and antibacterial agents. Active ASOs may be prepared with carriers that protect them from degradation or immediate elimination from the body, including implants or microcapsules with controlled release properties. For parenteral or enteral, intracardiac or intracerebroventricular administration, carriers may be saline or phosphate-buffered saline. International Publication WO2007 / 031091(A2), published March 22, 2007, further provides suitable pharmaceutically acceptable diluents, carriers and adjuvants.
[0172] IV. Diagnosis The present invention further provides diagnostic methods useful in diagnosing diseases or disorders associated with abnormal ANGPTL2 expression and / or activity. In some embodiments, such diseases or disorders include cardiovascular disease, obesity, metabolic disease, type 2 diabetes, cancer, and combinations thereof.
[0173] In some embodiments, the disease or disorder that can be diagnosed by the ASO of the present invention is cardiovascular disease.Non-limiting examples of cardiovascular disease include atherosclerosis, coronary artery disease, stroke, heart failure, hypertensive heart disease, rheumatic heart disease, cardiomyopathy, cardiac arrhythmia, congenital heart disease, valvular heart disease, carditis, aortic aneurysm, peripheral arterial disease, thromboembolic disease and venous thrombosis.In some embodiments, heart failure includes left-sided heart failure, right-sided heart failure, congestive heart failure, heart failure with reduced ejection fraction (HFrEF), heart failure with preserved ejection fraction (HFpEF), borderline heart failure (HFmrEF), hypertrophic cardiomyopathy (HCM), hypertensive heart disease (HHD) or hypertensive hypertrophic cardiomyopathy.
[0174] The ASOs of the invention can be used to measure the expression of ANGPTL2 transcripts in tissues or body fluids from an individual, and the measured expression levels compared to standard ANGPTL2 transcript expression levels in normal tissues or body fluids, whereby an increase in expression levels compared to normal is indicative of a disorder treatable with the ASOs of the invention.
[0175] The ASOs of the present invention can be used to assay ANGPTL2 transcript levels in biological samples using any method known to those skilled in the art (Touboul et al., Anticancer Res. (2002) 22 (6A): 3349-56; Verjout et al., Mutat. Res. (2000) 640: 127-38); Stowe et al., J. Virol. Methods (1998) 75 (1): 93-91).
[0176] The term "biological sample" refers to any biological sample obtained from an individual, a cell line, a tissue culture, or other source of cells that may express ANGPTL2 transcripts. Methods for obtaining such biological samples from mammals are well known in the art.
[0177] V. Kits containing ASO The present invention further provides kits that contain the ASOs described herein and can be used to carry out the methods described herein. In some embodiments, the kits contain at least one ASO in one or more containers. In some embodiments, the kits contain all of the components necessary and / or sufficient to carry out a detection assay, including all controls, instructions for carrying out the assay, and software necessary for analyzing and presenting results. Those skilled in the art will readily recognize that the disclosed ASOs can be easily incorporated into one of the established kit formats well known in the art.
[0178] VI. How to use The ASOs of the present invention can be used as research reagents, for example, for diagnosis, therapy, and prevention.
[0179] In research, such ASOs can be used to specifically inhibit synthesis of ANGPTL2 protein in cells and experimental animals (generally by degrading or inhibiting the mRNA, thereby preventing protein formation), thereby facilitating functional analysis of the target or evaluation of its usefulness as a target for therapeutic intervention. Also provided are methods for down-regulating ANGPTL2 mRNA and / or ANGPTL2 protein expression in cells or tissues, comprising contacting the cell or tissue in vitro or in vivo with an effective amount of one or more of the ASOs, conjugates, or compositions disclosed herein.
[0180] In diagnostics, ASOs can be used to detect and quantitate ANGPTL2 transcript expression in cells and tissues by Northern blotting, in situ hybridization or similar techniques.
[0181] For treatment, animals or humans suspected of having diseases or disorders that can be treated by regulating the expression of ANGPTL2 transcript and / or ANGPTL2 protein are treated by administering ASO according to the present invention.Further provided is a method for treating mammals, for example, humans, suspected of having or being predisposed to diseases or conditions associated with the increase in the expression of ANGPTL2 transcript and / or ANGPTL2 protein, by administering one or more therapeutically or prophylactically effective amounts of ASO or compositions of the present invention.The ASO, conjugate or pharmaceutical composition of the present invention is generally administered in an effective amount.In some embodiments, the ASO or conjugate of the present invention is used for treatment.
[0182] The present invention also provides ASO for use in treating the disease or disorder associated with one or more abnormal ANGPTL2 expression and / or activity.In some embodiments, such disease or disorder includes cardiovascular disease, obesity, metabolic disease, type 2 diabetes, cancer or a combination thereof.In some embodiments, disease or disorder is cardiovascular disease.Non-limiting examples of cardiovascular disease include atherosclerosis, coronary artery disease, stroke, heart failure, hypertensive heart disease, rheumatic heart disease, cardiomyopathy, cardiac arrhythmia, congenital heart disease, valvular heart disease, carditis, aortic aneurysm, peripheral arterial disease, thromboembolic disease and venous thrombosis.
[0183] In certain embodiments, the disease, disorder, or condition is associated with overexpression of the ANGPTL2 gene transcript and / or ANGPTL2 protein.
[0184] The present invention also provides a method for inhibiting (e.g., by reducing) expression of ANGPTL2 gene transcripts and / or ANGPTL2 protein in cells or tissues, comprising contacting the cells or tissues in vitro or in vivo with an effective amount of one or more ASOs, conjugates, or pharmaceutical compositions thereof of the present invention, resulting in a decrease in expression of the ANGPTL2 gene transcript, thereby including a reduction in ANGPTL2 protein.
[0185] The invention also provides the use of an ASO or conjugate of the invention in the manufacture of a medicament for the treatment of a disorder described herein or for a method of treating a disorder described herein.
[0186] The present invention further provides a method for inhibiting or reducing ANGPTL2 protein in cells that express ANGPTL2, comprising administering an ASO or conjugate of the present invention to the cells to inhibit or reduce ANGPTL2 protein in the cells.
[0187] The present invention also includes a method for reducing, alleviating, preventing or treating motor neuron hyperexcitability (e.g., as seen in cardiomyocytes) in a subject in need thereof, comprising administering an ASO or conjugate of the present invention.
[0188] The present invention also provides a method for treating a disorder described herein, comprising administering to a patient in need thereof an ASO or conjugate of the invention described herein and / or a pharmaceutical composition of the invention.
[0189] The ASOs and other compositions of the invention can be used to treat conditions associated with overexpression of the ANGPTL2 protein.
[0190] Generally, one embodiment of the invention relates to a method of treating a mammal having or suspected of having a condition associated with abnormal ANGPTL2 levels, comprising administering to the mammal a therapeutically effective amount of an ASO that targets an ANGPTL2 transcript containing one or more LNA units. The ASO, conjugate, or pharmaceutical composition of the invention is generally administered in an effective amount.
[0191] An important aspect of the present invention is the use of an ASO (compound) as defined herein or a conjugate as defined herein in the manufacture of a medicament for the treatment of a disease, disorder or condition described herein.
[0192] The method of the present invention can be used to treat or prevent the disease caused by abnormal ANGPTL2 protein level and / or activity.In some embodiments, the disease caused by abnormal ANGPTL2 protein level and / or activity includes cardiovascular disease, obesity, metabolic disease, type 2 diabetes, cancer and combinations thereof.In some embodiments, the disease is cardiovascular disease.Cardiovascular disease used herein can include atherosclerosis, coronary artery disease, stroke, heart failure, hypertensive heart disease, rheumatic heart disease, cardiomyopathy, cardiac arrhythmia, congenital heart disease, valvular heart disease, carditis, aortic aneurysm, peripheral arterial disease, thromboembolic disease and venous thrombosis.
[0193] In certain embodiments, the cardiovascular disease is heart failure, which can include left-sided heart failure, right-sided heart failure, congestive heart failure, heart failure with reduced ejection fraction (HFrEF), heart failure with preserved ejection fraction (HFpEF), borderline heart failure (HFmrEF), hypertrophic cardiomyopathy (HCM), hypertensive heart disease (HHD), or hypertensive hypertrophic cardiomyopathy.
[0194] In other words, in one embodiment, the present invention further relates to a method for treating abnormalities in ANGPTL2 protein levels, comprising administering an ASO of the present invention, a conjugate of the present invention, or a pharmaceutical composition of the present invention to a patient in need thereof.
[0195] The present invention also relates to an ASO, composition or conjugate as defined herein for use as a medicament.
[0196] The present invention further relates to the use of a compound, composition or conjugate as defined herein for the manufacture of a medicament for the treatment of abnormal levels of ANGPTL2 protein or expression of a variant of ANGPTL2 protein (e.g., an allelic variant associated with one of the diseases described herein).
[0197] A patient in need of treatment is one who has or may have a disease or disorder.
[0198] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology which are within the skill of those in the art and are fully explained in the literature. For example, Sambrook et al., ed. (1989) Molecular Cloning A Laboratory Manual (2nd ed.; Cold Spring Harbor Laboratory Press); Sambrook et al., ed. (1992) Molecular Cloning: A Laboratory Manual, (Cold Springs Harbor Laboratory, NY); DN Glover ed., (1985) DNA Cloning, Volumes I and II; Gait, ed. (1984) Oligonucleotide Synthesis; Mullis et al. US Pat. No. 4,683,195; Hames and Higgins, eds. (1984) Nucleic Acid Hybridization; Hames and Higgins, eds. (1984) Transcription And Translation; Freshney (1987) Culture Of Animal Cells (Alan R. Liss, Inc.); Immobilized Cells And Enzymes (IRL Press) (1986); Perbal (1984) A Practical Guide To Molecular Cloning; the treatise, Methods In Enzymology (Academic Press, Inc., NY); Miller and Calos eds. (1987) Gene Transfer Vectors For Mammalian Cells, (Cold Spring Harbor Laboratory); Wu et al., eds., Methods In Enzymology, Vols.154 and 155; Mayer and Walker, eds. (1987) Immunochemical Methods In Cell And Molecular Biology (Academic Press, London); Weir and Blackwell, eds., (1986) Handbook Of Experimental Immunology, Volumes I-IV; Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., (1986); ); Crooke, Antisense drug Technology: Principles, Strategies and Applications, 2. nd See Ed. CRC Press (2007) and in Ausubel et al. (1989) Current Protocols in Molecular Biology (John Wiley and Sons, Baltimore, Md.). The present disclosure relates, for example, to the following: [Section 1] An antisense oligonucleotide (ASO) comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within the angiopoietin-like 2 (ANGPTL2) transcript. [Section 2] The ASO of paragraph 1, which is at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% complementary to a nucleic acid sequence within an ANGPTL2 transcript. [Section 3] The ASO of term 1 or 2, wherein the ANGPTL2 transcript is selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:196, SEQ ID NO:197, SEQ ID NO:198, SEQ ID NO:199 and SEQ ID NO:207. [Section 4] An ASO according to any one of items 1 to 3, wherein the ASO can reduce ANGPTL2 protein expression in human cells that express the ANGPTL2 protein (e.g., SK-N-AS cells). [Section 5] An ASO of paragraph 4, in which ANGPTL2 protein expression is reduced by at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or about 100% compared to ANGPTL2 protein expression in human cells not exposed to the ASO. [Section 6] The ASO of any of items 1 to 5, which is capable of reducing ANGPTL2 transcript (e.g., mRNA) expression in human cells that express the ANGPTL2 transcript (e.g., SK-N-AS cells). [Section 7] An ASO of item 6, in which ANGPTL2 transcript expression is reduced by at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or about 100% compared to ANGPTL2 transcript expression in human cells not exposed to the ASO. [Section 8] The ASO of any of paragraphs 1 to 7, wherein the ASO is a gapmer. [Section 9] Item 8. The ASO of item 8, wherein the ASO comprises one or more nucleoside analogs. [Section 10] The ASO of item 9, wherein one or more of the nucleoside analogs comprises 2'-O-alkyl-RNA; 2'-O-methyl RNA (2'-OMe); 2'-alkoxy-RNA; 2'-O-methoxyethyl-RNA (2'-MOE); 2'-amino-DNA; 2'-fluoro-RNA; 2'-fluoro-DNA; arabinonucleic acid (ANA); 2'-fluoro-ANA; bicyclic nucleoside analog (LNA); or a combination thereof. [Section 11] 11. The ASO of paragraph 9 or 10, wherein one or more nucleoside analogues are affinity-enhancing 2' sugar-modified nucleosides. [Section 12] Item 12. An ASO according to item 11, wherein the affinity-enhancing 2' sugar-modified nucleoside is LNA. [Section 13] Item 13. The ASO of item 12, wherein the LNA is selected from the group consisting of constrained ethyl nucleosides (cEt), 2',4'-constrained 2'-O-methoxyethyl (cMOE), α-L-LNA, β-D-LNA, 2'-O,4'-C-ethylene-bridged nucleic acid (ENA), amino-LNA, oxy-LNA, thio-LNA, and any combination thereof. [Section 14] 14. The ASO of any one of paragraphs 1 to 13, wherein the ASO comprises one or more 5'-methyl-cytosine nucleobases. [Section 15] The ASO of any of paragraphs 1 to 14, wherein the ASO is capable of (i) reducing ANGPTL2 mRNA levels in SK-N-AS cells; (ii) reducing ANGPTL2 protein levels in SK-N-AS cells; (iii) reducing, alleviating, or treating one or more symptoms of a disease or disorder associated with aberrant ANGPTL2 expression and / or activity; or (iv) any combination thereof. [Section 16] Item 16. The ASO of item 15, wherein the disease or disorder associated with abnormal ANGPTL2 expression and / or activity comprises cardiovascular disease, obesity, metabolic disease, type 2 diabetes, cancer, or a combination thereof. [Section 17] 17. The ASO of any of paragraphs 1 to 16, wherein the contiguous nucleotide sequence is complementary to a nucleic acid sequence comprising: (i) nucleotides 1 to 211 of SEQ ID NO:1; (ii) nucleotides 471 to 686 of SEQ ID NO:1; (iii) nucleotides 1,069 to 1,376 of SEQ ID NO:1; (iv) nucleotides 1,666 to 8,673 of SEQ ID NO:1; (v) nucleotides 8,975 to 12,415 of SEQ ID NO:1; (vi) nucleotides 12,739 to 18,116 of SEQ ID NO:1; (vii) nucleotides 18,422 to 29,875 of SEQ ID NO:1; or (viii) nucleotides 30,373 to 35,389 of SEQ ID NO:1. [Section 18] 18. The ASO of any of paragraphs 1 to 17, wherein the contiguous nucleotide sequence is complementary to a nucleic acid sequence comprising: (i) nucleotides 37 to 161 of SEQ ID NO:1; (ii) nucleotides 521 to 636 of SEQ ID NO:1; (iii) nucleotides 1,119 to 1,326 of SEQ ID NO:1; (iv) nucleotides 1,716 to 8,623 of SEQ ID NO:1; (v) nucleotides 9,025 to 12,365 of SEQ ID NO:1; (vi) nucleotides 12,789 to 18,066 of SEQ ID NO:1; (vii) nucleotides 18,472 to 29,825 of SEQ ID NO:1; or (viii) nucleotides 30,423 to 35,339 of SEQ ID NO:1. [Section 19] 19. The ASO of any of paragraphs 1 to 18, wherein the contiguous nucleotide sequence is complementary to a nucleic acid sequence comprising: (i) nucleotides 87 to 111 of SEQ ID NO:1; (ii) nucleotides 571 to 586 of SEQ ID NO:1; (iii) nucleotides 1,169 to 1,276 of SEQ ID NO:1; (iv) nucleotides 1,766 to 8,573 of SEQ ID NO:1; (v) nucleotides 9,075 to 12,315 of SEQ ID NO:1; (vi) nucleotides 12,839 to 18,016 of SEQ ID NO:1; (vii) nucleotides 18,522 to 29,775 of SEQ ID NO:1; or (viii) nucleotides 30,473 to 35,289 of SEQ ID NO:1. [Section 20] 20. The ASO of any of paragraphs 1 to 19, wherein the contiguous nucleotide sequence is complementary to a nucleic acid comprising nucleotides 20,187 to 20,234 of SEQ ID NO:1. [Section 21] 21. The ASO of any of paragraphs 1 to 20, wherein the contiguous nucleotide sequence is complementary to a nucleic acid comprising nucleotides 20,202 to 20,219 of SEQ ID NO:1. [Section 22] 22. The ASO of any of items 1 to 21, wherein the contiguous nucleotide sequence comprises SEQ ID NO: 4 to SEQ ID NO: 193 with one or two mismatches. [Section 23] 22. The ASO of any one of items 1 to 21, wherein the contiguous nucleotide sequence comprises a nucleotide sequence selected from the sequences in Figure 2 (SEQ ID NO: 4 to SEQ ID NO: 193). [Section 24] 24. The ASO of any of Items 1 to 23, wherein the contiguous nucleotide sequence comprises SEQ ID NO:8, SEQ ID NO:20, SEQ ID NO:38, SEQ ID NO:46, SEQ ID NO:79, SEQ ID NO:84, SEQ ID NO:82, SEQ ID NO:88, SEQ ID NO:85, SEQ ID NO:90, SEQ ID NO:89, SEQ ID NO:93, SEQ ID NO:95, SEQ ID NO:97, SEQ ID NO:101, SEQ ID NO:111, SEQ ID NO:116, SEQ ID NO:120, SEQ ID NO:121, SEQ ID NO:122, SEQ ID NO:132, SEQ ID NO:142, SEQ ID NO:141, SEQ ID NO:143, SEQ ID NO:144, or SEQ ID NO:146. [Section 25] 24. The ASO of any of paragraphs 1 to 23, wherein the contiguous nucleotide sequence comprises SEQ ID NO: 141, SEQ ID NO: 122, SEQ ID NO: 8, SEQ ID NO: 38, SEQ ID NO: 95, SEQ ID NO: 88, or SEQ ID NO: 120. [Section 26] 24. The ASO of any of paragraphs 1 to 23, wherein the contiguous nucleotide sequence comprises SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 117, SEQ ID NO: 120, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 122, or a combination thereof. [Section 27] The ASO of any of paragraphs 1 to 26, having a design selected from the group corresponding to the design of Figure 2, where uppercase letters are sugar-modified nucleosides and lowercase letters are DNA. [Section 28] The ASO of any one of paragraphs 1 to 27, having a length of 15 to 20 nucleotides. [Section 29] 29. The ASO of any one of paragraphs 1 to 28, wherein the contiguous nucleotide sequence comprises one or more modified internucleoside linkages. [Section 30] 30. The ASO of paragraph 29, wherein one or more modified internucleoside linkages is a phosphorothioate linkage. [Section 31] 31. The ASO of paragraph 29 or 30, wherein at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% of the internucleoside linkages are modified. [Section 32] 32. The ASO of paragraph 31, wherein each of the internucleoside linkages is a phosphorothioate linkage. [Section 33] A conjugate comprising the ASO of any of items 1 to 32, wherein the ASO is covalently bound to at least one non-nucleotide or non-polynucleotide moiety. [Section 34] 34. The conjugate of paragraph 33, wherein the non-nucleotide or non-polynucleotide moiety comprises a protein, a fatty acid chain, a sugar residue, a glycoprotein, a polymer, or any combination thereof. [Section 35] A pharmaceutical composition comprising the ASO of any one of Items 1 to 32 or the conjugate of Item 33 or 34 and a pharmaceutically acceptable diluent, carrier, salt or adjuvant. [Section 36] 36. The pharmaceutical composition of paragraph 35, wherein the pharmaceutically acceptable salt comprises a sodium salt, a potassium salt, an ammonium salt, or any combination thereof. [Section 37] 37. The pharmaceutical composition of paragraph 35 or 36, further comprising at least one additional therapeutic agent. [Section 38] 38. The pharmaceutical composition of paragraph 37, wherein the additional therapeutic agent is an ANGPTL2 antagonist. [Section 39] Item 39. The pharmaceutical composition of Item 38, wherein the ANGPTL2 antagonist is an anti-ANGPTL2 antibody or a fragment thereof. [Section 40] A kit comprising the ASO of any one of Items 1 to 32, the conjugate of Item 33 or 34, or the pharmaceutical composition of any one of Items 35 to 39, and instructions for use. [Section 41] A diagnostic kit comprising the ASO of any one of items 1 to 32, the conjugate of item 33 or 34, or the pharmaceutical composition of any one of items 35 to 39, and instructions for use. [Section 42] A method for inhibiting or reducing ANGPTL2 protein expression in a cell, the method comprising administering the ASO of any one of items 1 to 32, the conjugate of item 33 or 34, or the pharmaceutical composition of any one of items 35 to 39 to a cell expressing the ANGPTL2 protein, wherein the expression of ANGPTL2 protein in the cell is inhibited or reduced after administration. [Section 43] An in vitro method for inhibiting or reducing ANGPTL2 protein expression in a cell, comprising contacting a cell expressing ANGPTL2 protein with the ASO of any one of items 1 to 32, the conjugate of item 33 or 34, or the pharmaceutical composition of any one of items 35 to 39, wherein ANGPTL2 protein expression in the cell is inhibited or reduced after the contact. [Section 44] The method of paragraph 42 or 43, wherein the ASO inhibits or reduces expression of an ANGPTL2 transcript (e.g., mRNA) in the cell after administration or contact. [Section 45] The method of paragraph 44, wherein expression of ANGPTL2 transcripts (e.g., mRNA) is reduced by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or about 100% after administration compared to cells not exposed to the ASO. [Section 46] Any of the methods of paragraphs 42 to 45, wherein the expression of ANGPTL2 protein is reduced by at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% after administration compared to cells not exposed to the ASO. [Section 47] 47. The method of any of items 42 to 46, wherein the cell is a brain cell, for example, a neuroblastoma cell (for example, an SK-N-AS cell). [Section 48] A method for reducing, alleviating or treating one or more symptoms of a disease or disorder associated with abnormal ANGPTL2 expression and / or activity in a subject in need of treatment, the method comprising administering to the subject an effective amount of the ASO of any of items 1 to 32, the conjugate of item 33 or 34, or the pharmaceutical composition of any of items 35 to 39. [Section 49] Use of the ASO of any one of items 1 to 32, the conjugate of item 33 or 34, or the pharmaceutical composition of any one of items 35 to 39 for the manufacture of a medicament. [Section 50] Use of the ASO of any of items 1 to 32, the conjugate of item 33 or 34, or the pharmaceutical composition of any of items 35 to 39 for the manufacture of a medicament for the treatment of a disease or disorder associated with abnormal ANGPTL2 expression and / or activity in a subject in need of such treatment. [Section 51] The ASO of any one of items 1 to 32, the conjugate of item 33 or 34, or the pharmaceutical composition of any one of items 35 to 39, for use in therapy. [Section 52] The ASO of any of items 1 to 32, the conjugate of item 33 or 34, or the pharmaceutical composition of any of items 35 to 39, for use in treating a disease or disorder associated with abnormal ANGPTL2 expression and / or activity in a subject in need of such treatment. [Section 53] The ASO of paragraph 15, the method of paragraph 48, the use of paragraph 50 or the ASO for use of paragraph 52, wherein the disease or disorder associated with abnormal ANGPTL2 expression and / or activity includes cardiovascular disease, obesity, metabolic disease, type 2 diabetes, cancer or a combination thereof. [Section 54] 54. The ASO, method, use or ASO for use of paragraph 53, wherein the cardiovascular disease or disorder comprises atherosclerosis, coronary artery disease, stroke, heart failure, hypertensive heart disease, rheumatic heart disease, cardiomyopathy, cardiac arrhythmia, congenital heart disease, valvular heart disease, carditis, aortic aneurysm, peripheral arterial disease, thromboembolic disease, venous thrombosis or any combination thereof. [Section 55] 55. An ASO, method, use or ASO for use according to paragraph 54, wherein the cardiovascular disease or disorder is heart failure. [Section 56] 56. The ASO, method, use or ASO for use of clause 55, wherein the heart failure comprises left-sided heart failure, right-sided heart failure, congestive heart failure, heart failure with reduced ejection fraction (HFrEF), heart failure with preserved ejection fraction (HFpEF), borderline heart failure (HFmrEF), hypertrophic cardiomyopathy (HCM), hypertensive heart disease (HHD) or hypertensive hypertrophic cardiomyopathy. [Section 57] An ASO for the method of any one of paragraphs 48 and 53 to 56, the use of any one of paragraphs 50 and 53 to 56, or the use of any one of paragraphs 52 to 56, wherein the subject is a human. [Section 58] 57. The method of any of paragraphs 48 and 53 to 57, the use of any of paragraphs 50 and 53 to 57, or the ASO for use of any of paragraphs 52 to 57, wherein the ASO, conjugate, or pharmaceutical composition is administered intracardially, orally, parenterally, intrathecally, intraventricularly, pulmonary, topically, or intracerebroventricularly.
[0199] The following examples are offered by way of illustration and not by way of limitation. [Example]
[0200] Example 1: Construction of ASO The antisense oligonucleotides described herein were designed to target various regions of the ANGPTL2 precursor mRNA (SEQ ID NO: 1). SEQ ID NO: 1 provides the genomic ANGPTL2 sequence, corresponding to the reverse complement of residues 127,087,349 to 127,122,765 of GenBank Accession No. NC_000009.12. For example, ASOs were constructed to target the indicated regions using the start and end sites of SEQ ID NO: 1 shown in Figure 2. Exemplary sequences of ASOs of the invention are provided in Figure 2. In certain embodiments, ASOs were designed as gapmers, as shown in Figure 2. Gapmers of the invention were constructed to include locked nucleic acids—LNA (uppercase)—for example, gapmers can have beta-deoxy LNA at the 5' and 3' ends and a phosphorothioate backbone. However, LNA can also be substituted with any other nucleoside analogue and the backbone can be another type of backbone (eg, phosphodiester linkage, phosphotriester linkage, methylphosphonate linkage, phosphoramidate linkage or any combination thereof).
[0201] ASOs were synthesized using methods well known in the art. Examples of methods for producing such ASOs are described in Barciszewski et al., Chapter 10 - "Locked Nucleic Acid Aptamers" in Nucleic Acid and Peptide Aptamers: Methods and Protocols, vol. 535, Gunter Mayer (ed.) (2009).
[0202] Example 2: qPCR assay to measure the reduction of ANGPTL2 mRNA expression in SK-N-AS cells The ASO of the present invention was cultured in SK-N-AS cells (ATCC (登録商標) CRL-2137 TMThe ability of SK-N-AS cells to reduce ANGPTL2 mRNA expression was tested. SK-N-AS cells were grown in cell culture medium (DMEM high glucose (D6546), supplemented with non-essential amino acids (0.1 mM, M7145), L-glutamine (2 mM, G7513), and 10% FBS). Every 5 days, cells were washed with phosphate-buffered saline (PBS) and then trypsinized by adding 0.25% trypsin-EDTA solution, incubating at 37°C for 2-3 minutes, triturating, and then seeding. Cells were maintained in vacuo for up to 15 passages.
[0203] For experimental use, 10,000 cells / well were seeded in 100 μL growth medium in a 96-well plate. ASOs were prepared from a 750 μM stock solution and dissolved in PBS. Approximately 24 hours after cell seeding, ASOs were added to the cells to achieve the desired final concentration (i.e., 5 μM or 25 μM). The cells were then incubated for 3 days without any medium changes. For potency determination (see Figure 3), eight concentrations of ASOs were prepared, ranging from 16 to 50,000 nM final concentrations. After incubation, the cells were rinsed with 125 μL PURELINK® 1000 nM PBS and then rinsed with 125 μL PURELINK® 1000 nM PBS. (登録商標) The RNA was harvested by adding Pro 96 Lysis buffer and 125 µL of 70% ethanol. The RNA was then purified according to the manufacturer's instructions and eluted in a final volume of 50 µL of water, resulting in an RNA concentration of 10–20 ng / µL. The RNA was then diluted 10-fold with water and subsequently subjected to a one-step qPCR reaction.
[0204] For one-step qPCR reactions, use qPCR-mix (qScript™ XLE 1-step RT-qPCR TOUGHMIX from QauntaBio). (登録商標)A master mix was generated by mixing the qPCR mix (Low ROX) with two Taqman probes in a 10:1:1 ratio (qPCR mix:probe 1:probe 2). The Taqman probes were obtained from Life Technologies and IDT: ANGPTL2_Hs00765776_m1; ACTB_Hs_PT.39a.22214847. The master mix (6 μL) and RNA (4 μL, 1–2 ng / μL) were then transferred to a qPCR plate (MICROAMP). (登録商標) The plates were mixed in an optical 384 well (catalog no. 4309849). After sealing, the plates were spun at high speed (1000g for 1 minute at RT) and transferred to a Viia™ 7 system (Applied Biosystems, Thermo). The following PCR conditions were used: 50°C for 15 minutes; 95°C for 3 minutes; 40 cycles of 95°C for 5 seconds, followed by a 1.6°C / second temperature ramp, followed by 60°C for 45 seconds. Data were analyzed using QuantStudio TM Analysis was performed using Real_time PCR Software. The percent inhibition of ASO-treated samples was calculated relative to the control-treated samples. The results are shown in Figures 3 and 4.
[0205] Example 3: Analysis of ANGPTL2 mRNA reduction in vivo To evaluate the efficacy of ASOs in reducing ANGPTL2 mRNA levels in vivo, 10-week-old male C57BL / 6 mice were subcutaneously administered one of the following exemplary ASOs: ASO-0027, ASO-0037, ASO-0094, ASO-0079, ASO-0050, ASO-0150, and ASO-0132. ASOs (formulated in sterile saline at approximately 5 mg / mL) were administered at a dose of 30 mg / kg / day for three consecutive days (days 1, 2, and 3). Mice were sacrificed one week after the first administration, their hearts were removed, and apical masses were stored in RNAlater. RNA purification was performed using a MagMAX-96 total RNA isolation kit (Thermo AM1830). cDNA synthesis was performed using a Quanta qScript cDNA synthesis kit (Quanta 95047). Ten nanograms of total cDNA was used for quantitative real-time PCR on an Applied Biosystems ViiA7 instrument using double-stranded Taqman reactions for Angptl2 (ThermoMm00507897_m1) and GAPDH (Thermo 4352339E). ANGPTL2 mRNA levels were normalized to GAPDH and expressed as a percent of the saline-treated control group.
[0206] As shown in Figure 5, all tested ASOs were able to reduce ANGPTL2 mRNA levels when administered to C57BL / 6 mice. Collectively, the results provided herein demonstrate the efficacy of ASOs both in vitro and in vivo and support the possibility that ANGPTL2-specific ASOs may be disease-modifying for the treatment of various medical disorders, such as those associated with aberrant ANGPTL2 expression and / or activity, e.g., cardiovascular-related diseases or disorders.
Claims
1. 1. An antisense oligonucleotide (ASO) targeting an angiopoietin-like 2 (ANGPTL2) transcript, the ASO comprising: (a) comprising the contiguous nucleotide sequence set forth in SEQ ID NO:4 and having a length of up to 23 nucleotides; or (b) comprising the contiguous nucleotide sequence set forth in SEQ ID NO:5 and having a length of up to 20 nucleotides; and the ASO is complementary to a nucleic acid sequence within nucleotides 87-111 of SEQ ID NO:
1. ASO.
2. The ASO of claim 1, wherein the ASO is capable of (i) reducing ANGPTL2 protein expression in human cells (e.g., SK-N-AS cells) that express the ANGPTL2 protein, (ii) reducing ANGPTL2 transcript (e.g., mRNA) expression in human cells (e.g., SK-N-AS cells) that express the ANGPTL2 transcript (e.g., mRNA); or (iii) reducing both (i) and (ii).
3. The ASO of claim 1 or 2, wherein the ASO is a gapmer.
4. 4. The ASO of claim 3, wherein the ASO comprises: (i) one or more nucleoside analogs; (ii) one or more 5-methyl-cytosine nucleobases; or (iii) both (i) and (ii).
5. The ASO of claim 4, wherein one or more of the nucleoside analogs is an affinity-enhancing 2' sugar-modified nucleoside, including 2'-O-alkyl-RNA; 2'-O-methyl RNA (2'-OMe); 2'-alkoxy-RNA; 2'-O-methoxyethyl-RNA (2'-MOE); 2'-amino-DNA; 2'-fluoro-RNA; 2'-fluoro-DNA; arabinonucleic acid (ANA); 2'-fluoro-ANA; bicyclic nucleoside analog (LNA); or any combination thereof.
6. 6. The ASO of claim 5, wherein the LNA is selected from the group consisting of constrained ethyl nucleosides (cEt), 2',4'-constrained 2'-O-methoxyethyl (cMOE), α-L-LNA, β-D-LNA, 2'-O,4'-C-ethylene-bridged nucleic acid (ENA), amino-LNA, oxy-LNA, thio-LNA, and any combination thereof.
7. The ASO of any one of claims 1 to 6, wherein the ASO is capable of reducing, alleviating or treating one or more symptoms of a disease or disorder associated with aberrant ANGPTL2 expression and / or activity.
8. The ASO of any one of claims 1 to 7, wherein the continuous nucleotide sequence comprises the nucleotide sequence set forth in SEQ ID NO: 4 or SEQ ID NO:
5.
9. 9. The ASO of any one of claims 1 to 8, wherein the contiguous nucleotide sequence comprises the nucleotide sequence TtacatgccgccagaggAA (SEQ ID NO: 4) or GAgcctttacatgcCG (SEQ ID NO: 5), where uppercase letters represent sugar-modified nucleosides and lowercase letters represent DNA.
10. The ASO of any one of claims 1 to 9, wherein the contiguous nucleotide sequence comprises one or more modified internucleoside linkages.
11. A conjugate comprising the ASO of any one of claims 1 to 10, wherein the ASO is covalently bound to at least one non-nucleotide or non-polynucleotide moiety.
12. A pharmaceutical composition comprising an ASO according to any one of claims 1 to 10 or a conjugate according to claim 11 and a pharmaceutically acceptable diluent, carrier, salt or adjuvant.
13. A kit comprising an ASO according to any one of claims 1 to 10, a conjugate according to claim 11 or a pharmaceutical composition according to claim 12 and instructions for use.
14. 13. An ASO according to any one of claims 1 to 10, a conjugate according to claim 11, or a pharmaceutical composition according to claim 12 for inhibiting or reducing ANGPTL2 protein expression in a cell, the ASO, conjugate, or pharmaceutical composition comprising contacting the ASO, conjugate, or pharmaceutical composition with a cell, wherein ANGPTL2 protein expression in the cell is inhibited or reduced after contact.
15. 13. The ASO of any of claims 1 to 10, the conjugate of claim 11 or the pharmaceutical composition of claim 12 for use in reducing, alleviating or treating one or more symptoms of a disease or disorder associated with aberrant ANGPTL2 expression and / or activity in a subject in need of such treatment.
16. The ASO of claim 7, or the ASO, conjugate or pharmaceutical composition of claim 15, wherein the disease or disorder associated with abnormal ANGPTL2 expression and / or activity includes cardiovascular disease, obesity, metabolic disease, type 2 diabetes, cancer or a combination thereof.
17. 17. The ASO, conjugate or pharmaceutical composition of claim 15 or 16, wherein the subject is a human.
Citation Information
Patent Citations
Cancer therapeutic agent
JP2011093896A
In-vivo delivery of oligonucleotides
JP2015502365A
Systemic in-vivo delivery of oligonucleotides
JP2016521753A
Angiopoietin-like proteins, crisp proteins and polynucleotides encoding same
WO2000059938A1
Methods and compositions for preventing and treating atherosclerosis
WO2014167529A1